WorldWideScience

Sample records for gene insertion technology

  1. Gene Insertion Patterns and Sites

    Science.gov (United States)

    Vain, Philippe; Thole, Vera

    During the past 25 years, the molecular analysis of transgene insertion patterns and sites in plants has greatly contributed to our understanding of the mechanisms underlying transgene integration, expression, and stability in the nuclear genome. Molecular characterization is also an essential step in the safety assessment of genetically modified crops. This chapter describes the standard experimental procedures used to analyze transgene insertion patterns and loci in cereals and grasses transformed using Agrobacterium tumefaciens or direct transfer of DNA. Methods and protocols enabling the determination of the number and configuration of transgenic loci via a combination of inheritance studies, polymerase chain reaction, and Southern analyses are presented. The complete characterization of transgenic inserts in plants is, however, a holistic process relying on a wide variety of experimental approaches. In this chapter, these additional approaches are not detailed but references to relevant bibliographic records are provided.

  2. Enhanced citrate production through gene insertion in Aspergillus niger

    DEFF Research Database (Denmark)

    Jongh, Wian de; Nielsen, Jens

    2007-01-01

    The effect of inserting genes involved in the reductive branch of the tricarboxylic acid (TCA) cycle on citrate production by Aspergillus niger was evaluated. Several different genes were inserted individually and in combination, i.e. malate dehydrogenase (mdh2) from Saccharomyces cerevisiae, two...

  3. Reliability Technology to Achieve Insertion of Advanced Packaging (RELTECH) program

    Science.gov (United States)

    Fayette, Daniel F.; Speicher, Patricia; Stoklosa, Mark J.; Evans, Jillian V.; Evans, John W.; Gentile, Mike; Pagel, Chuck A.; Hakim, Edward

    1993-01-01

    A joint military-commercial effort to evaluate multichip module (MCM) structures is discussed. The program, Reliability Technology to Achieve Insertion of Advanced Packaging (RELTECH), has been designed to identify the failure mechanisms that are possible in MCM structures. The RELTECH test vehicles, technical assessment task, product evaluation plan, reliability modeling task, accelerated and environmental testing, and post-test physical analysis and failure analysis are described. The information obtained through RELTECH can be used to address standardization issues, through development of cost effective qualification and appropriate screening criteria, for inclusion into a commercial specification and the MIL-H-38534 general specification for hybrid microcircuits.

  4. Have we found an optimal insertion site in a Newcastle disease virus vector to express a foreign gene for vaccine and gene therapy purposes?

    Science.gov (United States)

    Using reverse genetics technology, many strains of Newcastle disease virus (NDV) have been developed as vectors to express foreign genes for vaccine and gene therapy purposes. The foreign gene is usually inserted into a non-coding region of the NDV genome as an independent transcription unit. Eval...

  5. Single gene insertion drives bioalcohol production by a thermophilic archaeon

    Energy Technology Data Exchange (ETDEWEB)

    Basen, M; Schut, GJ; Nguyen, DM; Lipscomb, GL; Benn, RA; Prybol, CJ; Vaccaro, BJ; Poole, FL; Kelly, RM; Adams, MWW

    2014-12-09

    Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 degrees C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways.

  6. The BDGP gene disruption project: Single transposon insertions associated with 40 percent of Drosophila genes

    Energy Technology Data Exchange (ETDEWEB)

    Bellen, Hugo J.; Levis, Robert W.; Liao, Guochun; He, Yuchun; Carlson, Joseph W.; Tsang, Garson; Evans-Holm, Martha; Hiesinger, P. Robin; Schulze, Karen L.; Rubin, Gerald M.; Hoskins, Roger A.; Spradling, Allan C.

    2004-01-13

    The Berkeley Drosophila Genome Project (BDGP) strives to disrupt each Drosophila gene by the insertion of a single transposable element. As part of this effort, transposons in more than 30,000 fly strains were localized and analyzed relative to predicted Drosophila gene structures. Approximately 6,300 lines that maximize genomic coverage were selected to be sent to the Bloomington Stock Center for public distribution, bringing the size of the BDGP gene disruption collection to 7,140 lines. It now includes individual lines predicted to disrupt 5,362 of the 13,666 currently annotated Drosophila genes (39 percent). Other lines contain an insertion at least 2 kb from others in the collection and likely mutate additional incompletely annotated or uncharacterized genes and chromosomal regulatory elements. The remaining strains contain insertions likely to disrupt alternative gene promoters or to allow gene mis-expression. The expanded BDGP gene disruption collection provides a public resource that will facilitate the application of Drosophila genetics to diverse biological problems. Finally, the project reveals new insight into how transposons interact with a eukaryotic genome and helps define optimal strategies for using insertional mutagenesis as a genomic tool.

  7. Targeted, homology-driven gene insertion in stem cells by ZFN-loaded 'all-in-one' lentiviral vectors

    DEFF Research Database (Denmark)

    Cai, Yujia; Laustsen, Anders; Zhou, Yan;

    2016-01-01

    Biased integration remains a key challenge for gene therapy based on lentiviral vector technologies. Engineering of next-generation lentiviral vectors targeting safe genomic harbors for insertion is therefore of high relevance. In a previous paper (Cai et et, 2014a), we showed the use of integrase......% of transduced iPSCs. Our findings demonstrate the applicability of nuclease-loaded 'all-in-one' IDLVs for site-directed gene insertion in stem cell based gene therapies.......-defective lentiviral vectors (IDLVs) as carriers of complete gene repair kits consisting of zinc-finger nuclease (ZFN) proteins and repair sequences, allowing gene correction by homologous recombination (HR). Here, we follow this strategy to engineer ZEN-loaded IDLVs that insert transgenes by a homology...

  8. A novel reverse-genetic approach (SIMF) identifies Mutator insertions in new Myb genes.

    Science.gov (United States)

    Rabinowicz, P D; Grotewold, E

    2000-11-01

    We have developed a new strategy designated SIMF (Systematic Insertional Mutagenesis of Families), to identify DNA insertions in many members of a gene family simultaneously. This method requires only a short amino acid sequence conserved in all members of the family to make a degenerate oligonucleotide, and a sequence from the end of the DNA insertion. The SIMF strategy was successfully applied to the large maize R2R3 Myb family of regulatory genes, and Mutator insertions in several novel Myb genes were identified. Application of this technique to identify insertions in other large gene families could significantly decrease the effort involved in screening at the same time for insertions in all members of groups of genes that share a limited sequence identity.

  9. P and M gene junction is the optimal insertion site in Newcastle disease virus vaccine vector for foreign gene expression

    Science.gov (United States)

    Newcastle disease virus (NDV) has been developed as a vector for vaccine and gene therapy purposes. However, the optimal insertion site for foreign gene expression remained to be determined. In the present study, we inserted the green fluorescence protein (GFP) gene into five different intergenic ...

  10. Combining M-FISH and Quantum Dot technology for fast chromosomal assignment of transgenic insertions

    Directory of Open Access Journals (Sweden)

    Yusuf Mohammed

    2011-12-01

    Full Text Available Abstract Background Physical mapping of transgenic insertions by Fluorescence in situ Hybridization (FISH is a reliable and cost-effective technique. Chromosomal assignment is commonly achieved either by concurrent G-banding or by a multi-color FISH approach consisting of iteratively co-hybridizing the transgenic sequence of interest with one or more chromosome-specific probes at a time, until the location of the transgenic insertion is identified. Results Here we report a technical development for fast chromosomal assignment of transgenic insertions at the single cell level in mouse and rat models. This comprises a simplified 'single denaturation mixed hybridization' procedure that combines multi-color karyotyping by Multiplex FISH (M-FISH, for simultaneous and unambiguous identification of all chromosomes at once, and the use of a Quantum Dot (QD conjugate for the transgene detection. Conclusions Although the exploitation of the unique optical properties of QD nanocrystals, such as photo-stability and brightness, to improve FISH performance generally has been previously investigated, to our knowledge this is the first report of a purpose-designed molecular cytogenetic protocol in which the combined use of QDs and standard organic fluorophores is specifically tailored to assist gene transfer technology.

  11. The impact of gene duplication, insertion, deletion, lateral gene transfer and sequencing error on orthology inference: a simulation study.

    Science.gov (United States)

    Dalquen, Daniel A; Altenhoff, Adrian M; Gonnet, Gaston H; Dessimoz, Christophe

    2013-01-01

    The identification of orthologous genes, a prerequisite for numerous analyses in comparative and functional genomics, is commonly performed computationally from protein sequences. Several previous studies have compared the accuracy of orthology inference methods, but simulated data has not typically been considered in cross-method assessment studies. Yet, while dependent on model assumptions, simulation-based benchmarking offers unique advantages: contrary to empirical data, all aspects of simulated data are known with certainty. Furthermore, the flexibility of simulation makes it possible to investigate performance factors in isolation of one another.Here, we use simulated data to dissect the performance of six methods for orthology inference available as standalone software packages (Inparanoid, OMA, OrthoInspector, OrthoMCL, QuartetS, SPIMAP) as well as two generic approaches (bidirectional best hit and reciprocal smallest distance). We investigate the impact of various evolutionary forces (gene duplication, insertion, deletion, and lateral gene transfer) and technological artefacts (ambiguous sequences) on orthology inference. We show that while gene duplication/loss and insertion/deletion are well handled by most methods (albeit for different trade-offs of precision and recall), lateral gene transfer disrupts all methods. As for ambiguous sequences, which might result from poor sequencing, assembly, or genome annotation, we show that they affect alignment score-based orthology methods more strongly than their distance-based counterparts.

  12. The impact of gene duplication, insertion, deletion, lateral gene transfer and sequencing error on orthology inference: a simulation study.

    Directory of Open Access Journals (Sweden)

    Daniel A Dalquen

    Full Text Available The identification of orthologous genes, a prerequisite for numerous analyses in comparative and functional genomics, is commonly performed computationally from protein sequences. Several previous studies have compared the accuracy of orthology inference methods, but simulated data has not typically been considered in cross-method assessment studies. Yet, while dependent on model assumptions, simulation-based benchmarking offers unique advantages: contrary to empirical data, all aspects of simulated data are known with certainty. Furthermore, the flexibility of simulation makes it possible to investigate performance factors in isolation of one another.Here, we use simulated data to dissect the performance of six methods for orthology inference available as standalone software packages (Inparanoid, OMA, OrthoInspector, OrthoMCL, QuartetS, SPIMAP as well as two generic approaches (bidirectional best hit and reciprocal smallest distance. We investigate the impact of various evolutionary forces (gene duplication, insertion, deletion, and lateral gene transfer and technological artefacts (ambiguous sequences on orthology inference. We show that while gene duplication/loss and insertion/deletion are well handled by most methods (albeit for different trade-offs of precision and recall, lateral gene transfer disrupts all methods. As for ambiguous sequences, which might result from poor sequencing, assembly, or genome annotation, we show that they affect alignment score-based orthology methods more strongly than their distance-based counterparts.

  13. Technology Insertion and Management: Options for the Canadian Forces

    Science.gov (United States)

    2010-01-01

    L’insertion technologique et la gestion de la technologie : Options pour les Forces canadiennes », est une analyse documentaire qualitative de niveau...l’insertion technologique et son utilisation parmi les alliés du Canada et fournira certaines méthodes qui sont nécessaires pour faire une analyse ...technologique. Enfin, elle a fourni une gamme de méthodes nécessaires à une analyse coûts-avantages fondée sur l’optimisation des options en matière

  14. SEQUENCES OF PLANT TRANSFORMATION: THE RESULT OF THE INSERTED FOREIGN GENE EXPRESSION OR THE STRESS REACTION?

    Directory of Open Access Journals (Sweden)

    Enikeev A.G.

    2012-08-01

    Full Text Available The gene technology using in plant investigations came to the better understanding of plant physiological processes. At the same time unclear knowledge about transgenic plant physiology may occur a source of incorrect interpretation of obtained results and, consequently, wrong conclusions. In addition, the causes and mechanisms of pleiotropic effects associated with transgenic insertion and gene silencing are remaining unexplained. To solve the problem of transgenic plant physiology it is necessary to pay a close attention to physiological and biochemical peculiarities of plant-agrobacterium symbiosis, because it is a base of plant transformation. It was assumed earlier that agrobacterial transformation is a complex biotic stressing factor and transgenic plant is a long-term stressed organism. We suppose that physiological consequences of plant transformation are determined not only by foreign gene insertion, but largely by stress reaction of plant cells on agrobacterium transformation. Foreign DNA insertion to the plant recipient results in cascade of response reactions remarkably changing metabolism. The degree of such response is supposed to be in dependence on phylogenetic relations of gene donor and recipient. Cell cultures were obtained from tobacco plants (Nicotiana tabacum cv. ’Samsung’ transformed by following Agrobacterium tumefaciens strains: disarmed 669 one and LBA4400 one with hsp 101 in sense or antisense orientation. These cell cultures were used for investigations of the stress-reactions on biotic (bacterial infection agent Clavibacter michiganensis subsp. Sepedonicus and abiotic (high temperature, potassium fluoride factors. It was revealed that “sense” culture was superior to normal and “699” ones in tolerance to pointed stressing factors. Similar results were obtained for “antisense” culture, nevertheless it was a priori not expected to be tolerant. So, to assess the transformation consequence is necessary to

  15. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  16. A methodology for spacecraft technology insertion analysis balancing benefit, cost, and risk

    Science.gov (United States)

    Bearden, David Allen

    Emerging technologies are changing the way space missions are developed and implemented. Technology development programs are proceeding with the goal of enhancing spacecraft performance and reducing mass and cost. However, it is often the case that technology insertion assessment activities, in the interest of maximizing performance and/or mass reduction, do not consider synergistic system-level effects. Furthermore, even though technical risks are often identified as a large cost and schedule driver, many design processes ignore effects of cost and schedule uncertainty. This research is based on the hypothesis that technology selection is a problem of balancing interrelated (and potentially competing) objectives. Current spacecraft technology selection approaches are summarized, and a Methodology for Evaluating and Ranking Insertion of Technology (MERIT) that expands on these practices to attack otherwise unsolved problems is demonstrated. MERIT combines the modern techniques of technology maturity measures, parametric models, genetic algorithms, and risk assessment (cost and schedule) in a unique manner to resolve very difficult issues including: user-generated uncertainty, relationships between cost/schedule and complexity, and technology "portfolio" management. While the methodology is sufficiently generic that it may in theory be applied to a number of technology insertion problems, this research focuses on application to the specific case of small (goals, not-to-exceed costs, or hard schedule requirements. MERIT'S contributions to the engineering community are its: unique coupling of the aspects of performance, cost, and schedule; assessment of system level impacts of technology insertion; procedures for estimating uncertainties (risks) associated with advanced technology; and application of heuristics to facilitate informed system-level technology utilization decisions earlier in the conceptual design phase. MERIT extends the state of the art in technology

  17. Impact of lux gene insertion on bacterial surface properties and transport.

    Science.gov (United States)

    Chen, Gang; Srinivasa Ranga, Vijay Penagonda; Mao, Yongjun; Chen, Kevin; Qiao, Hanzi

    2008-03-01

    Genetic markers have been in popular use for tracing microbial movement in the environment. However, the impact of genetic marker insertion on microbial surface properties and consequent transport is often ignored. For this research, we investigated the impact of luminescence-based genetic marker insertion on bacterial surface properties and transport. Typical Gram-positive bacterial strains of Lactobacillus casei, Streptococcus mitis and Micrococcus luteus were used as model bacterial strains in this research. We manipulated gene transfer to observe the impact of lux gene insertion on bacterial surface properties based on contact angle measurements, and we conducted column experiments to evaluate the impact of lux gene insertion on bacterial transport. After lux gene insertion, bacterial interactions with the porous media increased, demonstrating stronger deposition potential in the porous media. Accordingly, retention of the daughter strains increased. Lux gene insertion also resulted in an increase in bacterial dispersion and equilibrium adsorption in the porous media. The bacterial deposition coefficient was found to correlate with the free energy of interactions between bacteria and the porous media.

  18. Sola dosis facit venenum. Leukemia in gene therapy trials: a question of vectors, inserts and dosage?

    Science.gov (United States)

    Staal, F J T; Pike-Overzet, K; Ng, Y Y; van Dongen, J J M

    2008-10-01

    In clinical gene therapy trials for X-linked severe combined immunodeficiency, the development of leukemia has come up as a severe adverse effect. In all five cases, T-cell acute lymphoblastic leukemia (T-ALL) occurred as a direct consequence of insertional mutagenesis by the retrovirus used to deliver the therapeutic gene. Here, we review the mechanisms of insertional mutagenesis, the function of the Il2RG gene and the future developments in the field. New lentiviral and gamma retroviral vectors can significantly improve the safety profile of the tools used but still carry the risk of insertional mutagenesis, as shown in this issue of Leukemia. Finally, the unfortunate side effects of gene therapy have given more insight into the development of human T-ALL.

  19. IS21-558 insertion sequences are involved in the mobility of the multiresistance gene cfr

    DEFF Research Database (Denmark)

    Kehrenberg, Corinna; Aarestrup, Frank Møller; Schwarz, Stefan

    2007-01-01

    exporter gene lsa(B) and the gene cfr for combined resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A antibiotics bracketed by IS21-558 insertion sequences orientated in the same direction. A 6-bp target site duplication was detected at the integration site within...

  20. Diamond MEMS: wafer scale processing, devices, and technology insertion

    Science.gov (United States)

    Carlisle, J. A.

    2009-05-01

    Diamond has long held the promise of revolutionary new devices: impervious chemical barriers, smooth and reliable microscopic machines, and tough mechanical tools. Yet it's been an outsider. Laboratories have been effectively growing diamond crystals for at least 25 years, but the jump to market viability has always been blocked by the expense of diamond production and inability to integrate with other materials. Advances in chemical vapor deposition (CVD) processes have given rise to a hierarchy of carbon films ranging from diamond-like carbon (DLC) to vapor-deposited diamond coatings, however. All have pros and cons based on structure and cost, but they all share some of diamond's heralded attributes. The best performer, in theory, is the purest form of diamond film possible, one absent of graphitic phases. Such a material would capture the extreme hardness, high Young's modulus and chemical inertness of natural diamond. Advanced Diamond Technologies Inc., Romeoville, Ill., is the first company to develop a distinct chemical process to create a marketable phase-pure diamond film. The material, called UNCD® (for ultrananocrystalline diamond), features grain sizes from 3 to 300 nm in size, and layers just 1 to 2 microns thick. With significant advantages over other thin films, UNCD is designed to be inexpensive enough for use in atomic force microscopy (AFM) probes, microelectromechanical machines (MEMS), cell phone circuitry, radio frequency devices, and even biosensors.

  1. TRINS: a method for gene modification by randomized tandem repeat insertions.

    Science.gov (United States)

    Kipnis, Yakov; Dellus-Gur, Eynat; Tawfik, Dan S

    2012-09-01

    In nature, the evolution of new protein functions is driven not only by side-chain substitutions (point mutations), but also by backbone modifications (insertions and deletions). The current laboratory diversification methods, however, are largely limited to point mutations. Of particular interest are short insertions-by-duplication that are frequent in nature but cannot be introduced in vitro in a library format (i.e. in random locations and lengths). Here, we describe a new procedure that allows the generation of tandem repeats of random fragments of the target gene via rolling-circle amplification, and the concurrent incorporation of these repeats into the target gene. This procedure, dubbed tandem repeat insertion, or TRINS, results in a library of genes carrying insertions-by-duplication of variable lengths (3-150 bp) at random positions. This diversification pattern allows sampling of sequence space regions that are not readily accessible by other protocols. We demonstrate this method by constructing three different gene libraries, and by selecting insertion variants of TEM-1 β-lactamase.

  2. Space Acquisitions: Space Based Infrared System Could Benefit from Technology Insertion Planning

    Science.gov (United States)

    2015-04-01

    Space Based Infrared System (SBIRS) Constellation with Defense Support Program (DSP) Augmentation (Nominal) 5 Figure 3: Key Space Based Infrared...5 GAO-15-366 Space Acquisitions Figure 2: Space Based Infrared System (SBIRS) Constellation with Defense Support Program (DSP) Augmentation...SPACE ACQUISITIONS Space Based Infrared System Could Benefit from Technology Insertion Planning Report to the

  3. Kinase domain insert containing receptor promotor controlled suicide gene system kills human umbilical vein endothelial cells

    Institute of Scientific and Technical Information of China (English)

    Zong-Hai Huang; Wen-Yu Yang; Qi Cheng; Jing-Long Yu; Zhou Li; Zong-Yan Tong; Hui-Juan Song; Xiao-Yan Che

    2005-01-01

    AIM: To evaluate the killing effect of double suicide gene mediated by adenovirus and regulated under kinase domain insert containing receptor (KDR) promoter on human umbilical vein endothelial cells. METHODS: By PCR technology, human KDR promoter gene, Escherichia coli(E. coli) cytosine deaminase (CD) gene and the herpes simple virus-thymidine kinase (TK) gene were cloned. Plasmid pKDR-CDglyTK was constructed with them. Then, a recombinant adenoviral plasmid pAdKDRCDglyTK was constructed in a "two-step transformation protocol". The newly constructed plasmids were transfected to 293 packaging cells to grow adenoviruses, which were further propagated and purified. Human umbilical vein endothelial cells (HUVEC) were infected with a different multiplicity of infection (MOI) of resultant recombinant adenovirus, the infection rate was measured with the aid of (GFP) expression. Infected cells were cultured in culture media containing different concentrations of (GCV) and/or 5-(FC), and the killing effects were measured.RESULTS: Recombinant adenoviruses AdKDR-CDglyTK were successfully constructed, and they infected HUVEC cells efficiently. Our data indicated that the infection rate was relevant to MOI of recombinant adenoviruses. HUVEC cells infected with AdKDR-CDglyTK were highly sensitive to the prodrugs, their survival rate correlated to both the concentration of the prodrugs and the MOI of recombinant adenoviruses. Our data also indicated that the two prodrugs used in combination were much more effective on killing transgeneic cells than GCV or 5-FC used alone. CONCLUSION: Prodrug/KDR-CDglyTK system is effective on killing HUVEC cells, its killing effect correlates to the concentration of prodrugs and recombinant adenovirus' MOI. Combined use of the two prodrugs confers better killing effects on transgeneic cells.

  4. Modeling insertional mutagenesis using gene length and expression in murine embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Alex S Nord

    Full Text Available BACKGROUND: High-throughput mutagenesis of the mammalian genome is a powerful means to facilitate analysis of gene function. Gene trapping in embryonic stem cells (ESCs is the most widely used form of insertional mutagenesis in mammals. However, the rules governing its efficiency are not fully understood, and the effects of vector design on the likelihood of gene-trapping events have not been tested on a genome-wide scale. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we used public gene-trap data to model gene-trap likelihood. Using the association of gene length and gene expression with gene-trap likelihood, we constructed spline-based regression models that characterize which genes are susceptible and which genes are resistant to gene-trapping techniques. We report results for three classes of gene-trap vectors, showing that both length and expression are significant determinants of trap likelihood for all vectors. Using our models, we also quantitatively identified hotspots of gene-trap activity, which represent loci where the high likelihood of vector insertion is controlled by factors other than length and expression. These formalized statistical models describe a high proportion of the variance in the likelihood of a gene being trapped by expression-dependent vectors and a lower, but still significant, proportion of the variance for vectors that are predicted to be independent of endogenous gene expression. CONCLUSIONS/SIGNIFICANCE: The findings of significant expression and length effects reported here further the understanding of the determinants of vector insertion. Results from this analysis can be applied to help identify other important determinants of this important biological phenomenon and could assist planning of large-scale mutagenesis efforts.

  5. Site-specific deletion and rearrangement of integron insert genes catalyzed by the integron DNA integrase.

    Science.gov (United States)

    Collis, C M; Hall, R M

    1992-01-01

    Deletion of individual antibiotic resistance genes found within the variable region of integrons is demonstrated. Evidence for gene duplications and rearrangements resulting from the insertion of gene units at new locations is also presented. Deletion, duplication, and rearrangement occur only in the presence of the integron-encoded DNA integrase. These events are precise and involve loss or gain of one or more complete insert units or gene cassettes. This confirms the recent definition of gene cassettes as consisting of the gene coding sequences, all except the last 7 bases of the 59-base element found at the 3' end of the gene, and the core site located 5' to the gene (Hall et al., Mol. Microbiol. 5:1941-1959, 1991) and demonstrates that individual gene cassettes are functional units which can be independently mobilized. Both deletions and duplications can be generated by integrase-mediated cointegrate formation followed by integrase-mediated resolution involving a different pair of sites. However, deletion occurs 10 times more frequently than duplication, and we propose that the majority of deletion events are likely to involve integrase-dependent excision of the gene unit to generate a circular gene cassette. The implications of these findings in understanding the evolution of integrons and the spread of antibiotic resistance genes in bacterial populations is discussed. Images PMID:1311297

  6. Insertion/deletion polymorphism of the ACE gene and adherence to ACE inhibitors

    NARCIS (Netherlands)

    H. Schelleman (Hedi); O.H. Klungel (Olaf); C.M. van Duijn (Cock); J.C.M. Witteman (Jacqueline); A. Hofman (Albert); A.C. de Boer (Anthonius); B.H.Ch. Stricker (Bruno)

    2005-01-01

    textabstractAims: We investigated whether the insertion/deletion (I/D) polymorphism of the ACE gene modified the adherence to ACE inhibitors as measured by the discontinuation of an ACE inhibitor, or addition of another antihypertensive drug. Methods: This was a cohort study among 239 subjects who

  7. Insertion/deletion polymorphism of the ACE gene and adherence to ACE inhibitors

    NARCIS (Netherlands)

    Schelleman, H; Klungel, O H; van Duijn, C M; Witteman, J C M; Hofman, A; de Boer, A; Stricker, B H Ch

    AIMS: We investigated whether the insertion/deletion (I/D) polymorphism of the ACE gene modified the adherence to ACE inhibitors as measured by the discontinuation of an ACE inhibitor, or addition of another antihypertensive drug. METHODS: This was a cohort study among 239 subjects who started ACE

  8. The NASA Electronic Parts and Packaging (NEPP) Program: Insertion of New Electronics Technologies

    Science.gov (United States)

    LaBel, Kenneth A.; Sampson, Michael J.

    2007-01-01

    This viewgraph presentation gives an overview of NASA Electronic Parts and Packaging (NEPP) Program's new electronics technology trends. The topics include: 1) The Changing World of Radiation Testing of Memories; 2) Even Application-Specific Tests are Costly!; 3) Hypothetical New Technology Part Qualification Cost; 4) Where we are; 5) Approaching FPGAs as a More Than a "Part" for Reliability; 6) FPGAs Beget Novel Radiation Test Setups; 7) Understanding the Complex Radiation Data; 8) Tracking Packaging Complexity and Reliability for FPGAs; 9) Devices Supporting the FPGA Need to be Considered; 10) Summary of the New Electronic Technologies and Insertion into Flight Programs Workshop; and 11) Highlights of Panel Notes and Comments

  9. Plant gene technology: social considerations

    African Journals Online (AJOL)

    Administrator

    African Journal of Biotechnology Vol. 3 (3), pp. 156-158 ... The genetic modification of plants by gene technology is of immense potential benefits, but there may ... this modern age. ... advantages over the current rate of food production and.

  10. Gene expression pattern after insertion of dexamethasone-eluting electrode into the guinea pig cochlea.

    Directory of Open Access Journals (Sweden)

    Yutaka Takumi

    Full Text Available A cochlear implant is an indispensable apparatus for a profound hearing loss patient. But insertion of the electrode entails a great deal of stress to the cochlea, and may cause irreversible damage to hair cells and related nerve structure. Although damage prevention effects of dexamethasone have been reported, long-term administration is difficult. In this study, we used a dexamethasone-eluting electrode in the guinea pig cochlea, and compared the gene expression after 7 days insertion with that of a normal electrode and non-surgically treated control by microarray. 40 genes were up-regulated 2-fold or more in the normal electrode group compared to the non-surgically treated group. Most of the up-regulated genes were associated with immune response and inflammation. In the dexamethasone-eluting group, compared to the normal electrode group, 7 of the 40 genes were further up-regulated, while 12 of them were down-regulated and there was a tendency to return to the non-surgical condition. 9 genes were down-regulated 2-fold or less with normal electrode insertion, and 4 of the 9 tended to return to the non-surgical condition in the dexamethasone-eluting group. These genes are certainly involved in the maintenance of the physiological functions of the cochlea. Our results indicate that the dexamethasone-eluting electrode will have an effect on the normalization of homeostasis in the cochlea.

  11. The NF1 gene contains hotspots for L1 endonuclease-dependent de novo insertion.

    Directory of Open Access Journals (Sweden)

    Katharina Wimmer

    2011-11-01

    Full Text Available Long interspersed (L1 and Alu elements are actively amplified in the human genome through retrotransposition of their RNA intermediates by the -100 still retrotranspositionally fully competent L1 elements. Retrotransposition can cause inherited disease if such an element is inserted near or within a functional gene. Using direct cDNA sequencing as the primary assay for comprehensive NF1 mutation analysis, we uncovered in 18 unrelated index patients splicing alterations not readily explained at the genomic level by an underlying point-mutation or deletion. Improved PCR protocols avoiding allelic drop-out of the mutant alleles uncovered insertions of fourteen Alu elements, three L1 elements, and one poly(T stretch to cause these splicing defects. Taken together, the 18 pathogenic L1 endonuclease-mediated de novo insertions represent the largest number of this type of mutations characterized in a single human gene. Our findings show that retrotransposon insertions account for as many as -0.4% of all NF1 mutations. Since altered splicing was the main effect of the inserted elements, the current finding was facilitated by the use of RNA-based mutation analysis protocols, resulting in improved detection compared to gDNA-based approaches. Six different insertions clustered in a relatively small 1.5-kb region (NF1 exons 21(16-23(18 within the 280-kb NF1 gene. Furthermore, three different specific integration sites, one of them located in this cluster region, were each used twice, i.e. NM_000267.3(NF1:c.1642-1_1642 in intron 14(10c, NM_000267.3(NF1:c.2835_2836 in exon 21(16, and NM_000267.3(NF1:c.4319_4320 in exon 33(25. Identification of three loci that each served twice as integration site for independent retrotransposition events as well as 1.5-kb cluster region harboring six independent insertions supports the notion of non-random insertion of retrotransposons in the human genome. Currently, little is known about which features make sites

  12. An analysis of substitution, deletion and insertion mutations in cancer genes.

    Science.gov (United States)

    Iengar, Prathima

    2012-08-01

    Cancer-associated mutations in cancer genes constitute a diverse set of mutations associated with the disease. To gain insight into features of the set, substitution, deletion and insertion mutations were analysed at the nucleotide level, from the COSMIC database. The most frequent substitutions were c → t, g → a, g → t, and the most frequent codon changes were to termination codons. Deletions more than insertions, FS (frameshift) indels more than I-F (in-frame) ones, and single-nucleotide indels, were frequent. FS indels cause loss of significant fractions of proteins. The 5'-cut in FS deletions, and 5'-ligation in FS insertions, often occur between pairs of identical bases. Interestingly, the cut-site and 3'-ligation in insertions, and 3'-cut and join-pair in deletions, were each found to be the same significantly often (p Proto-oncogenes undergo fewer, less-disruptive mutations, in selected protein regions, to activate a single allele. Finally, catalogues, in ranked order, of genes mutated in each cancer, and cancers in which each gene is mutated, were created. The study highlights the nucleotide level preferences and disruptive nature of cancer mutations.

  13. Transcriptional enhancers induce insertional gene deregulation independently from the vector type and design.

    Science.gov (United States)

    Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

    2009-05-01

    The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) gamma-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase--PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a gamma-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design.

  14. Distant horizontal gene transfer is rare for multiple families of prokaryotic insertion sequences.

    Science.gov (United States)

    Wagner, Andreas; de la Chaux, Nicole

    2008-11-01

    Horizontal gene transfer in prokaryotes is rampant on short and intermediate evolutionary time scales. It poses a fundamental problem to our ability to reconstruct the evolutionary tree of life. Is it also frequent over long evolutionary distances? To address this question, we analyzed the evolution of 2,091 insertion sequences from all 20 major families in 438 completely sequenced prokaryotic genomes. Specifically, we mapped insertion sequence occurrence on a 16S rDNA tree of the genomes we analyzed, and we also constructed phylogenetic trees of the insertion sequence transposase coding sequences. We found only 30 cases of likely horizontal transfer among distantly related prokaryotic clades. Most of these horizontal transfer events are ancient. Only seven events are recent. Almost all of these transfer events occur between pairs of human pathogens or commensals. If true also for other, non-mobile DNA, the rarity of distant horizontal transfer increases the odds of reliable phylogenetic inference from sequence data.

  15. Transposable element insertions in long intergenic non-coding RNA genes

    Directory of Open Access Journals (Sweden)

    Sivakumar eKannan

    2015-06-01

    Full Text Available Transposable elements (TE are abundant in mammalian genomes and appear to have contributed to the evolution of their hosts by providing novel regulatory or coding sequences. We analyzed different regions of long intergenic non-coding RNA (lincRNA genes in human and mouse genomes to systematically assess the potential contribution of TEs to the evolution of the structure and regulation of expression of lincRNA genes. Introns of lincRNA genes contain the highest percentage of TE-derived sequences, followed by exons and then promoter regions although the density of TEs is not significantly different between exons and promoters. Higher frequencies of ancient TEs in promoters and exons compared to introns implies that many lincRNA genes emerged before the split of primates and rodents. The content of TE-derived sequences in lincRNA genes is substantially higher than that in protein-coding genes, especially in exons and promoter regions. A significant positive correlation was detected between the content of TEs and evolutionary rate of lincRNAs indicating that inserted TEs are preferentially fixed in fast-evolving lincRNA genes. These results are consistent with the RIDL (Repeat Insertion Domains of LncRNAs hypothesis under which TEs have substantially contributed to the origin, evolution, and in particular functional diversification, of lincRNA genes.

  16. Gene transfer and genome-wide insertional mutagenesis by retroviral transduction in fish stem cells.

    Directory of Open Access Journals (Sweden)

    Qizhi Liu

    Full Text Available Retrovirus (RV is efficient for gene transfer and integration in dividing cells of diverse organisms. RV provides a powerful tool for insertional mutagenesis (IM to identify and functionally analyze genes essential for normal and pathological processes. Here we report RV-mediated gene transfer and genome-wide IM in fish stem cells from medaka and zebrafish. Three RVs were produced for fish cell transduction: rvLegfp and rvLcherry produce green fluorescent protein (GFP and mCherry fluorescent protein respectively under control of human cytomegalovirus immediate early promoter upon any chromosomal integration, whereas rvGTgfp contains a splicing acceptor and expresses GFP only upon gene trapping (GT via intronic in-frame integration and spliced to endogenous active genes. We show that rvLegfp and rvLcherry produce a transduction efficiency of 11~23% in medaka and zebrafish stem cell lines, which is as 30~67% efficient as the positive control in NIH/3T3. Upon co-infection with rvGTgfp and rvLcherry, GFP-positive cells were much fewer than Cherry-positive cells, consistent with rareness of productive gene trapping events versus random integration. Importantly, rvGTgfp infection in the medaka haploid embryonic stem (ES cell line HX1 generated GTgfp insertion on all 24 chromosomes of the haploid genome. Similar to the mammalian haploid cells, these insertion events were presented predominantly in intergenic regions and introns but rarely in exons. RV-transduced HX1 retained the ES cell properties such as stable growth, embryoid body formation and pluripotency gene expression. Therefore, RV is proficient for gene transfer and IM in fish stem cells. Our results open new avenue for genome-wide IM in medaka haploid ES cells in culture.

  17. Characterization of transcriptional activation and inserted-into-gene preference of various transposable elements in the Brassica species.

    Science.gov (United States)

    Gao, Caihua; Xiao, Meili; Jiang, Lingyan; Li, Jiana; Yin, Jiaming; Ren, Xiaodong; Qian, Wei; Oscar, Ortegón; Fu, Donghui; Tang, Zhanglin

    2012-07-01

    Transposable elements (TEs) have attracted increasing attention because of their tremendous contributions to genome reorganization and gene variation through dramatic proliferation and excision via transposition. However, less known are the transcriptional activation of various TEs and the characteristics of TE insertion into genomes at the genome-wide level. In the present study, we focused on TE genes for transposition and gene disruption by insertion of TEs in expression sequences of Brassica, to investigate the transcriptional activation of TEs, the biased insertion of TEs into genes, and their salient characteristics. Long terminal repeat (LTR-retrotransposon) accounted for the majority of these active TE genes (70.8%), suggesting that transposition activation varied with TE type. 6.1% genes were interrupted by LTR-retrotransposons, which indicated their preference for insertion into genes. TEs were preferentially inserted into cellular component-specific genes acted as "binding" elements and involved in metabolic processes. TEs have a biased insertion into some host genes that were involved with important molecular functions and TE genes exhibited spatiotemporal expression. These results suggested that various types of transposons differentially contributed to gene variation and affected gene function.

  18. Enhanced hydrogen production by insertional inactivation of adhE gene in Klebsiella oxytoca HP1

    Institute of Scientific and Technical Information of China (English)

    ZHU JunBo; LONG MinNan; XU FangCheng; WU XiaoBing; XU HuiJuan

    2007-01-01

    Ethanol is the main byproduct of anaerobic H2-producing fermentation in Klebsiella oxytoca HP1. Two moles of NAD(P)H are consumed to yield one mole of ethanol that may decrease bacterial hydrogen production. In this article the adhE gene that codes for acetaldehyde dehydrogenase was disrupted for the first time. A homologous recombination vector pTA-Str was constructed in which the adhE gene was disrupted by inserting an aminoglycoside-3'-adenyltransferase (aadA) gene. As expected, the vector includes the insertion 5'-adhE-aadA-adhE-3'. The amplified DNA fragment 5'-adhE-aadA-adhE-3' from pTA-Str was transformed into K. Oxytoca HP1 and one recombinant was obtained. PCR analysis of the resulting genomic DNA indicated the appropriate deletion and insertion. Compared with the H2-production of wild type K. Oxytoca HP1, the hydrogen yield of the mutant increased by 16.07% and ethanol concentration decreased by 77.47%, suggesting that inactivation of the adhE gene in K. Oxytoca HP1 is a potential method for enhancing bacterial H2-production.

  19. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.

    Science.gov (United States)

    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze

    2014-12-01

    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals.

  20. Comparative study of a responsive insertion technology (RIT colonoscope versus a variable-stiffness colonoscope

    Directory of Open Access Journals (Sweden)

    César Prieto-de-Frías

    2013-04-01

    Full Text Available Background and objectives: recently, Olympus developed a new prototype (XCF-Q180AY2L with responsive insertion technology (RIT, which besides the still known variable stiffness technology, included a passive bending section and a new high force insertion tube. Our objective was to investigate whether the use of this prototype could ease colonoscope insertion, increasing the cecal intubation rate, and/or shortening the cecal intubation time. Material and methods: the study was designed as a prospective observational study in 305 consecutive patients from a colo-rectal cancer screening program. We compared colonoscopies performed with conventional colonoscopes (CFH180AL/CFQ160L with those performed with the prototype XCF-Q180AY2L. End points were mean cecal and terminal ileal intubation times, cecum intubation rate, and need for specific maneuvers. All colonoscopies were performed under sedation with intravenous propofol. Finally, 288 patients were included. Results: no complications were observed. Complete cecal intubation rate was 100 % in both groups. The ileum could be reached in 98.95 % of cases. Mean time required to reach the cecum was shorter in the prototype endoscope group (4.31 min, SD 2.63 min than in the conventional endoscope group (4.66 min, SD 2.52 min (p < 0.05. Compared with the standard colonoscope group, we observed in the prototype group less subjective sensation of difficulty in the passage of the sigma (p < 0.01, fewer maneuvers when it proved necessary to straighten the scope (p < 0.01, and less frequent need to modify the stiffness of the endoscope (p < 0.05. Conclusion: we concluded that the prototype endoscope (XCF-Q180AY2L facilitated colonoscope insertion, requiring slightly less time to reach the cecum than a standard colonoscope.

  1. Comparison and Validation of Putative Pathogenicity-Related Genes Identified by T-DNA Insertional Mutagenesis and Microarray Expression Profiling in Magnaporthe oryzae

    Science.gov (United States)

    Wáng, Ying; Tan, Qi; Gao, Ying Nv; Li, Yan

    2017-01-01

    High-throughput technologies of functional genomics such as T-DNA insertional mutagenesis and microarray expression profiling have been employed to identify genes related to pathogenicity in Magnaporthe oryzae. However, validation of the functions of individual genes identified by these high-throughput approaches is laborious. In this study, we compared two published lists of genes putatively related to pathogenicity in M. oryzae identified by T-DNA insertional mutagenesis (comprising 1024 genes) and microarray expression profiling (comprising 236 genes), respectively, and then validated the functions of some overlapped genes between the two lists by knocking them out using the method of target gene replacement. Surprisingly, only 13 genes were overlapped between the two lists, and none of the four genes selected from the overlapped genes exhibited visible phenotypic changes on vegetative growth, asexual reproduction, and infection ability in their knockout mutants. Our results suggest that both of the lists might contain large proportions of unrelated genes to pathogenicity and therefore comparing the two gene lists is hardly helpful for the identification of genes that are more likely to be involved in pathogenicity as we initially expected.

  2. Insertional oncogenesis by non-acute retroviruses: implications for gene therapy.

    Science.gov (United States)

    Fan, Hung; Johnson, Chassidy

    2011-04-01

    Retroviruses cause cancers in a variety of animals and humans. Research on retroviruses has provided important insights into mechanisms of oncogenesis in humans, including the discovery of viral oncogenes and cellular proto-oncogenes. The subject of this review is the mechanisms by which retroviruses that do not carry oncogenes (non-acute retroviruses) cause cancers. The common theme is that these tumors result from insertional activation of cellular proto-oncogenes by integration of viral DNA. Early research on insertional activation of proto-oncogenes in virus-induced tumors is reviewed. Research on non-acute retroviruses has led to the discovery of new proto-oncogenes through searches for common insertion sites (CISs) in virus-induced tumors. Cooperation between different proto-oncogenes in development of tumors has been elucidated through the study of retrovirus-induced tumors, and retroviral infection of genetically susceptible mice (retroviral tagging) has been used to identify cellular proto-oncogenes active in specific oncogenic pathways. The pace of proto-oncogene discovery has been accelerated by technical advances including PCR cloning of viral integration sites, the availability of the mouse genome sequence, and high throughput DNA sequencing. Insertional activation has proven to be a significant risk in gene therapy trials to correct genetic defects with retroviral vectors. Studies on non-acute retroviral oncogenesis provide insight into the potential risks, and the mechanisms of oncogenesis.

  3. Screening for Escherichia coli K-12 genes conferring glyoxal resistance or sensitivity by transposon insertions.

    Science.gov (United States)

    Lee, Changhan; Kim, Jihong; Kwon, Minsuk; Lee, Kihyun; Min, Haeyoung; Kim, Seong Hun; Kim, Dongkyu; Lee, Nayoung; Kim, Jiyeun; Kim, Doyun; Ko, Changmin; Park, Chankyu

    2016-09-01

    Glyoxal (GO) belongs to the reactive electrophilic species generated in vivo in all organisms. In order to identify targets of GO and their response mechanisms, we attempted to screen for GO-sensitive mutants by random insertions of TnphoA-132. The genes responsible for GO susceptibility were functionally classified as the following: (i) tRNA modification; trmE, gidA and truA, (ii) DNA repair; recA and recC, (iii) toxin-antitoxin; mqsA and (iv) redox metabolism; yqhD and caiC In addition, an insertion in the crp gene, encoding the cAMP responsive transcription factor, exhibits a GO-resistant phenotype, which is consistent with the phenotype of adenylate cyclase (cya) mutant showing GO resistance. This suggests that global regulation involving cAMP is operated in a stress response to GO. To further characterize the CRP-regulated genes directly associated with GO resistance, we created double mutants deficient in both crp and one of the candidate genes including yqhD, gloA and sodB The results indicate that these genes are negatively regulated by CRP as confirmed by real-time RT-PCR. We propose that tRNA as well as DNA are the targets of GO and that toxin/antitoxin, antioxidant and cAMP are involved in cellular response to GO.

  4. Genome-wide retroviral insertional tagging of genes involved in cancer in Cdkn2a-deficient mice

    DEFF Research Database (Denmark)

    Lund, Anders H; Turner, Geoffrey; Trubetskoy, Alla;

    2002-01-01

    retroviral integration sites and mapped them against the mouse genome sequence databases from Celera and Ensembl. In addition to 17 insertions targeting gene loci known to be cancer-related, we identified a total of 37 new common insertion sites (CISs), of which 8 encode components of signaling pathways......-scale retroviral insertional mutagenesis in genetically predisposed mice is useful both as a system for identifying genes underlying cancer and as a genetic framework for the assignment of such genes to specific oncogenic pathways....

  5. Regulated gene insertion by steroid-induced PhiC31 integrase.

    Science.gov (United States)

    Sharma, Nynne; Moldt, Brian; Dalsgaard, Trine; Jensen, Thomas G; Mikkelsen, Jacob Giehm

    2008-06-01

    Nonviral integration systems are widely used genetic tools in transgenesis and play increasingly important roles in strategies for therapeutic gene transfer. Methods to efficiently regulate the activity of transposases and site-specific recombinases have important implications for their spatiotemporal regulation in live transgenic animals as well as for studies of their applicability as safe vectors for genetic therapy. In this report, strategies for posttranslational induction of a variety of gene-inserting proteins are investigated. An engineered hormone-binding domain, derived from the human progesterone receptor, hPR891, and specifically recognized by the synthetic steroid mifepristone, is fused to the Sleeping Beauty, Frog Prince, piggyBac and Tol2 transposases as well as to the Flp and PhiC31 recombinases. By analyzing mifepristone-directed inducibility of gene insertion in cultured human cells, efficient posttranslational regulation of the Flp recombinase and the PhiC31 integrase is documented. In addition, fusion of the PhiC31 integrase with the ER(T2) modified estrogen receptor hormone-binding domain results in a protein, which is inducible by a factor of 22-fold and retains 75% of the activity of the wild-type protein. These inducible PhiC31 integrase systems are important new tools in transgenesis and in safety studies of the PhiC31 integrase for gene therapy applications.

  6. Transposon insertional mutagenesis in mice identifies human breast cancer susceptibility genes and signatures for stratification

    Science.gov (United States)

    Chen, Liming; Jenjaroenpun, Piroon; Pillai, Andrea Mun Ching; Ivshina, Anna V.; Ow, Ghim Siong; Efthimios, Motakis; Zhiqun, Tang; Lee, Song-Choon; Rogers, Keith; Ward, Jerrold M.; Mori, Seiichi; Adams, David J.; Jenkins, Nancy A.; Copeland, Neal G.; Ban, Kenneth Hon-Kim; Kuznetsov, Vladimir A.; Thiery, Jean Paul

    2017-01-01

    Robust prognostic gene signatures and therapeutic targets are difficult to derive from expression profiling because of the significant heterogeneity within breast cancer (BC) subtypes. Here, we performed forward genetic screening in mice using Sleeping Beauty transposon mutagenesis to identify candidate BC driver genes in an unbiased manner, using a stabilized N-terminal truncated β-catenin gene as a sensitizer. We identified 134 mouse susceptibility genes from 129 common insertion sites within 34 mammary tumors. Of these, 126 genes were orthologous to protein-coding genes in the human genome (hereafter, human BC susceptibility genes, hBCSGs), 70% of which are previously reported cancer-associated genes, and ∼16% are known BC suppressor genes. Network analysis revealed a gene hub consisting of E1A binding protein P300 (EP300), CD44 molecule (CD44), neurofibromin (NF1) and phosphatase and tensin homolog (PTEN), which are linked to a significant number of mutated hBCSGs. From our survival prediction analysis of the expression of human BC genes in 2,333 BC cases, we isolated a six-gene-pair classifier that stratifies BC patients with high confidence into prognostically distinct low-, moderate-, and high-risk subgroups. Furthermore, we proposed prognostic classifiers identifying three basal and three claudin-low tumor subgroups. Intriguingly, our hBCSGs are mostly unrelated to cell cycle/mitosis genes and are distinct from the prognostic signatures currently used for stratifying BC patients. Our findings illustrate the strength and validity of integrating functional mutagenesis screens in mice with human cancer transcriptomic data to identify highly prognostic BC subtyping biomarkers. PMID:28251929

  7. An exonic insertion within Tex14 gene causes spermatogenic arrest in pigs

    Directory of Open Access Journals (Sweden)

    Sironen Anu

    2011-12-01

    Full Text Available Abstract Background Male infertility is an increasing problem in all domestic species including man. Localization and identification of genes involved in defects causing male infertility provide valuable information of specific events in sperm development. Sperm development is a complex process, where diploid spermatogonia develop into haploid, highly specialized spermatozoa. Correct expression and function of various genes and their protein products are required for production of fertile sperm. We have identified an infertility defect in Finnish Yorkshire boars caused by spermatogenic arrest. The aim of this study was to locate the disease associated region using genome wide screen with the PorcineSNP60 Beadchip and identify the causal mutation by candidate gene approach. Results In the Finnish Yorkshire pig population the spermatogenic arrest (SA defect appears to be of genetic origin and causes severe degeneration of germ cells and total absence of spermatozoa. Genome wide scan with the PorcineSNP60 Beadchip localized the SA defect to porcine chromosome 12 in a 2 Mbp region. Sequencing of a candidate gene Tex14 revealed a 51 bp insertion within exon 27, which caused differential splicing of the exon and created a premature translation stop codon. The expression of Tex14 was markedly down regulated in the testis of a SA affected boar compared to control boars and no protein product was identified by Western blotting. The SA insertion sequence was also found within intron 27 in all analyzed animals, thus the insertion appears to be a possible duplication event. Conclusion In this study we report the identification of a causal mutation for infertility caused by spermatogenic arrest at an early meiotic phase. Our results highlight the role of TEX14 specifically in spermatogenesis and the importance of specific genomic remodeling events as causes for inherited defects.

  8. Effects of insertion sites in a Newcastle disease virus vector on foreign gene expression through an internal ribosomal entry site

    Science.gov (United States)

    Newcastle disease virus (NDV), avian paramyxovirus type 1, has been developed as a vector to express foreign genes for vaccine and gene therapy purposes. The foreign genes are usually inserted into a non-coding region of the NDV genome as an independent transcription unit (ITU), which potentially a...

  9. Quantitative expression profiling guided by common retroviral insertion sites reveals novel and cell type–specific cancer genes in leukemia

    Science.gov (United States)

    Sauvageau, Martin; Miller, Michelle; Lemieux, Sébastien; Lessard, Julie; Hébert, Josée; Sauvageau, Guy

    2017-01-01

    Proviral insertional mutagenesis is a powerful tool for the discovery of cancer-associated genes. The ability of integrated proviruses to affect gene expression over long distances combined with the lack of methods to determine the expression levels of large numbers of genes in a systematic and truly quantitative manner have limited the identification of cancer genes by proviral insertional mutagenesis. Here, we have characterized a new model of proviral insertional mutagenesis-induced lymphoid tumors derived from Eed Polycomb group gene mutant mice and quantitatively determined the expression levels of all genes within 100 kb of 20 different retroviral common insertion sites (CISs) identified in these tumors. Using high-throughput quantitative reverse transcription–polymerase chain reaction (Q-RT-PCR), we document an average of 13 CIS-associated genes deregulated per tumor, half of which are leukemia subtype–specific, while the others are coordinately deregulated in the majority of tumors analyzed. Interestingly, we find that genes located distantly from common proviral integration sites are as frequently deregulated as proximal genes, with multiple genes affected per integration. Our studies reveal an unsuspected conservation in the group of genes deregulated among phenotypically similar subtypes of lymphoid leukemias, and suggest that identification of common molecular determinants of this disease is within reach. PMID:17906077

  10. Site-Specific Insertion Polymorphism of the MITE Alex-1 in the Genus Coffea Suggests Interspecific Gene Flow

    Directory of Open Access Journals (Sweden)

    Christine Dubreuil-Tranchant

    2011-01-01

    Full Text Available Miniature Inverted-repeat Transposable Elements (MITEs are small nonautonomous class-II transposable elements distributed throughout eukaryotic genomes. We identified a novel family of MITEs (named Alex in the Coffea canephora genome often associated with expressed sequences. The Alex-1 element is inserted in an intron of a gene at the CcEIN4 locus. Its mobility was demonstrated by sequencing the insertion site in C. canephora accessions and Coffea species. Analysis of the insertion polymorphism of Alex-1 at this locus in Coffea species and in C. canephora showed that there was no relationship between the geographical distribution of the species, their phylogenetic relationships, and insertion polymorphism. The intraspecific distribution of C. canephora revealed an original situation within the E diversity group. These results suggest possibly greater gene flow between species than previously thought. This MITE family will enable the study of the C. canephora genome evolution, phylogenetic relationships, and possible gene flows within the Coffea genus.

  11. Bridging PCR and partially overlapping primers for novel allergen gene cloning and expression insert decoration

    Institute of Scientific and Technical Information of China (English)

    Ai-Lin Tao; Shao-Heng He

    2004-01-01

    AIM: To obtain the entire gene open reading frame (ORF)and to construct the expression vectors for recombinant allergen production.METHODS: Gene fragments corresponding to the gene specific region and the cDNA ends of pollen allergens of short ragweed (Rg, Ambrosia artemisiifolia L.) were obtained by pan-degenerate primer-based PCR and rapid amplification of the cDNA ends (RACE), and the products were mixed to serve as the bridging PCR (BPCR) template. The full-length gene was then obtained. Partially overlapping primer-based PCR (POP-PCR) method was developed to overcome the other problem, i.e., the non-specific amplification of the ORF with routine long primers for expression insert decoration.Northern blot was conducted to confirm pollen sources of the gene. The full-length coding region was evaluated for its gene function by homologue search in GenBank database and Western blotting of the recombinant protein Amb a 8 (D106) expressed in Escherichia colipET-44 system.RESULTS: The full-length cDNA sequence of Amb a 8(D106)was obtained by using the above procedure and deduced to encode a 131 amino acid polypeptide. Multiple sequence alignment exhibited the gene D106sharing a homology as high as 54-89% and 79-89% to profilin from pollen and food sources, respectively. The expression vector of the allergen gene D106was successfully constructed by employing the combined method of BPCR and POP-PCR. Recombinant allergen rAmb a 8(D106) was then successfully generated.The allergenicity was hallmarked by immunoblotting with the allergic serum samples and its RNA source was confirmed by Northern blot.CONCLUSION: The combined procedure of POP-PCR and BPCR is a powerful method for full-length allergen gene retrieval and expression insert decoration, which would be useful for recombinant allergen production and subsequent diagnosis and immunotherapy of pollen and food allergy.

  12. The evolution of small insertions and deletions in the coding genes of Drosophila melanogaster.

    Science.gov (United States)

    Chong, Zechen; Zhai, Weiwei; Li, Chunyan; Gao, Min; Gong, Qiang; Ruan, Jue; Li, Juan; Jiang, Lan; Lv, Xuemei; Hungate, Eric; Wu, Chung-I

    2013-12-01

    Studies of protein evolution have focused on amino acid substitutions with much less systematic analysis on insertion and deletions (indels) in protein coding genes. We hence surveyed 7,500 genes between Drosophila melanogaster and D. simulans, using D. yakuba as an outgroup for this purpose. The evolutionary rate of coding indels is indeed low, at only 3% of that of nonsynonymous substitutions. As coding indels follow a geometric distribution in size and tend to fall in low-complexity regions of proteins, it is unclear whether selection or mutation underlies this low rate. To resolve the issue, we collected genomic sequences from an isogenic African line of D. melanogaster (ZS30) at a high coverage of 70× and analyzed indel polymorphism between ZS30 and the reference genome. In comparing polymorphism and divergence, we found that the divergence to polymorphism ratio (i.e., fixation index) for smaller indels (size ≤ 10 bp) is very similar to that for synonymous changes, suggesting that most of the within-species polymorphism and between-species divergence for indels are selectively neutral. Interestingly, deletions of larger sizes (size ≥ 11 bp and ≤ 30 bp) have a much higher fixation index than synonymous mutations and 44.4% of fixed middle-sized deletions are estimated to be adaptive. To our surprise, this pattern is not found for insertions. Protein indel evolution appear to be in a dynamic flux of neutrally driven expansion (insertions) together with adaptive-driven contraction (deletions), and these observations provide important insights for understanding the fitness of new mutations as well as the evolutionary driving forces for genomic evolution in Drosophila species.

  13. Methodology for conceptual remote sensing spacecraft technology: insertion analysis balancing performance, cost, and risk

    Science.gov (United States)

    Bearden, David A.; Duclos, Donald P.; Barrera, Mark J.; Mosher, Todd J.; Lao, Norman Y.

    1997-12-01

    Emerging technologies and micro-instrumentation are changing the way remote sensing spacecraft missions are developed and implemented. Government agencies responsible for procuring space systems are increasingly requesting analyses to estimate cost, performance and design impacts of advanced technology insertion for both state-of-the-art systems as well as systems to be built 5 to 10 years in the future. Numerous spacecraft technology development programs are being sponsored by Department of Defense (DoD) and National Aeronautics and Space Administration (NASA) agencies with the goal of enhancing spacecraft performance, reducing mass, and reducing cost. However, it is often the case that technology studies, in the interest of maximizing subsystem-level performance and/or mass reduction, do not anticipate synergistic system-level effects. Furthermore, even though technical risks are often identified as one of the largest cost drivers for space systems, many cost/design processes and models ignore effects of cost risk in the interest of quick estimates. To address these issues, the Aerospace Corporation developed a concept analysis methodology and associated software tools. These tools, collectively referred to as the concept analysis and design evaluation toolkit (CADET), facilitate system architecture studies and space system conceptual designs focusing on design heritage, technology selection, and associated effects on cost, risk and performance at the system and subsystem level. CADET allows: (1) quick response to technical design and cost questions; (2) assessment of the cost and performance impacts of existing and new designs/technologies; and (3) estimation of cost uncertainties and risks. These capabilities aid mission designers in determining the configuration of remote sensing missions that meet essential requirements in a cost- effective manner. This paper discuses the development of CADET modules and their application to several remote sensing satellite

  14. Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

    Directory of Open Access Journals (Sweden)

    Udhaya H Kotecha

    2014-01-01

    Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

  15. Dopamine D2 receptor gene -141C Insertion/Deletion polymorphism in Turkish schizophrenic patients.

    Science.gov (United States)

    Kurt, Hulyam; Dikmen, Miris; Basaran, Ayşe; Yenilmez, Cinar; Ozdemir, Figen; Degirmenci, Irfan; Gunes, Hasan Veysi; Kucuk, Meral Urhan; Mutlu, Fezan

    2011-02-01

    Schizophrenia is a chronic and neuropsychiatric disease that affects about 0.5-1% of the world's population. An increase in dopamine and dopamine D2 receptor (DRD2) gene products has been well described in schizophrenic patients. Several groups have studied the relationship between dopaminergic hyperactivity and cellular communications have obtained discordant results. Studies searching for the relationship between the schizophrenia and DRD2 gene have gained more interest. Our objective was to determine the relationships among schizophrenic symptoms in schizophrenia subtypes and severity of symptoms in terms of DRD2 gene -141C Insertion/Deletion [Ins/Del; I/D] polymorphism by PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) assay method. Genomic DNA was prepared from peripheral blood by using salt extraction method. After amplification of genomic DNA, PCR products were digested with BstNI restriction enzyme for the detection of DRD2 gene -141C Ins/Del polymorphism in 73 schizophrenic patients and 60 healthy control subjects. The allelic frequencies of the DRD2 gene -141C Ins/Del polymorphism in case and control groups were 79.5 and 77.5% for I allele; 20.5 and 22.5% for D allele respectively. There was no significant difference in frequencies of genotypes and alleles between the two groups. In schizophrenic and control subjects, there were no significant relationship in severity of the disease and schizophrenia types among the -141C Ins/Del genotypes and alleles.

  16. Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1.

    Science.gov (United States)

    Hacein-Bey-Abina, Salima; Garrigue, Alexandrine; Wang, Gary P; Soulier, Jean; Lim, Annick; Morillon, Estelle; Clappier, Emmanuelle; Caccavelli, Laure; Delabesse, Eric; Beldjord, Kheira; Asnafi, Vahid; MacIntyre, Elizabeth; Dal Cortivo, Liliane; Radford, Isabelle; Brousse, Nicole; Sigaux, François; Moshous, Despina; Hauer, Julia; Borkhardt, Arndt; Belohradsky, Bernd H; Wintergerst, Uwe; Velez, Maria C; Leiva, Lily; Sorensen, Ricardo; Wulffraat, Nicolas; Blanche, Stéphane; Bushman, Frederic D; Fischer, Alain; Cavazzana-Calvo, Marina

    2008-09-01

    Previously, several individuals with X-linked SCID (SCID-X1) were treated by gene therapy to restore the missing IL-2 receptor gamma (IL2RG) gene to CD34+ BM precursor cells using gammaretroviral vectors. While 9 of 10 patients were successfully treated, 4 of the 9 developed T cell leukemia 31-68 months after gene therapy. In 2 of these cases, blast cells contained activating vector insertions near the LIM domain-only 2 (LMO2) proto-oncogene. Here, we report data on the 2 most recent adverse events, which occurred in patients 7 and 10. In patient 10, blast cells contained an integrated vector near LMO2 and a second integrated vector near the proto-oncogene BMI1. In patient 7, blast cells contained an integrated vector near a third proto-oncogene,CCND2. Additional genetic abnormalities in the patients' blast cells included chromosomal translocations, gain-of-function mutations activating NOTCH1, and copy number changes, including deletion of tumor suppressor gene CDKN2A, 6q interstitial losses, and SIL-TAL1 rearrangement. These findings functionally specify a genetic network that controls growth in T cell progenitors. Chemotherapy led to sustained remission in 3 of the 4 cases of T cell leukemia, but failed in the fourth. Successful chemotherapy was associated with restoration of polyclonal transduced T cell populations. As a result, the treated patients continued to benefit from therapeutic gene transfer.

  17. The somatic hypermutation activity of a follicular lymphoma links to large insertions and deletions of immunoglobulin genes.

    Science.gov (United States)

    Wu, H Y; Kaartinen, M

    1995-07-01

    A biopsy specimen from a patient with follicular lymphoma was divided into two fragments. DNA was extracted from one fragment and a 1.2 kb region of the functional heavy chain (IgH) gene was amplified, cloned and sequenced (eight clones). From the other fragment a cell line (HF-1) was started. The IgH gene region was amplified from the cell line, and sequenced without cloning. The nine sequences obtained could be arranged into a genealogical tree where the individual sequences differed from the deduced ancestor by 16-29 single nucleotide changes, some also by an insertion and/or a deletion. It is apparent that the sequence alterations were caused by somatic mutations during the growth of the lymphoma. The comparison of the sequences with two published (allelic) germline sequences of the human JH region showed approximately 20% non-homology. The differences included five additional multinucleotide insertion/deletion changes, the longest of them a 101-nucleotide insertion. Two long insertions were homologous to the adjacent germline sequences. We propose that most of the changes observed, including long deletions and insertions, represent or are linked to somatic hypermutation events of the Ig gene type. Although in a few cases large deletions and insertions (> 2 bp) have been found in mutated immunoglobulin genes, our results, for the first time, firmly link these deletions/insertions to somatic hypermutations; their frequency was found to be 2.2% of the observed mutational events in the non-translated gene regions. HF-1 is the first follicular lymphoma line successfully established from a lymphoma known to have hypermutated its Ig genes during the malignant growth. It is a candidate cell line to be studied for its ability to generate mutations of B cell type in cell cultures.

  18. Genome-wide retroviral insertional tagging of genes involved in cancer in Cdkn2a-deficient mice.

    Science.gov (United States)

    Lund, Anders H; Turner, Geoffrey; Trubetskoy, Alla; Verhoeven, Els; Wientjens, Ellen; Hulsman, Danielle; Russell, Robert; DePinho, Ronald A; Lenz, Jack; van Lohuizen, Maarten

    2002-09-01

    We have used large-scale insertional mutagenesis to identify functional landmarks relevant to cancer in the recently completed mouse genome sequence. We infected Cdkn2a(-/-) mice with Moloney murine leukemia virus (MoMuLV) to screen for loci that can participate in tumorigenesis in collaboration with loss of the Cdkn2a-encoded tumor suppressors p16INK4a and p19ARF. Insertional mutagenesis by the latent retrovirus was synergistic with loss of Cdkn2a expression, as indicated by a marked acceleration in the development of both myeloid and lymphoid tumors. We isolated 747 unique sequences flanking retroviral integration sites and mapped them against the mouse genome sequence databases from Celera and Ensembl. In addition to 17 insertions targeting gene loci known to be cancer-related, we identified a total of 37 new common insertion sites (CISs), of which 8 encode components of signaling pathways that are involved in cancer. The effectiveness of large-scale insertional mutagenesis in a sensitized genetic background is demonstrated by the preference for activation of MAP kinase signaling, collaborating with Cdkn2a loss in generating the lymphoid and myeloid tumors. Collectively, our results show that large-scale retroviral insertional mutagenesis in genetically predisposed mice is useful both as a system for identifying genes underlying cancer and as a genetic framework for the assignment of such genes to specific oncogenic pathways.

  19. Sleeping Beauty transposon insertional mutagenesis based mouse models for cancer gene discovery

    Science.gov (United States)

    Moriarity, Branden S; Largaespada, David A

    2016-01-01

    Large-scale genomic efforts to study human cancer, such as the cancer gene atlas (TCGA), have identified numerous cancer drivers in a wide variety of tumor types. However, there are limitations to this approach, the mutations and expression or copy number changes that are identified are not always clearly functionally relevant, and only annotated genes and genetic elements are thoroughly queried. The use of complimentary, nonbiased, functional approaches to identify drivers of cancer development and progression is ideal to maximize the rate at which cancer discoveries are achieved. One such approach that has been successful is the use of the Sleeping Beauty (SB) transposon-based mutagenesis system in mice. This system uses a conditionally expressed transposase and mutagenic transposon allele to target mutagenesis to somatic cells of a given tissue in mice to cause random mutations leading to tumor development. Analysis of tumors for transposon common insertion sites (CIS) identifies candidate cancer genes specific to that tumor type. While similar screens have been performed in mice with the PiggyBac (PB) transposon and viral approaches, we limit extensive discussion to SB. Here we discuss the basic structure of these screens, screens that have been performed, methods used to identify CIS. PMID:26051241

  20. IS30-related transposon mediated insertional inactivation of bile salt hydrolase (bsh1) gene of Lactobacillus plantarum strain Lp20.

    Science.gov (United States)

    Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar

    2014-01-01

    Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system.

  1. Clonal Dominance With Retroviral Vector Insertions Near the ANGPT1 and ANGPT2 Genes in a Human Xenotransplant Mouse Model

    Directory of Open Access Journals (Sweden)

    Reinhard Haemmerle

    2014-01-01

    Full Text Available Insertional leukemogenesis represents the major risk factor of hematopoietic stem cell (HSC based gene therapy utilizing integrating viral vectors. To develop a pre-clinical model for the evaluation of vector-related genotoxicity directly in the relevant human target cells, cord blood CD34+ HSCs were transplanted into immunodeficient NOD.SCID.IL2rg−/− (NSG mice after transduction with an LTR-driven gammaretroviral vector (GV. Furthermore, we specifically investigated the effect of prolonged in vitro culture in the presence of cytokines recently described to promote HSC expansion or maintenance. Clonality of human hematopoiesis in NSG mice was assessed by high throughput insertion site analyses and validated by insertion site-specific PCR depicting a GV typical integration profile with insertion sites resembling to 25% those of clinical studies. No overrepresentation of integrations in the vicinity of cancer-related genes was observed, however, several dominant clones were identified including two clones harboring integrations in the ANGPT1 and near the ANGPT2 genes associated with deregulated ANGPT1- and ANGPT2-mRNA levels. While these data underscore the potential value of the NSG model, our studies also identified short-comings such as overall low numbers of engrafted HSCs, limited in vivo observation time, and the challenges of in-depth insertion site analyses by low contribution of gene modified hematopoiesis.

  2. Complete association between a retroviral insertion in the tyrosinase gene and the recessive white mutation in chickens

    Directory of Open Access Journals (Sweden)

    Oulmouden Ahmad

    2006-02-01

    Full Text Available Abstract Background In chickens, three mutant alleles have been reported at the C locus, including the albino mutation, and the recessive white mutation, which is characterized by white plumage and pigmented eyes. The albino mutation was found to be a 6 bp deletion in the tyrosinase (TYR gene. The present work describes an approach to identify the structural rearrangement in the TYR gene associated with the recessive white mutation. Results Molecular analysis of the chicken TYR gene has revealed a major structural difference (Restriction Fragment Length Polymorphism, RFLP in the genomic DNA of the recessive white chicken. A major size difference of 7.7 kb was found in intron 4 of the TYR gene by long-range PCR. Molecular cloning and sequencing results showed the insertion of a complete avian retroviral sequence of the Avian Leukosis Virus (ALV family. Several aberrant transcripts of the tyrosinase gene were found in 10 week old recessive white chickens but not in the homozygous wild type colored chicken. We established a rapid genotyping diagnostic test based on the discovery of this retroviral insertion. It shows that all homozygous carriers of this insertion had a white plumage in various chicken strains. Furthermore, it was possible to distinguish heterozygous carriers from homozygous normal chickens in a segregating line. Conclusion In this study, we conclude that the insertion of a complete avian retroviral sequence in intron 4 of the tyrosinase gene is diagnostic of the recessive white mutation in chickens. This insertion causes aberrant transcripts lacking exon 5, and we propose that this insertion is the causal mutation for the recessive white allele in the chicken.

  3. Biodegradable nanoparticles for gene therapy technology

    Energy Technology Data Exchange (ETDEWEB)

    Hosseinkhani, Hossein, E-mail: hosseinkhani@mail.ntust.edu.tw; He, Wen-Jie [National Taiwan University of Science and Technology (Taiwan Tech), Graduate Institute of Biomedical Engineering (China); Chiang, Chiao-Hsi [School of Pharmacy, National Defense Medical Center (China); Hong, Po-Da [National Taiwan University of Science and Technology (Taiwan Tech), Graduate Institute of Biomedical Engineering (China); Yu, Dah-Shyong [Nanomedicine Research Center, National Defense Medical Center (China); Domb, Abraham J. [The Hebrew University of Jerusalem, Institute of Drug Research, School of Pharmacy, Faculty of Medicine, Center for Nanoscience and Nanotechnology and The Alex Grass Center for Drug Design and Synthesis (Israel); Ou, Keng-Liang [College of Oral Medicine, Taipei Medical University, Research Center for Biomedical Devices and Prototyping Production (China)

    2013-07-15

    Rapid propagations in materials technology together with biology have initiated great hopes in the possibility of treating many diseases by gene therapy technology. Viral and non-viral gene carriers are currently applied for gene delivery. Non-viral technology is safe and effective for the delivery of genetic materials to cells and tissues. Non-viral systems are based on plasmid expression containing a gene encoding a therapeutic protein and synthetic biodegradable nanoparticles as a safe carrier of gene. Biodegradable nanoparticles have shown great interest in drug and gene delivery systems as they are easy to be synthesized and have no side effect in cells and tissues. This review provides a critical view of applications of biodegradable nanoparticles on gene therapy technology to enhance the localization of in vitro and in vivo and improve the function of administered genes.

  4. New Technology Makes Gene Mapping Cheaper, Faster

    Science.gov (United States)

    ... https://medlineplus.gov/news/fullstory_164255.html New Technology Makes Gene Mapping Cheaper, Faster: Study Researchers decoded ... they've developed a much cheaper and faster technology for mapping the genetic makeup of a living ...

  5. Genes Associated with Desiccation and Osmotic Stress in Listeria monocytogenes as Revealed by Insertional Mutagenesis

    Science.gov (United States)

    Hingston, Patricia A.; Piercey, Marta J.

    2015-01-01

    Listeria monocytogenes is a foodborne pathogen whose survival in food processing environments may be associated with its tolerance to desiccation. To probe the molecular mechanisms used by this bacterium to adapt to desiccation stress, a transposon library of 11,700 L. monocytogenes mutants was screened, using a microplate assay, for strains displaying increased or decreased desiccation survival (43% relative humidity, 15°C) in tryptic soy broth (TSB). The desiccation phenotypes of selected mutants were subsequently assessed on food-grade stainless steel (SS) coupons in TSB plus 1% glucose (TSB-glu). Single transposon insertions in mutants exhibiting a change in desiccation survival of >0.5 log CFU/cm2 relative to that of the wild type were determined by sequencing arbitrary PCR products. Strain morphology, motility, and osmotic stress survival (in TSB-glu plus 20% NaCl) were also analyzed. The initial screen selected 129 desiccation-sensitive (DS) and 61 desiccation-tolerant (DT) mutants, out of which secondary screening on SS confirmed 15 DT and 15 DS mutants. Among the DT mutants, seven immotile and flagellum-less strains contained transposons in genes involved in flagellum biosynthesis (fliP, flhB, flgD, flgL) and motor control (motB, fliM, fliY), while others harbored transposons in genes involved in membrane lipid biosynthesis, energy production, potassium uptake, and virulence. The genes that were interrupted in the 15 DS mutants included those involved in energy production, membrane transport, protein metabolism, lipid biosynthesis, oxidative damage control, and putative virulence. Five DT and 14 DS mutants also demonstrated similar significantly (P < 0.05) different survival relative to that of the wild type when exposed to osmotic stress, demonstrating that some genes likely have similar roles in allowing the organism to survive the two water stresses. PMID:26025900

  6. ACE Gene Insertion/Deletion Polymorphism and Type-2 Diabetic Nephropathy in Eastern Indian Population

    Directory of Open Access Journals (Sweden)

    Mithun Sikdar

    2013-02-01

    Full Text Available Background: Nephropathy is one of the major complications among the patients having type 1 or long term Type 2 diabetes and there are various studies that suggest its genetic predisposition. A 287 bp insertion/deletion (I/D polymorphism of the gene encoding angiotensin-I converting enzyme (ACE is shown to have association with diabetic nephropathy. Aim: To identify the association of ACE I/D polymorphism with subjects having diabetic nephropathy.Materials and methods: The present study examined the prevalence of ACE insertion/deletion polymorphism among 91 Bengali individuals from Eastern India. Among them 30 individuals belong to diabetic nephropathy (DN, 30 individuals having diabetes without nephropathy (DM and 31 normal controls. The DNA samples of studied subjects were genotyped using polymerase chain reaction.Results: The frequency of DD, ID and II genotypes in patients having diabetic nephropathy (DN were found to be 26.7%, 53.3% and 20.0% respectively, whereas the same for only diabetic patients (DM were 26.7%, 50.0%and 23.3% respectively. The frequencies of the same genotypes among the normal controls were found to be 9.68%, 64.5% and 25.8% respectively. Inspite of a slightly higher odds ratio for DD genotypes among DM and DN subjects in comparison to the normal group the distribution pattern of DD genotype did not differ significantly within the three cohorts. The frequency of D allele among the patients having diabetic nephropathy, diabetic without nephropathy and control subjects was found to be 0.533, 0.516 and 0.420 respectively. This distribution pattern also did not differ significantly (χ2=1.859, p>0.05.Conclusion: No significant association was found between ACE I/D polymorphism with diabetic nephropathy patients from Bengali caste population.

  7. Severe neonatal Marfan syndrome resulting from a de novo 3-bp insertion into the fibrillin gene on chromosome 15.

    Science.gov (United States)

    Milewicz, D. M.; Duvic, M.

    1994-01-01

    Severe neonatal Marfan syndrome has features of the Marfan syndrome and congenital contractural arachnodactyly present at birth, along with unique features such as loose, redundant skin and pulmonary emphysema. Since the Marfan syndrome and congenital contractural arachnodactyly are due to mutations in different genes, it has been uncertain whether neonatal Marfan syndrome is due to mutations in the fibrillin gene on chromosome 15 or in another gene. We studied an infant with severe neonatal Marfan syndrome. Dermal fibroblasts were metabolically labeled and found to secret fibrillin inefficiently when compared with control cells. Reverse transcription and amplification of the proband's fibroblast RNA was used to identify a 3-bp insertion between nucleotides 480-481 or 481-482 of the fibrillin cDNA. The insertion maintains the reading frame of the protein and inserts a cysteine between amino acids 160 and 161 in an epidermal growth-factor-like motif of fibrillin. This 3-bp insertion was not found in the fibrillin gene in 70 unrelated, unaffected individuals and 11 unrelated individuals with the Marfan syndrome. We conclude that neonatal Marfan syndrome is the result of mutations in the fibrillin gene on chromosome 15 and is part of the Marfan syndrome spectrum. Images Figure 1 Figure 2 Figure 3 PMID:8116614

  8. Severe neonatal marfan syndrome resulting from a De Novo 3-bp insertion into the fibrillin gene on chromosome 15

    Energy Technology Data Exchange (ETDEWEB)

    Milewicz, D.M.; Duvic, M. (Univ. of Texas Medical School, Houston, TX (United States))

    1994-03-01

    Severe neonatal Marfan syndrome has features of the Marfan syndrome and congenital contractural arachnodactyly present at birth, along with unique features such as loose, redundant skin and pulmonary emphysema. Since the Marfan syndrome and congenital contractural arachnodactyly are due to mutations in different genes, it has been uncertain whether neonatal Marfan syndrome is due to mutations in the fibrillin gene on chromosome 15 or in another gene. The authors studied an infant with severe neonatal Marfan syndrome. Dermal fibroblasts were metabolically labeled and found to secrete fibrillin inefficiently when compared with control cells. Reverse transcription and amplification of the proband's fibroblast RNA was used to identify a 3-bp insertion between nucleotides 480-481 or 481-482 of the fibrillin cDNA. The insertion maintains the reading frame of the protein and inserts a cysteine between amino acids 160 and 161 in an epidermal growth-factor-like motif of fibrillin. This 3-bp insertion was not found in the fibrillin gene in 70 unrelated, unaffected individuals and 11 unrelated individuals with the Maran syndrome. The authors conclude that neonatal Marfan syndrome is the result of mutations in the fibrillin gene on chromosome 15 and is part of the Marfan syndrome spectrum. 32 refs., 3 figs.

  9. Development of a rapid and efficient microinjection technique for gene insertion into fertilized salmonid eggs

    Energy Technology Data Exchange (ETDEWEB)

    Chandler, D.P.; Welt, M.; Leung, F.C.

    1990-10-01

    An efficient one-step injection technique for gene insertion into fertilized rainbow trout (Oncorhynchus mykiss) eggs is described, and basic parameters affecting egg survival are reported. Freshly fertilized rainbow trout eggs were injected in the perivitelline space with a recombinant mouse metallothionein-genomic bovine growth hormone (bGH) DNA construct using a 30-gauge hypodermic needle and a standard microinjection system. Relative to control, site of injection and DNA concentration did not affect the egg survival, but injections later than 3--4 hours post fertilization were detrimental. The injection technique permitted treatment of 100 eggs/hr with survivals up to 100%, resulting in a 4% DNA uptake rate as indicated by DNA dot blot analysis. Positive dot blot results also indicated that the injected DNA is able to cross the vitelline membrane and persist for 50--60 days post hatching, obviating the need for direct injection into the germinal disk. Results are consistent with previous transgenic fish work, underscoring the usefulness of the technique for generating transgenic trout and salmonids. 24 refs., 6 figs., 3 tabs.

  10. Systematic insertion mutagenesis of GntR family transcriptional regulator genes in Sinorhizobium meliloti

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    GntR-type transcriptional regulators regulate the most diverse biological processes in bacteria. Although GntR-type transcriptional regulators consist of the second largest family of transcriptional regulators in Sinorhizobium meliloti, little is known about their functions. In this study, we investigated 54 putative genes encoding GntR family of transcriptional regulators in S. meliloti Rm1021. Secondary structure analysis of the C-terminal domain of these putative transcriptional regulators indicated that thirty-seven were members of the FadR subfamily, ten of the HutC subfamily and five of the MocR subfamily. The remaining two did not fall into any specific subfamily category, and may form two new subfamilies. The 54 gntR genes were mutagenized by plasmid insertion mutagenesis to investigate their roles. We found that, of the 54 mutants, only the gtrA1 and gtrB1 mutants had slower growth rates and cell maximal yields on both rich medium and minimal medium, and lower cell motility on swarming plate than wild type Rm1021. All mutants, with the exception of gtrA1 and gtrB1, can establish effective symbioses with alfalfa. Plants inoculated with gtrA1 and gtrB1 mutants grew shorter than those inoculated with wild type, and formed relatively smaller, round and light pink nodules, which were mainly located on lateral roots. And there was an abnormal increase in the number of nodules induced by both mutants. These results suggested that the gtrA1 and gtrB1 mutants were symbiotically deficient. Our work presents a global overview of GntR-like transcriptional regulators involved in symbiosis in S.meliloti, and provides new insight into the functions of GntR-like transcriptional regulators.

  11. Inverse polymerase chain reaction for rapid gene isolation in Arabidopsis thaliana insertion mutants

    NARCIS (Netherlands)

    Vanderhaeghen, R.; Scheres, B.J.G.; Montagu, M. van; Lijsebetten, M. van

    1992-01-01

    Recently, many mutants have been isolated in the model plant Arabidopsis thaliana by the insertion of the Agrobacterium tumefaciens T-DNA into the plant genome. Instead of applying Southern analysis on these insertion mutants and to avoid the construction of mutant- derived genomic libraries, we pro

  12. Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes

    Directory of Open Access Journals (Sweden)

    Kubelka Claire F

    2007-10-01

    Full Text Available Abstract Background The yellow fever virus, a member of the genus Flavivirus, is an arthropod-borne pathogen causing severe disease in humans. The attenuated yellow fever 17D virus strain has been used for human vaccination for 70 years and has several characteristics that are desirable for the development of new, live attenuated vaccines. We described here a methodology to construct a viable, and immunogenic recombinant yellow fever 17D virus expressing a green fluorescent protein variant (EGFP. This approach took into account the presence of functional motifs and amino acid sequence conservation flanking the E and NS1 intergenic region to duplicate and fuse them to the exogenous gene and thereby allow the correct processing of the viral polyprotein precursor. Results YF 17D EGFP recombinant virus was grew in Vero cells and reached a peak titer of approximately 6.45 ± 0.4 log10 PFU/mL at 96 hours post-infection. Immunoprecipitation and confocal laser scanning microscopy demonstrated the expression of the EGFP, which was retained in the endoplasmic reticulum and not secreted from infected cells. The association with the ER compartment did not interfere with YF assembly, since the recombinant virus was fully competent to replicate and exit the cell. This virus was genetically stable up to the tenth serial passage in Vero cells. The recombinant virus was capable to elicit a neutralizing antibody response to YF and antibodies to EGFP as evidenced by an ELISA test. The applicability of this cloning strategy to clone gene foreign sequences in other flavivirus genomes was demonstrated by the construction of a chimeric recombinant YF 17D/DEN4 virus. Conclusion This system is likely to be useful for a broader live attenuated YF 17D virus-based vaccine development for human diseases. Moreover, insertion of foreign genes into the flavivirus genome may also allow in vivo studies on flavivirus cell and tissue tropism as well as cellular processes related

  13. Insertional mutagenesis and deep profiling reveals gene hierarchies and a Myc/p53-dependent bottleneck in lymphomagenesis.

    Directory of Open Access Journals (Sweden)

    Camille A Huser

    2014-02-01

    Full Text Available Retroviral insertional mutagenesis (RIM is a powerful tool for cancer genomics that was combined in this study with deep sequencing (RIM/DS to facilitate a comprehensive analysis of lymphoma progression. Transgenic mice expressing two potent collaborating oncogenes in the germ line (CD2-MYC, -Runx2 develop rapid onset tumours that can be accelerated and rendered polyclonal by neonatal Moloney murine leukaemia virus (MoMLV infection. RIM/DS analysis of 28 polyclonal lymphomas identified 771 common insertion sites (CISs defining a 'progression network' that encompassed a remarkably large fraction of known MoMLV target genes, with further strong indications of oncogenic selection above the background of MoMLV integration preference. Progression driven by RIM was characterised as a Darwinian process of clonal competition engaging proliferation control networks downstream of cytokine and T-cell receptor signalling. Enhancer mode activation accounted for the most efficiently selected CIS target genes, including Ccr7 as the most prominent of a set of chemokine receptors driving paracrine growth stimulation and lymphoma dissemination. Another large target gene subset including candidate tumour suppressors was disrupted by intragenic insertions. A second RIM/DS screen comparing lymphomas of wild-type and parental transgenics showed that CD2-MYC tumours are virtually dependent on activation of Runx family genes in strong preference to other potent Myc collaborating genes (Gfi1, Notch1. Ikzf1 was identified as a novel collaborating gene for Runx2 and illustrated the interface between integration preference and oncogenic selection. Lymphoma target genes for MoMLV can be classified into (a a small set of master regulators that confer self-renewal; overcoming p53 and other failsafe pathways and (b a large group of progression genes that control autonomous proliferation in transformed cells. These findings provide insights into retroviral biology, human cancer

  14. Novel insertion in exon 5 of the TCOF1 gene in twin sisters with Treacher Collins syndrome.

    Science.gov (United States)

    Marszałek-Kruk, Bożena Anna; Wójcicki, Piotr; Smigiel, Robert; Trzeciak, Wiesław H

    2012-08-01

    Treacher Collins syndrome (TCS) is associated with an abnormal differentiation of the first and second pharyngeal arches during fetal development. This causes mostly craniofacial deformities, which require numerous corrective surgeries. TCS is an autosomal dominant disorder and it occurs in the general population at a frequency of 1 in 50,000 live births. The syndrome is caused by mutations in the TCOF1 gene, which encodes the serine/alanine-rich protein named Treacle. Over 120 mutations of the TCOF1 gene responsible for TCS have been described. About 70% of recognized mutations are deletions, which lead to a frame shift, formation of a termination codon, and shortening of the protein product of the gene. Herewith, a new heterozygotic insertion, c.484_668ins185bp, was described in two monozygotic twin sisters suffering from TCS. This mutation was absent in their father, brother, and uncle, indicating a de novo origin. The insertion causes a shift in the reading frame and premature termination of translation at 167 aa. The novel insertion is the longest ever found in the TCOF1 gene and the only one found among monozygotic twin sisters.

  15. Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

    Directory of Open Access Journals (Sweden)

    Coelho Adriano C.

    2004-01-01

    Full Text Available Pentamidine (PEN is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

  16. Sherlock 3CG(®) Tip Confirmation System for Placement of Peripherally Inserted Central Catheters: A NICE Medical Technology Guidance.

    Science.gov (United States)

    Dale, Megan; Higgins, Ailish; Carolan-Rees, Grace

    2016-02-01

    In current clinical practice, peripherally inserted central catheters (PICCs) are typically inserted using external anatomical measurements and a confirmatory chest X-ray, or using fluoroscopy. The Sherlock 3CG(®) Tip Confirmation System (TCS) allows magnetic tracking of the PICC tip during insertion and confirmation of the final location using ECG, meaning that most patients will not require a chest X-ray or fluoroscopy. The Sherlock 3CG(®) TCS was evaluated in 2014 by the UK National Institute for Health and Care Excellence (NICE) as part of the Medical Technologies Evaluation Programme. The company (C.R. Bard Ltd) identified four abstracts, one paper pending publication and questionnaire data from NHS users of the Sherlock 3CG(®) TCS. None of the evidence included a comparator arm. Placement accuracy of PICCs using the Sherlock 3CG(®) TCS where a chest X-ray was also used ranged from 79.5 to 100 %. The company reported that 9 out of 16 NHS centres that used the Sherlock 3CG(®) TCS were no longer using chest X-rays to routinely confirm PICC tip location. The evidence did not report the need for catheter repositioning, re-insertion, staff time savings, treatment delays, length of stay, quality of life outcomes or complications. The company's model found that the Sherlock 3CG(®) TCS was cost saving by GBP25.67 per patient compared to blind bedside PICC insertion. The External Assessment Centre (EAC) adapted the company's model to test alternative assumptions for nurse time, theatre cost, malposition rate and reinsertion method, and found that the Sherlock 3CG(®) TCS was cost incurring by GBP9.37 per patient compared to blind bedside PICC insertion. The use of the Sherlock 3CG(®) TCS in the UK NHS compared to blind PICC insertion using a confirmatory chest X-ray appears to hover around being cost neutral. Staff time and accuracy were key drivers in the model: evidence for these is sparse and the reality will vary in different situations. If evidence became

  17. The zinc finger SET domain gene Prdm14 is overexpressed in lymphoblastic lymphomas with retroviral insertions at Evi32.

    Directory of Open Access Journals (Sweden)

    E J Dettman

    Full Text Available BACKGROUND: AKXD recombinant inbred strains of mice have proven to be very useful in the identification of potential oncogenes and tumor suppressors involved in the development of lymphoid and myeloid malignancies. In these tumors, the hematopoietic insertion of an active AKV murine leukemia virus (MuLV is associated with the onset of disease. Common sites of retroviral insertion (CIS identify genes causally associated with the development or initiation of lymphoma. METHODOLOGY: In the present study, we analyzed a previously uncharacterized CIS, Ecotropic Viral Integration Site 32 (Evi32, which is located on mouse chromosome 1. We analyzed candidate genes in the region to identify those involved in Evi32 mediated oncogenesis. RESULTS: Here we show that proviral insertion at Evi32 correlates with significant overexpression of a putative transcription factor, PR-domain containing 14 (Prdm14. Tumors with insertions at Evi32 are consistently lymphoid in nature. Prdm14 is normally expressed early in embryonic development with the highest expression in undifferentiated embryonic stem (ES cells. This study implicates Prdm14 as a proto-oncogene involved in lymphoblastic lymphoma formation.

  18. Advances in gene technology: Human genetic disorders

    Energy Technology Data Exchange (ETDEWEB)

    Scott, W.A.; Ahmad, F.; Black, S.; Schultz, J.; Whelan, W.J.

    1984-01-01

    This book discusses the papers presented at the conference on the subject of ''advances in Gene technology: Human genetic disorders''. Molecular biology of various carcinomas and inheritance of metabolic diseases is discussed and technology advancement in diagnosis of hereditary diseases is described. Some of the titles discussed are-Immunoglobulin genes translocation and diagnosis; hemophilia; oncogenes; oncogenic transformations; experimental data on mice, hamsters, birds carcinomas and sarcomas.

  19. Gene targeting in the red alga Cyanidioschyzon merolae: single- and multi-copy insertion using authentic and chimeric selection markers.

    Science.gov (United States)

    Fujiwara, Takayuki; Ohnuma, Mio; Yoshida, Masaki; Kuroiwa, Tsuneyoshi; Hirano, Tatsuya

    2013-01-01

    The unicellular red alga Cyanidioschyzon merolae is an emerging model organism for studying organelle division and inheritance: the cell is composed of an extremely simple set of organelles (one nucleus, one mitochondrion and one chloroplast), and their genomes are completely sequenced. Although a fruitful set of cytological and biochemical methods have now been developed, gene targeting techniques remain to be fully established in this organism. Thus far, only a single selection marker, URA Cm-Gs , has been available that complements the uracil-auxotrophic mutant M4. URA Cm-Gs , a chimeric URA5.3 gene of C. merolae and the related alga Galdieria sulphuraria, was originally designed to avoid gene conversion of the mutated URA5.3 allele in the parental strain M4. Although an early example of targeted gene disruption by homologous recombination was reported using this marker, the genome structure of the resultant transformants had never been fully characterized. In the current study, we showed that the use of the chimeric URA Cm-Gs selection marker caused multicopy insertion at high frequencies, accompanied by undesired recombination events at the targeted loci. The copy number of the inserted fragments was variable among the transformants, resulting in high yet uneven levels of transgene expression. In striking contrast, when the authentic URA5.3 gene (URA Cm-Cm ) was used as a selection marker, efficient single-copy insertion was observed at the targeted locus. Thus, we have successfully established a highly reliable and reproducible method for gene targeting in C. merolae. Our method will be applicable to a number of genetic manipulations in this organism, including targeted gene disruption, replacement and tagging.

  20. Association of the Alu insertion polymorphism in the progesterone receptor gene with breast cancer in a Mexican population

    Science.gov (United States)

    Figuera, Luis E.; Flores-Ramos, Liliana Gómez; Puebla-Pérez, Ana María; Zúñiga-González, Guillermo Moisés

    2015-01-01

    Introduction The progesterone receptor (PR) gene plays an important role in reproduction-related events. Data on polymorphisms in the PR gene have revealed associations with cancer, particularly for the Alu insertion polymorphism, which has been suggested to affect progesterone receptor function and contribute to tumor promotion in the mammary gland. Material and methods We examined the role of the Alu insertion polymorphism in the PR gene by comparing the genotypes of 209 healthy Mexican women with those of 481 Mexican women with breast cancer (BC). Results The genotype frequencies observed in the controls and BC patients were 0% and 4% for T2/T2 (Alu insertion), 16% and 21% for T1/T2, and 84% and 75% for T1/T1 (Alu deletion), respectively. The obtained odds ratio (OR) was 1.7, with a 95% confidence interval (95% CI) of 1.1–2.6, p = 0.009, for the T1/T2–T2/T2 genotypes. The association was also evident when the distributions of the T1/T2–T2/T2 genotypes in patients in the following categories were compared: obesity grade II (OR = 1.81, 95% CI: 1.03–3.18, p = 0.039) and the chemotherapy response (OR = 1.91, 95% CI: 1.27–3.067, p = 0.002). Conclusions The T1/T2–T2/T2 genotypes of the Alu insertion polymorphism in the PR gene are associated with BC susceptibility in the analyzed Mexican population. PMID:26170848

  1. Gene specificity of suppression of transgene-mediated insertional transcriptional activation by the chicken HS4 insulator.

    Directory of Open Access Journals (Sweden)

    Romain Desprat

    Full Text Available Insertional mutagenesis has emerged as a major obstacle for gene therapy based on vectors that integrate randomly in the genome. Reducing the genotoxicity of genomic viral integration can, in first approximation, be equated with reducing the risk of oncogene activation, at least in the case of therapeutic payloads that have no known oncogenic potential, such as the globin genes. An attractive solution to the problem of oncogene activation is the inclusion of insulators/enhancer-blockers in the viral vectors. In this study we have used Recombinase-Mediated Cassette Exchange to characterize the effect of integration of globin therapeutic cassettes in the presence or absence of the chicken HS4 and three other putative insulators inserted near Stil, Tal1 and MAP17, three well-known cellular proto-oncogenes in the SCL/Tal1 locus. We show that insertion of a Locus Control Region-driven globin therapeutic globin transgene had a dramatic activating effect on Tal1 and Map17, the two closest genes, a minor effect on Stil, and no effect on Cyp4x1, a non-expressed gene. Of the four element tested, cHS4 was the only one that was able to suppress this transgene-mediated insertional transcriptional activation. cHS4 had a strong suppressive effect on the activation expression of Map17 but has little or no effect on expression of Tal1. The suppressive activity of cHS4 is therefore promoter specific. Importantly, the observed suppressive effect of cHS4 on Map17 activation did not depend on its intercalation between the LCR and the Map 17 promoter. Rather, presence of one or two copies of cHS4 anywhere within the transgene was sufficient to almost completely block the activation of Map17. Therefore, at this complex locus, suppression of transgene-mediated insertional transcriptional activation by cHS4 could not be adequately explained by models that predict that cHS4 can only suppress expression through an enhancer-blocking activity that requires intercalation

  2. Angiotensin Converting Enzyme Gene Insertion/Deletion Polymorphism and Vesicoureteral Reflux in Children

    Science.gov (United States)

    Ai, Jin-Wei; Liu, Yu; Zeng, Xian-Tao; Lei, Qing; Zou, Li; Pei, Bin

    2015-01-01

    Abstract Vesicoureteral reflux (VUR) is a common and serious urinary disease in children. It usually causes renal scar, urinary tract infection, and chronic renal failure. Previous studies showed the angiotensin converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism might be associated with VUR; however, the conclusions were inconsistent. Therefore we used the meta-analytic approach to clarify the effect of ACE I/D polymorphism on VUR risk. We systematically searched the PubMed, CNKI, and EMBASE databases to identify all the potentially related studies published up to February 4, 2015. Two reviewers independently selected studies and extracted data. The strength of the association was assessed using odd ratio (OR) with its 95% confidence interval (CI) based on fixed or random effects model. The STATA 12.0 software was used for data analysis. A total of 14 case–control studies involving 1197 VUR patients and 1320 healthy controls met the eligibility criteria. Results of meta-analysis showed significant association between ACE I/D polymorphism and VUR risk (D vs. I: OR = 1.28, 95% CI = 1.06–1.54, P = 0.01; DD vs. II: OR = 1.44, 95% CI = 1.12–1.85, P = 0.01; DD vs. DI + II: OR = 1.49, 95% CI = 1.23–1.79, P < 0.01; DD + DI vs. II: OR = 1.20, 95% CI = 0.84–1.72, P = 0.31). Subgroup analyses revealed varied results. In Turkish people, results of all the genetic models other than DI vs. II showed statistical significance; in Caucasians, DD vs. DI + II showed statistical significance; and in Asians, DI versus II showed statistical significance. Our meta-analysis indicated that the ACE I/D polymorphism might be associated with increased risk of VUR in children. However, due to the limitations, we suggest conducting additional studies with larger sample size and adjustment for various risk factors, in the future for further clarification. PMID:26717402

  3. Lesch-Nyhan Syndrome in a Family with a Deletion Followed by an Insertion within the HPRT1 Gene.

    Science.gov (United States)

    Nguyen, Khue Vu; Nyhan, William L

    2015-01-01

    Lesch-Nyhan syndrome (LNS) is a rare X-linked inherited neurogenetic disorder of purine metabolism in which the enzyme, hypoxanthine-guanine phosphoribosyltransferase(HGprt) is defective. The authors report a novel mutation which led to LNS in a family with a deletion followed by an insertion (INDELS) via the serial replication slippage mechanism: c.428_432delTGCAGinsAGCAAA, p.Met143Lysfs*12 in exon 6 of HPRT1 gene. Molecular diagnosis discloses the genetic heterogeneity of HPRT1 gene responsible for HGprt deficiency. It allows fast, accurate carrier detection and genetic counseling.

  4. Insertion near the mitochondrial tyrosine tRNA gene in patients with mitochondrial diseases

    Energy Technology Data Exchange (ETDEWEB)

    Goto, Y.; Nonaka, I. [National Institute of Neuroscience, Tokyo (Japan); Horai, S. [National Institute of Genetics, Mishima (Japan)

    1994-09-01

    The 3243 mutation commonly found in patients with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) has been occasionally detected in patients with chronic progressive external opthalmoplegia (CPEO). To elucidate the molecular mechanism underlying this phenomenon, an extensive mitochondrial (mt) DNA study was performed on such a patient (3243-CPEO). The newly discovered insertion was located in the noncoding region between cytrochrome c oxidase subunit 1 and tyrosine tRNA. The insertion was not found in 58 or 22 CPEO patients with or without mtDNA large-scale deletion but in another 3243-CPEO patient. In addition, the insertion was present in 1 of 116 normal Japanese, who had no 3243 mutation, and in 3 of 68 3243-MELAS patients. These results raise the possibility that the phenotypic expression of the 3243 mutation could be modulated or arranged by additional mtDNA mutations.

  5. Genomic flank-sequencing of plasposon insertion sites for rapid identification of functional genes

    NARCIS (Netherlands)

    Leveau, J.H.J.; Gerards, S.; Fritsche, K.; Zondag, G.; Van Veen, J.A.

    2006-01-01

    Plasposons are modified mini-Tn5 transposons for random mutagenesis of Gram-negative bacteria. Their unique design allows for the rescue cloning and sequencing of DNA that flanks insertion sites in plasposon mutants. However, this process can be laborious and time-consuming, as it involves genomic D

  6. Transposable element insertion location bias and the dynamics of gene drive in mosquito populations.

    Science.gov (United States)

    Rasgon, J L; Gould, F

    2005-10-01

    Some vector-borne disease control strategies using transgenic mosquitoes require transgene spread to high frequency in populations. Transposable elements (TEs) are DNA sequences that replicate and transpose within the genomes of other organisms and may therefore be represented in the next generation in higher frequencies than predicted by Mendelian segregation. This over-representation has allowed some TEs to spread through natural populations. Transgenes incorporated within a TE sequence are expected to be driven into populations as long as there is a positive balance between fitness costs and over-representation. Models have been used to examine parameters that affect this balance but did not take into account biased insertion of TEs to linked sites in the genome. A simulation model was created to examine the impact of insertion bias on TE spread in mosquito populations. TEs that induce no fitness costs are predicted to increase in frequency over a wide range of parameter values but spread is slower for lower levels of transposition and non-local movement. If TEs are costly, high proportions of local movement can slow or halt spread. To function as a robust transgene drive mechanism a TE should replicate and transpose > 10%/insert/generation, induce < 1% fitness cost/insert, and move preferentially to unlinked sites in the genome.

  7. Variations in angiotensin-converting enzyme gene insertion/deletion polymorphism in Indian populations of different ethnic origins

    Indian Academy of Sciences (India)

    M A Qadar Pasha; Amjad P Khan; Ratan Kumar; Rekh B Ram; Surinder K Grover; Kaushal K Srivastava; William Selvamurthy; Samir K Brahmachari

    2002-02-01

    The pattern of angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism in the Indian population is poorly known. In order to determine the status of the polymorphism, young unrelated male army recruits were screened. The population had cultural and linguistic differences and lived in an environment that varied significantly from one region to another. Analysis of the genotype, showed higher frequency of the insertion allele in four of the five groups i.e. I allele frequency was significantly higher ( < 0.05) in Dogras, Assamese and Kumaonese. The deletion allele frequency was comparatively higher in the fifth group that belonged to Punjab. A correlation was observed between the genotype and enzyme activity. Involvement of a single D allele in the genotype enhanced the activity up to 37.56 ± 3.13%. The results suggested ethnic heterogeneity with a significant gene cline with higher insertion allele frequency. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics.

  8. Systems Biology-Based Investigation of Cellular Antiviral Drug Targets Identified by Gene-Trap Insertional Mutagenesis.

    Science.gov (United States)

    Cheng, Feixiong; Murray, James L; Zhao, Junfei; Sheng, Jinsong; Zhao, Zhongming; Rubin, Donald H

    2016-09-01

    Viruses require host cellular factors for successful replication. A comprehensive systems-level investigation of the virus-host interactome is critical for understanding the roles of host factors with the end goal of discovering new druggable antiviral targets. Gene-trap insertional mutagenesis is a high-throughput forward genetics approach to randomly disrupt (trap) host genes and discover host genes that are essential for viral replication, but not for host cell survival. In this study, we used libraries of randomly mutagenized cells to discover cellular genes that are essential for the replication of 10 distinct cytotoxic mammalian viruses, 1 gram-negative bacterium, and 5 toxins. We herein reported 712 candidate cellular genes, characterizing distinct topological network and evolutionary signatures, and occupying central hubs in the human interactome. Cell cycle phase-specific network analysis showed that host cell cycle programs played critical roles during viral replication (e.g. MYC and TAF4 regulating G0/1 phase). Moreover, the viral perturbation of host cellular networks reflected disease etiology in that host genes (e.g. CTCF, RHOA, and CDKN1B) identified were frequently essential and significantly associated with Mendelian and orphan diseases, or somatic mutations in cancer. Computational drug repositioning framework via incorporating drug-gene signatures from the Connectivity Map into the virus-host interactome identified 110 putative druggable antiviral targets and prioritized several existing drugs (e.g. ajmaline) that may be potential for antiviral indication (e.g. anti-Ebola). In summary, this work provides a powerful methodology with a tight integration of gene-trap insertional mutagenesis testing and systems biology to identify new antiviral targets and drugs for the development of broadly acting and targeted clinical antiviral therapeutics.

  9. Systems Biology-Based Investigation of Cellular Antiviral Drug Targets Identified by Gene-Trap Insertional Mutagenesis.

    Directory of Open Access Journals (Sweden)

    Feixiong Cheng

    2016-09-01

    Full Text Available Viruses require host cellular factors for successful replication. A comprehensive systems-level investigation of the virus-host interactome is critical for understanding the roles of host factors with the end goal of discovering new druggable antiviral targets. Gene-trap insertional mutagenesis is a high-throughput forward genetics approach to randomly disrupt (trap host genes and discover host genes that are essential for viral replication, but not for host cell survival. In this study, we used libraries of randomly mutagenized cells to discover cellular genes that are essential for the replication of 10 distinct cytotoxic mammalian viruses, 1 gram-negative bacterium, and 5 toxins. We herein reported 712 candidate cellular genes, characterizing distinct topological network and evolutionary signatures, and occupying central hubs in the human interactome. Cell cycle phase-specific network analysis showed that host cell cycle programs played critical roles during viral replication (e.g. MYC and TAF4 regulating G0/1 phase. Moreover, the viral perturbation of host cellular networks reflected disease etiology in that host genes (e.g. CTCF, RHOA, and CDKN1B identified were frequently essential and significantly associated with Mendelian and orphan diseases, or somatic mutations in cancer. Computational drug repositioning framework via incorporating drug-gene signatures from the Connectivity Map into the virus-host interactome identified 110 putative druggable antiviral targets and prioritized several existing drugs (e.g. ajmaline that may be potential for antiviral indication (e.g. anti-Ebola. In summary, this work provides a powerful methodology with a tight integration of gene-trap insertional mutagenesis testing and systems biology to identify new antiviral targets and drugs for the development of broadly acting and targeted clinical antiviral therapeutics.

  10. Systems Biology-Based Investigation of Cellular Antiviral Drug Targets Identified by Gene-Trap Insertional Mutagenesis

    Science.gov (United States)

    Zhao, Junfei; Sheng, Jinsong; Rubin, Donald H.

    2016-01-01

    Viruses require host cellular factors for successful replication. A comprehensive systems-level investigation of the virus-host interactome is critical for understanding the roles of host factors with the end goal of discovering new druggable antiviral targets. Gene-trap insertional mutagenesis is a high-throughput forward genetics approach to randomly disrupt (trap) host genes and discover host genes that are essential for viral replication, but not for host cell survival. In this study, we used libraries of randomly mutagenized cells to discover cellular genes that are essential for the replication of 10 distinct cytotoxic mammalian viruses, 1 gram-negative bacterium, and 5 toxins. We herein reported 712 candidate cellular genes, characterizing distinct topological network and evolutionary signatures, and occupying central hubs in the human interactome. Cell cycle phase-specific network analysis showed that host cell cycle programs played critical roles during viral replication (e.g. MYC and TAF4 regulating G0/1 phase). Moreover, the viral perturbation of host cellular networks reflected disease etiology in that host genes (e.g. CTCF, RHOA, and CDKN1B) identified were frequently essential and significantly associated with Mendelian and orphan diseases, or somatic mutations in cancer. Computational drug repositioning framework via incorporating drug-gene signatures from the Connectivity Map into the virus-host interactome identified 110 putative druggable antiviral targets and prioritized several existing drugs (e.g. ajmaline) that may be potential for antiviral indication (e.g. anti-Ebola). In summary, this work provides a powerful methodology with a tight integration of gene-trap insertional mutagenesis testing and systems biology to identify new antiviral targets and drugs for the development of broadly acting and targeted clinical antiviral therapeutics. PMID:27632082

  11. Aspects of the insertion of Igreja Universal do Reino de Deus into televised media: technologies of discourse serving hegemonic practice

    Directory of Open Access Journals (Sweden)

    Cláudio Márcio do Carmo

    2010-05-01

    Full Text Available This article analyses some aspects of the insertion of Igreja Universal do Reino de Deus (The Universal Church of the Kingdom of God into the media. It started with the television program Pare de Sofrer, broadcast daily by Rede Record.My presupposition is that this new preaching space helps to marketize the discourse due to its intersemiotic aspect. The interface between some conceptions of critical discourse analysis and marketing theories may explain some aspects of discourse technologies used to intensify institutional ideologies and guarantee a consistent argumentation capable of helping unleash a persuasive and hegemonic process for the religious institution.

  12. A large insertion in intron 2 of the TYRP1 gene associated with American Palomino phenotype in American mink

    DEFF Research Database (Denmark)

    Cirera Salicio, Susanna; Markakis, Marios Nektarios; Kristiansen, Thea

    2016-01-01

    for amplifying the genomic DNA and cDNA at the beginning of intron 2 of AP TYRP1 revealed the presence of a large insertion of approximately eight kb. The insertion most likely disrupts different elements necessary for the splicing of intron 2 of the TYRP1 gene. In AP RNAseq data indicate, however, the presence...

  13. Deletion and deletion/insertion mutations in the juxtamembrane domain of the FLT3 gene in adult acute myeloid leukemia

    Directory of Open Access Journals (Sweden)

    Kristin K. Deeb

    2014-01-01

    Full Text Available In contrast to FLT3 ITD mutations, in-frame deletions in the FLT3 gene have rarely been described in adult acute leukemia. We report two cases of AML with uncommon in-frame mutations in the juxtamembrane domain of the FLT3 gene: a 3-bp (c.1770_1774delCTACGinsGT; p.F590_V592delinsLF deletion/insertion and a 12-bp (c.1780_1791delTTCAGAGAATAT; p.F594_Y597del deletion. We verified by sequencing that the reading frame of the FLT3 gene was preserved and by cDNA analysis that the mRNA of the mutant allele was expressed in both cases. Given the recent development of FLT3 inhibitors, our findings may be of therapeutic value for AML patients harboring similar FLT3 mutations.

  14. Differentially Expressed Genes Distributed Over Chromosomes and Implicated in Certain Biological Processes for Site Insertion Genetically Modified Rice Kemingdao

    Directory of Open Access Journals (Sweden)

    Zhi Liu, Yunhe Li, Jie Zhao, Xiuping Chen, Guiliang Jian, Yufa Peng, Fangjun Qi

    2012-01-01

    Full Text Available Release of genetically modified (GM plants has sparked off intensive debates worldwide partly because of concerns about potential adverse unintended effects of GM plants to the agro system and the safety of foods. In this study, with the aim of revealing the molecular basis for unintended effects of a single site insertion GM Kemingdao (KMD rice transformed with a synthetic cry1Ab gene, and bridging unintended effects of KMD rice through clues of differentially expressed genes, comparative transcriptome analyses were performed for GM KMD rice and its parent rice of Xiushui11 (XS11. The results showed that 680 differentially expressed transcripts were identified from 30-day old seedlings of GM KMD rice. The absolute majority of these changed expression transcripts dispersed and located over all rice chromosomes, and existed physical distance on chromosome from the insertion site, while only two transcripts were found to be differentially expressed within the 21 genes located within 100 kb up and down-stream of the insertion site. Pathway and biology function analyses further revealed that differentially expressed transcripts of KMD rice were involved in certain biological processes, and mainly implicated in two types of pathways. One type was pathways implicated in plant stress/defense responses, which were considerably in coordination with the reported unintended effects of KMD rice, which were more susceptible to rice diseases compared to its parent rice XS11; the other type was pathways associated with amino acids metabolism. With this clue, new unintended effects for changes in amino acids synthesis of KMD rice leaves were successfully revealed. Such that an actual case was firstly provided for identification of unintended effects in GM plants by comparative transciptome analysis.

  15. Subcloning plus insertion (SPI)--a novel recombineering method for the rapid construction of gene targeting vectors.

    Science.gov (United States)

    Reddy, Thimma R; Kelsall, Emma J; Fevat, Léna M S; Munson, Sarah E; Cowley, Shaun M

    2015-01-08

    Gene targeting refers to the precise modification of a genetic locus using homologous recombination. The generation of novel cell lines and transgenic mouse models using this method necessitates the construction of a 'targeting' vector, which contains homologous DNA sequences to the target gene, and has for many years been a limiting step in the process. Vector construction can be performed in vivo in Escherichia coli cells using homologous recombination mediated by phage recombinases using a technique termed recombineering. Recombineering is the preferred technique to subclone the long homology sequences (>4 kb) and various targeting elements including selection markers that are required to mediate efficient allelic exchange between a targeting vector and its cognate genomic locus. Typical recombineering protocols follow an iterative scheme of step-wise integration of the targeting elements and require intermediate purification and transformation steps. Here, we present a novel recombineering methodology of vector assembly using a multiplex approach. Plasmid gap repair is performed by the simultaneous capture of genomic sequence from mouse Bacterial Artificial Chromosome libraries and the insertion of dual bacterial and mammalian selection markers. This subcloning plus insertion method is highly efficient and yields a majority of correct recombinants. We present data for the construction of different types of conditional gene knockout, or knock-in, vectors and BAC reporter vectors that have been constructed using this method. SPI vector construction greatly extends the repertoire of the recombineering toolbox and provides a simple, rapid and cost-effective method of constructing these highly complex vectors.

  16. Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients.

    Science.gov (United States)

    Howe, Steven J; Mansour, Marc R; Schwarzwaelder, Kerstin; Bartholomae, Cynthia; Hubank, Michael; Kempski, Helena; Brugman, Martijn H; Pike-Overzet, Karin; Chatters, Stephen J; de Ridder, Dick; Gilmour, Kimberly C; Adams, Stuart; Thornhill, Susannah I; Parsley, Kathryn L; Staal, Frank J T; Gale, Rosemary E; Linch, David C; Bayford, Jinhua; Brown, Lucie; Quaye, Michelle; Kinnon, Christine; Ancliff, Philip; Webb, David K; Schmidt, Manfred; von Kalle, Christof; Gaspar, H Bobby; Thrasher, Adrian J

    2008-09-01

    X-linked SCID (SCID-X1) is amenable to correction by gene therapy using conventional gammaretroviral vectors. Here, we describe the occurrence of clonal T cell acute lymphoblastic leukemia (T-ALL) promoted by insertional mutagenesis in a completed gene therapy trial of 10 SCID-X1 patients. Integration of the vector in an antisense orientation 35 kb upstream of the protooncogene LIM domain only 2 (LMO2) caused overexpression of LMO2 in the leukemic clone. However, leukemogenesis was likely precipitated by the acquisition of other genetic abnormalities unrelated to vector insertion, including a gain-of-function mutation in NOTCH1, deletion of the tumor suppressor gene locus cyclin-dependent kinase 2A (CDKN2A), and translocation of the TCR-beta region to the STIL-TAL1 locus. These findings highlight a general toxicity of endogenous gammaretroviral enhancer elements and also identify a combinatorial process during leukemic evolution that will be important for risk stratification and for future protocol design.

  17. Original tandem duplication in FXIIIA gene with splicing site modification and four amino acids insertion causes factor XIII deficiency.

    Science.gov (United States)

    Louhichi, Nacim; Haj Salem, Ikhlass; Medhaffar, Moez; Miled, Nabil; Hadji, Ahmad F; Keskes, Leila; Fakhfakh, Faiza

    2017-04-01

    : Recessive mutations of F13A gene are reported to be responsible of FXIIIA subunit deficiency (FXIIIA). In all, some intronic nucleotide changes identified in this gene were investigated by in-silico analysis and occasionally supported by experimental data or reported in some cases as a polymorphism. To determine the molecular defects responsible of congenital factor XIII deficiency in Libyan patient, molecular analysis was performed by direct DNA sequencing of the coding regions and splice junctions of the FXIIIA subunit gene (F13A). A splicing minigene assay was used to study the effect of this mutation. Bioinformatics exploration was fulfilled to conceive consequences on protein. A 12-bp duplication straddling the border of intron 9 and exon 10 leads to two 3' acceptor splice sites, resulting in silencing of the downstream wild 3' splice site. It caused an in-frame insertion of 12 nucleotides into mRNA and four amino acids into protein. Bioinformatic analysis predicts that the insertion of four amino acids affects the site 3 of calcium binding site, which disturbs the smooth function of the FXIIIA peptide causing the factor XIII deficiency. This study showed that a small duplication seems to weaken the original 3' splice site and enhance the activation of a new splice site responsible for an alternative splicing. It would be interesting to examine the underlying molecular mechanism involved in this rearrangement.

  18. Adapting Strategic Aircraft Assets to a Changing World: Technology Insertion to Provide Flexibility

    Science.gov (United States)

    1994-09-01

    PROCESSOR L ALTm AMSS-- A MtAAn S Sute m DEU DATAI A RT HF-- Hgh Frquen- AIRCRAFT nrNTERC SUBSYST MSM St Legend: ALT- Altimeter AMSS- Altitude Motion Sensor...these are superior computer systems. To put this information in perspective, note that most 1992 consumers would not want to buy 1982 computer (8088...technology; instead, they would want to buy the latest technology, such as a 486. If they owned the older 8088, they would remember that it

  19. Newer Gene Editing Technologies toward HIV Gene Therapy

    Directory of Open Access Journals (Sweden)

    Premlata Shankar

    2013-11-01

    Full Text Available Despite the great success of highly active antiretroviral therapy (HAART in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy.

  20. Newer gene editing technologies toward HIV gene therapy.

    Science.gov (United States)

    Manjunath, N; Yi, Guohua; Dang, Ying; Shankar, Premlata

    2013-11-14

    Despite the great success of highly active antiretroviral therapy (HAART) in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called "Berlin patient" who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy.

  1. Hybrid tooling technologies and standardization for the manufacturing of inserts for micro injection molding

    DEFF Research Database (Denmark)

    Tosello, Guido; Fillon, Bertrand; Azcarate, Sabino

    2007-01-01

    . A metrological approach was applied to standardize the employed tooling processes (micro milling, µEDM, laser micromachining, electrochemical µ-milling). The micro tools were then tested with different polymers (PP, PP + nano fillers, PC, COC). The paper provides a comparison of these technologies concerning...

  2. Hybrid tooling technologies and standardization for the manufacturing of inserts for micro injection molding

    DEFF Research Database (Denmark)

    Tosello, Guido; Fillon, Bertrand; Azcarate, Sabino;

    2007-01-01

    . A metrological approach was applied to standardize the employed tooling processes (micro milling, µEDM, laser micromachining, electrochemical µ-milling). The micro tools were then tested with different polymers (PP, PP + nano fillers, PC, COC). The paper provides a comparison of these technologies concerning...

  3. The PML gene is linked to a megabase-scale insertion/deletion restriction fragment length polymorphism

    Energy Technology Data Exchange (ETDEWEB)

    Goy, A.; Xiao, Y.H.; Passalaris, T. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [and others

    1995-03-20

    The PML gene located on chromosome band 15q22 is involved with the RAR{alpha} locus (17q21) in a balanced reciprocal translocation uniquely observed in acute promyelocytic leukemia. Physical mapping studies by pulsed-field gel electrophoresis revealed that the PML gene is flanked by two CpG islands that are separated by a variable distance in normal individuals. Several lines of evidence demonstrate that this is the consequence of a large insertion/deletion polymorphism linked to the PML locus: (1) overlapping fragments obtained with a variety of rare-cutting restriction enzymes demonstrated the same variability in distance between the flanking CpG islands; (2) mapping with restriction enzymes insensitive to CpG methylation confirmed that the findings were not a consequence of variable methylation of CpG dinucleotides; (3) the polymorphism followed a Mendelian inheritance pattern. This polymorphism is localized 3{prime} to the PML locus. There are five common alleles, described on the basis of BssHII fragments, ranging from 220 to 350 kb with increments of approximately 30 kb between alleles. Both heterozygous (61%) and homozygous (391%) patterns were observed in normal individuals. Mega-base-scale insertion/deletion restriction fragment length polymorphisms are very rare and have been described initially in the context of multigene families. Such structures have been also reported as likely regions of genetic instability. High-resolution restriction mapping of this particular structure linked to the PML locus is underway. 47 refs., 4 figs., 1 tab.

  4. New insights and unresolved issues regarding insertional mutagenesis in X-linked SCID gene therapy.

    Science.gov (United States)

    Pike-Overzet, Karin; van der Burg, Mirjam; Wagemaker, Gerard; van Dongen, Jacques J M; Staal, Frank J T

    2007-11-01

    The oncogenic potential of retrovirus-mediated gene therapy has been re-emphasized because four patients developed T-cell acute lymphoblastic leukemia (T-ALL)-like disease from an otherwise successful gene therapy trial for X-linked severe combined immunodeficiency (X-linked SCID). X-linked SCID, a disease caused by inactivating mutations in the IL2Rgamma gene, is part of a heterogeneous group of SCIDs characterized by the lack of T cells in conjunction with the absence of B and/or natural killer (NK) cells. Gene therapy approaches are being developed for this group of diseases. In this review we discuss the various forms of SCID in relation to normal T-cell development. In addition, we consider the possible role of LMO2 and other T-ALL oncogenes in the development of adverse effects as seen in the X-linked SCID gene therapy trial. Furthermore, we debate whether the integration near the LMO2 locus is sufficient to result in T-ALL-like proliferations or whether the gamma-retroviral viral expression of the therapeutic IL2RG gene contributes to leukemogenesis. Finally, we review some newly developed murine models that may have added value for gene therapy safety studies.

  5. A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

    Directory of Open Access Journals (Sweden)

    V.L. Quadros

    2006-07-01

    Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

  6. A Noise Trimming and Positional Significance of Transposon Insertion System to Identify Essential Genes in Yersinia pestis.

    Science.gov (United States)

    Yang, Zheng Rong; Bullifent, Helen L; Moore, Karen; Paszkiewicz, Konrad; Saint, Richard J; Southern, Stephanie J; Champion, Olivia L; Senior, Nicola J; Sarkar-Tyson, Mitali; Oyston, Petra C F; Atkins, Timothy P; Titball, Richard W

    2017-02-06

    Massively parallel sequencing technology coupled with saturation mutagenesis has provided new and global insights into gene functions and roles. At a simplistic level, the frequency of mutations within genes can indicate the degree of essentiality. However, this approach neglects to take account of the positional significance of mutations - the function of a gene is less likely to be disrupted by a mutation close to the distal ends. Therefore, a systematic bioinformatics approach to improve the reliability of essential gene identification is desirable. We report here a parametric model which introduces a novel mutation feature together with a noise trimming approach to predict the biological significance of Tn5 mutations. We show improved performance of essential gene prediction in the bacterium Yersinia pestis, the causative agent of plague. This method would have broad applicability to other organisms and to the identification of genes which are essential for competitiveness or survival under a broad range of stresses.

  7. A Noise Trimming and Positional Significance of Transposon Insertion System to Identify Essential Genes in Yersinia pestis

    Science.gov (United States)

    Yang, Zheng Rong; Bullifent, Helen L.; Moore, Karen; Paszkiewicz, Konrad; Saint, Richard J.; Southern, Stephanie J.; Champion, Olivia L.; Senior, Nicola J.; Sarkar-Tyson, Mitali; Oyston, Petra C. F.; Atkins, Timothy P.; Titball, Richard W.

    2017-02-01

    Massively parallel sequencing technology coupled with saturation mutagenesis has provided new and global insights into gene functions and roles. At a simplistic level, the frequency of mutations within genes can indicate the degree of essentiality. However, this approach neglects to take account of the positional significance of mutations - the function of a gene is less likely to be disrupted by a mutation close to the distal ends. Therefore, a systematic bioinformatics approach to improve the reliability of essential gene identification is desirable. We report here a parametric model which introduces a novel mutation feature together with a noise trimming approach to predict the biological significance of Tn5 mutations. We show improved performance of essential gene prediction in the bacterium Yersinia pestis, the causative agent of plague. This method would have broad applicability to other organisms and to the identification of genes which are essential for competitiveness or survival under a broad range of stresses.

  8. A Noise Trimming and Positional Significance of Transposon Insertion System to Identify Essential Genes in Yersinia pestis

    Science.gov (United States)

    Yang, Zheng Rong; Bullifent, Helen L.; Moore, Karen; Paszkiewicz, Konrad; Saint, Richard J.; Southern, Stephanie J.; Champion, Olivia L.; Senior, Nicola J.; Sarkar-Tyson, Mitali; Oyston, Petra C. F.; Atkins, Timothy P.; Titball, Richard W.

    2017-01-01

    Massively parallel sequencing technology coupled with saturation mutagenesis has provided new and global insights into gene functions and roles. At a simplistic level, the frequency of mutations within genes can indicate the degree of essentiality. However, this approach neglects to take account of the positional significance of mutations - the function of a gene is less likely to be disrupted by a mutation close to the distal ends. Therefore, a systematic bioinformatics approach to improve the reliability of essential gene identification is desirable. We report here a parametric model which introduces a novel mutation feature together with a noise trimming approach to predict the biological significance of Tn5 mutations. We show improved performance of essential gene prediction in the bacterium Yersinia pestis, the causative agent of plague. This method would have broad applicability to other organisms and to the identification of genes which are essential for competitiveness or survival under a broad range of stresses. PMID:28165493

  9. Alu insertion/deletion of ACE gene polymorphism might not affect ...

    African Journals Online (AJOL)

    Widodo

    2016-09-03

    Sep 3, 2016 ... Received 2 May 2016; accepted 1 August 2016. Available ... The Egyptian Journal of Medical Human Genetics (2017) 18, 187–191. HOSTED BY ..... insertion–deletion polymorphism of ACE gene and Alzheimer's · disease in ...

  10. Genome Analysis of Kingella kingae Strain KWG1 Reveals How a β-Lactamase Gene Inserted in the Chromosome of This Species.

    Science.gov (United States)

    Bidet, Philippe; Basmaci, Romain; Guglielmini, Julien; Doit, Catherine; Jost, Christelle; Birgy, André; Bonacorsi, Stéphane

    2015-11-16

    We describe the genome of a penicillinase-producing Kingella kingae strain (KWG1), the first to be isolated in continental Europe, whose bla(TEM-1) gene was, for the first time in this species, found to be chromosomally inserted. The bla(TEM) gene is located in an integrative and conjugative element (ICE) inserted in Met-tRNA and comprising genes that encode resistance to sulfonamides, streptomycin, and tetracycline. This ICE is homologous to resistance-conferring plasmids of K. kingae and other Gram-negative bacteria.

  11. Germline cell death is inhibited by P-element insertions disrupting the dcp-1/pita nested gene pair in Drosophila.

    Science.gov (United States)

    Laundrie, Bonni; Peterson, Jeanne S; Baum, Jason S; Chang, Jeffrey C; Fileppo, Dana; Thompson, Sharona R; McCall, Kimberly

    2003-12-01

    Germline cell death in Drosophila oogenesis is controlled by distinct signals. The death of nurse cells in late oogenesis is developmentally regulated, whereas the death of egg chambers during mid-oogenesis is induced by environmental stress or developmental abnormalities. P-element insertions in the caspase gene dcp-1 disrupt both dcp-1 and the outlying gene, pita, leading to lethality and defective nurse cell death in late oogenesis. By isolating single mutations in the two genes, we have found that the loss of both genes contributes to this ovary phenotype. Mutants of pita, which encodes a C2H2 zinc-finger protein, are homozygous lethal and show dumpless egg chambers and premature nurse cell death in germline clones. Early nurse cell death is not observed in the dcp-1/pita double mutants, suggesting that dcp-1+ activity is required for the mid-oogenesis cell death seen in pita mutants. dcp-1 mutants are viable and nurse cell death in late oogenesis occurs normally. However, starvation-induced germline cell death during mid-oogenesis is blocked, leading to a reduction and inappropriate nuclear localization of the active caspase Drice. These findings suggest that the combinatorial loss of pita and dcp-1 leads to the increased survival of abnormal egg chambers in mutants bearing the P-element alleles and that dcp-1 is essential for cell death during mid-oogenesis.

  12. Recombinant Newcastle disease virus (NDV) with inserted gene coding for GM-CSF as a new vector for cancer immunogene therapy

    NARCIS (Netherlands)

    Janke, M.; Peeters, B.P.H.; Leeuw, de O.S.; Moormann, R.J.M.; Arnold, A.; Fournier, P.; Schirrmacher, V.

    2007-01-01

    This is the first report describing recombinant (rec) Newcastle disease virus (NDV) as vector for gene therapy of cancer. The gene encoding granulocyte/macrophage colony-stimulating factor (GM-CSF) was inserted as an additional transcription unit at two different positions into the NDV genome. The r

  13. Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals.

    Science.gov (United States)

    Patel, Vidushi S; Cooper, Steven J B; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer A M

    2008-07-25

    Vertebrate alpha (alpha)- and beta (beta)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the alpha- and beta-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil beta-globin gene (omega) in the marsupial alpha-cluster, however, suggested that duplication of the alpha-beta cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous alpha- and beta-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. The platypus alpha-globin cluster (chromosome 21) contains embryonic and adult alpha- globin genes, a beta-like omega-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-zeta-zeta'-alphaD-alpha3-alpha2-alpha1-omega-GBY-3'. The platypus beta-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-epsilon-beta-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate alpha-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal beta-globin clusters are embedded in olfactory genes. Thus, the mammalian alpha- and beta-globin clusters are orthologous to the bird alpha- and beta-globin clusters respectively. We propose that alpha- and beta-globin clusters evolved from an ancient MPG-C16orf35-alpha-beta-GBY-LUC7L arrangement 410 million years ago. A copy of the original beta (represented by omega in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of beta-globin genes with different expression

  14. Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

    Directory of Open Access Journals (Sweden)

    Warren Wesley C

    2008-07-01

    Full Text Available Abstract Background Vertebrate alpha (α- and beta (β-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus, to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21 contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2 contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago, then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages.

  15. Angiotensin-converting enzyme gene insertion/deletion polymorphism in migraine patients

    Directory of Open Access Journals (Sweden)

    White Linda R

    2008-03-01

    Full Text Available Abstract Background The main objective of this study was to investigate the angiotensin converting enzyme (ACE genotype as a possible risk factor for migraine (both with and without aura compared to controls. We also wanted to examine whether a clinical response to an ACE inhibitor, lisinopril, or an angiotensin II receptor blocker, candesartan, in migraine prophylaxis was related to ACE genotype. Methods 347 migraine patients aged 18–68 (155 migraine without aura (MoA, 187 migraine with aura (MwA and 5 missing aura subgroup data and 403 healthy non-migrainous controls > 40 years of age were included in the study. A polymerase chain reaction (PCR was performed on the genomic DNA samples to obtain the ACE insertion (I/deletion(D polymorphisms. Results No significant differences between migraine patients and controls were found with regard to ACE genotype and allele distributions. Furthermore, there was no significant difference between the controls and the MwA or MoA subgroups. Conclusion In our sample there is no association between ACE genotype or allele frequency and migraine. In addition, ACE genotype in our experience did not predict the clinical response to lisinopril or candesartan used as migraine prophylactics.

  16. Identification of genes affecting alginate biosynthesis in Pseudomonas fluorescens by screening a transposon insertion library.

    Science.gov (United States)

    Ertesvåg, Helga; Sletta, Håvard; Senneset, Mona; Sun, Yi-Qian; Klinkenberg, Geir; Konradsen, Therese Aursand; Ellingsen, Trond E; Valla, Svein

    2017-01-03

    Polysaccharides often are necessary components of bacterial biofilms and capsules. Production of these biopolymers constitutes a drain on key components in the central carbon metabolism, but so far little is known concerning if and how the cells divide their resources between cell growth and production of exopolysaccharides. Alginate is an industrially important linear polysaccharide synthesized from fructose 6-phosphate by several bacterial species. The aim of this study was to identify genes that are necessary for obtaining a normal level of alginate production in alginate-producing Pseudomonas fluorescens. Polysaccharide biosynthesis is costly, since it utilizes nucleotide sugars and sequesters carbon. Consequently, transcription of the genes necessary for polysaccharide biosynthesis is usually tightly regulated. In this study we used an engineered P. fluorescens SBW25 derivative where all genes encoding the proteins needed for biosynthesis of alginate from fructose 6-phosphate and export of the polymer are expressed from inducible Pm promoters. In this way we would avoid identification of genes merely involved in regulating the expression of the alginate biosynthetic genes. The engineered strain was subjected to random transposon mutagenesis and a library of about 11500 mutants was screened for strains with altered alginate production. Identified inactivated genes were mainly found to encode proteins involved in metabolic pathways related to uptake and utilization of carbon, nitrogen and phosphor sources, biosynthesis of purine and tryptophan and peptidoglycan recycling. The majority of the identified mutants resulted in diminished alginate biosynthesis while cell yield in most cases were less affected. In some cases, however, a higher final cell yield were measured. The data indicate that when the supplies of fructose 6-phosphate or GTP are diminished, less alginate is produced. This should be taken into account when bacterial strains are designed for

  17. ANALYSIS OF ANGIOTENSIN CONVERTING ENZYME (ACE GENE INSERTION/DELETION(I/DPOLYMORPHISM IN MIGRAINE

    Directory of Open Access Journals (Sweden)

    Saime Sezer

    2013-03-01

    In patient groups DD genotype frequency was 35.0%, ID genotype frequency was 45.5% and II genotype frequency 19.5% (0.322. Allelic frequencies was detected 57.75% for D allele, 42.25% for I allele in patients. There were no significant differences in genotype/allele frequencies of angiotensin converting enzyme gene polymorphism between patients with migraine and controls (p=0.474. Our results show that I/D polymorphism of angiotensin converting enzyme gene is not a risk factor for migraine. [J Contemp Med 2013; 3(1.000: 7-11

  18. TGIF1 Gene Silencing in Tendon-Derived Stem Cells Improves the Tendon-to-Bone Insertion Site Regeneration

    Directory of Open Access Journals (Sweden)

    Liyang Chen

    2015-11-01

    Full Text Available Background/Aims: The slow healing process of tendon-to-bone junctions can be accelerated via implanted tendon-derived stem cells (TDSCs with silenced transforming growth interacting factor 1 (TGIF1 gene. Tendon-to-bone insertion site is the special form of connective tissues derivatives of common connective progenitors, where TGF-β plays bidirectional effects (chondrogenic or fibrogenic through different signaling pathways at different stages. A recent study revealed that TGF-β directly induces the chondrogenic gene Sox9. However, TGIF1 represses the expression of the cartilage master Sox9 gene and changes its expression rate against the fibrogenesis gene Scleraxis (Scx. Methods: TGIF1 siRNA was transduced or TGIF1 was over-expressed in tendon-derived stem cells. Following suprapinatus tendon repair, rats were either treated with transduced TDSCs or nontransduced TDSCs. Histologic examination and Western blot were performed in both groups. Results: In this study, the silencing of TGIF1 significantly upregulated the chondrogenic genes and markers. Similarly, TGIF1 inhibited TDSC differentiation into cartilage via interactions with TGF-β-activated Smad2 and suppressed the phosphorylation of Smad2. The area of fibrocartilage at the tendon-bone interface was significantly increased in the TGIF1 (- group compared with the control and TGIF1-overexpressing groups in the early stages of the animal model. The interface between the tendon and bone showed a increase of new bone and fibrocartilage in the TGIF1 (- group at 4 weeks. Fibrovascular scar tissue was observed in the TGIF1-overexpressing group and the fibrin glue only group. Low levels of fibrocartilage and fibrovascular scar tissue were found in the TDSCs group. Conclusion: Collectively, this study shows that the tendon-derived stem cell modified with TGIF1 gene silencing has promising effects on tendon-to-bone healing which can be further explored as a therapeutic tool in regenerative medicine.

  19. Detection of a functional insertion sequence responsible for deletion of the thermostable direct hemolysin gene (tdh) in Vibrio parahaemolyticus.

    Science.gov (United States)

    Kamruzzaman, Muhammad; Bhoopong, Phuangthip; Vuddhakul, Varaporn; Nishibuchi, Mitsuaki

    2008-09-15

    The thermostable direct hemolysin coded by the tdh gene is a marker of virulent strains of Vibrio parahaemolyticus. The tdh genes are flanked by insertion sequences collectively named as ISVs or their remnants; but the ISVs so far examined have accumulated mutations in the transposase genes and underwent structural arrangements and their transposition activity could not be expected; the tdh gene was thus considered to have been acquired by V. parahaemolyticus through horizontal transfer in the past during evolution. We recently isolated from the same patient tdh+ strains and a tdh(-) strain (PCR examination) that were otherwise indistinguishable. The purpose of this study was to examine the hypothesis that the tdh(-) strain was derived from the tdh+ strain by a deletion of the tdh gene mediated by a functional ISV. Southern blot hybridization showed tdh+ sequences in the tdh(-) strain (PSU-1466). Nucleotide sequence analysis of the tdh and its flanking sequences revealed the tdh gene was split into two parts and they were located 3182-bp apart in PSU-1466. The two tdh sequences were flanked by one of the ISVs, named as ISVpa3, in PSU-1466. This genetic structure could be explained by an ISVpa3-mediated partial tdh deletion from a tdh+ strain followed by transposition of the duplicated ISVpa3 and the deleted tdh sequence into a neighboring location. The ISVpa3 of PSU-1466 coded for a full-length transposase and a DDE motif. We were able to demonstrate transposition activity of the ISVpa3 cloned from PSU-1466 using the replicon fusion assay with the conjugal transfer of a cointegrate from Escherichia coli to V. parahaemolyticus. Our data support ISVpa3-mediated partial tdh deletion resulted in the emergence of the tdh(-) strain.

  20. Molecular genetics of Psoriasis (Principles, technology, gene location, genetic polymorphism and gene expression).

    Science.gov (United States)

    Al Robaee, Ahmad A

    2010-11-01

    Psoriasis is a common inflammatory skin disease with an etiology bases on both environmental and genetic factors. As is the case of many autoimmune diseases its real cause remains poorly defined. However, it is known that genetic factors contribute to disease susceptibility. The linkage analysis has been used to identify multiple loci and alleles that confer risk of the disease. Some other studies have focused upon single nucleotide polymorphisms (SNPs) for mapping of probable causal variants. Other studies, using genome-wide analytical techniques, tried to link the disease to copy number variants (CNVs) that are segments of DNA ranging in size from kilobases to megabases that vary in copy number. CNVs represent an important element of genomic polymorphism in humans and harboring dosage-sensitive genes may cause or predispose to a variety of human genetic diseases. The mechanisms giving rise to SNPs and CNVs can be considered as fundamental processes underlying gene duplications, deletions, insertions, inversions and complex combinations of rearrangements. The duplicated genes being the results of 'successful' copies are fixed and maintained in the population. Conversely, many 'unsuccessful' duplicates remain in the genome as pseudogenes. There is another form of genetic variations termed copy-neutral loss of heterozygosity (LOH) with less information about their potential impact on complex diseases. Additional studies would include associated gene expression variations with either SNPs or CNVs. Now many genetic techniques such as PCR, real time PCR, microarray and restriction fragment length analysis are available for detecting genetic polymorphisms, gene mapping and estimation of gene expression. Recently, the scientists have used these tools to define genetic signatures of disease, to understand genetic causes of disease and to characterize the effects of certain drugs on gene expression. This review highlights the principles, technology and applications on

  1. Kinase domain insert containing receptor promoter controlled suicide gene system selectively kills human umbilical vein endothelial cells

    Institute of Scientific and Technical Information of China (English)

    Wen-Yu Yang; Zong-Hai Huang; Li-Jun Lin; Zhou Li; Jing-Long Yu; Hui-Juan Song; Yong Qian; Xiao-Yan Che

    2006-01-01

    AIM: To study the selective killing of human umbilical vein endothelial cells (HUVECs) by a double suicide gene under the regulation of a kinase domain insert containing receptor (KDR) promoter and mediated by an adenoviral gene vector.METHODS: Human KDR promoter was cloned by polymerase chain reaction (PCR), and two recombinant adenoviral plasmids pAdKDR-CdglyTK, pAdCMV-CDglyTK were constructed according to a two-step transformation protocol. These two newly constructed plasmids were then transfected into 293 packaging cells to grow adenovirus, which were further multiplied and purified.HUVECs and LoVo cells were infected with either of the two resultant recombinant adenoviruses (AdKDR-CDglyTK and AdCMV-CDglyTK) respectively, and the infection rates were estimated by detection of green fluorescent protein (GFP) expression. Infected cells were cultured in culture media containing different concentrations of 5-fluorocytosine (5-FC) and ganciclovir (GCV), and the killing effects were measured.RESULTS: The two recombinant adenoviral plasmids pAdKDR-CdglyTK, pAdCMV-CDglyTK were successfully constructed and transfected into 293 cells. The resultant recombinant adenoviruses infected cells caused similar infection rates; and the infected cells exhibited different sensitivity to the prodrugs: HUVECs infected with AdCMV-CDglyTK and LoVo cells infected with AdCMVCDglyTK were highly sensitive to the prodrugs, and HUVECs infected with AdKDR-CDglyTK were similarly sensitive but significantly more sensitive than the LoVo cells infected with AdKDR-CdglyTK (P<0.001).CONCLJSION: Selective killing of HUVECs may be achieved by gene transfer of double suicide gene under the regulation of the KDR promoter. This finding may provide an optional way to target gene therapy of malignant tumors by abrogation of tumor blood vessels.

  2. Construction of recombinant industrial Saccharomyces cerevisiae strain with bglS gene insertion into PEP4 locus by homologous recombination

    Institute of Scientific and Technical Information of China (English)

    Qiang ZHANG; Qi-he CHEN; Ming-liang FU; Jin-ling WANG; Hong-bo ZHANG; Guo-qing HE

    2008-01-01

    The bglS gene encoding endo-1,3-1,4-β-glucanase from Bacillus subtilis was cloned and sequenced in this study. The bglS expression cassette, including PGK1 promoter, bglS gene fused to the signal sequence of the yeast mating pheromone α-factor (MFals), and ADH1 terminator with G418-resistance as the selected marker, was constructed. Then one of the PEP4 allele of Saccharomyces cerevisiae WZ65 strain was replaced by bglS expression cassette using chromosomal integration of polymerase chain reaction (PCR)-mediated homologous recombination, and the bglS gene was expressed simultaneously. The recombinant strain S. cerevisiae (SC-βG) was preliminarily screened by the clearing hydrolysis zone formed after the barley β-glucan was hydrolyzed in the plate and no proteinase A (PrA) activity was measured in fermenting liquor. The results of PCR analysis ofgenome DNA showed that one of the PEP4 allele had been replaced and bglS gene had been inserted into the locus of PEP4 gene in recombinant strains. Different endo-1,3-1,4-β-glucanase assay methods showed that the recombinant strain SC-βG had high endo-1,3-1,4-β-glucanase expression level with the maximum of 69.3 U/(h-ml) after 60 h of incubation. Meanwhile, the Congo Red method was suitable for the determination of endo-1,3-1,4-β-glucanase activity during the actual brewing process. The current research implies that the constructed yeast strain could be utilized to improve the industrial brewing property of beer.

  3. Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

    Science.gov (United States)

    Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

    2014-01-01

    The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  4. Analysis of the 227 bp short interspersed nuclear element (SINE insertion of the promoter of the myostatin (MSTN gene in different horse breeds

    Directory of Open Access Journals (Sweden)

    Stefania Dall'Olio

    2014-09-01

    Full Text Available The myostatin (MSTN gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic. The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81 and in the Thoroughbred (0.51, whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  5. VISMapper: ultra-fast exhaustive cartography of viral insertion sites for gene therapy.

    Science.gov (United States)

    Juanes, José M; Gallego, Asunción; Tárraga, Joaquín; Chaves, Felipe J; Marín-Garcia, Pablo; Medina, Ignacio; Arnau, Vicente; Dopazo, Joaquín

    2017-09-20

    The possibility of integrating viral vectors to become a persistent part of the host genome makes them a crucial element of clinical gene therapy. However, viral integration has associated risks, such as the unintentional activation of oncogenes that can result in cancer. Therefore, the analysis of integration sites of retroviral vectors is a crucial step in developing safer vectors for therapeutic use. Here we present VISMapper, a vector integration site analysis web server, to analyze next-generation sequencing data for retroviral vector integration sites. VISMapper can be found at: http://vismapper.babelomics.org . Because it uses novel mapping algorithms VISMapper is remarkably faster than previous available programs. It also provides a useful graphical interface to analyze the integration sites found in the genomic context.

  6. The generation of successive unmarked mutations and chromosomal insertion of heterologous genes in Actinobacillus pleuropneumoniae using natural transformation.

    Directory of Open Access Journals (Sweden)

    Janine T Bossé

    Full Text Available We have developed a simple method of generating scarless, unmarked mutations in Actinobacillus pleuropneumoniae by exploiting the ability of this bacterium to undergo natural transformation, and with no need to introduce plasmids encoding recombinases or resolvases. This method involves two successive rounds of natural transformation using linear DNA: the first introduces a cassette carrying cat (which allows selection by chloramphenicol and sacB (which allows counter-selection using sucrose flanked by sequences to either side of the target gene; the second transformation utilises the flanking sequences ligated directly to each other in order to remove the cat-sacB cassette. In order to ensure efficient uptake of the target DNA during transformation, A. pleuropneumoniae uptake sequences are added into the constructs used in both rounds of transformation. This method can be used to generate multiple successive deletions and can also be used to introduce targeted point mutations or insertions of heterologous genes into the A. pleuropneumoniae chromosome for development of live attenuated vaccine strains. So far, we have applied this method to highly transformable isolates of serovars 8 (MIDG2331, which is the most prevalent in the UK, and 15 (HS143. By screening clinical isolates of other serovars, it should be possible to identify other amenable strains.

  7. A novel 9-bp insertion detected in steroid 21-hydroxylase gene (CYP21A2: prediction of its structural and functional implications by computational methods

    Directory of Open Access Journals (Sweden)

    Varma R Raveendra

    2009-01-01

    Full Text Available Abstract Background Steroid 21-hydroxylase deficiency is the most common cause of congenital adrenal hyperplasia (CAH. Detection of underlying mutations in CYP21A2 gene encoding steroid 21-hydroxylase enzyme is helpful both for confirmation of diagnosis and management of CAH patients. Here we report a novel 9-bp insertion in CYP21A2 gene and its structural and functional consequences on P450c21 protein by molecular modeling and molecular dynamics simulations methods. Methods A 30-day-old child was referred to our laboratory for molecular diagnosis of CAH. Sequencing of the entire CYP21A2 gene revealed a novel insertion (duplication of 9-bp in exon 2 of one allele and a well-known mutation I172N in exon 4 of other allele. Molecular modeling and simulation studies were carried out to understand the plausible structural and functional implications caused by the novel mutation. Results Insertion of the nine bases in exon 2 resulted in addition of three valine residues at codon 71 of the P450c21 protein. Molecular dynamics simulations revealed that the mutant exhibits a faster unfolding kinetics and an overall destabilization of the structure due to the triple valine insertion was also observed. Conclusion The novel 9-bp insertion in exon 2 of CYP21A2 genesignificantly lowers the structural stability of P450c21 thereby leading to the probable loss of its function.

  8. Construction and characterization of Pseudomonas aeruginosa protein F-deficient mutants after in vitro and in vivo insertion mutagenesis of the cloned gene.

    Science.gov (United States)

    Woodruff, W A; Hancock, R E

    1988-06-01

    Mutants with insertion mutations in the Pseudomonas aeruginosa protein F (oprF) gene were created in vivo by Tn1 mutagenesis of the cloned gene in Escherichia coli and in vitro by insertion of the streptomycin resistance-encoding omega fragment into the cloned gene, followed by transfer of the mutated protein F gene back to P. aeruginosa. Homologous recombination into the P. aeruginosa chromosome was driven by a bacteriophage F116L transduction method in the oprF::Tn1 mutants or Tn5-instability in the oprF::omega mutants. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblotting demonstrated that the resultant oprF insertion mutants had lost protein F, whereas restriction digestion and Southern blotting experiments proved that the mutants contained a single chromosomal oprF gene with either Tn1 or omega inserted into it. It has been proposed that protein F has a role in antibiotic uptake in P. aeruginosa. Measurement of antibiotic resistance levels showed small to marginal increases in resistance, compared with that of the parent P. aeruginosa strain, to a variety of beta-lactam antibiotics. Protein F-deficient mutants had altered barrier properties as revealed by a three- to fivefold increase in the uptake of the hydrophobic fluorescent probe 1-N-phenylnaphthylamine.

  9. The ACE Gene Insertion/Deletion Polymorphism and Cerebrovascular Diseases in Uzbek Patients with Arterial Hypertension

    Directory of Open Access Journals (Sweden)

    Nargiza U. Makhkamova

    2016-09-01

    Full Text Available The aim of the present study was to investigate the association between the ACE gene I/D polymorphism and the development of hypertensive encephalopathy (HE in Uzbek patients with hypertension (HT. Materials and methods: The study included 91 male patients aged from 32 to 74 years (mean age 52.5±9.2 with HT Grade 1, 2 and 3 (ESH/ESC, 2013 [4] and presence of HE. All patients were checked on office BP using Korotkov’s method and ambulatory blood pressure monitoring (ABPM. Intima-media thickness (IMT of the carotid artery was measured by a 7.5MHz high-resolution ultrasound. Genomic DNA was isolated from peripheral blood using the DiatomTM DNA Prep 200 Kit according to the manufacturer's protocol. ACE gene I/D polymorphism genotypes were determined by PCR. Results: Among HT patients with HE, we have identified a statistically significant predominance of ID genotype carriers (65.9% against carriers of the II genotype (18.75 and DD genotype (15.4% (P=0.000; the frequency of I and D alleles was 51.6% and 48.4%, respectively (P>0.05. Comparative analysis showed a possible association between the ID genotype/D allele and HE development in HT patients, according to the general model (OR = 6.36; 95% CI 3.04 -13.31; p=0.000 and multiplicative model (OR = 2.02; 95% CI 1.25 -3.27; p=0.004 of inheritance. High grades of HT were predominant in carriers of the DD genotype. IMT was significantly higher in carriers of the DD genotype than in carriers of the II and ID genotypes. The carriage of D allele was associated with the highest levels of TC, TG, and VLDL-C. Carriers of the DD genotype were characterized by higher values of daytime SBP, nighttime SBP variability and nighttime SBP load.

  10. Insertion of part of an intron into the 5[prime] untranslated region of a Caenorhabditis elegans gene converts it into a trans-spliced gene

    Energy Technology Data Exchange (ETDEWEB)

    Conrad, R.; Thomas, J.; Spieth, J.; Blumenthal, T. (Indiana University, Bloomington (United States))

    1991-04-01

    In nematodes, the RNA products of some genes are trans-spliced to a 22-nucleotide spliced leader (SL), while the RNA products of other genes are not. In Caenorhabditis elegans, there are two SLs, Sl1 and SL2, donated by two distinct small nuclear ribonucleoprotein particles in a process functionally quite similar to nuclear intron removal. The authors demonstrate here that it is possible to convert a non-trans-spliced gene into a trans-spliced gene by placement of an intron missing only the 5[prime] splice site into the 5[prime] untranslated region. Stable transgenic strains were isolated expressing a gene in which 69 nucleotides of a vit-5 intron, including the 3[prime] splice site, were inserted into the 5[prime] untranslated region of a vit-2/vit-6 fusion gene. The RNA product of this gene was examined by primer extension and PCR amplification. Although the vit-2/vit-6 transgene product is not normally trans-spliced, the majority of transcripts from this altered gene were trans-spliced to SL1. They termed the region of a trans-spliced mRNA precursor between the 5[prime] end and the first 3[prime] splice site an 'outrun'. The results suggest that if a transcript begins with intronlike sequence followed by a 3[prime] splice site, this alone may constitute an outrun and be sufficient to demarcate a transcript as a trans-splice acceptor. These findings leave open the possibility that specific sequences are required to increase the efficiency of trans-splicing.

  11. Biased hypermutation occurred frequently in a gene inserted into the IC323 recombinant measles virus during its persistence in the brains of nude mice

    Energy Technology Data Exchange (ETDEWEB)

    Otani, Sanae [Department of Virology and Graduate School of Medicine, Osaka City University, 1-4-3 Asahimachi, Abeno-ku, Osaka 545-8585 (Japan); Department of Pediatrics, Graduate School of Medicine, Osaka City University, Osaka (Japan); Ayata, Minoru, E-mail: maverick@med.osaka-cu.ac.jp [Department of Virology and Graduate School of Medicine, Osaka City University, 1-4-3 Asahimachi, Abeno-ku, Osaka 545-8585 (Japan); Takeuchi, Kaoru [Laboratory of Environmental Microbiology, Division of Biomedical Science, Faculty of Medicine, University of Tsukuba, Ibaraki (Japan); Takeda, Makoto [Department of Virology 3, National Institute of Infectious Diseases, Tokyo (Japan); Shintaku, Haruo [Department of Pediatrics, Graduate School of Medicine, Osaka City University, Osaka (Japan); Ogura, Hisashi [Department of Virology and Graduate School of Medicine, Osaka City University, 1-4-3 Asahimachi, Abeno-ku, Osaka 545-8585 (Japan)

    2014-08-15

    Measles virus (MV) is the causative agent of measles and its neurological complications, subacute sclerosing panencephalitis (SSPE) and measles inclusion body encephalitis (MIBE). Biased hypermutation in the M gene is a characteristic feature of SSPE and MIBE. To determine whether the M gene is the preferred target of hypermutation, an additional transcriptional unit containing a humanized Renilla reniformis green fluorescent protein (hrGFP) gene was introduced into the IC323 MV genome, and nude mice were inoculated intracerebrally with the virus. Biased hypermutation occurred in the M gene and also in the hrGFP gene when it was inserted between the leader and the N gene, but not between the H and L gene. These results indicate that biased hypermutation is usually found in a gene whose function is not essential for viral proliferation in the brain and that the location of a gene in the MV genome can affect its mutational frequency. - Highlights: • Wild-type MV can cause persistent infections in nude mice. • Biased hypermutation occurred in the M gene. • Biased hypermutation occurred in an inessential gene inserted between the leader and the N gene.

  12. Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

    Science.gov (United States)

    Li, Jie; Zhu, Xichun; Ma, Lin; Xu, Hongwei; Cao, Xin; Luo, Renyun; Chen, Hong; Sun, Xiuzhu; Cai, Yong; Lan, Xianyong

    2017-03-31

    Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the mutation polymorphism of the PRND has been highly concerned recently, including the single nucleiotide polymorphism and insertion/deletion (indel). Therefore, the objective of present study was to examine this novel indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing four diversity sheep breeds. The results showed that three genotypes were detected and the minor allelic frequency was 0.008 (Lanzhou Fat-Tail sheep), 0.084 (Small Tail Han sheep), 0.021(Tong sheep) and 0.083 (Hu sheep), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus were significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the 20-bp indel of sheep PRND gene by ME strategy, which may provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

  13. Correlation between the Insertion/Deletion Mutations of Prion Protein Gene and BSE Susceptibility and Milk Performance in Dairy Cows

    Institute of Scientific and Technical Information of China (English)

    2013-01-01

    Objective To investigate the 23 bp and 12 bp insertion/deletion (indel) mutations within the bovine prion protein (PRNP) gene in Chinese dairy cows, and to detect the associations of two indel mutations with BSE susceptibility and milk performance. Methods Based on bovine PRNP gene sequence, two pairs of primers for testing the 23 bp and 12 bp indel mutations were designed. The PCR ampliifcation and agarose electrophoresis were carried out to distinguish the different genotypes within the mutations. Moreover, based on previous data from other cattle breeds and present genotypic and allelic frequencies of two indels mutations in this study, the corrections between the two indel mutations and BSE susceptibility were tested, as well as the relationships between the mutations and milk performance traits were analyzed in this study based on the statistical analyses. Results In the analyzed Chinese Holstein population, the frequencies of two“del”alleles in 23 bp and 12 bp indel muations were more frequent. The frequency of haplotype of 23del-12del was higher than those of 23del-12ins and 23ins-12del. From the estimated r2 and D’ values, two indel polymorphisms were linked strongly in the Holstein population (D’=57.5%, r2=0.257). Compared with the BSE-affected cattle populations from the reported data, the signiifcant differences of genotypic and allelic frequencies were found among present Holstein and some BSE-affected populations (P0.05). Conclusions These observations revealed that the inlfuence of two indel mutations within the bovine PRNP gene on BSE depended on the breed and they did not affect the milk production traits, which layed the foundation for future selection of resistant animals, and for improving health conditions for dairy breeding against BSE in China.

  14. Specific PCR detection of Fusarium oxysporum f. sp. vasinfectum California Race 4 based on a unique Tfo1 insertion event in the PHO gene

    Science.gov (United States)

    A highly virulent race 4 (Cal race 4) of Fusarium oxysporum f. sp. vasinfectum (Fov) was identified in California cotton fields in 2001, and has since been found in increasing numbers of fields. Cal race 4 isolates contain a unique Tfo1 transposon insertion in the PHO gene that was not found in othe...

  15. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-03-01

    Background: Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multi-gene family. Although the function of the members of the PE_PGRS multi-gene family is not yet known, it is hypothesized that the PE_PGRS genes may be associated with genetic variability. Material and methods: Whole genome sequencing analysis was performed on (n= 37) extensively drug resistant (XDR) MTB strains from Pakistan which included Central Asian (n= 23), East African Indian (n= 2), X3 (n= 1), T group (n= 3) and Orphan (n= 8) MTB strains. Results: By analyzing 42 PE_PGRS genes, 111 SNPs were identified, of which 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in the PE_PGRS genes were as follows: 6, 9, 10 and 55 present in each of the CAS, EAI, Orphan, T1 and X3 XDR MTB strains studied. Deletions in PE_PGRS genes: 19, 21 and 23 were observed in 7 (35.0%) CAS1 and 3 (37.5%) in Orphan XDR MTB strains, while deletions in the PE_PGRS genes: 49 and 50 were observed in 36 (95.0%) CAS1 and all CAS, CAS2 and Orphan XDR MTB strains. An insertion in PE_PGRS6 gene was observed in all CAS, EAI3 and Orphan, while insertions in the PE_PGRS genes 19 and 33 were observed in 19 (95%) CAS1 and all CAS, CAS2, EAI3 and Orphan XDR MTB strains. Conclusion: Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs, Insertions and Deletions in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  16. Energy Saving Melting and Revert Reduction Technology: Improved Die Casting Process to Preserve the Life of the Inserts

    Energy Technology Data Exchange (ETDEWEB)

    David Schwam, PI; Xuejun Zhu, Sr. Research Associate

    2012-09-30

    lubricants and technical support. Experiments conducted with these lubricants demonstrated good protection of the substrate steel. Graphite and boron nitride used as benchmarks are capable of completely eliminating soldering and washout. However, because of cost and environmental considerations these materials are not widely used in industry. The best water-based die lubricants evaluated in this program were capable of providing similar protection from soldering and washout. In addition to improved part quality and higher production rates, improving die casting processes to preserve the life of the inserts will result in energy savings and a reduction in environmental wastes. Improving die life by means of optimized cooling line placement, baffles and bubblers in the die will allow for reduced die temperatures during processing, saving energy associated with production. The utilization of optimized die lubricants will also reduce heat requirements in addition to reducing waste associated with soldering and washout. This new technology was predicted to result in an average energy savings of 1.1 trillion BTU's/year over a 10 year period. Current (2012) annual energy saving estimates, based on commercial introduction in 2010, a market penetration of 70% by 2020 is 1.26 trillion BTU's/year. Along with these energy savings, reduction of scrap and improvement in casting yield will result in a reduction of the environmental emissions associated with the melting and pouring of the metal which will be saved as a result of this technology. The average annual estimate of CO2 reduction per year through 2020 is 0.025 Million Metric Tons of Carbon Equivalent (MM TCE).

  17. CTG repeats distribution and Alu insertion polymorphism at myotonic dystrophy (DM) gene in Amhara and Oromo populations of Ethiopia.

    Science.gov (United States)

    Gennarelli, M; Pavoni, M; Cruciani, F; De Stefano, G; Dallapiccola, B; Novelli, G

    1999-01-01

    Myotonic dystrophy (DM) is a dominantly inherited neuromuscular disease, highly variable and multisystemic, which is caused by the expansion of a CTG repeat located in the 3' untranslated region of the DMPK gene. Normal alleles show a copy number of 5-37 repeats on normal chromosomes, amplified to 50-3000 copies on DM chromosomes. The trinucleotide repeat shows a trimodal allele distribution in the majority of the examined population. The first class includes alleles carrying (CTG)5, the second class, alleles in the range 7-18 repeats, and the third class, alleles (CTG) > or =19. The frequency of this third class is directly related to the prevalence of DM in different populations, suggesting that normal large-sized alleles predispose toward DM. We studied CTG repeat allele distribution and Alu insertion and/or deletion polymorphism at the myotonic dystrophy locus in two major Ethiopian populations, the Amhara and Oromo. CTG allele distribution and haplotype analysis on a total of 224 normal chromosomes showed significant differences between the two ethnic groups. These differences have a bearing on the out-of-Africa hypothesis for the origin of the DM mutation. In addition, (CTG) > or =19 were exclusively detected in the Amhara population, confirming the predisposing role of these alleles compared with the DM expansion-mutation.

  18. An active hAT transposable element causing bud mutation of carnation by insertion into the flavonoid 3'-hydroxylase gene.

    Science.gov (United States)

    Momose, Masaki; Nakayama, Masayoshi; Itoh, Yoshio; Umemoto, Naoyuki; Toguri, Toshihiro; Ozeki, Yoshihiro

    2013-04-01

    The molecular mechanisms underlying spontaneous bud mutations, which provide an important breeding tool in carnation, are poorly understood. Here we describe a new active hAT type transposable element, designated Tdic101, the movement of which caused a bud mutation in carnation that led to a change of flower color from purple to deep pink. The color change was attributed to Tdic101 insertion into the second intron of F3'H, the gene for flavonoid 3'-hydroxylase responsible for purple pigment production. Regions on the deep pink flowers of the mutant can revert to purple, a visible phenotype of, as we show, excision of the transposable element. Sequence analysis revealed that Tdic101 has the characteristics of an autonomous element encoding a transposase. A related, but non-autonomous element dTdic102 was found to move in the genome of the bud mutant as well. Its mobilization might be the result of transposase activities provided by other elements such as Tdic101. In carnation, therefore, the movement of transposable elements plays an important role in the emergence of a bud mutation.

  19. A novel deletion/insertion caused by a replication error in the β-globin gene locus control region.

    Science.gov (United States)

    Joly, Philippe; Lacan, Philippe; Garcia, Caroline; Meley, Roland; Pondarré, Corinne; Francina, Alain

    2011-01-01

    Deletions in the β-globin locus control region (β-LCR) lead to (εγδβ)(0)-thalassemia [(εγδβ)(0)-thal]. In patients suffering from these rare deletions, a normal hemoglobin (Hb), phenotype is found, contrasting with a hematological thalassemic phenotype. Multiplex-ligation probe amplification (MLPA) is an efficient tool to detect β-LCR deletions combined with long-range polymerase chain reaction (PCR) and DNA sequencing to pinpoint deletion breakpoints. We present here a novel 11,155 bp β-LCR deletion found in a French Caucasian patient which removes DNase I hypersensitive site 2 (HS2) to HS4 of the β-LCR. Interestingly, a 197 bp insertion of two inverted sequences issued from the HS2-HS3 inter-region is present and suggests a complex rearrangement during replication. Carriers of this type of thalassemia can be misdiagnosed as an α-thal trait. Consequently, a complete α- and β-globin gene cluster analysis is required to prevent a potentially damaging misdiagnosis in genetic counselling.

  20. Insertion of an SVA-E retrotransposon into the CASP8 gene is associated with protection against prostate cancer.

    Science.gov (United States)

    Stacey, Simon N; Kehr, Birte; Gudmundsson, Julius; Zink, Florian; Jonasdottir, Aslaug; Gudjonsson, Sigurjon A; Sigurdsson, Asgeir; Halldorsson, Bjarni V; Agnarsson, Bjarni A; Benediktsdottir, Kristrun R; Aben, Katja K H; Vermeulen, Sita H; Cremers, Ruben G; Panadero, Angeles; Helfand, Brian T; Cooper, Phillip R; Donovan, Jenny L; Hamdy, Freddie C; Jinga, Viorel; Okamoto, Ichiro; Jonasson, Jon G; Tryggvadottir, Laufey; Johannsdottir, Hrefna; Kristinsdottir, Anna M; Masson, Gisli; Magnusson, Olafur T; Iordache, Paul D; Helgason, Agnar; Helgason, Hannes; Sulem, Patrick; Gudbjartsson, Daniel F; Kong, Augustine; Jonsson, Eirikur; Barkardottir, Rosa B; Einarsson, Gudmundur V; Rafnar, Thorunn; Thorsteinsdottir, Unnur; Mates, Ioan N; Neal, David E; Catalona, William J; Mayordomo, José I; Kiemeney, Lambertus A; Thorleifsson, Gudmar; Stefansson, Kari

    2016-03-01

    Transcriptional and splicing anomalies have been observed in intron 8 of the CASP8 gene (encoding procaspase-8) in association with cutaneous basal-cell carcinoma (BCC) and linked to a germline SNP rs700635. Here, we show that the rs700635[C] allele, which is associated with increased risk of BCC and breast cancer, is protective against prostate cancer [odds ratio (OR) = 0.91, P = 1.0 × 10(-6)]. rs700635[C] is also associated with failures to correctly splice out CASP8 intron 8 in breast and prostate tumours and in corresponding normal tissues. Investigation of rs700635[C] carriers revealed that they have a human-specific short interspersed element-variable number of tandem repeat-Alu (SINE-VNTR-Alu), subfamily-E retrotransposon (SVA-E) inserted into CASP8 intron 8. The SVA-E shows evidence of prior activity, because it has transduced some CASP8 sequences during subsequent retrotransposition events. Whole-genome sequence (WGS) data were used to tag the SVA-E with a surrogate SNP rs1035142[T] (r(2) = 0.999), which showed associations with both the splicing anomalies (P = 6.5 × 10(-32)) and with protection against prostate cancer (OR = 0.91, P = 3.8 × 10(-7)).

  1. Genotyping of the 19-bp insertion/deletion polymorphism in the 5' flank of beta-hydroxylase gene by dissociation analysis of allele-specific PCR products

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Werge, Thomas

    2005-01-01

    The 19-bp insertion/deletion polymorphism in the 5' flank of the dopamine beta-hydroxylase (DBH) gene has been associated with psychiatric disorders. We have developed a simple, reliable and inexpensive closed-tube assay for genotyping of this polymorphism based upon T(m) determination of amplified...... and a conventional approach based upon agarose gel electrophoresis of amplified fragments revealed complete concordance between the two procedures. The insights obtained in this study may be utilized to develop assays based upon dissociation analysis of PCR products for genotyping of other insertion...

  2. Insertion of a nuclear factor kappa B DNA nuclear-targeting sequence potentiates suicide gene therapy efficacy in lung cancer cell lines

    DEFF Research Database (Denmark)

    Cramer, F; Christensen, C L; Poulsen, T T

    2012-01-01

    Lung cancer currently causes the majority of cancer-related deaths worldwide and new treatments are in high demand. Gene therapy could be a promising treatment but currently lacks sufficient efficiency for clinical use, primarily due to limited cellular and nuclear DNA delivery. In the present...... improve plasmid nuclear delivery and enhance the therapeutic effect of a validated transcriptionally cancer-targeted suicide gene therapy system. A clear correlation between the number of inserted NFκB-binding sites and the therapeutic effect of the suicide system was observed in both small cell lung....... This is to our knowledge the first time a DTS strategy has been implemented for suicide gene therapy....

  3. Angiotensin-Converting Enzyme Gene Insertion/Deletion Polymorphism and Small Vessel Cerebral Stroke in Indian Population

    Directory of Open Access Journals (Sweden)

    Puttachandra Prabhakar

    2014-01-01

    Full Text Available Background. Hypertension is an established risk factor for small-vessel cerebral stroke and the renin-angiotensin system plays an important role in the maintenance of blood pressure. We aimed at evaluating the contribution of the angiotensin-converting enzyme (ACE gene insertion/deletion (I/D polymorphism to the risk of small-vessel stroke in south Indian population. Materials and Methods. We investigated 128 patients diagnosed with small-vessel stroke and 236 age, and gender-matched healthy controls. ACE I/D polymorphism was detected by polymerase chain reaction. Results. Hypertension was significantly more prevalent in the patient group and was associated with 6-fold increase in risk for stroke. ACE genotypes were in Hardy-Weinberg equilibrium in both patients and controls. Prevalence of DD, ID, and II genotypes in cases (34.4%, 43.7%, and 28% did not differ significantly from controls (31.8%, 43.2%, and 25%. The polymorphism was not associated with small-vessel stroke (OR: 1.34; 95% CI: 0.52–1.55. However, diastolic blood pressure was associated with the ACE I/D genotypes in the patients. (DD; 90.2±14.2> ID; 86.2±11.9> II; 82.3±7.8 mm Hg,  P=0.047. Conclusion. Our study showed that hypertension, but not ACE I/D polymorphism, increased the risk of small-vessel stroke.

  4. The Corynebacterium xerosis composite transposon Tn5432 consists of two identical insertion sequences, designated IS1249, flanking the erythromycin resistance gene ermCX.

    Science.gov (United States)

    Tauch, A; Kassing, F; Kalinowski, J; Pühler, A

    1995-09-01

    Analysis of the 50-kb R-plasmid pTP10 from the clinical isolate Corynebacterium xerosis M82B revealed that the erythromycin resistance gene, ermCX, is located on a 4524-bp composite transposable element, Tn5432. The ends of Tn5432 are identical, direct repeats of an insertion sequence, designated IS1249, encoding a putative transposase of the IS256 family. IS1249 consists of 1385 bp with 45/42 imperfect terminal inverted repeats. The nucleotide sequence of the 1754-bp Tn5432 central region is 99% identical to the previously sequenced erythromycin resistance region of the Corynebacterium diphtheriae plasmid pNG2. It encodes the erythromycin resistance gene, ermCX, and an ORF homologous to the amino-terminal end of the transposase of IS31831 from Corynebacterium glutamicum. Transposons with regions flanking the insertion sites were recovered from the C. glutamicum chromosome by a plasmid rescue technique. Insertion of Tn5432 created 8-bp target site duplications. A Tn5432-induced isoleucine/valine-auxotrophic mutant was found to carry the transposon in the 5' region of the ilvBNC cluster; in pTP10 the transposon is inserted in a region similar to replication and partitioning functions of the Enterococcus faecalis plasmid pAD1 and the Agrobacterium tumefaciens plasmid pTAR.

  5. Insertional mutagenesis in Neurospora crassa: cloning and molecular analysis of the preg+ gene controlling the activity of the transcriptional activator NUC-1.

    Science.gov (United States)

    Kang, S; Metzenberg, R L

    1993-02-01

    The transcriptional activator NUC-1 controls the transcription of the genes for phosphorus acquisition enzymes, and its activity is regulated by the negative regulatory factors, PREG and PGOV In this report, we describe the cloning and molecular analysis of the preg+ gene. In Neurospora crassa, as in higher eukaryotes, transformation frequently results in nonhomologous integration of transforming DNA. Insertion of transforming DNA into host genes mutates the gene and provides a molecular tag for cloning it. We obtained two mutants that have an insertion in the preg+ and pgov+ genes, respectively, among 2 x 10(5) transformants. The preg+ gene was cloned by screening a Neurospora genomic DNA library with DNA sequences flanking the transforming DNA of the rescued plasmid. Northern analysis showed that the transcription of the preg+ gene is not regulated by phosphate. The carboxy-terminal half of PREG shows strong homology with Saccharomyces cerevisiae PHO80 whose function is analogous to that of PREG. The pregc mutations are located in the well conserved residues which may directly interact with the residues in the regulatory domain of NUC-1.

  6. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Directory of Open Access Journals (Sweden)

    Etchells J Peter

    2009-10-01

    Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.

  7. A large deletion/insertion-induced frameshift mutation of the androgen receptor gene in a family with a familial complete androgen insensitivity syndrome.

    Science.gov (United States)

    Cong, Peikuan; Ye, Yinghui; Wang, Yue; Lu, Lingping; Yong, Jing; Yu, Ping; Joseph, Kimani Kagunda; Jin, Fan; Qi, Ming

    2012-06-01

    Androgen insensitivity syndrome (AIS) is an X-linked recessive genetic disorder with a normal 46, XY karyotype caused by abnormality of the androgen receptor (AR) gene. One Chinese family consisting of the proband and 5 other members with complete androgen insensitivity syndrome (CAIS) was investigated. Mutation analysis by DNA sequencing on all 8 exons and flanking intron regions of the AR gene revealed a unique large deletion/insertion mutation in the family. A 287 bp deletion and 77 bp insertion (c.933_1219delins77) mutation at codon 312 resulted in a frameshift which caused a premature stop (p.Phe312Aspfs*7) of polypeptide formation. The proband's mother and grandmother were heterozygous for the mutant allele. The proband's father, uncle and grandfather have the normal allele. From the pedigree constructed from mutational analysis of the family, it is revealed that the probably pathogenic mutation comes from the maternal side.

  8. The expanding universe of transposon technologies for gene and cell engineering

    Directory of Open Access Journals (Sweden)

    Ivics Zoltán

    2010-12-01

    Full Text Available Abstract Transposable elements can be viewed as natural DNA transfer vehicles that, similar to integrating viruses, are capable of efficient genomic insertion. The mobility of class II transposable elements (DNA transposons can be controlled by conditionally providing the transposase component of the transposition reaction. Thus, a DNA of interest (be it a fluorescent marker, a small hairpin (shRNA expression cassette, a mutagenic gene trap or a therapeutic gene construct cloned between the inverted repeat sequences of a transposon-based vector can be used for stable genomic insertion in a regulated and highly efficient manner. This methodological paradigm opened up a number of avenues for genome manipulations in vertebrates, including transgenesis for the generation of transgenic cells in tissue culture, the production of germline transgenic animals for basic and applied research, forward genetic screens for functional gene annotation in model species, and therapy of genetic disorders in humans. Sleeping Beauty (SB was the first transposon shown to be capable of gene transfer in vertebrate cells, and recent results confirm that SB supports a full spectrum of genetic engineering including transgenesis, insertional mutagenesis, and therapeutic somatic gene transfer both ex vivo and in vivo. The first clinical application of the SB system will help to validate both the safety and efficacy of this approach. In this review, we describe the major transposon systems currently available (with special emphasis on SB, discuss the various parameters and considerations pertinent to their experimental use, and highlight the state of the art in transposon technology in diverse genetic applications.

  9. Gilbert's syndrome: High frequency of the (TA)7 TAA allele in India and its interaction with a novel CAT insertion in promoter of the gene for bilirubin UDP-glucuronosyltransferase 1 gene

    Institute of Scientific and Technical Information of China (English)

    Shabana Farheen; Sanghamitra Sengupta; Amal Santra; Suparna Pal; Gopal Krishna Dhali; Meenakshi Chakravorty; Partha P Majumder; Abhijit Chowdhury

    2006-01-01

    AIM: To identify the variants in UDP-glucuronosyltransferase 1 (UGT1A1) gene in Gilbert's syndrome (GS) and to estimate the association between homozygosity for TA insertion and GS in India, as well as the frequency of TA insertion and its impact among normal controls in India.METHODS: Ninety-five GS cases and 95 normal controls were selected. Liver function and other tests were done. The promoter and all 5 exons of UGT1A1 gene were resequenced. Functional assessment of a novel trinucleotide insertion was done byin silico analysis and by estimating UGT1A1 promoter activity carried out by luciferase reporter assay of appropriate constructs in Hep G2 cell line.RESULTS: Among the GS patients, 80% were homozygous for the TA insertion, which was several-fold higher than reports from other ethnic groups. The mean UCB level was elevated among individuals with only one copy of this insertion, which was not significantly different from those with two copies. Many new DNA variants in UGT1A1 gene were discovered, including a trinucleotide (CAT) insertion in the promoter found in a subset (10%) of GS patients, but not among normal controls. In-silico analysis showed marked changes in the DNA-folding of the promoter and functional analysis showed a 20-fold reduction in transcription efficiency of UGT1A1 gene resulting from this insertion, thereby significantly elevating the UCB level.CONCLUSION: The genetic epidemiology of GS is variable across ethnic groups and the epistatic interactions among UGT1A1 promoter variants modulate bilirubin glucuronidation.

  10. Local administration of cells containing an inserted IL-2 gene and producing IL-2 inhibits growth of human tumours in nu/nu mice.

    Science.gov (United States)

    Bubenik, J; Voitenok, N N; Kieler, J; Prassolov, V S; Chumakov, P M; Bubenikova, D; Simova, J; Jandlova, T

    1988-12-01

    We have prepared a retroviral expression construct, pPS-IL-2, in which human IL-2 cDNA has been inserted into the polylinker region, and have used the retroviral vector to introduce the functional IL-2 gene into a fibroblast cell line, RAT-1. Peritumoral administration of IL-2-producing RAT-1 cells into congenitally athymic (nu/nu) mice carrying subcutaneous transplants of human carcinoma cells inhibited the growth of the human tumour xenografts.

  11. [Mutants of bacterium Azospirillum brasilense Sp245 with Omegon insertion in mmsB or fabG genes of lipid metabolism are defective in motility and flagellation].

    Science.gov (United States)

    Kovtunov, E A; Shelud'ko, A V; Chernyshova, M P; Petrova, L P; Katsy, E I

    2013-11-01

    Bacteria Azospirillum brasilense have mixed flagellation: in addition to the polar flagellum, numerous lateral flagella are formed in their cells on medium with increased density. Flagella determine the active swimming and swarming capacities of azospirilla. Using A. brasilense Sp245 as an example, we showed that the Omegon-Km artificial transposon insertion into the chromosomal gene for 3-hydroxyisobutyrate dehydrogenase (mmsB) was concurrent with the appearance of significant defects in the formation of polar flagella and with the paralysis of lateral flagella. The Sp245 mutant with the Omegon insertion into the plasmid AZOBR_p1-borne gene for 3-oxoacyl-[acyl-carrier protein]-reductase (fabG) showed the complete loss of flagella and the swarming capacity, as well as significant defects in polar flagellar assembly (though some cells are still motile in liquid medium). The viability of the A. brasilense Sp245 mutants with the Omegon insertion into the mmsB or fabG gene was not reduced. No considerable differences in the fatty acid composition of whole cell lipid extracts were found for the A. brasilense Sp245 strain and its mmsB and fabG mutants.

  12. Insertion devices

    CERN Document Server

    Bahrdt, J

    2006-01-01

    The interaction of an insertion device with the electron beam in a storage ring is discussed. The radiation property including brightness, ux and polarization of an ideal and real planar and helical / elliptical device is described. The magnet design of planar, helical, quasiperiodic devices and of devices with a reduced on axis power density are resumed.

  13. Calorimeter insertion

    CERN Multimedia

    2006-01-01

    Calorimeter insertion between toroids in the ATLAS experiment detector Calorimeters are surrounding the inner detector. Calorimeters will absorb and measure the energies of the most charged and neutral particles after the collisions. The saved energy in the calorimeter is detected and converted to signals that are taken out with data taking electronics.

  14. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

    Science.gov (United States)

    Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and

  15. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

    Science.gov (United States)

    Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and

  16. State-of-the-art human gene therapy: part I. Gene delivery technologies.

    Science.gov (United States)

    Wang, Dan; Gao, Guangping

    2014-01-01

    Safe and effective gene delivery is a prerequisite for successful gene therapy. In the early age of human gene therapy, setbacks due to problematic gene delivery vehicles plagued the exciting therapeutic outcome. However, gene delivery technologies rapidly evolved ever since. With the advancement of gene delivery techniques, gene therapy clinical trials surged during the past decade. As the first gene therapy product (Glybera) has obtained regulatory approval and reached clinic, human gene therapy finally realized the promise that genes can be medicines. The diverse gene delivery techniques available today have laid the foundation for gene therapy applications in treating a wide range of human diseases. Some of the most urgent unmet medical needs, such as cancer and pandemic infectious diseases, have been tackled by gene therapy strategies with promising results. Furthermore, combining gene transfer with other breakthroughs in biomedical research and novel biotechnologies opened new avenues for gene therapy. Such innovative therapeutic strategies are unthinkable until now, and are expected to be revolutionary. In part I of this review, we introduced recent development of non-viral and viral gene delivery technology platforms. As cell-based gene therapy blossomed, we also summarized the diverse types of cells and vectors employed in ex vivo gene transfer. Finally, challenges in current gene delivery technologies for human use were discussed.

  17. Preparation and evaluation of nanoparticles loading plasmid DNAs inserted with siRNA fragments targeting c-Myc gene.

    Science.gov (United States)

    Ma, Tao; Jiang, Jin-Ling; Liu, Ying; Ye, Zheng-Bao; Zhang, Jun

    2014-09-01

    c-Myc plays a key role in glioma cancer stem cell maintenance. A drug delivery system, nanoparticles loading plasmid DNAs inserted with siRNA fragments targeting c-Myc gene (NPs-c-Myc-siRNA-pDNAs), for the treatment of glioma, has not previously been reported. NPs-c-Myc-siRNA-pDNAs were prepared and evaluated in vitro. Three kinds of c-Myc-siRNA fragments were separately synthesized and linked with empty siRNA expression vectors in the mole ratio of 3:1 by T4 DNA ligase. The linked products were then separately transfected into Escherichia coli. DH5α followed by extraction with Endofree plasmid Mega kit (Qiagen, Hilden, Germany) obtained c-Myc-siRNA-pDNAs. Finally, the recombinant c-Myc-siRNA3-pDNAs, generating the highest transfection efficiency and the greatest apoptotic ability, were chosen for encapsulation into NPs by the double-emulsion solvent-evaporation procedure, followed by stability, transfection efficiency, as well as qualitative and quantitative apoptosis evaluation. NPs-c-Myc-siRNA3-pDNAs were obtained with spherical shape in uniform size below 150 nm, with the zeta potential about -18 mV, the encapsulation efficiency and loading capacity as 76.3 ± 5.4% and 1.91 ± 0.06%, respectively. The stability results showed that c-Myc-siRNA3-pDNAs remained structurally and functionally stable after encapsulated into NPs, and NPs could prevent the loaded c-Myc-siRNA3-pDNAs from DNase degradation. The transfection efficiency of NPs-c-Myc-siRNA3-pDNAs was proven to be positive. Furthermore, NPs-c-Myc-siRNA3-pDNAs produced significant apoptosis with the apoptotic rate at 24.77 ± 5.39% and early apoptosis cells observed. Methoxy-poly-(ethylene-glycol)-poly-(lactide-co-glycolide) nanoparticles (MPEG-PLGA-NPs) are potential delivery carriers for c-Myc-siRNA3-pDNAs.

  18. Bovine spongiform encephalopathy associated insertion/deletion polymorphisms of the prion protein gene in the four beef cattle breeds from North China.

    Science.gov (United States)

    Zhu, Xiang-Yuan; Feng, Fu-Ying; Xue, Su-Yuan; Hou, Ting; Liu, Hui-Rong

    2011-10-01

    Two insertion/deletion (indel) polymorphisms of the prion protein gene (PRNP), a 23-bp indel in the putative promoter region and a 12-bp indel within intron I, are associated with the susceptibility to bovine spongiform encephalopathy (BSE) in cattle. In the present study, the polymorphism frequencies of the two indels in four main beef cattle breeds (Hereford, Simmental, Black Angus, and Mongolian) from North China were studied. The results showed that the frequencies of deletion genotypes and alleles of 23- and 12-bp indels were lower, whereas the frequencies of insertion genotypes and alleles of the two indels were higher in Mongolian cattle than in the other three cattle breeds. In Mongolian cattle, the 23-bp insertion / 12-bp insertion was the major haplotype, whereas in Hereford, Simmental, and Black Angus cattle, the 23-bp deletion / 12-bp deletion was the major haplotype. These results demonstrated that Mongolian cattle could be more resistant to BSE, compared with the other three cattle breeds, because of its relatively low frequencies of deletion genotypes and alleles of 23- and 12-bp indel polymorphisms. Thus, this race could be important for selective breeding to improve resistance against BSE in this area.

  19. Evaluation of PET performance and MR compatibility of a preclinical PET/MR insert with digital silicon photomultiplier technology

    Energy Technology Data Exchange (ETDEWEB)

    Hallen, Patrick; Schug, David; Wehner, Jakob [Department of Physics of Molecular Imaging Systems, RWTH Aachen University (Germany); Weissler, Bjorn [Department of Chemical Application Research, Philips Research (Germany); Gebhardt, Pierre [Division of Imaging Sciences and Biomedical Engineering, King’s College London (United Kingdom); Goldschmidt, Benjamin [Department of Physics of Molecular Imaging Systems, RWTH Aachen University (Germany); Salomon, Andre [Department of Oncology Solutions, Philips Research (Germany); Duppenbecker, Peter [Department of Physics of Molecular Imaging Systems, RWTH Aachen University (Germany); Kiessling, Fabian [Institute for Experimental Molecular Imaging, RWTH Aachen University (Germany); Schultz, Volkmar [Department of Physics of Molecular Imaging Systems, RWTH Aachen University (Germany)

    2015-05-18

    In this work we present detailed characterizations of our preclinical high resolution PET/MR insert based on the Hyperion-IID platform. The PET/MR insert consists of a ring of 10 singles detection modules, each comprising 2x3 scintillation detector stacks. Each detector stack features a 30x30 pixelated LYSO crystal array with a height of 12 mm and a pitch of 1 mm, coupled via a slit 2 mm light guide to a digital SiPM tile. The PET performance is stable under a wide range of operating points. The spatial resolution is below 1Ä,mm and the CRT reaches 260 or 450 ps depending on trigger settings. The energy resolution is 12.6% FWHM. The characterization of the MR compatibility showed no relevant degradation in PET performance during MRI operation. On the MRI side, we observe a degradation in B0 homogeneity from a VRMS of 0.03 ppm to 0.08 ppm with active shimming, while observing only minor degradations in the B0 field. The noise floor is slightly increased by 2-15% without any observable dependence on the activity. The Z gradients induces an observable eddy current inside the PET inserts which can lead to ghosting artifacts for EPI sequences. However, we don't observe any visible image degradation for widely used anatomical imaging sequences such as gradient echo and turbo spin echo sequences. To prove the viability of our PET/MR insert for in vivo small animal studies, we successfully performed a longitudinal mouse study with subcutaneously injected tumor model cells. The simultaneously acquired PET/MR images provide a high level of anatomical information and soft tissue contrast in the MR layer together with a high resolution image of the FDG tracer distribution in the PET layer.

  20. The detection of a novel insertion mutation in exon 2 of the MEFV gene associated with familial mediterranean fever in a moroccan family.

    Science.gov (United States)

    Mejtoute, Touhami; Sayel, Hanane; El-Akhal, Jamila; Moufid, Fatima Z; Bouguenouch, Laila; El Bouchikhi, Ihssane; Hida, Mustapha; Couissi, Driss; Ouldim, Karim

    2017-01-01

    Familial Mediterranean fever (FMF) is a hereditary autoinflammatory disease that is inherited in an autosomal recessive manner and is caused by mutations in the MEFV gene. As the name indicates, FMF occurs within families and is more common in individuals of Mediterranean descent than in persons of any other ethnicity. To date, 314 mutations have been reported. We studied a Moroccan family with a total of five members, including a mother who was presenting with symptoms of FMF, while her four children remained asymptomatic. The five patients were screened by DNA sequencing of exon 2 and exon 10 of the MEFV gene. Then, complete exome sequencing analysis of the MEFV gene was done for the patients in whom a novel mutation was detected. This analysis identified a novel single base Cytosine (C) insertion mutation in the coding region of the MEFV gene, named c.441dupC (p. Glu148Argfs*5 or E148RfsX5), which resulted in a mutated Pyrin/Marenostrin protein. This is the first report of a new mutation in exon 2 of the MEFV gene in a Moroccan family. This novel insertion mutation may provide important information for further studies of FMF pathogenesis.

  1. A novel insertion mutation in the cartilage-derived morphogenetic protein-1 (CDMP1 gene underlies Grebe-type chondrodysplasia in a consanguineous Pakistani family

    Directory of Open Access Journals (Sweden)

    Ansar Muhammad

    2008-11-01

    Full Text Available Abstract Background Grebe-type chondrodysplasia (GCD is a rare autosomal recessive syndrome characterized by severe acromesomelic limb shortness with non-functional knob like fingers resembling toes. Mutations in the cartilage-derived morphogenetic protein 1 (CDMP1 gene cause Grebe-type chondrodysplasia. Methods Genotyping of six members of a Pakistani family with Grebe-type chondrodysplasia, including two affected and four unaffected individuals, was carried out by using polymorphic microsatellite markers, which are closely linked to CDMP1 locus on chromosome 20q11.22. To screen for a mutation in CDMP1 gene, all of its coding exons and splice junction sites were PCR amplified from genomic DNA of affected and unaffected individuals of the family and sequenced directly in an ABI Prism 310 automated DNA sequencer. Results Genotyping results showed linkage of the family to CDMP1 locus. Sequence analysis of the CDMP1 gene identified a novel four bases insertion mutation (1114insGAGT in exon 2 of the gene causing frameshift and premature termination of the polypeptide. Conclusion We describe a 4 bp novel insertion mutation in CDMP1 gene in a Pakistani family with Grebe-type chondrodysplasia. Our findings extend the body of evidence that supports the importance of CDMP1 in the development of limbs.

  2. A "White" Anthocyanin-less Pomegranate (Punica granatum L.) Caused by an Insertion in the Coding Region of the Leucoanthocyanidin Dioxygenase (LDOX; ANS) Gene.

    Science.gov (United States)

    Ben-Simhon, Zohar; Judeinstein, Sylvie; Trainin, Taly; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

    2015-01-01

    Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils) and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase), which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV radiation.

  3. A "White" Anthocyanin-less Pomegranate (Punica granatum L. Caused by an Insertion in the Coding Region of the Leucoanthocyanidin Dioxygenase (LDOX; ANS Gene.

    Directory of Open Access Journals (Sweden)

    Zohar Ben-Simhon

    Full Text Available Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase, which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV

  4. A single base insertion in the putative transmembrane domain of the tyrosinase gene as a cause for tyrosinase-negative oculocutaneous albinism

    Energy Technology Data Exchange (ETDEWEB)

    Chintamaneni, C.D.; Kobayashi, Y.; Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (United States)); Halaban, R. (Yale Univ. School of Medicine, New Haven, CT (United States)); Witkop, C.J. Jr. (Univ. of Minnesota, Minneapolis (United States))

    1991-06-15

    The authors have determined a molecular defect to be the likely basis for inactivity of the tyrosinase from a patient with tyrosinase-negative oculocutaneous albinism. A single base (thymine) was inserted in exon 5 of the tyrosinase gene following codon 471 in the putative transmembrane coding region. This insertion caused a shift in the reading frame of 19 amino acids at the 3{prime} end and introduced a premature termination signal that would be expected to truncate the protein by 21 amino acids at the carboxyl terminus. The albino tyrosinase was not recognized by antibodies directed to the carboxyl terminus of tyrosinase. Furthermore, as shown by gel electrophoresis of the immunoprecipitated protein, the tyrosinase was {approx} 3kDa smaller than normal. Similar immunoprecipitation data were obtained when cloned normal and mutant tyrosinases were expressed in COS-1 cells.

  5. Gene insertion and replacement in Schizosaccharomyces pombe mediated by the Streptomyces bacteriophage phiC31 site-specific recombination system.

    Science.gov (United States)

    Thomason, L C; Calendar, R; Ow, D W

    2001-08-01

    The site-specific recombination system used by the Streptomyces bacteriophage phiC31 was tested in the fission yeast Schizosaccharomyces pombe. A target strain with the phage attachment site attP inserted at the leu1 locus was co-transformed with one plasmid containing the bacterial attachment site attB linked to a ura4+ marker, and a second plasmid expressing the phiC31 integrase gene. High-efficiency transformation to the Ura+ phenotype occurred when the integrase gene was expressed. Southern analysis revealed that the attB-ura4+ plasmid integrated into the chromosomal attP site. Sequence analysis showed that the attBxattP recombination was precise. In another approach, DNA with a ura4+ marker flanked by two attB sites in direct orientation was used to transform S. pombe cells bearing an attP duplication. The phiC31 integrase catalyzed two reciprocal cross-overs, resulting in a precise gene replacement. The site-specific insertions are stable, as no excision (the reverse reaction) was observed on maintenance of the integrase gene in the integrant lines. The irreversibility of the phiC31 site-specific recombination system sets it apart from other systems currently used in eukaryotic cells, which reverse readily. Deployment of the phiC31 recombination provides new opportunities for directing transgene and chromosome rearrangements in eukaryotic systems.

  6. Phenotypic screening of Arabidopsis T-DNA insertion lines for cell wall mechanical properties revealed ANTHOCYANINLESS2, a cell wall-related gene.

    Science.gov (United States)

    Mabuchi, Atsushi; Soga, Kouichi; Wakabayashi, Kazuyuki; Hoson, Takayuki

    2016-02-01

    We performed a phenotypic screening of confirmed homozygous T-DNA insertion lines in Arabidopsis for cell wall extensibility, in an attempt to identify genes involved in the regulation of cell wall mechanical properties. Seedlings of each line were cultivated and the cell wall extensibility of their hypocotyls was measured with a tensile tester. Hypocotyls of lines with known cell wall-related genes showed higher or lower extensibility than those of the wild-type at high frequency, indicating that the protocol used was effective. In the first round of screening of randomly selected T-DNA insertion lines, we identified ANTHOCYANINLESS2 (ANL2), a gene involved in the regulation of cell wall mechanical properties. In the anl2 mutant, the cell wall extensibility of hypocotyls was significantly lower than that of the wild-type. Levels of cell wall polysaccharides per hypocotyl, particularly cellulose, increased in anl2. Microarray analysis showed that in anl2, expression levels of the major peroxidase genes also increased. Moreover, the activity of ionically wall-bound peroxidases clearly increased in anl2. The activation of peroxidases as well as the accumulation of cell wall polysaccharides may be involved in decreased cell wall extensibility. The approach employed in the present study could contribute to our understanding of the mechanisms underlying the regulation of cell wall mechanical properties.

  7. Multi-species sequence comparison reveals dynamic evolution of the elastin gene that has involved purifying selection and lineage-specific insertions/deletions

    Directory of Open Access Journals (Sweden)

    Green Eric D

    2004-05-01

    Full Text Available Abstract Background The elastin gene (ELN is implicated as a factor in both supravalvular aortic stenosis (SVAS and Williams Beuren Syndrome (WBS, two diseases involving pronounced complications in mental or physical development. Although the complete spectrum of functional roles of the processed gene product remains to be established, these roles are inferred to be analogous in human and mouse. This view is supported by genomic sequence comparison, in which there are no large-scale differences in the ~1.8 Mb sequence block encompassing the common region deleted in WBS, with the exception of an overall reversed physical orientation between human and mouse. Results Conserved synteny around ELN does not translate to a high level of conservation in the gene itself. In fact, ELN orthologs in mammals show more sequence divergence than expected for a gene with a critical role in development. The pattern of divergence is non-conventional due to an unusually high ratio of gaps to substitutions. Specifically, multi-sequence alignments of eight mammalian sequences reveal numerous non-aligning regions caused by species-specific insertions and deletions, in spite of the fact that the vast majority of aligning sites appear to be conserved and undergoing purifying selection. Conclusions The pattern of lineage-specific, in-frame insertions/deletions in the coding exons of ELN orthologous genes is unusual and has led to unique features of the gene in each lineage. These differences may indicate that the gene has a slightly different functional mechanism in mammalian lineages, or that the corresponding regions are functionally inert. Identified regions that undergo purifying selection reflect a functional importance associated with evolutionary pressure to retain those features.

  8. Gene transfer and transposition mutagenesis in Streptomyces roseosporus: mapping of insertions that influence daptomycin or pigment production.

    Science.gov (United States)

    McHenney, M A; Baltz, R H

    1996-09-01

    Streptomyces reseosporus, the producer of the cyclic lipopeptide antibiotic daptomycin, was shown to be a suitable host for molecular genetic manipulation. S. roseosporus does not appear to express significant restriction barriers based upon bacteriophage plaque formation studies. Plasmid DNA can be introduced into S. roseosporus by bacteriophage-FP43-mediated transduction and by conjugation from Escherichia coli. The streptomycete transposons Tn5096 and Tn5099, derived from IS493, transpose in S. roseosporus, and Tn5099-induced transposition mutants altered in the production of daptomycin, red pigment or black pigment were identified, and mapped to Dral and Asnl fragments. Three auxotrophic mutations (argB1, ade-1 and metB1) were identified among 100 individual Tn5096 insertions. Alignment and physical mapping of several Tn5099 insertions in Dral-E and Asnl-B fragments was facilitated by the presence of Dral and Asnl cleavage sites in Tn5099.

  9. NORMAL NASAL GENE EXPRESSION LEVELS USING CDNA ARRAY TECHNOLOGY

    Science.gov (United States)

    Normal Nasal Gene Expression Levels Using cDNA Array Technology. The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...

  10. GENE TECHNOLOGY: A NEW WAY TO TREAT CANCER

    Directory of Open Access Journals (Sweden)

    Prajapati P M.

    2012-06-01

    Full Text Available Gene therapy is the process of introducing genetic material RNA or DNA into a person's cells to fight disease. Gene therapy treats disease by either replacing damaged or missing genes with normal ones, or by providing new genes. The concept of gene therapy was born more than thirty years ago; however, new technology is opening the door to dramatically new possibilities in the treatment of cancers of all kinds. The long-term goal of cancer gene therapy is to develop treatments that attack only cancer cells, thereby eliminating adverse effects on the body and improving the possibility to cure disease. Gene therapy may someday soon make cancer a manageable disease with nominal side effects to the patients. Furthermore, since gene therapy has potential for other diseases such as cystic fibrosis, hemophilia, sickle-cell anemia, muscular dystrophy and Parkinson's, the value of research and discovery has broad applications.

  11. Suppression of leaky expression of adenovirus genes by insertion of microRNA-targeted sequences in the replication-incompetent adenovirus vector genome

    Directory of Open Access Journals (Sweden)

    Kahori Shimizu

    2014-01-01

    Full Text Available Leaky expression of adenovirus (Ad genes occurs following transduction with a conventional replication-incompetent Ad vector, leading to an induction of cellular immunity against Ad proteins and Ad protein-induced toxicity, especially in the late phase following administration. To suppress the leaky expression of Ad genes, we developed novel Ad vectors by incorporating four tandem copies of sequences with perfect complementarity to miR-122a or miR-142-3p into the 3′-untranslated region (UTR of the E2A, E4, or pIX gene, which were mainly expressed from the Ad vector genome after transduction. These Ad vectors easily grew to high titers comparable to those of a conventional Ad vector in conventional 293 cells. The leaky expression of these Ad genes in mouse organs was significantly suppressed by 2- to 100-fold, compared with a conventional Ad vector, by insertion of the miRNA-targeted sequences. Notably, the Ad vector carrying the miR-122a–targeted sequences into the 3′-UTR of the E4 gene expressed higher and longer-term transgene expression and more than 20-fold lower levels of all the Ad early and late genes examined in the liver than a conventional Ad vector. miR-122a–mediated suppression of the E4 gene expression in the liver significantly reduced the hepatotoxicity which an Ad vector causes via both adaptive and non-adaptive immune responses.

  12. Angiotensin-converting enzyme insertion/deletion gene polymorphism in Egyptian children with systemic lupus erythematosus: a possible relation to proliferative nephritis.

    Science.gov (United States)

    Hammad, A; Yahia, S; Laimon, W; Hamed, S M; Shouma, A; Shalaby, N M; Abdel-Hady, D; Ghanem, R; El-Farahaty, R M; El-Bassiony, S R; Hammad, E M

    2017-06-01

    Introduction Angiotensin-converting enzyme (ACE) is crucial in the pathogenesis of systemic lupus erythematosus through angiotensin II which regulates vascular tone and endothelial functions. Objectives To study the frequency of ACE insertion/deletion (I/D) gene polymorphism in Egyptian children with systemic lupus erythematosus and its possible relation to the renal pathology in cases with lupus nephritis. Subjects and methods The frequency of ACE gene insertion/deletion polymorphism genotypes was determined in 78 Egyptian children with systemic lupus erythematosus and compared to a matched group of 140 healthy controls using polymerase chain reaction. Results The DD genotype of the ACE gene was higher in systemic lupus erythematosus patients when compared to controls ( Psystemic lupus erythematosus patients in comparison to controls ( P lupus nephritis group, the DD genotype was significantly higher in those with proliferative lupus nephritis when compared to those with non-proliferative lupus nephritis ( P = 0.02; OR = 1.45; 95% CI = 1.4-1.6). Also, patients with proliferative lupus nephritis showed a higher frequency of the D allele ( P systemic lupus erythematosus and occurrence of proliferative nephritis in Egyptian children.

  13. Why commercialization of gene therapy stalled; examining the life cycles of gene therapy technologies.

    Science.gov (United States)

    Ledley, F D; McNamee, L M; Uzdil, V; Morgan, I W

    2014-02-01

    This report examines the commercialization of gene therapy in the context of innovation theories that posit a relationship between the maturation of a technology through its life cycle and prospects for successful product development. We show that the field of gene therapy has matured steadily since the 1980s, with the congruent accumulation of >35 000 papers, >16 000 US patents, >1800 clinical trials and >$4.3 billion in capital investment in gene therapy companies. Gene therapy technologies comprise a series of dissimilar approaches for gene delivery, each of which has introduced a distinct product architecture. Using bibliometric methods, we quantify the maturation of each technology through a characteristic life cycle S-curve, from a Nascent stage, through a Growing stage of exponential advance, toward an Established stage and projected limit. Capital investment in gene therapy is shown to have occurred predominantly in Nascent stage technologies and to be negatively correlated with maturity. Gene therapy technologies are now achieving the level of maturity that innovation research and biotechnology experience suggest may be requisite for efficient product development. Asynchrony between the maturation of gene therapy technologies and capital investment in development-focused business models may have stalled the commercialization of gene therapy.

  14. Adaptation of Xanthobacter autotrophicus GJ10 to bromoacetate due to activation and mobilization of the haloacetate dehalogenase gene by insertion element IS1247

    DEFF Research Database (Denmark)

    van der Ploeg, J; Willemsen, M; Van Hall, Gerrit;

    1995-01-01

    Monobromoacetate (MBA) is toxic for the 1,2-dichloroethane-degrading bacterium Xanthobacter autotrophicus GJ10 at concentrations higher than 5 mM. Mutants which are able to grow on higher concentrations of MBA were isolated and found to overexpress haloacid dehalogenase, which is encoded by the dhl......B gene. In mutant GJ10M50, a DNA fragment (designated IS1247) had copied itself from a position on the chromosome that was not linked to the dhlB region to a site immediately upstream of dhlB, resulting in a 1,672-bp insertion. IS1247 was found to encode an open reading frame corresponding to 464 amino...... acids which showed similarity to putative transposases from two other insertion elements. In most of the other MBA-resistant mutants of GJ10, IS1247 was also present in one more copy than in the wild type, which had two copies located within 20 kb. After insertion to a site proximal to dhlB, IS1247...

  15. A glycine insertion in the estrogen-related receptor (ERR is associated with enhanced expression of three cytochrome P450 genes in transgenic Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Weilin Sun

    Full Text Available Insecticide-resistant Drosophila melanogaster strains represent a resource for the discovery of the underlying molecular mechanisms of cytochrome P450 constitutive over-expression, even if some of these P450s are not directly involved in the resistance phenotype. For example, in select 4,4'-dichlorodiphenyltrichloroethane (DDT resistant strains the glucocorticoid receptor-like (GR-like potential transcription factor binding motifs (TFBMs have previously been shown to be associated with constitutively differentially-expressed cytochrome P450s, Cyp12d1, Cyp6g2 and Cyp9c1. However, insects are not known to have glucocorticoids. The only ortholog to the mammalian glucocorticoid receptor (GR in D. melanogaster is an estrogen-related receptor (ERR gene, which has two predicted alternative splice isoforms (ERRa and ERRb. Sequencing of ERRa and ERRb in select DDT susceptible and resistant D. melanogaster strains has revealed a glycine (G codon insertion which was only observed in the ligand binding domain of ERR from the resistant strains tested (ERR-G. Transgenic flies, expressing the ERRa-G allele, constitutively over-expressed Cyp12d1, Cyp6g2 and Cyp9c1. Only Cyp12d1 and Cyp6g2 were over-expressed in the ERRb-G transgenic flies. Phylogenetic studies show that the G-insertion appeared to be located in a less conserved domain in ERR and this insertion is found in multiple species across the Sophophora subgenera.

  16. Natural insertion of the bro-1 β-lactamase gene into the gatCAB operon affects Moraxella catarrhalis aspartyl-tRNA(Asn) amidotransferase activity.

    Science.gov (United States)

    Akochy, Pierre-Marie; Lapointe, Jacques; Roy, Paul H

    2012-09-01

    Only about half of bacterial species use an asparaginyl-tRNA synthetase (AsnRS) to attach Asn to its cognate tRNA(Asn). Other bacteria, including the human pathogen Moraxella catarrhalis, a causative agent of otitis media, lack a gene encoding AsnRS, and form Asn-tRNA(Asn) by an indirect pathway catalysed by two enzymes: first, a non-discriminating aspartyl-tRNA synthetase (ND-AspRS) catalyses the formation of aspartyl-tRNA(Asn) (Asp-tRNA(Asn)); then, a tRNA-dependent amidotransferase (GatCAB) transamidates this 'incorrect' product into Asn-tRNA(Asn). As M. catarrhalis has a Gln-tRNA synthetase, its GatCAB functions as an Asp-tRNA(Asn) amidotransferase. This pathogen rapidly evolved to about 90 % ampicillin resistance worldwide by insertion of a bro-1 β-lactamase gene within the gatCAB operon. Comparison of the GatCAB subunits from bro-1 β-lactamase-positive and bro-negative strains showed that the laterally transferred bro-1 gene, inserted into the gatCAB operon, affected the C-terminal sequence of GatA. The identity between the C-terminal sequences of GatA(wt) (residues 479-491) and of GatA(BRO-1) (residues 479-492) was about 36 %, whereas the rest of the GatA sequence was relatively conserved. The characterization of these two distinct GatCABs as well as the hybrid GatCAB containing GatA(1-478)(wt)(479-492)(BRO-1) and truncated GatCAB enzymes of M. catarrhalis showed that the substitution in GatA(wt) of residues 479-492 of GatA(BRO-1) causes increased specificity for glutamine, and decreased specificity for Asp-tRNA(Asn) in the transamidation reaction. We conclude that the bro gene insertion has altered the kinetic parameters of Asp-tRNA(Asn) amidotransferase, and we propose a model for gatA evolution after the insertion of bro-1 at the carboxyl end of gatA.

  17. Issues of social policy and ethics in gene technology.

    Science.gov (United States)

    Sade, R M

    1994-09-01

    Technical developments in the last ten years have made possible mapping and sequencing of the entire human genome, along with the possibility of treating genetic disorders by manipulating DNA. A variety of issues regarding potential uses and abuses of these technologies have become apparent. They relate to both genetic screening and gene therapy. Problems facing individuals and their families mostly revolve around rights of self-determination and of confidentiality. Health care professionals will need to design optimal systems to provide genetic counseling and to protect confidentiality of DNA data bases. Society and social institutions will need to develop policies and laws that protect the privacy of individuals whose DNA is stored in data banks. Patenting of the results of gene research remains controversial internationally. Moreover, there is concern in many quarters about society's potential abuse of gene technology for eugenic purposes. Gene therapy is now a reality. There is little disagreement on the use of gene therapy to treat genetic diseases in individuals by somatic cell therapy. There is much controversy, however, over the use of germ-line cell therapy. Gene technology has contributed to the growth among a small group of influential people of the Post-Modern Movement, which is strongly antiscience and antitechnology. This movement may pose a long-term threat to future technological advances and should not be ignored. There is much outside of the laboratory that scientists, particularly molecular biologists, can do to assure a secure place for science and technology in our culture.

  18. AAV Vectorization of DSB-mediated Gene Editing Technologies.

    Science.gov (United States)

    Moser, Rachel J; Hirsch, Matthew L

    2016-01-01

    Recent work both at the bench and the bedside demonstrate zinc-finger nucleases (ZFNs), CRISPR/Cas9, and other programmable site-specific endonuclease technologies are being successfully utilized within and alongside AAV vectors to induce therapeutically relevant levels of directed gene editing within the human chromosome. Studies from past decades acknowledge that AAV vector genomes are enhanced substrates for homology-directed repair in the presence or absence of targeted DNA damage within the host genome. Additionally, AAV vectors are currently the most efficient format for in vivo gene delivery with no vector related complications in >100 clinical trials for diverse diseases. At the same time, advancements in the design of custom-engineered site-specific endonucleases and the utilization of elucidated endonuclease formats have resulted in efficient and facile genetic engineering for basic science and for clinical therapies. AAV vectors and gene editing technologies are an obvious marriage, using AAV for the delivery of repair substrate and/or a gene encoding a designer endonuclease; however, while efficient delivery and enhanced gene targeting by vector genomes are advantageous, other attributes of AAV vectors are less desirable for gene editing technologies. This review summarizes the various roles that AAV vectors play in gene editing technologies and provides insight into its trending applications for the treatment of genetic diseases.

  19. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-01-21

    Background Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multigene family. Although the function of PE_PGRS genes is unknown, it is hypothesized that the PE_PGRS genes may be associated with antigenic variability in MTB. Material and methods Whole genome sequencing analysis was performed on (n = 37) extensively drug-resistant (XDR) MTB strains from Pakistan, which included Lineage 1 (East African Indian, n = 2); Other lineage 1 (n = 3); Lineage 3 (Central Asian, n = 24); Other lineage 3 (n = 4); Lineage 4 (X3, n = 1) and T group (n = 3) MTB strains. Results There were 107 SNPs identified from the analysis of 42 PE_PGRS genes; of these, 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in PE_PGRS genes – 6, 9 and 10 – were common in all EAI, CAS, Other lineages (1 and 3), T1 and X3. Deletions (DELs) in PE_PGRS genes – 3 and 19 – were observed in 17 (80.9%) CAS1 and 6 (85.7%) in Other lineages (1 and 3) XDR MTB strains, while DELs in the PE_PGRS49 were observed in all CAS1, CAS, CAS2 and Other lineages (1 and 3) XDR MTB strains. All CAS, EAI and Other lineages (1 and 3) strains showed insertions (INS) in PE_PGRS6 gene, while INS in the PE_PGRS genes 19 and 33 were observed in 20 (95.2%) CAS1, all CAS, CAS2, EAI and Other lineages (1 and 3) XDR MTB strains. Conclusion Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs and INDELs in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  20. Newer Gene Editing Technologies toward HIV Gene Therapy

    OpenAIRE

    2013-01-01

    Despite the great success of highly active antiretroviral therapy (HAART) in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realist...

  1. Vaccination Using Gene-Gun Technology.

    Science.gov (United States)

    Bergmann-Leitner, Elke S; Leitner, Wolfgang W

    2015-01-01

    DNA vaccines against infection with Plasmodium have been highly successful in rodent models of malaria and have shown promise in the very limited number of clinical trials conducted so far. The vaccine platform is highly attractive for numerous reasons, such as low cost and a very favorable safety profile. Gene gun delivery of DNA plasmids drastically reduces the vaccine dose and does not only have the potential to make vaccines more accessible and affordable, but also simplifies (a) the testing of novel antigens as vaccine candidates, (b) the testing of antigen combinations, and (c) the co-delivery of antigens with molecular adjuvants such as cytokines or costimulatory molecules. Described in this chapter are the preparation of the inoculum (i.e., DNA plasmids attached to gold particles, coating to the inside of plastic tubing also referred to as gene gun "bullets" or cartridges), the gene gun vaccination procedure, and the challenge of mice with Plasmodium berghei parasites to test the efficacy of the experimental vaccine.

  2. Severe neonatal Marfan syndrome resulting from a de novo 3-bp insertion into the fibrillin gene on chromosome 15.

    OpenAIRE

    Milewicz, D M; Duvic, M

    1994-01-01

    Severe neonatal Marfan syndrome has features of the Marfan syndrome and congenital contractural arachnodactyly present at birth, along with unique features such as loose, redundant skin and pulmonary emphysema. Since the Marfan syndrome and congenital contractural arachnodactyly are due to mutations in different genes, it has been uncertain whether neonatal Marfan syndrome is due to mutations in the fibrillin gene on chromosome 15 or in another gene. We studied an infant with severe neonatal ...

  3. Initial PET Performance Evaluation of a Preclinical Insert for PET/MRI with Digital SiPM Technology

    CERN Document Server

    Schug, David; Weissler, Bjoern; Gebhardt, Pierre; Goldschmidt, Benjamin; Wehner, Jakob; Dueppenbecker, Peter Michael; Salomon, Andre; Hallen, Patrick; Kiessling, Fabian; Schulz, Volkmar

    2015-01-01

    Hyperion-IID is a positron emission tomography (PET) insert which allows simultaneous operation in a clinical magnetic resonance imaging (MRI) scanner. To read out the scintillation light of the employed LYSO crystal arrays with a pitch of 1 mm pitch and 12 mm in height, digital silicon photomultipliers (DPC 3200-22, Philips Digital Photon Counting) (DPC) are used. The basic PET performance in terms of energy resolution, coincidence resolution time (CRT) and sensitivity as a function of operating parameters, such as the operating temperature, the applied overvoltage, activity and configuration parameters of the DPCs, were evaluated on system level. The measured energy resolution did not show a large dependency on the selected parameters and is in the range of 12.4-12.9% for low activities and degrades to ~13.6% at activities of ~100 MBq. The CRT strongly depends on the selected trigger scheme (trig) of the DPCs. We measured approximately 260 ps, 440 ps, 540 ps and 1300 ps for trig 1-4, respectively. The trues...

  4. Murine leukemias with retroviral insertions at Lmo2 are predictive of the leukemias induced in SCID-X1 patients following retroviral gene therapy.

    Directory of Open Access Journals (Sweden)

    Utpal P Davé

    2009-05-01

    Full Text Available Five X-linked severe combined immunodeficiency patients (SCID-X1 successfully treated with autologous bone marrow stem cells infected ex vivo with an IL2RG-containing retrovirus subsequently developed T-cell leukemia and four contained insertional mutations at LMO2. Genetic evidence also suggests a role for IL2RG in tumor formation, although this remains controversial. Here, we show that the genes and signaling pathways deregulated in murine leukemias with retroviral insertions at Lmo2 are similar to those deregulated in human leukemias with high LMO2 expression and are highly predictive of the leukemias induced in SCID-X1 patients. We also provide additional evidence supporting the notion that IL2RG and LMO2 cooperate in leukemia induction but are not sufficient and require additional cooperating mutations. The highly concordant nature of the genetic events giving rise to mouse and human leukemias with mutations at Lmo2 are an encouraging sign to those wanting to use mice to model human cancer and may help in designing safer methods for retroviral gene therapy.

  5. Murine leukemias with retroviral insertions at Lmo2 are predictive of the leukemias induced in SCID-X1 patients following retroviral gene therapy.

    Science.gov (United States)

    Davé, Utpal P; Akagi, Keiko; Tripathi, Rati; Cleveland, Susan M; Thompson, Mary A; Yi, Ming; Stephens, Robert; Downing, James R; Jenkins, Nancy A; Copeland, Neal G

    2009-05-01

    Five X-linked severe combined immunodeficiency patients (SCID-X1) successfully treated with autologous bone marrow stem cells infected ex vivo with an IL2RG-containing retrovirus subsequently developed T-cell leukemia and four contained insertional mutations at LMO2. Genetic evidence also suggests a role for IL2RG in tumor formation, although this remains controversial. Here, we show that the genes and signaling pathways deregulated in murine leukemias with retroviral insertions at Lmo2 are similar to those deregulated in human leukemias with high LMO2 expression and are highly predictive of the leukemias induced in SCID-X1 patients. We also provide additional evidence supporting the notion that IL2RG and LMO2 cooperate in leukemia induction but are not sufficient and require additional cooperating mutations. The highly concordant nature of the genetic events giving rise to mouse and human leukemias with mutations at Lmo2 are an encouraging sign to those wanting to use mice to model human cancer and may help in designing safer methods for retroviral gene therapy.

  6. Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

    Science.gov (United States)

    Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

    2014-07-01

    Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework.

  7. Students' Attitudes Toward Gene Technology: Deconstructing a Construct

    Science.gov (United States)

    Gardner, Grant E.; Troelstrup, Angelique

    2015-10-01

    Emergent technologies are commonly characterized as involving cutting-edge developments while lacking wide-scale public implementation. Although currently prevalent in many applications, gene technology is often considered emergent in that the science changes so rapidly. Science educators at all levels of formal education are faced with a unique challenge of facilitating student understanding of gene technology (in comparison with more established content) as well as integrating some of the more controversial socioscientific aspects of such content into the curricula. Much of the literature regarding student understanding of biotechnology has focused on development of student attitudes toward the field and the impact of this on their learning. However, there has, of yet, been no unifying framework in the literature regarding what is meant by attitudes toward gene technology. This article reviews the current scholarship (38 empirical studies published between 1990 and 2011) on the measurement of student attitudes toward biotechnology in order to highlight major themes present within the literature. Items from all reviewed studies were collected, coded, and sorted for construction of a comprehensive instrument representing the conceptualizations of attitudes toward gene technology in all 38 studies. Factor analytic techniques were used as a tool to reduce and categorize measurement items. Results provided a framework of five factors that help describe student attitudes toward biotechnology across all the studies. This emergent framework of factors is proposed as a useful means to standardize the discourse in future research.

  8. Nonviral Technologies for Gene Therapy in Cardiovascular Research

    Directory of Open Access Journals (Sweden)

    Cheng-Huang Su

    2008-06-01

    Full Text Available Gene therapy, which is still at an experimental stage, is a technique that attempts to correct or prevent a disease by delivering genes into an individual's cells and tissues. In gene delivery, a vector is a vehicle for transferring genetic material into cells and tissues. Synthetic vectors are considered to be prerequisites for gene delivery, because viral vectors have fundamental problems in relation to safety issues as well as large-scale production. Among the physical approaches, ultrasound with its associated bioeffects such as acoustic cavitation, especially inertial cavitation, can increase the permeability of cell membranes to macromolecules such as plasmid DNA. Microbubbles or ultrasound contrast agents lower the threshold for cavitation by ultrasound energy. Furthermore, ultrasound-enhanced gene delivery using polymers or other nonviral vectors may hold much promise for the future but is currently at the preclinical stage. We all know aging is cruel and inevitable. Currently, among the promising areas for gene therapy in acquired diseases, the incidences of cancer and ischemic cardiovascular diseases are strongly correlated with the aging process. As a result, gene therapy technology may play important roles in these diseases in the future. This brief review focuses on understanding the barriers to gene transfer as well as describing the useful nonviral vectors or tools that are applied to gene delivery and introducing feasible models in terms of ultrasound-based gene delivery.

  9. Tn5 insertion in the tonB gene promoter affects iron-related phenotypes and increases extracellular siderophore levels in Gluconacetobacter diazotrophicus.

    Science.gov (United States)

    de Paula Soares, Cleiton; Rodrigues, Elisete Pains; de Paula Ferreira, Jéssica; Simões Araújo, Jean Luiz; Rouws, Luc Felicianus Marie; Baldani, José Ivo; Vidal, Marcia Soares

    2015-03-01

    TonB-dependent receptors in concert with the TonB-ExbB-ExbD protein complex are responsible for the uptake of iron and substances such as vitamin B12 in several bacterial species. In this study, Tn5 mutagenesis of the sugarcane endophytic bacterium Gluconacetobacter diazotrophicus led to the isolation of a mutant with a single Tn5-insertion in the promoter region of a tonB gene ortholog. This mutant, named Gdiaa31, displayed a reduced growth rate and a lack of response to iron availability when compared to the wild-type strain PAL5(T). Several efforts to generate null-mutants for the tonB gene by insertional mutagenesis were without success. RT-qPCR analysis demonstrated reduced transcription of tonB in Gdiaa31 when compared to PAL5(T). tonB transcription was inhibited in the presence of Fe(3+) ions both in PAL5(T) and in Gdiaa31. In comparison with PAL5(T), Gdiaa31 also demonstrated decreased nitrogenase activity and biofilm formation capability, two iron-requiring physiological characteristics of G. diazotrophicus. Additionally, Gdiaa31 accumulated higher siderophore levels in culture supernatant. The genetic complementation of the Gdiaa31 strain with a plasmid that carried the tonB gene including its putative promoter region (pP(tonB)) restored nitrogenase activity and siderophore accumulation phenotypes. These results indicate that the TonB complex has a role in iron/siderophore transport and may be essential in the physiology of G. diazotrophicus.

  10. Effect of polystyrene and polyether imide cell culture inserts with different roughness on chondrocyte metabolic activity and gene expression profiles of aggrecan and collagen.

    Science.gov (United States)

    König, Josephine; Kohl, Benjamin; Kratz, Karl; Jung, Friedrich; Lendlein, Andreas; Ertel, Wolfgang; Schulze-Tanzil, Gundula

    2013-01-01

    In vitro cultured autologous chondrocytes can be used for implantation to support cartilage repair. For this purpose, a very small number of autologous cells harvested from a biopsy have to be expanded in monolayer culture. Commercially available polymer surfaces lead to chondrocyte dedifferentiation. Hence, the demanding need for optimized polymers and surface topologies supporting chondrocytes' differentiated phenotypes in vitro arises. In this study we explored the effect of tailored cell culture plate inserts prepared from polystyrene (PS) and polyether imide (PEI) exhibiting three different roughness levels (R0, RI, RII) on chondrocyte morphology, metabolism and gene expression profile. As a control, commercially available tissue culture plastic (TCP) dishes were included. Primary porcine articular chondrocytes were seeded on tailored PS and PEI inserts with three different roughness levels. The metabolic activity of the chondrocytes was determined after 24 hours using alamar blue assay. Chondrocyte gene expression profiles (aggrecan, type I and type II collagen) were monitored after 48 hours using Real Time Detection (RTD)-PCR. Chondrocytes cultured on PS and PEI surfaces formed cell clusters after 24 and 48 hours, which was not observed on TCP. The metabolic activity of chondrocytes cultured on PS was lower than of chondrocytes cultured on PEI, but also lower than on TCP. Gene expression analyses revealed an elevated expression of cartilage-specific aggrecan and an impaired expression of both collagen types by chondrocytes on PS and PEI compared with TCP. In summary, PEI is a biocompatible biomaterial suitable for chondrocyte culturing, which can be further chemically functionalized for generating specific surface interactions or covalent binding of biomolecules.

  11. Artificially inserting a reticuloendotheliosis virus long terminal repeat into a bacterial artificial chromosome clone of Marek's disease virus (MDV) alters expression of nearby MDV genes.

    Science.gov (United States)

    Kim, Taejoong; Mays, Jody; Fadly, Aly; Silva, Robert F

    2011-06-01

    Researchers reported that co-cultivating the JM/102W strain of Marek's disease virus (MDV) with reticuloendotheliosis virus (REV) resulted in an REV long terminal repeat (LTR) being inserted into the internal repeat short (IRS) region of JM/102W. When the resulting recombinant virus was serially passed in cell culture, the initial LTR was duplicated and a second LTR spontaneously appeared in the terminal repeat short (TRS) region of the MDV genome. The virus, designated RM1, was significantly attenuated but still induced severe bursal and thymic atrophy (Isfort et al. PNAS 89:991-995). To determine whether the altered phenotype was due solely to the LTR, we cloned the LTR from the RM1 IRS region and inserted it into the IRS region of a very virulent bacterial artificial clone (BAC) of the Md5 strain of MDV, which we designated rMd5-RM1-LTR. During blind passage in duck embryo fibroblast cultures, the initial LTR in the rMd5-RM1-LTR was also duplicated, with LTRs appearing in both IRS and TRS regions of the MDV genome. The inserted LTR sequences and transcripts associated with the MDV open reading frames MDV085, MDV086, SORF2, US1, and US10 were molecularly characterized. The parental Md5 BAC contains a family of transcripts of 3, 2, and 1 kb that all terminate at the end of the US10 gene. The rMd5-RM1-LTR and RM1 viruses both express an additional 4 kb transcript that originates in the LTR and also terminates after US10. Collectively, the data suggest that our engineered rMd5-RM1-LTR virus very closely resembles the RM1 virus in its structure and transcription patterns.

  12. A Tourist-like MITE insertion in the upstream region of the BnFLC.A10 gene is associated with vernalization requirement in rapeseed (Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Hou Jinna

    2012-12-01

    Full Text Available Abstract Background Rapeseed (Brassica napus L. has spring and winter genotypes adapted to different growing seasons. Winter genotypes do not flower before the onset of winter, thus leading to a longer vegetative growth period that promotes the accumulation and allocation of more resources to seed production. The development of winter genotypes enabled the rapeseed to spread rapidly from southern to northern Europe and other temperate regions of the world. The molecular basis underlying the evolutionary transition from spring- to winter- type rapeseed is not known, however, and needs to be elucidated. Results We fine-mapped the spring environment specific quantitative trait locus (QTL for flowering time, qFT10-4,in a doubled haploid (DH mapping population of rapeseed derived from a cross between Tapidor (winter-type and Ningyou7 (semi-winter and delimited the qFT10-4 to an 80-kb region on chromosome A10 of B. napus. The BnFLC.A10 gene, an ortholog of FLOWERING LOCUS C (FLC in Arabidopsis, was cloned from the QTL. We identified 12 polymorphic sites between BnFLC.A10 parental alleles of the TN-DH population in the upstream region and in intron 1. Expression of both BnFLC.A10 alleles decreased during vernalization, but decreased more slowly in the winter parent Tapidor. Haplotyping and association analysis showed that one of the polymorphic sites upstream of BnFLC.A10 is strongly associated with the vernalization requirement of rapeseed (r2 = 0.93, χ2 = 0.50. This polymorphic site is derived from a Tourist-like miniature inverted-repeat transposable element (MITE insertion/deletion in the upstream region of BnFLC.A10. The MITE sequence was not present in the BnFLC.A10 gene in spring-type rapeseed, nor in ancestral ‘A’ genome species B. rapa genotypes. Our results suggest that the insertion may have occurred in winter rapeseed after B. napus speciation. Conclusions Our findings strongly suggest that (i BnFLC.A10 is the gene underlying qFT10

  13. High Speed Video Insertion

    Science.gov (United States)

    Janess, Don C.

    1984-11-01

    This paper describes a means of inserting alphanumeric characters and graphics into a high speed video signal and locking that signal to an IRIG B time code. A model V-91 IRIG processor, developed by Instrumentation Technology Systems under contract to Instrumentation Marketing Corporation has been designed to operate in conjunction with the NAC model FHS-200 High Speed Video Camera which operates at 200 fields per second. The system provides for synchronizing the vertical and horizontal drive signals such that the vertical sync precisely coincides with five millisecond transitions in the IRIG time code. Additionally, the unit allows for the insertion of an IRIG time message as well as other data and symbols.

  14. Gene targeting in embryonic stem cells, II: conditional technologies

    Science.gov (United States)

    Genome modification via transgenesis has allowed researchers to link genotype and phenotype as an alternative approach to the characterization of random mutations through evolution. The synergy of technologies from the fields of embryonic stem (ES) cells, gene knockouts, and protein-mediated recombi...

  15. Designer Babies? Teacher Views on Gene Technology and Human Medicine.

    Science.gov (United States)

    Schibeci, Renato

    1999-01-01

    Summarizes the views of a sample of primary and high school teachers on the application of gene technology to human medicine. In general, high school teachers are more positive about these developments than primary teachers, and both groups of teachers are more positive than interested lay publics. Highlights ways in which this topic can be…

  16. Insertional inactivation of the methionine s-methyltransferase gene eliminates the s-methylmethionine cycle and increases the methylation ratio.

    Science.gov (United States)

    Kocsis, Michael G; Ranocha, Philippe; Gage, Douglas A; Simon, Eric S; Rhodes, David; Peel, Gregory J; Mellema, Stefan; Saito, Kazuki; Awazuhara, Motoko; Li, Changjiang; Meeley, Robert B; Tarczynski, Mitchell C; Wagner, Conrad; Hanson, Andrew D

    2003-04-01

    Methionine (Met) S-methyltransferase (MMT) catalyzes the synthesis of S-methyl-Met (SMM) from Met and S-adenosyl-Met (Ado-Met). SMM can be reconverted to Met by donating a methyl group to homocysteine (homo-Cys), and concurrent operation of this reaction and that mediated by MMT sets up the SMM cycle. SMM has been hypothesized to be essential as a methyl donor or as a transport form of sulfur, and the SMM cycle has been hypothesized to guard against depletion of the free Met pool by excess Ado-Met synthesis or to regulate Ado-Met level and hence the Ado-Met to S-adenosylhomo-Cys ratio (the methylation ratio). To test these hypotheses, we isolated insertional mmt mutants of Arabidopsis and maize (Zea mays). Both mutants lacked the capacity to produce SMM and thus had no SMM cycle. They nevertheless grew and reproduced normally, and the seeds of the Arabidopsis mutant had normal sulfur contents. These findings rule out an indispensable role for SMM as a methyl donor or in sulfur transport. The Arabidopsis mutant had significantly higher Ado-Met and lower S-adenosylhomo-Cys levels than the wild type and consequently had a higher methylation ratio (13.8 versus 9.5). Free Met and thiol pools were unaltered in this mutant, although there were moderate decreases (of 30%-60%) in free serine, threonine, proline, and other amino acids. These data indicate that the SMM cycle contributes to regulation of Ado-Met levels rather than preventing depletion of free Met.

  17. Genome-editing Technologies for Gene and Cell Therapy

    Science.gov (United States)

    Maeder, Morgan L; Gersbach, Charles A

    2016-01-01

    Gene therapy has historically been defined as the addition of new genes to human cells. However, the recent advent of genome-editing technologies has enabled a new paradigm in which the sequence of the human genome can be precisely manipulated to achieve a therapeutic effect. This includes the correction of mutations that cause disease, the addition of therapeutic genes to specific sites in the genome, and the removal of deleterious genes or genome sequences. This review presents the mechanisms of different genome-editing strategies and describes each of the common nuclease-based platforms, including zinc finger nucleases, transcription activator-like effector nucleases (TALENs), meganucleases, and the CRISPR/Cas9 system. We then summarize the progress made in applying genome editing to various areas of gene and cell therapy, including antiviral strategies, immunotherapies, and the treatment of monogenic hereditary disorders. The current challenges and future prospects for genome editing as a transformative technology for gene and cell therapy are also discussed. PMID:26755333

  18. Genome-editing Technologies for Gene and Cell Therapy.

    Science.gov (United States)

    Maeder, Morgan L; Gersbach, Charles A

    2016-03-01

    Gene therapy has historically been defined as the addition of new genes to human cells. However, the recent advent of genome-editing technologies has enabled a new paradigm in which the sequence of the human genome can be precisely manipulated to achieve a therapeutic effect. This includes the correction of mutations that cause disease, the addition of therapeutic genes to specific sites in the genome, and the removal of deleterious genes or genome sequences. This review presents the mechanisms of different genome-editing strategies and describes each of the common nuclease-based platforms, including zinc finger nucleases, transcription activator-like effector nucleases (TALENs), meganucleases, and the CRISPR/Cas9 system. We then summarize the progress made in applying genome editing to various areas of gene and cell therapy, including antiviral strategies, immunotherapies, and the treatment of monogenic hereditary disorders. The current challenges and future prospects for genome editing as a transformative technology for gene and cell therapy are also discussed.

  19. Accuracy of fibular sectioning and insertion into a rapid-prototyped bone plate, for mandibular reconstruction using CAD-CAM technology.

    Science.gov (United States)

    Ciocca, Leonardo; Marchetti, Claudio; Mazzoni, Simona; Baldissara, Paolo; Gatto, Maria Rosaria Antonella; Cipriani, Riccardo; Scotti, Roberto; Tarsitano, Achille

    2015-01-01

    Modern techniques of mandibular reconstruction, such as CAD-CAM technology and rapid prototyping, offer new means by which reconstructive surgery can be planned to optimise aesthetic outcomes and prosthetic rehabilitation. The high degree of accuracy afforded by these approaches is principally attributable to high-precision fibular sectioning and insertion of the bone into a customised bone plate. CAD-CAM mandibular reconstruction procedures using vascularised bone free-flap transfers were performed on 10 patients with benign or malignant neoplasms. Five were not treated with the aid of CAD-CAM technology, and served as the control group. Five were scheduled for maxillofacial surgery using surgical cutting guides and customised bone plates. A generalised linear model for linear measures was used to compare the accuracy of reconstruction between the two groups. A difference, even though not significant, in the lateral shift of the mesial and distal positions of the fibular units was evident between groups. CAD-CAM-generated fibular surgical guides afford improved accuracy when used to restore native anatomy, especially in the context of mandibular arch restoration, and both operating room time and related costs are reduced during fibular sectioning.

  20. Simultaneous detection of the exon 10 polymorphism and a novel intronic single base insertion polymorphism in the XPD gene using single strand conformation polymorphism.

    Science.gov (United States)

    Kumar, Rajiv; Angelini, Sabrina; Hemminki, Kari

    2003-03-01

    We developed a new method based on the single strand conformation polymorphism (SSCP) technique for the detection of a G23591A (Asp312Asn) polymorphism in exon 10 of the XPD gene. In the process we also identified a novel polymorphism 23623C-ins (IVS10+17C-ins) in intron 10 of the same gene. With this newly developed SSCP-based method of genotyping we could detect both polymorphisms in the same assay and thus consequently determine the haplotype. In order to determine the population frequency of the novel polymorphism and the haplotype frequency, 302 healthy individuals were genotyped. The allelic frequency of the 23623C-ins intronic polymorphism was 0.16, whereas the frequency of the variant allele for the G23591A polymorphism was 0.39. Forty-three individuals (14%) were heterozygous for both polymorphisms but none carried polymorphic variants for both G23591A and 23623C-ins on the same allele. The effect of the novel intronic insertion polymorphism, which is located 16 nt downstream of the 3'-end of exon 10 of the XPD gene and involves a mononucleotide C repeat sequence, on expression remains to be determined.

  1. A recombinant field strain of Marek's disease (MD) virus with reticuloendotheliosis virus long terminal repeat insert lacking the meq gene as a vaccine against MD.

    Science.gov (United States)

    Su, Shuai; Cui, Ning; Zhou, Yu; Chen, Zimeng; Li, Yanpeng; Ding, Jiabo; Wang, Yixin; Duan, Luntao; Cui, Zhizhong

    2015-01-29

    Marek's disease virus (MDV) GX0101, which is a field strain with a naturally occurring insertion of the reticuloendotheliosis virus (REV) long terminal repeat (LTR) fragment, shows distinct biological activities. Deletion of the meq gene in GX0101 contributes to its complete loss of pathogenicity and oncogenicity in SPF chickens, but this virus has a kanamycin resistance gene (kan(r)) residual at the site of meq gene. In the present study, the kan(r) was knocked out and a meq-null virus with a good replicative ability termed SC9-1 was selected. In vivo studies showed that SC9-1 had no pathogenicity or tumorigenicity to chickens. There were no obvious impacts on chicken weight, immune organ index or antibody levels induced by avian influenza virus (AIV)/newcastle disease virus (NDV) inactivated vaccines compared with the control group. The SC9-1 virus provided superior protection than CVI988/Rispens vaccine in both SPF chickens and Hy-line brown chickens when challenged with a very virulent MDV (rMd5 strain). There was no obvious change in SC9-1 protection against MDV rMd5 in SPF chickens after 20 passages in chicken embryonic fibroblast cells (CEFs). In conclusion, SC9-1 is a safe and effective vaccine candidate for the prevention of Marek's disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. A novel silent deletion, an insertion mutation and a nonsense mutation in the TCOF1 gene found in two Chinese cases of Treacher Collins syndrome.

    Science.gov (United States)

    Wang, Yan; Yin, Xiao-Juan; Han, Tao; Peng, Wei; Wu, Hong-Lin; Liu, Xin; Feng, Zhi-Chun

    2014-12-01

    Treacher Collins syndrome (TCS) is the most common and well-known craniofacial disorder caused by mutations in the genes involved in pre-rRNA transcription, which include the TCOF1 gene. This study explored the role of TCOF1 mutations in Chinese patients with TCS. Mutational analysis of the TCOF1 gene was performed in three patients using polymerase chain reaction and direct sequencing. Among these three patients, two additional TCOF1 variations, a novel 18 bp deletion and a novel 1 bp insertion mutation, were found in patient 1, together with a novel nonsense mutation (p.Ser476X) and a previously reported 4 bp deletion (c.1872_1875delTGAG) in other patients. Pedigree analysis allowed for prediction of the character of the mutation, which was either pathological or not. The 18 bp deletion of six amino acids, Ser-Asp-Ser-Glu-Glu-Glu (798*803), which was located in the CKII phosphorylation site of treacle, seemed relatively benign for TCS. By contrast, another novel mutation of c.1072_1073insC (p.Gln358ProfsX23) was a frameshift mutation and expected to result in a premature stop codon. This study provides insights into the functional domain of treacle and illustrates the importance of clinical and family TCS screening for the interpretation of novel sequence alterations.

  3. Microarray Analysis of Transposon Insertion Mutants in Bacillus Anthracis: Global Identification of Genes Required for Sporulation and Germination

    Science.gov (United States)

    2007-02-01

    Gilois, M. Rose, and D. Lereclus. 2001. Oligopep- tide permease is required for expression of the Bacillus thuringiensis plcR regulon and for...non- toxin gene expression in Bacillus anthracis. Infect. Immun. 65:3091–3099. 10. Ikeda, R. A., C. M. Ligman, and S. Warshamana. 1992. T7 promoter con...nontoxi- genic Bacillus anthracis spore vaccines based on strains expressing mutant vari- ants of lethal toxin components. Vaccine 23:5688–5697. 17. Read

  4. Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover using a large insert BAC library

    Directory of Open Access Journals (Sweden)

    Thomas Ann

    2009-07-01

    Full Text Available Abstract Background Polyphenol oxidase (PPO activity in plants is a trait with potential economic, agricultural and environmental impact. In relation to the food industry, PPO-induced browning causes unacceptable discolouration in fruit and vegetables: from an agriculture perspective, PPO can protect plants against pathogens and environmental stress, improve ruminant growth by increasing nitrogen absorption and decreasing nitrogen loss to the environment through the animal's urine. The high PPO legume, red clover, has a significant economic and environmental role in sustaining low-input organic and conventional farms. Molecular markers for a range of important agricultural traits are being developed for red clover and improved knowledge of PPO genes and their structure will facilitate molecular breeding. Results A bacterial artificial chromosome (BAC library comprising 26,016 BAC clones with an average 135 Kb insert size, was constructed from Trifolium pratense L. (red clover, a diploid legume with a haploid genome size of 440–637 Mb. Library coverage of 6–8 genome equivalents ensured good representation of genes: the library was screened for polyphenol oxidase (PPO genes. Two single copy PPO genes, PPO4 and PPO5, were identified to add to a family of three, previously reported, paralogous genes (PPO1–PPO3. Multiple PPO1 copies were identified and characterised revealing a subfamily comprising three variants PPO1/2, PPO1/4 and PPO1/5. Six PPO genes clustered within the genome: four separate BAC clones could be assembled onto a predicted 190–510 Kb single BAC contig. Conclusion A PPO gene family in red clover resides as a cluster of at least 6 genes. Three of these genes have high homology, suggesting a more recent evolutionary event. This PPO cluster covers a longer region of the genome than clusters detected in rice or previously reported in tomato. Full-length coding sequences from PPO4, PPO5, PPO1/5 and PPO1/4 will facilitate

  5. Characterization of trimethoprim-sulfamethoxazole resistance genes and their relatedness to class 1 integron and insertion sequence common region in gram-negative bacilli.

    Science.gov (United States)

    Shin, Hae Won; Lim, Jinsook; Kim, Semi; Kim, Jimyung; Kwon, Gye Cheol; Koo, Sun Hoe

    2015-01-01

    Trimethoprim-sulfamethoxazole (TMP-SMX) has been used for the treatment of urinary tract infections, but increasing resistance to TMP-SMX has been reported. In this study, we analyzed TMP-SMX resistance genes and their relatedness with integrons and insertion sequence common regions (ISCRs) in uropathogenic gram-negative bacilli. Consecutive nonduplicate TMP-SMX nonsusceptible clinical isolates of E. coli, K. pneumoniae, Acinetobacter spp., and P. aeruginosa were collected from urine. The minimal inhibitory concentration was determined by Etest. TMP-SMX resistance genes (sul and dfr), integrons, and ISCRs were analyzed by PCR and sequencing. A total of 45 E. coli (37.8%), 15 K. pneumoniae (18.5%), 12 Acinetobacter spp. (70.6%), and 9 Pseudomonas aeruginosa (30.0%) isolates were found to be resistant to TMP-SMX. Their MICs were all over 640. In E. coli and K. pneumoniae, sul1 and dfr genes were highly prevalent in relation with integron1. The sul3 gene was detected in E. coli. However, in P. aeruginosa and Acinetobacter spp., only sul1 was prevalent in relation with class 1 integron; however, dfr was not detected and sul2 was less prevalent than in Enterobacteriaceae. ISCR1 and/or ISCR2 were detected in E. coli, K. pneumoniae, and Acinetobacter spp. but the relatedness with TMP-SMX resistance genes was not prominent. ISCR14 was detected in six isolates of E. coli. In conclusion, resistance mechanisms for TMP-SMX were different between Enterobacteriaceae and glucose non-fermenting gram-negative bacilli. Class 1 integron was widely disseminated in uropathogenic gram-negative baciili, so the adoption of prudent use of antimicrobial agents and the establishment of a surveillance system are needed.

  6. Association between an insertion/deletion polymorphism in IL-1A gene and cancer risk: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Ma L

    2015-12-01

    Full Text Available Ling Ma,1 Ning Zhou21Department of Stomatology, 2Department of Anesthesiology, No 454 Hospital, PLA, Nanjing, Jiangsu, People’s Republic of ChinaPurpose: Previous studies have reported the association of an insertion/deletion (Ins/Del polymorphism (rs3783553 in the 3' untranslated region of interleukin-1A (IL-1A with the risk of cancer, such as oral squamous cell carcinoma, nasopharyngeal carcinoma, and cervical carcinoma. However, the results are still inconsistent. The present meta-analysis aimed to clarify the association of IL-1A rs3783553 polymorphism with cancer risk.Methods: All eligible studies were selected from PubMed, Web of Science, and Chinese National Knowledge Infrastructure up to September 2, 2015. Summary odds ratios (ORs and 95% confidence intervals (CIs were used to evaluate cancer risk.Results: A total of ten case–control studies with 4,514 cases and 6,689 controls were included this meta-analysis. We found that IL-1A rs3783553 polymorphism was significantly associated with cancer risk (Ins/Ins + Ins/Del vs Del/Del: OR =0.79, 95% CI =0.67–0.92; Ins/Ins vs Del/Del: OR =0.61, 95% CI =0.47–0.79; Ins/Ins vs Ins/Del + Del/Del: OR =0.67, 95% CI =0.55–0.83; Ins vs Del: OR =0.81, 95% CI =0.72–0.92. In the stratified analyses, significant effects were found among Asian populations (Ins/Ins + Ins/Del vs Del/Del: OR =0.81, 95% CI =0.69–0.95 and cervical carcinoma (Ins/Ins vs Del/Del: OR =0.51, 95% CI =0.34–0.76; Ins/Ins vs Ins/Del + Del/Del: OR =0.52, 95% CI =0.35–0.78.Conclusion: Our meta-analysis suggests that the IL-1A rs3783553 polymorphism contributes to susceptibility to cancer. However, well-designed studies with larger sample sizes are required to verify the results.Keywords: IL-1A, polymorphism, cancer, meta-analysis

  7. Artifically inserting a reticuloendotheliosis virus long terminal repeat into a bacterial artificial chromosome clone of Marek's disease virus (MDV) alters expression of nearby MDV genes

    Science.gov (United States)

    The long terminal repeat (LTR) sequence of reticuloendotheliosis virus (REV) was inserted into the very virulent Marek’s disease virus (MDV) Md5 bacterial artificial chromosome clone. The insertion site was nearly identical to the REV LTR that was naturally inserted into the JM/102W strain of MDV fo...

  8. Targeting Human α-Lactalbumin Gene Insertion into the Goat β-Lactoglobulin Locus by TALEN-Mediated Homologous Recombination.

    Directory of Open Access Journals (Sweden)

    Hongmei Zhu

    Full Text Available Special value of goat milk in human nutrition and well being is associated with medical problems of food allergies which are caused by milk proteins such as β-lactoglobulin (BLG. Here, we employed transcription activator-like effector nuclease (TALEN-assisted homologous recombination in goat fibroblasts to introduce human α-lactalbumin (hLA genes into goat BLG locus. TALEN-mediated targeting enabled isolation of colonies with mono- and bi-allelic transgene integration in up to 10.1% and 1.1%, respectively, after selection. Specifically, BLG mRNA levels were gradually decreasing in both mo- and bi-allelic goat mammary epithelial cells (GMECs while hLA demonstrated expression in GMECs in vitro. Gene-targeted fibroblast cells were efficiently used in somatic cell nuclear transfer, resulting in production of hLA knock-in goats directing down-regulated BLG expression and abundant hLA secretion in animal milk. Our findings provide valuable background for animal milk optimization and expedited development for agriculture and biomedicine.

  9. Comparison of plasmid DNA versus PCR amplified gene of insert DNA for nucleofection in Kasumi-1 cells.

    Science.gov (United States)

    Wu, Kang; Zhao, Xu-Jie; Wong, Ka-Wing; Fan, Xiao-Yong

    2015-03-01

    Plasmid electroporation, or its optimized version nucleofection, is an important technique for gene transfection of cells in suspension. However, substantial cell death and/or low transfection efficiency are still common for some cell lines. By using enhanced green fluorescent protein (EGFP) as a reporter, we compared the use of PCR amplified EGFP (PaEGFP) and its parental plasmid (pEGFP-N2) for nucleofection in Kasumi-1 cells. We found that PaEGFP induced significantly lower cell death but had similar transfection efficiency compared to its parent plasmid (pEGFP-N2). Most importantly, contrary to the pEGFP-N2-nucleofected cells, the PaEGFP-nucleofected cells subsequently grew properly. Tests in other cell lines also implied that PaEGFP indeed induced consistently less cell death, but transfection efficiencies varied, being good in suspension cell lines but lower in adhesive cell lines. We suggest that direct transfection with PCR amplified genes can be a simple and useful approach for optimization of electropulse-based transfection not only of Kasumi-1 cells, but also may be useful for other cell lines that are difficult to transfect in suspension.

  10. Silencing of end-joining repair for efficient site-specific gene insertion after TALEN/CRISPR mutagenesis in Aedes aegypti.

    Science.gov (United States)

    Basu, Sanjay; Aryan, Azadeh; Overcash, Justin M; Samuel, Glady Hazitha; Anderson, Michelle A E; Dahlem, Timothy J; Myles, Kevin M; Adelman, Zach N

    2015-03-31

    Conventional control strategies for mosquito-borne pathogens such as malaria and dengue are now being complemented by the development of transgenic mosquito strains reprogrammed to generate beneficial phenotypes such as conditional sterility or pathogen resistance. The widespread success of site-specific nucleases such as transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 in model organisms also suggests that reprogrammable gene drive systems based on these nucleases may be capable of spreading such beneficial phenotypes in wild mosquito populations. Using the mosquito Aedes aegypti, we determined that mutations in the FokI domain used in TALENs to generate obligate heterodimeric complexes substantially and significantly reduce gene editing rates. We found that CRISPR/Cas9-based editing in the mosquito Ae. aegypti is also highly variable, with the majority of guide RNAs unable to generate detectable editing. By first evaluating candidate guide RNAs using a transient embryo assay, we were able to rapidly identify highly effective guide RNAs; focusing germ line-based experiments only on this cohort resulted in consistently high editing rates of 24-90%. Microinjection of double-stranded RNAs targeting ku70 or lig4, both essential components of the end-joining response, increased recombination-based repair in early embryos as determined by plasmid-based reporters. RNAi-based suppression of Ku70 concurrent with embryonic microinjection of site-specific nucleases yielded consistent gene insertion frequencies of 2-3%, similar to traditional transposon- or ΦC31-based integration methods but without the requirement for an initial docking step. These studies should greatly accelerate investigations into mosquito biology, streamline development of transgenic strains for field releases, and simplify the evaluation of novel Cas9-based gene drive systems.

  11. Prevalence of 5' insertion mutants and analysis of single nucleotide polymorphism in the erythrocyte binding-like 1 (ebl-1) gene in Kenyan Plasmodium falciparum field isolates.

    Science.gov (United States)

    Githui, Elijah K; Peterson, David S; Aman, Rashid A; Abdi, Abdirahman I

    2010-08-01

    Plasmodium merozoites attach to and invade red blood cells (RBCs) during the erythrocytic cycle. The invasion process requires recognition of RBC surface receptors by proteins of the Plasmodium Duffy binding like erythrocyte binding like (DBL-EBP) family. Clones and isolates of Plasmodium falciparum have varying abilities to utilize different RBC receptors, and multiple distinct pathways so far identified depend on glycophorins A, B, C, and as yet unidentified receptors. At present, five members of the DBL-EBP family have been identified in the P. falciparum genome, based on gene structure and amino acid sequence homology. The cardinal features of this family consist of conserved 5' and 3' cysteine-rich regions (regions II and VI, respectively) whose cysteine residues are highly conserved along with the majority of aromatic amino acids. In contrast to the single DBL-EBP family member in Plasmodium vivax, in P. falciparum all DBL-EBP family members have a duplication of the conserved 5' cysteine-rich region denoted as the F1 and F2 domains. These cysteine-rich regions are considered crucial in recognition of erythrocyte receptors and it has been shown that several bind to glycophorins on the erythrocyte surface. Several studies, on both field isolates and laboratory strains have uncovered a relatively high degree of sequence polymorphism in the DBP-EBL genes. This study is now extended to include field isolates collected from sites within Kenya. DNA isolated from blood samples of infected patients was utilized to amplify the region I sequence of ebl-1 gene in order to investigate polymorphism in the region immediately adjacent to the 5' cysteine-rich domains, and to determine the prevalence of an insertion mutant that effectively knocks out the gene. Copyright 2009 Elsevier B.V. All rights reserved.

  12. Association of DD Genotype of Insertion/Deletion Polymorphism of Angiotensin-Converting Enzyme Gene with Systemic Lupus Erythematosus and Lupus Nephropathy

    Directory of Open Access Journals (Sweden)

    Saeedeh Salimi

    2013-10-01

    Full Text Available Background: Systemic lupus erythematosus (SLE is a multisystem disease with unknown etiology. We hypothesized that insertion/deletion (I/D polymorphism of angiotensin-converting enzyme (ACE gene may influence the development and/or progression of SLE and lupus nephritis. Materials and Methods: In a crass sectional case-control study, genomic DNA from 106 SLE patients and 103 healthy controls matched for sex, age, and ethnicity, were genotyped for the (I/D polymorphism of ACE gene by polymerase chain reaction (PCR. Comparison of quantitative variants between two groups was assessed by student t-test and association between qualitative variables was analyzed by the chi-square or Fisher exact tests. Results: The frequency of DD genotype in SLE patients was significantly higher than control group (25.5 % vs. 14 %, and the risk of SLE was 2.2 times greater in subjects with DD genotype than the individual by DI and II genotypes (OR, 2.2 [95% CI, 1.1 to 4.4]; p=0.023. The distribution of D allele in SLE patients was significantly higher (p=0.021 compare to controls (47 and 36.4, respectively. The Risk of nephropathy in SLE patients with DD genotype was three times more than other genotypes (OR, 3 [95% CI, 1.1 to 8]; p=0.027].Conclusion: This study demonstrated that ACE DD genotype acts as a risk factor on SLE and Lupus nephropathy in an Iranian population.

  13. Associations between clinical characteristics and angiotensin-converting enzyme gene insertion/deletion polymorphism in Moroccan population with Type-2 diabetic nephropathy

    Directory of Open Access Journals (Sweden)

    Maria Mansouri

    2017-01-01

    Full Text Available Diabetic nephropathy (DN is one of the severe complications of Type-2 diabetes mellitus (T2DM and a major cause of end-stage renal disease in these patients. Results from published studies on the relationship between angiotensin-converting enzyme (ACE insertion/ deletion (I/D gene polymorphism and patients with DN are still conflicting. We compared the clinical characteristics and the genotype frequencies of ACE polymorphism in 130 T2DM Moroccan patients with DN and 85 T2DM Moroccan patients without DN (controls using specific primers in a polymerase chain reaction. The degenerative complications of diabetes were significantly higher in the group with nephropathy. The distribution of the I/D genotypes was in Hardy–Weinberg equilibrium. The D allele was the most frequent allele in the Moroccan population in both groups studied (P = 0.68, however, there was no significant difference between the genotypes in T2DM patients with or without DN (P = 0.78. The ACE gene I/D polymorphism was not associated with an increased risk of DN in the Moroccan population.

  14. In Vivo Acquisition of Carbapenemase Gene blaKPC-2 in Multiple Species of Enterobacteriaceae through Horizontal Transfer of Insertion Sequence or Plasmid

    Directory of Open Access Journals (Sweden)

    Baixing Ding

    2016-10-01

    Full Text Available Objectives: Current worldwide spread of carbapenem resistance in Enterobacteriaceae constitutes a critical public health threat. This study aims to investigate how carbapenem resistance is acquired in Enterobacteriaceae in patients during antimicrobial therapy. Methods: Clinical strains from the same anatomical site of the same patients that converted from carbapenem-susceptible to resistant during antimicrobial therapy and showed identical or similar PFGE patterns were identified. The similarly sized plasmids carried by the susceptible and resistant strains, the latter containing the carbapenemase genes, were sequenced and analyzed. Results: Paired strains were identified from four patients: three had neurosurgical conditions while the other had acute exacerbation of COPD. Two pairs of Klebsiella pneumoniae (KP1-S/R and KP2-S/R, S and R indicating susceptible and resistant strains, respectively, one pair of Morganella morganii (MM-S/R and one pair of Enterobacter aerogenes (EA-S/R were collected. All four carbapenem-resistant strains carried plasmids harboring blaKPC-2. Compared with the similarly sized plasmids in KP1-S and KP2-S, an insertion sequence that includes ISKpn6-like, blaKPC-2 and ISKpn8 was noted in pKP1-R and pKP2-R. Strains MM-R and EA-R had blaKPC-2-carrying plasmids not resembling plasmids in strains MM-S and EA-S suggesting their new acquisition while on therapy. Conclusions: Enterobacteriaceae can acquire carbapenem resistance during antimicrobial therapy through horizontal transfer of an insertion sequence or plasmid.

  15. Nucleotide diversity of the ZmPox3 maize peroxidase gene: Relationships between a MITE insertion in exon 2 and variation in forage maize digestibility

    Directory of Open Access Journals (Sweden)

    Rigau Joan

    2004-07-01

    Full Text Available Abstract Background Polymorphisms were investigated within the ZmPox3 maize peroxidase gene, possibly involved in lignin biosynthesis because of its colocalization with a cluster of QTL related to lignin content and cell wall digestibility. The purpose of this study was to identify, on the basis of 37 maize lines chosen for their varying degrees of cell wall digestibility and representative of temperate regions germplasm, ZmPox3 haplotypes or individual polymorphisms possibly associated with digestibility. Results Numerous haplotypes with high diversity were identified. Frequency of nucleotide changes was high with on average one SNP every 57 bp. Nucleotide diversity was not equally distributed among site categories: the estimated π was on average eight times higher for silent sites than for non-synonymous sites. Numerous sites were in linkage disequilibrium that decayed with increasing physical distance. A zmPox3 mutant allele, carrying an insertion of a transposable element in the second exon, was found in lines derived from the early flint inbred line, F7. This element possesses many structural features of miniature inverted-repeat transposable elements (MITE. The mutant allele encodes a truncated protein lacking important functional sites. An ANOVA performed with a subset of 31 maize lines indicated that the transposable element was significantly associated with cell wall digestibility. This association was confirmed using an additional set of 25 flint lines related to F7. Moreover, RT-PCR experiments revealed a decreased amount of corresponding mRNA in plants with the MITE insertion. Conclusion These results showed that ZmPox3 could possibly be involved in monolignol polymerisation, and that a deficiency in ZmPox3 peroxidase activity seemingly has a negative effect on cell wall digestibility. Also, genetic diversity analyses of ZmPox3 indicated that this peroxidase could be a relevant target for grass digestibility improvement using

  16. In vivo Acquisition of Carbapenemase Gene blaKPC-2 in Multiple Species of Enterobacteriaceae through Horizontal Transfer of Insertion Sequence or Plasmid

    Science.gov (United States)

    Ding, Baixing; Shen, Zhen; Hu, Fupin; Ye, Meiping; Xu, Xiaogang; Guo, Qinglan; Wang, Minggui

    2016-01-01

    Objectives: Current worldwide spread of carbapenem resistance in Enterobacteriaceae constitutes a critical public health threat. This study aims to investigate how carbapenem resistance is acquired in Enterobacteriaceae in patients during antimicrobial therapy. Methods: Clinical strains from the same anatomical site of the same patients that converted from carbapenem-susceptible to resistant during antimicrobial therapy and showed identical or similar PFGE patterns were identified. The similarly sized plasmids carried by the susceptible and resistant strains, the latter containing the carbapenemase genes, were sequenced and analyzed. Results: Paired strains were identified from four patients: three had neurosurgical conditions while the other had acute exacerbation of COPD. Two pairs of Klebsiella pneumoniae (KP1-S/R and KP2-S/R, S and R indicating susceptible and resistant strains, respectively), one pair of Morganella morganii (MM-S/R) and one pair of Enterobacter aerogenes (EA-S/R) were collected. All four carbapenem-resistant strains carried plasmids harboring blaKPC−2. Compared with the similarly sized plasmids in KP1-S and KP2-S, an insertion sequence that includes ISKpn6-like, blaKPC−2 and ISKpn8 was noted in pKP1-R and pKP2-R. Strains MM-R and EA-R had blaKPC−2-carrying plasmids not resembling plasmids in strains MM-S and EA-S suggesting their new acquisition while on therapy. Conclusions: Enterobacteriaceae can acquire carbapenem resistance during antimicrobial therapy through horizontal transfer of an insertion sequence or plasmid. PMID:27818649

  17. Immunologic applications of conditional gene modification technology in the mouse.

    Science.gov (United States)

    Sharma, Suveena; Zhu, Jinfang

    2014-04-02

    Since the success of homologous recombination in altering mouse genome and the discovery of Cre-loxP system, the combination of these two breakthroughs has created important applications for studying the immune system in the mouse. Here, we briefly summarize the general principles of this technology and its applications in studying immune cell development and responses; such implications include conditional gene knockout and inducible and/or tissue-specific gene over-expression, as well as lineage fate mapping. We then discuss the pros and cons of a few commonly used Cre-expressing mouse lines for studying lymphocyte development and functions. We also raise several general issues, such as efficiency of gene deletion, leaky activity of Cre, and Cre toxicity, all of which may have profound impacts on data interpretation. Finally, we selectively list some useful links to the Web sites as valuable mouse resources.

  18. Photonics Research and Technology Insertion

    Science.gov (United States)

    2015-06-05

    spectroscopy ( SERS ) detection of bacteria and spores. Transition: Several compact instruments were developed using these enhanced substrates with a...Startup company licensed to develop SERS bacterial detection prototype (Raman Systems Inc, Boston, MA) Collaborative efforts with USAMRIID for...for sniper detection , bacterial and viral detection , laser communication, blue light and UV light source development, and nanophotonic detection

  19. Disruption of bbe02 by Insertion of a Luciferase Gene Increases Transformation Efficiency of Borrelia burgdorferi and Allows Live Imaging in Lyme Disease Susceptible C3H Mice.

    Directory of Open Access Journals (Sweden)

    Kamfai Chan

    Full Text Available Lyme disease is the most prevalent tick-borne disease in North America and Europe. The causative agent, Borrelia burgdorferi persists in the white-footed mouse. Infection with B. burgdorferi can cause acute to persistent multisystemic Lyme disease in humans. Some disease manifestations are also exhibited in the mouse model of Lyme disease. Genetic manipulation of B. burgdorferi remains difficult. First, B. burgdorferi contains a large number of endogenous plasmids with unique sequences encoding unknown functions. The presence of these plasmids needs to be confirmed after each genetic manipulation. Second, the restriction modification defense systems, including that encoded by bbe02 gene lead to low transformation efficiency in B. burgdorferi. Therefore, studying the molecular basis of Lyme pathogenesis is a challenge. Furthermore, investigation of the role of a specific B. burgdorferi protein throughout infection requires a large number of mice, making it labor intensive and expensive. To overcome the problems associated with low transformation efficiency and to reduce the number of mice needed for experiments, we disrupted the bbe02 gene of a highly infectious and pathogenic B. burgdorferi strain, N40 D10/E9 through insertion of a firefly luciferase gene. The bbe02 mutant shows higher transformation efficiency and maintains luciferase activity throughout infection as detected by live imaging of mice. Infectivity and pathogenesis of this mutant were comparable to the wild-type N40 strain. This mutant will serve as an ideal parental strain to examine the roles of various B. burgdorferi proteins in Lyme pathogenesis in the mouse model in the future.

  20. Spontaneous asj-2J mutant mouse as a model for generalized arterial calcification of infancy: a large deletion/insertion mutation in the Enpp1 gene.

    Directory of Open Access Journals (Sweden)

    Qiaoli Li

    Full Text Available Generalized arterial calcification of infancy (GACI, an autosomal recessive disorder caused by mutations in the ENPP1 gene, manifests with extensive mineralization of the cardiovascular system. The affected individuals in most cases die within the first year of life, and there is currently no effective treatment for this disorder. In this study, we characterized a spontaneous mutant mouse, asj-2J, as a model for GACI. These mice were identified as part of a phenotypic deviant search in a large-scale production colony of BALB/cJ mice at The Jackson Laboratory. They demonstrated a characteristic gait due to stiffening of the joints, with phenotypic similarity to a previously characterized asj ("ages with stiffened joints" mouse, caused by a missense mutation in the Enpp1 gene. Complementation testing indicated that asj-2J and asj were allelic. PCR-based mutation detection strategy revealed in asj-2J mice a large, 40,035 bp, deletion spanning from intron 1 to the 3'-untranslated region of the Enpp1 gene, coupled with a 74 bp insertion. This was accompanied with a significant reduction in the plasma PPi concentration and reduced PPi/Pi ratio. As a consequence, extensive aberrant mineralization affecting the arterial vasculature, a number of internal organs, and the dermal sheath of vibrissae, a progressive biomarker of the ectopic mineralization process, was demonstrated by a combination of micro computed tomography, histopathology with calcium-specific stains, and direct chemical assay of calcium. Comparison of the asj and asj-2J mice demonstrated that the latter ones, particularly when placed on an acceleration diet high in phosphate and low in magnesium, had more extensive mineralization. Thus, the asj-2J mouse serves as a novel model for GACI, a currently intractable disorder.

  1. Fatal sepsis caused by multidrug-resistant Bacteroides fragilis, harboring a cfiA gene and an upstream insertion sequence element, in Japan.

    Science.gov (United States)

    Nakamura, Itaru; Aoki, Kotaro; Miura, Yuri; Yamaguchi, Tetsuo; Matsumoto, Tetsuya

    2017-04-01

    Here, we report a case of fatal sepsis resulting from an intra-abdominal infection caused by a Bacteroides fragilis strain containing a CfiA4 metallo-β-lactamase and an upstream insertion sequence (IS) element. Meropenem was used as empiric therapy for septic shock as a result of the intra-abdominal infection, although two rounds of carbapenem treatment had been administered previously. B. fragilis was isolated from two anaerobic blood culture bottles 4 days after the onset of septic shock. Susceptibility testing revealed that the isolate was non-susceptible to all tested agents except metronidazole and tigecycline. The isolate gave a positive result in ethylenediaminetetraacetic acid and carbapenem inactivation tests, but a negative result in a double-disk synergy test using sodium mercaptoacetate. Next-generation whole-genome sequencing indicated the presence of the cfiA4, emrG and emrF genes. PCR indicated the presence of an IS element upstream of the cifA4 gene. Although carbapenem-resistant B. fragilis isolates have previously been reported, clinical sepsis by this organism is considered rare. In Japan, as in most countries worldwide, routine susceptibility testing and the detection of metallo-β-lactamases is not carried out in anaerobic organisms, including B. fragilis. The emergence of carbapenem resistance during therapy should be monitored, as B. fragilis strains containing the cfiA gene show decreased sensitivity during carbapenem therapy. Therefore, susceptibility testing and appropriate antibiotic stewardship are required in cases of anaerobic bacterial infections. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH).

    Science.gov (United States)

    Leveau, Johan H J; Gerards, Saskia; de Boer, Wietse; van Veen, Johannes A

    2004-09-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia coli of large-sized genomic DNA fragments of the mycophagous soil bacterium Collimonas fungivorans, and hybridized 768 library clones with the Collimonas-specific fluorescent probe CTE998-1015. Critical to the success of this approach (which we refer to as large-insert library FISH or LIL-FISH) was the ability to induce fosmid copy number, the exponential growth status of library clones in the FISH assay and the use of a simple pooling strategy to reduce the number of hybridizations. Twelve out of 768 E. coli clones were suspected to harbour and express Collimonas 16S rRNA genes based on their hybridization to CTE998-1015. This was confirmed by the finding that all 12 clones were also identified in an independent polymerase chain reaction-based screening of the same 768 clones using a primer set for the specific detection of Collimonas 16S ribosomal DNA (rDNA). Fosmids isolated from these clones were grouped by restriction analysis into two distinct contigs, confirming that C. fungivorans harbours at least two 16S rRNA genes. For one contig, representing 1-2% of the genome, the nucleotide sequence was determined, providing us with a narrow but informative view of Collimonas genome structure and content.

  3. Prevalence of angiotensin converting enzyme (ACE gene insertion/deletion polymorphism in South Indian population with hypertension and chronic kidney disease

    Directory of Open Access Journals (Sweden)

    R Shanmuganathan

    2015-01-01

    Full Text Available Context: Chronic Kidney Disease (CKD is associated with a high risk of developing further severe complications such as, cardiovascular disease and eventually End Stage Renal Disease (ESRD leading to death. Hypertension plays a key role in the progression of renal failure and is also a chief risk factor for the occurrence of End Stage Renal Disease (ESRD. Aim: This study investigates the possible association of insertion (I and deletion (D polymorphism of ACE gene in patients of Chronic Kidney Disease (CKD with and without hypertension (HT. Settings and Design: Total 120 participants with 30 members in each group (Control, HT, CKD and CKD-HT were chosen followed by informed consent. Materials and Methods: Blood samples were collected and subjected to biochemical analyses and nested PCR amplification was performed to genotype the DNA, for ACE I/D using specific primers. Statistical Analysis: Statistical analyses were performed using SPSS version 13. Allele and genotypic frequency was calculated by direct gene counting method. Comparison of the different genotypes was done by using Chi square test. Odd′s ratios were calculated with a 95% confidence interval limit. Results: The ACE genotype were distributed as II, 27 (90%; DD, 2 (6.67% and ID, 1 (3.33% in control, II, 1 (3.33%; DD, 5 (16.67% and ID, 24 (80% in HT, II, 4 (13.33%; DD, 24 (80% and ID, 2 (6.67% in CKD and II, 0 (0%; DD, 2 (6.67% and ID, 28 (93.33% in CKD-HT group. Conclusions: D allele of ACE gene confers a greater role in genetic variations underlying CKD and hypertension. This result suggest that CKD patients should be offered analysis for defects in ACE I/D polymorphisms, especially if they are hypertensive.

  4. First detection of insertion sequence element ISPa1328 in the oprD porin gene of an imipenem-resistant Pseudomonas aeruginosa isolate from an idiopathic pulmonary fibrosis patient in Marseille, France

    Science.gov (United States)

    Al-Bayssari, C.; Valentini, C.; Gomez, C.; Reynaud-Gaubert, M.; Rolain, J.-M.

    2015-01-01

    We report here the first case of a carbapenem-resistant Pseudomonas aeruginosa clinical isolate harboring the insertion sequence (IS) element ISPa1328 in the oprD gene in an idiopathic pulmonary fibrosis patient in France previously treated with imipenem. PMID:26137309

  5. First detection of insertion sequence element ISPa1328 in the oprD porin gene of an imipenem-resistant Pseudomonas aeruginosa isolate from an idiopathic pulmonary fibrosis patient in Marseille, France

    Directory of Open Access Journals (Sweden)

    C. Al-Bayssari

    2015-09-01

    Full Text Available We report here the first case of a carbapenem-resistant Pseudomonas aeruginosa clinical isolate harboring the insertion sequence (IS element ISPa1328 in the oprD gene in an idiopathic pulmonary fibrosis patient in France previously treated with imipenem.

  6. Technology of preventing drilling hole collapse in soft coal seam by inserting casing in drill pipe%钻杆内下套管防治软煤层钻孔塌孔技术

    Institute of Scientific and Technical Information of China (English)

    李定启; 邓广涛; 李海贵; 王明中

    2015-01-01

    In order to prevent collapse and block of drilling hole in short time when conducting gas extraction in soft coal seam, and improve the gas drainage efficiency of drilling, the equipments and methods of inserting casing in drill pipe for soft coal seam were analyzed and studied.By comparing and analyzing the experimental results in soft coal seam with conventional technology of casing running, original technology of inserting casing in drill pipe and improved technology of inserting casing in drill pipe, it showed that:the length of inserting casing by the improved technology is much greater than that by conventional technology, and the design of drill bit and drilling rob on e-quipment of inserting casing in drill pipe have a greater influence on the drilling and length of inserting casing.In the design, the diameter of drilling bit should be moderate and the smooth joint connection should be adopted on drilling rob.The gas drainage capacity of drilling per hundred meters by this technology is much greater than that by ordinary technology.%为了防止软煤层钻孔在瓦斯抽采过程中短时间内塌孔堵死,提高钻孔瓦斯抽放效率,对软煤层钻孔钻杆内下套管设备和工艺方法进行了分析和研究。通过对比分析常规下套管方式、原有钻杆内下套管方式和改进后钻杆内下套管方式的在软煤层试验,得出以下结论:采用钻杆内下套管设备下套管的长度远大于采用常规钻进方式下套管的长度;钻杆内下套管设备的钻头和钻杆设计对钻进和下套管长度影响较大,设计时钻头直径大小应适中,钻杆应尽量采取内平丝扣连接;采用钻杆内下套管方式的百米钻孔瓦斯抽放量要远大于普通钻进下套管钻孔的百米钻孔瓦斯抽放量。

  7. Insertion sequence IS1016 and absence of Haemophilus capsulation genes in the Brazilian purpuric fever clone of Haemophilus influenzae biogroup aegyptius.

    Science.gov (United States)

    Dobson, S R; Kroll, J S; Moxon, E R

    1992-02-01

    Brazilian purpuric fever (BPF) strains of Haemophilus influenzae biogroup aegyptius form a clone of organisms distinct from more innocuous, conjunctivitis-associated isolates. There has been controversy over whether the virulence of BPF strains might derive from the presence of a polysaccharide capsule analogous to that found in conventional invasive H. influenzae, a controversy fuelled by the observation (G. M. Carlone, L. Gorelkin, L. L. Gheesling, A. L. Erwin, S. K. Hoiseth, M. H. O. Mulks, S. P. Connor, R. S. Weyant, J. Myrick, L. Rubin, R. S. Mumford III, E. H. White, R. J. Arko, B. Swaminathan, L. M. Graves, L. W. Mayer, M. K. Robinson, S. P. Caudill, and the Brazilian Purpuric Fever Study Group, J. Clin, Microbiol. 27:609-614, 1989) that a capsulation DNA probe from H. influenzae type b hybridized uniquely to BPF strains. In this work, the basis for this hybridization has been established as the possession by BPF strains, but not by non-BPF strains, of the Haemophilus insertion element IS1016. Although IS1016 is associated with the capsulation locus in some Haemophilus spp., a Southern hybridization study suggests that in BPF strains there are no capsulation genes.

  8. Association between angiotensin converting enzyme gene insertion/deletion polymorphism and renal scar risk in children vesicoureteral reflex: a reappraise meta-analysis.

    Science.gov (United States)

    Ai, Jin-Wei; Zeng, Xian-Tao; Liu, Ying; Fu, Yu; Liu, Tong-Zu; Pei, Bin

    2016-08-10

    Vesicoureteral reflex(VUR) is a common disease in children. Some studies indicated that the angiotensin converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism associated with the renal scar in VUR, but not all researchers agreed with it. To clarify the effect of ACE I/D polymorphism on renal scar risk in children with VUR, we performed the present meta-analysis. PubMed, CNKI, CBM, and Embase databases were searched for studies that examined the relationship between ACE I/D polymorphism and renal scar risk in children with VUR. The Stata 12.0 software was used for statistical analyses. 11 case-control studies with 1,032 VUR patients were analyzed. The results showed that the DD genotype and D allele were associated with renal scar risk in overall VUR patients, DD vs. DI + II: OR = 1.61, 95% CI = 1.04-2.49, P = 0.03; DD vs. II: OR = 1.78, 95% CI = 1.20-2.65, P increase the risk of renal scar in children with VUR.

  9. Association of AluYb8 insertion/deletion polymorphism in the MUTYH gene with mtDNA maintain in the type 2 diabetes mellitus patients.

    Science.gov (United States)

    Guo, Wenwen; Zheng, Bixia; Guo, Dong; Cai, Zhenming; Wang, Yaping

    2015-07-05

    A common AluYb8-element insertion/deletion polymorphism of the MUTYH gene (AluYb8MUTYH) is a novel genetic risk factor for type 2 diabetes mellitus (T2DM). In the present study, mtDNA sequencing analysis indicated that the mtDNA sequence heteroplasmy was not associated with AluYb8MUTYH polymorphism. To better understand the genetic risk for T2DM, we investigated the association of this polymorphism with mtDNA content, mtDNA breakage and mtDNA transcription in the leukocytes of T2DM patients. The mtDNA content and unbroken mtDNA were significantly increased in the mutant patients than in the wild-type patients (P <0.05, respectively). However, no association between mtDNA transcription and AluYb8MUTYH variant was observed. The results suggested that the AluYb8MUTYH variant was associated with an altered mtDNA maintain in T2DM patients. The high level of mtDNA content observed in the mutant patients may have resulted from inefficient base excision repair of mitochondrial MUTYH and a compensatory mechanism that is triggered by elevated oxidative stress.

  10. Association between insertion/deletion polymorphism in angiotensin-converting enzyme gene and acute lung injury/acute respiratory distress syndrome: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Matsuda Akihisa

    2012-08-01

    Full Text Available Abstract Background A previous meta-analysis reported a positive association between an insertion/deletion (I/D polymorphism in the angiotensin-converting enzyme gene (ACE and the risk of acute lung injury (ALI/acute respiratory distress syndrome (ARDS. Here, we updated this meta-analysis and additionally assessed the association of this polymorphism with ALI/ARDS mortality. Methods We searched electronic databases through October 2011 for the terms “angiotensin-converting enzyme gene”, “acute lung injury”, and “acute respiratory distress syndrome,” and reviewed all studies that reported the relationship of the I/D polymorphism in ACE with ALI/ARDS in humans. Seven studies met the inclusion criteria, comprising 532 ALI/ARDS patients, 3032 healthy controls, and 1432 patients without ALI/ARDS. We used three genetic models: the allele, dominant, and recessive models. Results The ACE I/D polymorphism was not associated with susceptibility to ALI/ARDS for any genetic model. However, the ACE I/D polymorphism was associated with the mortality risk of ALI/ARDS in Asian subjects ( Pallele Pdominant = 0.001, Precessive = 0.002. This finding remained significant after correction for multiple comparisons. Conclusions There is a possible association between the ACE I/D polymorphism genotype and the mortality risk of ALI/ARDS in Asians.

  11. Does the Angiotensin-converting enzyme (ACE gene insertion/deletion polymorphism modify the response to ACE inhibitor therapy? – A systematic review

    Directory of Open Access Journals (Sweden)

    Perna Annalisa

    2005-10-01

    Full Text Available Abstract Background Pharmacogenetic testing to individualize ACE inhibitor therapy remains controversial. We conducted a systematic review to assess the effect modification of the insertion/deletion (I/D polymorphism of the ACE gene on any outcome in patients treated with ACE inhibitors for cardiovascular and/or renal disease. Methods Our systematic review involved searching six electronic databases, then contacting the investigators (and pharmaceutical industry representatives responsible for the creation of these databases. Two reviewers independently selected relevant randomized, placebo-controlled trials and abstracted from each study details on characteristics and quality. Results Eleven studies met our inclusion criteria. Despite repeated efforts to contact authors, only four of the eleven studies provided sufficient data to quantify the effect modification by genotypes. We observed a trend towards better response to ACE inhibitors in Caucasian DD carriers compared to II carriers, in terms of blood pressure, proteinuria, glomerular filtration rate, ACE activity and progression to end-stage renal failure. Pooling of the results was inappropriate, due to heterogeneity in ethnicity, clinical domains and outcomes. Conclusion Lack of sufficient genetic data from the reviewed studies precluded drawing any convincing conclusions. Better reporting of genetic data are needed to confirm our preliminary observations concerning better response to ACE inhibitors among Caucasian DD carriers as compared to II carriers.

  12. Experimental gene therapy using p21Waf1 gene for esophageal squamous cell carcinoma by gene gun technology.

    Science.gov (United States)

    Tanaka, Yuichi; Fujii, Teruhiko; Yamana, Hideaki; Kato, Seiya; Morimatsu, Minoru; Shirouzu, Kazuo

    2004-10-01

    In our previous study, the proliferation rate of esophageal squamous cell carcinoma cell lines, which poorly expressed p21Waf1, was found to be regulated by p21Waf1 gene transfection using adenovirus vector. In the present study, in order to examine the effect of p21Waf1 gene therapy in esophageal cancer, we used gene gun technology, which proved to be a powerful method to introduce the p21Waf1 gene into esophageal cancer cells. p21Waf1 transfection to KE3 and YES2 cells (weakly expressed p21Waf1 protein cells) showed a high expression of p21Waf1 protein after applying this gene gun technique. In KE3 and YES2 cells, statistical significant growth inhibition was observed after p21Waf1 transfection compared with LacZ transfection (KE3, p=0.0009; YES2, pgun technique significantly inhibited the low basal p21Waf1 expressed esophageal cancer cell growth in vitro and in vivo. Furthermore, p21Waf1 transfection strongly enhanced the effect of 5Fu suggesting that p21Waf1 may prove beneficial in chemotherapy combined with gene therapy using gene gun technology in patients with esophageal cancer who have a low level of p21Waf1 expressed tumor.

  13. Technological issues and experimental design of gene association studies.

    Science.gov (United States)

    Distefano, Johanna K; Taverna, Darin M

    2011-01-01

    Genome-wide association studies (GWAS), in which thousands of single-nucleotide polymorphisms (SNPs) spanning the genome are genotyped in individuals who are phenotypically well characterized, -currently represent the most popular strategy for identifying gene regions associated with common -diseases and related quantitative traits. Improvements in technology and throughput capability, development of powerful statistical tools, and more widespread acceptance of pooling-based genotyping approaches have led to greater utilization of GWAS in human genetics research. However, important considerations for optimal experimental design, including selection of the most appropriate genotyping platform, can enhance the utility of the approach even further. This chapter reviews experimental and technological issues that may affect the success of GWAS findings and proposes strategies for developing the most comprehensive, logical, and cost-effective approaches for genotyping given the population of interest.

  14. Development of a versatile and conventional technique for gene disruption in filamentous fungi based on CRISPR-Cas9 technology.

    Science.gov (United States)

    Zheng, Yan-Mei; Lin, Fu-Long; Gao, Hao; Zou, Gen; Zhang, Jiang-Wei; Wang, Gao-Qian; Chen, Guo-Dong; Zhou, Zhi-Hua; Yao, Xin-Sheng; Hu, Dan

    2017-08-23

    Filamentous fungi represent an invaluable source of pharmaceutically active compounds. The development of versatile methods to genetically manipulate filamentous fungi is of great value for improving the low yields of bioactive metabolites and expanding chemical diversity. The CRISPR-Cas9-based system has become a common platform for genome editing in a variety of organisms. However, recent application of this technology in filamentous fungi is limited to model strains, a versatile method for efficient gene disruption in different fungi is lacking. Here, we investigated the utility of the CRISPR-Cas9 system in a less-studied fungus Nodulisporium sp. (No. 65-12-7-1), and we have developed an efficient CRISPR-Cas9-based gene disruption strategy by simultaneous transformation of in vitro transcriptional gRNA and the linear maker gene cassette into the Cas9-expressing fungi. We found that the linear marker gene cassette could not only allow for selection of transformants, but also significantly enhance the gene disruption efficiency by inserting itself into the Cas9 cut site. Moreover, the above approach also demonstrated its efficiency in two other phylogenetically distinct strains Aspergillus oryzae NSAR1 and Sporormiella minima (No. 40-1-4-1) from two different classes of Ascomycota. These results suggested that a versatile CRISPR-Cas9-based gene disruption method in filamentous fungi was established.

  15. Chest tube insertion

    Science.gov (United States)

    ... tube insertion; Insertion of tube into chest; Tube thoracostomy; Pericardial drain ... Kirsch TD, Sax J. Tube thoracostomy. In: Roberts JR, ed. Roberts and ... . 6th ed. Philadelphia, PA: Elsevier Saunders; 2014:chap 10.

  16. Feeding tube insertion - gastrostomy

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/002937.htm Feeding tube insertion - gastrostomy To use the sharing features on this page, please enable JavaScript. A gastrostomy feeding tube insertion is the placement of a feeding ...

  17. Regional Fluctuation in the Functional Consequence of LINE-1 Insertion in the Mitf Gene: The Black Spotting Phenotype Arisen from the Mitfmi-bw Mouse Lacking Melanocytes.

    Science.gov (United States)

    Takeda, Kazuhisa; Hozumi, Hiroki; Ohba, Koji; Yamamoto, Hiroaki; Shibahara, Shigeki

    2016-01-01

    Microphthalmia-associated transcription factor (Mitf) is a key regulator for differentiation of melanoblasts, precursors to melanocytes. The mouse homozygous for the black-eyed white (Mitfmi-bw) allele is characterized by the white-coat color and deafness with black eyes due to the lack of melanocytes. The Mitfmi-bw allele carries LINE-1, a retrotransposable element, which results in the Mitf deficiency. Here, we have established the black spotting mouse that was spontaneously arisen from the homozygous Mitfmi-bw mouse lacking melanocytes. The black spotting mouse shows multiple black patches on the white coat, with age-related graying. Importantly, each black patch also contains hair follicles lacking melanocytes, whereas the white-coat area completely lacks melanocytes. RT-PCR analyses of the pigmented patches confirmed that the LINE-1 insertion is retained in the Mitf gene of the black spotting mouse, thereby excluding the possibility of the somatic reversion of the Mitfmi-bw allele. The immunohistochemical analysis revealed that the staining intensity for beta-catenin was noticeably lower in hair follicles lacking melanocytes of the homozygous Mitfmi-bw mouse and the black spotting mouse, compared to the control mouse. In contrast, the staining intensity for beta-catenin and cyclin D1 was higher in keratinocytes of the black spotting mouse, compared to keratinocytes of the control mouse and the Mitfmi-bw mouse. Moreover, the keratinocyte layer appears thicker in the Mitfmi-bw mouse, with the overexpression of Ki-67, a marker for cell proliferation. We also show that the presumptive black spots are formed by embryonic day 15.5. Thus, the black spotting mouse provides the unique model to explore the molecular basis for the survival and death of developing melanoblasts and melanocyte stem cells in the epidermis. These results indicate that follicular melanocytes are responsible for maintaining the epidermal homeostasis; namely, the present study has provided

  18. Associations of ACE gene insertion/deletion polymorphism, ACE activity, and ACE mRNA expression with hypertension in a Chinese population.

    Directory of Open Access Journals (Sweden)

    Qingfang He

    Full Text Available The present study was designed to explore the association of angiotensin converting enzyme (ACE gene insertion/deletion (I/D, rs4646994 polymorphism, plasma ACE activity, and circulating ACE mRNA expression with essential hypertension (EH in a Chinese population. In addition, a new detection method for circulating ACE mRNA expression was explored.The research was approved by the ethics committee of Zhejiang Provincial Center for Disease Prevention and Control. Written informed consent was obtained prior to the investigation. 221 hypertensives (cases and 221 normotensives (controls were interviewed, subjected to a physical examination, and provided blood for biochemical and genetic tests. The ACE mRNA expression was analyzed by real time fluorescent quantitative Reverse Transcription PCR (FQ-RT-PCR. We performed logistic regression to assess associations of ACE I/D genotypes, ACE activity, and ACE mRNA expression levels with hypertension.The results of the multivariate logistic regression analysis showed that the additive model (ID, DD versus II of the ACE genotype revealed an association with hypertension with adjusted OR of 1.43(95% CI: 1.04-1.97, and ACE ID genotype with adjusted OR of 1.72(95% CI: 1.01-2.92, DD genotype with adjusted OR of 1.94(95% CI: 1.01-3.73, respectively. In addition, our data also indicate that plasma ACE activity (adjusted OR was 1.13(95% CI: 1.08-1.18 was significantly related to hypertension. However, the plasma ACE mRNA expressions were not different between the cases and controls.ACE I/D polymorphism and ACE activity revealed significant influence on hypertension, while circulating ACE mRNA expression was not important factors associated with hypertension in this Chinese population. The detection of circulating ACE mRNA expression by FQ-RT-PCR might be a useful method for early screening and monitoring of EH.

  19. Long-distance effects of insertional mutagenesis.

    Directory of Open Access Journals (Sweden)

    Ruchi Singhal

    Full Text Available BACKGROUND: Most common systems of genetic engineering of mammalian cells are associated with insertional mutagenesis of the modified cells. Insertional mutagenesis is also a popular approach to generate random alterations for gene discovery projects. A better understanding of the interaction of the structural elements within an insertional mutagen and the ability of such elements to influence host genes at various distances away from the insertion site is a matter of considerable practical importance. METHODOLOGY/PRINCIPAL FINDINGS: We observed that, in the context of a lentiviral construct, a transcript, which is initiated at an internal CMV promoter/enhancer region and incorporates a splice donor site, is able to extend past a collinear viral LTR and trap exons of host genes, while the polyadenylation signal, which is naturally present in the LTR, is spliced out. Unexpectedly, when a vector, which utilizes this phenomenon, was used to produce mutants with elevated activity of NF-κB, we found mutants, which owed their phenotype to the effect of the insert on a gene located tens or even hundreds of kilobases away from the insertion site. This effect did not result from a CMV-driven transcript, but was sensitive to functional suppression of the insert. Interestingly, despite the long-distance effect, expression of loci most closely positioned to the insert appeared unaffected. CONCLUSIONS/SIGNIFICANCE: We concluded that a polyadenylation signal in a retroviral LTR, when occurring within an intron, is an inefficient barrier against the formation of a hybrid transcript, and that a vector containing a strong enhancer may selectively affect the function of genes far away from its insertion site. These phenomena have to be considered when experimental or therapeutic transduction is performed. In particular, the long-distance effects of insertional mutagenesis bring into question the relevance of the lists of disease-associated retroviral integration

  20. Telemetric Technologies for the Assay of Gene Expression

    Science.gov (United States)

    Paul, Anna-Lisa; Bamsey, Matthew; Berinstain, Alain; Neron, Philip; Graham, Thomas; Ferl, Robert

    Telemetric data collection has been widely used in spaceflight applications where human participation is limited (orbital mission payloads) or unfeasible (planetary landers, satellites, and probes). The transmission of digital data from electronic sensors of typical environmental parameters, growth patterns and physical properties of materials is routine telemetry, and even the collection and transmission of deep space images is a standard tool of astrophysics. But telemetric imaging for current biological payloads has thus far been limited to the collection of standard white-light photography that is largely confined to reporting the surface characteristics of the specimens involved. Advances in imaging technologies that facilitate the collection of a variety of light wavelengths will expand the science return on biological payloads to include evaluations of the molecular genetic response of organisms to the spaceflight or extraterrestrial environment, with minimal or no human intervention. Advanced imaging technology in combination with biologically engineered sensor organisms can create a system that can report via telemetry on the patterns of gene expression required to adapt to a novel environment. The utilization of genetically engineered plants as biosensors has made elegant strides in the recent years, providing keen insights into the health of plants in general and particularly in the nature and cellular location of stress responses. Moreover, molecular responses to gravitational vectors have been elegantly analyzed with fluorescent tools. Green Fluorescence Protein (GFP) and other fluorophores have made it possible for analyses of gene expression and biological responses to occur telemetrically, with the information potentially delivered to the investigator over large distances as simple, preprocessed fluorescence images. Having previously deployed transgenic plant biosensors to evaluate responses to orbital spaceflight, we wish to develop both the plants

  1. Vascular Endothelial Growth Factor Gene Polymorphism (rs2010963 and Its Receptor, Kinase Insert Domain-Containing Receptor Gene Polymorphism (rs2071559, and Markers of Carotid Atherosclerosis in Patients with Type 2 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    Sebastjan Merlo

    2016-01-01

    Full Text Available Background. The current study was designed to reveal possible associations between the polymorphisms of the vascular endothelial growth factor (VEGF gene (rs2010963 and its receptor, kinase insert domain-containing receptor (KDR gene polymorphism (rs2071559, and markers of carotid atherosclerosis in patients with type 2 diabetes mellitus (T2DM. Patients and Methods. 595 T2DM subjects and 200 control subjects were enrolled. The carotid intima-media thickness (CIMT and plaque characteristics (presence and structure were assessed ultrasonographically. Biochemical analyses were performed using standard biochemical methods. Genotyping of VEGF/KDR polymorphisms (rs2010963, rs2071559 was performed using KASPar assays. Results. Genotype distributions and allele frequencies of the VEGF/KDR polymorphisms (rs2010963, rs2071559 were not statistically significantly different between diabetic patients and controls. In our study, we demonstrated an association between the rs2071559 of KDR and either CIMT or the sum of plaque thickness in subjects with T2DM. We did not, however, demonstrate any association between the tested polymorphism of VEGF (rs2010963 and either CIMT, the sum of plaque thickness, the number of involved segments, hsCRP, the presence of carotid plaques, or the presence of unstable carotid plaques. Conclusions. In the present study, we demonstrated minor effect of the rs2071559 of KDR on markers of carotid atherosclerosis in subjects with T2DM.

  2. Regional Fluctuation in the Functional Consequence of LINE-1 Insertion in the Mitf Gene: The Black Spotting Phenotype Arisen from the Mitfmi-bw Mouse Lacking Melanocytes.

    Directory of Open Access Journals (Sweden)

    Kazuhisa Takeda

    Full Text Available Microphthalmia-associated transcription factor (Mitf is a key regulator for differentiation of melanoblasts, precursors to melanocytes. The mouse homozygous for the black-eyed white (Mitfmi-bw allele is characterized by the white-coat color and deafness with black eyes due to the lack of melanocytes. The Mitfmi-bw allele carries LINE-1, a retrotransposable element, which results in the Mitf deficiency. Here, we have established the black spotting mouse that was spontaneously arisen from the homozygous Mitfmi-bw mouse lacking melanocytes. The black spotting mouse shows multiple black patches on the white coat, with age-related graying. Importantly, each black patch also contains hair follicles lacking melanocytes, whereas the white-coat area completely lacks melanocytes. RT-PCR analyses of the pigmented patches confirmed that the LINE-1 insertion is retained in the Mitf gene of the black spotting mouse, thereby excluding the possibility of the somatic reversion of the Mitfmi-bw allele. The immunohistochemical analysis revealed that the staining intensity for beta-catenin was noticeably lower in hair follicles lacking melanocytes of the homozygous Mitfmi-bw mouse and the black spotting mouse, compared to the control mouse. In contrast, the staining intensity for beta-catenin and cyclin D1 was higher in keratinocytes of the black spotting mouse, compared to keratinocytes of the control mouse and the Mitfmi-bw mouse. Moreover, the keratinocyte layer appears thicker in the Mitfmi-bw mouse, with the overexpression of Ki-67, a marker for cell proliferation. We also show that the presumptive black spots are formed by embryonic day 15.5. Thus, the black spotting mouse provides the unique model to explore the molecular basis for the survival and death of developing melanoblasts and melanocyte stem cells in the epidermis. These results indicate that follicular melanocytes are responsible for maintaining the epidermal homeostasis; namely, the present study

  3. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    Energy Technology Data Exchange (ETDEWEB)

    Solera, J. (Unidades de Genetica Molecular, Madrid (Spain)); Magallon, M.; Martin-Villar, J. (Hemofilia Hospital, Madrid (Spain)); Coloma, A. (Departamento deBioquimica de la Facultad de Medicina de la Universidad Autonoma, Madrid (Spain))

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.

  4. A Compact W-Band Reflection-Type Phase Shifter with Extremely Low Insertion Loss Variation Using 0.13 µm CMOS Technology

    Directory of Open Access Journals (Sweden)

    Xiao-Dong Deng

    2015-03-01

    Full Text Available This paper presents a reflection-type phase shifter (RTPS at W-band in a 0.13 µm complementary metal oxide semiconductor (CMOS process. The RTPS is composed of a 90° hybrid coupler and two identical reflection loads. Lumped-distributed element transmission line is introduced in the 90° hybrid coupler to reduce the chip size. Series inductor-capacitor (LC resonators are used as the reflective loads and parallel inductors are deployed to reduce insertion loss variation. By cascading two-stage RTPS, 90° phase shifting range and 10.5 dB insertion loss with 1 dB variations from 80 GHz to 90 GHz are achieved. An impressive 0.1 dB variation is obtained at 86 GHz.

  5. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  6. Multipurpose Transposon-Insertion Libraries in Yeast.

    Science.gov (United States)

    Kumar, Anuj

    2016-06-01

    Libraries of transposon-insertion alleles constitute powerful and versatile tools for large-scale analysis of yeast gene function. Transposon-insertion libraries are constructed most simply through mutagenesis of a plasmid-based genomic DNA library; modification of the mutagenizing transposon by incorporation of yeast selectable markers, recombination sites, and an epitope tag enables the application of insertion alleles for phenotypic screening and protein localization. In particular, yeast genomic DNA libraries have been mutagenized with modified bacterial transposons carrying the URA3 marker, lox recombination sites, and sequence encoding multiple copies of the hemagglutinin (HA) epitope. Mutagenesis with these transposons has yielded a large resource of insertion alleles affecting nearly 4000 yeast genes in total. Through well-established protocols, these insertion libraries can be introduced into the desired strain backgrounds and the resulting insertional mutants can be screened or systematically analyzed. Relative to alternative methods of UV irradiation or chemical mutagenesis, transposon-insertion alleles can be easily identified by PCR-based approaches or high-throughput sequencing. Transposon-insertion libraries also provide a cost-effective alternative to targeted deletion approaches, although, in contrast to start-codon to stop-codon deletions, insertion alleles might not represent true null-mutants. For protein-localization studies, transposon-insertion alleles can provide encoded epitope tags in-frame with internal codons; in many cases, these transposon-encoded epitope tags can provide a more accurate localization for proteins in which terminal sequences are crucial for intracellular targeting. Thus, overall, transposon-insertion libraries can be used quickly and economically and have a particular utility in screening for desired phenotypes and localization patterns in nonstandard genetic backgrounds.

  7. [Advances in research on radioiodine therapy of carcinoma mediated by gene transfer technology].

    Science.gov (United States)

    Mu, Da; Kuang, Anren

    2010-10-01

    Radioiodine therapy of carcinoma could be mediated by transferring the genes which participate in the process of iodine metabolism in thyroid. The correlative genes are sodium/iodine symporter gene, thyroid peroxidase gene and the specific thyroid transcription factors, and others. The objective gene can specifically express in carcinoma by inserting the tissue-specific promoter/enhancer upstream of them, so radioiodine could be used to treat varied carcinomas. The radioiodine uptake in carcinoma cells was obviously increased and the radioiodine therapy of carcinoma was effective after those genes had expressed in carcinoma cells. The main problem was that the effective half-time of radioiodine in cells was too short to produce the ideal effect of radioiodine therapy. Moreover, 211At and 188Re could be transferred by sodium/iodine symporter and they could be used to treat the carcinoma that is capable of radioiodine uptake.

  8. Technology development for gene discovery and full-length sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Marcelo Bento Soares

    2004-07-19

    In previous years, with support from the U.S. Department of Energy, we developed methods for construction of normalized and subtracted cDNA libraries, and constructed hundreds of high-quality libraries for production of Expressed Sequence Tags (ESTs). Our clones were made widely available to the scientific community through the IMAGE Consortium, and millions of ESTs were produced from our libraries either by collaborators or by our own sequencing laboratory at the University of Iowa. During this grant period, we focused on (1) the development of a method for preferential cloning of tissue-specific and/or rare transcripts, (2) its utilization to expedite EST-based gene discovery for the NIH Mouse Brain Molecular Anatomy Project, (3) further development and optimization of a method for construction of full-length-enriched cDNA libraries, and (4) modification of a plasmid vector to maximize efficiency of full-length cDNA sequencing by the transposon-mediated approach. It is noteworthy that the technology developed for preferential cloning of rare mRNAs enabled identification of over 2,000 mouse transcripts differentially expressed in the hippocampus. In addition, the method that we optimized for construction of full-length-enriched cDNA libraries was successfully utilized for the production of approximately fifty libraries from the developing mouse nervous system, from which over 2,500 full-ORF-containing cDNAs have been identified and accurately sequenced in their entirety either by our group or by the NIH-Mammalian Gene Collection Program Sequencing Team.

  9. Maternal homozygocity for a 14 basepair insertion in exon 8 of the HLA-G gene and carriage of HLA class II alleles restricting HY immunity predispose to unexplained secondary recurrent miscarriage and low birth weight in children born to these patients

    DEFF Research Database (Denmark)

    Christiansen, Ole B; Kolte, Astrid Marie; Dahl, Mette;

    2012-01-01

    Homozygous carriage of a 14 base pair (bp) insertion in exon 8 of the HLA-G gene may be associated with low levels of soluble HLA-G and recurrent miscarriage (RM). We investigated the G14bp insertion(ins)/deletion(del) polymorphism in 339 women with unexplained RM and 125 control women. In all...

  10. Tie rod insertion test

    CERN Multimedia

    B. LEVESY

    2002-01-01

    The superconducting coil is inserted in the outer vaccum tank and supported by a set of tie rods. These tie rods are made of titanium alloy. This test reproduce the final insertion of the tie rods inside the outer vacuum tank.

  11. Constructive technology assessment of gene expression profiling for breast cancer

    NARCIS (Netherlands)

    Retèl, Valesca Pavlawna

    2011-01-01

    Constructive Technology Assessment (CTA) can be used as a complementary approach to Health Technology Assessment (HTA), especially for the early and dynamic introduction of new technologies in a controlled way. CTA is based on the idea that during the course of technology development, choices are co

  12. Malaria Prevention by New Technology: Vectored Delivery of Antibody Genes

    Science.gov (United States)

    2016-10-01

    sequence of both chains of the mAb, synthesis of synthetic DNA fragments encoding the mAb variable regions, and insertion of those fragments into the... monograph , dissertation, abstract, or the like published as or in a separate publication, rather than a periodical or series. Include any significant...e.g., Germplasm; cell lines, DNA probes, animal models); • clinical interventions; • new business creation; and • other. 7. PARTICIPANTS

  13. The first LHC insertion quadrupole

    CERN Multimedia

    2004-01-01

    An important milestone was reached in December 2003 at the CERN Magnet Assembly Facility. The team from the Accelerator Technology - Magnet and Electrical Systems group, AT-MEL, completed the first special superconducting quadrupole for the LHC insertions which house the experiments and major collider systems. The magnet is 8 metres long and contains two matching quadrupole magnets and an orbit corrector, a dipole magnet, used to correct errors in quadrupole alignment. All were tested in liquid helium and reached the ultimate performance criteria required for the LHC. After insertion in the cryostat, the superconducting magnet will be installed as the Q9 quadrupole in sector 7-8, the first sector of the LHC to be put in place in 2004. Members of the quadrupole team, from the AT-MEL group, gathered around the Q9 quadrupole at its inauguration on 12 December 2003 in building 181.

  14. Silencing of end-joining repair for efficient site-specific gene insertion after TALEN/CRISPR mutagenesis in Aedes aegypti

    OpenAIRE

    Basu, Sanjay; Aryan, Azadeh; Overcash, Justin M.; Samuel, Glady Hazitha; Anderson, Michelle A.E.; Dahlem, Timothy J.; Myles, Kevin M.; Adelman, Zach N.

    2015-01-01

    Mosquitoes are vectors of both parasites and viruses responsible for high-impact diseases including malaria, dengue, and chikungunya. Novel interventions based on genetic modification of the mosquito genome are currently being developed and implemented. To comprehensively exploit such interventions, detailed knowledge of mosquito physiology, genetics, and genome engineering are required. We developed and validated a two-step process for performing high-efficiency site-specific insertion of ge...

  15. An Undergraduate Laboratory Class Using CRISPR/Cas9 Technology to Mutate Drosophila Genes

    Science.gov (United States)

    Adame, Vanesa; Chapapas, Holly; Cisneros, Marilyn; Deaton, Carol; Deichmann, Sophia; Gadek, Chauncey; Lovato, TyAnna L.; Chechenova, Maria B.; Guerin, Paul; Cripps, Richard M.

    2016-01-01

    CRISPR/Cas9 genome editing technology is used in the manipulation of genome sequences and gene expression. Because of the ease and rapidity with which genes can be mutated using CRISPR/Cas9, we sought to determine if a single-semester undergraduate class could be successfully taught, wherein students isolate mutants for specific genes using…

  16. An Undergraduate Laboratory Class Using CRISPR/Cas9 Technology to Mutate Drosophila Genes

    Science.gov (United States)

    Adame, Vanesa; Chapapas, Holly; Cisneros, Marilyn; Deaton, Carol; Deichmann, Sophia; Gadek, Chauncey; Lovato, TyAnna L.; Chechenova, Maria B.; Guerin, Paul; Cripps, Richard M.

    2016-01-01

    CRISPR/Cas9 genome editing technology is used in the manipulation of genome sequences and gene expression. Because of the ease and rapidity with which genes can be mutated using CRISPR/Cas9, we sought to determine if a single-semester undergraduate class could be successfully taught, wherein students isolate mutants for specific genes using…

  17. Identification of Alternative Variants and Insertion of the Novel Polymorphic AluYl17 in TSEN54 Gene during Primate Evolution

    Directory of Open Access Journals (Sweden)

    Ja-Rang Lee

    2016-01-01

    Full Text Available TSEN54 encodes a subunit of the tRNA-splicing endonuclease complex, which catalyzes the identification and cleavage of introns from precursor tRNAs. Previously, we identified an AluSx-derived alternative transcript in TSEN54 of cynomolgus monkey. Reverse transcription-polymerase chain reaction (RT-PCR amplification and TSEN54 sequence analysis of primate and human samples identified five novel alternative transcripts, including the AluSx exonized transcript. Additionally, we performed comparative expression analysis via RT-qPCR in various cynomolgus, rhesus monkey, and human tissues. RT-qPCR amplification revealed differential expression patterns. Furthermore, genomic PCR amplification and sequencing of primate and human DNA samples revealed that AluSx elements were integrated in human and all of the primate samples tested. Intriguingly, in langur genomic DNA, an additional AluY element was inserted into AluSx of intron eight of TSEN54. The new AluY element showed polymorphic insertion. Using standardized nomenclature for Alu repeats, the polymorphic AluY of the langur TSEN54 was designated as being of the AluYl17 subfamily. Our results suggest that integration of the AluSx element in TSEN54 contributed to diversity in transcripts and induced lineage- or species-specific evolutionary events such as alternative splicing and polymorphic insertion during primate evolution.

  18. Distribution of Insertion- and Deletion-Associated Genetic Polymorphisms among Four Mycobacterium tuberculosis Phospholipase C Genes and Associations with Extrathoracic Tuberculosis: a Population-Based Study

    OpenAIRE

    Kong, Y.; Cave, M D; Yang, D.; Zhang,L.; Marrs, C. F.; Foxman, B.; Bates, J H; Wilson, F.; Mukasa, L. N.; Yang, Z. H.

    2005-01-01

    The Mycobacterium tuberculosis genome contains four phospholipase C (PLC)-encoding genes, designated plcA, plcB, plcC, and plcD, respectively. Each of the four genes contributes to the overall PLC activity of M. tuberculosis. PLC is hypothesized to contribute to M. tuberculosis virulence. Infection of M. tuberculosis strains carrying a truncated plcD gene is associated with the occurrence of extrathoracic tuberculosis. However, whether the other three plc genes are also associated with extrat...

  19. Chest tube insertion - slideshow

    Science.gov (United States)

    ... presentations/100008.htm Chest tube insertion - series—Normal anatomy To use the sharing features ... pleural space is the space between the inner and outer lining of the lung. It is normally very thin, and lined only ...

  20. Ear tube insertion - slideshow

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/presentations/100045.htm Ear tube insertion - series—Normal anatomy To use the ... 4 Overview The eardrum (tympanic membrane) separates the ear canal from the middle ear. Review Date 8/ ...

  1. Abnormal secretion and function of recombinant human factor VII as the result of modification to a calcium binding site caused by a 15-base pair insertion in the F7 gene.

    Science.gov (United States)

    Peyvandi, F; Carew, J A; Perry, D J; Hunault, M; Khanduri, U; Perkins, S J; Mannucci, P M; Bauer, K A

    2001-02-15

    A case of a novel mutation in the F7 gene that results in factor VII coagulant activity (VII:c) of less than 1% and VII antigen (VII:Ag) levels of 10% is presented. DNA analysis revealed a homozygous 15-base pair (bp) in-frame insertion-type mutation at nucleotide 10554. This insertion consisted of a duplication of residues leucine (L)213 to aspartic acid (D)217 (leucine, serine, glutamic acid, histidine, and aspartic acid), probably arising by slipped mispairing between 2 copies of a direct repeat (GCGAGCACGAC) separated by 4 bp. Molecular graphic analyses showed that the insertion is located at the surface of the catalytic domain in an exposed loop stabilized by extensive salt-bridge and hydrogen bond formation at which the calcium binding site is located. The mutation probably interferes with protein folding during VII biosynthesis and/or diminishes functional activity through the loss of calcium binding. In vitro expression studies demonstrated that the levels of VII:Ag in lysates of cells transfected with wild type VII (VIIWT) were equivalent to those with mutant type VII (VIIMT), but the level of secreted VIIMT was 5% to 10% that of VIIWT. Pulse chase studies demonstrated that VIIMT did not accumulate intracellularly, and studies with inhibitors of protein degradation showed that recombinant VIIMT was partially degraded in the pre-Golgi compartment. Accordingly, only small amounts of VIIMT with undetectable procoagulant activity were secreted into conditioned media. These results demonstrate that a combination of secretion and functional defects is the mechanism whereby this insertion causes VII deficiency.

  2. Advances in gene therapy technologies to treat retinitis pigmentosa

    OpenAIRE

    2013-01-01

    Hilda Petrs-Silva, Rafael LindenInstitute of Biophysics, Federal University of Rio de Janeiro, Rio de Janeiro, BrazilAbstract: Retinitis pigmentosa (RP) is a class of diseases that leads to progressive degeneration of the retina. Experimental approaches to gene therapy for the treatment of inherited retinal dystrophies have advanced in recent years, inclusive of the safe delivery of genes to the human retina. This review is focused on the development of gene therapy for RP using recombinant a...

  3. Comparing Leaf and Root Insertion

    Directory of Open Access Journals (Sweden)

    Jaco Geldenhuys

    2010-07-01

    Full Text Available We consider two ways of inserting a key into a binary search tree: leaf insertion which is the standard method, and root insertion which involves additional rotations. Although the respective cost of constructing leaf and root insertion binary search trees trees, in terms of comparisons, are the same in the average case, we show that in the worst case the construction of a root insertion binary search tree needs approximately 50% of the number of comparisons required by leaf insertion.

  4. Novel enabling technologies of gene isolation and plant transformation for improved crop protection

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2013-02-04

    Meeting the needs of agricultural producers requires the continued development of improved transgenic crop protection products. The completed project focused on developing novel enabling technologies of gene discovery and plant transformation to facilitate the generation of such products.

  5. SPERM RNA AMPLIFICATION FOR GENE EXPRESSION PROFILING BY DNA MICROARRAY TECHNOLOGY

    Science.gov (United States)

    Sperm RNA Amplification for Gene Expression Profiling by DNA Microarray TechnologyHongzu Ren, Kary E. Thompson, Judith E. Schmid and David J. Dix, Reproductive Toxicology Division, NHEERL, Office of Research and Development, US Environmental Protection Agency, Research Triang...

  6. Engineering Synthetic Gene Circuits in Living Cells with CRISPR Technology.

    Science.gov (United States)

    Jusiak, Barbara; Cleto, Sara; Perez-Piñera, Pablo; Lu, Timothy K

    2016-07-01

    One of the goals of synthetic biology is to build regulatory circuits that control cell behavior, for both basic research purposes and biomedical applications. The ability to build transcriptional regulatory devices depends on the availability of programmable, sequence-specific, and effective synthetic transcription factors (TFs). The prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR) system, recently harnessed for transcriptional regulation in various heterologous host cells, offers unprecedented ease in designing synthetic TFs. We review how CRISPR can be used to build synthetic gene circuits and discuss recent advances in CRISPR-mediated gene regulation that offer the potential to build increasingly complex, programmable, and efficient gene circuits in the future.

  7. Advances in gene therapy technologies to treat retinitis pigmentosa.

    Science.gov (United States)

    Petrs-Silva, Hilda; Linden, Rafael

    2014-01-01

    Retinitis pigmentosa (RP) is a class of diseases that leads to progressive degeneration of the retina. Experimental approaches to gene therapy for the treatment of inherited retinal dystrophies have advanced in recent years, inclusive of the safe delivery of genes to the human retina. This review is focused on the development of gene therapy for RP using recombinant adenoassociated viral vectors, which show a positive safety record and have so far been successful in several clinical trials for congenital retinal disease. Gene therapy for RP is under development in a variety of animal models, and the results raise expectations of future clinical application. Nonetheless, the translation of such strategies to the bedside requires further understanding of the mutations and mechanisms that cause visual defects, as well as thorough examination of potential adverse effects.

  8. Insertion/deletion polymorphism of the angiotensin-converting enzyme gene and the risk of hypertension among residents of two cities, South-South Nigeria

    Directory of Open Access Journals (Sweden)

    Mary Esien Kooffreh

    2014-01-01

    Conclusion: The I/D polymorphism of the angiotensin-converting enzyme gene was a risk factor for hypertension in the sample population of Calabar and Uyo. This research will form baseline information for subsequent molecular studies in this population.

  9. Detection of the common resistance genes in Gram-negative bacteria using gene chip technology

    Directory of Open Access Journals (Sweden)

    C Ting

    2013-01-01

    Full Text Available Objective: To design a resistance gene detection chip that could, in parallel, detect common clinical drug resistance genes of Gram-negative bacteria. Materials and Methods: Seventy clinically significant Gram-negative bacilli (Klebsiella pneumoniae, Escherichia coli, Enterobacter cloacae, Pseudomonas aeruginosa, Acinetobacter baumannii were collected. According to the known resistance gene sequences, we designed and synthesized primers and probes, which were used to prepare resistance gene detection chips, and finally we hybridized and scanned the gene detection chips. Results: The results between the gene chip and polymerase chain reaction (PCR were compared. The rate was consistently 100% in the eight kinds of resistance genes tested (TEM, SHV, CTX-M, DHA, CIT, VIM, KPC, OXA-23. One strain of Pseudomonas aeruginosa had the IMP, but it was not found by gene chip. Conclusion: The design of Gram-negative bacteria-resistant gene detection chip had better application value.

  10. Pixel detector insertion

    CERN Multimedia

    CMS

    2015-01-01

    Insertion of the Pixel Tracker, the 66-million-channel device used to pinpoint the vertex of each colliding proton pair, located at the heart of the detector. The geometry of CMS is a cylinder lying on its side (22 meters long and 15 meters high in dia

  11. The Composite Insertion Electrode

    DEFF Research Database (Denmark)

    Atlung, Sven; Zachau-Christiansen, Birgit; West, Keld

    1984-01-01

    The specific energy obtainable by discharge of porous insertion electrodes is limited by electrolyte depletion in thepores. This can be overcome using a solid ion conductor as electrolyte. The term "composite" is used to distinguishthese electrodes from porous electrodes with liquid electrolyte...

  12. Inserting the CMS solenoid

    CERN Multimedia

    Maximilien Brice

    2005-01-01

    The huge superconducting solenoid for CMS is inserted into the cryostat barrel. CMS uses the world's largest thin solenoid, in terms of energy stored, and is 12 m long, with a diameter of 6 m and weighing 220 tonnes. When turned on the magnet will produce a field strength of 4 T using superconducting niobium-titanium material at 4.5 K.

  13. [Insertional mutation in the AZOBR_p60120 gene is accompanied by defects in the synthesis of lipopolysaccharide and calcofluor-binding polysaccharides in the bacterium Azospirillum brasilense Sp245].

    Science.gov (United States)

    Katsy, E I; Prilipov, A G

    2015-03-01

    In the bacterium Azospirillum brasilense Sp245, extracellular calcofluor-binding polysaccharides (Cal+ phenotype) and two types of lipopolysaccharides, LPSI and LPSII, were previously identified. These lipopolysaccharides share the same repeating O-polysaccharide unit but have different antigenic structures and different charges of their O-polysaccharides and/or core oligosaccharides. Several dozens of predicted genes involved in the biosynthesis of polysaccharides have been localized in the AZOBR_p6 plasmid of strain Sp245 (GenBank accession no. HE577333). In the present work, it was demonstrated that an artificial transposon Omegon-Km had inserted into the central region of the AZOBR_p60120 gene in the A. brasilense Sp245 LPSI- Cal- KM252 mutant. In A. brasilense strain Sp245, this plasmid gene encodes a putative glycosyltransferase containing conserved domains characteristic of the enzymes participating in the synthesis of O-polysaccharides and capsular polysaccharides (accession no. YP004987664). In mutant KM252, a respective predicted protein is expected to be completely inactivated. As a result of the analysis of the EcoRI fragment of the AZOBR_p6 plasmid, encompassing the AZOBR_p60120 gene and a number of other loci, novel data on the structure of AZOBR_p6 were obtained: an approximately 5-kb gap (GenBank accession no. KM189439) was closed in the nucleotide sequence of this plasmid.

  14. Gene Technology: Also a Gender Issue. Views of Dutch Informed Women on Genetic Screening and Gene Therapy.

    Science.gov (United States)

    van Berkel, Dymphie; Klinge, Ineke

    1997-01-01

    The views of Dutch women on the implications of the analysis of the human genome were studied by questionnaire and interview. Although a serious lack of knowledge about the topic was found, interviews produced a broad range of problematic issues. Attention to gender implications of gene technology is needed. (Author/EMK)

  15. Implementation of BacMam virus gene delivery technology in a drug discovery setting.

    Science.gov (United States)

    Kost, Thomas A; Condreay, J Patrick; Ames, Robert S; Rees, Stephen; Romanos, Michael A

    2007-05-01

    Membrane protein targets constitute a key segment of drug discovery portfolios and significant effort has gone into increasing the speed and efficiency of pursuing these targets. However, issues still exist in routine gene expression and stable cell-based assay development for membrane proteins, which are often multimeric or toxic to host cells. To enhance cell-based assay capabilities, modified baculovirus (BacMam virus) gene delivery technology has been successfully applied to the transient expression of target proteins in mammalian cells. Here, we review the development, full implementation and benefits of this platform-based gene expression technology in support of SAR and HTS assays across GlaxoSmithKline.

  16. Future of health technology assessment studies in gene and cell ...

    African Journals Online (AJOL)

    SERVER

    2007-07-18

    Jul 18, 2007 ... The application of new knowledge and technological change is a key driver of the achievements in policy decisions in health ... extension of human life, reduction of pain, disease risk .... of uncertainty, (ii) the transferring of results of evaluations between .... up R&D companies are benefitting especially at the.

  17. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH)

    NARCIS (Netherlands)

    Leveau, J.H.J.; Gerards, S.; De Boer, W.; Van Veen, J.A.

    2004-01-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia

  18. A MusD retrotransposon insertion in the mouse Slc6a5 gene causes alterations in neuromuscular junction maturation and behavioral phenotypes.

    Directory of Open Access Journals (Sweden)

    Laurent P Bogdanik

    Full Text Available Glycine is the major inhibitory neurotransmitter in the spinal cord and some brain regions. The presynaptic glycine transporter, GlyT2, is required for sustained glycinergic transmission through presynaptic reuptake and recycling of glycine. Mutations in SLC6A5, encoding GlyT2, cause hereditary hyperekplexia in humans, and similar phenotypes in knock-out mice, and variants are associated with schizophrenia. We identified a spontaneous mutation in mouse Slc6a5, caused by a MusD retrotransposon insertion. The GlyT2 protein is undetectable in homozygous mutants, indicating a null allele. Homozygous mutant mice are normal at birth, but develop handling-induced spasms at five days of age, and only survive for two weeks, but allow the study of early activity-regulated developmental processes. At the neuromuscular junction, synapse elimination and the switch from embryonic to adult acetylcholine receptor subunits are hastened, consistent with a presumed increase in motor neuron activity, and transcription of acetylcholine receptors is elevated. Heterozygous mice, which show no reduction in lifespan but nonetheless have reduced levels of GlyT2, have a normal thermal sensitivity with the hot-plate test, but differences in repetitive grooming and decreased sleep time with home-cage monitoring. Open-field and elevated plus-maze tests did not detect anxiety-like behaviors; however, the latter showed a hyperactivity phenotype. Importantly, grooming and hyperactivity are observed in mouse schizophrenia models. Thus, mutations in Slc6a5 show changes in neuromuscular junction development as homozygotes, and behavioral phenotypes as heterozygotes, indicating their usefulness for studies related to glycinergic dysfunction.

  19. A study on drug resistance gene and genetic markers of insertion sequence of acinetobacter baumannii%鲍曼不动杆菌耐药基因及插入序列遗传标记的研究

    Institute of Scientific and Technical Information of China (English)

    曹晓君; 李小燕

    2014-01-01

    目的:通过对鲍曼不动杆菌的耐药基因和插入序列遗传标记进行研究来了解鲍曼不动杆菌的耐药机制,为临床治疗性用药、提供临床疗效提供实验依据。方法通过细菌药物敏感试验检测鲍曼不动杆菌对抗菌药物的耐药情况,通过PCR方法检测鲍曼不动杆菌的携带β-内酰胺类药物耐药基因的状况以及插入序列遗传标记的情况。结果细菌药物敏感试验检测结果是鲍曼不动杆菌对多种抗菌药物均耐药,共检出TEM、OXA-2、ADC、CTX-M-1、CTX-M-2、IMP、OXA-24等耐药基因,插入序列遗传标记ISabal、IS26、tnp513检出率分别为80.43%和47.82%、52.17%。结论β-内酰胺酶基因广泛存在于鲍曼不动杆菌中,是鲍曼不动杆菌对目前临床常用的β-内酰胺类药物存在多重耐药的主要原因。多重耐药鲍曼不动杆菌的耐药性与插入序列遗传标记有一定的相关性。%Objective To study the drug resistance gene and genetic markers of insertion sequence of acinetobacter baumannii,so as to understand the resistance mechanisms of acinetobacter baumannii and provide experimental evidence for clinical medication and clinical curative effect. Methods Drug sensitivity tests were carried out to test the drug resistance of acinetobacter baumannii towards anti-bacterial drugs. PCR was applied to test the drug resistance gene of β-lactam antibiotics carried by acinetobacter baumannii as well as test the genetic markers of insertion sequence. Results The results of drug sensitivity tests showed that acinetobacter baumannii is resistant to various kinds of anti-bacterial drugs.Drug resistance genes,such as TEM,OXA-2,ADC,CTX-M-1,CTX-M-2,IMP-OXA-24,were detected,and the detection rates of genetic marks of insertion sequence, including Isabal, IS26 and tnp513,were 80.43%,47.82% and 52.17% respectively. Conclusion β-lactamase gene is widely distributed in acinetobacter baumannii,which explains the main

  20. Prenatal diagnosis of common single gene disorders by DNA technology

    OpenAIRE

    1997-01-01

    Using the new DNA technology, it is now possible to offer prenatal diagnosis or presymptomatic testing for many genetic diseases. For prenatal diagnosis, foetal tissue is obtained y chorionic villus sampling at 9 to 11 weeks gestation or amniocentesis at 18 weeks. The programme in Hong Kong, which started in 1982, is reviewed here and now included alpha and beta thalassaemia, haemophilia A and B, Duchenne muscular dystrophy, Huntington's diseases, and spinal muscular atrophy. DNA diagnosis ca...

  1. [Experimental gene therapy using p21/WAF1 gene in esophageal squamous cell carcinoma--adenovirus infection and gene gun technology].

    Science.gov (United States)

    Fujii, T; Tanaka, Y; Tanaka, T; Matono, S; Sueyoshi, S; Fujita, H; Shirouzu, K; Kato, S; Yamana, H

    2001-10-01

    p21/WAF1 (p21) inhibits the activity of the cyclin/cdk complex and controls the G1 to S cell phase transition. In the present study, we used a recombinant adenoviral approach and gene gun technology to introduce p21 into esophageal cancer cells in order to assess the effect of p21 on cell growth. Infection with the p21 adenovirus (AdV) using gene gun technology resulted in inhibition of TE9 and KE3 cell growth. The levels of involucrin, which is a marker of squamous epithelium differentiation, markedly increased at 48 h and 72 h after p21 AdV infection in TE9 cells. These results indicate that p21 plays an important role in esophageal cancer cell proliferation. Overexpression of the p21 gene can inhibit cell growth and induce differentiation in esophageal cancer cells. p21 gene therapy may prove beneficial in the treatment of esophageal cancer.

  2. ISPa46, a novel insertion sequence in the oprD porin gene of an imipenem-resistant Pseudomonas aeruginosa isolate from a cystic fibrosis patient in Marseille, France.

    Science.gov (United States)

    Diene, Seydina M; L'homme, Tiphanie; Bellulo, Sophia; Stremler, Nathalie; Dubus, Jean-Christophe; Mely, Laurent; Leroy, Sylvie; Degand, Nicolas; Rolain, Jean-Marc

    2013-09-01

    Clinical isolates of Pseudomonas aeruginosa exhibiting high-level resistance to carbapenems were recovered from a French patient with cystic fibrosis (CF) who had not received carbapenem therapy. This study was conducted to investigate the molecular mechanism conferring the carbapenem-resistant phenotype in clinical isolates of P. aeruginosa recovered from the same CF patient chronically colonised since 2005. Investigation of imipenem resistance of P. aeruginosa strain_02 isolated in May 2011 showed no carbapenemase activity. However, amplification and sequencing of the oprD porin gene revealed disruption of this gene by an insertion sequence (IS) element of 1337 bp that contained a novel transposase of 1227 bp (ISPa46) bordered by two terminal imperfect inverted repeats of 28 bp, which was associated with carbapenem resistance. Retrospective analysis of five additional strains of P. aeruginosa isolated before May 2011 from the same patient revealed that all isolates were likely to be the same clone by multilocus sequence typing analysis (ST540/551), but one of the five isolates was imipenem-susceptible. Although it was possible to demonstrate the presence of ISPa46 in all strains by PCR, this IS was transposed in the oprD gene only for imipenem-resistant isolates. Therefore, this study reports a novel IS element (ISPa46) in P. aeruginosa clinical isolates of a CF patient in Marseille, France, that was associated with carbapenem resistance and was selected in the absence of carbapenem treatment.

  3. Characterization of the staphylococcal cassette chromosome mec insertion site in 108 isolates lacking the mecA gene and identified as methicillin-resistant Staphylococcus aureus by the Xpert MRSA assay.

    Science.gov (United States)

    Stojanov, M; Blanc, D S

    2014-11-01

    During a 3-year period, 848 patients were detected as carriers of methicillin-resistant Staphylococcus aureus (MRSA) by the Xpert MRSA assay (Cepheid). Among them, 108 patients (12.7 %) were colonized with strains showing methicillin-susceptible phenotypes and absence of the mecA gene, despite being positive with the rapid polymerase chain reaction (PCR) assay. DNA sequences of the staphylococcal cassette chromosome mec (SCCmec) insertion site of these "false-positive" strains was determined by direct sequencing of the genomic DNA. More than half (53.7 %) of the strains had DNA sequences unrelated to either SCC or SCCmec and one-third had DNA sequences related to non-mec SCC. Only 10.2 % of the strains carried sequences related to SCCmec, suggesting that a sequence containing the mecA gene was lost from an SCCmec. These findings differ from the general idea that all methicillin-susceptible S. aureus having positive Xpert MRSA assay results are essentially MRSA that lost the mecA gene.

  4. Essential Genes for In Vitro Growth of the Endophyte Herbaspirillum seropedicae SmR1 as Revealed by Transposon Insertion Site Sequencing

    OpenAIRE

    Rosconi, Federico; de Vries, Stefan P. W.; Baig, Abiyad; Fabiano, Elena; Grant, Andrew J

    2016-01-01

    ABSTRACT The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis o...

  5. Relationship between Angiotensin-Converting Enzyme Insertion/Deletion Gene Polymorphism and Susceptibility of Minimal Change Nephrotic Syndrome: A Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Tian-Biao Zhou

    2011-01-01

    Africans: D: =.81, DD: =.49. Furthermore, the II genotype seemed not to play a protective role against MCNS risk for Asians, Caucasians and Africans (=.12, =.09, =.76, resp.. Interestingly, there was also significant association between ACE I/D gene polymorphism and MCNS susceptibility in overall populations (D: =.007, DD: =.04, II: =.03. Conclusion. D allele or DD genotype might be a significant genetic molecular marker for MCNS susceptibility in Asians and overall populations, but not for Caucasians and Africans. More larger and rigorous genetic epidemiological investigations are required to further explore this association.

  6. A novel insertion-induced frameshift mutation of the SLC26A4 gene in a Korean family with Pendred syndrome.

    Science.gov (United States)

    Sagong, Borum; Seok, Jun Ho; Kwon, Tae-Jun; Kim, Un-Kyung; Lee, Sang-Heun; Lee, Kyu-Yup

    2012-10-15

    Pendred syndrome (PS) is an autosomal recessive disorder characterized by congenital bilateral sensorineural hearing loss, goiter, and incomplete iodide organification. Patients with PS also have structural anomalies of the inner ear such as enlarged vestibular aqueducts (EVA) and Mondini's malformation. The goiter, which is a major clinical manifestation of PS, usually develops around adolescence. PS is caused by biallelic mutations of the SLC26A4 gene, while nonsyndromic bilateral EVA is associated with zero or one SLC26A4 mutant allele. We report here a Korean family including a young female with PS who had goiter and progressive, fluctuating sensorineural hearing loss that could be partially recovered by oral steroid treatment. Genetic investigation revealed compound heterozygous mutations for p.R677AfsX11, a novel frameshift mutation, and p.H723R in the SLC26A4 gene. Our findings provide detailed information regarding the distribution of mutant alleles for PS and may serve as a foundation for studies to comprehend the genetic portion of syndromic hearing loss.

  7. Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish

    Directory of Open Access Journals (Sweden)

    Atsuo Kawahara

    2016-05-01

    Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.

  8. Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish.

    Science.gov (United States)

    Kawahara, Atsuo; Hisano, Yu; Ota, Satoshi; Taimatsu, Kiyohito

    2016-05-13

    The zebrafish (Danio rerio) is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9) system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs) at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.

  9. Delivery and therapeutic applications of gene editing technologies ZFNs, TALENs, and CRISPR/Cas9.

    Science.gov (United States)

    LaFountaine, Justin S; Fathe, Kristin; Smyth, Hugh D C

    2015-10-15

    In recent years, several new genome editing technologies have been developed. Of these the zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR/Cas9 RNA-guided endonuclease system are the most widely described. Each of these technologies utilizes restriction enzymes to introduce a DNA double stranded break at a targeted location with the guide of homologous binding proteins or RNA. Such targeting is viewed as a significant advancement compared to current gene therapy methods that lack such specificity. Proof-of-concept studies have been performed to treat multiple disorders, including in vivo experiments in mammals and even early phase human trials. Careful consideration and investigation of delivery strategies will be required so that the therapeutic potential for gene editing is achieved. In this review, the mechanisms of each of these gene editing technologies and evidence of therapeutic potential will be briefly described and a comprehensive list of past studies will be provided. The pharmaceutical approaches of each of these technologies are discussed along with the current delivery obstacles. The topics and information reviewed herein provide an outline of the groundbreaking research that is being performed, but also highlights the potential for progress yet to be made using these gene editing technologies.

  10. [PCR-derived technology in gene identification and typing of Yersinia pestis].

    Science.gov (United States)

    Wang, Mei; Tang, Xinyuan; Wang, Zuyun

    2015-01-01

    Application of the PCR-derived technology in gene identification and genotypes of different ecotype Yersinia pestis to make the high-throughput experimental results can reflect the epidemic history and compare the diversity in genome, pathogenicity, so that results from these experiments provide an important basis for clinical diagnosis, treatment and origin. But the experiment should be considered typing ability, practicality, budget and other experimental factors or conditions, because each PCR-derivative technology has advantages and disadvantages.

  11. Insertion/deletion variant (-141C Ins/Del) in the 5' regulatory region of the dopamine D2 receptor gene: lack of association with schizophrenia and bipolar affective disorder. Short communication.

    Science.gov (United States)

    Stöber, G; Jatzke, S; Heils, A; Jungkunz, G; Knapp, M; Mössner, R; Riederer, P; Lesch, K P

    1998-01-01

    A possible dysregulation of dopaminergic neurotransmission has been implicated in the aetiology of schizophrenic psychoses, in particular of paranoid-hallucinatory states, and of the manic episodes of bipolar affective disorder. In the present study we analysed allelic and genotypic variations of a recently described functional deletion/insertion variant (-141C Ins/Del) in the 5' flanking region of the human dopamine D2 receptor gene. We investigated a total of 620 unrelated individuals, comprising 260 schizophrenic patients, 70 patients with bipolar affective disorder, and 290 population controls. Analysis of the -141C Ins/Del variant revealed that the schizophrenic, bipolar affective and control groups did not differ significantly regarding genotype frequencies and allele frequencies. No evidence of an allelic association with either a family history of schizophrenic psychosis or a diagnosis of schizophrenia of the paranoid type (according to ICD 10) was found. Our findings indicate that the -141C Del variant in the 5' flanking region of the human dopamine D2 receptor gene is unlikely to play a substantial role in genetic predisposition to major psychiatric disorders in Caucasians.

  12. -141C insertion/deletion polymorphism of the dopamine D2 receptor gene is associated with schizophrenia in Chinese Han population: Evidence from an ethnic group-specific meta-analysis.

    Science.gov (United States)

    Zhao, Xiaofeng; Huang, Yinglin; Chen, Kaiyuan; Li, Duolu; Han, Chao; Kan, Quancheng

    2016-09-01

    Accumulate evidence has implicated dopamine D2 receptor gene polymorphisms in the etiology of schizophrenia. A single nucleotide polymorphism, -141C insertion/deletion (Ins/Del) (rs1799732), in the promoter region of the dopamine D2 receptor gene has been linked to schizophrenia; however, the data are inconclusive. This study investigated whether the -141C polymorphism is associated with the risk of schizophrenia in different ethnic groups by performing a meta-analysis. A total of 24 case-control studies examining the association between -141C Ins/Del polymorphism and schizophrenia were identified according to established inclusion criteria. Significant association was revealed between -141C Ins/Del polymorphism and schizophrenia risk in dominant genetic model (Ins/Ins + Ins/Del versus Del/Del) (odds ratio = 0.33, 95% confidence interval = 0.14-0.81, z = 2.41, P = 0.02) in Chinese Han but not in Caucasian, Japanese or India populations. Our results indicate that -141C Ins/Del polymorphism might be a susceptibility factor for schizophrenia in Chinese Han population. © 2015 Wiley Publishing Asia Pty Ltd.

  13. The Trojan Horse Liposome Technology for Nonviral Gene Transfer across the Blood-Brain Barrier

    OpenAIRE

    Boado, Ruben J.; Pardridge, William M.

    2011-01-01

    The application of blood-borne gene therapy protocols to the brain is limited by the presence of the blood-brain barrier (BBB). Viruses have been extensively used as gene delivery systems. However, their efficacy in brain is limited by the lack of transport across the BBB following intravenous (IV) administration. Recent progress in the “Trojan Horse Liposome” (THL) technology applied to transvascular non-viral gene therapy of the brain presents a promising solution to the trans-vascular brai...

  14. Gene Technology in Winemaking: New Approaches to an Ancient Art

    Directory of Open Access Journals (Sweden)

    Isak S. Pretorius

    2001-03-01

    Full Text Available For the last century, the availability of pure culture yeast has improved reproducibility in wine fermentations and product quality. However, there is not a single wine yeast strain that possesses an ideal combination of oenological characteristics that are optimised for the task set by today´s leading winemakers. With new developments in modern winemaking there has arisen an urgent need to modify wine yeast strains in order to take full advantage of technology and to satisfy the demands of the sophisticated wine consumers. The combined use of mutagenesis, hybridisation and recombinant DNA methods have significantly increased the genetic diversity that can be introduced into Saccharomyces cerevisiae strains. The overall aim of the strain development programmes extends far beyond the primary role of wine yeast to catalyse the rapid and complete conversion of grape sugars into alcohol and carbon dioxide without distorting the flavour of the final product. Starter cultures of S. cerevisiae must now possess a range of other properties that differ with the type and style of wine to be made and the technical requirements of the winery. Our strain development programme focuses on a number of targets that are amenable to a genetic approach, including strain security and quality control, the increase of fermentation and processing efficiencies, and the enhancement of the sensorial quality and health properties of wine and other grape-based beverages. However, successful commercialisation of transgenic wine yeasts will depend on a multitude of scientific, technical, economic, marketing, safety, regulatory, legal and ethical issues. Therefore, it would be foolish to entertain unrealistic expectations over rapid commercialisation and short-term benefits. However, it will be equally unwise to deny the potential advantages of genetically improved wine yeasts to both the winemaker and consumer in the third millennium.

  15. ENDOSCOPIC GROMMET INSERTION OUR EXPERIENCE

    Directory of Open Access Journals (Sweden)

    Balasubramanian Thiagarajan

    2012-03-01

    Full Text Available Grommet insertion the commonest surgical procedure next only to circumcision is usually performed using an operating microscope 1. Authors have been using 4 mm 0 degree nasalendoscopes to perform this procedure during the last 5 years. This is a report of their experience in using endoscope inlieu of microscope in performing this surgery. This study makes a comparative analysis of Endoscopic Grommet insertion viz a viz Microscopic Grommet insertion. For this comparative analysis one year (2009 data base of Government Stanley Medical College Chennai India was used. This study reveals that Endoscopic Grommet insertion compared favorably with Microscopic Grommet insertion in all aspects with certain obvious advantages.

  16. Environment effect on fruit ripening related gene to develop a new post harvest technology

    Science.gov (United States)

    Dwivany, Fenny; Esyanti, Rizkita Rahmi; Robertlee, Jekson; Paramaputra, Indra Chandra; Permatadewi, Rinda Kania; Tambun, Dina Hermawaty; Handayani, Resnanti Utami; Pratiwi, Aksarani'Sa; Zaskia, Herafi

    2014-03-01

    Ripening process of fruits is a very complex process, which involves ethylene production, causing alteration on molecular and physiology level. Environmental stress caused by biotic and abiotic stress conditions (such as pathogen, mechanical stress, physical and physiology stress) can stimulate ethylene production. High levels of ethylene in turn can also inhibit growth, cause premature ripening and induce the onset of senescence, which then potentially reduce plant productivity. The ACC Synthase (ACS) and ACC Oxidase (ACO) genes are genes that have role in the ethylene production. By regulating those genes, especially ethylene biosynthesis genes, we might improve the quality of fruit at post harvest condition. Therefore, in this research we studied fruit ripening related genes expression on banana such as MaACS family at different environment condition. The result of study can give contributions in developing of new plants with desired traits or new post harvest technologies.

  17. Large genomic fragment deletions and insertions in mouse using CRISPR/Cas9.

    Directory of Open Access Journals (Sweden)

    Luqing Zhang

    Full Text Available ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93 are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26 and 73.1% (19/26 for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48 of targeting rate by ES cell transfection and 11.1% (2/18 by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies.

  18. Dietary ω-3 polyunsaturated fatty acid intake modulates impact of Insertion/Deletion polymorphism of ApoB gene on obesity risk in type 2 diabetic patients.

    Science.gov (United States)

    Rafiee, Masoumeh; Sotoudeh, Gity; Djalali, Mahmoud; Alvandi, Ehsan; Eshraghian, Mohammadreza; Sojoudi, Fereshteh; Koohdani, Fariba

    2016-10-01

    The goal of the study described here was to determine whether dietary ω-3 polyunsaturated fatty acid (PUFA) intake modulates the association between ApoB Ins/Del polymorphism and obesity in type 2 diabetic patients. In this cross-sectional study, 700 patients with type 2 diabetes were recruited in Tehran. Weight and waist circumference (WC) were measured, and body mass index (BMI) was calculated. Dietary intake was assessed using a validated semiquantitative food frequency questionnaire. ApoB genotyping was performed with 8% polyacrylamide gel electrophoresis. We observed a significant interaction between Ins/Del genotype and dietary ω-3 PUFA intake with respect to BMI, WC, and obesity risk in both unadjusted (P = 0.007, P = 0.001, and P = 0.021, respectively) and adjusted (P = 0.007, P = 0.04, and P = 0.002, respectively) samples. Thus, the carriers of the Del allele were only associated with lower BMI (P = 0.01) and WC (P = 0.002) among individuals with high ω-3 PUFA intake (≥0.6% of energy), but not in those with low ω-3 PUFA intake (obesity risk in carriers of the Del allele was about 1.6 times higher than that of Ins/Ins homozygotes (odds ratio = 1.59, 95% confidence interval: 1.05-2.52, P = 0.039). But with high ω-3 PUFA intake (≥0.6%), the risk was 0.46 times lower (odds ratio = 0.46, 95% confidence interval: 0.25-0.79, P = 0.003). Moreover, a similar interaction was observed in central obesity only in men after adjustment for confounder variables (P = 0.041). These findings support the hypothesis that a diet high in ω-3 PUFA (≥0.6%) can decrease the obesity risk in carriers of the Del allele of ApoB gene. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. H-60 Mission Avionics Technology Insertion

    Science.gov (United States)

    2004-01-01

    single board computer . This is the same single board computer that is utilized in the Primary Mission Computer, so it would be subject to the same...Report Document No. 312-015-002 Page 23 4.2.13 Acoustic Processor The Acoustic Processor contains four single board computer modules in a 15 slot VME

  20. J85 Rejuvenation Through Technology Insertion

    Science.gov (United States)

    2000-10-01

    protective coating at this ABB Alstom to share the development cost. Due to interface, it was felt that this introduced an the exceptional number of in...proved to be Inconel 718. program. GE and ABB Alstom agreed to fund the remainder of the development and certification in Inco 718 had previously been...FAR33 rules, with the proviso that GE and ABB both probabilistic and deterministic methodologies, Alstom provide additional information to the USAF a

  1. Technology Insertion for Recapitalization of Legacy Systems

    Science.gov (United States)

    2015-09-30

    been completed. Existing software that leverages development of an analysisframework/methodology for assessment of the reliability, life-cycle cost...Modelica was selected for its use of the functional mockup interface (FMI) whose goal is to support the exchange of simulation models between...suppliers and OEMs across various software tools. The Python- based computational environment, with its interface to FMI (JModelica) and the large number

  2. Gene-splitting technology: a novel approach for the containment of transgene flow in Nicotiana tabacum.

    Directory of Open Access Journals (Sweden)

    Xu-Jing Wang

    Full Text Available The potential impact of transgene escape on the environment and food safety is a major concern to the scientists and public. This work aimed to assess the effect of intein-mediated gene splitting on containment of transgene flow. Two fusion genes, EPSPSn-In and Ic-EPSPSc, were constructed and integrated into N. tabacum, using Agrobacterium tumefaciens-mediated transformation. EPSPSn-In encodes the first 295 aa of the herbicide resistance gene 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS fused with the first 123 aa of the Ssp DnaE intein (In, whereas Ic-EPSPSc encodes the 36 C-terminal aa of the Ssp DnaE intein (Ic fused to the rest of EPSPS C terminus peptide sequences. Both EPSPSn-In and Ic-EPSPSc constructs were introduced into the same N. tabacum genome by genetic crossing. Hybrids displayed resistance to the herbicide N-(phosphonomethyl-glycine (glyphosate. Western blot analysis of protein extracts from hybrid plants identified full-length EPSPS. Furthermore, all hybrid seeds germinated and grew normally on glyphosate selective medium. The 6-8 leaf hybrid plants showed tolerance of 2000 ppm glyphosate in field spraying. These results indicated that functional EPSPS protein was reassembled in vivo by intein-mediated trans-splicing in 100% of plants. In order to evaluate the effect of the gene splitting technique for containment of transgene flow, backcrossing experiments were carried out between hybrids, in which the foreign genes EPSPSn-In and Ic-EPSPSc were inserted into different chromosomes, and non-transgenic plants NC89. Among the 2812 backcrossing progeny, about 25% (664 plantlets displayed glyphosate resistance. These data indicated that transgene flow could be reduced by 75%. Overall, our findings provide a new and highly effective approach for biological containment of transgene flow.

  3. Protein-Trap Insertional Mutagenesis Uncovers New Genes Involved in Zebrafish Skin Development, Including a Neuregulin 2a-Based ErbB Signaling Pathway Required during Median Fin Fold Morphogenesis.

    Directory of Open Access Journals (Sweden)

    Stephanie E Westcot

    Full Text Available Skin disorders are widespread, but available treatments are limited. A more comprehensive understanding of skin development mechanisms will drive identification of new treatment targets and modalities. Here we report the Zebrafish Integument Project (ZIP, an expression-driven platform for identifying new skin genes and phenotypes in the vertebrate model Danio rerio (zebrafish. In vivo selection for skin-specific expression of gene-break transposon (GBT mutant lines identified eleven new, revertible GBT alleles of genes involved in skin development. Eight genes--fras1, grip1, hmcn1, msxc, col4a4, ahnak, capn12, and nrg2a--had been described in an integumentary context to varying degrees, while arhgef25b, fkbp10b, and megf6a emerged as novel skin genes. Embryos homozygous for a GBT insertion within neuregulin 2a (nrg2a revealed a novel requirement for a Neuregulin 2a (Nrg2a-ErbB2/3-AKT signaling pathway governing the apicobasal organization of a subset of epidermal cells during median fin fold (MFF morphogenesis. In nrg2a mutant larvae, the basal keratinocytes within the apical MFF, known as ridge cells, displayed reduced pAKT levels as well as reduced apical domains and exaggerated basolateral domains. Those defects compromised proper ridge cell elongation into a flattened epithelial morphology, resulting in thickened MFF edges. Pharmacological inhibition verified that Nrg2a signals through the ErbB receptor tyrosine kinase network. Moreover, knockdown of the epithelial polarity regulator and tumor suppressor lgl2 ameliorated the nrg2a mutant phenotype. Identifying Lgl2 as an antagonist of Nrg2a-ErbB signaling revealed a significantly earlier role for Lgl2 during epidermal morphogenesis than has been described to date. Furthermore, our findings demonstrated that successive, coordinated ridge cell shape changes drive apical MFF development, making MFF ridge cells a valuable model for investigating how the coordinated regulation of cell polarity

  4. The Trojan Horse Liposome Technology for Nonviral Gene Transfer across the Blood-Brain Barrier

    Directory of Open Access Journals (Sweden)

    Ruben J. Boado

    2011-01-01

    Full Text Available The application of blood-borne gene therapy protocols to the brain is limited by the presence of the blood-brain barrier (BBB. Viruses have been extensively used as gene delivery systems. However, their efficacy in brain is limited by the lack of transport across the BBB following intravenous (IV administration. Recent progress in the “Trojan Horse Liposome” (THL technology applied to transvascular non-viral gene therapy of the brain presents a promising solution to the trans-vascular brain gene delivery problem. THLs are comprised of immunoliposomes carrying nonviral gene expression plasmids. The tissue target specificity of the THL is provided by peptidomimetic monoclonal antibody (MAb component of the THL, which binds to specific endogenous receptors located on both the BBB and on brain cellular membranes, for example, insulin receptor and transferrin receptor. These MAbs mediate (a receptor-mediated transcytosis of the THL complex through the BBB, (b endocytosis into brain cells and (c transport to the brain cell nuclear compartment. The expression of the transgene in brain may be restricted using tissue/cell specific gene promoters. This manuscript presents an overview on the THL transport technology applied to brain disorders, including lysosomal storage disorders and Parkinson's disease.

  5. Comparison of insertional RNA editing in Myxomycetes.

    Directory of Open Access Journals (Sweden)

    Cai Chen

    Full Text Available RNA editing describes the process in which individual or short stretches of nucleotides in a messenger or structural RNA are inserted, deleted, or substituted. A high level of RNA editing has been observed in the mitochondrial genome of Physarum polycephalum. The most frequent editing type in Physarum is the insertion of individual Cs. RNA editing is extremely accurate in Physarum; however, little is known about its mechanism. Here, we demonstrate how analyzing two organisms from the Myxomycetes, namely Physarum polycephalum and Didymium iridis, allows us to test hypotheses about the editing mechanism that can not be tested from a single organism alone. First, we show that using the recently determined full transcriptome information of Physarum dramatically improves the accuracy of computational editing site prediction in Didymium. We use this approach to predict genes in the mitochondrial genome of Didymium and identify six new edited genes as well as one new gene that appears unedited. Next we investigate sequence conservation in the vicinity of editing sites between the two organisms in order to identify sites that harbor the information for the location of editing sites based on increased conservation. Our results imply that the information contained within only nine or ten nucleotides on either side of the editing site (a distance previously suggested through experiments is not enough to locate the editing sites. Finally, we show that the codon position bias in C insertional RNA editing of these two organisms is correlated with the selection pressure on the respective genes thereby directly testing an evolutionary theory on the origin of this codon bias. Beyond revealing interesting properties of insertional RNA editing in Myxomycetes, our work suggests possible approaches to be used when finding sequence motifs for any biological process fails.

  6. Comparison of Insertional RNA Editing in Myxomycetes

    Science.gov (United States)

    Chen, Cai; Frankhouser, David; Bundschuh, Ralf

    2012-01-01

    RNA editing describes the process in which individual or short stretches of nucleotides in a messenger or structural RNA are inserted, deleted, or substituted. A high level of RNA editing has been observed in the mitochondrial genome of Physarum polycephalum. The most frequent editing type in Physarum is the insertion of individual Cs. RNA editing is extremely accurate in Physarum; however, little is known about its mechanism. Here, we demonstrate how analyzing two organisms from the Myxomycetes, namely Physarum polycephalum and Didymium iridis, allows us to test hypotheses about the editing mechanism that can not be tested from a single organism alone. First, we show that using the recently determined full transcriptome information of Physarum dramatically improves the accuracy of computational editing site prediction in Didymium. We use this approach to predict genes in the mitochondrial genome of Didymium and identify six new edited genes as well as one new gene that appears unedited. Next we investigate sequence conservation in the vicinity of editing sites between the two organisms in order to identify sites that harbor the information for the location of editing sites based on increased conservation. Our results imply that the information contained within only nine or ten nucleotides on either side of the editing site (a distance previously suggested through experiments) is not enough to locate the editing sites. Finally, we show that the codon position bias in C insertional RNA editing of these two organisms is correlated with the selection pressure on the respective genes thereby directly testing an evolutionary theory on the origin of this codon bias. Beyond revealing interesting properties of insertional RNA editing in Myxomycetes, our work suggests possible approaches to be used when finding sequence motifs for any biological process fails. PMID:22383871

  7. Comparison of insertional RNA editing in Myxomycetes.

    Science.gov (United States)

    Chen, Cai; Frankhouser, David; Bundschuh, Ralf

    2012-01-01

    RNA editing describes the process in which individual or short stretches of nucleotides in a messenger or structural RNA are inserted, deleted, or substituted. A high level of RNA editing has been observed in the mitochondrial genome of Physarum polycephalum. The most frequent editing type in Physarum is the insertion of individual Cs. RNA editing is extremely accurate in Physarum; however, little is known about its mechanism. Here, we demonstrate how analyzing two organisms from the Myxomycetes, namely Physarum polycephalum and Didymium iridis, allows us to test hypotheses about the editing mechanism that can not be tested from a single organism alone. First, we show that using the recently determined full transcriptome information of Physarum dramatically improves the accuracy of computational editing site prediction in Didymium. We use this approach to predict genes in the mitochondrial genome of Didymium and identify six new edited genes as well as one new gene that appears unedited. Next we investigate sequence conservation in the vicinity of editing sites between the two organisms in order to identify sites that harbor the information for the location of editing sites based on increased conservation. Our results imply that the information contained within only nine or ten nucleotides on either side of the editing site (a distance previously suggested through experiments) is not enough to locate the editing sites. Finally, we show that the codon position bias in C insertional RNA editing of these two organisms is correlated with the selection pressure on the respective genes thereby directly testing an evolutionary theory on the origin of this codon bias. Beyond revealing interesting properties of insertional RNA editing in Myxomycetes, our work suggests possible approaches to be used when finding sequence motifs for any biological process fails.

  8. Facility target insert shielding assessment

    Energy Technology Data Exchange (ETDEWEB)

    Mocko, Michal [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-06

    Main objective of this report is to assess the basic shielding requirements for the vertical target insert and retrieval port. We used the baseline design for the vertical target insert in our calculations. The insert sits in the 12”-diameter cylindrical shaft extending from the service alley in the top floor of the facility all the way down to the target location. The target retrieval mechanism is a long rod with the target assembly attached and running the entire length of the vertical shaft. The insert also houses the helium cooling supply and return lines each with 2” diameter. In the present study we focused on calculating the neutron and photon dose rate fields on top of the target insert/retrieval mechanism in the service alley. Additionally, we studied a few prototypical configurations of the shielding layers in the vertical insert as well as on the top.

  9. An Evolution Algorithm of Using Gene Fragment Inserting for Travel Salesman Problem%基于基因片段插入的旅行商问题的演化算法研究

    Institute of Scientific and Technical Information of China (English)

    刘欣欣; 陈宝兴

    2014-01-01

    The traveling salesman problem (TSP) is a NP-hard problem which widely studied in combinatorial optimization dom-ain. A new operator, named gene fragment inserting, is proposed in this paper. By using this operator, an evolution algorithm for solving travel salesman problem is presented. Experiment results show that the proposed algorithm can find an approximate optimal solution for TSP with a high probability.%旅行商问题是组合优化中一个广泛研究的NP-hard问题。本文引入了一种新的运算方式:基因片段插入,并利用此运算给出了一种求解旅行商问题的演化算法。实验结果表明,此算法能以较高的概率找到旅行商问题的近似最优解。

  10. Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

    Science.gov (United States)

    Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

    2012-07-01

    A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

  11. Impedance calculation for ferrite inserts

    Energy Technology Data Exchange (ETDEWEB)

    Breitzmann, S.C.; Lee, S.Y.; /Indiana U.; Ng, K.Y.; /Fermilab

    2005-01-01

    Passive ferrite inserts were used to compensate the space charge impedance in high intensity space charge dominated accelerators. They study the narrowband longitudinal impedance of these ferrite inserts. they find that the shunt impedance and the quality factor for ferrite inserts are inversely proportional to the imaginary part of the permeability of ferrite materials. They also provide a recipe for attaining a truly passive space charge impedance compensation and avoiding narrowband microwave instabilities.

  12. The rulB gene of plasmid pWW0 is a hotspot for the site-specific insertion of integron-like elements found in the chromosomes of environmental Pseudomonas fluorescens group bacteria.

    Science.gov (United States)

    Rhodes, Glenn; Bosma, Hester; Studholme, David; Arnold, Dawn L; Jackson, Robert W; Pickup, Roger W

    2014-08-01

    The rulAB operon of Pseudomonas spp. confers fitness traits on the host and has been suggested to be a hotspot for insertion of mobile elements that carry avirulence genes. Here, for the first time, we show that rulB on plasmid pWW0 is a hotspot for the active site-specific integration of related integron-like elements (ILEs) found in six environmental pseudomonads (strains FH1-FH6). Integration into rulB on pWW0 occurred at position 6488 generating a 3 bp direct repeat. ILEs from FH1 and FH5 were 9403 bp in length and contained eight open reading frames (ORFs), while the ILE from FH4 was 16 233 bp in length and contained 16 ORFs. In all three ILEs, the first 5.1 kb (containing ORFs 1-4) were structurally conserved and contained three predicted site-specific recombinases/integrases and a tetR homologue. Downstream of these resided ORFs of the 'variable side' with structural and sequence similarity to those encoding survival traits on the fitness enhancing plasmid pGRT1 (ILE(FH1) and ILE(FH5)) and the NR-II virulence region of genomic island PAGI-5 (ILE(FH4)). Collectively, these ILEs share features with the previously described type III protein secretion system effector ILEs and are considered important to host survival and transfer of fitness enhancing and (a)virulence genes between bacteria.

  13. Transposon insertion mapping with PIMMS – Pragmatic Insertional Mutation Mapping System.

    Directory of Open Access Journals (Sweden)

    Adam eBlanchard

    2015-04-01

    Full Text Available The PIMMS (Pragmatic Insertional Mutation Mapping System pipeline has been developed for simple conditionally essential genome discovery experiments in bacteria. Capable of using raw sequence data files alongside a FASTA sequence of the reference genome and GFF file, PIMMS will generate a tabulated output of each coding sequence with corresponding mapped insertions accompanied with normalised results enabling streamlined analysis. This allows for a quick assay of the genome to identify conditionally essential genes on a standard desktop computer prioritising results for further investigation.Availability: The PIMMS script, manual and accompanying test data is freely available at https://github.com/ADAC-UoN/PIMMS

  14. Insertion device and method for accurate and repeatable target insertion

    Energy Technology Data Exchange (ETDEWEB)

    Gubeli, III, Joseph F.; Shinn, Michelle D.; Bevins, Michael E.; Dillon-Townes, Lawrence; Neil, George R.

    2017-07-04

    The present invention discloses a device and a method for inserting and positioning a target within a free electron laser, particle accelerator, or other such device that generates or utilizes a beam of energy or particles. The system includes a three-point registration mechanism that insures angular and translational accuracy and repeatability of positioning upon multiple insertions within the same structure.

  15. Age-related regulation of genes: slow homeostatic changes and age-dimension technology

    Science.gov (United States)

    Kurachi, Kotoku; Zhang, Kezhong; Huo, Jeffrey; Ameri, Afshin; Kuwahara, Mitsuhiro; Fontaine, Jean-Marc; Yamamoto, Kei; Kurachi, Sumiko

    2002-11-01

    Through systematic studies of pro- and anti-blood coagulation factors, we have determined molecular mechanisms involving two genetic elements, age-related stability element (ASE), GAGGAAG and age-related increase element (AIE), a unique stretch of dinucleotide repeats (AIE). ASE and AIE are essential for age-related patterns of stable and increased gene expression patterns, respectively. Such age-related gene regulatory mechanisms are also critical for explaining homeostasis in various physiological reactions as well as slow homeostatic changes in them. The age-related increase expression of the human factor IX (hFIX) gene requires the presence of both ASE and AIE, which apparently function additively. The anti-coagulant factor protein C (hPC) gene uses an ASE (CAGGAG) to produce age-related stable expression. Both ASE sequences (G/CAGAAG) share consensus sequence of the transcriptional factor PEA-3 element. No other similar sequences, including another PEA-3 consensus sequence, GAGGATG, function in conferring age-related gene regulation. The age-regulatory mechanisms involving ASE and AIE apparently function universally with different genes and across different animal species. These findings have led us to develop a new field of research and applications, which we named “age-dimension technology (ADT)”. ADT has exciting potential for modifying age-related expression of genes as well as associated physiological processes, and developing novel, more effective prophylaxis or treatments for age-related diseases.

  16. Exploration of new perspectives and limitations in Agrobacterium mediated gene transfer technology. Progress report, [June 1, 1992-- May 31, 1994

    Energy Technology Data Exchange (ETDEWEB)

    Marton, L.

    1994-12-31

    This report describes progress aimed at constructing gene-transfer technology for Nicotiana plumbaginifolia. Most actual effort as described herein has so far been directed at exploring new perspectives and limitations in Agrobacterium mediated gene transfer. Accomplishments are described using a core homologous gene targeting vector.

  17. Comparison of hybridization-based and sequencing-based gene expression technologies on biological replicates

    Directory of Open Access Journals (Sweden)

    Cepko Connie L

    2007-06-01

    Full Text Available Abstract Background High-throughput systems for gene expression profiling have been developed and have matured rapidly through the past decade. Broadly, these can be divided into two categories: hybridization-based and sequencing-based approaches. With data from different technologies being accumulated, concerns and challenges are raised about the level of agreement across technologies. As part of an ongoing large-scale cross-platform data comparison framework, we report here a comparison based on identical samples between one-dye DNA microarray platforms and MPSS (Massively Parallel Signature Sequencing. Results The DNA microarray platforms generally provided highly correlated data, while moderate correlations between microarrays and MPSS were obtained. Disagreements between the two types of technologies can be attributed to limitations inherent to both technologies. The variation found between pooled biological replicates underlines the importance of exercising caution in identification of differential expression, especially for the purposes of biomarker discovery. Conclusion Based on different principles, hybridization-based and sequencing-based technologies should be considered complementary to each other, rather than competitive alternatives for measuring gene expression, and currently, both are important tools for transcriptome profiling.

  18. HPE液压垂直插入机施作钢管柱施工技术%HPE Hydraulic Vertical Inserting Machine Applied Construction Technology of Steel Pipe Column

    Institute of Scientific and Technical Information of China (English)

    朱元生

    2012-01-01

    This paper,based on the South Station in Wuhan Metro Steel Pipe Column construction practice,discusses in detail the vertical insertion of the HPE hydraulic facilities for steel column construction process principles,processes,operating points and quality control requirements.Test data proves that the advanced technology is reliable,can assure quality,solving problems in the traditional steel column installation such as no assurance of the security of artificial positioning,the complex construction process,long duration,high cost,and reduces the construction period of South Station by five months,to break the constraints bottleneck of duration%结合武汉地铁中南路站钢管柱施工实践,详细论述了HPE液压垂直插入机施作钢管柱施工技术的工艺原理、工艺流程、操作要点和质量控制要求。检测数据证明,该技术先进可靠,能保证质量,突破了传统钢柱安装人工定位存在的安全不能保障、施工工序复杂、工期比较长、成本较高等诸多难题,并使中南路车站施工工期提前了5个月,打破了工期制约的瓶颈。

  19. From single gene to integrative molecular concept MAPS: pitfalls and potentials of microarray technology.

    Science.gov (United States)

    Chiorino, G; Mello Grand, M; Scatolini, M; Ostano, P

    2008-01-01

    Microarray experiments have a large variety of applications and several important achievements have been obtained by means of this technology, especially within the field of whole genome expression profiling, which undoubtedly is the most diffused world-wide. Nevertheless, care must be taken in unconditionally applying such high-throughput techniques and in extracting/interpreting their results. Both the validity and the reproducibility of microarray-based clinical research have recently been challenged. Pitfalls and potentials of the microarray technology for gene expression profiling are critically reviewed in this paper.

  20. Targeted Gene Manipulation in Plants Using the CRISPR/Cas Technology.

    Science.gov (United States)

    Zhang, Dandan; Li, Zhenxiang; Li, Jian-Feng

    2016-05-20

    The CRISPR/Cas technology is emerging as a revolutionary genome editing tool in diverse organisms including plants, and has quickly evolved into a suite of versatile tools for sequence-specific gene manipulations beyond genome editing. Here, we review the most recent applications of the CRISPR/Cas toolkit in plants and also discuss key factors for improving CRISPR/Cas performance and strategies for reducing the off-target effects. Novel technical breakthroughs in mammalian research regarding the CRISPR/Cas toolkit will also be incorporated into this review in hope to stimulate prospective users from the plant research community to fully explore the potential of these technologies.

  1. An overview on gene therapy programs.

    Science.gov (United States)

    Romano, Gaetano

    2008-01-01

    The 11th Annual Meeting of the American Society of Gene Therapy focused on clinical trials for the treatment of various pathological conditions, preclinical studies, use of gene transfer technology for genetic immunization purposes and problems related to the improvement of vector design. In this respect, a major emphasis was placed on safety issues, such as insertional mutagenesis and host immune responses to gene delivery systems.

  2. Effect of electro-acupuncture on gene expression in heart of rats with stress-induced pre-hypertension based on gene chip technology.

    Science.gov (United States)

    Guo, Yan; Xie, Xiaojia; Guo, Changqing; Wang, Zhaoyang; Liu, Qingguo

    2015-06-01

    To explore electro-acupuncture's (EA's) effect on gene expression in heart of rats with stress-induced pre-hypertension and try to reveal its biological mechanism based on gene chip technology. Twenty-seven Wistar male rats were randomly divided into 3 groups. The stress-induced hypertensive rat model was prepared by electric foot-shocks combined with generated noise. Molding cycle lasted for 14 days and EA intervene was applied,on rats in model + EA group during model preparation. Rat Gene 2.0 Sense Target Array technology was used for the determination of gene expression profiles and the screened key genes were verified by real-time quantitative polymerase chain reaction (RT-PCR) method. Compared with blank control group, 390 genes were changed in model group; compared with model control group, 330 genes were changed in model+EA group. Significance analysis of gene function showed that the differentially expressed genes are those involved in biological process, molecular function and cellular components. RT-PCR result of the screened key genes is consistent with that of gene chip test. EA could significantly lower blood pressure of stress-induced pre-hypertension rats and affect its gene expression profile in heart. Genes that related to the contraction of vascular smooth muscle may be involved in EA's anti-hypertensive mechanism.

  3. Research on six genes and insertion sequence ISAbal of carbopenems-resistant Acinetobacter baumannii%耐碳青霉烯类鲍曼不动杆菌6种基因及ISAbal插入序列的研究

    Institute of Scientific and Technical Information of China (English)

    廖晚珍; 杨璐; 温桂兰; 彭卫华; 胡雪飞; 余阳

    2012-01-01

    Objective To study the relationship between the genotype characteristics and insertion sequence ISAbal of carbopenems resistant Acinetobacter baumannii ( CRAB) ,and investigate the drug resistant mechanism. Methods A total of 70 strains of CRAB (no repeat strains) and 10 strains of carbopenems-sensitive Acinetobacter baumannii were collected. Metalloenzyme beta-lactamase (MBLs) were detected by 2-mercaptopropionic acid inhibition test. The blaIMP,blaVIM,blaOXA-23,blaOXA-24,blaOXA-51,blaOXA-58 and ISA balOXA-23 were amplified by multiplex polymerase chain reaction (PCR). The amplified products were measured for DNA sequence . Results The synergy tests were negative (MBLs negative ) by 2-mercaptopropionic acid and ceftazime in 70 strains of CRAB. Through 7 pairs of specific primers,70 strains of CRAB and 10 strains of carbopenems-sensitive Acinetobacter baumannii were determined for PCR amplification. All the CRAB strains carried blaOXA-23 and blaOXA-51,but blaOXA-24 was never detected. Only 1 strain carried blaOXA-58,and the 80 strains did not carry blaIMP and blaVIM In addition,all the CRAB strains carried insertion sequence ISAbalOXA-23,however,all the sensitive strains did not carry. Conclusions Major genes are blaOXA-51 and blaOXA-23 in the CRAB strains. Insertion sequence ISAbal is located in the upstream of blaOXA-23. There is no correlation among drug-resistance of Acinetobacter baumannii to MBLs,blaOXA-24 and blaOXA-58.%目的 研究耐碳青霉烯类鲍曼不动杆菌(CRAB)的基因型特点和与插入序列ISAbal的关系,探讨其耐药机制.方法 收集CRAB 70株(非重复)和碳青霉烯类敏感鲍曼不动杆菌10株,采用2-巯基丙酸抑制试验检测金属β-内酰胺酶(MBLs);采用多重聚合酶链反应(PCR)扩增blaIMP、blaVIM、blaOXA-23、blaOXA-24、blaOXA-51、blaOXA-58、ISAbalOXA-23,扩增产物DNA测序进行比对.结果 70株CRAB 2-巯基丙酸与头孢他啶协同试验全部为阴性(即MBLs阴性),用7对特异性引物对70

  4. Lithium insertion in nanostructured titanates

    NARCIS (Netherlands)

    Borghols, W.J.H.

    2010-01-01

    Upon nano-sizing of insertion compounds several significant changes in Li-insertion behavior have been observed for sizes below approximately 50 nm. Although the origins of the phenomena are interrelated, the changes can be divided in three main observations. (1) The formation of new phases, leading

  5. Large-scale Gene Ontology analysis of plant transcriptome-derived sequences retrieved by AFLP technology

    Directory of Open Access Journals (Sweden)

    Ramina Angelo

    2008-07-01

    Full Text Available Abstract Background After 10-year-use of AFLP (Amplified Fragment Length Polymorphism technology for DNA fingerprinting and mRNA profiling, large repertories of genome- and transcriptome-derived sequences are available in public databases for model, crop and tree species. AFLP marker systems have been and are being extensively exploited for genome scanning and gene mapping, as well as cDNA-AFLP for transcriptome profiling and differentially expressed gene cloning. The evaluation, annotation and classification of genomic markers and expressed transcripts would be of great utility for both functional genomics and systems biology research in plants. This may be achieved by means of the Gene Ontology (GO, consisting in three structured vocabularies (i.e. ontologies describing genes, transcripts and proteins of any organism in terms of their associated cellular component, biological process and molecular function in a species-independent manner. In this paper, the functional annotation of about 8,000 AFLP-derived ESTs retrieved in the NCBI databases was carried out by using GO terminology. Results Descriptive statistics on the type, size and nature of gene sequences obtained by means of AFLP technology were calculated. The gene products associated with mRNA transcripts were then classified according to the three main GO vocabularies. A comparison of the functional content of cDNA-AFLP records was also performed by splitting the sequence dataset into monocots and dicots and by comparing them to all annotated ESTs of Arabidopsis and rice, respectively. On the whole, the statistical parameters adopted for the in silico AFLP-derived transcriptome-anchored sequence analysis proved to be critical for obtaining reliable GO results. Such an exhaustive annotation may offer a suitable platform for functional genomics, particularly useful in non-model species. Conclusion Reliable GO annotations of AFLP-derived sequences can be gathered through the optimization

  6. Real-Time Imaging of Gene Delivery and Expression with DNA Nanoparticle Technologies

    Science.gov (United States)

    Sun, Wenchao; Ziady, Assem G.

    The construction of safe, efficient, and modifiable synthetic DNA nanoparticles is an emerging technology that has achieved important milestones of success in the past 5 years. Advances in chemical conjugation, purification, and controlled synthesis have allowed researchers to produce uniform and stable particles, whose physical characteristics can be well characterized and monitored. As a result of these improvements, DNA nanoparticles have now been cleared for clinical testing, and show good potential for human gene therapy. A very important recent development in the study of DNA nanoparticles is the use of small-animal imaging. Real-time imaging has become a valuable technique for tracking particle biodistribution and gene transfer efficacy. In this chapter, we discuss how bioluminescent, positron emission tomography, and magnetic resonance imaging can be used separately or in concert to study particle delivery, localization, and magnitude of gene expression in vivo.

  7. Delivery and Specificity of CRISPR-Cas9 Genome Editing Technologies for Human Gene Therapy.

    Science.gov (United States)

    Gori, Jennifer L; Hsu, Patrick D; Maeder, Morgan L; Shen, Shen; Welstead, G Grant; Bumcrot, David

    2015-07-01

    Genome editing using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR associated 9 (Cas9) technology is revolutionizing the study of gene function and likely will give rise to an entire new class of therapeutics for a wide range of diseases. Achieving this goal requires not only characterization of the technology for efficacy and specificity but also optimization of its delivery to the target cells for each disease indication. In this review we survey the various methods by which the CRISPR-Cas9 components have been delivered to cells and highlight some of the more clinically relevant approaches. Additionally, we discuss the methods available for assessing the specificity of Cas9 editing; an important safety consideration for development of the technology.

  8. New genes and pathomechanisms in mitochondrial disorders unraveled by NGS technologies.

    Science.gov (United States)

    Legati, Andrea; Reyes, Aurelio; Nasca, Alessia; Invernizzi, Federica; Lamantea, Eleonora; Tiranti, Valeria; Garavaglia, Barbara; Lamperti, Costanza; Ardissone, Anna; Moroni, Isabella; Robinson, Alan; Ghezzi, Daniele; Zeviani, Massimo

    2016-08-01

    Next Generation Sequencing (NGS) technologies are revolutionizing the diagnostic screening for rare disease entities, including primary mitochondrial disorders, particularly those caused by nuclear gene defects. NGS approaches are able to identify the causative gene defects in small families and even single individuals, unsuitable for investigation by traditional linkage analysis. These technologies are contributing to fill the gap between mitochondrial disease cases defined on the basis of clinical, neuroimaging and biochemical readouts, which still outnumber by approximately 50% the cases for which a molecular-genetic diagnosis is attained. We have been using a combined, two-step strategy, based on targeted genes panel as a first NGS screening, followed by whole exome sequencing (WES) in still unsolved cases, to analyze a large cohort of subjects, that failed to show mutations in mtDNA and in ad hoc sets of specific nuclear genes, sequenced by the Sanger's method. Not only this approach has allowed us to reach molecular diagnosis in a significant fraction (20%) of these difficult cases, but it has also revealed unexpected and conceptually new findings. These include the possibility of marked variable penetrance of recessive mutations, the identification of large-scale DNA rearrangements, which explain spuriously heterozygous cases, and the association of mutations in known genes with unusual, previously unreported clinical phenotypes. Importantly, WES on selected cases has unraveled the presence of pathogenic mutations in genes encoding non-mitochondrial proteins (e.g. the transcription factor E4F1), an observation that further expands the intricate genetics of mitochondrial disease and suggests a new area of investigation in mitochondrial medicine. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy, July 2-6, 2016', edited by Prof. Paolo Bernardi.

  9. [Recent progress in gene mapping through high-throughput sequencing technology and forward genetic approaches].

    Science.gov (United States)

    Lu, Cairui; Zou, Changsong; Song, Guoli

    2015-08-01

    Traditional gene mapping using forward genetic approaches is conducted primarily through construction of a genetic linkage map, the process of which is tedious and time-consuming, and often results in low accuracy of mapping and large mapping intervals. With the rapid development of high-throughput sequencing technology and decreasing cost of sequencing, a variety of simple and quick methods of gene mapping through sequencing have been developed, including direct sequencing of the mutant genome, sequencing of selective mutant DNA pooling, genetic map construction through sequencing of individuals in population, as well as sequencing of transcriptome and partial genome. These methods can be used to identify mutations at the nucleotide level and has been applied in complex genetic background. Recent reports have shown that sequencing mapping could be even done without the reference of genome sequence, hybridization, and genetic linkage information, which made it possible to perform forward genetic study in many non-model species. In this review, we summarized these new technologies and their application in gene mapping.

  10. Antibiotic resistance genes fate and removal by a technological treatment solution for water reuse in agriculture.

    Science.gov (United States)

    Luprano, Maria Laura; De Sanctis, Marco; Del Moro, Guido; Di Iaconi, Claudio; Lopez, Antonio; Levantesi, Caterina

    2016-11-15

    In order to mitigate the potential effects on the human health which are associated to the use of treated wastewater in agriculture, antibiotic resistance genes (ARGs) are required to be carefully monitored in wastewater reuse processes and their spread should be prevented by the development of efficient treatment technologies. Objective of this study was the assessment of ARGs reduction efficiencies of a novel technological treatment solution for agricultural reuse of municipal wastewaters. The proposed solution comprises an advanced biological treatment (Sequencing Batch Biofilter Granular Reactor, SBBGR), analysed both al laboratory and pilot scale, followed by sand filtration and two different disinfection final stages: ultraviolet light (UV) radiation and peracetic acid (PAA) treatments. By Polymerase Chain Reaction (PCR), the presence of 9 ARGs (ampC, mecA, ermB, sul1, sul2, tetA, tetO, tetW, vanA) were analysed and by quantitative PCR (qPCR) their removal was determined. The obtained results were compared to the reduction of total bacteria (16S rDNA gene) and of a faecal contamination indicator (Escherichia coli uidA gene). Only four of the analysed genes (ermB, sul1, sul2, tetA) were detected in raw wastewater and their abundance was estimated to be 3.4±0.7 x10(4) - 9.6±0.5 x10(9) and 1.0±0.3 x10(3) to 3.0±0.1 x10(7) gene copies/mL in raw and treated wastewaters, respectively. The results show that SBBGR technology is promising for the reduction of ARGs, achieving stable removal performance ranging from 1.0±0.4 to 2.8±0.7 log units, which is comparable to or higher than that reported for conventional activated sludge treatments. No reduction of the ARGs amount normalized to the total bacteria content (16S rDNA), was instead obtained, indicating that these genes are removed together with total bacteria and not specifically eliminated. Enhanced ARGs removal was obtained by sand filtration, while no reduction was achieved by both UV and PAA disinfection

  11. Non-insertional Achilles tendinopathy

    Science.gov (United States)

    Pearce, Christopher J.; Tan, Audrey

    2016-01-01

    Non-insertional Achilles tendinopathy is a degenerative condition characterised by pain on activity. Eccentric stretching is the most effective treatment. Surgical treatment is reserved for recalcitrant cases. Minimally-invasive and tendinoscopic treatments are showing promising results. Cite this article: Pearce CJ, Tan A. Non-insertional Achilles tendinopathy. EFORT Open Rev 2016;1:383-390. DOI: 10.1302/2058-5241.1.160024. PMID:28461917

  12. Building Next-Generation Technologies for Low-Cost Gene Synthesis and High-Accuracy Genome Engineering

    OpenAIRE

    2014-01-01

    The technologies that enable writing and editing of DNA form the foundation of modern molecular biology and biotechnology. However, a number of methodological barriers have limited the widespread adoption of both high-throughput de novo gene synthesis and large-scale genome alteration. Increasingly, work in the fields of synthetic biology, protein design, and gene therapy has been hindered by shortcomings in current DNA writing and editing technologies. The goal of this dissertation has be...

  13. A potential disruptive technology in vaccine development: gene-based vaccines and their application to infectious diseases.

    Science.gov (United States)

    Kaslow, David C

    2004-10-01

    Vaccine development requires an amalgamation of disparate disciplines and has unique economic and regulatory drivers. Non-viral gene-based delivery systems, such as formulated plasmid DNA, are new and potentially disruptive technologies capable of providing 'cheaper, simpler, and more convenient-to-use' vaccines. Typically and somewhat ironically, disruptive technologies have poorer product performance, at least in the near-term, compared with the existing conventional technologies. Because successful product development requires that the product's performance must meet or exceed the efficacy threshold for a desired application, the appropriate selection of the initial product applications for a disruptive technology is critical for its successful evolution. In this regard, the near-term successes of gene-based vaccines will likely be for protection against bacterial toxins and acute viral and bacterial infections. Recent breakthroughs, however, herald increasing rather than languishing performance improvements in the efficacy of gene-based vaccines. Whether gene-based vaccines ultimately succeed in eliciting protective immunity in humans to persistent intracellular pathogens, such as HIV, malaria and tuberculosis, for which the conventional vaccine technologies have failed, remains to be determined. A success against any one of the persistent intracellular pathogens would be sufficient proof that gene-based vaccines represent a disruptive technology against which future vaccine technologies will be measured.

  14. Gas turbine vane cooling air insert

    Energy Technology Data Exchange (ETDEWEB)

    North, W.E.; Hultgren, K.G.; Dishman, C.D.; Van Heusden, G.S.

    1992-09-08

    This patent describes a gas turbine. It comprises turbine vanes, each of the vanes supplied with cooling air and having: an airfoil portion forming a first cavity having an insert disposed therein for directing the flow of the cooling air, the insert having first and second insert ends; a shroud portion from which the airfoil portion extends, the insert attached to the shroud portion at the first insert end; an insert extension extending through a portion of the insert and extending beyond the first insert end, the insert extension and the insert forming an annular gap therebetween separating the insert from the insert extension; a plate covering at least a portion of the shroud, the plate having a first hole formed therein through which the insert extension extends; and at least a first seal extending between the insert extension and the insert, and sealing the annular gap therebetween. This patent also describes a method of making a gas turbine. It comprises welding a first tubular insert adjacent its first end to a vane outer shroud; partially inserting a second tubular insert into the first tubular member and attaching the second tubular insert thereto; placing a plate having a hole formed therein on the outer shroud so that the hole surrounds the second tubular insert; and attaching the second tubular insert to the plate by placing a first seal between the first and second tubular inserts and attaching the first seal to each of the first and second tubular inserts, and placing a second seal between the second tubular insert and the plate and welding the second seal to the second tubular insert and the plate.

  15. Commercial Generic Bioprocessing Apparatus Science Insert - 03

    Science.gov (United States)

    Moreno, Nancy; Stodieck, Louis; Cushing, Paula; Stowe, Mark; Hamilton, Mary Ann; Werner, Ken

    2008-01-01

    Commercial Generic Bioprocessing Apparatus Science Insert - 03 (CSI-03) is the third set of investigations in the CSI program series. The CSI program provides the K-12 community opportunities to utilize the unique microgravity environment of the International Space Station as part of the regular classroom to encourage learning and interest in science, technology, engineering and math. CSI-03 will examine the complete life cycle of the painted lady butterfly and the ability of an orb weaving spider to spin a web, eat and remain healthy in space.

  16. Improving oligonucleotide fingerprinting of rRNA genes by implementation of polony microarray technology

    Science.gov (United States)

    Ruegger, Paul M.; Bent, Elizabeth; Li, Wei; Jeske, Daniel R.; Cui, Xinping; Braun, Jonathan; Jiang, Tao; Borneman, James

    2012-01-01

    Improvements to oligonucleotide fingerprinting of rRNA genes (OFRG) were obtained by implementing polony microarray technology. OFRG is an array-based method for analyzing microbial community composition. Polonies are discrete clusters of DNA, produced by solid-phase PCR in hydrogels, and derived from individual, spatially isolated DNA molecules. The advantages of a polony-based OFRG method include higher throughput and reductions in the PCR-induced errors and compositional skew inherent in all other PCR-based community composition methods, including high throughput sequencing of rRNA genes. Given the similarities between polony microarrays and certain aspects of sequencing methods such as the Illumina platform, we suggest that if concepts presented in this study were implemented in high throughput sequencing protocols, a reduction of PCR-induced errors and compositional skew may be realized. PMID:22640891

  17. Phenotype profiling of single gene deletion mutants of E. coli using Biolog technology.

    Science.gov (United States)

    Tohsato, Yukako; Mori, Hirotada

    2008-01-01

    Phenotype MicroArray (PM) technology is high-throughput phenotyping system and is directly applicable to assay the effects of genetic changes in cells. In this study, we performed comprehensive PM analysis using single gene deletion mutants of central metabolic pathway and related genes. To elucidate the structure of central metabolic networks in Escherichia coli K-12, we focused 288 different PM conditions of carbon and nitrogen sources and performed bioinformatic analysis. For data processing, we employed noise reduction procedures. The distance between each of the mutants was defined by Manhattan distance and agglomerative Ward's hierarchical method was applied for clustering analysis. As a result, five clusters were revealed which represented to activate or repress cellular respiratory activities. Furthermore, the results might suggest that Glyceraldehyde-3P plays a key role as a molecular switch of central metabolic network.

  18. Reverse genetics in Chlamydomonas: a platform for isolating insertional mutants

    OpenAIRE

    de Montaigu Amaury; Magneschi Leonardo; Catalanotti Claudia; Yang Wenqiang; Mus Florence; Pootakham Wirulda; Gonzalez-Ballester David; Higuera Jose J; Prior Matthew; Galván Aurora; Fernandez Emilio; Grossman Arthur R

    2011-01-01

    Abstract A method was developed to identify insertional mutants of Chlamydomonas reinhardtii disrupted for selected target genes. The approach relies on the generation of thousands of transformants followed by PCR-based screenings that allow for identification of strains harboring the introduced marker gene within specific genes of interest. Our results highlight the strengths and limitations of two independent screens that differed in the nature of the marker DNA used (PCR-amplified fragment...

  19. 汉族人群血管紧张素转换酶基因插入/缺失(I/D)的遗传多态性%Genetic polymorphism of angiotensin-converting enzyme gene insertion/deletion in Chinese Han population

    Institute of Scientific and Technical Information of China (English)

    高纯; 顾国浩; 夏正

    2006-01-01

    BACKGROUND: The angiotensin-converting enzyme (ACE) is the important component of the renin-angiotensin-aldosterone system (RAS). The ACE gene has, in fact,insertion/deletion polymorphism in intron 16, consisting of a 287-base pair Alu repeat sequence. ACE gene heterozygotes insertion/deletion (I/D) polymorphism is correlated with cardiovascular disease and IgA nephropathy and other diseases. OBJECTIVE: To investigate the distribution of ACE gene I/D polymor-phism in Chinese Han population in comparison with other known ethnic populations. DESIGN: Observation study on healthy individuals of Han nationality. SETTING: Key Laboratory of Clinical Immunology of Jiangsu Province; Department of Laboratory Medicine, First Hospital Affiliated to Soochow University; Department of aboratory Medicine, College of Medical Technology of Jiangsu University PARTICIPANTS: Totally 241 healthy individuals who received the healthy examination in the First Hospital of Soochow University between December 2005 and January 2006 were recruited in the experiment. They were 152 male and 89 female , with mean age of (27±8)years. All the participants without blood relationship were Han nationality from Suzhou region in China, free from disorder of hepatic, renal, endocrine and cardio- cerebrovascular diseases which were confirmed by clinical and experimen- tal examination. METHODS: Genotype of ACE gene I/D polymorphism allele of 241 healthy individuals of Han nationality was detected with polymerase chain reaction (PCR). PCR purified products with genotype of deletion/deletion (DD) and insertion/insertion (Ⅱ) polymorphism were performed DNA sequencing with fluorescence-labeled end termination method. MAIN OUTCOME MEASURES: Genotype and allele frequency of ACE gene I/D, as well as the comparison between them and those of other ethnic population. RESULTS: All the 241 subjects participated in final result analysis. ① The genotypes of ACE were DD, Ⅱ and ID. Compared with allele Ⅰ, allele D

  20. A New Two-Step Approach for Hands-On Teaching of Gene Technology: Effects on Students' Activities During Experimentation in an Outreach Gene Technology Lab

    Science.gov (United States)

    Scharfenberg, Franz-Josef; Bogner, Franz X.

    2011-08-01

    Emphasis on improving higher level biology education continues. A new two-step approach to the experimental phases within an outreach gene technology lab, derived from cognitive load theory, is presented. We compared our approach using a quasi-experimental design with the conventional one-step mode. The difference consisted of additional focused discussions combined with students writing down their ideas (step one) prior to starting any experimental procedure (step two). We monitored students' activities during the experimental phases by continuously videotaping 20 work groups within each approach ( N = 131). Subsequent classification of students' activities yielded 10 categories (with well-fitting intra- and inter-observer scores with respect to reliability). Based on the students' individual time budgets, we evaluated students' roles during experimentation from their prevalent activities (by independently using two cluster analysis methods). Independently of the approach, two common clusters emerged, which we labeled as `all-rounders' and as `passive students', and two clusters specific to each approach: `observers' as well as `high-experimenters' were identified only within the one-step approach whereas under the two-step conditions `managers' and `scribes' were identified. Potential changes in group-leadership style during experimentation are discussed, and conclusions for optimizing science teaching are drawn.

  1. Gene Disruption Technologies Have the Potential to Transform Stored Product Insect Pest Control

    Science.gov (United States)

    Perkin, Lindsey C.; Adrianos, Sherry L.; Oppert, Brenda

    2016-01-01

    Stored product insects feed on grains and processed commodities manufactured from grain post-harvest, reducing the nutritional value and contaminating food. Currently, the main defense against stored product insect pests is the pesticide fumigant phosphine. Phosphine is highly toxic to all animals, but is the most effective and economical control method, and thus is used extensively worldwide. However, many insect populations have become resistant to phosphine, in some cases to very high levels. New, environmentally benign and more effective control strategies are needed for stored product pests. RNA interference (RNAi) may overcome pesticide resistance by targeting the expression of genes that contribute to resistance in insects. Most data on RNAi in stored product insects is from the coleopteran genetic model, Tribolium castaneum, since it has a strong RNAi response via injection of double stranded RNA (dsRNA) in any life stage. Additionally, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology has been suggested as a potential resource for new pest control strategies. In this review we discuss background information on both gene disruption technologies and summarize the advances made in terms of molecular pest management in stored product insects, mainly T. castaneum, as well as complications and future needs. PMID:27657138

  2. Gene Disruption Technologies Have the Potential to Transform Stored Product Insect Pest Control.

    Science.gov (United States)

    Perkin, Lindsey C; Adrianos, Sherry L; Oppert, Brenda

    2016-09-19

    Stored product insects feed on grains and processed commodities manufactured from grain post-harvest, reducing the nutritional value and contaminating food. Currently, the main defense against stored product insect pests is the pesticide fumigant phosphine. Phosphine is highly toxic to all animals, but is the most effective and economical control method, and thus is used extensively worldwide. However, many insect populations have become resistant to phosphine, in some cases to very high levels. New, environmentally benign and more effective control strategies are needed for stored product pests. RNA interference (RNAi) may overcome pesticide resistance by targeting the expression of genes that contribute to resistance in insects. Most data on RNAi in stored product insects is from the coleopteran genetic model, Tribolium castaneum, since it has a strong RNAi response via injection of double stranded RNA (dsRNA) in any life stage. Additionally, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology has been suggested as a potential resource for new pest control strategies. In this review we discuss background information on both gene disruption technologies and summarize the advances made in terms of molecular pest management in stored product insects, mainly T. castaneum, as well as complications and future needs.

  3. Gene Disruption Technologies Have the Potential to Transform Stored Product Insect Pest Control

    Directory of Open Access Journals (Sweden)

    Lindsey C. Perkin

    2016-09-01

    Full Text Available Stored product insects feed on grains and processed commodities manufactured from grain post-harvest, reducing the nutritional value and contaminating food. Currently, the main defense against stored product insect pests is the pesticide fumigant phosphine. Phosphine is highly toxic to all animals, but is the most effective and economical control method, and thus is used extensively worldwide. However, many insect populations have become resistant to phosphine, in some cases to very high levels. New, environmentally benign and more effective control strategies are needed for stored product pests. RNA interference (RNAi may overcome pesticide resistance by targeting the expression of genes that contribute to resistance in insects. Most data on RNAi in stored product insects is from the coleopteran genetic model, Tribolium castaneum, since it has a strong RNAi response via injection of double stranded RNA (dsRNA in any life stage. Additionally, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR technology has been suggested as a potential resource for new pest control strategies. In this review we discuss background information on both gene disruption technologies and summarize the advances made in terms of molecular pest management in stored product insects, mainly T. castaneum, as well as complications and future needs.

  4. Identification of Actinobacillus pleuropneumoniae Genes Preferentially Expressed During Infection Using In Vivo-Induced Antigen Technology (IVIAT).

    Science.gov (United States)

    Zhang, Fei; Zhang, Yangyi; Wen, Xintian; Huang, Xiaobo; Wen, Yiping; Wu, Rui; Yan, Qigui; Huang, Yong; Ma, Xiaoping; Zhao, Qin; Cao, Sanjie

    2015-10-01

    Porcine pleuropneumonia is an infectious disease caused by Actinobacillus pleuropneumoniae. The identification of A. pleuropneumoniae genes, specially expressed in vivo, is a useful tool to reveal the mechanism of infection. IVIAT was used in this work to identify antigens expressed in vivo during A. pleuropneumoniae infection, using sera from individuals with chronic porcine pleuropneumonia. Sequencing of DNA inserts from positive clones showed 11 open reading frames with high homology to A. pleuropneumoniae genes. Based on sequence analysis, proteins encoded by these genes were involved in metabolism, replication, transcription regulation, and signal transduction. Moreover, three function-unknown proteins were also indentified in this work. Expression analysis using quantitative real-time PCR showed that most of the genes tested were up-regulated in vivo relative to their expression levels in vitro. IVI (in vivoinduced) genes that were amplified by PCR in different A. pleuropneumoniae strains showed that these genes could be detected in almost all of the strains. It is demonstrated that the identified IVI antigen may have important roles in the infection of A. pleuropneumoniae.

  5. Post-CTS Delay Insertion

    Directory of Open Access Journals (Sweden)

    Jianchao Lu

    2010-01-01

    clock skew operation is performed only at the clock sinks in order to preserve the structure and the optimizations implemented in the clock tree synthesis stage. The methodology is implemented as a linear programming model amenable to two design objectives: fixing timing violations or optimizing the clock period. Experimental results show that the clock networks of the largest ISCAS'89 circuits can be corrected post-CTS to resolve the timing conflicts in approximately 90% of the circuits with minimal delay insertion (0.159  ×  clock period per clock path on average. It is also shown that the majority of the clock period improvement achievable through unrestricted clock skew scheduling are obtained through very limited insertion (≈43% average improvement through 10% of max insertion.

  6. Insertion and deletion mutagenesis of the human cytomegalovirus genome

    Energy Technology Data Exchange (ETDEWEB)

    Spaete, R.R.; Mocarski, E.S.

    1987-10-01

    Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, with levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.

  7. An insertion algorithm for catabolizability

    CERN Document Server

    Blasiak, Jonah

    2009-01-01

    Motivated by our recent work relating canonical bases to combinatorics of Garsia-Procesi modules \\cite{B}, we give an insertion algorithm that computes the catabolizability of the insertion tableau of a standard word. This allows us to characterize catabolizability as the statistic on words invariant under Knuth transformations, certain (co)rotations, and a new operation called a catabolism transformation. We also prove a Greene's Theorem-like characterization of catabolizability, and a result about how cocyclage changes catabolizability, strengthening a similar result in \\cite{SW}.

  8. Two new beta0-thalassemic mutations: a deletion (-CC) at codon 142 or overlapping codons 142-143, and an insertion (+T) at codon 45 or overlapping codons 44-45/45-46 of the beta-globin gene.

    Science.gov (United States)

    Lacan, Philippe; Aubry, Martine; Couprie, Nicole; Francina, Alain

    2007-01-01

    We report here two new beta(0)-thalassemic mutations. In the first case, a deletion of two nucleotides (-CC) at codon 142 was found in a French Caucasian woman. In the second case, an insertion of a single nucleotide (+T) at codon 45 was found in a Turkish girl. In both cases, no dominant thalassemia-like phenotype was observed.

  9. Concepts for stereoselective acrylate insertion

    KAUST Repository

    Neuwald, Boris

    2013-01-23

    Various phosphinesulfonato ligands and the corresponding palladium complexes [{((PaO)PdMeCl)-μ-M}n] ([{( X1-Cl)-μ-M}n], (PaO) = κ2- P,O-Ar2PC6H4SO2O) with symmetric (Ar = 2-MeOC6H4, 2-CF3C6H4, 2,6-(MeO)2C6H3, 2,6-(iPrO)2C 6H3, 2-(2′,6′-(MeO)2C 6H3)C6H4) and asymmetric substituted phosphorus atoms (Ar1 = 2,6-(MeO)2C6H 3, Ar2 = 2′-(2,6-(MeO)2C 6H3)C6H4; Ar1 = 2,6-(MeO)2C6H3, Ar2 = 2-cHexOC 6H4) were synthesized. Analyses of molecular motions and dynamics by variable temperature NMR studies and line shape analysis were performed for the free ligands and the complexes. The highest barriers of ΔGa = 44-64 kJ/mol were assigned to an aryl rotation process, and the flexibility of the ligand framework was found to be a key obstacle to a more effective stereocontrol. An increase of steric bulk at the aryl substituents raises the motional barriers but diminishes insertion rates and regioselectivity. The stereoselectivity of the first and the second methyl acrylate (MA) insertion into the Pd-Me bond of in situ generated complexes X1 was investigated by NMR and DFT methods. The substitution pattern of the ligand clearly affects the first MA insertion, resulting in a stereoselectivity of up to 6:1 for complexes with an asymmetric substituted phosphorus. In the consecutive insertion, the stereoselectivity is diminished in all cases. DFT analysis of the corresponding insertion transition states revealed that a selectivity for the first insertion with asymmetric (P aO) complexes is diminished in the consecutive insertions due to uncooperatively working enantiomorphic and chain end stereocontrol. From these observations, further concepts are developed. © 2012 American Chemical Society.

  10. Insertion DNA Accelerates Meiotic Interchromosomal Recombination in Arabidopsis thaliana.

    Science.gov (United States)

    Sun, Xiao-Qin; Li, Ding-Hong; Xue, Jia-Yu; Yang, Si-Hai; Zhang, Yan-Mei; Li, Mi-Mi; Hang, Yue-Yu

    2016-08-01

    Nucleotide insertions/deletions are ubiquitous in eukaryotic genomes, and the resulting hemizygous (unpaired) DNA has significant, heritable effects on adjacent DNA. However, little is known about the genetic behavior of insertion DNA. Here, we describe a binary transgenic system to study the behavior of insertion DNA during meiosis. Transgenic Arabidopsis lines were generated to carry two different defective reporter genes on nonhomologous chromosomes, designated as "recipient" and "donor" lines. Double hemizygous plants (harboring unpaired DNA) were produced by crossing between the recipient and the donor, and double homozygous lines (harboring paired DNA) via self-pollination. The transfer of the donor's unmutated sequence to the recipient generated a functional β-glucuronidase gene, which could be visualized by histochemical staining and corroborated by polymerase chain reaction amplification and sequencing. More than 673 million seedlings were screened, and the results showed that meiotic ectopic recombination in the hemizygous lines occurred at a frequency  >6.49-fold higher than that in the homozygous lines. Gene conversion might have been exclusively or predominantly responsible for the gene correction events. The direct measurement of ectopic recombination events provided evidence that an insertion, in the absence of an allelic counterpart, could scan the entire genome for homologous counterparts with which to pair. Furthermore, the unpaired (hemizygous) architectures could accelerate ectopic recombination between itself and interchromosomal counterparts. We suggest that the ectopic recombination accelerated by hemizygous architectures may be a general mechanism for interchromosomal recombination through ubiquitously dispersed repeat sequences in plants, ultimately contributing to genetic renovation and eukaryotic evolution.

  11. Allelic prevalence of intron 3 insertion/deletion genetic ...

    African Journals Online (AJOL)

    Leila Fallahzadeh-Abarghooei

    2015-03-18

    Mar 18, 2015 ... genetic polymorphism of DNA double-strand break repair gene ..... [12] Amirshahi P, Sunderland E, Farhud DD, Tavakoli SH, · Daneshmand P ... [17] Saadat M. Distribution of ACE insertion/deletion (I/D) · polymorphism in ...

  12. Disease Control in Animals Using Molecular Technology by Inactivation of ASO, RNAi and ss-siRNA Genes

    Directory of Open Access Journals (Sweden)

    Muhamad Ali

    2014-03-01

    Full Text Available Globalization causes high mobility of human and livestock, hence increase the transmission of infectious diseases, including avian influenza, severe acute respiratory syndrome (SARS, and swine influenza. Therefore, prevention of those diseases is required. Vaccines are effective to prevent infectious diseases; however, their development takes a long time and they cannot provide immediate protection in pandemic cases. This paper describes several gene silencing technologies including antisense oligonucleotide (ASO, RNA interference (RNAi and single strand-small interfering RNA (ss-siRNA for controlling diseases. The primary mechanism of these technologies is inhibition of gene expression, typically by causing the destruction of specific RNA molecule of the pathogen. The use of gene silencing technologies is expected to give new alternative that is more effective in eradication of infectious diseases in animals before threaten human being.

  13. Impact of the GeneXpert MTB/RIF Technology on Tuberculosis Control.

    Science.gov (United States)

    Stevens, Wendy Susan; Scott, Lesley; Noble, Lara; Gous, Natasha; Dheda, Keertan

    2017-01-01

    Molecular technology revolutionized the diagnosis of tuberculosis (TB) with a paradigm shift to faster, more sensitive, clinically relevant patient care. The most recent molecular leader is the GeneXpert MTB/RIF assay (Xpert) (Cepheid, Sunnyvale, CA), which was endorsed by the World Health Organization with unprecedented speed in December 2010 as the initial diagnostic for detection of HIV-associated TB and for where high rates of drug resistance are suspected. South Africa elected to take an aggressive smear replacement approach to facilitate earlier diagnosis and treatment through the decision to implement the Xpert assay nationally in March 2011, against the backdrop of approximately 6.3 million HIV-infected individuals, one of highest global TB and HIV coinfection rates, no available implementation models, uncertainties around field performance and program costs, and lack of guidance on how to operationalize the assay into existing complex clinical algorithms. South Africa's national implementation was conducted as a phased, forecasted, and managed approach (March 2011 to September 2013), through political will and both treasury-funded and donor-funded support. Today there are 314 GeneXperts across 207 microscopy centers; over 8 million assays have been conducted, and South Africa accounts for over half the global test cartridge usage. As with any implementation of new technology, challenges were encountered, both predicted and unexpected. This chapter discusses the challenges and consequences of such large-scale implementation efforts, the opportunities for new innovations, and the need to strengthen health systems, as well as the impact of the Xpert assay on rifampin-sensitive and multidrug-resistant TB patient care that translated into global TB control as we move toward the sustainable development goals.

  14. PRODUCTION OF CAST DIE INSERTS FOR HOT STRAINING

    Directory of Open Access Journals (Sweden)

    L. R. Dudetskaja

    2009-01-01

    Full Text Available The paper discusses distinctive design features of casting molds and technological aspects of producing cast inserts from 5ХНМЛ pressed steel. The designs of long-life metal shell molds are described. They ensure saving of molding material, increase of accepted material and improvement of quality of castings.

  15. Transposable element insertions have strongly affected human evolution.

    Science.gov (United States)

    Britten, Roy J

    2010-11-16

    Comparison of a full collection of the transposable element (TE) sequences of vertebrates with genome sequences shows that the human genome makes 655 perfect full-length matches. The cause is that the human genome contains many active TEs that have caused TE inserts in relatively recent times. These TE inserts in the human genome are several types of young Alus (AluYa5, AluYb8, AluYc1, etc.). Work in many laboratories has shown that such inserts have many effects including changes in gene expression, increases in recombination, and unequal crossover. The time of these very effective changes in the human lineage genome extends back about 4 million years according to these data and very likely much earlier. Rapid human lineage-specific evolution, including brain size is known to have also occurred in the last few million years. Alu insertions likely underlie rapid human lineage evolution. They are known to have many effects. Examples are listed in which TE sequences have influenced human-specific genes. The proposed model is that the many TE insertions created many potentially effective changes and those selected were responsible for a part of the striking human lineage evolution. The combination of the results of these events that were selected during human lineage evolution was apparently effective in producing a successful and rapidly evolving species.

  16. Insertion device calculations with mathematica

    Energy Technology Data Exchange (ETDEWEB)

    Carr, R. [Stanford Synchrotron Radiation Lab., CA (United States); Lidia, S. [Univ. of California, Davis, CA (United States)

    1995-02-01

    The design of accelerator insertion devices such as wigglers and undulators has usually been aided by numerical modeling on digital computers, using code in high level languages like Fortran. In the present era, there are higher level programming environments like IDL{reg_sign}, MatLab{reg_sign}, and Mathematica{reg_sign} in which these calculations may be performed by writing much less code, and in which standard mathematical techniques are very easily used. The authors present a suite of standard insertion device modeling routines in Mathematica to illustrate the new techniques. These routines include a simple way to generate magnetic fields using blocks of CSEM materials, trajectory solutions from the Lorentz force equations for given magnetic fields, Bessel function calculations of radiation for wigglers and undulators and general radiation calculations for undulators.

  17. Patterns of transposable element expression and insertion in cancer

    Directory of Open Access Journals (Sweden)

    Evan A Clayton

    2016-11-01

    Full Text Available Human transposable element (TE activity in somatic tissues causes mutations that can contribute to tumorigenesis. Indeed, TE insertion mutations have been implicated in the etiology of a number of different cancer types. Nevertheless, the full extent of somatic TE activity, along with its relationship to tumorigenesis, have yet to be fully explored. Recent developments in bioinformatics software make it possible to analyze TE expression levels and TE insertional activity directly from transcriptome (RNA-seq and whole genome (DNA-seq next-generation sequence data. We applied these new sequence analysis techniques to matched normal and primary tumor patient samples from the Cancer Genome Atlas (TCGA in order to analyze the patterns of TE expression and insertion for three cancer types: breast invasive carcinoma, head and neck squamous cell carcinoma, and lung adenocarcinoma. Our analysis focused on the three most abundant families of active human TEs: Alu, SVA and L1. We found evidence for high levels of somatic TE activity for these three families in normal and cancer samples across diverse tissue types. Abundant transcripts for all three TE families were detected in both normal and cancer tissues along with an average of ~80 unique TE insertions per individual patient/tissue. We observed an increase in L1 transcript expression and L1 insertional activity in primary tumor samples for all three cancer types. Tumor-specific TE insertions are enriched for private mutations, consistent with a potentially causal role in tumorigenesis. We used genome feature analysis to investigate two specific cases of putative cancer-causing TE mutations in further detail. An Alu insertion in an upstream enhancer of the CBL tumor suppressor gene is associated with down-regulation of the gene in a single breast cancer patient, and an L1 insertion in the first exon of the BAALC gene also disrupts its expression in head and neck squamous cell carcinoma. Our results are

  18. Inserting Agility in System Development

    Science.gov (United States)

    2012-07-01

    Agile IT Acquisition, IT Box, Scrum Inserting Agility in System Development Matthew R. Kennedy and Lt Col Dan Ward, USAF With the fast-paced nature...1,700 individuals and 71 countries, found Scrum and eXtreme Programming to be the most widely followed method- ologies (VersionOne, 2007). Other...University http://www.dau.mil 259 Defense ARJ, July 2012, Vol. 19 No. 3 : 249–264 Scrum Scrum is a framework used for project management, which is

  19. HTS Insert Magnet Design Study

    CERN Document Server

    Devaux, M; Fleiter, J; Fazilleau, P; Lécrevisse, T; Pes, C; Rey, J-M; Rifflet, J-M; Sorbi, M; Stenvall, A; Tixador, P; Volpini, G

    2011-01-01

    Future accelerator magnets will need to reach higher field in the range of 20 T. This field level is very difficult to reach using only Low Temperature Superconductor materials whereas High Temperature Superconductors (HTS) provide interesting opportunities. High current densities and stress levels are needed to design such magnets. YBCO superconductor indeed carries large current densities under high magnetic field and provides good mechanical properties especially when produced using the IBAD approach. The HFM EUCARD program studies the design and the realization of an HTS insert of 6 T inside a Nb3Sn dipole of 13T at 4.2 K. In the2HTS insert, engineering current densities higher than 250 MA/m under 19 T are required to fulfill the specifications. The stress level is also very severe. YBCO IBAD tapes theoretically meet these challenges from presented measurements. The insert protection is also a critical because HTS materials show low quench propagation velocities and the coupling with the Nb3Sn magnet make...

  20. Gene-Transformation-Induced Changes in Chemical Functional Group Features and Molecular Structure Conformation in Alfalfa Plants Co-Expressing Lc-bHLH and C1-MYB Transcriptive Flavanoid Regulatory Genes: Effects of Single-Gene and Two-Gene Insertion

    Directory of Open Access Journals (Sweden)

    Ravindra G. Heendeniya

    2017-03-01

    Full Text Available Alfalfa (Medicago sativa L. genotypes transformed with Lc-bHLH and Lc transcription genes were developed with the intention of stimulating proanthocyanidin synthesis in the aerial parts of the plant. To our knowledge, there are no studies on the effect of single-gene and two-gene transformation on chemical functional groups and molecular structure changes in these plants. The objective of this study was to use advanced molecular spectroscopy with multivariate chemometrics to determine chemical functional group intensity and molecular structure changes in alfalfa plants when co-expressing Lc-bHLH and C1-MYB transcriptive flavanoid regulatory genes in comparison with non-transgenic (NT and AC Grazeland (ACGL genotypes. The results showed that compared to NT genotype, the presence of double genes (Lc and C1 increased ratios of both the area and peak height of protein structural Amide I/II and the height ratio of α-helix to β-sheet. In carbohydrate-related spectral analysis, the double gene-transformed alfalfa genotypes exhibited lower peak heights at 1370, 1240, 1153, and 1020 cm−1 compared to the NT genotype. Furthermore, the effect of double gene transformation on carbohydrate molecular structure was clearly revealed in the principal component analysis of the spectra. In conclusion, single or double transformation of Lc and C1 genes resulted in changing functional groups and molecular structure related to proteins and carbohydrates compared to the NT alfalfa genotype. The current study provided molecular structural information on the transgenic alfalfa plants and provided an insight into the impact of transgenes on protein and carbohydrate properties and their molecular structure’s changes.

  1. The common viral insertion site Evi12 is located in the 5'-noncoding region of Gnn, a novel gene with enhanced expression in two subclasses of human acute myeloid leukemia.

    NARCIS (Netherlands)

    E. van den Akker (Eric); Y.V. Vankan-Berkhoudt (Yolanda); P.J.M. Valk (Peter); B. Löwenberg (Bob); H.R. Delwel (Ruud)

    2005-01-01

    textabstractThe leukemia and lymphoma disease locus Evi12 was mapped to the noncoding region of a novel gene, Gnn (named for Grp94 neighboring nucleotidase), that is located immediately upstream of the Grp94/Tra1 gene on mouse chromosome 10. The Gnn gene is conserved in mice and humans. Expression o

  2. Ultrasonic airborne insertion loss measurements at normal incidence (L).

    Science.gov (United States)

    Farley, Jayrin; Anderson, Brian E

    2010-12-01

    Transmission loss and insertion loss measurements of building materials at audible frequencies are commonly made using plane wave tubes or as a panel between reverberant rooms. These measurements provide information for noise isolation control in architectural acoustics and in product development. Airborne ultrasonic sound transmission through common building materials has not been fully explored. Technologies and products that utilize ultrasonic frequencies are becoming increasingly more common, hence the need to conduct such measurements. This letter presents preliminary measurements of the ultrasonic insertion loss levels for common building materials over a frequency range of 28-90 kHz using continuous-wave excitation.

  3. Shield Insertion to Minimize Noise Amplitude in Global Interconnects

    Directory of Open Access Journals (Sweden)

    Kalpana.A.B

    2012-09-01

    Full Text Available Shield insertion is an effective technique for minimise crosstalk noise and signal delay uncertainty .To reduce the effects of coupling uniform or simultaneous shielding may be used on either or both sides of a signal line. Shields are ground or power lines placed between two signal wires to prevent direct coupling between them as the shield width increases, the noise amplitude decreases, in this paper inserting a shield line between two coupled interconnects is shown to be more effective in reducing crosstalk noise for different technology nodes .

  4. New bioinformatic tool for quick identification of functionally relevant endogenous retroviral inserts in human genome.

    Science.gov (United States)

    Garazha, Andrew; Ivanova, Alena; Suntsova, Maria; Malakhova, Galina; Roumiantsev, Sergey; Zhavoronkov, Alex; Buzdin, Anton

    2015-01-01

    Endogenous retroviruses (ERVs) and LTR retrotransposons (LRs) occupy ∼8% of human genome. Deep sequencing technologies provide clues to understanding of functional relevance of individual ERVs/LRs by enabling direct identification of transcription factor binding sites (TFBS) and other landmarks of functional genomic elements. Here, we performed the genome-wide identification of human ERVs/LRs containing TFBS according to the ENCODE project. We created the first interactive ERV/LRs database that groups the individual inserts according to their familial nomenclature, number of mapped TFBS and divergence from their consensus sequence. Information on any particular element can be easily extracted by the user. We also created a genome browser tool, which enables quick mapping of any ERV/LR insert according to genomic coordinates, known human genes and TFBS. These tools can be used to easily explore functionally relevant individual ERV/LRs, and for studying their impact on the regulation of human genes. Overall, we identified ∼110,000 ERV/LR genomic elements having TFBS. We propose a hypothesis of "domestication" of ERV/LR TFBS by the genome milieu including subsequent stages of initial epigenetic repression, partial functional release, and further mutation-driven reshaping of TFBS in tight coevolution with the enclosing genomic loci.

  5. Students' Ontological Security and Agency in Science Education--An Example from Reasoning about the Use of Gene Technology

    Science.gov (United States)

    Lindahl, Mats Gunnar; Linder, Cedric

    2013-01-01

    This paper reports on a study of how students' reasoning about socioscientific issues is framed by three dynamics: societal structures, agency and how trust and security issues are handled. Examples from gene technology were used as the forum for interviews with 13 Swedish high-school students (year 11, age 17-18). A grid based on modalities from…

  6. An Elementary Discussion on Factors of Gene Technology Risk%基因技术风险成因分析

    Institute of Scientific and Technical Information of China (English)

    曹静; 冯慧卿; 鄢来均

    2015-01-01

    Since the gene technology came into being ,it has been a divisive issue. The paper holds that people should not only focus on the advantages and disadvantages which the gene technology brings right now ,but also should have a long-term sight,care about gene technology risk. In this paper, factors of gene technology risk from the aspects of limited cognition,researchers'ethics anomie,economy,national interests at first,risk social amplification effect are analyzed briefly.%基因技术自问世以来就引发了广泛的争议.文章认为人们不仅应关注基因技术当下带来的益处与弊端,也应关注基因技术带来的风险.文章简要地从主体认知的局限性、科研人员道德失范、经济、国家利益至上、风险的社会放大效应这几个方面分析了基因技术的风险成因.

  7. High-throughput semiquantitative analysis of insertional mutations in heterogeneous tumors

    NARCIS (Netherlands)

    Koudijs, M.J.; Klijn, C.; van der Weyden, L.; Kool, J.; ten Hoeve, J.; Sie, D.; Prasetyanti, P.R.; Schut, E.; Kas, S.; Whipp, T.; Cuppen, E.; Wessels, L.; Adams, D.J.; Jonkers, J.

    2011-01-01

    Retroviral and transposon-based insertional mutagenesis (IM) screens are widely used for cancer gene discovery in mice. Exploiting the full potential of IM screens requires methods for high-throughput sequencing and mapping of transposon and retroviral insertion sites. Current protocols are based on

  8. Field errors in hybrid insertion devices

    Energy Technology Data Exchange (ETDEWEB)

    Schlueter, R.D. [Lawrence Berkeley Lab., CA (United States)

    1995-02-01

    Hybrid magnet theory as applied to the error analyses used in the design of Advanced Light Source (ALS) insertion devices is reviewed. Sources of field errors in hybrid insertion devices are discussed.

  9. Additive manufacturing for the production of inserts for micro injection moulding

    DEFF Research Database (Denmark)

    Mischkot, Michael; Hansen, Hans Nørgaard; Pedersen, David Bue

    2015-01-01

    The production of inserts for micro injection moulding using additive manufacturing technology has the potential to greatly improve the efficiency of pilot production and reduce overall time to market. In this work, Digital Light Processing (DLP) was used to produce micro injection moulding inserts...

  10. Velamentous and Furcate Cord Insertion with Placenta Accreta in an IVF Pregnancy with Unicornuate Uterus

    Directory of Open Access Journals (Sweden)

    Mehmet Tunç Canda

    2013-01-01

    Full Text Available Velamentous and furcate cord insertion with concomitant placenta accreta is a very rare and life-threatening event of pregnancy for both the mother and the fetus. Obstetricians should be cautious about umbilical cord insertion and placental adherence abnormalities in pregnancies conceived by assisted reproductive technologies (ART particularly in women with Müllerian anomalies.

  11. Genetic aspects of targeted insertion mutagenesis in yeasts.

    Science.gov (United States)

    Klinner, U; Schäfer, B

    2004-05-01

    Targeted insertion mutagenesis is a main molecular tool of yeast science initially applied in Saccharomyces cerevisiae. The method was extended to fission yeast Schizosaccharomyces pombe and to "non-conventional" yeast species, which show specific properties of special interest to both basic and applied research. Consequently, the behaviour of such non-Saccharomyces yeasts is reviewed against the background of the knowledge of targeted insertion mutagenesis in S. cerevisiae. Data of homologous integration efficiencies obtained with circular, ends-in or ends-out vectors in several yeasts are compared. We follow details of targeted insertion mutagenesis in order to recognize possible rate-limiting steps. The route of the vector to the target and possible mechanisms of its integration into chromosomal genes are considered. Specific features of some yeast species are discussed. In addition, similar approaches based on homologous recombination that have been established for the mitochondrial genome of S. cerevisiae are described.

  12. Optimized production and concentration of lentiviral vectors containing large inserts.

    Science.gov (United States)

    al Yacoub, Nadya; Romanowska, Malgorzata; Haritonova, Natalie; Foerster, John

    2007-07-01

    Generation of high titer lentiviral stocks and efficient virus concentration are central to maximize the utility of lentiviral technology. Here we evaluate published protocols for lentivirus production on a range of transfer vectors differing in size (7.5-13.2 kb). We present a modified virus production protocol robustly yielding useful titers (up to 10(7)/ml) for a range of different transfer vectors containing packaging inserts up to 7.5 kb. Moreover, we find that virus recovery after concentration by ultracentrifugation depends on the size of the packaged inserts, heavily decreasing for large packaged inserts. We describe a fast (4 h) centrifugation protocol at reduced speed allowing high virus recovery even for large and fragile lentivirus vectors. The protocols outlined in the current report should be useful for many labs interested in producing and concentrating high titer lentiviral stocks.

  13. JT/LJT connector insert material evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Baca, J.R.F.

    1991-10-01

    Different insert (insulator) materials are undergoing evaluation to replace the Fiberite E-3938 BE96 material currently used. Also being evaluated is the reconfiguration of the insert and metal shell-edge geometries for the purpose of reducing the alleged interference principally responsible for insert damage.

  14. Reverse genetics in Chlamydomonas: a platform for isolating insertional mutants

    Directory of Open Access Journals (Sweden)

    de Montaigu Amaury

    2011-07-01

    Full Text Available Abstract A method was developed to identify insertional mutants of Chlamydomonas reinhardtii disrupted for selected target genes. The approach relies on the generation of thousands of transformants followed by PCR-based screenings that allow for identification of strains harboring the introduced marker gene within specific genes of interest. Our results highlight the strengths and limitations of two independent screens that differed in the nature of the marker DNA used (PCR-amplified fragment containing the plasmid-free marker versus entire linearized plasmid with the marker and in the strategies used to maintain and store transformants.

  15. From Flavr Savr Tomatoes to STEM Cell Therapy: Young People's Understandings of Gene Technology, 15 Years On

    Science.gov (United States)

    Lewis, Jenny

    2014-01-01

    This paper explores knowledge and understanding of basic genetics and gene technologies in school students who have been taught to a "science for all" National Curriculum and compares 482 students in 1995 (gene technology was a new and rapidly developing area of science with potential to impact on everyday life; the first cohort of…

  16. From Flavr Savr Tomatoes to STEM Cell Therapy: Young People's Understandings of Gene Technology, 15 Years On

    Science.gov (United States)

    Lewis, Jenny

    2014-01-01

    This paper explores knowledge and understanding of basic genetics and gene technologies in school students who have been taught to a "science for all" National Curriculum and compares 482 students in 1995 (gene technology was a new and rapidly developing area of science with potential to impact on everyday life; the first cohort of…

  17. Democracy and the governance of uncertainty. The case of agricultural gene technologies.

    Science.gov (United States)

    Pellizzoni, L

    2001-09-14

    The use of genetically modified organisms (GMOs) in agriculture and food production is the object of an intense and divisive debate. Drawing on a study on the public perception of agricultural gene technologies carried out in five European countries, the article deals with the policy aspects of the issue, and more precisely on the relation between institutions, experts and the public in a context of deep uncertainty. A theoretical framework is developed and compared with the study findings, suggesting that issues like the GMOs one represent a strong case for a more participatory policy-making. My conclusions suggest a style of governance based on the principles of deliberative democracy, as a suitable approach to the confrontation of different viewpoints and forms of knowledge. This appears to be the best way to improve the overall quality of policy-making: in this I include its legitimacy, the degree of public trust, and also the actual quality of its products. Strengthening the role of the public sphere seems more effective than simply increasing direct decision-making by the populace, and it offers an alternative to the 'elitist' solutions to the crisis of representative democracy.

  18. Use of Staby(®) technology for development and production of DNA vaccines free of antibiotic resistance gene.

    Science.gov (United States)

    Reschner, Anca; Scohy, Sophie; Vandermeulen, Gaëlle; Daukandt, Marc; Jacques, Céline; Michel, Benjamin; Nauwynck, Hans; Xhonneux, Florence; Préat, Véronique; Vanderplasschen, Alain; Szpirer, Cédric

    2013-10-01

    The appearance of new viruses and the cost of developing certain vaccines require that new vaccination strategies now have to be developed. DNA vaccination seems to be a particularly promising method. For this application, plasmid DNA is injected into the subject (man or animal). This plasmid DNA encodes an antigen that will be expressed by the cells of the subject. In addition to the antigen, the plasmid also encodes a resistance to an antibiotic, which is used during the construction and production steps of the plasmid. However, regulatory agencies (FDA, USDA and EMA) recommend to avoid the use of antibiotics resistance genes. Delphi Genetics developed the Staby(®) technology to replace the antibiotic-resistance gene by a selection system that relies on two bacterial genes. These genes are small in size (approximately 200 to 300 bases each) and consequently encode two small proteins. They are naturally present in the genomes of bacteria and on plasmids. The technology is already used successfully for production of recombinant proteins to achieve higher yields and without the need of antibiotics. In the field of DNA vaccines, we have now the first data validating the innocuousness of this Staby(®) technology for eukaryotic cells and the feasibility of an industrial production of an antibiotic-free DNA vaccine. Moreover, as a proof of concept, mice have been successfully vaccinated with our antibiotic-free DNA vaccine against a deadly disease, pseudorabies (induced by Suid herpesvirus-1).

  19. Report on emerging technologies for translational bioinformatics: a symposium on gene expression profiling for archival tissues

    Directory of Open Access Journals (Sweden)

    Waldron Levi

    2012-03-01

    Full Text Available Abstract Background With over 20 million formalin-fixed, paraffin-embedded (FFPE tissue samples archived each year in the United States alone, archival tissues remain a vast and under-utilized resource in the genomic study of cancer. Technologies have recently been introduced for whole-transcriptome amplification and microarray analysis of degraded mRNA fragments from FFPE samples, and studies of these platforms have only recently begun to enter the published literature. Results The Emerging Technologies for Translational Bioinformatics symposium on gene expression profiling for archival tissues featured presentations of two large-scale FFPE expression profiling studies (each involving over 1,000 samples, overviews of several smaller studies, and representatives from three leading companies in the field (Illumina, Affymetrix, and NuGEN. The meeting highlighted challenges in the analysis of expression data from archival tissues and strategies being developed to overcome them. In particular, speakers reported higher rates of clinical sample failure (from 10% to 70% than are typical for fresh-frozen tissues, as well as more frequent probe failure for individual samples. The symposium program is available at http://www.hsph.harvard.edu/ffpe. Conclusions Multiple solutions now exist for whole-genome expression profiling of FFPE tissues, including both microarray- and sequencing-based platforms. Several studies have reported their successful application, but substantial challenges and risks still exist. Symposium speakers presented novel methodology for analysis of FFPE expression data and suggestions for improving data recovery and quality assessment in pre-analytical stages. Research presentations emphasized the need for careful study design, including the use of pilot studies, replication, and randomization of samples among batches, as well as careful attention to data quality control. Regardless of any limitations in quantitave transcriptomics for

  20. First study on gene expression of cement proteins and potential adhesion-related genes of a membranous-based barnacle as revealed from Next-Generation Sequencing technology

    KAUST Repository

    Lin, Hsiu Chin

    2013-12-12

    This is the first study applying Next-Generation Sequencing (NGS) technology to survey the kinds, expression location, and pattern of adhesion-related genes in a membranous-based barnacle. A total of 77,528,326 and 59,244,468 raw sequence reads of total RNA were generated from the prosoma and the basis of Tetraclita japonica formosana, respectively. In addition, 55,441 and 67,774 genes were further assembled and analyzed. The combined sequence data from both body parts generates a total of 79,833 genes of which 47.7% were shared. Homologues of barnacle cement proteins - CP-19K, -52K, and -100K - were found and all were dominantly expressed at the basis where the cement gland complex is located. This is the main area where transcripts of cement proteins and other potential adhesion-related genes were detected. The absence of another common barnacle cement protein, CP-20K, in the adult transcriptome suggested a possible life-stage restricted gene function and/or a different mechanism in adhesion between membranous-based and calcareous-based barnacles. © 2013 © 2013 Taylor & Francis.

  1. Insertional hypermutation in mineral oil-induced plasmacytomas.

    Science.gov (United States)

    Knittel, Gero; Metzner, Mirjam; Beck-Engeser, Gabriele; Kan, Ada; Ahrends, Tomasz; Eilat, Dan; Huppi, Konrad; Wabl, Matthias

    2014-09-01

    Unless stimulated by a chronic inflammatory agent, such as mineral oil, plasma cell tumors are rare in young BALB/c mice. This raises the questions: What do inflammatory tissues provide to promote mutagenesis? And what is the nature of mutagenesis? We determined that mineral oil-induced plasmacytomas produce large amounts of endogenous retroelements--ecotropic and polytropic murine leukemia virus and intracisternal A particles. Therefore, plasmacytoma formation might occur, in part, by de novo insertion of these retroelements, induced or helped by the inflammation. We recovered up to ten de novo insertions in a single plasmacytoma, mostly in genes with common retroviral integration sites. Additional integrations accompany tumor evolution from a solid tumor through several generations in cell culture. The high frequency of de novo integrations into cancer genes suggests that endogenous retroelements are coresponsible for plasmacytoma formation and progression in BALB/c mice.

  2. Destabilization of the human epigenome: consequences of foreign DNA insertions.

    Science.gov (United States)

    Weber, Stefanie; Hofmann, Andrea; Herms, Stefan; Hoffmann, Per; Doerfler, Walter

    2015-08-01

    We previously reported changes of DNA methylation and transcription patterns in mammalian cells that carry integrated foreign DNA. Experiments were now designed to assess the epigenetic consequences of inserting a 5.6 kbp plasmid into the human genome. Differential transcription and CpG methylation patterns were compared between transgenomic and nontransgenomic cell clones by using gene chip microarray systems. In 4.7% of the 28.869 gene segments analyzed, transcriptional activities were up- or downregulated in the transgenomic cell clones. Genome-wide profiling revealed differential methylation in 3791 of > 480,000 CpG's examined in transgenomic versus nontransgenomic clones. The data document genome-wide effects of foreign DNA insertions on the epigenetic stability of human cells. Many fields in experimental biology and medicine employ transgenomic or otherwise genome-manipulated cells or organisms without considering the epigenetic consequences for the recipient genomes.

  3. Mono-allelic retrotransposon insertion addresses epigenetic transcriptional repression in human genome

    Directory of Open Access Journals (Sweden)

    Byun Hyang-Min

    2012-02-01

    Full Text Available Abstract Background Retrotransposons have been extensively studied in plants and animals and have been shown to have an impact on human genome dynamics and evolution. Their ability to move within genomes gives retrotransposons to affect genome instability. Methods we examined the polymorphic inserted AluYa5, evolutionary young Alu, in the progesterone receptor gene to determine the effects of Alu insertion on molecular environment. We used mono-allelic inserted cell lines which carry both Alu-present and Alu-absent alleles. To determine the epigenetic change and gene expression, we performed restriction enzyme digestion, Pyrosequencing, and Chromatin Immunoprecipitation. Results We observed that the polymorphic insertion of evolutionally young Alu causes increasing levels of DNA methylation in the surrounding genomic area and generates inactive histone tail modifications. Consequently the Alu insertion deleteriously inactivates the neighboring gene expression. Conclusion The mono-allelic Alu insertion cell line clearly showed that polymorphic inserted repetitive elements cause the inactivation of neighboring gene expression, bringing aberrant epigenetic changes.

  4. Applications of Gene Targeting Technology to Mental Retardation and Developmental Disability Research

    Science.gov (United States)

    Pimenta, Aurea F.; Levitt, Pat

    2005-01-01

    The human and mouse genome projects elucidated the sequence and position map of innumerous genes expressed in the central nervous system (CNS), advancing our ability to manipulate these sequences and create models to investigate regulation of gene expression and function. In this article, we reviewed gene targeting methodologies with emphasis on…

  5. 血管紧张素转换酶基因插入/缺失多态性与飞行员加速度耐力的相关性研究%Research on Relationship Between Insertion/Delation Polymorphism of Angiotensin Converting Enzyme Gene and Acceleration Tolerance of Pilots

    Institute of Scientific and Technical Information of China (English)

    蔡庆; 刘红巾; 邹志康; 陈涛; 马中立

    2013-01-01

    Objective To investigate the association of insertion/deletion (I/D) polymorphism of the angioten-sin-converting enzyme (ACE) gene with acceleration ( +Gz) tolerance of pilots. Methods Polymerase chain reaction (PCR) was used to determine the genotypes for an insertion/delation (I/D) polymorphism of the ACE gene in 50 pilots with high + Gz tolerance and 32 pilots with low + Gz tolerance. Results The genotype II and I allele frequency were significantly higher in the pilots with high + Gz tolerance (58. 00% and 0. 76) than that in the pilots with low + Gz tolerance (18. 75% and 0. 47, P <0. 01). Conclusion It is suggested that I gene of ACE may play a role in + Gz tolerance of pilots.%目的 探讨飞行员血管紧张素转换酶(ACE)基因插入或缺失(I/D)多态性与飞行员加速度耐力的相关性.方法 用聚合酶链反应(PCR)扩增技术检测50例高+Gz耐力飞行员和32例低+Gz耐力飞行员的ACE基因I/D多态性.结果 高+Gz耐力飞行员组Ⅱ基因型(58.00%)和I等位基因频率(0.76)显著高于低+ Gz耐力飞行员组(分别为18.75%和0.47,P<0.01).结论 ACE I基因有可能在飞行员的+ Gz耐力中起重要作用.

  6. Challenges for Insertion of Structural Nanomaterials in Aerospace Applications

    Science.gov (United States)

    Sochi, Emilie J.

    2012-01-01

    In the two decades since Iijima's report on carbon nanotubes (CNT), there has been great interest in realizing the benefits of mechanical properties observed at the nanoscale in large-scale structures. The weight savings possible due to dramatic improvements in mechanical properties relative to state-of-the-art material systems can be game changing for applications like aerospace vehicles. While there has been significant progress in commercial production of CNTs, major aerospace applications that take advantage of properties offered by this material have yet to be realized. This paper provides a perspective on the technical challenges and barriers for insertion of CNTs as an emerging material technology in aerospace applications and proposes approaches that may reduce the typical timeframe for technology maturation and insertion into aerospace structures.

  7. The Evolution of Insertion Sequences within Enteric Bacteria

    OpenAIRE

    Lawrence, J G; Ochman, H.; Hartl, D. L.

    1992-01-01

    To identify mechanisms that influence the evolution of bacterial transposons, DNA sequence variation was evaluated among homologs of insertion sequences IS1, IS3 and IS30 from natural strains of Escherichia coli and related enteric bacteria. The nucleotide sequences within each class of IS were highly conserved among E. coli strains, over 99.7% similar to a consensus sequence. When compared to the range of nucleotide divergence among chromosomal genes, these data indicate high turnover and ra...

  8. ISPpu22, a novel insertion sequence in the oprD porin gene of a carbapen- em-resistant Pseudomonas aeruginosa isolate from a burn patient in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Davood Kalantar-Neyestanaki

    2015-12-01

    Full Text Available Background and Objectives: The oprD mutation and AmpC overproduction are the main mechanisms of intrinsic resistance to carbapenems such as imipenem and meropenem in Pseudomonas aeruginosa.Materials and Methods: In this study, we investigated intrinsic resistance to carbapenems including mutation of oprD and AmpC overproduction in a carbapenem-resistant P. aeruginosa isolated from a burn patient by phenotypic and molecular methods.Results: In our study, the carbapenem-resistant P. aeruginosa isolate was resistant to imipenem, meropenem, cefepime, gentamicin, ceftriaxone, carbenicillin, aztreonam and ciprofloxacin but was susceptible to ceftazidime and polymyxin B. The minimum inhibitory concentrations (MICs against imipenem, meropenem and ceftazidime were 64 μg/ml, 16 μg/ml and 2μg/ml, respectively. The isolate was ESBLs and AmpC overproducer. No carbapenemase activity was detected by Modified Hodge test (MHT. This isolate was carrying only blaOXA-10. PCR amplification and sequencing of oprD performed on isolate resulted in PCR product of 2647bp. Sequence analysis of the 2647bp product revealed insertion of a sequence of 1232 bp at position 8 in coding region of oprD.Conclusion: According to the results of this study, oprD mutation and AmpC overproduction can cause the main mechanism of resistance of P. aeruginosa to carbapenems.Keywords: ISPpu22, oprD, AmpC, Carbapenem-resistant P. aeruginosa

  9. Sequential cooling insert for turbine stator vane

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Russel B

    2017-04-04

    A sequential flow cooling insert for a turbine stator vane of a small gas turbine engine, where the impingement cooling insert is formed as a single piece from a metal additive manufacturing process such as 3D metal printing, and where the insert includes a plurality of rows of radial extending impingement cooling air holes alternating with rows of radial extending return air holes on a pressure side wall, and where the insert includes a plurality of rows of chordwise extending second impingement cooling air holes on a suction side wall. The insert includes alternating rows of radial extending cooling air supply channels and return air channels that form a series of impingement cooling on the pressure side followed by the suction side of the insert.

  10. Requirements in screening cDNA libraries for new genes and solutions offered by SBH technology

    Energy Technology Data Exchange (ETDEWEB)

    Drmanac, R.; Drmanac, S.; Labat, I.; Stavropoulos, N.

    1993-12-31

    Under different assumptions about the total number of genes, the number of housekeeping and tissue-specific genes, and the difference in the number of mRNAs per cell for functional and nonfunctional genes, significantly different results can be expected from screening random cDNA clones. We have developed gene expression models as a guide for interpretation of experimental results. For statistical, biological, and technical reasons, the search for 100,000 plus genes and discrimination between nonfunctional, housekeeping, and tissue-specific genes requires the analysis of up to 10 million clones from 20 to 50 tissues. Oligonucleotide hybridization of dense clone blots is an inexpensive and fast way to screen such large clone sets. Our preliminary results on control clones and thousands of cDNA clones from an infant brain library demonstrate the feasibility of the method. We present several models of gene expression and analyze the main factors which can influence the hunt for new genes via the screening of random cDNA libraries. The basic steps in the preparation and use of dense DNA dot arrays are described, and some results that demonstrate the feasibility and efficiency of gene inventorying by oligonucleotide hybridization are presented. Furthermore, partial SBH and single-pass gel sequencing are compared and a gene analysis scheme that combines the two approaches is discussed.

  11. Genome-wide LORE1 retrotransposon mutagenesis and high-throughput insertion detection in Lotus japonicus.

    Science.gov (United States)

    Urbański, Dorian Fabian; Małolepszy, Anna; Stougaard, Jens; Andersen, Stig Uggerhøj

    2012-02-01

    Use of insertion mutants facilitates functional analysis of genes, but it has been difficult to identify a suitable mutagen and to establish large populations for reverse genetics in most plant species. The main challenge is developing efficient high-throughput procedures for both mutagenesis and identification of insertion sites. To date, only floral-dip T-DNA transformation of Arabidopsis has produced independent germinal insertions, thereby allowing generation of mutant populations from seeds of single plants. In addition, advances in insertion detection have been hampered by a lack of protocols, including software for automated data analysis, that take full advantage of high-throughput next-generation sequencing. We have addressed these challenges by developing the FSTpoolit protocol and software package, and here we demonstrate its efficacy by detecting 8935 LORE1 insertions in 3744 Lotus japonicus plants. The identified insertions show that the endogenous LORE1 retrotransposon is well suited for insertion mutagenesis due to homogenous gene targeting and exonic insertion preference. As LORE1 transposition occurs in the germline, harvesting seeds from a single founder line and cultivating progeny generates a complete mutant population. This ease of LORE1 mutagenesis, combined with the efficient FSTpoolit protocol, which exploits 2D pooling, Illumina sequencing and automated data analysis, allows highly cost-efficient development of a comprehensive reverse genetic resource.

  12. Association of Angiotensin-Converting Enzyme Intron 16 Insertion/Deletion and Angiotensin II Type 1 Receptor A1166C Gene Polymorphisms with Preeclampsia in South East of Iran

    Directory of Open Access Journals (Sweden)

    Saeedeh Salimi

    2011-01-01

    Full Text Available Some evidence suggests that a variety of genetic factors contributed in pathogenesis of the preeclampsia. The aim of this study was to assess the association between the angiotensin-converting enzyme (ACE I/D and angiotensin II type1 receptor A1166C polymorphisms with preeclampsia. This study was performed in 125 preeclamptic pregnant women and 132 controls. The I/D Polymorphism of the ACE gene was assessed by polymerase chain reaction and the A1166C Polymorphism of the AT1R gene was determined by restriction fragment length polymorphism. The genotype and allele frequencies of I/D polymorphism differed between two groups. The risk of preeclampsia was 3.2-fold in pregnant women with D allele (OR, 3.2 [95% CI, 1.1 to 3.8]; P=0.01. The distribution of the AT1R gene A1166C polymorphism was similar in affected and control groups. Our results supported that presence of the I/D polymorphism of ACE gene is a marker for the increased risk of preeclampsia.

  13. Insertional mutagenesis in mice deficient for p15Ink4b, p16Ink4a, p21Cip1, and p27Kip1 reveals cancer gene interactions and correlations with tumor phenotypes

    DEFF Research Database (Denmark)

    Kool, Jaap; Uren, Anthony G; Martins, Carla P

    2010-01-01

    The cyclin dependent kinase (CDK) inhibitors p15, p16, p21, and p27 are frequently deleted, silenced, or downregulated in many malignancies. Inactivation of CDK inhibitors predisposes mice to tumor development, showing that these genes function as tumor suppressors. Here, we describe high-through...

  14. Comparison of the sequences of the Aspergillus nidulans hxB and Drosophila melanogaster ma-l genes with nifS from Azotobacter vinelandii suggests a mechanism for the insertion of the terminal sulphur atom in the molybdopterin cofactor.

    Science.gov (United States)

    Amrani, L; Primus, J; Glatigny, A; Arcangeli, L; Scazzocchio, C; Finnerty, V

    2000-10-01

    The molybdopterin cofactor (MoCF) is required for the activity of a variety of oxidoreductases. The xanthine oxidase class of molybdoenzymes requires the MoCF to have a terminal, cyanolysable sulphur ligand. In the sulphite oxidase/nitrate reductase class, an oxygen is present in the same position. Mutations in both the ma-l gene of Drosophila melanogaster and the hxB gene of Aspergillus nidulans result in loss of activities of all molybdoenzymes that necessitate a cyanolysable sulphur in the active centre. The ma-l and hxB genes encode highly similar proteins containing domains common to pyridoxal phosphate-dependent cysteine transulphurases, including the cofactor binding site and a conserved cysteine, which is the putative sulphur donor. Key similarities were found with NifS, the enzyme involved in the generation of the iron-sulphur centres in nitrogenase. These similarities suggest an analogous mechanism for the generation of the terminal molybdenum-bound sulphur ligand. We have identified putative homologues of these genes in a variety of organisms, including humans. The human homologue is located in chromosome 18.q12.

  15. Teleoperated master-slave needle insertion.

    Science.gov (United States)

    Abolhassani, Niki; Patel, Rajni V

    2009-12-01

    Accuracy of needle tip placement and needle tracking in soft tissue are of particular importance in many medical procedures. In recent years, developing autonomous and teleoperated systems for needle insertion has become an active area of research. In this study, needle insertion was performed using a master-slave set-up with multi-degrees of freedom. The effect of force feedback on the accuracy of needle insertion was investigated. In addition, this study compared autonomous, teleoperated and semi-autonomous needle insertion. The results of this study show that incorporation of force feedback can improve teleoperated needle insertion. However, autonomous and semi-autonomous needle insertions, which use feedback from a deflection model, provide significantly better performance. Development of a haptic master-slave needle insertion system, which is capable of performing some autonomous tasks based on feedback from tissue deformation and needle deflection models, can improve the performance of autonomous robotics-based insertions as well as non-autonomous teleoperated manual insertions. Copyright (c) 2009 John Wiley & Sons, Ltd.

  16. A HTS dipole insert coil constructed

    CERN Document Server

    Ballarino, A; Rey, J M; Stenvall, A; Sorbi, M; Tixador, P

    2013-01-01

    This report is the deliverable report 7.4.1 “A HTS dipole insert coil constructed“. The report has three parts: “Design report for the HTS dipole insert”, “One insert pancake prototype coil constructed with the setup for a high field test”, and “All insert components ordered”. The three report parts show that, although the insert construction will be only completed by end 2013, all elements are present for a successful completion and that, given the important investments done by the participants, there is a full commitment of all of them to finish the project

  17. Genome-scale metabolic network validation of Shewanella oneidensis using transposon insertion frequency analysis.

    Directory of Open Access Journals (Sweden)

    Hong Yang

    2014-09-01

    Full Text Available Transposon mutagenesis, in combination with parallel sequencing, is becoming a powerful tool for en-masse mutant analysis. A probability generating function was used to explain observed miniHimar transposon insertion patterns, and gene essentiality calls were made by transposon insertion frequency analysis (TIFA. TIFA incorporated the observed genome and sequence motif bias of the miniHimar transposon. The gene essentiality calls were compared to: 1 previous genome-wide direct gene-essentiality assignments; and, 2 flux balance analysis (FBA predictions from an existing genome-scale metabolic model of Shewanella oneidensis MR-1. A three-way comparison between FBA, TIFA, and the direct essentiality calls was made to validate the TIFA approach. The refinement in the interpretation of observed transposon insertions demonstrated that genes without insertions are not necessarily essential, and that genes that contain insertions are not always nonessential. The TIFA calls were in reasonable agreement with direct essentiality calls for S. oneidensis, but agreed more closely with E. coli essentiality calls for orthologs. The TIFA gene essentiality calls were in good agreement with the MR-1 FBA essentiality predictions, and the agreement between TIFA and FBA predictions was substantially better than between the FBA and the direct gene essentiality predictions.

  18. [Advances in genetic modification technologies].

    Science.gov (United States)

    Zhang, Baixue; Sun, Qixin; Li, Haifeng

    2015-08-01

    Genetic modification technology is a new molecular tool for targeted genome modification. It includes zinc finger nucleases (ZFN) technology, transcription activator-like effector nucleases (TALEN) technology and clustered regularly interspaced short palindromic repeat (CRISPR)-associated (Cas) (CRISPR-Cas) nucleases technology. All of these nucleases create DNA double-strand breaks (DSB) at chromosomal targeted sites and induce cell endogenous mechanisms that are primarily repaired by the non-homologous end joining (NHEJ) or homologous recombination (HR) pathway, resulting in targeted endogenous gene knock-out or exogenous gene insertion. In recent years, genetic modification technologies have been successfully applied to bacteria, yeast, human cells, fruit fly, zebra fish, mouse, rat, livestock, cynomolgus monkey, Arabidopsis, rice, tobacco, maize, sorghum, wheat, barley and other organisms, showing its enormous advantage in gene editing field. Especially, the newly developed CRISPR-Cas9 system arose more attention because of its low cost, high effectiveness, simplicity and easiness. We reviewed the principles and the latest research progress of these three technologies, as well as prospect of future research and applications.

  19. Visualization analysis of CRISPR/Cas9 gene editing technology studies

    Institute of Scientific and Technical Information of China (English)

    Quan-sheng DU; Jie CUI; Chun-jie ZHANG; Ke HE

    2016-01-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) system is an adaptive immune defense system that resists the invasion of viruses and plasmids heterologous genetic material in bacteria and archaea. Taking the literature related to gene editing technology of CRISPR/Cas9 from the Web of Science database from 2002 to 2015, we use the software CiteSpaceV to analyze co-cited literature in order to establish the research hotspots and fronts recently in this field by knowledge mapping.%题目:基因编辑技术CRISPR/Cas9研究的可视化分析目的:理解CRISPR/Cas9研究的知识进化路径,以及动态过程和特点。创新点:CRISPR/Cas9系统是细菌和古细菌在长期演化过程中形成的一种抵御异源遗传物质入侵的适应性免疫防御机制。它被广泛应用于人类细胞、小鼠、斑马鱼、大米等的基因定向改造。本研究利用信息可视化软件 CiteSpaceV 分析了近年发表的CRISPR/Cas9有关文献,并绘制了知识图谱。方法:基于Web of Science数据库中2002年至2015年有关基因编辑技术 CRISPR/Cas9的文献资料为研究对象。利用信息可视化软件CiteSpaceV进行共被引文献分析,以知识图谱方式展现该领域近年来的研究热点和前沿。结论:CRISPR/Cas9系统的历史研究充分表明跨学科的重要性。跨学科点通常是新的科学的增长点和新的科学前沿,这是最有可能产生显著科学突破的地方。

  20. Inserção da Educação Física na área de Linguagens, Códigos e suas Tecnologias Inserting Physical Education in the area of Languages, codes and their technologies

    Directory of Open Access Journals (Sweden)

    Marlene de Fátima dos Santos

    2012-09-01

    Full Text Available Os Parâmetros Curriculares Nacionais para o Ensino Médio introduziram a Educação Física na área de Linguagens, Códigos e suas Tecnologias, juntamente com as disciplinas Língua Portuguesa, Artes, Informática, Literatura e Língua Estrangeira Moderna. Diante disso, este trabalho se propôs a investigar como professores das referidas disciplinas interpretam a inserção da Educação Física nessa área. Participaram deste estudo de caso qualitativo 16 professores de três escolas públicas estaduais, com mais de 1.500 alunos. Os resultados, obtidos por meio de questionário, evidenciam a dificuldade dos professores de trabalhar interdisciplinarmente, de identificar as relações possíveis entre as disciplinas e, inclusive, de reconhecer a Educação Física como integrante da área de Linguagens, Códigos e suas Tecnologias. Essas constatações configuram, portanto, aspectos relevantes a serem considerados no desafio de implementação das proposições legais nas escolas da Educação Básica.The High School National Curriculum Parameters introduced Physical Education in the area of Languages, Codes and their Technologies, along with other subjects like Portuguese language, Arts, Information Technology, Literature and Foreign Modern Language. Thus, this study aimed to investigate how teachers understand Physical Education in this area. For achieving this, a qualitative case study was done, in which 16 teachers from three public state schools with over 1.500 students. The results, obtained through a questionnaire, demonstrate the teachers' difficulty in developing interdisciplinary projects, in identifying the possible relations among disciplines, and even in recognizing Physical Education as part of the area of Languages, Codes, and their Technologies. These are, therefore, important issues to be considered in the challenge of implementing the legal propositions in the schools of Primary Education.

  1. Technology.

    Science.gov (United States)

    Online-Offline, 1998

    1998-01-01

    Focuses on technology, on advances in such areas as aeronautics, electronics, physics, the space sciences, as well as computers and the attendant progress in medicine, robotics, and artificial intelligence. Describes educational resources for elementary and middle school students, including Web sites, CD-ROMs and software, videotapes, books,…

  2. Microarray technology reveals potentially novel genes and pathways involved in non-functioning pituitary adenomas

    Science.gov (United States)

    Qiao, X; Wang, H; Wang, X; Zhao, B

    2016-01-01

    Abstract Microarray data of non-functioning pituitary adenomas (NFPAs) were analyzed to disclose novel genes and pathways involved in NFPA tumorigenesis. Raw microarray data were downloaded from Gene Expression Omnibus. Data pre-treatment and differential analysis were conducted using packages in R. Functional and pathway enrichment analyses were performed using package GOs-tats. A protein-protein interaction (PPI) network was constructed using server STRING and Cytoscape. Known genes involved in pituitary adenomas (PAs), were obtained from the Comparative Toxicogenomics Database. A total of 604 differentially expressed genes (DEGs) were identifed between NFPAs and controls, including 177 up- and 427 down-regulated genes. Jak-STAT and p53 signaling pathways were significantly enriched by DEGs. The PPI network of DEGs was constructed, containing 99 up- and 288 down-regulated known disease genes (e.g. EGFR and ESR1) as well as 16 up- and 17 down-regulated potential novel NFPAs-related genes (e.g. COL4A5, LHX3, MSN, and GHSR). Genes like COL4A5, LHX3, MSN, and GHSR and pathways such as p53 signaling and Jak-STAT signaling, might participate in NFPA development. Although further validations are required, these findings might provide guidance for future basic and therapy researches. PMID:28289583

  3. Development of a predictor for human brain tumors based on gene expression values obtained from two types of microarray technologies.

    Science.gov (United States)

    Castells, Xavier; Acebes, Juan José; Boluda, Susana; Moreno-Torres, Angel; Pujol, Jesús; Julià-Sapé, Margarida; Candiota, Ana Paula; Ariño, Joaquín; Barceló, Anna; Arús, Carles

    2010-04-01

    Development of molecular diagnostics that can reliably differentiate amongst different subtypes of brain tumors is an important unmet clinical need in postgenomics medicine and clinical oncology. A simple linear formula derived from gene expression values of four genes (GFAP, PTPRZ1, GPM6B, and PRELP) measured from cDNA microarrays (n = 35) have distinguished glioblastoma and meningioma cases in a previous study. We herein extend this work further and report that the above predictor formula showed its robustness when applied to Affymetrix microarray data acquired prospectively in our laboratory (n = 80) as well as publicly available data (n = 98). Importantly, GFAP and GPM6B were both retained as being significant in the predictive model upon using the Affymetrix data obtained in our laboratory, whereas the other two predictor genes were SFRP2 and SLC6A2. These results collectively indicate the importance of the expression values of GFAP and GPM6B genes sampled from the two types of microarray technologies tested. The high prediction accuracy obtained in these instances demonstrates the robustness of the predictors across microarray platforms used. This result would require further validation with a larger population of meningioma and glioblastoma cases. At any rate, this study paves the way for further application of gene signatures to more stringent biopsy discrimination challenges.

  4. Gene expression profiling of RNA extracted from FFPE tissues: NuGEN technologies' whole-transcriptome amplification system.

    Science.gov (United States)

    Turner, Leah; Heath, Joe Don; Kurn, Nurith

    2011-01-01

    Gene expression profiling of RNA isolated from formalin fixed, paraffin-embedded (FFPE) tissue samples has been historically challenging. Yet FFPE samples are sought-after because of the in-depth retrospective records typically associated with them rendering these samples a valuable resource for translational medicine studies. Extensive degradation, chemical modifications, and cross-linking have made it difficult to isolate RNA of sufficient quality required for large-scale gene expression profiling studies. NuGEN Technologies' WT-Ovation™ FFPE System linearly amplifies RNA from FFPE samples through a robust and simple whole-transcriptome approach using as little as 50 ng total RNA isolated from FFPE samples. The amplified material may be labeled with validated kits and/or protocols from NuGEN for analysis on any of the major gene expression microarray platforms, including: Affymetrix, Agilent, and Illumina gene expression arrays. Results compare well with those obtained using RNA from fresh-frozen samples. RNA quality from FFPE samples varies significantly and neither sample age nor sample size analysis via gel electrophoresis or the Agilent Bioanalyzer system accurately predict materials suitable for amplification. Therefore, NuGEN has validated a correlative qPCR-based analytical method for the RNA derived from FFPE samples which effectively predicts array results. The NuGEN approach enables fast and successful analysis of samples previously thought to be too degraded for gene expression analysis.

  5. Association between the DRD2-141C Insertion/Deletion polymorphism and schizophrenia Associação entre o polimorfismo -141C Ins/Del do gene do DRD2 e esquizofrenia

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2009-06-01

    Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between the -141 Ins/Del (rs1799732 polymorphism of the dopamine receptor type 2 (DRD2 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 229 patients and 733 controls. There were statistical differences in the allelic (χ2=9.78; p=0.001 and genotypic genotypic (χ2=12.74; p=0.001 distributions between patients and controls. Thus the -141C Ins/Del polymorphism of the DRD2 gene (allele Ins was associated to the SCZ phenotype in the investigated sample.Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para o desenvolvimento de esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para os estudos moleculares em pacientes com esquizofrenia, devido ao fato dos antipsicóticos, em especial os de primeira geração, exercerem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a possível associação entre polimorfismo -141C Ins/Del (rs1799732 do gene do receptor dopaminérgico tipo 2 (DRD2 e esquizofrenia. Um total de 229 pacientes e 733 controles pareados para sexo e idade foi selecionado com o objetivo de investigar a distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferença estatisticamente significante nas distribuições alélica (χ2=9,78; p=0,001 e genotípica (χ2=12,74; p=0,001 entre pacientes e

  6. HOW TO REDUCE NEEDLE INSERTION INDUCED PAIN

    Institute of Scientific and Technical Information of China (English)

    王斌; 董莉

    2001-01-01

    Acupuncture needle insertion always results in pain in the local area due to stimulating the free nerve endings—algesireceptors of the skin. In spite of mildness, this pain may induce many patients' fright, and thus, hinders more extensive application of acupuncture. In the present paper, the author introduces some methods for reducing needle insertion induced pain.

  7. Marginal adaptation of ceramic inserts after cementation

    NARCIS (Netherlands)

    Ozcan, M; Pfeiffer, P; Nergiz, [No Value

    2002-01-01

    The advantage of using ceramic inserts is to prevent major drawbacks of composite resins such as polymerization shrinkage, wear and microleakage. This in vitro study evaluated the marginal adaptation of two approximal ceramic insert systems after cementation to the cavities opened with ultrasonic ti

  8. An Elementary Account of Needle Insertion

    Institute of Scientific and Technical Information of China (English)

    张文兵; 霍则军

    2004-01-01

    @@ Based on the authors' clinical and personal experiences, several pain-inducing factors easily to be ignored by the operators when quick needle insertion is applied, and the authors' first invented slow painless needle insertion method are introduced in the article.

  9. Capacitações tecnológicas de micro e pequenas empresas inseridas em redes tecnoprodutivas: o caso da eletrometal-mecânica em Joinville (SC Technological capabilities of small and micro firms inserted in techno-productive networks: the case of electrometal-mechanic industry of Joinville (SC

    Directory of Open Access Journals (Sweden)

    Fabio Stallivieri

    2007-12-01

    structure, with patterns of specialization and complementarities according to the size of establishments and along different activities. The analysis of the labor division in the arrangement and of the specializations by size of the companies, combined with the market interactions and the types of sub contraction, will help to comprehend how micro and small companies insert themselves in the arrangement and technological capabilities they develop. The study is based on the neo-schumpeterian theoretical framework and has as its main objective the analysis of the different technological capabilities developed by these types of firms, according to their pattern of insertion in the local productive structure. For this purpose a survey with 83 companies of different sizes was made. An important finding was the existence of several kinds of techno-productive networks, which vary according to the forms of governance, the productive and technological characteristics and the nature of the learning processes. Such specificities affect, with different intensities, the possibilities of technological capacity building, which were also influenced by the relations with agents outside the arrangement.

  10. Evaluation of low density array technology for quantitative parallel measurement of multiple genes in human tissue

    Directory of Open Access Journals (Sweden)

    Harmer Daniel W

    2006-02-01

    Full Text Available Abstract Background Low density arrays (LDAs have recently been introduced as a novel approach to gene expression profiling. Based on real time quantitative RT-PCR (QRT-PCR, these arrays enable a more focused and sensitive approach to the study of gene expression than gene chips, while offering higher throughput than more established approaches to QRT-PCR. We have now evaluated LDAs as a means of determining the expression of multiple genes simultaneously in human tissues and cells. Results Comparisons between LDAs reveal low variability, with correlation coefficients close to 1. By performing 2-fold and 10-fold serial dilutions of cDNA samples in the LDAs we determined a clear linear relationship between the gene expression data points over 5 orders of magnitude. We also showed that it is possible to use LDAs to accurately and quantitatively detect 2-fold changes in target copy number as well as measuring genes that are expressed with low and high copy numbers in the range of 1 × 102 – 1 × 106 copies. Furthermore, the data generated by the LDA from a cell based pharmacological study were comparable to data generated by conventional QRT-PCR. Conclusion LDAs represent a valuable new approach for sensitive and quantitative gene expression profiling.

  11. A Non-canonical Transferred DNA Insertion at the BRI 1 Locus in Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    Zhong Zhao; Yan Zhu; Mathieu Erhardt; Ying Ruan; Wen-Hui Shen

    2009-01-01

    Agrobacterium-mediated transformation is widely used in transgenic plant englnserlng and has been proven to be a powerful tool for insertional mutagenesis of the plant genome.The transferred DNA (T-DNA) from Agrobacterlum is Integrated into the plant genome through illegitimate recombination between the T-DNA and the plant DNA.Contrasting to the canonical insertion,here we report on a locus showing a complex mutation associated with T-DNA insertion at the BRI 1 gene in Arabidopsis thaliana.We obtained a mutant line,named salade for its phenotype of dwarf stature and proliferating rosette,Molecular charactedzation of this mutant revealed that in addition to T-DNA a non.T.DNA-Iocalized transposon from bacteda was inserted in the Arabidopsis genome and that a region of more than 11.5 kb of the Arebidopsis genome was deleted at the insertion site.The deleted region contains the brassinosteroid receptor gene BRI 1 and the transcdption factor gene WRKY13.Our finding reveals non-canonical T-DNA insertion,implicating horizontal gene transfer and cautioning the use of T-DNA as mutagen in transgenic research.

  12. Determination and characterization of IS4Bsu1-insertion loci and identification of a new insertion sequence element of the IS256 family in a natto starter.

    Science.gov (United States)

    Kimura, Keitarou; Itoh, Yoshifumi

    2007-10-01

    The insertion sequence IS4Bsu1 frequently causes Bacillus subtilis starters for the production of Japanese fermented soybean pasts (natto) to lose the ability to produce poly-gamma-glutamate, the viscous material characteristic of natto. Bacillus subtilis NAFM5, a derivative of a natto starter, has six IS4Bsu1 copies on its chromosome. In this study, we determined all six insertion loci of the insertion sequence (IS). One was located in the coding region of yktD, a putative gene involved in polyketide synthesis. Four were located in non-coding regions between iolR and iolA, between tuaA and lytC, between rapI and orf1 (a potential gene of unknown function), and between ynaE and orf3 (a putative gene similar to thiF), and one resided in an intergenic region between divergent possible orf4 and orf5 genes of unknown function. Here we describe the structural features of these loci and discuss the effects of the IS4Bsu1 insertions on the functions of the target gene and the expression of the downstream genes. In addition, we found that strain NAFM5 and commercial natto starters possess eight to 10 loci of another IS of the IS256 family (designated IS256Bsu1) on their chromosomes. IS256Bus1 appeared active in transposition, potentially causing phenotypic alterations in natto starters like those induced by IS4Bsu1.

  13. Intradermal normal saline solution, self-selected music, and insertion difficulty effects on intravenous insertion pain.

    Science.gov (United States)

    Jacobson, A F

    1999-01-01

    To examine the effect of listening to self-selected music versus an intradermal injection of normal saline solution on the intensity and distress of intravenous (IV) catheter insertion pain. Prospective, randomized, controlled study. Inpatient and outpatient units in 2 university-affiliated southwestern medical centers. One hundred ten adult inpatients and outpatients undergoing IV therapy. Pain intensity, pain distress, and IV insertion difficulty visual analog scales. Patients were randomly assigned to receive an intradermal injection of normal saline solution, listen with headphones to self-selected music, or be in a control group for IV insertion. A MANOVA revealed no statistically significant multivariate or univariate differences in pain by treatment group, but significantly higher pain distress scores with failed IV insertions. The pain intensity and distress scores were significantly higher in the saline solution group when compared with the music and control groups combined. Insertion difficulty was significantly positively correlated with pain intensity and distress for the entire sample, with weak, nonsignificant correlations in the music group. Intradermal unpreserved saline solution contributes to greater pain intensity and distress, greater insertion difficulty, and a higher failure rate than the use of music or routine IV insertion. Listening to preferred music attenuates the effect of insertion difficulty on IV insertion pain. Intravenous insertion attempts were unsuccessful in more than one third of the subjects, resulting in higher pain distress scores. Further research is needed on interventions to reduce IV insertion pain and on factors contributing to IV insertion failure.

  14. Cellular Reprogramming, Genome Editing, and Alternative CRISPR Cas9 Technologies for Precise Gene Therapy of Duchenne Muscular Dystrophy

    Directory of Open Access Journals (Sweden)

    Peter Gee

    2017-01-01

    Full Text Available In the past decade, the development of two innovative technologies, namely, induced pluripotent stem cells (iPSCs and the CRISPR Cas9 system, has enabled researchers to model diseases derived from patient cells and precisely edit DNA sequences of interest, respectively. In particular, Duchenne muscular dystrophy (DMD has been an exemplary monogenic disease model for combining these technologies to demonstrate that genome editing can correct genetic mutations in DMD patient-derived iPSCs. DMD is an X-linked genetic disorder caused by mutations that disrupt the open reading frame of the dystrophin gene, which plays a critical role in stabilizing muscle cells during contraction and relaxation. The CRISPR Cas9 system has been shown to be capable of targeting the dystrophin gene and rescuing its expression in in vitro patient-derived iPSCs and in vivo DMD mouse models. In this review, we highlight recent advances made using the CRISPR Cas9 system to correct genetic mutations and discuss how emerging CRISPR technologies and iPSCs in a combined platform can play a role in bringing a therapy for DMD closer to the clinic.

  15. Insertion of pedagogical activities mediated by ICT in literacy

    Directory of Open Access Journals (Sweden)

    Lúcia Margarete Santos da Costa

    2016-12-01

    Full Text Available This article is cut out of a research dissertation entitled "Educational activities insertion mediated by ICT literacy. This study aimed to implement such activities promoting the integration of ICT as an aid in the literacy process in a primary education school (EF of Santa Maria and had as participants the students of the 3rd year. In this survey we present results of the activities of insertion mediated by E-book technology. Therefore we sought theoretical foundation in authors like Ferreira and Teberoscky (1999, Freire (1989, 1996, Mendonça and Mendonça (2008 and other authors who contribute to the theme. The methodology used was action research that enables the construction of knowledge through practice, reflection-action and intervention in school reality. This study is linked to the line of research "Educational Technologies in Management Network", Federal University of Santa Maria. The results showed that the ICT e-book inserted in literacy contributed significantly to the advancement of learning reading, writing and the development of various skills as well as to build the autonomy of collaboration and cooperation among students considering the teacher as an important articulator and mediator interactions.

  16. Preliminary analysis of insertion site of transgenic wheat exogenous gene and the establishment of detection method%转基因小麦外源基因插入位点初步分析及检测方法的建立

    Institute of Scientific and Technical Information of China (English)

    段晓亮; 许兰杰; 刘志勇; 梁荣奇

    2014-01-01

    利用染色体步移(genome -walking)原理和巢式 PCR 方法,对转基因小麦外源基因 sGNA 插入位点的序列特征进行了分析,并以此建立了 sGNA 基因转化事件特异性检测的方法。根据 sGNA 基因的核苷酸序列设计特异引物,利用 Takara 公司提供的简并随机引物,通过染色体步移法扩增到了转sGNA 基因株系 zy2-18的插入位点的边界序列,分析得到的边界序列可知,外源基因片段是通过部分同源重组的方式与小麦基因组进行整合的,整合位点位于 A 染色体组。检测结果显示携带外源基因 sGNA 的质粒在与小麦基因组整合的过程中发生了剪切,且 Ubi 启动子与 bar 基因被切除,保留了两个串联的 NOS 基因,且在4500~4520 bp 区间发生了重组后的缺失,而在4786~4810 bp 区间有一段碱基序列插入,导致插入区段的小麦基因组序列发生重排,初步分析外源基因是通过同源重组的方式进行整合的。通过验证,证明了插入位点信息的准确性,并初步判断插入位点位于小麦 A 染色体组。因此,随机引物法 genome -walking 可以作为转基因小麦安全检测及身份识别的有效方法。%The sequence character of insertion site of transgenic wheat exogenous gene sGNA was analyzed by genome -walking and the Nested -PCR methods,and the method of detection of sGNA gene trans-form event specificity was established.The random primers were supplied by Takara and the specific primers were designed based on the sGNA sequence.The boundary sequences of sGNA were cloned by genome -walking,and located on genome A by the homologous recombination.The Ubi promoter and bar gene of the plasmid with exogenous gene sGNA were cut off during the integration process,and two series of NOS genes were remained,the deletion was resulted in 4 500 ~4 520 bp,and insertion of a seg-ment of base sequence was discovered between 4 786 bp to 4810 bp

  17. Constructing gene-enriched plant genomic libraries using methylation filtration technology.

    Science.gov (United States)

    Rabinowicz, Pablo D

    2003-01-01

    Full genome sequencing in higher plants is a very difficult task, because their genomes are often very large and repetitive. For this reason, gene targeted partial genomic sequencing becomes a realistic option. The method reported here is a simple approach to generate gene-enriched plant genomic libraries called methylation filtration. This technique takes advantage of the fact that repetitive DNA is heavily methylated and genes are hypomethylated. Then, by simply using an Escherichia coli host strain harboring a wild-type modified cytosine restriction (McrBC) system, which cuts DNA containing methylcytosine, repetitive DNA is eliminated from these genomic libraries, while low copy DNA (i.e., genes) is recovered. To prevent cloning significant proportions of organelle DNA, a crude nuclear preparation must be performed prior to purifying genomic DNA. Adaptor-mediated cloning and DNA size fractionation are necessary for optimal results.

  18. Computer technology of genogeographic analysis of a gene pool: II. Statistical transformation of maps

    Energy Technology Data Exchange (ETDEWEB)

    Balanovskaya, E.V.; Nurbaev, S.D.; Rychkov, Yu.G. [Vavilov Institute of General Genetics, Moscow (Russian Federation)

    1994-11-01

    Transformations of computer maps of geographic distribution of gene frequencies using basic mathematical statistical procedures are considered. These transformations are designated as statistical transformation of maps. Two transformation groups are considered: of one map separately and of a group of maps. Transformations possess a value beyond their use as intermediate stages of more complicated cartographical analysis: the resulting maps carry entirely new information on the geography of genes or a gene pool. This article considers three examples of obtaining new genetic profiles using statistical transformation algorithms. These profiles are of: (1) heterozygosity (of HLA-A, B, C loci in northeastern Eurasia); (2) disease risk (Rh-incompatibility of mother and child with simultaneous registration of Rh and ABO blood groups in Eastern Europe); (3) genetic distances (from own mean ethnic values for Belarus and from mean Russian values for the gene pool of Eastern Europe). 15 refs., 9 figs., 1 tab.

  19. Central Solenoid Insert Technical Specification

    Energy Technology Data Exchange (ETDEWEB)

    Martovetsky, Nicolai N [ORNL; Smirnov, Alexandre [ORNL

    2011-09-01

    The US ITER Project Office (USIPO) is responsible for the ITER central solenoid (CS) contribution to the ITER project. The Central Solenoid Insert (CSI) project will allow ITER validation the appropriate lengths of the conductors to be used in the full-scale CS coils under relevant conditions. The ITER Program plans to build and test a CSI to verify the performance of the CS conductor. The CSI is a one-layer solenoid with an inner diameter of 1.48 m and a height of 4.45 m between electric terminal ends. The coil weight with the terminals is approximately 820 kg without insulation. The major goal of the CSI is to measure the temperature margin of the CS under the ITER direct current (DC) operating conditions, including determining sensitivity to load cycles. Performance of the joints, ramp rate sensitivity, and stability against thermal or electromagnetic disturbances, electrical insulation, losses, and instrumentation are addressed separately and therefore are not major goals in this project. However, losses and joint performance will be tested during the CSI testing campaign. The USIPO will build the CSI that will be tested at the Central Solenoid Model Coil (CSMC) Test Facility at the Japan Atomic Energy Agency (JAEA), Naka, Japan. The industrial vendors (the Suppliers) will report to the USIPO (the Company). All approvals to proceed will be issued by the Company, which in some cases, as specified in this document, will also require the approval of the ITER Organization. Responsibilities and obligations will be covered by respective contracts between the USIPO, called Company interchangeably, and the industrial Prime Contractors, called Suppliers. Different stages of work may be performed by more than one Prime Contractor, as described in this specification. Technical requirements of the contract between the Company and the Prime Contractor will be covered by the Fabrication Specifications developed by the Prime Contractor based on this document and approved by

  20. Technology

    Directory of Open Access Journals (Sweden)

    Xu Jing

    2016-01-01

    Full Text Available The traditional answer card reading method using OMR (Optical Mark Reader, most commonly, OMR special card special use, less versatile, high cost, aiming at the existing problems proposed a method based on pattern recognition of the answer card identification method. Using the method based on Line Segment Detector to detect the tilt of the image, the existence of tilt image rotation correction, and eventually achieve positioning and detection of answers to the answer sheet .Pattern recognition technology for automatic reading, high accuracy, detect faster

  1. Evolutionary study of plastid and mitochondrial DNA insertions into the nucleus of flowering plants

    NARCIS (Netherlands)

    Noutsos, C.

    2007-01-01

    The aim of this study was to characterize the structure of functional and non-functional nuclear inserts of organelle DNA as well the expression of photosynthetic genes which are transferred during endosymbiosis into the nucleus with the final scope to determine the impact of organelle DNA on gene

  2. Evolutionary study of plastid and mitochondrial DNA insertions into the nucleus of flowering plants

    NARCIS (Netherlands)

    Noutsos, C.

    2007-01-01

    The aim of this study was to characterize the structure of functional and non-functional nuclear inserts of organelle DNA as well the expression of photosynthetic genes which are transferred during endosymbiosis into the nucleus with the final scope to determine the impact of organelle DNA on gene a

  3. Key Construction Technology of 60 kg/m No. 42 Single Ballasted Turnout Inserted into Existing Line%60kg/m42号单开有砟道岔既有线插入施工关键技术

    Institute of Scientific and Technical Information of China (English)

    陈仁超

    2015-01-01

    文章以贵广铁路施工Ⅰ标老罗堡线路所2组1/42有砟单开道岔为例,采用侧位拼装整体推移插铺方案技术,研究总结了大号码道岔区间插入施工技术和工艺;插入施工的关键技术主要有:采用侧位拼装整体推移插铺方案;研制道岔钢轨件吊卸组合桁架,实现了道岔长大钢轨件的卸车作业;研制的尖轨区及辙叉心起道用辅助桁架,解决了液压高程起道机无法在1/42道岔长尖轨、长辙叉心直接安设的技术难题;用绝缘轨距拉杆提高道岔整体刚度;分级控制道岔轨排拨接量,保证道岔轨排拨接过程有良好的平顺性和到位精度;测设轨道控制桩网,施工时分段使用,达到控制道岔轨排横移到位精度;为防止道岔横移过程中滑轮倾覆,采用组合滑轮等技术,取得了较好效果。%Taking Laoluobao 1 / 42 ballasted single turnout of construction sectionⅠof Guiyang - Guangzhou railway as an example,by adopting the mature process and technology of lateral assembly integral movement and inserted laying,the construction technologies of large-size turnout inserted into the interval is stduied and concluded,which mainly include:adopting the scheme of lateral assembly integral movement and inserted laying;developing the turnout rail part slinging and unloading composite truss to realize the unloading operation of the long rail part of turnout;developing the auxiliary truss for track lifting of switch rail area and frog center to solve the technical problem of hydraulic elevation track lifting jack unable to be installed directly in long switch rail and long frog center of 1 / 42 turnout;adopting Insulation gauge tie rod to improve the integral rigidity of the turnout;hierarchically controlling the lining and joining quantity of track panel of switch to ensure the good ride and position accuracy in lining and joining process of track panel of switch;setting-out the track control

  4. Case Report: Whole exome sequencing identifies a novel frameshift insertion c.1325dupT (p.F442fsX2 in the tyrosine kinase domain of BTK gene in a young Indian individual with X-linked agammaglobulinemia [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Amit Rawat

    2017-08-01

    Full Text Available X-linked agammaglobulinemia (XLA is an extremely rare inherited primary immunodeficiency characterized by recurrent bacterial infections, decrease in number of mature B cells and low serum immunoglobulins. XLA is caused by mutations in the gene encoding Bruton's tyrosine kinase. We report a case of a young Indian boy suspected to have XLA. Immunophenotyping was performed for the affected child using CD20, CD19 and CD3 antibodies. Whole exome sequencing was performed using trio-based approach. The variants were further analyzed using capillary sequencing in the trio as well as maternal grandmother. Initial immunophenotyping in the affected child showed decreased count of CD19+ B cells. To strengthen the clinical findings and confirm the diagnosis of XLA, we performed whole exome sequencing. Our analysis identified a novel frameshift insertion (c.1325dupT in the BTK gene, which was further validated by Sanger sequencing. Our approach shows the potential in using whole exome sequencing to pinpoint the molecular lesion, enabling timely diagnosis and genetic counseling, and potentially offering prenatal genetic testing for the family.

  5. Study of Uranium Oxide Insertion Compounds

    Science.gov (United States)

    1993-01-01

    05 0-6 0-7 08 0.9 x in LiU03 Figure 1.6 Equilibrium discharge curve for lithium insertion into Y-U0 3 at approximately 25’C in 1 M LiBF4 in propylene...insertion into a-U 30 8 at - 25"C in 1M LiBF4 in propylene carbonate/1,2- dimethoxyethane Lithium insertion into a-U 30 8 causes very little change in

  6. Sequential cooling insert for turbine stator vane

    Science.gov (United States)

    Jones, Russell B; Krueger, Judson J; Plank, William L

    2014-04-01

    A sequential impingement cooling insert for a turbine stator vane that forms a double impingement for the pressure and suction sides of the vane or a triple impingement. The insert is formed from a sheet metal formed in a zigzag shape that forms a series of alternating impingement cooling channels with return air channels, where pressure side and suction side impingement cooling plates are secured over the zigzag shaped main piece. Another embodiment includes the insert formed from one or two blocks of material in which the impingement channels and return air channels are machined into each block.

  7. Insertions and the emergence of novel protein structure: a structure-based phylogenetic study of insertions

    Directory of Open Access Journals (Sweden)

    Blouin Christian

    2007-11-01

    Full Text Available Abstract Background In protein evolution, the mechanism of the emergence of novel protein domain is still an open question. The incremental growth of protein variable regions, which was produced by stochastic insertions, has the potential to generate large and complex sub-structures. In this study, a deterministic methodology is proposed to reconstruct phylogenies from protein structures, and to infer insertion events in protein evolution. The analysis was performed on a broad range of SCOP domain families. Results Phylogenies were reconstructed from protein 3D structural data. The phylogenetic trees were used to infer ancestral structures with a consensus method. From these ancestral reconstructions, 42.7% of the observed insertions are nested insertions, which locate in previous insert regions. The average size of inserts tends to increase with the insert rank or total number of insertions in the variable regions. We found that the structures of some nested inserts show complex or even domain-like fold patterns with helices, strands and loops. Furthermore, a basal level of structural innovation was found in inserts which displayed a significant structural similarity exclusively to themselves. The β-Lactamase/D-ala carboxypeptidase domain family is provided as an example to illustrate the inference of insertion events, and how the incremental growth of a variable region is capable to generate novel structural patterns. Conclusion Using 3D data, we proposed a method to reconstruct phylogenies. We applied the method to reconstruct the sequences of insertion events leading to the emergence of potentially novel structural elements within existing protein domains. The results suggest that structural innovation is possible via the stochastic process of insertions and rapid evolution within variable regions where inserts tend to be nested. We also demonstrate that the structure-based phylogeny enables the study of new questions relating to the

  8. A high-throughput splinkerette-PCR method for the isolation and sequencing of retroviral insertion sites

    DEFF Research Database (Denmark)

    Uren, Anthony G; Mikkers, Harald; Kool, Jaap;

    2009-01-01

    Insertional mutagens such as viruses and transposons are a useful tool for performing forward genetic screens in mice to discover cancer genes. These screens are most effective when performed using hundreds of mice; however, until recently, the cost-effective isolation and sequencing of insertion...

  9. [Study on gene expression of Tamarix under NaHCO3 stress using SSH technology].

    Science.gov (United States)

    Yang, Chuan-Ping; Wang, Yu-Cheng; Liu, Gui-Feng; Jiang, Jing

    2004-09-01

    The gene expression of Tamarix androssowii under NaHCO3 stresses is studied by using SSH technique, in which the cDNA from the materials treated with NaHCO3 solution is as tester and the cDNA from the materials in normal growth is as driver. Total 36 genes related to NaHCO3 stress were obtained through Northern hybridization. Blastx analysis showed that the proteins encoded by these genes were homologous to the following proteins: the antioxidant enzymes catalase and peroxiredoxin; trehalose phosphatase, which was related to trehalose synthesis; a few regulation proteins such as bZIP transcription factor, MADS-box protein, glycine-rich RNA-binding proteins, CCCH-type zinc finger protein and F-box protein etc; early light-induced protein, which could protect and/or repair the photosynthetic apparatus damage induced by stress; cysteine proteinase and vacuolar processing enzyme that can make function in plant cell death, and lipid transfer protein precursor, polyubiquitin, chalcone synthase, NADP-dependent isocitrate dehydrogenase, salt-induced S12 protein, and oxygen-evolving enhancer protein 1 etc. Among 36 genes obtained, the proteins encoded three genes were homologous to 3 putative proteins: HAK2, calcium-binding protein and RNA-binding protein, respectively. In addition, 6 new salt stress response squences were found. The result indicated that the salt-tolerant mechanism of Tamarix androssowii may be a complicated, interactive system involving multiple approaches and multiple genes, but not only a single salt gland-depended approach.

  10. Application of conditionally replicating adenoviruses in tumor early diagnosis technology, gene-radiation therapy and chemotherapy.

    Science.gov (United States)

    Li, Shun; Ou, Mengting; Wang, Guixue; Tang, Liling

    2016-10-01

    Conditionally replicating adenoviruses (CRAds), or known as replication-selective adenoviruses, were discovered as oncolytic gene vectors several years ago. They have a strong ability of scavenging tumor and lesser toxicity to normal tissue. CRAds not only have a tumor-killing ability but also can combine with gene therapy, radiotherapy, and chemotherapy to induce tumor cell apoptosis. In this paper, we review the structure of CRAds and CRAd vectors and summarize the current application of CRAds in tumor detection as well as in radiotherapy and suicide gene-mediating chemotherapy. We also propose further research strategies that can improve the application value of CRAds, including enhancing tumor destruction effect, further reducing toxic effect, reducing immunogenicity, constructing CRAds that can target tumor stem cells, and trying to use mesenchymal stem cells (MSCs) as the carriers for oncolytic adenoviruses. As their importance to cancer diagnosis, gene-radiation, and chemotherapy, CRAds may play a considerable role in clinical diagnosis and various cancer treatments in the future.

  11. Bulkhead insert for an internal combustion engine

    Energy Technology Data Exchange (ETDEWEB)

    Maki, Clifford E.; Chottiner, Jeffrey Eliot; Williams, Rick L.; Thibault, Mark W.; Ervin, James Douglas; Boileau, James Maurice; McKeough, Bryan

    2017-08-01

    An engine includes a cylinder block defining at least one main bearing bulkhead adjacent to a cylinder, and a crankshaft rotatably housed within the block by a main bearing. A bulkhead insert has a cap portion, and an insert portion provided within the bulkhead. The insert portion has having first and second end regions connected by first and second straps. Each strap having a flanged beam cross section. The first and second ends of the insert portion are configured to connect a main bearing cap column to a cylinder head column. Each of the first and second end regions define at least one protrusion having a surface substantially normal to engine combustion and reactive loads. The cap portion is configured to mate with the first end region at the main bearing cap column and support the main bearing.

  12. HB+ inserted into the CMS Solenoid

    CERN Multimedia

    Tejinder S. Virdee, CERN

    2006-01-01

    The first half of the barrel hadron calorimeter (HB+) has been inserted into the superconducting solenoid of CMS, in preparation for the magnet test and cosmic challenge. The operation went smoothly, lasting a couple of days.

  13. Overview of the ATLAS Insertable B-Layer (IBL) Project

    CERN Document Server

    Grinstein, S; The ATLAS collaboration

    2012-01-01

    The upgrades for the ATLAS Pixel Detector will be staged in preparation for high luminosity LHC. The first upgrade will be the construction of a new pixel layer which will be installed during the first shutdown of the LHC machine, foreseen in 2013-14. The new detector, called the Insertable B-layer (IBL), will be installed between the existing Pixel Detector and a new, smaller radius beam-pipe at a radius of 3.3 cm. The IBL will require the development of several new technologies to cope with increased radiation and pixel occupancy and also to improve the physics performance through reduction of the pixel size and a more stringent material budget. Two silicon sensor technologies, planar and 3D, are currently under investigation for the IBL. An overview of the IBL project, of the module design and the qualification for these sensor technologies will be presented.

  14. KASPTM genotyping technology and its use in gene­tic-breeding programs (a study of maize

    Directory of Open Access Journals (Sweden)

    Н. Е. Волкова

    2017-06-01

    Full Text Available Purpose. To review publications relating to the key point of the genotyping technology that is competitive allele-specific polymerase chain reaction (which is called now Kompetitive Allele Specific PCR, KASPTM and its use in various genetic-breeding researching (a study of maize. Results. The essence of KASP-genotyping, its advantages are highlighted. The requirements for matrix DNA are presented, since the success of the KASP-analysis depends on its qua­lity and quantity. Examples of global projects of plant breeding for increasing crop yields using the KASP genoty­ping technology are given. The results of KASP genotyping and their introduction into breeding and seed production, in particular, for determining genetic identity, genetic purity, origin check, marker-assisted selection, etc. are presented using maize as an example. It is demonstrated how geno­mic selection according to KASP genotyping technology can lead to rapid genetic enhancement of drought resistance in maize. Comparison of the effectiveness of creating lines with certain traits (for example, combination of high grain yield and drought resistance using traditional breeding approaches (phenotype selection and molecular genetic methods (selection by markers was proved that it takes four seasons (two years in case of greenhouses in order to unlock the potential of the plant genotype using traditional self-pollination, test-crossing and definitions, while using markers, the population was enriched with target alleles during one season. At the same time, there was no need for a stress factor. Conclusions. KASP genotyping technology is a high-precision and effective tool for modern genetics and breeding, which is successfully used to study genetic diversity, genetic relationship, population structure, gene­tic identity, genetic purity, origin check, quantitative locus mapping, allele mapping, marker-assisted selection, marker-assisted breeding. It is expedient and timely to

  15. Large-scale Gene Ontology analysis of plant transcriptome-derived sequences retrieved by AFLP technology

    NARCIS (Netherlands)

    Botton, A.; Galla, G.; Conesa, A.; Bachem, C.W.B.; Ramina, A.; Barcaccia, G.

    2008-01-01

    Background: After 10-year-use of AFLP (Amplified Fragment Length Polymorphism) technology for DNA fingerprinting and mRNA profiling, large repertories of genome- and transcriptome-derived sequences are available in public databases for model, crop and tree species. AFLP marker systems have been and

  16. Large-scale Gene Ontology analysis of plant transcriptome-derived sequences retrieved by AFLP technology

    NARCIS (Netherlands)

    Botton, A.; Galla, G.; Conesa, A.; Bachem, C.W.B.; Ramina, A.; Barcaccia, G.

    2008-01-01

    Background: After 10-year-use of AFLP (Amplified Fragment Length Polymorphism) technology for DNA fingerprinting and mRNA profiling, large repertories of genome- and transcriptome-derived sequences are available in public databases for model, crop and tree species. AFLP marker systems have been and

  17. ACE基因插入/缺失多态与国人肺血栓栓塞症的关联研究%Insertion/deletion polymorphsim of the angiotensin I converting enzyme gene and pulmonary thromboembolism in Chinese population

    Institute of Scientific and Technical Information of China (English)

    陆艳辉; 惠汝太; 赵彦芬; 刘国仗; 柳志红; 陈白屏; 叶珏; 张春玲

    2001-01-01

    Objective To investigate whether there is an association between the insertiondeletion polymorphsim of human angiotensin I converting enzyme gene(ACE) and pulmonary thromboembolism and whether D allele incrases the risk of pulmonary thromboembolism in Chinese population.Methods Seventy-two Patients with pulmonary thromboembolism and 72 sex and age matched healthy controls were recruited in this study, all patients were diagnosed by lung ventilation/perfusion scan and/or ultrafast CT as well as medical bistory. Risk factor of venous thrombosis and pulmonary thromboembolism were inquired. Genome DNA was extracted from whole blood using phenol-chloroform. Subjects were genotyped for the I/D polymorphism of ACE gene using polymerase chain reaction based restriction fragment length polymorphism analysis.Results (1)The incidences of trauma, operation, phlebitis and varicose were significant higher in the patient than in controls. No significant difference were found in the family history of pulmonary thromboembolism and cardiovascular diseases,personal history of oral contraceptive, cigarette smoking and alcohol drinking between the patient and controls. (2) Frequencies of allele I and D in the controls were 0.66 and 0.34 respectively, the distribution of genotypes met the in Hardy-Weinberg equilibrium. No significant differences were found in the frequencies of genotypeⅡ, ID and DD between patients and controls. (3)The recessive allele model was informative and the odds ratio of DD genotype was 2.51(P <0.05) compared with the othe two genotypes. (4) After further stratification , we found DD genotype was bound to be associated with an 2.64-fold risk of pulmonary thromboembolism for those individuals without existing traditional environmental risk factors and 3.36-fold risk for individuals with medical history of venous thrombosis(P<0.05).Conclusion This study shows that I/D polymorphism of ACE gene is associated with pulmonary thromboembolism in Chinese population

  18. A study of insertion/delation polymorphism of the angiotensin-converting enzyme gene and serum ACE concentration in pilots%飞行员血管紧张素转换酶基因插入/缺失 多态性及其血清水平的研究

    Institute of Scientific and Technical Information of China (English)

    刘红巾; 蔡庆; 纪桂英; 朱美财; 占志; 王荫静

    2001-01-01

    Objective To understand insertion/delation (I/D ) polymorphism of the angiotensin-converting enzyme (ACE) gene and serum ACE co ncentration in pilots, and to explore the relationship between ACE gene I/D poly morphism and the perfomance of the pilots. Methods The study p opulation consisted of 118 pilots and 96 healthy subjects as controls. The genot ypes for an I/D polymorphism in intron 16 of the ACE gene were determined by the polymerase chain reaction (PCR). The serum ACE concentration was measured by hi gh-performance liquid chromatography with the use of an artificial substrate.[ WTHZ  Results The I/D polymorphism in intron 16 of the ACE gene was c ategorized into three genotypes: two deletion alleles (genotype DD), heterozygou s alleles (genotype ID), and two insertion alleles (genotype II). The genotype I I and I allele frequency were significantly higher in pilots (44.07% and 0.65) than that in healthy subjects (31.25% and 0.52). The ACE gene I/D polymorphis m is strongly associated with serum ACE levels(DD>ID, DD>II). Conclusio n It is suggested that I gene of ACE may play a role in perfomance of t he pilots.%目的了解飞行员血管紧张素转换酶(ACE)基因插入/缺失( I/D)多态性及其血清水平,探讨ACE基因多态性与飞行员耐力可能的关系。方法飞行员118例,健康对照者96例,用聚合酶链反应(PCR)扩增技术检测ACE基因I /D多态性,用比色法测定血清ACE水平。结果位于ACE基因第16内含子的I/D多态性经PCR扩增后呈三种基因型:纯合子插入型(II)、纯合子缺失型(DD)和杂合子插入/缺失型(I/D)。飞行员组II基因型(44.07%)和Ⅰ等位基因频率(0.65)显著高于健康对照组(分别为31.25%和0.52)。 ACE基因多态性与血清ACE水平明显相关(DD>ID, D D>II)。结论 ACE Ⅰ基因有可能在飞行员的飞行耐力中起重要作用。

  19. Shrink-Fit Solderable Inserts Seal Hermetically

    Science.gov (United States)

    Croucher, William C.

    1992-01-01

    Shrink-fit stainless-steel insert in aluminum equipment housing allows electrical connectors to be replaced by soldering, without degrading hermeticity of housing or connector. Welding could destroy electrostatic-sensitive components and harm housing and internal cables. Steel insert avoids problems because connector soldered directly to it rather than welded to housing. Seals between flange and housing, and between connector and flange resistant to leaks, even after mechanical overloading and thermal shocking.

  20. Rescuing Alu: recovery of new inserts shows LINE-1 preserves Alu activity through A-tail expansion.

    Directory of Open Access Journals (Sweden)

    Bradley J Wagstaff

    Full Text Available Alu elements are trans-mobilized by the autonomous non-LTR retroelement, LINE-1 (L1. Alu-induced insertion mutagenesis contributes to about 0.1% human genetic disease and is responsible for the majority of the documented instances of human retroelement insertion-induced disease. Here we introduce a SINE recovery method that provides a complementary approach for comprehensive analysis of the impact and biological mechanisms of Alu retrotransposition. Using this approach, we recovered 226 de novo tagged Alu inserts in HeLa cells. Our analysis reveals that in human cells marked Alu inserts driven by either exogenously supplied full length L1 or ORF2 protein are indistinguishable. Four percent of de novo Alu inserts were associated with genomic deletions and rearrangements and lacked the hallmarks of retrotransposition. In contrast to L1 inserts, 5' truncations of Alu inserts are rare, as most of the recovered inserts (96.5% are full length. De novo Alus show a random pattern of insertion across chromosomes, but further characterization revealed an Alu insertion bias exists favoring insertion near other SINEs, highly conserved elements, with almost 60% landing within genes. De novo Alu inserts show no evidence of RNA editing. Priming for reverse transcription rarely occurred within the first 20 bp (most 5' of the A-tail. The A-tails of recovered inserts show significant expansion, with many at least doubling in length. Sequence manipulation of the construct led to the demonstration that the A-tail expansion likely occurs during insertion due to slippage by the L1 ORF2 protein. We postulate that the A-tail expansion directly impacts Alu evolution by reintroducing new active source elements to counteract the natural loss of active Alus and minimizing Alu extinction.

  1. Students' Ontological Security and Agency in Science Education—An Example from Reasoning about the Use of Gene Technology

    Science.gov (United States)

    Lindahl, Mats Gunnar; Linder, Cedric

    2013-09-01

    This paper reports on a study of how students' reasoning about socioscientific issues is framed by three dynamics: societal structures, agency and how trust and security issues are handled. Examples from gene technology were used as the forum for interviews with 13 Swedish high-school students (year 11, age 17-18). A grid based on modalities from the societal structures described by Giddens was used to structure the analysis. The results illustrate how the participating students used both modalities for 'Legitimation' and 'Domination' to justify positions that accept or reject new technology. The analysis also showed how norms and knowledge can be used to justify opposing positions in relation to building trust in science and technology, or in democratic decisions expected to favour personal norms. Here, students accepted or rejected the authority of experts based on perceptions of the knowledge base that the authority was seen to be anchored in. Difficulty in discerning between material risks (reduced safety) and immaterial risks (loss of norms) was also found. These outcomes are used to draw attention to the educational challenges associated with students' using knowledge claims (Domination) to support norms (Legitimation) and how this is related to the development of a sense of agency in terms of sharing norms with experts or with laymen.

  2. Epigenetic Consequences of Artificial Reproductive Technologies to the Bovine Imprinted Genes SNRPN, H19/IGF2 and IGF2R

    Directory of Open Access Journals (Sweden)

    Lawrence C. Smith

    2015-02-01

    Full Text Available Animal breeders have made widespread use of assisted reproductive technologies to accelerate genetic improvement programs aimed at obtaining more, better and cheaper food products. Selection approaches have traditionally focused on Mendel’s laws of inheritance using parental phenotypic characteristics and quantitative genetics approaches to choose the best parents for the next generation, regardless of their gender. However, apart from contributing DNA sequence variants, male and female gametes carry parental-specific epigenetic marks that play key roles during pre- and post-natal development and growth of the offspring. We herein review the epigenetic anomalies that are associated with artificial reproductive technologies in current use in animal breeding programs. For instance, we demonstrate that bovine embryos and foetuses derived by in vitro culture and somatic cell nuclear transfer show epigenetic anomalies in the differentially methylated regions controlling the expression of some imprinted genes. Although these genomic imprinting errors are undetected in the somatic tissues after birth, further research is warranted to examine potential germ cell transmission of epimutations and the potential risks of reproducing cattle using artificial reproductive technologies.

  3. The ATLAS Insertable B-Layer: from construction to operation

    Science.gov (United States)

    La Rosa, A.

    2016-12-01

    The ATLAS Insertable B-Layer (IBL) is the innermost layer of pixel detectors, and was installed in May 2014 at a radius of 3.3 cm from the beam axis, between the existing Pixel detector and a new smaller radius beam-pipe. The new detector, built to cope with high radiation and occupancy, is the first large scale application of 3D sensors and CMOS 130 nm technology. The IBL detector construction was completed within about two years (2012 – 2014), and the key features and challenges met during the IBL project are presented, as well as its commissioning and operational experience at the LHC.

  4. The ATLAS Insertable B-Layer: from construction to operation

    CERN Document Server

    La Rosa, Alessandro; The ATLAS collaboration

    2016-01-01

    The ATLAS Insertable B-Layer (IBL) is the innermost layer of pixel detectors, and was installed in May 2014 at a radius of 3.3 cm from the beam axis, between the existing Pixel detector and a new smaller radius beam-pipe. The new detector, built to cope with high radiation and occupancy, is the first large scale application of 3D sensors and CMOS 130 nm technology. The IBL detector construction was completed within about two years (2012-2014), and the key features and challenges met during the IBL project are presented, as well as its commissioning and operational experience at the LHC

  5. A novel intergenic ETnII-β insertion mutation causes multiple malformations in polypodia mice.

    Directory of Open Access Journals (Sweden)

    Jessica A Lehoczky

    Full Text Available Mouse early transposon insertions are responsible for ~10% of spontaneous mutant phenotypes. We previously reported the phenotypes and genetic mapping of Polypodia, (Ppd, a spontaneous, X-linked dominant mutation with profound effects on body plan morphogenesis. Our new data shows that mutant mice are not born in expected Mendelian ratios secondary to loss after E9.5. In addition, we refined the Ppd genetic interval and discovered a novel ETnII-β early transposon insertion between the genes for Dusp9 and Pnck. The ETn inserted 1.6 kb downstream and antisense to Dusp9 and does not disrupt polyadenylation or splicing of either gene. Knock-in mice engineered to carry the ETn display Ppd characteristic ectopic caudal limb phenotypes, showing that the ETn insertion is the Ppd molecular lesion. Early transposons are actively expressed in the early blastocyst. To explore the consequences of the ETn on the genomic landscape at an early stage of development, we compared interval gene expression between wild-type and mutant ES cells. Mutant ES cell expression analysis revealed marked upregulation of Dusp9 mRNA and protein expression. Evaluation of the 5' LTR CpG methylation state in adult mice revealed no correlation with the occurrence or severity of Ppd phenotypes at birth. Thus, the broad range of phenotypes observed in this mutant is secondary to a novel intergenic ETn insertion whose effects include dysregulation of nearby interval gene expression at early stages of development.

  6. Insertional transformation of hematopoietic cells by self-inactivating lentiviral and gammaretroviral vectors.

    Science.gov (United States)

    Modlich, Ute; Navarro, Susana; Zychlinski, Daniela; Maetzig, Tobias; Knoess, Sabine; Brugman, Martijn H; Schambach, Axel; Charrier, Sabine; Galy, Anne; Thrasher, Adrian J; Bueren, Juan; Baum, Christopher

    2009-11-01

    Gene transfer vectors may cause clonal imbalance and even malignant cell transformation by insertional upregulation of proto-oncogenes. Lentiviral vectors (LV) with their preferred integration in transcribed genes are considered less genotoxic than gammaretroviral vectors (GV) with their preference for integration next to transcriptional start sites and regulatory gene regions. Using a sensitive cell culture assay and a series of self-inactivating (SIN) vectors, we found that the lentiviral insertion pattern was approximately threefold less likely than the gammaretroviral to trigger transformation of primary hematopoietic cells. However, lentivirally induced mutants also showed robust replating, in line with the selection for common insertion sites (CIS) in the first intron of the Evi1 proto-oncogene. This potent proto-oncogene thus represents a CIS for both GV and LV, despite major differences in their integration mechanisms. Altering the vectors' enhancer-promoter elements had a greater effect on safety than the retroviral insertion pattern. Clinical grade LV expressing the Wiskott-Aldrich syndrome (WAS) protein under control of its own promoter had no transforming potential. Mechanistic studies support the conclusion that enhancer-mediated gene activation is the major cause for insertional transformation of hematopoietic cells, opening rational strategies for risk prevention.

  7. Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish

    OpenAIRE

    Atsuo Kawahara; Yu Hisano; Satoshi Ota; Kiyohito Taimatsu

    2016-01-01

    The zebrafish (Danio rerio) is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9) system, have allowed researchers to generate diverse genomic modifications in whole animals and i...

  8. Effective Technology Insertion: The Key to Evolutionary Acquisition Program

    Science.gov (United States)

    2004-05-03

    Additionally, there is concern about ambiguous initial program descriptions, the lack of well- defined benchmarks, and the more volatile funding projections...consider this option for a well- defined research program with known milestones or a contract for lab or testing services. Grants and cooperative agreements...Army War College, 7 April 2003. 47Orazia A. Di Marca ; Rejto, Stephen B. Rejto and Thomas Gomez, “ Open System Design and Evolutionary Acquisition

  9. Magnetic targeting strategies in gene delivery.

    Science.gov (United States)

    Delyagina, Evgenya; Li, Wenzhong; Ma, Nan; Steinhoff, Gustav

    2011-11-01

    Gene delivery is a process of the insertion of transgenes into cells with the purpose to obtain the expression of encoded protein. The therapeutic application of this process is termed gene therapy, which is becoming a promising instrument to treat genetic and acquired diseases. Although numerous methods of gene transfer have already been developed, including biological, physical and chemical approaches, the optimal strategy has to be discovered. Importantly, it should be effective, selective and safe to be translated to the clinic. Magnetic targeting has been demonstrated as an effective strategy to decrease side effects of gene transfer, while increasing the selectivity and efficiency of the applied vector. This article will focus on the latest progress in the development of different magnetic vectors, based on both viral and nonviral gene delivery agents. It will also include a description of magnetic targeting applications in stem cells and in vivo, which has gained interest in recent years due to the rapid development of technology.

  10. Gene therapy for primary immunodeficiencies: Part 1.

    Science.gov (United States)

    Cavazzana-Calvo, Marina; Fischer, Alain; Hacein-Bey-Abina, Salima; Aiuti, Alessandro

    2012-10-01

    Over 60 patients affected by SCID due to IL2RG deficiency (SCID-X1) or adenosine deaminase (ADA)-SCID have received hematopoietic stem cell gene therapy in the past 15 years using gammaretroviral vectors, resulting in immune reconstitution and clinical benefit in the majority of them. However, the occurrence of insertional oncogenesis in the SCID-X1 trials has led to the development of new clinical trials based on integrating vectors with improved safety design as well as investigation on new technologies for highly efficient gene targeting and site-specific gene editing. Here we will present the experience and perspectives of gene therapy for SCID-X1 and ADA-SCID and discuss the pros and cons of gene therapy in comparison to allogeneic transplantation.

  11. Epigenetic Suppression of T-DNA Insertion Mutants in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Yangbin Gao; Yunde Zhao

    2013-01-01

    T-DNA insertion mutants have been widely used to define gene functions in Arabidopsis and in other plants.Here,we report an unexpected phenomenon of epigenetic suppression of T-DNA insertion mutants in Arabidopsis.When the two T-DNA insertion mutants,yucl-1 and ag-TD,were crossed together,the defects in all of the ag-TD plants in the F2 population were partially suppressed regardless of the presence of yucl-1.Conversion of ag-TD to the suppressed ag-TD (named as ag-TD*) did not follow the laws of Mendelian genetics.The ag-TD* could be stably transmitted for many generations without reverting to ag-TD,and ag-TD* had the capacity to convert ag-TD to ag-TD*.We show that epigenetic suppression of T-DNA mutants is not a rare event,but certain structural features in the T-DNA mutants are needed in order for the suppression to take place.The suppressed T-DNA mutants we observed were all intronic T-DNA mutants and the T-DNA fragments in both the trigger T-DNA as well as in the suppressed T-DNA shared stretches of identical sequences.We demonstrate that the suppression of intronic T-DNA mutants is mediated by trans-interactions between two ToDNA insertions.This work shows that caution is needed when intronic T-DNA mutants are used.

  12. Retroviral vector insertion sites associated with dominant hematopoietic clones mark "stemness" pathways.

    Science.gov (United States)

    Kustikova, Olga S; Geiger, Hartmut; Li, Zhixiong; Brugman, Martijn H; Chambers, Stuart M; Shaw, Chad A; Pike-Overzet, Karin; de Ridder, Dick; Staal, Frank J T; von Keudell, Gottfried; Cornils, Kerstin; Nattamai, Kalpana Jekumar; Modlich, Ute; Wagemaker, Gerard; Goodell, Margaret A; Fehse, Boris; Baum, Christopher

    2007-03-01

    Evidence from model organisms and clinical trials reveals that the random insertion of retrovirus-based vectors in the genome of long-term repopulating hematopoietic cells may increase self-renewal or initiate malignant transformation. Clonal dominance of nonmalignant cells is a particularly interesting phenotype as it may be caused by the dysregulation of genes that affect self-renewal and competitive fitness. We have accumulated 280 retrovirus vector insertion sites (RVISs) from murine long-term studies resulting in benign or malignant clonal dominance. RVISs (22.5%) are located in or near (up to 100 kb [kilobase]) to known proto-oncogenes, 49.6% in signaling genes, and 27.9% in other or unknown genes. The resulting insertional dominance database (IDDb) shows substantial overlaps with the transcriptome of hematopoietic stem/progenitor cells and the retrovirus-tagged cancer gene database (RTCGD). RVISs preferentially marked genes with high expression in hematopoietic stem/progenitor cells, and Gene Ontology revealed an overrepresentation of genes associated with cell-cycle control, apoptosis signaling, and transcriptional regulation, including major "stemness" pathways. The IDDb forms a powerful resource for the identification of genes that stimulate or transform hematopoietic stem/progenitor cells and is an important reference for vector biosafety studies in human gene therapy.

  13. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  14. Global hepatic gene expression in rainbow trout exposed to sewage effluents: A comparison of different sewage treatment technologies

    Energy Technology Data Exchange (ETDEWEB)

    Cuklev, Filip, E-mail: filip.cuklev@neuro.gu.se [Institute of Neuroscience and Physiology, Department of Physiology, The Sahlgrenska Academy at the University of Gothenburg, Box 434, SE-405 30 Goeteborg (Sweden); Gunnarsson, Lina, E-mail: lina.gunnarsson@fysiologi.gu.se [Institute of Neuroscience and Physiology, Department of Physiology, The Sahlgrenska Academy at the University of Gothenburg, Box 434, SE-405 30 Goeteborg (Sweden); Cvijovic, Marija, E-mail: marija.cvijovic@chalmers.se [Institute of Neuroscience and Physiology, Department of Physiology, The Sahlgrenska Academy at the University of Gothenburg, Box 434, SE-405 30 Goeteborg (Sweden); Department of Mathematical Sciences, Chalmers University of Technology and University of Gothenburg, SE-412 96 Goeteborg (Sweden); Kristiansson, Erik, E-mail: erik.kristiansson@chalmers.se [Department of Mathematical Sciences, Chalmers University of Technology and University of Gothenburg, SE-412 96 Goeteborg (Sweden); Rutgersson, Carolin [Institute of Neuroscience and Physiology, Department of Physiology, The Sahlgrenska Academy at the University of Gothenburg, Box 434, SE-405 30 Goeteborg (Sweden); Bjoerlenius, Berndt, E-mail: berndtb@kth.se [Stockholm Water Company, Vaermdoevaegen 23, SE-131 55 Stockholm (Sweden); Larsson, D.G. Joakim, E-mail: joakim.larsson@fysiologi.gu.se [Institute of Neuroscience and Physiology, Department of Physiology, The Sahlgrenska Academy at the University of Gothenburg, Box 434, SE-405 30 Goeteborg (Sweden)

    2012-06-15

    Effluents from sewage treatment plants contain a mixture of micropollutants with the potential of harming aquatic organisms. Thus, addition of advanced treatment techniques to complement existing conventional methods has been proposed. Some of the advanced techniques could, however, potentially produce additional compounds affecting exposed organisms by unknown modes of action. In the present study the aim was to improve our understanding of how exposure to different sewage effluents affects fish. This was achieved by explorative microarray and quantitative PCR analyses of hepatic gene expression, as well as relative organ sizes of rainbow trout exposed to different sewage effluents (conventionally treated, granular activated carbon, ozonation (5 or 15 mg/L), 5 mg/L ozone plus a moving bed biofilm reactor, or UV-light treatment in combination with hydrogen peroxide). Exposure to the conventionally treated effluent caused a significant increase in liver and heart somatic indexes, an effect removed by all other treatments. Genes connected to xenobiotic metabolism, including cytochrome p450 1A, were differentially expressed in the fish exposed to the conventionally treated effluents, though only effluent treatment with granular activated carbon or ozone at 15 mg/L completely removed this response. The mRNA expression of heat shock protein 70 kDa was induced in all three groups exposed to ozone-treated effluents, suggesting some form of added stress in these fish. The induction of estrogen-responsive genes in the fish exposed to the conventionally treated effluent was effectively reduced by all investigated advanced treatment technologies, although the moving bed biofilm reactor was least efficient. Taken together, granular activated carbon showed the highest potential of reducing responses in fish induced by exposure to sewage effluents. - Highlights: Black-Right-Pointing-Pointer Livers of trout exposed to different sewage effluents were analysed by microarray. Black

  15. TOGA: An automated parsing technology for analyzing expression of nearly all genes

    OpenAIRE

    Sutcliffe, J. Gregor; Foye, Pamela E.; Erlander, Mark G.; HIlbush, Brian S.; Bodzin, Leon J.; Durham, Jayson T.; Hasel, Karl W.

    2000-01-01

    We have developed an automated, high-throughput, systematic cDNA display method called TOGA, an acronym for total gene expression analysis. TOGA utilizes 8-nt sequences, comprised of a 4-nt restriction endonuclease cleavage site and adjacent 4-nt parsing sequences, and their distances from the 3′ ends of mRNA molecules to give each mRNA species in an organism a single identity. The parsing sequences are used as parts of primer-binding sites in 256 PCR-based assays performed robotically on tis...

  16. Utilization of TALEN and CRISPR/Cas9 technologies for gene targeting and modification.

    Science.gov (United States)

    Pu, Jiali; Frescas, David; Zhang, Baorong; Feng, Jian

    2015-08-01

    The capability to modify the genome precisely and efficiently offers an extremely useful tool for biomedical research. Recent developments in genome editing technologies such as transcription activator-like effector nuclease and the clustered regularly interspaced short palindromic repeats system have made genome modification available for a number of organisms with relative ease. Here, we introduce these genome editing techniques, compare and contrast each technical approach and discuss their potential to study the underlying mechanisms of human disease using patient-derived induced pluripotent stem cells.

  17. Bioethical conflicts of gene therapy: a brief critical review

    Directory of Open Access Journals (Sweden)

    José Ednésio da Cruz Freire

    2014-12-01

    Full Text Available Methods and techniques employed in gene therapy are reviewed in parallel with pertinent ethical conflicts. Clinical interventions based on gene therapy techniques preferentially use vectors for the transportation of therapeutic genes, however little is known about the potential risks and damages to the patient. Thus, attending carefully to the clinical complications arising as well as to security is essential. Despite the scientific and technological advances, there are still many uncertainties about the side effects of gene therapy. Moreover, there is a need, above all, to understand the principles of bioethics as both science and ethics, in accordance with its socioecological responsibility, in order to prioritize the health and welfare of man and nature, using properly natural resources and technology. Therefore, it is hard to determine objective results and to which extent the insertion of genes can affect the organism, as well as the ethical implication

  18. “O brave new world” CRISPR Mediated Gene Editing in Somatic and Germ Line Contexts for Therapeutics and Enhancement of the Human Species – an Ethical and Legal Discussion.

    OpenAIRE

    Farrell, Cathal B

    2016-01-01

    Gene editing has been a topic of controversy since the late 1970’s, however as of 2015 the topic of gene editing and its potential applications has shot to the forefront of biomedical, ethical and legal debate. CRISPR is a new molecular technology, which is essentially a molecular scissors capable of cutting a single gene, or multiple genes out of the genome of any species. Scientists have further manipulated CRISPR so that after it has excised a gene, or genes, it can then insert a gene of c...

  19. Hamstring tendons insertion - an anatomical study

    Directory of Open Access Journals (Sweden)

    Cristiano Antonio Grassi

    2013-09-01

    Full Text Available OBJECTIVE: To study the anatomy of the hamstring tendons insertion and anatomical rela-tionships. METHODS: Ten cadaver knees with medial and anterior intact structures were selected. The dissection was performed from anteromedial access to exposure of the insertion of the flexor tendons (FT, tibial plateau (TP and tibial tuberosity (TT. A needle of 40 × 12 and a caliper were used to measure the distance of the tibial plateau of the knee flexor tendons insertion at 15 mm from the medial border of the patellar tendon and tibial tuberosity to the insertion of the flexor tendons of the knee. The angle between tibial plateau and the insertion of the flexor tendons of the knee (A-TP-FT was calculated using Image Pro Plus software. RESULTS: The mean distance TP-FT was 41 ± 4.6 mm. The distance between the TT-FT was 6.88 ± 1 mm. The (A-TP-FT was 20.3 ± 4.9°. CONCLUSION: In the anterior tibial flexor tendons are about 40 mm from the plateau with an average of 20°.

  20. [The application of CRISPR-Cas9 gene editing technology in viral infection diseases].

    Science.gov (United States)

    Lijuan, Yin; Siqi, Hu; Fei, Guo

    2015-05-01

    The RNA-guided Cas9 nuclease from microbial clustered regularly interspaced short palindromic repeats (CRISPR) adaptive immune system has been used to facilitate efficient genome engineering in eukaryotic cells. The specific targeted genome is recognized and cut by gRNA-directed CRISPR/Cas9 complex, specifically by the endonuclease Cas9. The targeted gene locus could be repaired either by homology-directed repair or nonhomologous end joining, thus achieving a desired editing outcome. Viruses infect cells through specific receptors, and then the viral genome is transcribed, replicated and translated to complete its life cycle. As a result, some DNA virus and retrovirus genomes are integrated into the cellular genome. Gene therapy is a new trend to treat viral infected diseases. Given its designable sequence-specific editing of the targeted genome, CRISPR/Cas9 has tremendous potential in treating persistent and latent viral infections. In this review, we summarize the mechanism and progresses of CRISPR/Cas9, and also highlight its therapeutic application in infectious diseases.

  1. Genome-wide LORE1 retrotransposon mutagenesis and high-throughput insertion detection in Lotus japonicus

    DEFF Research Database (Denmark)

    Urbanski, Dorian Fabian; Malolepszy, Anna; Stougaard, Jens

    2012-01-01

    including software for automated data analysis, which take full advantage of high next-generation sequencing throughput. Here we address these challenges by developing the FSTpoolit protocol and software package and we demonstrate its efficacy by detecting 8,935 LORE1 insertions in 3,744 Lotus japonicus...... plants. The identified insertions showed that the endogenous LORE1 retrotransposon is well suited for insertion mutagenesis due to its homogenous gene targeting and exonic insertion preference. Since LORE1 transposition occurs in the germline, harvesting seeds from a single founder line and cultivating...... progeny generates a complete mutant population. This ease of LORE1 mutagenesis combined with the efficient FSTpoolit protocol, which exploits 2D pooling, Illumina sequencing, and automated data analysis, allows highly cost-efficient development of a comprehensive reverse genetic resource....

  2. 血管紧张素转换酶基因插入或缺失多态性与飞行员原发性高血压的相关性%Relationship between insertion/deletion polymorphism of the angiotensin-convetting enzyme gene and essential hypertension in pilots

    Institute of Scientific and Technical Information of China (English)

    蔡庆; 刘红巾; 陈涛; 朱美财

    2011-01-01

    目的 探讨血管紧张素转换酶(ACE)基因插入或缺失(L/D)多态性和飞行员原发性高血压的相关性,为飞行员原发性高血压的预防提供依据.方法 用聚合酶链反应(PCR)扩增检测48例飞行员原发性高血压患者和50例飞行员健康对照者的ACE基因I/D多态性.结果 飞行员高血压组ACE DD基因型(25%)和D等位基因频率(0.47)显著高于健康对照组(分别为8%和0.30).结论 ACE DD基因型和D等位基因与飞行员原发性高血压病相关.%Objective To investigate the relationship between insertion/delation (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene and essential hypertension of pilots and provide an important reference for essential hypertension of pilots. Methods 48 pilots with essential hypertension and SO healthy control pilots were genotyped for the I/D polymorphism of the ACE gene by the polymerase chain reaction (PCR). Results It was showed that the genotype DD and D allele frequency of ACE were significantly higher in pilots with essential hypertension (25% and 0.47) than that in healthy control subjects (8% and 0.30). Conclusion The genotype DD and D allele of ACE were correlated with essential hypertension in pilots.

  3. Future cereal starch bioengineering: Cereal ancestors encounter gene technology and designer enzymes

    DEFF Research Database (Denmark)

    Blennow, Andreas; Jensen, Susanne Langgård; Shaik, Shahnoor Sultana

    2013-01-01

    The importance of cereal starch production worldwide cannot be overrated. However, the qualities and resulting values of existing raw and processed starch do not fully meet future demands for environmentally friendly production of renewable, advanced biomaterials, functional foods and biomedical...... additives. New approaches for starch bioengineering are needed. In this review we discuss cereal starch from a combined universal bioresource point of view. The combination of new biotechniques and clean tech methods can be implemented to replace e.g. chemical modification. The recently released cereal...... genomes and the exploding advancement in whole genome sequencing now paves the road for identifying new genes to be exploited to generate a multitude of completely new starch functionalities directly in the cereal grain converting cereal crops to production plants. Newly released genome data from cereal...

  4. The ATLAS Insertable B-Layer Detector (IBL)

    CERN Document Server

    Huegging, F; The ATLAS collaboration

    2010-01-01

    The upgrade for the ATLAS detector will undergo different phases towards SLHC. The first upgrade for the Pixel Detector will consist in the construction of a new pixel layer which will be installed during a longer shutdown of the LHC machine, the so-called Phase I Upgrade. The new detector, called Insertable B-Layer (IBL), will be inserted between the existing pixel detector and a new (smaller radius) beam-pipe at a radius of about 3.2 cm. The IBL requires the development of several new technologies to cope with the increase of radiation and pixel occupancy as well as to improve the physics performance of the existing pixel detector. In order to achieve these goals the pixel size is reduced and the material budget is minimized by using new lightweight mechanical support materials and a CO2 based cooling system. Main component of the module development for the IBL is the new ATLAS pixel readout chip, FE-I4, designed in 130 nm technology which features an array of 80 by 336 pixels with a pixel size of 50x250 µ...

  5. Overview of the ATLAS Insertable B-Layer (IBL) Project

    CERN Document Server

    Djama, F; The ATLAS collaboration

    2012-01-01

    The upgrades for the ATLAS Pixel Detector will be staged in preparation for high luminosity LHC. The first upgrade for the Pixel Detector will be the construction of a new pixel layer which will be installed during the first shutdown of the LHC machine, foreseen in 2013-14. The new detector, called the Insertable B-layer (IBL), will be installed between the existing Pixel Detector and a new, smaller radius beampipe at a radius of 3.3 cm. The IBL will require the development of several new technologies to cope with increased radiation and pixel occupancy and also to improve the physics performance through reduction of the pixel size and a more stringent material budget. Two different and promising silicon sensor technologies, planar n-in-n and 3D, are currently under investigation for the IBL. An overview of the IBL project, of the module design and qualification with particular emphasis on irradiation tests will be presented.

  6. Overview of the ATLAS Insertable B-Layer (IBL) Project

    CERN Document Server

    Djama, F; The ATLAS collaboration

    2012-01-01

    The upgrades for the ATLAS Pixel Detector will be staged in preparation for high luminosity LHC. The first upgrade for the Pixel Detector will be the construction of a new pixel layer which will be installed during the first shutdown of the LHC machine, foreseen in 2013-14. The new detector, called the Insertable B-layer (IBL), will be installed between the existing Pixel Detector and a new, smaller radius beam-pipe at a radius of 3.3 cm. The IBL will require the development of several new technologies to cope with increased radiation and pixel occupancy and also to improve the physics performance through reduction of the pixel size and a more stringent material budget. Two different and promising silicon sensor technologies, planar n-in-n and 3D, are currently under investigation for the IBL. An overview of the IBL project, of the module design and qualification with particular emphasis on irradiation tests will be presented.

  7. Overview of the ATLAS Insertable B-Layer (IBL) Project

    CERN Document Server

    Kagan, M; The ATLAS collaboration

    2013-01-01

    The upgrades for the ATLAS Pixel Detector will be staged in preparation for high luminosity LHC. The first upgrade for the Pixel Detector will be the construction of a new pixel layer which is currently under construction and will be installed during the first shutdown of the LHC machine, in 2013-14. The new detector, called the Insertable B-layer (IBL), will be installed between the existing Pixel Detector and a new, smaller radius beam-pipe at a radius of 3.3 cm. The IBL required the development of several new technologies to cope with increased radiation and pixel occupancy and also to improve the physics performance through reduction of the pixel size and a more stringent material budget. Two different silicon sensor technologies, planar n-in-n and 3D, will be used, connected with the new generation 130nm IBM CMOS FE-I4 readout chip via solder bump-bonds. 32 \

  8. Insertional mutagenesis by a hybrid piggyBac and sleeping beauty transposon in the rat.

    Science.gov (United States)

    Furushima, Kenryo; Jang, Chuan-Wei; Chen, Diane W; Xiao, Ningna; Overbeek, Paul A; Behringer, Richard R

    2012-12-01

    A hybrid piggyBac/Sleeping Beauty transposon-based insertional mutagenesis system that can be mobilized by simple breeding was established in the rat. These transposons were engineered to include gene trap sequences and a tyrosinase (Tyr) pigmentation reporter to rescue the albinism of the genetic background used in the mutagenesis strategy. Single-copy transposon insertions were transposed into the rat genome by co-injection of plasmids carrying the transposon and RNA encoding piggyBac transposase into zygotes. The levels of transgenic Tyr expression were influenced by chromosomal context, leading to transgenic rats with different pigmentation that enabled visual genotyping. Transgenic rats designed to ubiquitously express either piggyBac or Sleeping Beauty transposase were generated by standard zygote injection also on an albino background. Bigenic rats carrying single-copy transposons at known loci and transposase transgenes exhibited coat color mosaicism, indicating somatic transposition. PiggyBac or Sleeping Beauty transposase bigenic rats bred with wild-type albino rats yielded offspring with pigmentation distinct from the initial transposon insertions as a consequence of germline transposition to new loci. The germline transposition frequency for Sleeping Beauty and piggyBac was ∼10% or about one new insertion per litter. Approximately 50% of the insertions occurred in introns. Chimeric transcripts containing endogenous and gene trap sequences were identified in Gabrb1 mutant rats. This mutagenesis system based on simple crosses and visual genotyping can be used to generate a collection of single-gene mutations in the rat.

  9. Transposon insertions of magellan-4 that impair social gliding motility in Myxococcus xanthus.

    Science.gov (United States)

    Youderian, Philip; Hartzell, Patricia L

    2006-03-01

    Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a delta aglU (A-) strain with the defective transposon, magellan-4, and screened for S- mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism.

  10. RERTR-12 Insertion 2 Irradiation Summary Report

    Energy Technology Data Exchange (ETDEWEB)

    D. M. Perez; G. S. Chang; D. M. Wachs; G. A. Roth; N. E. Woolstenhulme

    2012-09-01

    The Reduced Enrichment for Research and Test Reactor (RERTR) experiment RERTR-12 was designed to provide comprehensive information on the performance of uranium-molybdenum (U-Mo) based monolithic fuels for research reactor applications.1 RERTR-12 insertion 2 includes the capsules irradiated during the last three irradiation cycles. These capsules include Z, Y1, Y2 and Y3 type capsules. The following report summarizes the life of the RERTR-12 insertion 2 experiment through end of irradiation, including as-run neutronic analysis results, thermal analysis results and hydraulic testing results.

  11. Compact insert design for cryogenic pressure vessels

    Science.gov (United States)

    Aceves, Salvador M.; Ledesma-Orozco, Elias Rigoberto; Espinosa-Loza, Francisco; Petitpas, Guillaume; Switzer, Vernon A.

    2017-06-14

    A pressure vessel apparatus for cryogenic capable storage of hydrogen or other cryogenic gases at high pressure includes an insert with a parallel inlet duct, a perpendicular inlet duct connected to the parallel inlet. The perpendicular inlet duct and the parallel inlet duct connect the interior cavity with the external components. The insert also includes a parallel outlet duct and a perpendicular outlet duct connected to the parallel outlet duct. The perpendicular outlet duct and the parallel outlet duct connect the interior cavity with the external components.

  12. On the Insertion Time of Cuckoo Hashing

    CERN Document Server

    Fountoulakis, Nikolaos; Steger, Angelika

    2010-01-01

    Cuckoo hashing is an efficient technique for creating large hash tables with high space utilization and guaranteed constant access times. There, each item can be placed in a location given by any one out of k different hash functions. In this paper we investigate further the random walk heuristic for inserting in an online fashion new items into the hash table. Provided that k > 2 and that the number of items in the table is below (but arbitrarily close) to the theoretically achievable load threshold, we show a polylogarithmic bound for the maximum insertion time that holds with high probability.

  13. Harnessing microbial gene pools to remediate persistent organic pollutants using genetically modified plants--a viable technology?

    Science.gov (United States)

    Rylott, Elizabeth L; Johnston, Emily J; Bruce, Neil C

    2015-11-01

    It has been 14 years since the international community came together to legislate the Stockholm Convention on Persistent Organic Pollutants (POPs), restricting the production and use of specific chemicals that were found to be environmentally stable, often bioaccumulating, with long-term toxic effects. Efforts are continuing to remove these pollutants from the environment. While incineration and chemical treatment can be successful, these methods require the removal of tonnes of soil, at high cost, and are damaging to soil structure and microbial communities. The engineering of plants for in situ POP remediation has had highly promising results, and could be a more environmentally-friendly alternative. This review discusses the characterization of POP-degrading bacterial pathways, and how the genes responsible have been harnessed using genetic modification (GM) to introduce these same abilities into plants. Recent advances in multi-gene cloning, genome editing technologies and expression in monocot species are accelerating progress with remediation-applicable species. Examples include plants developed to degrade 2,4,6-trinitrotoluene (TNT), hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), trichloroethylene (TCE), and polychlorinated biphenyls (PCBs). However, the costs and timescales needed to gain regulatory approval, along with continued public opposition, are considerable. The benefits and challenges in this rapidly developing and promising field are discussed. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  14. Specific Destruction of HIV Proviral p17 Gene in T Lymphoid Cells Achieved by the Genome Editing Technology.

    Science.gov (United States)

    Kishida, Tsunao; Ejima, Akika; Mazda, Osam

    2016-01-01

    Recent development in genome editing technologies has enabled site-directed deprivation of a nucleotide sequence in the chromosome in mammalian cells. Human immunodeficiency (HIV) infection causes integration of proviral DNA into the chromosome, which potentially leads to re-emergence of the virus, but conventional treatment cannot delete the proviral DNA sequence from the cells infected with HIV. In the present study, the transcription activator-like effector nucleases (TALENs) specific for the HIV p17 gene were constructed, and their activities to destroy the target sequence were evaluated. SSA assay showed a high activity of a pair of p17-specific TALENs. A human T lymphoid cell line, Jurkat, was infected with a lentivirus vector followed by transfection with the TALEN-HIV by electroporation. The target sequence was destructed in approximately 10-95% of the p17 polymerase chain reaction clones, and the efficiencies depended on the Jurkat-HIV clones. Because p17 plays essential roles for assembly and budding of HIV, and this gene has relatively low nucleotide sequence diversity, genome editing procedures targeting p17 may provide a therapeutic benefit for HIV infection.

  15. Insertional Achilles tendinitis and Haglund's deformity.

    Science.gov (United States)

    Kang, Steve; Thordarson, David B; Charlton, Timothy P

    2012-06-01

    Haglund's deformity is an enlargement of the posterosuperior prominence of the calcaneus, which is frequently associated with insertional Achilles tendinitis. To our knowledge, no study has been done successfully correlating the characteristics of a Haglund's deformity with insertional Achilles tendinitis. The purpose of our study was to analyze the characteristics of a Haglund's deformity in patients with and without insertional Achilles tendinitis to see if there was a correlation. The study was a retrospective radiographic review of a single surgeon's patients with insertional Achilles tendinitis from 2005 to 2008. Our study population consisted of 44 patients, 48 heels (22 male, 22 female) with insertional Achilles tendinitis, with a mean age of 52 (range, 23 to 79) years. Our control population consisted of 50 patients (25 males, 25 females) and 50 heels without insertional Achilles tendinitis with a mean age of 55.6 (range, 18 to 89) years. We introduced two new measurements of the Haglund's deformity in this study: the Haglund's deformity height and peak angle. A standing lateral foot or ankle radiograph was analyzed for each patient and the following measurements were made: Haglund deformity height and peak angle; Bohler's angle; Fowler-Philip angle; and parallel pitch sign. We also looked for the presence of calcification in the study group and the length and width of the calcification. Unpaired t-test was used to analyze the measurements between the groups. Ten patients' radiographs were re-measured and correlation coefficients were obtained to assess the reliability of the measuring techniques. For the insertional Achilles tendinitis group, the mean Haglund's deformity height was 9.6 (range, 5.3 to 15.3) mm and the mean Haglund's deformity peak angle was 105 (range, 87 to 123) degrees. Calcification was present in 35 of 48 or (73%) of patients with a mean length of 13.3 (range, 3.2 to 41.9) mm and mean width of 4.5 (range, 1.0 to 10.4) mm. In the control

  16. TOGA: an automated parsing technology for analyzing expression of nearly all genes.

    Science.gov (United States)

    Sutcliffe, J G; Foye, P E; Erlander, M G; Hilbush, B S; Bodzin, L J; Durham, J T; Hasel, K W

    2000-02-29

    We have developed an automated, high-throughput, systematic cDNA display method called TOGA, an acronym for total gene expression analysis. TOGA utilizes 8-nt sequences, comprised of a 4-nt restriction endonuclease cleavage site and adjacent 4-nt parsing sequences, and their distances from the 3' ends of mRNA molecules to give each mRNA species in an organism a single identity. The parsing sequences are used as parts of primer-binding sites in 256 PCR-based assays performed robotically on tissue extracts to determine simultaneously the presence and relative concentration of nearly every mRNA in the extracts, regardless of whether the mRNA has been discovered previously. Visualization of the electrophoretically separated fluorescent assay products from different extracts displayed via a Netscape browser-based graphical user interface allows the status of each mRNA to be compared among samples and its identity to be matched with sequences of known mRNAs compiled in databases.

  17. Thermal Performance of the XRS Helium Insert

    Science.gov (United States)

    Breon, Susan R.; DiPirro, Michael J.; Tuttle, James G.; Shirron, Peter J.; Warner, Brent A.; Boyle, Robert F.; Canavan, Edgar R.

    1999-01-01

    The X-Ray Spectrometer (XRS) is an instrument on the Japanese Astro-E satellite, scheduled for launch early in the year 2000. The XRS Helium Insert comprises a superfluid helium cryostat, an Adiabatic Demagnetization Refrigerator (ADR), and the XRS calorimeters with their cold electronics. The calorimeters are capable of detecting X-rays over the energy range 0.1 to 10 keV with a resolution of 12 eV. The Helium Insert completed its performance and verification testing at Goddard in January 1999. It was shipped to Japan, where it has been integrated with the neon dewar built by Sumitomo Heavy Industries. The Helium Insert was given a challenging lifetime requirement of 2.0 years with a goal of 2.5 years. Based on the results of the thermal performance tests, the predicted on-orbit lifetime is 2.6 years with a margin of 30%. This is the result of both higher efficiency in the ADR cycle and the low temperature top-off, more than compensating for an increase in the parasitic heat load. This paper presents a summary of the key design features and the results of the thermal testing of the XRS Helium Insert.

  18. Methidium intercalator inserted into synthetic oligonucleotides.

    Energy Technology Data Exchange (ETDEWEB)

    Timofeev, E. N.; Smirnov, I. P.; Haff, L. A.; Tishchenko, E. I.; Mirzabekov, A. D.; Florentiev, V. L.; Center for Mechanistic Biology and Biotechnology; Engelhardt Inst. of Molecular Biology; PerSeptive BioSystems Inc.

    1996-01-01

    A new methidium intercalator phosphoramidite has been synthesized. Methidium incorporation into an oligonucleotide during the synthesis was confirmed by UV and MALDI TOF MS data. UV melting experiments showed enhanced stability of a duplex, containing internal methidium. Methidium phosphoramidite has been synthesized and used for insertion of intercalator into the deoxyoligonucleotides.

  19. Aspects of insertion in random trees

    NARCIS (Netherlands)

    Bagchi, Arunabha; Reingold, E.M.

    1982-01-01

    A method formulated by Yao and used by Brown has yielded bounds on the fraction of nodes with specified properties in trees bult by a sequence of random internal nodes in a random tree built by binary search and insertion, and show that in such a tree about bounds better than those now known. We the

  20. Aspects of insertion in random trees

    NARCIS (Netherlands)

    Bagchi, Arunabha; Reingold, E.M.

    1982-01-01

    A method formulated by Yao and used by Brown has yielded bounds on the fraction of nodes with specified properties in trees bult by a sequence of random internal nodes in a random tree built by binary search and insertion, and show that in such a tree about bounds better than those now known. We

  1. Construction of a lentivector containing over-expressing β-catenin gene by multisite Gateway technology%应用Gateway技术构建过表达β-catenin基因的慢病毒载体

    Institute of Scientific and Technical Information of China (English)

    吴倩; 魏亚明; 李瑜元; 曹燕雯; 陈其慧

    2013-01-01

    Objective To construct a lentiviral vector over-expressing β-catenin gene by multisite Gateway technology and confirm its effect.Methods By using multisite Gateway clone technique,the entry clone of pDown-Ctnnb1 was constructed using BP recombination reaction.Then,LR recombination reaction was performed among pUp-EF1A,pDown-Ctnnb1,pTail-IRES/DsRed-Express2 and pLV.Des3d.P/puro to generate an expression clone of pLV.EX3d.P/puro-EF1A>Ctnnb1 >IRES/DsRed-Express2.In each step,PCR and sequencing analysis were used to verify the constructions.When it was verified that plasmids were transfected into 293T cells,PT-PCR was performed to determine the mRNA level of β-catenin gene.Results Both PCR and sequencing analysis revealed that β-catenin over-expression gene was inserted into the target site and the insertion sequence was perfectly corrected.The RT-PCR results showed that the expression of β-catenin gene was significantly upregulated.Conclusion The lenvivirus-mediate β-catenin over-expression gene was successfully constructed..%目的 应用Gateway技术构建靶向过表达β-catenin基因的慢病毒载体,验证该载体的功能.方法 利用多位点Gateway克隆技术,通过BP重组反应,构建穿梭载体pDown-Ctnnb1;再通过LR重组反应,将pUp-EF1A、pDown-Ctnnb1、pTail-IRES/DsRed-Express2和母载体pLV.Des3d.P/puro 4个质粒构建成表达载体pLV.EX3d.P/puro-EF1A>Ctnnb1 >IRES/DsRed-Express2;再转化到感受态细胞stbl3,经PCR筛选菌落阳性克隆测序鉴定.将成功构建的慢病毒表达载体转染293T细胞,用实时荧光定量PCR法验证重组载体对β-catenin基因mRNA水平的影响.结果 菌落PCR筛选和DNA测序鉴定显示入门克隆和表达载体插入片段序列正确,实时荧光定量PCR证实β-catenin基因mRNA水平显著上调(P<0.01).结论 成功构建能显著上调β-catenin基因mRNA表达的慢病毒载体.

  2. Insertion loads and forearm muscle activity during flexible hose insertion tasks.

    Science.gov (United States)

    Grieshaber, D Christian; Armstrong, Thomas J

    2007-10-01

    To quantify the physical demands of hose insertion tasks in automotive assembly operations and how they are affected by method and the mechanical interference between the hose and the flange. Insertion tasks were identified by workers as physically demanding and can often lead to fatigue or losses in production attributable to pain or injury. Six male and 6 female participants pushed a 25.4-mm flexible rubber hose onto a stationary flange during simulated insertions. Three insertion methods -- rock, straight, and twist -- were examined in the study. Muscle activity of the finger flexors was recorded to estimate grip effort during the simulated insertions. The twist method (114.8 N) resulted in a 26% reduction in axial force compared with the straight method (155.7 N). Average muscle activity ranged from a low of 14% maximum voluntary contraction (MVC; men, straight method) to a high of 67% MVC (women, twist method). Hose resultant forces ranged from a low of 52.2 N to a high of 461.1 N for all participants. Men exerted 6% higher resultant forces with 37% less muscle activity than women. There are situations when the 26% reduction in the axial force attributable to twisting may be helpful during an insertion, despite the fact that forearm muscle activity was highest for both male and female participants during twisting insertions. The results of this study can be applied to the future design of tasks that involve the joining of two parts such as a hose and flange.

  3. Prenatal diagnosis of abnormal umbilical cord insertion: a rare case of furcate insertion.

    Science.gov (United States)

    Fujita, Yasuyuki; Yumoto, Yasuo; Kato, Kiyoko

    2017-04-01

    Furcate insertion (FI) is an extremely rare abnormality of umbilical cord insertion. One of the complications associated with FI is hemorrhage from the umbilical vein at the site of FI of the umbilical cord, which can cause sudden intrauterine fetal death. Because of its rarity, no prenatal diagnosis of FI has been reported. A 31-year-old woman at 34 weeks' gestation was referred to us for suspected abnormal cord insertion. Ultrasonography showed normal fetal growth and amniotic fluid volume, with no fetal anomalies. Although the umbilical cord contained three vessels inserted at the center of the placenta, the umbilical vessels separated from the cord substance before their insertion to the placenta. Based on these findings, the patient was diagnosed with FI. During labor at 37 weeks' gestation, fetal heart rate was normal and a healthy neonate was delivered. At macroscopic examination, the umbilical cord was inserted in the middle of the placenta, and the placental parenchymal tissue just under the cord insertion was deficient and had been changed to white, elastic hard tissue. Pathological examination of the white tissue revealed fibrin deposition and focal infarction. Although FI is a very rare condition, prenatal diagnosis can be achieved through detailed color Doppler ultrasound studies. Therefore, taking precautions and keeping in mind the poor fetal outcome associated with FI are preferred.

  4. Insertion mutagenesis of the yeast Candida famata (Debaryomyces hansenii) by random integration of linear DNA fragments.

    Science.gov (United States)

    Dmytruk, Kostyantyn V; Voronovsky, Andriy Y; Sibirny, Andriy A

    2006-09-01

    The feasibility of using random insertional mutagenesis to isolate mutants of the flavinogenic yeast Candida famata was explored. Mutagenesis was performed by transformation of the yeast with an integrative plasmid containing the Saccharomyces cerevisiae LEU2 gene as a selective marker. The addition of restriction enzyme together with the plasmid (restriction enzyme-mediated integration, REMI) increased the transformation frequency only slightly. Integration of the linearized plasmid occurred randomly in the C. famata genome. To investigate the potential of insertional mutagenesis, it was used for tagging genes involved in positive regulation of riboflavin synthesis in C. famata. Partial DNA sequencing of tagged genes showed that they were homologous to the S. cerevisiae genes RIB1, MET2, and SEF1. Intact orthologs of these genes isolated from Debaryomyces hansenii restored the wild phenotype of the corresponding mutants, i.e., the ability to overproduce riboflavin under iron limitation. The Staphylococcus aureus ble gene conferring resistance to phleomycin was used successfully in the study as a dominant selection marker for C. famata. The results obtained indicate that insertional mutagenesis is a powerful tool for tagging genes in C. famata.

  5. A critical appraisal of medication package inserts

    Directory of Open Access Journals (Sweden)

    Pranjit Narzaree

    2015-10-01

    Full Text Available Introduction: Package Inserts (PIs refers to officially specified document that accompanies a drug for relevant, updated and unbiased information for rational drug use based on regulatory guidelines as per section 6.2 and 6.3 of schedule D of Indian Drug and cosmetic Act 1945. But some studies had shown non-uniformity with suboptimal level of informations which frequently can lead to medication errors. Hence this study was conducted to evaluate the completeness of PIs.Aim: To critically evaluate package inserts of allopathic medicines.Material and Methods: 100 allopathic drug PIs were collected from pharmacies in Rohtak and were checked for the presence of each heading as per schedule D criteria, followed by scrutiny of the information included under the heading. Indian guidelines were also compared with US FDA guidelines for PIs.Scoring of package inserts: The informations were evaluated for completeness and scored as 1 if present otherwise scored as zero for no information or partial information. Scores for each heading were calculated by totaling the scores of all the package inserts. The total scores were expressed as absolute numbers and percentages.Results:  On an average PIs analyzed for the completeness of the criteria scored 10 (Mean± SD = 9.73±2.48 out of 16. Absence of common layout and headings caused inconvenience. In comparison to US FDA guidelines it lacked, disclaimer statement, boxed warning, revision date, approval date, toll-free number etc.Conclusion: PIs don’t seem to be serving effectively because of multiple deficiencies like completeness, uniformity, absence of headings.Keywords: Critical appraisal, package inserts.

  6. COMPARATIVE STUDY OF EARLY POSTPARTUM IUCD INSERTION TO INTERVAL IUCD INSERTION

    Directory of Open Access Journals (Sweden)

    Shibani Devi

    2016-07-01

    Full Text Available INTRODUCTION According to National Family Health Survey-3, Indian women have 13% unmet need for contraception and according to District Level Household & Facility Survey-3, it is 21.3% in the postpartum period. Postpartum intrauterine contraceptive device insertion - both immediately post-placental delivery and somewhat later, but within 48 hours after delivery are options which merit consideration as the woman is likely to have a high motivation for accepting contraception and the healthcare centre provides a convenient setting for insertion of IUCD. AIM Comparison of efficacy and complications of IUCD insertions in post-placental with interval period: 6-month followup. METHOD This perspective study was conducted among 100 women: - 50 women had IUCD inserted within 10 minutes of placental delivery and 50 had insertion more than 6 weeks after delivery. They were followed till 6 months post insertion and were compared regarding early and late complications, continuation rates and expulsion rates. RESULT At the end of six months, we found higher occurrence of lower abdominal pain, heavy menstrual bleeding in case of interval insertion as compared to post-placental insertion which was statistically significant (p value-0.04 & 0.007 respectively. However, the expulsion rates of post-placental IUCD were somewhat elevated (14% compared to interval insertions (2%. Continuation rates at the end of 6 months in both the groups were 82% and 86% respectively which is comparable. CONCLUSION Post-placental IUCD is thus found to be an ideal method to meet the unmet need of postpartum women as it is easily accessible and convenient for both women and their health care providers, is associated with less discomfort and fewer side effects and allow women to obtain safe, long acting, highly effective contraception while still in the health care system.

  7. Comparative analysis of methods for gene transcription profiling data derived from different microarray technologies in rat and mouse models of diabetes

    Directory of Open Access Journals (Sweden)

    Bihoreau Marie-Thérèse

    2009-02-01

    Full Text Available Abstract Background Microarray technologies are widely used to quantify the abundance of transcripts corresponding to thousands of genes. To maximise the robustness of transcriptome results, we have tested the performance and reproducibility of rat and mouse gene expression data obtained with Affymetrix, Illumina and Operon platforms. Results We present a thorough analysis of the degree of reproducibility provided by analysing the transcriptomic profile of the same animals of several experimental groups under different popular microarray technologies in different tissues. Concordant results from inter- and intra-platform comparisons were maximised by testing many popular computational methods for generating fold changes and significances and by only considering oligonucleotides giving high expression levels. The choice of Affymetrix signal extraction technique was shown to have the greatest effect on the concordance across platforms. In both species, when choosing optimal methods, the agreement between data generated on the Affymetrix and Illumina was excellent; this was verified using qRT-PCR on a selection of genes present on all platforms. Conclusion This study provides an extensive assessment of analytical methods best suited for processing data from different microarray technologies and can assist integration of technologically different gene expression datasets in biological systems.

  8. Constructive Technology Assessment (CTA) as a tool in coverage with evidence development: the case of the 70-gene prognosis signature for breast cancer diagnostics

    NARCIS (Netherlands)

    Retèl, Valesca P.; Bueno-de-Mesquita, Jolien M.; Hummel, Marjan J.M.; Vijver, van de Marc J.; Douma, Kirsten F.L.; Karsenberg, Kim; Dam, van Frits S.A.M.; Krimpen, van Cees; Bellot, Frank E.; Roumen, Rudi M.H.; Linn, Sabine C.; Harten, van Wim H.

    2009-01-01

    Objectives: Constructive Technology Assessment (CTA) is a means to guide early implementation of new developments in society, and can be used as an evaluation tool for Coverage with Evidence Development (CED). We used CTA for the introduction of a new diagnostic test in the Netherlands, the 70-gene

  9. Quasispecies Sequence Analyses of Envelope Protein E1/E2 Coding Genes from four Chinese HCV Patients and Identification of a Novel Insertion Mutation of HCV%四份中国HCV阳性血清中包膜蛋白E1/E2准种基因的序列分析及新型插入突变的发现

    Institute of Scientific and Technical Information of China (English)

    李从力; 张玲; 鲁健; 刘晓明; 邓瑶; 王岳; 沈晓玲; 谭文杰

    2012-01-01

    为分析四份中国丙型肝炎病毒(HCV)阳性血清中包膜蛋白E1/E2基因的准种特征.本研究对从4份中国HCV阳性血清(1b亚型:274、366和383;2a亚型:283)中提取的HCV核酸,采用逆转录-聚合酶反应扩增编码全长E1/E2蛋白(191~764aa)的基因片段,随机挑取多个克隆测序.根据E1/E2基因核苷酸的序列与其他相关序列(来自于GenBank)构建亲缘性关系进化树,进行核苷酸与氨基酸同源性分析并对重要的基因位点进行分析.共获得阳性克隆序列43个(274株10个,283株12个,366株13个,383株8个),发现高变区HVR1、HVR2的基因异质性高,而其他抗体中和表位及跨膜区I、Ⅱ及N末端糖基化位点相对保守.并首次发现在HCV 2a亚型(283血清)中多个准种序列存在1 279nt(E1区,313aa)处单碱基插入优势基因突变,导致HCV包膜蛋白编码突变与中断(E2区,398aa).本研究对中国HCV代表株包膜蛋白E1/E2编码基因的准种多样性及一种新型插入突变进行了描述,可为进一步研究HCV免疫逃避与慢性化机制提供重要信息.%This paper investigated the envelope protein E1/E2 quasispecies genetic characterization of 4 HCV positive sera (Genotype 1b:274,366,383; Genotype 2a;283) in China. Nucleotide acid was extracted and glycoprotein E1/E2 (191~764aa) coding genes were obtained by RT-PCR, positive clones were randomly selected for sequencing. The phylogenetic relationships and the homology of nucleotide and amino acid were analyzed based on E1/E2 coding genes, and some vital functional regions of E1/E2 were characterized. A total of 43 sequences (274 : 10;283 : 12;366 : 13; 383 : 8) were obtained showing high genetic heterogeneity in HVR1 and HVR2 regions, while sequences of the neutralizing epitopes, transmembrane domain I,II and N-terminal ectodomain were comparatively conservative. Single base(C)insertion mutation at ntl279 ( El region, aa313),resulting in a mutated El coding protein (beginning at aa 313) and

  10. Effect of electro-acupuncture on gene expression in heart of rats with stress-induced pre-hypertension based on gene chip technology

    National Research Council Canada - National Science Library

    Guo Yan Xie Xiaojia Guo Changqing Wang Zhaoyang Liu Qingguo

    2015-01-01

    OBJECTIVE:To explore electro-acupuncture's(EA's)effect on gene expression in heart of rats with stress-induced pre-hypertension and try to reveal its biological mechanism based on gene chip...

  11. Association of Lactobacillus crispatus with fructo-oligosaccharides and ascorbic acid in hydroxypropyl methylcellulose vaginal insert.

    Science.gov (United States)

    Vitali, Beatrice; Abruzzo, Angela; Parolin, Carola; Palomino, Rogers Alberto Ñahui; Dalena, Francesco; Bigucci, Federica; Cerchiara, Teresa; Luppi, Barbara

    2016-01-20

    The aim of this work was to develop a synbiotic vaginal insert containing the probiotic strain Lactobacillus crispatus BC5, the prebiotic substrate fructo-oligosaccharide and the antioxidant agent ascorbic acid, for the prophylaxis and therapy of vaginal infections. Mucoadhesive in situ gelling vaginal inserts based on hydroxypropyl methylcellulose were prepared by freeze-drying, stored at +2-8 °C for 90 days and characterized in terms of technological and functional properties. Complete survival of L. crispatus BC5 was found immediately after insert preparation (96.08%) as well as after 90 days of storage (95.82%) in the vaginal inserts containing fructo-oligosaccharide, ascorbic acid and skimmed milk. Synbiotic inserts showed improved mucoadhesion ability (from three- to five-fold) with respect to a standard formulation based on hydroxypropyl methylcellulose alone. Moreover, inserts allowed to modulate lactobacilli release in virtue of the different amounts of fructo-oligosaccharide. Finally, antimicrobial activity was exerted by L. crispatus BC5 released from the vaginal formulation.

  12. Comparison of conventional Injection Mould Inserts to Additively Manufactured Inserts using Life Cycle Assessment

    DEFF Research Database (Denmark)

    Hofstätter, Thomas; Bey, Niki; Mischkot, Michael

    2016-01-01

    Polymer Additive Manufacturing can be used to produce soft tooling inserts for injection moulding. Compared to conventional tooling, the energy and time consumption during production are significantly lower. As the life time of such inserts is significantly shorter than the life time of traditional...... of their potential environmental impact and yield throughout the development and pilot phase. Insert geometry is particularly advantageous for pilot production and small production sizes. In this research, Life Cycle Assessment is used to compare the environmental impact of soft tooling by Additive Manufacturing...... (using Digital Light Processing) and three traditional methods for the manufacture of inserts (milling of brass, steel, and aluminium) for injection moulds during the pre-production phase....

  13. Comparison of conventional Injection Mould Inserts to Additively Manufactured Inserts using Life Cycle Assessment

    DEFF Research Database (Denmark)

    Hofstätter, Thomas; Bey, Niki; Mischkot, Michael

    2016-01-01

    Polymer Additive Manufacturing can be used to produce soft tooling inserts for injection moulding. Compared to conventional tooling, the energy and time consumption during production are significantly lower. As the life time of such inserts is significantly shorter than the life time of traditional...... of their potential environmental impact and yield throughout the development and pilot phase. Insert geometry is particularly advantageous for pilot production and small production sizes. In this research, Life Cycle Assessment is used to compare the environmental impact of soft tooling by Additive Manufacturing...... (using Digital Light Processing) and three traditional methods for the manufacture of inserts (milling of brass, steel, and aluminium) for injection moulds during the pre-production phase....

  14. Assessment of Insertion Sequence Mobilization as an Adaptive Response to Oxidative Stress in Acinetobacter baumannii Using IS-seq.

    Science.gov (United States)

    Wright, Meredith S; Mountain, Stephanie; Beeri, Karen; Adams, Mark D

    2017-05-01

    Insertion sequence (IS) elements are found throughout bacterial genomes and contribute to genome variation by interrupting genes or altering gene expression. Few of the more than 30 IS elements described in Acinetobacter baumannii have been characterized for transposition activity or expression effects. A targeted sequencing method, IS-seq, was developed to efficiently map the locations of new insertion events in A. baumannii genomes and was used to identify novel IS sites following growth in the presence of hydrogen peroxide, which causes oxidative stress. Serial subculture in the presence of subinhibitory concentrations of hydrogen peroxide led to rapid selection of cells carrying an ISAba1 element upstream of the catalase-peroxidase gene katG Several additional sites for the elements ISAba1, ISAba13, ISAba25, ISAba26, and ISAba125 were found at low abundance after serial subculture, indicating that each element is active and contributes to genetic variation that may be subject to selection. Following hydrogen peroxide exposure, rapid changes in gene expression were observed in genes related to iron homeostasis. The IS insertions adjacent to katG resulted in more than 20-fold overexpression of the gene and increased hydrogen peroxide tolerance.IMPORTANCE Insertion sequences (IS) contribute to genomic and phenotypic variation in many bacterial species, but little is known about how transposition rates vary among elements or how selective pressure influences this process. A new method for identifying new insertion locations that arise under experimental growth conditions in the genome, termed IS-seq, was developed and tested with cells grown in the presence of hydrogen peroxide, which causes oxidative stress. Gene expression changes in response to hydrogen peroxide exposure are similar to those observed in other species and include genes that control free iron concentrations. New IS insertions adjacent to a gene encoding a catalase enzyme confirm that IS elements

  15. Development of ocular inserts for cattle.

    Science.gov (United States)

    Greer, R T; Ryoo, J P

    1987-06-01

    Ring shaped ocular inserts have been developed to administer a therapeutic level of tylosin tartrate throughout a five day period to treat pinkeye in cattle. The inserts are based on polyvinyl chloride rings which are dip coated with a copolymer containing the antibiotic (tylosin tartrate). Scanning electron microscope (SEM) characterization of surfaces has been of value to evaluate the presence and extent of surface flaws in the hydrogel coating, and to contribute to improvement in fabrication of the rings to insure the establishment of satisfactory seals at joints, uniformity of microporosity and cross sections, and the absence of significant cracking or flaking. In vitro release rates were determined using thin layer chromatography techniques, and rates were seen to be above a few micrograms of antibiotic per hour for experiments as long as nine days at simulated tear rates as high as 2 milliliters per hour.

  16. Perception and Action in Teleoperated Needle Insertion.

    Science.gov (United States)

    Nisky, I; Pressman, A; Pugh, C M; Mussa-Ivaldi, F A; Karniel, A

    2011-01-01

    We studied the effect of delay on perception and action in contact with a force field that emulates elastic soft tissue with a rigid nonlinear boundary. Such a field is similar to forces exerted on a needle during teleoperated needle insertion. We found that delay causes motor underestimation of the stiffness of this nonlinear soft tissue, without perceptual change. These experimental results are supported by simulation of a simplified mechanical model of the arm and neural controller, and a model for perception of stiffness, which is based on regression in the force-position space. In addition, we show that changing the gain of the teleoperation channel cancels the motor effect of delay without adding perceptual distortion. We conclude that it is possible to achieve perceptual and motor transparency in virtual one-dimensional remote needle insertion task.

  17. Complex central venous catheter insertion for hemodialysis.

    Science.gov (United States)

    Powell, Steven; Belfield, Jane

    2014-01-01

    Despite the introduction of payment by results in the UK, there has been no decrease in central venous catheter (CVC) use. In part, this may relate to a requirement to dialyse through a CVC while autogenous access matures. Mortality data have improved in parallel and patients on hemodialysis live longer, which may lead to an increased exposure to CVCs.Exposure to CVCs carries a significant risk of infection and occlusion requiring their repositioning or exchange. The mid to long-term sequelae of CVC use is central venous occlusion leaving clinical teams with an ever increasing challenge to find adequate venous access.In this article, we will discuss the challenges faced by operators inserting CVCs into the hemodialysis-dependent patient who has exhausted more tradition insertion sites. These include translumbar caval catheters, transocclusion and transcollateral catheters, transjugular Inferior Vena Cava catheter positioning, and transhepatic catheters. We will demonstrate the techniques employed, complications, and anticipated longevity of function.

  18. Guided pedicle screw insertion: techniques and training.

    Science.gov (United States)

    Manbachi, Amir; Cobbold, Richard S C; Ginsberg, Howard J

    2014-01-01

    In spinal fusion surgery, the accuracy with which screws are inserted in the pedicle has a direct effect on the surgical outcome. Accurate placement generally involves considerable judgmental skills that have been developed through a lengthy training process. Because the impact of misaligning one or more pedicle screws can directly affect patient safety, a number of navigational and trajectory verification approaches have been described and evaluated in the literature to provide some degree of guidance to the surgeon. To provide a concise review to justify the need and explore the current state of developing navigational or trajectory verification techniques for ensuring proper pedicle screw insertion along with simulation methods for better educating the surgical trainees. Recent literature review. To justify the need to develop new methods for optimizing pedicle screw paths, we first reviewed some of the recent publications relating to the statistical outcomes for different types of navigation along with the conventional freehand (unassisted) screw insertion. Second, because of the importance of providing improved training in the skill of accurate screw insertion, the training aspects of relevant techniques are considered. The third part is devoted to the description of specific navigational assist methods or trajectory verification techniques and these include computer-assisted navigation, three-dimensional simulations, and also electric impedance and optical and ultrasonic image-guided methods. This article presents an overview of the need and the current status of the guidance methods available for improving the surgical outcomes in spinal fusion procedures. It also describes educational aids that have the potential for reducing the training process. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Anionic phospholipids modulate peptide insertion into membranes.

    Science.gov (United States)

    Liu, L P; Deber, C M

    1997-05-06

    While the insertion of a hydrophobic peptide or membrane protein segment into the bilayer can be spontaneous and driven mainly by the hydrophobic effect, anionic lipids, which comprise ca. 20% of biological membranes, provide a source of electrostatic attractions for binding of proteins/peptides into membranes. To unravel the interplay of hydrophobicity and electrostatics in the binding of peptides into membranes, we designed peptides de novo which possess the typical sequence Lys-Lys-Ala-Ala-Ala-X-Ala-Ala-Ala-Ala-Ala-X-Ala-Ala-Trp-Ala-Ala-X-Ala-Al a-Ala-Lys-Lys-Lys-Lys-amide, where X residues correspond to "guest" residues which encompass a range of hydrophobicity (Leu, Ile, Gly, and Ser). Circular dichroism spectra demonstrated that peptides were partially (40-90%) random in aqueous buffer but were promoted to form 100% alpha-helical structures by anionic lipid micelles. In neutral lipid micelles, only the relatively hydrophobic peptides (X = L and I) spontaneously adopted the alpha-helical conformation, but when 25% of negatively charged lipids were mixed in to mimic the content of anionic lipids in biomembranes, the less hydrophobic (X = S and G) peptides then formed alpha-helical conformations. Consistent with these findings, fluorescence quenching by the aqueous-phase quencher iodide indicated that in anionic (dimyristoylphosphatidylglycerol) vesicles, the peptide Trp residue was buried in the lipid vesicle hydrophobic core, while in neutral (dimyristoylphosphatidylcholine) vesicles, only hydrophobic (X = L and I) peptides were shielded from the aqueous solution. Trp emission spectra of peptides in the presence of phospholipids doxyl-labeled at the 5-, 7-, 10-, 12-, and 16-fatty acid positions implied not only a transbilayer orientation for inserted peptides but also that mixed peptide populations (transbilayer + surface-associated) may arise. Overall results suggest that for hydrophobic peptides with segmental threshold hydrophobicity below that which

  20. Thought insertion, cognitivism, and inner space.

    Science.gov (United States)

    Thornton, Tim

    2002-08-01

    Whatever its underlying causes, even the description of the phenomenon of thought insertion, of the content of the delusion, presents difficulty. It may seem that the best hope of a description comes from a broadly cognitivist approach to the mind which construes content-laden mental states as internal mental representations within what is literally an inner space: the space of the brain or nervous system. Such an approach objectifies thoughts in a way which might seem to hold out the prospect of describing the ''alienated'' relation to one's own thoughts that seems to be present in thought insertion.1 Firstly, I examine the general structure of cognitivist accounts of intentional or content-laden mental states. I raise the general difficulty of explaining how free-standing, and thus world-independent, inner states can still have bearing on the outer world. Secondly, I briefly examine Frith's model for explaining thought insertion and other passivity phenomena by postulating a failure of an internal monitoring mechanism of inner states. I question what account can be given of non-pathological cases and raise two specific objects. Cognitivist accounts of the mind face a general, and possibly insuperable, challenge: explaining the intentionality of mental states in non-intentional, nonquestion-begging terms. There have so far been no satisfactory solutions. Cognitivist accounts of passivity phenomena in terms of a failure of internal monitoring face two objections. Firstly, accounting for non-pathological cases generates an infinite regress. Secondly, no account can be given of the paradoxical nature of utterances of the form of Moore's paradox: ''it is raining but I do not believe it''. A cognitivist approach presents an alienated account of thought in normal, non-pathological cases and is no help in accounting for thought insertion.