WorldWideScience

Sample records for gene homologue treated

  1. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  2. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles

    2016-08-01

    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  3. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  4. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

    OpenAIRE

    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

    2007-01-01

    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  5. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

    Science.gov (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

    2014-01-01

    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  6. Regulation of Metalloprotease Gene Expression in Vibrio vulnificus by a Vibrio harveyi LuxR Homologue

    Science.gov (United States)

    Shao, Chung-Ping; Hor, Lien-I

    2001-01-01

    Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950

  7. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    OpenAIRE

    Apte, Manasi S.; Meller, Victoria H.

    2011-01-01

    Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

  8. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

    2014-01-01

    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  9. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

    2005-01-01

    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  10. Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

    2015-10-01

    To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

  11. Pepsin homologues in bacteria

    Directory of Open Access Journals (Sweden)

    Bateman Alex

    2009-09-01

    Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

  12. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne

    2007-06-01

    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  13. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

    Science.gov (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

    2012-11-30

    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  15. Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger

    2015-03-01

    Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

  16. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

    Science.gov (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

    2003-05-01

    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  17. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  18. Homologues of CsLOB1 in citrus function as disease susceptibility genes in citrus canker.

    Science.gov (United States)

    Zhang, Junli; Huguet-Tapia, Jose Carlos; Hu, Yang; Jones, Jeffrey; Wang, Nian; Liu, Sanzhen; White, Frank F

    2017-08-01

    The lateral organ boundary domain (LBD) genes encode a group of plant-specific proteins that function as transcription factors in the regulation of plant growth and development. Citrus sinensis lateral organ boundary 1 (CsLOB1) is a member of the LBD family and functions as a disease susceptibility gene in citrus bacterial canker (CBC). Thirty-four LBD members have been identified from the Citrus sinensis genome. We assessed the potential for additional members of LBD genes in citrus to function as surrogates for CsLOB1 in CBC, and compared host gene expression on induction of different LBD genes. Using custom-designed transcription activator-like (TAL) effectors, two members of the same clade as CsLOB1, named CsLOB2 and CsLOB3, were found to be capable of functioning similarly to CsLOB1 in CBC. RNA sequencing and quantitative reverse transcription-polymerase chain reaction analyses revealed a set of cell wall metabolic genes that are associated with CsLOB1, CsLOB2 and CsLOB3 expression and may represent downstream genes involved in CBC. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  19. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  20. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

    OpenAIRE

    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

    1996-01-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  1. Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

    International Nuclear Information System (INIS)

    Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu

    2007-01-01

    RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

  2. Activation of pur Gene Expression by a Homologue of the Bacillus subtilis PurR repressor:

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Martinussen, Jan

    1998-01-01

    R encoded repressor from Bacillus subtilis. The wildtype purR gene complements the purine auxotrophy of a purR::Iss1mutant, and it was shown that the purR::Iss1 mutation lowers transcription from the purine regulated L. lactis purD promoter. In a parallel study on the regulation of purC and purD expression....... We have identified a PurBox sequence overlapping the -35 region of the L. lactis purR promoter and found, by studies of a purR-lacLM fusion plasmid, that purR is autoregulated. Because of the high similarity of the PurR proteins from B. subtilis and L. lactis, we looked for PurBox sequences...... in the promoter regions of the PurR regulated genes in B. subtilis, and identified a perfectly matching PurBox in the purA promoter region, and slightly degenerate PurBox like sequences in the promoter regions for the pur operon and the purR gene....

  3. An X-linked homologue of the autosomal inprinted gene ZNF127 escapes X inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Longstreet, M.; Nicholls, R.D.; Willard, H.F. [Case Western Reserve Univ., Cleveland, OH (United States)] [and others

    1994-09-01

    The ZNF127 gene has been shown to be subject to parental imprinting in both humans and the mouse and maps to within the Prader-Willi/Angelman Syndrome critical region on chromosome 15. We have cloned two X-linked related loci, one of which, ZNFXp is a transcribed gene while the other, ZNFXq, is an untranscribed pseudogene. ZNFXp is 83.6% identical to ZNFXq and 65.4% identical to ZNF127 over 1.4 kb of open reading frame they share in common, Like ZNF127, the predicted protein sequence of ZNFXp contains a C{sub 3}HC{sub 4} zinc finger domain and C{sub 3}H zinc finger-like motifs. Whereas ZNF127 has three C{sub 3}H motifs, ZNFXp has four. A strong CpG island is located within 1 kb 5{prime} of the predicted amino terminus of ZNFXp. Expression of ZNFXp has been detected from mouse/human somatic cell hybrids containing either an active (n=2) or an inactive (n=4) chromosome, and thus escapes X inactivation. Probes made from the 3{prime} UTR of ZNFXp detect a number of related loci in both human and murine DNA, none of which is the ZNF127 locus on chromosome 15. None of the detectable murine bands shows dosage differences between males and females as would be expected for X-linked loci. This raises the possibility that ZNFXp inserted into the human X chromosome after its divergence from a common ancestor with the murine X. We have mapped ZNFXp to Xp11.4 by Southern blotting and PCR of hybrid DNAs and by fluorescence in situ hybridization (FISH). ZNFXq maps within the X Inactivation Center (XIC) region on Xq13.2, approximately 300 kb distal to the XIST gene. We find it intriguing, and perhaps significant, that two members of this gene family are subject to epigenetic regulation -- one autosomal imprinting, and the other escape from X inactivation. These results could imply an evolutionary and mechanistic relationship between these two processes.

  4. Mouse Homologue of the Schizophrenia Susceptibility Gene ZNF804A as a Target of Hoxc8

    Directory of Open Access Journals (Sweden)

    Hyun Joo Chung

    2010-01-01

    Full Text Available Using a ChIP-cloning technique, we identified a Zinc finger protein 804a (Zfp804a as one of the putative Hoxc8 downstream target genes. We confirmed binding of Hoxc8 to an intronic region of Zfp804a by ChIP-PCR in F9 cells as well as in mouse embryos. Hoxc8 upregulated Zfp804a mRNA levels and augmented minimal promoter activity in vitro. In E11.5 mouse embryos, Zfp804a and Hoxc8 were coexpressed. Recent genome-wide studies identified Zfp804a (or ZNF804A in humans as a plausible marker for schizophrenia, leading us to hypothesize that this embryogenic regulatory control might also exert influence in development of complex traits such as psychosis.

  5. Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

    Directory of Open Access Journals (Sweden)

    Knüchel Ruth

    2008-05-01

    Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

  6. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo

    2005-10-01

    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  7. Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

    International Nuclear Information System (INIS)

    Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi

    1990-01-01

    Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

  8. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  9. Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Moore Landon L

    2008-02-01

    Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

  10. acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes.

    Science.gov (United States)

    Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J

    2017-10-02

    The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

  11. The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

    International Nuclear Information System (INIS)

    Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.

    2003-01-01

    Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

  12. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  13. Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

    Directory of Open Access Journals (Sweden)

    Adriano Senatore

    Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

  14. An indigoidine biosynthetic gene cluster from Streptomyces chromofuscus ATCC 49982 contains an unusual IndB homologue.

    Science.gov (United States)

    Yu, Dayu; Xu, Fuchao; Valiente, Jonathan; Wang, Siyuan; Zhan, Jixun

    2013-01-01

    A putative indigoidine biosynthetic gene cluster was located in the genome of Streptomyces chromofuscus ATCC 49982. The silent 9.4-kb gene cluster consists of five open reading frames, named orf1, Sc-indC, Sc-indA, Sc-indB, and orf2, respectively. Sc-IndC was functionally characterized as an indigoidine synthase through heterologous expression of the enzyme in both Streptomyces coelicolor CH999 and Escherichia coli BAP1. The yield of indigoidine in E. coli BAP1 reached 2.78 g/l under the optimized conditions. The predicted protein product of Sc-indB is unusual and much larger than any other reported IndB-like protein. The N-terminal portion of this enzyme resembles IdgB and the C-terminal portion is a hypothetical protein. Sc-IndA and/or Sc-IndB were co-expressed with Sc-IndC in E. coli BAP1, which demonstrated the involvement of Sc-IndB, but not Sc-IndA, in the biosynthetic pathway of indigoidine. The yield of indigoidine was dramatically increased by 41.4 % (3.93 g/l) when Sc-IndB was co-expressed with Sc-IndC in E. coli BAP1. Indigoidine is more stable at low temperatures.

  15. Hyper-radiation sensitivity of murine scid mutation and mapping of the human homologue HYRC1 gene

    International Nuclear Information System (INIS)

    Komatsu, Kenshi; Ohta, Tohru; Niikawa, Norio; Okumura, Yutaka; Kubota, Nobuo.

    1994-01-01

    The murine severe combined immunodeficient mutation (scid) is characterized by a lack of both B and T cells, due to a defect in lymphoid variable-(diversity)-joining(V(D)J) rearrangement. Scid cells are highly sensitive to both radiation-induced killing and chromosomal aberrations. Present experiments also demonstrated the high sensitivity of scid cells to killing, because of a deficient repair of double strand breaks(DSB). Scid cells can repair only 60% of radiation-induced DSB for 3 hours, while normal cells repair 85% of the DSB. Significantly reduced Do and n values were obtained from survival curves of scid cells and were similar to ataxia-telangiectasia(AT) cells (a unique human disease conferring whole body radiosensitivity). However, the kinetics of DNA synthesis after irradiation were different between the two cell types. In contrast with the radioresistant DNA synthesis of AT cells, DNA synthesis of scid cells was markedly inhibited after irradiation. The existence of different mutations was also supported by evidence of complementation in somatic cell hybrids between scid cells and AT cells. Using these hybrid cells, fragments of human chromosome 8 were introduced into scid cells HPRT mutant via X-irradiation and somatic cell fusion. The resulting hybrid clones contained human DNA fragment(s) which complemented the hyper-radiosensitivity of the scid cells. Alu-PCR products from these hybrids were used for chromosome painting using the technique of chromosome in situ suppression hybridization, allowing assignment of the human HYRC1 (hyper-radiosensitivity of murine scid mutation, complementing 1) gene, a candidate for a V(D)J recombinant gene, to human chromosome 8q11. (author)

  16. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  17. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

    2005-01-01

    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  18. A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development.

    Science.gov (United States)

    Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

    2011-11-01

    Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

  19. The light gene of Drosophila melanogaster encodes a homologue of VPS41, a yeast gene involved in cellular-protein trafficking.

    Science.gov (United States)

    Warner, T S; Sinclair, D A; Fitzpatrick, K A; Singh, M; Devlin, R H; Honda, B M

    1998-04-01

    Mutations in a number of genes affect eye colour in Drosophila melanogaster; some of these "eye-colour" genes have been shown to be involved in various aspects of cellular transport processes. In addition, combinations of viable mutant alleles of some of these genes, such as carnation (car) combined with either light (lt) or deep-orange (dor) mutants, show lethal interactions. Recently, dor was shown to be homologous to the yeast gene PEP3 (VPS18), which is known to be involved in intracellular trafficking. We have undertaken to extend our earlier work on the lt gene, in order to examine in more detail its expression pattern and to characterize its gene product via sequencing of a cloned cDNA. The gene appears to be expressed at relatively high levels in all stages and tissues examined, and shows strong homology to VPS41, a gene involved in cellular-protein trafficking in yeast and higher eukaryotes. Further genetic experiments also point to a role for lt in transport processes: we describe lethal interactions between viable alleles of lt and dor, as well as phenotypic interactions (reductions in eye pigment) between allels of lt and another eye-colour gene, garnet (g), whose gene product has close homology to a subunit of the human adaptor complex, AP-3.

  20. Molecular and functional characterization of a human ATM gene analogue at Arabidopsis thaliana; Caracterisation moleculaire et Fonctionnelle d'un Homologue du gene humain ATM chez Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, V.

    2001-12-15

    The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)

  1. Gene expression profiles in adenosine-treated human mast cells ...

    African Journals Online (AJOL)

    Gene expression profiles in adenosine-treated human mast cells. ... SW Kang, JE Jeong, CH Kim, SH Choi, SH Chae, SA Jun, HJ Cha, JH Kim, YM Lee, YS ... beta 4, ring finger protein, high-mobility group, calmodulin 2, RAN binding protein, ...

  2. The Saccharomyces cerevisiae RAD30 gene, a homologue of Escherichia coli dinB and umuC, is DNA damage inducible and functions in a novel error-free postreplication repair mechanism

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.

    1997-12-15

    Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)

  3. Dataset of the human homologues and orthologues of lipid-metabolic genes identified as DAF-16 targets their roles in lipid and energy metabolism

    Directory of Open Access Journals (Sweden)

    Lavender Yuen-Nam Fan

    2017-04-01

    Full Text Available The data presented in this article are related to the review article entitled ‘Unravelling the role of fatty acid metabolism in cancer through the FOXO3-FOXM1 axis’ (Saavedra-Garcia et al., 2017 [24]. Here, we have matched the DAF-16/FOXO3 downstream genes with their respective human orthologues and reviewed the roles of these targeted genes in FA metabolism. The list of genes listed in this article are precisely selected from literature reviews based on their functions in mammalian FA metabolism. The nematode Caenorhabditis elegans gene orthologues of the genes are obtained from WormBase, the online biological database of C. elegans. This dataset has not been uploaded to a public repository yet.

  4. Dataset of the human homologues and orthologues of lipid-metabolic genes identified as DAF-16 targets their roles in lipid and energy metabolism.

    Science.gov (United States)

    Fan, Lavender Yuen-Nam; Saavedra-García, Paula; Lam, Eric Wing-Fai

    2017-04-01

    The data presented in this article are related to the review article entitled 'Unravelling the role of fatty acid metabolism in cancer through the FOXO3-FOXM1 axis' (Saavedra-Garcia et al., 2017) [24]. Here, we have matched the DAF-16/FOXO3 downstream genes with their respective human orthologues and reviewed the roles of these targeted genes in FA metabolism. The list of genes listed in this article are precisely selected from literature reviews based on their functions in mammalian FA metabolism. The nematode Caenorhabditis elegans gene orthologues of the genes are obtained from WormBase, the online biological database of C. elegans. This dataset has not been uploaded to a public repository yet.

  5. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  6. Isolation and characterization of an AGAMOUS homologue from cocoa

    NARCIS (Netherlands)

    Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

    2006-01-01

    We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

  7. Mating type gene homologues and putative sex pheromone-sensing pathway in arbuscular mycorrhizal fungi, a presumably asexual plant root symbiont.

    Directory of Open Access Journals (Sweden)

    Sébastien Halary

    Full Text Available The fungal kingdom displays a fascinating diversity of sex-determination systems. Recent advances in genomics provide insights into the molecular mechanisms of sex, mating type determination, and evolution of sexual reproduction in many fungal species in both ancient and modern phylogenetic lineages. All major fungal groups have evolved sexual differentiation and recombination pathways. However, sexuality is unknown in arbuscular mycorrhizal fungi (AMF of the phylum Glomeromycota, an ecologically vital group of obligate plant root symbionts. AMF are commonly considered an ancient asexual lineage dating back to the Ordovician, approximately 460 M years ago. In this study, we used genomic and transcriptomic surveys of several AMF species to demonstrate the presence of conserved putative sex pheromone-sensing mitogen-activated protein (MAP kinases, comparable to those described in Ascomycota and Basidiomycota. We also find genes for high mobility group (HMG transcription factors, homologous to SexM and SexP genes in the Mucorales. The SexM genes show a remarkable sequence diversity among multiple copies in the genome, while only a single SexP sequence was detected in some isolates of Rhizophagus irregularis. In the Mucorales and Microsporidia, the sexM gene is flanked by genes for a triosephosphate transporter (TPT and a RNA helicase, but we find no evidence for synteny in the vicinity of the Sex locus in AMF. Nonetheless, our results, together with previous observations on meiotic machinery, suggest that AMF could undergo a complete sexual reproduction cycle.

  8. USE OF GENE EXPRESSION ANALYSIS INCORPORATING OPERON-TRANSCRIPTIONAL COUPLING AND TOXICANT DOSE RESPONSE TO DISTINGUISH AMONG STRUCTURAL HOMOLOGUES OF MX

    Science.gov (United States)

    We recently described a general method that can improve microarray analysis of toxicant-exposed cells that uses the intrinsic power of transcriptional coupling and toxicant concentration-expression response data. In this analysis, we characterized changes in global gene expressio...

  9. Curcumin administration suppress acetylcholinesterase gene expression in cadmium treated rats.

    Science.gov (United States)

    Akinyemi, Ayodele Jacob; Oboh, Ganiyu; Fadaka, Adewale Oluwaseun; Olatunji, Babawale Peter; Akomolafe, Seun

    2017-09-01

    Curcumin, the main polyphenolic component of turmeric (Curcuma longa) rhizomes have been reported to exert anticholinesterase potential with limited information on how they regulate acetylcholinesterase (AChE) gene expression. Hence, this study sought to evaluate the effect of curcumin on cerebral cortex acetylcholinesterase (AChE) activity and their mRNA gene expression level in cadmium (Cd)-treated rats. Furthermore, in vitro effect of different concentrations of curcumin (1-5μg/mL) on rat cerebral cortex AChE activity was assessed. Animals were divided into six groups (n=6): group 1 serve as control (without Cd) and receive saline/vehicle, group 2 receive saline plus curcumin at 25mg/kg, group 3 receive saline plus curcumin 50mg/kg, group 4 receive Cd plus vehicle, group 5 receive Cd plus curcumin at 25mg/kg and group 6 receive Cd plus curcumin at 50mg/kg. Rats received Cd (2.5mg/kg) and curcumin (25 and 50mg/kg, respectively) by oral gavage for 7days. Acetylcholinesterase activity was measured by Ellman's method and AChE expression was carried out by a quantitative reverse transcriptase polymerase chain reaction (RT-qPCR) assay. We observed that acute administration of Cd increased acetylcholinesterase activity and in addition caused a significant (Pcurcumin inhibited AChE activity and alters AChE mRNA levels when compared to Cd-treated group. In addition, curcumin inhibits rat cerebral cortex AChE activity in vitro. In conclusion, curcumin exhibit anti-acetylcholinesterase activity and suppressed AChE mRNA gene expression level in Cd exposed rats, thus providing some biochemical and molecular evidence on the therapeutic effect of this turmeric-derived compound in treating neurological disorders including Alzheimer's disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Combination of Hypomorphic Mutations of the Drosophila Homologues of Aryl Hydrocarbon Receptor and Nucleosome Assembly Protein Family Genes Disrupts Morphogenesis, Memory and Detoxification

    OpenAIRE

    Kuzin, Boris A.; Nikitina, Ekaterina A.; Cherezov, Roman O.; Vorontsova, Julia E.; Slezinger, Mikhail S.; Zatsepina, Olga G.; Simonova, Olga B.; Enikolopov, Grigori N.; Savvateeva-Popova, Elena V.

    2014-01-01

    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response...

  11. Gene dosage effects of the imprinted delta-like homologue 1 (dlk1/pref1 in development: implications for the evolution of imprinting.

    Directory of Open Access Journals (Sweden)

    Simao Teixeira da Rocha

    2009-02-01

    Full Text Available Genomic imprinting is a normal process that causes genes to be expressed according to parental origin. The selective advantage conferred by imprinting is not understood but is hypothesised to act on dosage-critical genes. Here, we report a unique model in which the consequences of a single, double, and triple dosage of the imprinted Dlk1/Pref1, normally repressed on the maternally inherited chromosome, can be assessed in the growing embryo. BAC-transgenic mice were generated that over-express Dlk1 from endogenous regulators at all sites of embryonic activity. Triple dosage causes lethality associated with major organ abnormalities. Embryos expressing a double dose of Dlk1, recapitulating loss of imprinting, are growth enhanced but fail to thrive in early life, despite the early growth advantage. Thus, any benefit conferred by increased embryonic size is offset by postnatal lethality. We propose a negative correlation between gene dosage and survival that fixes an upper limit on growth promotion by Dlk1, and we hypothesize that trade-off between growth and lethality might have driven imprinting at this locus.

  12. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification.

    Science.gov (United States)

    Kuzin, Boris A; Nikitina, Ekaterina A; Cherezov, Roman O; Vorontsova, Julia E; Slezinger, Mikhail S; Zatsepina, Olga G; Simonova, Olga B; Enikolopov, Grigori N; Savvateeva-Popova, Elena V

    2014-01-01

    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  13. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification.

    Directory of Open Access Journals (Sweden)

    Boris A Kuzin

    Full Text Available Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  14. A lumpy skin disease virus deficient of an IL-10 gene homologue provides protective immunity against virulent capripoxvirus challenge in sheep and goats.

    Science.gov (United States)

    Boshra, Hani; Truong, Thang; Nfon, Charles; Bowden, Timothy R; Gerdts, Volker; Tikoo, Suresh; Babiuk, Lorne A; Kara, Pravesh; Mather, Arshad; Wallace, David B; Babiuk, Shawn

    2015-11-01

    Sheep and goat pox continue to be important livestock diseases that pose a major threat to the livestock industry in many regions in Africa and Asia. Currently, several live attenuated vaccines are available and used in endemic countries to control these diseases. One of these is a partially attenuated strain of lumpy skin disease virus (LSDV), KS-1, which provides cross-protection against both sheep pox and goat pox. However, when used in highly stressed dairy cattle to protect against lumpy skin disease (LSD) the vaccine can cause clinical disease. In order to develop safer vaccines effective against all three diseases, a pathogenic strain of LSDV (Warmbaths [WB], South Africa) was attenuated by removing a putative virulence factor gene (IL-10-like) using gene knockout (KO) technology. This construct (LSDV WB005KO) was then evaluated as a vaccine for sheep and goats against virulent capripoxvirus challenge. Sheep and goats were vaccinated with the construct and the animals were observed for 21days. The vaccine appeared to be safe, and did not cause disease, although it induced minor inflammation at the injection site similar to that caused by other attenuated sheep and goat pox vaccines. In addition, no virus replication was detected in blood, oral or nasal swabs using real-time PCR following vaccination and low levels of neutralising antibodies were detected in both sheep and goats. Leukocytes isolated from vaccinated animals following vaccination elicited capripoxvirus-specific IFN-γ secretion, suggesting that immunity was also T-cell mediated. Following challenge with virulent capripoxvirus, vaccinated sheep and goats were found to be completely protected and exhibited no clinical disease. Furthermore, real-time PCR of blood samples at various time points suggested that viremia was absent in both groups of vaccinated animals, as opposed to capripoxvirus-related clinical disease and viremia observed in the unvaccinated animals. These findings suggest that this

  15. nuvA, an Aspergillus nidulans gene involved in DNA repair and recombination, is a homologue of Saccharomyces cerevisiae RAD18 and Neurospora crassa uvs-2.

    Science.gov (United States)

    Iwanejko, L; Cotton, C; Jones, G; Tomsett, B; Strike, P

    1996-03-01

    A 40 kb genomic clone and 2.3 kb EcoRI subclone that rescued the DNA repair and recombination defects of the Aspergillus nidulans nuvA11 mutant were isolated and the subclone sequenced. The subclone hybridized to a cosmid in a chromosome-specific library confirming the assignment of nuvA to linkage group IV and indicating its closeness to bimD. Amplification by PCR clarified the relative positions of nuvA and bimD. A region identified within the subclone, encoding a C3HC4 zinc finger motif, was used as a probe to retrieve a cDNA clone. Sequencing of this clone showed that the nuvA gene has an ORF of 1329 bp with two introns of 51 bp and 60 bp. Expression of nuvA appears to be extremely low. The putative NUVA polypeptide has two zinc finger motifs, a molecular mass of 48906 Da and has 39% identity with the Neurospora crassa uvs-2 and 25% identity with the Saccharomyces cerevisiae RAD18 translation products. Although mutations in nuvA, uvs-2 and RAD18 produce similar phenotypes, only the nuvA11 mutation affects meiotic recombination. A role for nuvA in both DNA repair and genetic recombination is proposed.

  16. Liver steatosis study_PFAA treated mouse gene array data

    Data.gov (United States)

    U.S. Environmental Protection Agency — This file contains a link for Gene Expression Omnibus and the GSE designations for the publicly available gene expression data used in the study and reflected in...

  17. Treating Duchenne Cardiomyopathy in the Mouse Model by Gene Repair

    Science.gov (United States)

    2017-08-01

    Photoregulated Gene Expression for Spatiotemporal Control of Morphogenesis Time Commitments: 0 Supporting Agency: NSF Career Award, CBET-1151035...vector toolkit for human gene therapy. Mol Ther 2006, 14:316-327. 20. Gao G, Vandenberghe LH, Wilson JM: New recombinant serotypes of AAV vectors. Curr

  18. Gene expression profiles in adenosine-treated human mast cells

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... assignment (Ewing and Green, 1998a; Ewing et al., 1998b). The trace files were trimmed with trim-alt 0.05 (P-score>20). In addition, vector trimming was conducted with cross-match software. Each gene expression pattern was analyzed by clustering. (30 bp or more 94% homology) and assembly.

  19. Liver Gene Expression Profiles of Rats Treated with Clofibric Acid

    Science.gov (United States)

    Michel, Cécile; Desdouets, Chantal; Sacre-Salem, Béatrice; Gautier, Jean-Charles; Roberts, Ruth; Boitier, Eric

    2003-01-01

    Clofibric acid (CLO) is a peroxisome proliferator (PP) that acts through the peroxisome proliferator activated receptor α, leading to hepatocarcinogenesis in rodents. CLO-induced hepatocarcinogenesis is a multi-step process, first transforming normal liver cells into foci. The combination of laser capture microdissection (LCM) and genomics has the potential to provide expression profiles from such small cell clusters, giving an opportunity to understand the process of cancer development in response to PPs. To our knowledge, this is the first evaluation of the impact of the successive steps of LCM procedure on gene expression profiling by comparing profiles from LCM samples to those obtained with non-microdissected liver samples collected after a 1 month CLO treatment in the rat. We showed that hematoxylin and eosin (H&E) staining and laser microdissection itself do not impact on RNA quality. However, the overall process of the LCM procedure affects the RNA quality, resulting in a bias in the gene profiles. Nonetheless, this bias did not prevent accurate determination of a CLO-specific molecular signature. Thus, gene-profiling analysis of microdissected foci, identified by H&E staining may provide insight into the mechanisms underlying non-genotoxic hepatocarcinogenesis in the rat by allowing identification of specific genes that are regulated by CLO in early pre-neoplastic foci. PMID:14633594

  20. Treating Combat Hearing Loss with Atoh1 Gene Therapy

    Science.gov (United States)

    2015-06-01

    K, Hibino H, Kubo T (2009) Analysis of gene expression profiles along the tonotopic map of mouse cochlea by cDNA microarrays. Acta Otolaryngol Suppl...Murata, J., Tokunaga, A., Okano, H., and Kubo , T. (2006). Mapping of notch activation during cochlear development in mice: implications for determination

  1. A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

    NARCIS (Netherlands)

    Spassieva, S; Hille, J

    Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

  2. A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

    2004-01-01

    Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

  3. Gene therapy as a potential tool for treating neuroblastoma-a focused review.

    Science.gov (United States)

    Kumar, M D; Dravid, A; Kumar, A; Sen, D

    2016-05-01

    Neuroblastoma, a solid tumor caused by rapid division of undifferentiated neuroblasts, is the most common childhood malignancy affecting children aged genes is restored to normalcy. Gene therapy is a powerful tool with the potential to inhibit the deleterious effects of oncogenes by inserting corrected/normal genes into the genome. Both viral and non-viral vector-based gene therapies have been developed and adopted to deliver the target genes into neuroblastoma cells. These attempts have given hope to bringing in a new regime of treatment against neuroblastoma. A few gene-therapy-based treatment strategies have been tested in limited clinical trials yielding some positive results. This mini review is an attempt to provide an overview of the available options of gene therapy to treat neuroblastoma.

  4. Gene expression profiles in BCL11B-siRNA treated malignant T cells

    Directory of Open Access Journals (Sweden)

    Grabarczyk Piotr

    2011-05-01

    Full Text Available Abstract Background Downregulation of the B-cell chronic lymphocytic leukemia (CLL/lymphoma11B (BCL11B gene by small interfering RNA (siRNA leads to growth inhibition and apoptosis of the human T-cell acute lymphoblastic leukemia (T-ALL cell line Molt-4. To further characterize the molecular mechanism, a global gene expression profile of BCL11B-siRNA -treated Molt-4 cells was established. The expression profiles of several genes were further validated in the BCL11B-siRNA -treated Molt-4 cells and primary T-ALL cells. Results 142 genes were found to be upregulated and 109 genes downregulated in the BCL11B-siRNA -treated Molt-4 cells by microarray analysis. Among apoptosis-related genes, three pro-apoptotic genes, TNFSF10, BIK, BNIP3, were upregulated and one anti-apoptotic gene, BCL2L1 was downregulated. Moreover, the expression of SPP1 and CREBBP genes involved in the transforming growth factor (TGF-β pathway was down 16-fold. Expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP were also examined by real-time PCR. A similar expression pattern of TNFSF10, BCL2L1, and SPP1 was identified. However, CREBBP was not downregulated in the BLC11B-siRNA -treated Molt-4 cells. Conclusion BCL11B-siRNA treatment altered expression profiles of TNFSF10, BCL2L1, and SPP1 in both Molt-4 T cell line and primary T-ALL cells.

  5. Status of therapeutic gene transfer to treat canine dilated cardiomyopathy in dogs.

    Science.gov (United States)

    Sleeper, Meg M; Bish, Lawrence T; Sweeney, H Lee

    2010-07-01

    Therapeutic gene transfer holds promise as a way to treat dilated cardiomyopathy from any underlying cause because the approach attempts to address metabolic disturbances that occur at the molecular level of the failing heart. Calcium-handling abnormalities and increased rates of apoptosis are abnormalities that occur in many types of heart disease, and gene therapies that target these metabolic defects have proven to be beneficial in numerous rodent models of heart disease. The authors are currently evaluating this approach to treat canine idiopathic dilated cardiomyopathy.

  6. The role of the leukemia-associated ETO homologue repressors in hematopoiesis

    OpenAIRE

    Olsson, André

    2006-01-01

    The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

  7. Predictive value of MSH2 gene expression in colorectal cancer treated with capecitabine

    DEFF Research Database (Denmark)

    Jensen, Lars H; Danenberg, Kathleen D; Danenberg, Peter V

    2007-01-01

    was associated with a hazard ratio of 0.5 (95% confidence interval, 0.23-1.11; P = 0.083) in survival analysis. CONCLUSION: The higher gene expression of MSH2 in responders and the trend for predicting overall survival indicates a predictive value of this marker in the treatment of advanced CRC with capecitabine.......PURPOSE: The objective of the present study was to evaluate the gene expression of the DNA mismatch repair gene MSH2 as a predictive marker in advanced colorectal cancer (CRC) treated with first-line capecitabine. PATIENTS AND METHODS: Microdissection of paraffin-embedded tumor tissue, RNA...

  8. Gene expression profiling of liver from dairy cows treated intra-mammary with lipopolysaccharide

    DEFF Research Database (Denmark)

    Jiang, Li; Sørensen, Peter; Røntved, Christine

    2008-01-01

    Liver plays a profound role in the acute phase response (APR) observed in the early phase of acute bovine mastitis caused by Escherichia coli (E. coli). To gain an insight into the genes and pathways involved in hepatic APR of dairy cows we performed a global gene expression analysis of liver...... also seemed to participate in APR. CONCLUSIONS: Performing global gene expression analysis on liver tissue from IM LPS treated cows verified that the liver plays a major role in the APR of E. coli mastitis, and that the bovine hepatic APR follows the same pattern as other mammals when...

  9. Differential gene expression profile in pig adipose tissue treated with/without clenbuterol

    Directory of Open Access Journals (Sweden)

    Deng Xue M

    2007-11-01

    Full Text Available Abstract Background Clenbuterol, a beta-agonist, can dramatically reduce pig adipose accumulation at high dosages. However, it has been banned in pig production because people who eat pig products treated with clenbuterol can be poisoned by the clenbuterol residues. To understand the molecular mechanism for this fat reduction, cDNA microarray, real-time PCR, two-dimensional electrophoresis and mass spectra were used to study the differential gene expression profiles of pig adipose tissues treated with/without clenbuterol. The objective of this research is to identify novel genes and physiological pathways that potentially facilitate clenbuterol induced reduction of adipose accumulation. Results Clenbuterol was found to improve the lean meat percentage about 10 percent (P Conclusion Pig fat accumulation was reduced dramatically with clenbuterol treatment. Histological sections and global evaluation of gene expression after administration of clenbuterol in pigs identified profound changes in adipose cells. With clenbuterol stimulation, adipose cell volumes decreased and their gene expression profile changed, which indicate some metabolism processes have been also altered. Although the biological functions of the differentially expressed genes are not completely known, higher expressions of these molecules in adipose tissue might contribute to the reduction of fat accumulation. Among these genes, five lipid metabolism related genes were of special interest for further study, including apoD and apoR. The apoR expression was increased at both the RNA and protein levels. The apoR may be one of the critical molecules through which clenbuterol reduces fat accumulation.

  10. TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

    OpenAIRE

    Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

    1994-01-01

    The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

  11. HerDing: herb recommendation system to treat diseases using genes and chemicals.

    Science.gov (United States)

    Choi, Wonjun; Choi, Chan-Hun; Kim, Young Ran; Kim, Seon-Jong; Na, Chang-Su; Lee, Hyunju

    2016-01-01

    In recent years, herbs have been researched for new drug candidates because they have a long empirical history of treating diseases and are relatively free from side effects. Studies to scientifically prove the medical efficacy of herbs for target diseases often spend a considerable amount of time and effort in choosing candidate herbs and in performing experiments to measure changes of marker genes when treating herbs. A computational approach to recommend herbs for treating diseases might be helpful to promote efficiency in the early stage of such studies. Although several databases related to traditional Chinese medicine have been already developed, there is no specialized Web tool yet recommending herbs to treat diseases based on disease-related genes. Therefore, we developed a novel search engine, HerDing, focused on retrieving candidate herb-related information with user search terms (a list of genes, a disease name, a chemical name or an herb name). HerDing was built by integrating public databases and by applying a text-mining method. The HerDing website is free and open to all users, and there is no login requirement. Database URL: http://combio.gist.ac.kr/herding. © The Author(s) 2016. Published by Oxford University Press.

  12. Gene expression of panaxydol-treated human melanoma cells using radioactive cDNA microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Joong Youn; Yu, Su Jin; Soh, Jeong Won; Kim, Meyoung Kon [College of Medicine, Korea Univ., Seoul (Korea, Republic of)

    2001-07-01

    Polyacetylenic alcohols derived from Panax ginseng have been studied to be an anticancer reagent previously. One of the Panax ginseng polyacetylenic alcohols, i.e., panaxydol, has been studied to possess an antiproliferative effect on human melanoma cell line (SK-MEL-1). In ths study, radioactive cDNA microarrays enabled an efficient approach to analyze the pattern of gene expression (3.194 genes in a total) simultaneously. The bioinformatics selection of human cDNAs, which is specifically designed for immunology, apoptosis and signal transduction, were arrayed on nylon membranes. Using with {sup 33}P labeled probes, this method provided highly sensitive gene expression profiles of our interest including apoptosis, cell proliferation, cell cycle, and signal transduction. Gene expression profiles were also classified into several categories in accordance with the duration of panaxydol treatment. Consequently, the gene profiles of our interest were significantly up (199 genes, > 2.0 of Z-ratio) or down-(196 genes, < 2.0 of Z-ratio) regulated in panaxydol-treated human melanoma cells.

  13. Gene expression of panaxydol-treated human melanoma cells using radioactive cDNA microarrays

    International Nuclear Information System (INIS)

    Cho, Joong Youn; Yu, Su Jin; Soh, Jeong Won; Kim, Meyoung Kon

    2001-01-01

    Polyacetylenic alcohols derived from Panax ginseng have been studied to be an anticancer reagent previously. One of the Panax ginseng polyacetylenic alcohols, i.e., panaxydol, has been studied to possess an antiproliferative effect on human melanoma cell line (SK-MEL-1). In ths study, radioactive cDNA microarrays enabled an efficient approach to analyze the pattern of gene expression (3.194 genes in a total) simultaneously. The bioinformatics selection of human cDNAs, which is specifically designed for immunology, apoptosis and signal transduction, were arrayed on nylon membranes. Using with 33 P labeled probes, this method provided highly sensitive gene expression profiles of our interest including apoptosis, cell proliferation, cell cycle, and signal transduction. Gene expression profiles were also classified into several categories in accordance with the duration of panaxydol treatment. Consequently, the gene profiles of our interest were significantly up (199 genes, > 2.0 of Z-ratio) or down-(196 genes, < 2.0 of Z-ratio) regulated in panaxydol-treated human melanoma cells

  14. Microarray gene expression during early healing of GBR-treated calvarial critical size defects.

    Science.gov (United States)

    Al-Kattan, R; Retzepi, M; Calciolari, E; Donos, N

    2017-10-01

    To investigate the gene expression and molecular pathways implicated in the regulation of the osseous healing process following guided bone regeneration (GBR). Six 6-month-old Wistar male rats were used. Standardized 5-mm critical size defects were created in the parietal bones of each animal and treated with an extracranial and intracranial ePTFE membrane, according to the GBR principle. Three animals were randomly sacrificed after 7 and 15 days of healing. Total RNA was extracted from each sample and prepared for gene expression analysis. RNA quality and quantity were assessed, followed by hybridization of the cRNA to Affymetrix GeneChip Rat Genome 230 2.0 Arrays. The Affymetrix data were processed, and first-order analysis, quality control and statistical analysis were performed. Biological interpretation was performed via pathway and Gene Ontology (GO) analysis. Between the 7- and 15-day samples, 538 genes were differently regulated. At day 7, inflammatory and immune responses were clearly upregulated. In addition, GO terms related to angiogenesis and cell cycle regulation were overexpressed. At day 15, a more complex cellular activity and cell metabolism were evident. The bone formation processes were significantly overexpressed, with several genes encoding growth factors, enzyme activity, and extracellular matrix formation found as upregulated. Remarkably, a negative regulation of Wnt signalling pathway was observed at 15 days. The gene expression profile of the cells participating in osseous formation varied depending on the healing stage. A number of candidate genes that seem differentially expressed during early stages of intramembranous bone regeneration was suggested. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Gene response in rice plants treated with continuous fog influenced by pH, was similar to that treated with biotic stress.

    Science.gov (United States)

    Satoh, Kouji; Saji, Shoko; Ito, Shoko; Shimizu, Hideyuki; Saji, Hikaru; Kikuchi, Shoshi

    2014-01-01

    Throughout Asia, including Japan, rice plants are cultivated in a wide range of areas from lowlands to highlands and are frequently exposed to fog, including acid fog. Some physiological studies have shown that acid fog can be a stress factor for plants. We analyzed the gene expression profiles of rice plants treated with artificially prepared simulated acid fog (SiAF) or simulated neutral fog (SiNF) for 1 or 7 days. Microarray analysis results suggested that both the SiAF and the SiNF treatments induced the expression of genes involved in the defense and stress responses in rice plants. Induction of such genes was detected in plants treated with SiAF for 1 day, and the number of induced genes increased in plants treated with SiAF for 7 days. The genes for defense and stress responses were also induced by SiNF for 7 days, although they were not induced by SiNF for 1 day. The gene expression profiles of the SiAF-treated and the SiNF-treated plants were compared to those of plants treated with other stress factors. The comparison revealed that both SiAF and SiNF treatments have similar effects to biotic stresses and ozone stress. The genes encoding NADPH oxidase and germin, which function in apoplasts, were also induced by SiAF, SiNF and biotic stresses. These findings suggest that both the SiAF and the SiNF treatments may result in oxidative stress through the apoplastic production of reactive oxygen species.

  16. Profiling of hepatic gene expression in rats treated with fibric acid analogs

    Energy Technology Data Exchange (ETDEWEB)

    Cornwell, Paul D.; Souza, Angus T. de; Ulrich, Roger G

    2004-05-18

    Peroxisome proliferator-activated receptors (PPARs) are a group of nuclear receptors whose ligands include fatty acids, eicosanoids and the fibrate class of drugs. In humans, fibrates are used to treat dyslipidemias. In rodents, fibrates cause peroxisome proliferation, a change that might explain the observed hepatomegaly. In this study, rats were treated with multiple dose levels of six fibric acid analogs (including fenofibrate) for up to two weeks. Pathological analysis identified hepatocellular hypertrophy as the only sign of hepatotoxicity, and only one compound at the highest dose caused any significant increase in serum ALT or AST activity. RNA profiling revealed that the expression of 1288 genes was related to dose or length of treatment and correlated with hepatocellular hypertrophy. This gene list included expression changes that were consistent with increased mitochondrial and peroxisomal {beta}-oxidation, increased fatty acid transport, increased hepatic uptake of LDL-cholesterol, decreased hepatic uptake of glucose, decreased gluconeogenesis and decreased glycolysis. These changes are likely linked to many of the clinical benefits of fibrate drugs, including decreased serum triglycerides, decreased serum LDL-cholesterol and increased serum HDL-cholesterol. In light of the fact that all six compounds stimulated similar or identical changes in the expression of this set of 1288 genes, these results indicate that hepatomegaly is due to PPAR{alpha} activation, although signaling through other receptors (e.g. PPAR{gamma}, RXR) or through non-receptor pathways cannot be excluded.

  17. Profiling of hepatic gene expression in rats treated with fibric acid analogs

    International Nuclear Information System (INIS)

    Cornwell, Paul D.; Souza, Angus T. de; Ulrich, Roger G.

    2004-01-01

    Peroxisome proliferator-activated receptors (PPARs) are a group of nuclear receptors whose ligands include fatty acids, eicosanoids and the fibrate class of drugs. In humans, fibrates are used to treat dyslipidemias. In rodents, fibrates cause peroxisome proliferation, a change that might explain the observed hepatomegaly. In this study, rats were treated with multiple dose levels of six fibric acid analogs (including fenofibrate) for up to two weeks. Pathological analysis identified hepatocellular hypertrophy as the only sign of hepatotoxicity, and only one compound at the highest dose caused any significant increase in serum ALT or AST activity. RNA profiling revealed that the expression of 1288 genes was related to dose or length of treatment and correlated with hepatocellular hypertrophy. This gene list included expression changes that were consistent with increased mitochondrial and peroxisomal β-oxidation, increased fatty acid transport, increased hepatic uptake of LDL-cholesterol, decreased hepatic uptake of glucose, decreased gluconeogenesis and decreased glycolysis. These changes are likely linked to many of the clinical benefits of fibrate drugs, including decreased serum triglycerides, decreased serum LDL-cholesterol and increased serum HDL-cholesterol. In light of the fact that all six compounds stimulated similar or identical changes in the expression of this set of 1288 genes, these results indicate that hepatomegaly is due to PPARα activation, although signaling through other receptors (e.g. PPARγ, RXR) or through non-receptor pathways cannot be excluded

  18. Gene expression profiling of liver from dairy cows treated intra-mammary with lipopolysaccharide

    Directory of Open Access Journals (Sweden)

    Vels Lotte

    2008-09-01

    Full Text Available Abstract Background Liver plays a profound role in the acute phase response (APR observed in the early phase of acute bovine mastitis caused by Escherichia coli (E. coli. To gain an insight into the genes and pathways involved in hepatic APR of dairy cows we performed a global gene expression analysis of liver tissue sampled at different time points before and after intra-mammary (IM exposure to E. coli lipopolysaccharide (LPS treatment. Results Approximately 20% target transcripts were differentially expressed and eight co-expression clusters were identified. Each cluster had a unique time-dependent expression profile and consisted of genes involved in different biological processes. Our findings suggest that APR in the liver is triggered by the activation of signaling pathways that are involved with common and hepatic-specific transcription factors and pro-inflammatory cytokines. These mediators in turn stimulated or repressed the expression of genes encoding acute phase proteins (APP, collectins, complement components, chemokines, cell adhesion molecules and key metabolic enzymes during the APR. Hormones, anti-inflammatory and other hypothalamus-pituitary-adrenal axis (HPAA linked mediators also seemed to participate in APR. Conclusion Performing global gene expression analysis on liver tissue from IM LPS treated cows verified that the liver plays a major role in the APR of E. coli mastitis, and that the bovine hepatic APR follows the same pattern as other mammals when they are challenged with LPS. Our work presents the first insight into the dynamic changes in gene expression in the liver that influences the induction, kinetics and clinical outcome of the APR in dairy cows.

  19. Gene expression profile of colon cancer cell lines treated with SN-38

    DEFF Research Database (Denmark)

    Wallin, A; Francis, P; Nilbert, M

    2010-01-01

    the incidence in fact has increased. To improve chemotherapy and enable personalised treatment, the need of biomarkers is of great significance. In this study, we evaluated the gene expression profiles of the colon cancer cell lines treated with SN-38, the active metabolite of topoisomerase-1 inhibitor......Colorectal cancer is the third most common form of cancer in the industrial countries. Due to advances regarding the treatments, primarily development of improved surgical methods and the ability to make the earlier diagnosis, the mortality has remained constant during the past decades even though...

  20. Is the Prosthetic Homologue Necessary for Embodiment?

    Science.gov (United States)

    Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

    2016-01-01

    Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

  1. Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

    Science.gov (United States)

    Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

    2012-01-01

    Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

  2. Gene expression profiling in rat liver treated with compounds inducing phospholipidosis

    International Nuclear Information System (INIS)

    Hirode, Mitsuhiro; Ono, Atsushi; Miyagishima, Toshikazu; Nagao, Taku; Ohno, Yasuo; Urushidani, Tetsuro

    2008-01-01

    We have constructed a large-scale transcriptome database of rat liver treated with various drugs. In an effort to identify a biomarker for diagnosis of hepatic phospholipidosis, we extracted 78 probe sets of rat hepatic genes from data of 5 drugs, amiodarone, amitriptyline, clomipramine, imipramine, and ketoconazole, which actually induced this phenotype. Principal component analysis (PCA) using these probes clearly separated dose- and time-dependent clusters of treated groups from their controls. Moreover, 6 drugs (chloramphenicol, chlorpromazine, gentamicin, perhexiline, promethazine, and tamoxifen), which were reported to cause phospholipidosis but judged as negative by histopathological examination, were designated as positive by PCA using these probe sets. Eight drugs (carbon tetrachloride, coumarin, tetracycline, metformin, hydroxyzine, diltiazem, 2-bromoethylamine, and ethionamide), which showed phospholipidosis-like vacuolar formation in the histopathology, could be distinguished from the typical drugs causing phospholipidosis. Moreover, the possible induction of phospholipidosis was predictable by the expression of these genes 24 h after single administration in some of the drugs. We conclude that these identified 78 probe sets could be useful for diagnosis of phospholipidosis, and that toxicogenomics would be a promising approach for prediction of this type of toxicity

  3. Gene expression alterations associated with outcome in aromatase inhibitor-treated ER+ early-stage breast cancer patients

    DEFF Research Database (Denmark)

    Gravgaard Thomsen, Karina Hedelund; Lyng, Maria Bibi; Elias, Daniel

    2015-01-01

    predictive of outcome of ER+ breast cancer patients treated with AIs are needed. Global gene expression analysis was performed on ER+ primary breast cancers from patients treated with adjuvant AI monotherapy; half experienced recurrence (median follow-up 6.7 years). Gene expression alterations were validated...... by qRT-PCR, and functional studies evaluating the effect of siRNA-mediated gene knockdown on cell growth were performed. Twenty-six genes, including TFF3, DACH1, RGS5, and GHR, were shown to exhibit altered expression in tumors from patients with recurrence versus non-recurrent (fold change ≥1.5, p ....05), and the gene expression alterations were confirmed using qRT-PCR. Ten of these 26 genes could be linked in a network associated with cellular proliferation, growth, and development. TFF3, which encodes for trefoil factor 3 and is an estrogen-responsive oncogene shown to play a functional role in tamoxifen...

  4. Identification of valid endogenous control genes for determining gene expression in C6 glioma cell line treated with conditioned medium from adipose-derived stem cell.

    Science.gov (United States)

    Iser, I C; de Campos, R P; Bertoni, A P S; Wink, M R

    2015-10-01

    There is growing evidence that mesenchymal stem cells (MSCs) can be important players in the tumor microenvironment. They can affect the glioma progression through the modulation of different genes. This modulation can be evaluated through a very useful model, treating the tumor cells with MSC-conditioned medium. However, for an accurate and reliable gene expression analysis, normalization of gene expression data against reference genes is a prerequisite. We performed a systematic review in an attempt to find a reference gene to use when analyzing gene expression in C6 glioma cells lines. Considering that we were not able to find a reference gene originated by an appropriate validation, in this study we evaluated candidate genes to be used as reference gene in C6 cells under different treatments with adipose-derived stem cells conditioned medium (CM-ADSCs). β-actin (ACTB); glyceraldehyde-3-phosphate dehydrogenase (GAPDH); hypoxanthine-guanine phosphoribosyltransferase I (HPRT-1); TATA box binding protein (TBP) and beta-2-microglobulin (B2M) were evaluated by real-time reverse transcription PCR (RT-qPCR). The mean Cq, the maximum fold change (MFC) and NormFinder software were used for reference gene evaluation and selection. The GAPDH and ACTB genes have been the most widely used reference genes to normalize among the different investigated genes in our review, however, controversially these genes underwent a substantial variability among the genes evaluated in the present work. Individually, TBP gene was more stable when compared with other genes analyzed and the combination of TBP and HPRT-1 was even more stable. These results evidence the importance of appropriate validation of reference genes before performing qPCR experiments. Besides, our data will contribute with researchers that work analyzing the role of ADSCs in glioma microenvironment through gene expression. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  5. Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas

    Science.gov (United States)

    Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu

    2017-01-01

    Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

  6. Gene expression in SK-Mel-28 human melanoma cells treated with the snake venom jararhagin.

    Science.gov (United States)

    Klein, Anelise; Capitanio, Juliana Silva; Maria, Durvanei Augusto; Ruiz, Itamar Romano Garcia

    2011-01-01

    Alternative approaches to improve the treatment of advanced melanomas are highly needed. The disintegrin domain of metalloproteinases binds integrin receptors on tumor cells, blocking migration, invasion, and metastatization. Previous studies showed that jararhagin, from the Bothrops jararaca snake venom, induces changes in the morphology and viability of SK-Mel-28 human melanoma cells, and decreases the number of metastases in mice injected with pre-treated cells. The purpose of this study was to evaluate the molecular effects of jararhagin on SK-Mel-28 cells and fibroblasts, concerning the expression of integrins, cadherins, caspases, and TP53 genes. Sub-toxic doses of jararhagin were administered to confluent cells. RT-PCR was performed following extraction of total RNA. Jararhagin treatments induced similar morphological alterations in both normal and tumor cells, with higher IC50 values for fibroblasts. Integrin genes were downregulated in untreated cells, except for ITGA6a,b, ITGAv, and ITGB3 which were highly expressed in SK-Mel-28. The integrin expression profiles were not affected by the toxin. However, jararhagin 30ng/μl upregulated genes TP53, CDKN1A, CDKN2A, CASP3, CASP5, CASP6, CASP8, and E-CDH in SK-Mel-28, and genes ITGB6, ITGB7, CASP3, TP53, and CDKN1B in fibroblasts. Appropriate jararhagin concentration can have apoptotic and suppressant effects on SK-Mel-28 cells, rather than on fibroblasts, and can be used to develop potential anti-cancer drugs. Copyright © 2010 Elsevier Ltd. All rights reserved.

  7. [Clinical Significance of ID4 Gene Mehtylation in Demethylation-Treated MDS Cell Line and 2 MDS Patients].

    Science.gov (United States)

    Kang, Hui-Yuan; Wang, Xin-Rong; Gao, Li; Wang, Wei; Li, Mian-Yang; Wang, Li-Li; Wang, Cheng-Bin; Yu, Li

    2015-04-01

    To evaluate significance of ID4 gene mehtylation in demethylating myelodysplastic syndrome(MDS) cell Line MUTZ1 and 2 patients with MDS. The methylation-specific PCR (MS-PCR) and reverse transcription-PCR (RT-PCR) were applied to identify the methylation status and gene expression of ID4 gene in MDS cell line MUTZ1, a patient with aplastic anemia(AA) and a donor with normal bone marrow (NBM). RT-PCR was applied to detect the ID4 gene expression status in MUTZ1 cell line treated with decitabine at 3 different concentrations. Then bisulfite sequencing PCR (BSP) was applied to detect ID4 gene methylation status in 2 MDS parients treated with decitabine. The MDS cell line MUTZ-1 displayed a complete methylation of ID4 gene promoter with little mRNA expression. Inversely, bone marrow of an AA patient and NBM showed complete unmethylation of this gene with intensity mRNA expression. With the increase of decitabine concentration, ID4 gene mRNA expression was more and more increased. After decitabine treatment, ID4 gene methylation-positive frequencies of both the 2 MDS patients were much more decreased than that of the first treatment. So, ID4 gene mRNA expression inhibited by promoter hypemethylation could be recovered by using demethylation medicine. ID4 as a new potential anti-oncogene suggests that its methylation may become a marker for selection and assessment of therapeutic schedules in patients with MDS.

  8. A suicide gene therapy approach to treat epidermolysis bullosa-associated skin cancer

    International Nuclear Information System (INIS)

    Gruber, C.

    2009-01-01

    Recessive dystrophic epidermolysis bullosa (RDEB) is an inherited disease causing extensive blister formation within the basal membrane zone (BMZ) of the skin and mucous membranes. It is caused by premature STOP mutations in the COL7A1 gene, which is indispensable for proper skin assembling. RDEB is associated with the development of a highly malignant skin cancer (squamous cell carcinoma, SCC) in early adulthood that displays a life threatening complication within this patient group. To date, neither chemo- nor radiotherapies showed successful results and due to the high metastatic potential of RDEB SCC wide surgical excision is still favoured. In this study we could reveal a new promising cancer treatment using spliceosome mediated RNA trans-splicing (SMaRT) using a suicide gene therapy approach. First we identified the tumour marker gene MMP-9 expressed by RDEB SCC cells in cell culture which was used to generate various pre-mRNA trans-splicing molecules (PTM). PTMs are able to facilitate trans-splicing between a tumour target gene and a cell death inducing peptide/toxin, encoded by the PTM. As a consequence the toxin is expressed in cancer cells leading to the induction of cell death. This technique offers high specificity in cancer cell targeting compared to other conventional cDNA expression studies. Various trans-splicing molecules were pre-evaluated in a fluorescence screening model for their best trans-splicing efficiency with the target molecule. Herein we identified two potent PTMs (PTM BD0 and PTM BD6), that were further adapted for endogenous suicide studies by inserting the toxin streptolysin O. In two independent in vitro cell culture assays we were able to confirm that the trans-splicing molecules are able to induce expression of the toxin resulting in cell membrane permeabilization and increased cell death induction. The results indicate that SMaRT technology offers a new platform for a suicide gene therapy approach to treat malignant squamous cell

  9. Biofilm processes in treating mariculture wastewater may be a reservoir of antibiotic resistance genes

    International Nuclear Information System (INIS)

    Li, Shuai; Zhang, Shenghua; Ye, Chengsong; Lin, Wenfang; Zhang, Menglu; Chen, Lihua; Li, Jinmei; Yu, Xin

    2017-01-01

    Antibiotics are heavily used in Chinese mariculture, but only a small portion of the added antibiotics are absorbed by living creatures. Biofilm processes are universally used in mariculture wastewater treatment. In this study, removal of antibiotics (norfloxacin, rifampicin, and oxytetracycline) from wastewater by moving bed biofilm reactors (MBBRs) and the influence of antibiotics on reactor biofilm were investigated. The results demonstrated that there was no significant effect of sub-μg/L–sub-mg/L concentrations of antibiotics on TOC removal. Moreover, the relative abundance of antibiotic resistance genes (ARGs) and antibiotic resistance bacteria (ARB) in MBBR biofilm increased because of selective pressure of antibiotics. In addition, antibiotics decreased the diversity of the biofilm bacterial community and altered bacterial community structure. These findings provide an empirical basis for the development of appropriate practices for mariculture, and suggest that disinfection and advanced oxidation should be applied to eliminate antibiotics, ARGs, and ARB from mariculture wastewater. - Highlights: • The removal of antibiotics by Moving Bed Biofilm Reactors (MBBR) was investigated. • Biofilm process such as MBBR had little effect on the removal of the antibiotics. • The antibiotics decreased the diversity of biofilm bacterial community and altered bacterial community structure. • Biofilm processes in treating mariculture wastewater may be a reservoir of antibiotic resistance genes.

  10. A 1-month-old infant with chylomicronemia due to gene mutation treated by plasmapheresis

    Directory of Open Access Journals (Sweden)

    Mo Kyung Jung

    2017-03-01

    Full Text Available Chylomicronemia is a severe type of hypertriglyceridemia characterized by chylomicron accumulation that arises from a genetic defect in intravascular lipolysis. It requires urgent and proper management, because serious cases can be accompanied by pancreatic necrosis or persistent multiple organ failure. We present the case of a 1-month-old infant with chylomicronemia treated by plasmapheresis. His chylomicronemia was discovered incidentally when lactescent plasma was noticed during routine blood sampling during a hospital admission for fever and irritability. Laboratory investigation revealed marked triglyceridemia (>5,000 mg/dL with high chylomicron levels. We therefore decided to perform a therapeutic plasmapheresis to prevent acute pancreatitis. Sequence analysis revealed a homozygous novel mutation in exon 4 of GPIHBP1: c.476delG (p.Gly159Alafs. Glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1 (GPIHBP1 stabilizes the binding of chylomicrons near lipoprotein lipase and supports lipolysis. Mutations of GPIHBP1, the most recently discovered gene, can lead to severe hyperlipidemia and are known to make up only 2% of the monogenic mutations associated with chylomicronemia. The patient maintains mild hypertriglyceridemia without rebound after single plasmapheresis and maintenance fibrate medication so far. Here, we report an infant with chylomicronemia due to GPIHBP1 mutation, successfully treated by plasmapheresis.

  11. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    International Nuclear Information System (INIS)

    Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

    2011-01-01

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

  12. Prognostic impact of carboxylesterase 1 gene variants in patients with congestive heart failure treated with angiotensin-converting enzyme inhibitors

    DEFF Research Database (Denmark)

    Nelveg-Kristensen, Karl E.; Madsen, Majbritt B.; Torp-Pedersen, Christian

    2016-01-01

    OBJECTIVE: Most angiotensin-converting enzyme inhibitors (ACEIs) are prodrugs activated by carboxylesterase 1 (CES1). We investigated the prognostic importance of CES1 gene (CES1) copy number variation and the rs3815583 single-nucleotide polymorphism in CES1 among ACEI-treated patients with conge...

  13. Abundance and distribution of Macrolide-Lincosamide-Streptogramin resistance genes in an anaerobic-aerobic system treating spiramycin production wastewater.

    Science.gov (United States)

    Liu, Miaomiao; Ding, Ran; Zhang, Yu; Gao, Yingxin; Tian, Zhe; Zhang, Tong; Yang, Min

    2014-10-15

    The behaviors of the Macrolide-Lincosamide-Streptogramin (MLS) resistance genes were investigated in an anaerobic-aerobic pilot-scale system treating spiramycin (SPM) production wastewater. After screening fifteen typical MLS resistance genes with different mechanisms using conventional PCR, eight detected genes were determined by quantitative PCR, together with three mobile elements. Aerobic sludge in the pilot system exhibited a total relative abundance of MLS resistance genes (per 16S rRNA gene) 2.5 logs higher than those in control samples collected from sewage and inosine wastewater treatment systems (P resistance genes. However, the total relative gene abundance in anaerobic sludge (4.3 × 10(-1)) was lower than that in aerobic sludge (3.7 × 10(0)) despite of the higher SPM level in anaerobic reactor, showing the advantage of anaerobic treatment in reducing the production of MLS resistance genes. The rRNA methylase genes (erm(B), erm(F), erm(X)) were the most abundant in the aerobic sludge (5.3 × 10(-1)-1.7 × 10(0)), followed by esterase gene ere(A) (1.3 × 10(-1)) and phosphorylase gene mph(B) (5.7 × 10(-2)). In anaerobic sludge, erm(B), erm(F), ere(A), and msr(D) were the major ones (1.2 × 10(-2)-3.2 × 10(-1)). These MLS resistance genes (except for msr(D)) were positively correlated with Class 1 integron (r(2) = 0.74-0.93, P < 0.05), implying the significance of horizontal transfer in their proliferation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  15. TMPRSS2-ERG gene fusion is not associated with outcome in patients treated by prostatectomy

    Science.gov (United States)

    Gopalan, Anuradha; Leversha, Margaret A.; Satagopan, Jaya M.; Zhou, Qin; Al-Ahmadie, Hikmat A.; Fine, Samson W.; Eastham, James A.; Scardino, Peter T.; Scher, Howard I.; Tickoo, Satish K.; Reuter, Victor E.; Gerald, William L.

    2009-01-01

    A significant number of prostate cancers have been shown to have recurrent chromosomal rearrangements resulting in the fusion of the androgen regulated TMPRSS2 promoter to a member of the ETS transcription factor family, most commonly ERG. This results in ERG overexpression which may have a direct causal role in prostate tumorigenesis or progression. However, the clinical significance of the rearrangement is unclear and, in particular, relationship to outcome has been inconsistent in recent reports. We analyzed TMPRSS2-ERG gene rearrangement status by fluorescence in situ hybridization (FISH) in 521 cases of clinically localized surgically treated prostate cancer with 95 months median follow-up and also in 40 unmatched metastases. 42% of primary tumors and 40% of metastases had rearrangements. 11% had copy number increase (CNI) of the TMPRRS2-ERG region. Rearrangement alone was associated with lower grade, but not with stage, biochemical recurrence, metastases or death. CNI with and without rearrangement was associated with high grade and advanced stage. Further, a subgroup of cancers with CNI and rearrangement by deletion, with two or more copies of the deleted locus, tended to be more clinically aggressive. DNA index assessment revealed that the majority of tumors with CNI of TMPRSS2-ERG had generalized aneuploidy/ tetraploidy in contrast to tumors without TMPRSS2-ERG CNI, which were predominantly diploid. We therefore conclude that translocation of TMPRSS2-ERG is not associated with outcome and the aggressive clinical features associated with CNI of chromosome 21 reflect generalized aneuploidy and are not due to CNI specifically of rearranged TMPRSS2-ERG. PMID:19190343

  16. RNA Sequencing Reveals the Alteration of the Expression of Novel Genes in Ethanol-Treated Embryoid Bodies.

    Science.gov (United States)

    Mandal, Chanchal; Kim, Sun Hwa; Chai, Jin Choul; Oh, Seon Mi; Lee, Young Seek; Jung, Kyoung Hwa; Chai, Young Gyu

    2016-01-01

    Fetal alcohol spectrum disorder is a collective term representing fetal abnormalities associated with maternal alcohol consumption. Prenatal alcohol exposure and related anomalies are well characterized, but the molecular mechanism behind this phenomenon is not well characterized. In this present study, our aim is to profile important genes that regulate cellular development during fetal development. Human embryonic carcinoma cells (NCCIT) are cultured to form embryoid bodies and then treated in the presence and absence of ethanol (50 mM). We employed RNA sequencing to profile differentially expressed genes in the ethanol-treated embryoid bodies from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH data sets. A total of 632, 205 and 517 differentially expressed genes were identified from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH, respectively. Functional annotation using bioinformatics tools reveal significant enrichment of differential cellular development and developmental disorders. Furthermore, a group of 42, 15 and 35 transcription factor-encoding genes are screened from all of the differentially expressed genes obtained from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH, respectively. We validated relative gene expression levels of several transcription factors from these lists by quantitative real-time PCR. We hope that our study substantially contributes to the understanding of the molecular mechanism underlying the pathology of alcohol-mediated anomalies and ease further research.

  17. Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity.

    Science.gov (United States)

    Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J

    2017-04-01

    Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)

    NEPOMUCENO ALEXANDRE LIMA

    2000-01-01

    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  19. Early gene expression profiles of patients with chronic hepatitis C treated with pegylated interferon-alfa and ribavirin.

    Science.gov (United States)

    Younossi, Zobair M; Baranova, Ancha; Afendy, Arian; Collantes, Rochelle; Stepanova, Maria; Manyam, Ganiraju; Bakshi, Anita; Sigua, Christopher L; Chan, Joanne P; Iverson, Ayuko A; Santini, Christopher D; Chang, Sheng-Yung P

    2009-03-01

    Responsiveness to hepatitis C virus (HCV) therapy depends on viral and host factors. Our aim was to assess sustained virologic response (SVR)-associated early gene expression in patients with HCV receiving pegylated interferon-alpha2a (PEG-IFN-alpha2a) or PEG-IFN-alpha2b and ribavirin with the duration based on genotypes. Blood samples were collected into PAXgene tubes prior to treatment as well as 1, 7, 28, and 56 days after treatment. From the peripheral blood cells, total RNA was extracted, quantified, and used for one-step reverse transcription polymerase chain reaction to profile 154 messenger RNAs. Expression levels of messenger RNAs were normalized with six "housekeeping" genes and a reference RNA. Multiple regression and stepwise selection were performed to assess differences in gene expression at different time points, and predictive performance was evaluated for each model. A total of 68 patients were enrolled in the study and treated with combination therapy. The results of gene expression showed that SVR could be predicted by the gene expression of signal transducer and activator of transcription-6 (STAT-6) and suppressor of cytokine signaling-1 in the pretreatment samples. After 24 hours, SVR was predicted by the expression of interferon-dependent genes, and this dependence continued to be prominent throughout the treatment. Early gene expression during anti-HCV therapy may elucidate important molecular pathways that may be influencing the probability of achieving virologic response.

  20. Altered Gene Transcription in Human Cells Treated with Ludox® Silica Nanoparticles

    Directory of Open Access Journals (Sweden)

    Caterina Fede

    2014-08-01

    Full Text Available Silica (SiO2 nanoparticles (NPs have found extensive applications in industrial manufacturing, biomedical and biotechnological fields. Therefore, the increasing exposure to such ultrafine particles requires studies to characterize their potential cytotoxic effects in order to provide exhaustive information to assess the impact of nanomaterials on human health. The understanding of the biological processes involved in the development and maintenance of a variety of pathologies is improved by genome-wide approaches, and in this context, gene set analysis has emerged as a fundamental tool for the interpretation of the results. In this work we show how the use of a combination of gene-by-gene and gene set analyses can enhance the interpretation of results of in vitro treatment of A549 cells with Ludox® colloidal amorphous silica nanoparticles. By gene-by-gene and gene set analyses, we evidenced a specific cell response in relation to NPs size and elapsed time after treatment, with the smaller NPs (SM30 having higher impact on inflammatory and apoptosis processes than the bigger ones. Apoptotic process appeared to be activated by the up-regulation of the initiator genes TNFa and IL1b and by ATM. Moreover, our analyses evidenced that cell treatment with LudoxÒ silica nanoparticles activated the matrix metalloproteinase genes MMP1, MMP10 and MMP9. The information derived from this study can be informative about the cytotoxicity of Ludox® and other similar colloidal amorphous silica NPs prepared by solution processes.

  1. Removal of bacterial cells, antibiotic resistance genes and integrase genes by on-site hospital wastewater treatment plants: surveillance of treated hospital effluent quality

    KAUST Repository

    Timraz, Kenda Hussain Hassan

    2016-12-15

    This study aims to evaluate the removal efficiency of microbial contaminants, including total cell counts, antibiotic-resistant bacteria (ARB), antibiotic resistance genes (ARGs, e.g. tetO, tetZ, sul1 and sul2) and integrase genes (e.g. intl1 and intl2), by wastewater treatment plants (WWTPs) operated on-site of two hospitals (i.e., SH WWTP and IH WWTP). Both SH and IH WWTPs utilize the conventional activated sludge process but differences in the removal efficiencies were observed. Over the 2 week sampling period, IH WWTP outperformed SH WWTP, and achieved an approximate 0.388 to 2.49-log log removal values (LRVs) for total cell counts compared to the 0.010 to 0.162-log removal in SH WWTP. Although ARB were present in the hospital influent, the treatment process of both hospitals effectively removed ARB from most of the effluent samples. In instances where ARB were recovered in the effluent, none of the viable isolates were identified to be opportunistic pathogenic species based on 16S rRNA gene sequencing. However, sul1 and intl1 genes remained detectable at up to 105 copies per mL or 8 x 10(-1) copies per 16S rRNA gene in the treated effluent, with an LRV of less than 1.2. When the treated effluent is discharged from hospital WWTPs into the public sewer for further treatment as per requirement in many countries, the detected amount of ARGs and integrase genes in the hospital effluent can become a potential source of horizontal gene dissemination in the municipal WWTP. Proper on-site wastewater treatment and surveillance of the effluent quality for emerging contaminants are therefore highly recommended.

  2. CAR expression and inducibility of CYP2B genes in liver of rats treated with PB-like inducers

    International Nuclear Information System (INIS)

    Pustylnyak, Vladimir O.; Gulyaeva, Lyudmila F.; Lyakhovich, Vyacheslav V.

    2005-01-01

    The expression of the CAR gene and inducibility of CYP2B protein in the liver of male Wistar rats treated with phenobarbital (PB) and triphenyldioxane (TPD) were investigated. To clarify the role of phosphorylation/dephosphorylation in these processes, rats were treated with inhibitors of Ca 2+ /calmodulin-dependent kinase II (W 7 ) or protein phosphatases PP1 and PP2A (OA) before induction. Constitutive expression of the CAR gene in livers of untreated rats was detected by multiplex RT-PCR. Treatment with W 7 resulted in a 2.8-fold induction of CAR gene expression, whereas OA led to a 2.4-fold decrease of the mRNA level. The same results were obtained for CYP2B genes expression, which were increased by W 7 treatment (two-fold) and decreased by OA (2.3-fold). PB-induction did not lead to significant alteration in the level of CAR gene expression, although CYP2B genes expression was enhanced two-fold over control values. TPD caused a two-fold increase of both CAR and CYP2B mRNA levels. Both inducers reduced the effects of inhibitors on CAR gene expression. Results of EMSA showed that PB, TPD or W 7 alone induced formation of complexes of NR1 with nuclear proteins. Appearance of the complexes correlated with an increase in CYP2B expression, and their intensities were modulated by the protein kinase inhibitors. Thus, our results demonstrate that constitutive expressions of CAR as well as CYP2B during induction are regulated by phosphorylation/dephosphorylation processes

  3. Gene expression profile change and growth inhibition in Drosophila larvae treated with azadirachtin.

    Science.gov (United States)

    Lai, Duo; Jin, Xiaoyong; Wang, Hao; Yuan, Mei; Xu, Hanhong

    2014-09-20

    Azadirachtin is a botanical insecticide that affects various biological processes. The effects of azadirachtin on the digital gene expression profile and growth inhibition in Drosophila larvae have not been investigated. In this study, we applied high-throughput sequencing technology to detect the differentially expressed genes of Drosophila larvae regulated by azadirachtin. A total of 15,322 genes were detected, and 28 genes were found to be significantly regulated by azadirachtin. Biological process and pathway analysis showed that azadirachtin affected starch and sucrose metabolism, defense response, signal transduction, instar larval or pupal development, and chemosensory behavior processes. The genes regulated by azadirachtin were mainly enriched in starch and sucrose metabolism. This study provided a general digital gene expression profile of dysregulated genes in response to azadirachtin and showed that azadirachtin provoked potent growth inhibitory effects in Drosophila larvae by regulating the genes of cuticular protein, amylase, and odorant-binding protein. Finally, we propose a potential mechanism underlying the dysregulation of the insulin/insulin-like growth factor signaling pathway by azadirachtin. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes

    Science.gov (United States)

    Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil

    2012-01-01

    Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

  5. Increased Abundance and Transferability of Resistance Genes after Field Application of Manure from Sulfadiazine-Treated Pigs

    Science.gov (United States)

    Jechalke, Sven; Kopmann, Christoph; Rosendahl, Ingrid; Groeneweg, Joost; Weichelt, Viola; Krögerrecklenfort, Ellen; Brandes, Nikola; Nordwig, Mathias; Ding, Guo-Chun; Siemens, Jan; Heuer, Holger

    2013-01-01

    Spreading manure containing antibiotics in agriculture is assumed to stimulate the dissemination of antibiotic resistance in soil bacterial populations. Plant roots influencing the soil environment and its microflora by exudation of growth substrates might considerably increase this effect. In this study, the effects of manure from pigs treated with sulfadiazine (SDZ), here called SDZ manure, on the abundance and transferability of sulfonamide resistance genes sul1 and sul2 in the rhizosphere of maize and grass were compared to the effects in bulk soil in a field experiment. In plots that repeatedly received SDZ manure, a significantly higher abundance of both sul genes was detected compared to that in plots where manure from untreated pigs was applied. Significantly lower abundances of sul genes relative to bacterial ribosomal genes were encountered in the rhizosphere than in bulk soil. However, in contrast to results for bulk soil, the sul gene abundance in the SDZ manure-treated rhizosphere constantly deviated from control treatments over a period of 6 weeks after manuring, suggesting ongoing antibiotic selection over this period. Transferability of sulfonamide resistance was analyzed by capturing resistance plasmids from soil communities into Escherichia coli. Increased rates of plasmid capture were observed in samples from SDZ manure-treated bulk soil and the rhizosphere of maize and grass. More than 97% of the captured plasmids belonged to the LowGC type (having low G+C content), giving further evidence for their important contribution to the environmental spread of antibiotic resistance. In conclusion, differences between bulk soil and rhizosphere need to be considered when assessing the risks associated with the spreading of antibiotic resistance. PMID:23315733

  6. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H

    2010-01-01

    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  7. Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

    Energy Technology Data Exchange (ETDEWEB)

    Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)

    2007-02-15

    Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

  8. Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

    International Nuclear Information System (INIS)

    Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying

    2007-01-01

    Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

  9. Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.

    Science.gov (United States)

    Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain

    2015-03-01

    NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

  10. Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

    Science.gov (United States)

    Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

    2013-09-15

    Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Microarray analysis of the gene expression profile in triethylene glycol dimethacrylate-treated human dental pulp cells.

    Science.gov (United States)

    Torun, D; Torun, Z Ö; Demirkaya, K; Sarper, M; Elçi, M P; Avcu, F

    2017-11-01

    Triethylene glycol dimethacrylate (TEGDMA) is an important resin monomer commonly used in the structure of dental restorative materials. Recent studies have shown that unpolymerized resin monomers may be released into the oral environment and cause harmful biological effects. We investigated changes in the gene expression profiles of TEGDMA-treated human dental pulp cells (hDPCs) following short- (1-day) and long-term (7-days) exposure. HDPCs were exposed to a noncytotoxic concentration of TEGDMA, and gene expression profiles were evaluated by microarray analysis. The results were confirmed by quantitative reverse-transcriptase PCR (qRT PCR). In total, 1282 and 1319 genes (up- or down-regulated) were differentially expressed compared with control group after the 1- and 7-day incubation periods, respectively. Biological ontology-based analyses revealed that metabolic, cellular, and developmental processes constituted the largest groups of biological functional processes. qRT-PCR analysis on bone morphogenetic protein-2 (BMP-2), BMP-4, secreted protein, acidic, cysteine-rich, collagen type I alpha 1, oxidative stress-induced growth inhibitor 1, MMP3, interleukin-6, and heme oxygenase-1 genes confirmed the changes in expression observed in the microarray analysis. Our results suggest that TEGDMA can change the many functions of hDPCs through large changes in gene expression levels and complex interactions with different signaling pathways.

  12. Evaluation of Gene Therapy as an Intervention Strategy to Treat Brain Injury from Stroke

    Directory of Open Access Journals (Sweden)

    Amanda J Craig

    2016-05-01

    Full Text Available Stroke is a leading cause of death and disability, with a lack of treatments available to prevent cell death, regenerate damaged cells and pathways, or promote neurogenesis. The extended period of hours to weeks over which tissue damage continues to occur makes this disorder a candidate for gene therapy. This review highlights the development of gene therapy in the area of stroke, with the evolution of viral administration, in experimental stroke models, from pre-injury to clinically relevant timeframes of hours to days post-stroke. The putative therapeutic proteins being examined include anti-apoptotic, pro-survival, anti-inflammatory, and guidance proteins, targeting multiple pathways within the complex pathology, with promising results. The balance of findings from animal models suggests that gene therapy provides a viable translational platform for treatment of ischaemic brain injury arising from stroke.

  13. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M

    2008-01-01

    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  14. Potential mechanisms for cell-based gene therapy to treat HIV/AIDS.

    Science.gov (United States)

    Herrera-Carrillo, Elena; Berkhout, Ben

    2015-02-01

    An estimated 35 million people are infected with HIV worldwide. Anti-retroviral therapy (ART) has reduced the morbidity and mortality of HIV-infected patients but efficacy requires strict adherence and the treatment is not curative. Most importantly, the emergence of drug-resistant virus strains and drug toxicity can restrict the long-term therapeutic efficacy in some patients. Therefore, novel treatment strategies that permanently control or eliminate the virus and restore the damaged immune system are required. Gene therapy against HIV infection has been the topic of intense investigations for the last two decades because it can theoretically provide such a durable anti-HIV control. In this review we discuss two major gene therapy strategies to combat HIV. One approach aims to kill HIV-infected cells and the other is based on the protection of cells from HIV infection. We discuss the underlying molecular mechanisms for candidate approaches to permanently block HIV infection, including the latest strategies and future therapeutic applications. Hematopoietic stem cell-based gene therapy for HIV/AIDS may eventually become an alternative for standard ART and should ideally provide a functional cure in which the virus is durably controlled without medication. Recent results from preclinical research and early-stage clinical trials support the feasibility and safety of this novel strategy.

  15. Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

    Science.gov (United States)

    Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

    2002-12-01

    The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

  16. RNA-seq methods for identifying differentially expressed gene in human pancreatic islet cells treated with pro-inflammatory cytokines.

    Science.gov (United States)

    Li, Bo; Bi, Chang Long; Lang, Ning; Li, Yu Ze; Xu, Chao; Zhang, Ying Qi; Zhai, Ai Xia; Cheng, Zhi Feng

    2014-01-01

    Type 1 diabetes is a chronic autoimmune disease in which pancreatic beta cells are killed by the infiltrating immune cells as well as the cytokines released by these cells. Many studies indicate that inflammatory mediators have an essential role in this disease. In the present study, we profiled the transcriptome in human islets of langerhans under control conditions or following exposure to the pro-inflammatory cytokines based on the RNA sequencing dataset downloaded from SRA database. After filtered the low-quality ones, the RNA readers was aligned to human genome hg19 by TopHat and then assembled by Cufflinks. The expression value of each transcript was calculated and consequently differentially expressed genes were screened out. Finally, a total of 63 differentially expressed genes were identified including 60 up-regulated and three down-regulated genes. GBP5 and CXCL9 stood out as the top two most up-regulated genes in cytokines treated samples with the log2 fold change of 12.208 and 10.901, respectively. Meanwhile, PTF1A and REG3G were identified as the top two most down-regulated genes with the log2 fold change of -3.759 and -3.606, respectively. Of note, we also found 262 lncRNAs (long non-coding RNA), 177 of which were inferred as novel lncRNAs. Further in-depth follow-up analysis of the transcriptional regulation reported in this study may shed light on the specific function of these lncRNA.

  17. Gene activation of heavy ion treated bacillus subtilis 168 endospores during germination involved DNA-repair

    International Nuclear Information System (INIS)

    Moeller, R.; Berger, T.; Reitz, G.; Okayasu, Ryuichi

    2006-01-01

    This research project is aimed at correlating radiation effects induced DNA damage in Bacillus subtilis endospores with the linear energy transfer (LET) of the used radiation by investigating survival and gene activation after irradiation with high-LET particles. During the stationary growth phase Bacillus subtilis change their metabolic active state from the vegetative cells to the metabolic inactive but even more resistant endospores. If spores find optimal conditions, they could germinate and switch to the vegetative growth. With these outgrowth spores can and/or must repair the induced formed DNA damage. During germination spores lose their most resistance. In more detail, DNA repair and mutation induction events investigated will include the survivability, behaviour against specific antibiotics and their germination. DNA repair pattern will be detected during germination by using DNA microarrays, which contain the whole genome of Bacillus subtilis 168. (author)

  18. Multi-parametric MRI at 14T for muscular dystrophy mice treated with AAV vector-mediated gene therapy.

    Directory of Open Access Journals (Sweden)

    Joshua Park

    Full Text Available The objective of this study was to investigate the efficacy of using quantitative magnetic resonance imaging (MRI as a non-invasive tool for the monitoring of gene therapy for muscular dystrophy. The clinical investigations for this family of diseases often involve surgical biopsy which limits the amount of information that can be obtained due to the invasive nature of the procedure. Thus, other non-invasive tools may provide more opportunities for disease assessment and treatment responses. In order to explore this, dystrophic mdx4cv mice were systemically treated with a recombinant adeno-associated viral (AAV vector containing a codon-optimized micro-dystrophin gene. Multi-parametric MRI of T2, magnetization transfer, and diffusion effects alongside 3-D volume measurements were then utilized to monitor disease/treatment progression. Mice were imaged at 10 weeks of age for pre-treatment, then again post-treatment at 8, 16, and 24 week time points. The efficacy of treatment was assessed by physiological assays for improvements in function and quantification of expression. Tissues from the hindlimbs were collected for histological analysis after the final time point for comparison with MRI results. We found that introduction of the micro-dystrophin gene restored some aspects of normal muscle histology and pathology such as decreased necrosis and resistance to contraction-induced injury. T2 relaxation values showed percentage decreases across all muscle types measured (tibialis anterior, gastrocnemius, and soleus when treated groups were compared to untreated groups. Additionally, the differences between groups were statistically significant for the tibialis anterior as well. The diffusion measurements showed a wider range of percentage changes and less statistical significance while the magnetization transfer effect measurements showed minimal change. MR images displayed hyper-intense regions of muscle that correlated with muscle pathology in

  19. Identification of differential gene expression in in vitro FSH treated pig granulosa cells using suppression subtractive hybridization

    Directory of Open Access Journals (Sweden)

    Tosser-Klopp G

    2006-07-01

    Full Text Available Abstract FSH, which binds to specific receptors on granulosa cells in mammals, plays a key role in folliculogenesis. Its biological activity involves stimulation of intercellular communication and upregulation of steroidogenesis, but the entire spectrum of the genes regulated by FSH has yet to be fully characterized. In order to find new regulated transcripts, however rare, we have used a Suppression Subtractive Hybridization approach (SSH on pig granulosa cells in primary culture treated or not with FSH. Two SSH libraries were generated and 76 clones were sequenced after selection by differential screening. Sixty four different sequences were identified, including 3 novel sequences. Experiments demonstrated the presence of 25 regulated transcripts. A gene ontology analysis of these 25 genes revealed (1 catalytic; (2 transport; (3 signal transducer; (4 binding; (5 anti-oxidant and (6 structural activities. These findings may deepen our understanding of FSH's effects. Particularly, they suggest that FSH is involved in the modulation of peroxidase activity and remodelling of chromatin.

  20. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  1. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  2. RNA-Seq profiling reveals novel hepatic gene expression pattern in aflatoxin B1 treated rats.

    Directory of Open Access Journals (Sweden)

    B Alex Merrick

    Full Text Available Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1, a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG than microarray analysis, including low copy and novel transcripts related to AFB1's carcinogenic activity compared to feed controls (CTRL. Paired-end reads were mapped to the rat genome (Rn4 with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005 compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT's on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c

  3. RNA-Seq profiling reveals novel hepatic gene expression pattern in aflatoxin B1 treated rats.

    Science.gov (United States)

    Merrick, B Alex; Phadke, Dhiral P; Auerbach, Scott S; Mav, Deepak; Stiegelmeyer, Suzy M; Shah, Ruchir R; Tice, Raymond R

    2013-01-01

    Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1), a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG) than microarray analysis, including low copy and novel transcripts related to AFB1's carcinogenic activity compared to feed controls (CTRL). Paired-end reads were mapped to the rat genome (Rn4) with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005) compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT's) on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c. We find the

  4. A Biotin Biosynthesis Gene Restricted to Helicobacter

    Science.gov (United States)

    Bi, Hongkai; Zhu, Lei; Jia, Jia; Cronan, John E.

    2016-01-01

    In most bacteria the last step in synthesis of the pimelate moiety of biotin is cleavage of the ester bond of pimeloyl-acyl carrier protein (ACP) methyl ester. The paradigm cleavage enzyme is Escherichia coli BioH which together with the BioC methyltransferase allows synthesis of the pimelate moiety by a modified fatty acid biosynthetic pathway. Analyses of the extant bacterial genomes showed that bioH is absent from many bioC-containing bacteria and is replaced by other genes. Helicobacter pylori lacks a gene encoding a homologue of the known pimeloyl-ACP methyl ester cleavage enzymes suggesting that it encodes a novel enzyme that cleaves this intermediate. We isolated the H. pylori gene encoding this enzyme, bioV, by complementation of an E. coli bioH deletion strain. Purified BioV cleaved the physiological substrate, pimeloyl-ACP methyl ester to pimeloyl-ACP by use of a catalytic triad, each member of which was essential for activity. The role of BioV in biotin biosynthesis was demonstrated using a reconstituted in vitro desthiobiotin synthesis system. BioV homologues seem the sole pimeloyl-ACP methyl ester esterase present in the Helicobacter species and their occurrence only in H. pylori and close relatives provide a target for development of drugs to specifically treat Helicobacter infections. PMID:26868423

  5. Application of a cDNA microarray for profiling the gene expression of Echinococcus granulosus protoscoleces treated with albendazole and artemisinin.

    Science.gov (United States)

    Lü, Guodong; Zhang, Wenbao; Wang, Jianhua; Xiao, Yunfeng; Zhao, Jun; Zhao, Jianqin; Sun, Yimin; Zhang, Chuanshan; Wang, Junhua; Lin, Renyong; Liu, Hui; Zhang, Fuchun; Wen, Hao

    2014-12-01

    Cystic echinoccocosis (CE) is a neglected zoonosis that is caused by the dog-tapeworm Echinococcus granulosus. The disease is endemic worldwide. There is an urgent need for searching effective drug for the treatment of the disease. In this study, we sequenced a cDNA library constructed using RNA isolated from oncospheres, protoscoleces, cyst membrane and adult worms of E. granulosus. A total of 9065 non-redundant or unique sequences were obtained and spotted on chips as uniEST probes to profile the gene expression in protoscoleces of E. granulosus treated with the anthelmintic drugs albendazole and artemisinin, respectively. The results showed that 7 genes were up-regulated and 38 genes were down-regulated in the protoscoleces treated with albendazole. Gene analysis showed that these genes are responsible for energy metabolism, cell cycle and assembly of cell structure. We also identified 100 genes up-regulated and 6 genes down-regulated in the protoscoleces treated with artemisinin. These genes play roles in the transduction of environmental signals, and metabolism. Albendazole appeared its drug efficacy in damaging cell structure, while artemisinin was observed to increase the formation of the heterochromatin in protoscolex cells. Our results highlight the utility of using cDNA microarray methods to detect gene expression profiles of E. granulosus and, in particular, to understand the pharmacologic mechanism of anti-echinococcosis drugs. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Epidermal growth factor receptor gene copy number in 101 advanced colorectal cancer patients treated with chemotherapy plus cetuximab

    Directory of Open Access Journals (Sweden)

    Zeuli Massimo

    2010-04-01

    Full Text Available Abstract Background Responsiveness to Cetuximab alone can be mediated by an increase of Epidermal Growth factor Receptor (EGFR Gene Copy Number (GCN. Aim of this study was to assess the role of EGFR-GCN in advanced colorectal cancer (CRC patients receiving chemotherapy plus Cetuximab. Methods One hundred and one advanced CRC patients (43 untreated- and 58 pre-treated were retrospectively studied by fluorescence in situ hybridization (FISH to assess EGFR-GCN and by immunohistochemistry (IHC to determine EGFR expression. Sixty-one out of 101 patients were evaluated also for k-ras status by direct sequencing. Clinical end-points were response rate (RR, progression-free survival (PFS and overall survival (OS. Results Increased EGFR-GCN was found in 60/101 (59% tumor samples. There was no correlation between intensity of EGFR-IHC and EGFR-GCN (p = 0.43. Patients receiving chemotherapy plus Cetuximab as first line treatment had a RR of 70% (30/43 while it was 18% (10/56 in the group with previous lines of therapy (p Conclusion In metastatic CRC patients treated with chemotherapy plus Cetuximab number of chemotherapy lines and increased EGFR-GCN were significantly associated with a better clinical outcome, independent of k-ras status.

  7. Development of the Zebra Danio Model: Carcinogenesis and Gene Transfer Studies

    Science.gov (United States)

    1996-09-01

    Volhard, C. (1992). The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of...protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo

  8. Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

    DEFF Research Database (Denmark)

    Koch, Birgit; Nybroe, Ole

    2006-01-01

    A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

  9. Polymorphisms of homologous recombination genes and clinical outcomes of non-small cell lung cancer patients treated with definitive radiotherapy.

    Directory of Open Access Journals (Sweden)

    Ming Yin

    Full Text Available The repair of DNA double-strand breaks (DSBs is the major mechanism to maintain genomic stability in response to irradiation. We hypothesized that genetic polymorphisms in DSB repair genes may affect clinical outcomes among non-small cell lung cancer (NSCLC patients treated with definitive radio(chemotherapy. We genotyped six potentially functional single nucleotide polymorphisms (SNPs (i.e., RAD51 -135G>C/rs1801320 and -172G>T/rs1801321, XRCC2 4234G>C/rs3218384 and R188H/rs3218536 G>A, XRCC3 T241M/rs861539 and NBN E185Q/rs1805794 and estimated their associations with overall survival (OS and radiation pneumonitis (RP in 228 NSCLC patients. We found a predictive role of RAD51 -135G>C SNP in RP development (adjusted hazard ratio [HR] = 0.52, 95% confidence interval [CI], 0.31-0.86, P = 0.010 for CG/CC vs. GG. We also found that RAD51 -135G>C and XRCC2 R188H SNPs were independent prognostic factors for overall survival (adjusted HR = 1.70, 95% CI, 1.14-2.62, P = 0.009 for CG/CC vs. GG; and adjusted HR = 1.70; 95% CI, 1.02-2.85, P = 0.043 for AG vs. GG, respectively and that the SNP-survival association was most pronounced in the presence of RP. Our study suggests that HR genetic polymorphisms, particularly RAD51 -135G>C, may influence overall survival and radiation pneumonitis in NSCLC patients treated with definitive radio(chemotherapy. Large studies are needed to confirm our findings.

  10. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

    Science.gov (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

    2017-10-01

    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Changes in diapause related gene expression pattern during early embryonic development in HCl-treated eggs of bivoltine silkworm Bombyx mori (Lepidoptera: Bombycidae

    Directory of Open Access Journals (Sweden)

    Sirigineedi Sasibhushan

    2013-02-01

    Full Text Available Investigation of differential expression of diapause related genes (five metabolic, five heat shock protein and one translational regulatory in HCl-treated (non-diapause and untreated (diapause eggs of B. mori during early embryogenesis (up to 48h following oviposition revealed the up-regulation of sorbitol dehydrogenase upon HCl treatment, indicating increased glycogen synthesis for further embryonic development but, down-regulation of phosphofructo kinase gene expression after 18h of oviposition indicating an arrest of glycerol and sorbitol conversion. The expression of poly A binding protein gene expression was higher upon HCl treatment, revealing the initiation of translation. The expression levels of other genes analyzed did not vary significantly, except for Hsp90 and Hsp40, which were up-regulated on acid treatment until 18h. Thus, Sorbitoldehydrogenase and phosphofructo kinasegenes have a crucial role in diapause termination as evidenced by HCl treatment, while the other genes did not have major roles.

  12. Identification of valid reference genes for the normalization of RT-qPCR expression studies in human breast cancer cell lines treated with and without transient transfection.

    Directory of Open Access Journals (Sweden)

    Lin-Lin Liu

    Full Text Available Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is a powerful technique for examining gene expression changes during tumorigenesis. Target gene expression is generally normalized by a stably expressed endogenous reference gene; however, reference gene expression may differ among tissues under various circumstances. Because no valid reference genes have been documented for human breast cancer cell lines containing different cancer subtypes treated with transient transfection, we identified appropriate and reliable reference genes from thirteen candidates in a panel of 10 normal and cancerous human breast cell lines under experimental conditions with/without transfection treatments with two transfection reagents. Reference gene expression stability was calculated using four algorithms (geNorm, NormFinder, BestKeeper and comparative delta Ct, and the recommended comprehensive ranking was provided using geometric means of the ranking values using the RefFinder tool. GeNorm analysis revealed that two reference genes should be sufficient for all cases in this study. A stability analysis suggests that 18S rRNA-ACTB is the best reference gene combination across all cell lines; ACTB-GAPDH is best for basal breast cancer cell lines; and HSPCB-ACTB is best for ER+ breast cancer cells. After transfection, the stability ranking of the reference gene fluctuated, especially with Lipofectamine 2000 transfection reagent in two subtypes of basal and ER+ breast cell lines. Comparisons of relative target gene (HER2 expression revealed different expressional patterns depending on the reference genes used for normalization. We suggest that identifying the most stable and suitable reference genes is critical for studying specific cell lines under certain circumstances.

  13. The Escherichia coli K-12 gntP gene allows E. coli F-18 to occupy a distinct nutritional niche in the streptomycin-treated mouse large intestine

    DEFF Research Database (Denmark)

    Sweeney, N.J.; Klemm, Per; McCormick, Beth A.

    1996-01-01

    Escherichia coli F-18 is a human fecal isolate that makes type 1 fimbriae, encoded by the fim gene cluster, and is an excellent colonizer of the streptomycin-treated mouse intestine. E. coli F-18 fimA::tet, lacking type 1 fimbriae, was constructed by bacteriophage P1 transduction of the fim regio...

  14. Nucleoside Analog-treated Chronic Hepatitis B Patients showed Reduced Expression of PECAM-1 Gene in Peripheral Blood Mononuclear Cells in Bangladesh

    Science.gov (United States)

    Tabassum, Shahina; Ullah Munshi, Saif; Hossain, Marufa; Imam, Akhter

    2014-01-01

    ABSTRACT Background and aim Assessment of therapeutic response is important for monitoring the prognosis and to take decision for cessation of nucleoside analogues therapy in chronic hepatitis B patients. In addition to serum alanine aminotransferase (ALT), hepatitis B virus (HBV) deoxyribonucleic acid (DNA) load and HBeAg status, identification of molecular markers associated with host immune response would be essential to assess therapeutic response. In this regard the current study was performed with the aim to detect expression of platelet endothelial cell adhesion molecule (PECAM)-I gene in peripheral blood monocytes (PBMCs) of treated chronic hepatitis B patients and also to correlate expression of this gene with serum HBV DNA load and serum ALT levels. Materials and methods The study analyzed 60 chronic hepatitis B (CHB) patients, including 30 untreated and 30 nucleoside analogs treated and 10 healthy controls. PECAM-1 gene expression/ transcripts were detected by conventional RT-PCR. Results The expression PECAM-1 mRNA in the PBMCs of CHB patients was significantly higher in untreated (3.17 ± 0.75) than the treated patients (1.64 ± 0.29) (p Tabassum S, Munshi SU, Hossain M, Imam A. Nucleoside Analog-treated Chronic Hepatitis B Patients showed Reduced Expression of PECAM-1 Gene in Peripheral Blood Mononuclear Cells in Bangladesh. Euroasian J Hepato-Gastroenterol 2014;4(2):87-91. PMID:29699354

  15. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    Energy Technology Data Exchange (ETDEWEB)

    Singh,S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

  16. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    International Nuclear Information System (INIS)

    Singh, S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  17. Glucocorticoid Receptor Hetero-Complex Gene STIP1 Is Associated with Improved Lung Function in Asthmatics Treated with Inhaled Corticosteroids

    Science.gov (United States)

    Hawkins, Gregory A.; Lazarus, Ross; Smith, Richard S.; Tantisira, Kelan G.; Meyers, Deborah A.; Peters, Stephen P.; Weiss, Scott T.; Bleecker, Eugene R.

    2015-01-01

    Background Corticosteroids exert their anti-inflammatory action by binding and activating the intracellular the glucocorticoid receptor (GR) hetero-complex. Objective Evaluate the genes HSPCB, HSPCA, STIP1, HSPA8, DNAJB1, PTGES3, FKBP5, and FKBP4 on corticosteroid response. Methods Caucasian asthmatics (382) randomized to once daily flunisolide or conventional inhaled corticosteroid therapy were genotyped. Outcome measures were baseline FEV1, % predicted FEV1, and % change in FEV1 after corticosteroid treatment. Multivariable analyses adjusted for age, gender, and height, were performed fitting the most appropriate genetic model based on quantitative mean derived from ANOVA models to determine if there was an independent effect of polymorphisms on change in FEV1 independent of baseline level. Results Positive recessive model correlations for STIP1 SNPs were observed for baseline FEV1 [rs4980524, p=0.009; rs6591838, p=0.0045; rs2236647, p=0.002; and rs2236648; p=0.013], baseline % predicted FEV1 [rs4980524, p=0.002; rs6591838, p=0.017; rs2236647, p=0.003; and rs2236648; p=0.008] ; % change in FEV1 at 4 weeks [rs4980524, p=0.044; rs6591838, p=0.016; rs2236647; p=0.01] and 8 weeks therapy [rs4980524, p=0.044; rs6591838, p=0.016; rs2236647; p=0.01]. Haplotypic associations were observed for baseline FEV1 and % change in FEV1 at 4 weeks therapy [p=0.05 and p=0.01, respectively]. Significant trends towards association were observed for baseline % predicted FEV1 and % change in FEV1 at 8 weeks therapy. Positive correlations between haplotypes and % change in FEV1 were also observed. Conclusions STIP1 genetic variations may play a role in regulating corticosteroid response in asthmatics with reduced lung function. Replication in a second asthma population is required to confirm these observations. Clinical Implications Identifying genes that regulate corticosteroid responses could allow a priori determination of individual responses to corticosteroid therapy, leading to

  18. CD48-deficient T-lymphocytes from DMBA-treated rats have de novo mutations in the endogenous Pig-a gene.

    Science.gov (United States)

    Dobrovolsky, Vasily N; Revollo, Javier; Pearce, Mason G; Pacheco-Martinez, M Monserrat; Lin, Haixia

    2015-10-01

    A major question concerning the scientific and regulatory acceptance of the rodent red blood cell-based Pig-a gene mutation assay is the extent to which mutants identified by their phenotype in the assay are caused by mutations in the Pig-a gene. In this study, we identified T-lymphocytes deficient for the glycosylphosphatidylinositol-anchored surface marker, CD48, in control and 7,12-dimethylbenz[a]anthracene (DMBA)-treated rats using a flow cytometric assay and determined the spectra of mutations in the endogenous Pig-a gene in these cells. CD48-deficient T-cells were seeded by sorting at one cell per well into 96-well plates, expanded into clones, and exons of their genomic Pig-a were sequenced. The majority (78%) of CD48-deficient T-cell clones from DMBA-treated rats had mutations in the Pig-a gene. The spectrum of DMBA-induced Pig-a mutations was dominated by mutations at A:T, with the mutated A being on the nontranscribed strand and A → T transversion being the most frequent change. The spectrum of Pig-a mutations in DMBA-treated rats was different from the spectrum of Pig-a mutations in N-ethyl-N-nitrosourea (ENU)-treated rats, but similar to the spectrum of DMBA mutations for another endogenous X-linked gene, Hprt. Only 15% of CD48-deficient mutants from control animals contained Pig-a mutations; T-cell biology may be responsible for a relatively large fraction of false Pig-a mutant lymphocytes in control animals. Among the verified mutants from control rats, the most common were frameshifts and deletions. The differences in the spectra of spontaneous, DMBA-, and ENU-induced Pig-a mutations suggest that the flow cytometric Pig-a assay detects de novo mutation in the endogenous Pig-a gene. © 2015 Wiley Periodicals, Inc.

  19. Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

    Directory of Open Access Journals (Sweden)

    E Wyroba

    2009-08-01

    Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

  20. The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

    International Nuclear Information System (INIS)

    Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

    2005-01-01

    We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

  1. Cyclophosphamide Alters the Gene Expression Profile in Patients Treated with High Doses Prior to Stem Cell Transplantation

    Science.gov (United States)

    El-Serafi, Ibrahim; Abedi-Valugerdi, Manuchehr; Potácová, Zuzana; Afsharian, Parvaneh; Mattsson, Jonas; Moshfegh, Ali; Hassan, Moustapha

    2014-01-01

    Background Hematopoietic stem cell transplantation is a curative treatment for several haematological malignancies. However, treatment related morbidity and mortality still is a limiting factor. Cyclophosphamide is widely used in condition regimens either in combination with other chemotherapy or with total body irradiation. Methods We present the gene expression profile during cyclophosphamide treatment in 11 patients conditioned with cyclophosphamide for 2 days followed by total body irradiation prior to hematopoietic stem cell transplantation. 299 genes were identified as specific for cyclophosphamide treatment and were arranged into 4 clusters highly down-regulated genes, highly up-regulated genes, early up-regulated but later normalized genes and moderately up-regulated genes. Results Cyclophosphamide treatment down-regulated expression of several genes mapped to immune/autoimmune activation and graft rejection including CD3, CD28, CTLA4, MHC II, PRF1, GZMB and IL-2R, and up-regulated immune-related receptor genes, e.g. IL1R2, IL18R1, and FLT3. Moreover, a high and significant expression of ANGPTL1 and c-JUN genes was observed independent of cyclophosphamide treatment. Conclusion This is the first investigation to provide significant information about alterations in gene expression following cyclophosphamide treatment that may increase our understanding of the cyclophosphamide mechanism of action and hence, in part, avoid its toxicity. Furthermore, ANGPTL1 remained highly expressed throughout the treatment and, in contrast to several other alkylating agents, cyclophosphamide did not influence c-JUN expression. PMID:24466173

  2. Identification of unique cis-element pattern on simulated microgravity treated Arabidopsis by in silico and gene expression

    Science.gov (United States)

    Soh, Hyuncheol; Choi, Yongsang; Lee, Taek-Kyun; Yeo, Up-Dong; Han, Kyeongsik; Auh, Chungkyun; Lee, Sukchan

    2012-08-01

    Arabidopsis gene expression microarray (44 K) was used to detect genes highly induced under simulated microgravity stress (SMS). Ten SMS-inducible genes were selected from the microarray data and these 10 genes were found to be abundantly expressed in 3-week-old plants. Nine out of the 10 SMS-inducible genes were also expressed in response to the three abiotic stresses of drought, touch, and wounding in 3-week-old Arabidopsis plants respectively. However, WRKY46 was elevated only in response to SMS. Six other WRKY genes did not respond to SMS. To clarify the characteristics of the genes expressed at high levels in response to SMS, 20 cis-elements in the promoters of the 40 selected genes including the 10 SMS-inducible genes, the 6 WRKY genes, and abiotic stress-inducible genes were analyzed and their spatial positions on each promoter were determined. Four cis-elements (M/T-G-T-P from MYB1AT or TATABOX5, GT1CONSENSUS, TATABOX5, and POLASIG1) showed a unique spatial arrangement in most SMS-inducible genes including WRKY46. Therefore the M/T-G-T-P cis-element patterns identified in the promoter of WRKY46 may play important roles in regulating gene expression in response to SMS. The presences of the cis-element patterns suggest that the order or spatial positioning of certain groups of cis-elements is more important than the existence or numbers of specific cis-elements. Taken together, our data indicate that WRKY46 is a novel SMS inducible transcription factor and the unique spatial arrangement of cis-elements shown in WRKY46 promoter may play an important role for its response to SMS.

  3. A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

    Science.gov (United States)

    Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

    1994-12-01

    We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

  4. Low-dose Norfloxacin-treated leptospires induce less IL-1β release in J774A.1 cells following discrepant leptospiral gene expression.

    Science.gov (United States)

    Cao, Yongguo; Xie, Xufeng; Zhang, Wenlong; Wu, Dianjun; Tu, Changchun

    2018-06-01

    Currently, accumulating evidence is challenging subtherapeutic therapy. Low-dose Norfloxacin (Nor) has been reported to suppress the immune response and worsen leptospirosis. In this study, we investigated the influence of low-dose Nor (0.03 μg/ml, 0.06 μg/ml, 0.125 μg/ml) on leptospiral gene expression and analyzed the immunomodulatory effects of low-dose Nor-treated leptospires in J774A.1 cells. To study the expression profiles of low-dose Nor-treated leptospires, we chose LipL71/LipL21 as reference genes determined by the geNorm applet in this experiment. The results showed that low-dose Nor up-regulated the expression of FlaB and inhibited the expression of 16S rRNA, LipL32, LipL41, Loa22, KdpA, and KdpB compared with the untreated leptospires. These results indicated that low-dose Nor could regulate leptospiral gene expression. Using RT-PCR, the gene expression of IL-1β and TNF-α in J774A.1 cells was detected. Nor-treated leptospires induced higher expression levels of both IL-1β and TNF-α. However, when analyzed by ELISA, the release of mature IL-1β was reduced compared with that observed in cells induced with no Nor-treated leptospires, although the TNF-α protein level showed no significant change. Our study indicated that the gene expression of leptospires could be modulated by low-dose Nor, which induced less IL-1β release in J774A.1 cells. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. The impact of IL28B genotype on the gene expression profile of patients with chronic hepatitis C treated with pegylated interferon alpha and ribavirin

    Directory of Open Access Journals (Sweden)

    Younossi Zobair M

    2012-02-01

    Full Text Available Abstract Background Recent studies of CH-C patients have demonstrated a strong association between IL28B CC genotype and sustained virologic response (SVR after PEG-IFN/RBV treatment. We aimed to assess whether IL28B alleles rs12979860 genotype influences gene expression in response to PEG-IFN/RBV in CH-C patients. Methods Clinical data and gene expression data were available for 56 patients treated with PEG-IFN/RBV. Whole blood was used to determine IL28B genotypes. Differential expression of 153 human genes was assessed for each treatment time point (Days: 0, 1, 7, 28, 56 and was correlated with IL28B genotype (IL28B C/C or non-C/C over the course of the PEG-IFN/RBV treatment. Genes with statistically significant changes in their expression at each time point were used as an input for pathway analysis using KEGG Pathway Painter (KPP. Pathways were ranked based on number of gene involved separately per each study cohort. Results The most striking difference between the response patterns of patients with IL28B C/C and T* genotypes during treatment, across all pathways, is a sustained pattern of treatment-induced gene expression in patients carrying IL28B C/C. In the case of IL28B T* genotype, pre-activation of genes, the lack of sustained pattern of gene expression or a combination of both were observed. This observation could potentially provide an explanation for the lower rate of SVR observed in these patients. Additionally, when the lists of IL28B genotype-specific genes which were differentially expressed in patients without SVR were compared at their baseline, IRF2 and SOCS1 genes were down-regulated regardless of patients' IL28B genotype. Furthermore, our data suggest that CH-C patients who do not have the SOCS1 gene silenced have a better chance of achieving SVR. Our observations suggest that the action of SOCS1 is independent of IL28B genotype. Conclusions IL28B CC genotype patients with CH-C show a sustained treatment-induced gene

  6. The impact of IL28B genotype on the gene expression profile of patients with chronic hepatitis C treated with pegylated interferon alpha and ribavirin.

    Science.gov (United States)

    Younossi, Zobair M; Birerdinc, Aybike; Estep, Mike; Stepanova, Maria; Afendy, Arian; Baranova, Ancha

    2012-02-07

    Recent studies of CH-C patients have demonstrated a strong association between IL28B CC genotype and sustained virologic response (SVR) after PEG-IFN/RBV treatment. We aimed to assess whether IL28B alleles rs12979860 genotype influences gene expression in response to PEG-IFN/RBV in CH-C patients. Clinical data and gene expression data were available for 56 patients treated with PEG-IFN/RBV. Whole blood was used to determine IL28B genotypes. Differential expression of 153 human genes was assessed for each treatment time point (Days: 0, 1, 7, 28, 56) and was correlated with IL28B genotype (IL28B C/C or non-C/C) over the course of the PEG-IFN/RBV treatment. Genes with statistically significant changes in their expression at each time point were used as an input for pathway analysis using KEGG Pathway Painter (KPP). Pathways were ranked based on number of gene involved separately per each study cohort. The most striking difference between the response patterns of patients with IL28B C/C and T* genotypes during treatment, across all pathways, is a sustained pattern of treatment-induced gene expression in patients carrying IL28B C/C. In the case of IL28B T* genotype, pre-activation of genes, the lack of sustained pattern of gene expression or a combination of both were observed. This observation could potentially provide an explanation for the lower rate of SVR observed in these patients. Additionally, when the lists of IL28B genotype-specific genes which were differentially expressed in patients without SVR were compared at their baseline, IRF2 and SOCS1 genes were down-regulated regardless of patients' IL28B genotype. Furthermore, our data suggest that CH-C patients who do not have the SOCS1 gene silenced have a better chance of achieving SVR. Our observations suggest that the action of SOCS1 is independent of IL28B genotype. IL28B CC genotype patients with CH-C show a sustained treatment-induced gene expression profile which is not seen in non-CC genotype patients

  7. Abundance and distribution of antibiotic resistance genes in a full-scale anaerobic-aerobic system alternately treating ribostamycin, spiramycin and paromomycin production wastewater.

    Science.gov (United States)

    Tang, Mei; Dou, Xiaomin; Wang, Chunyan; Tian, Zhe; Yang, Min; Zhang, Yu

    2017-12-01

    The occurrence of antibiotic-resistant bacteria and antibiotic resistance genes (ARGs) has been intensively investigated for wastewater treatment systems treating single class of antibiotic in recent years. However, the impacts of alternately occurring antibiotics in antibiotic production wastewater on the behavior of ARGs in biological treatment systems were not well understood yet. Herein, techniques including high-capacity quantitative PCR and quantitative PCR (qPCR) were used to investigate the behavior of ARGs in an anaerobic-aerobic full-scale system. The system alternately treated three kinds of antibiotic production wastewater including ribostamycin, spiramycin and paromomycin, which referred to stages 1, 2 and 3. The aminoglycoside ARGs (52.1-79.3%) determined using high-capacity quantitative PCR were the most abundant species in all sludge samples of the three stages. The total relative abundances of macrolide-lincosamide-streptogramin (MLS) resistance genes and aminoglycoside resistance genes measured using qPCR were significantly higher (P  0.05) in both aerobic and anaerobic sludge samples. In aerobic sludge, one acetyltransferase gene (aacA4) and the other three nucleotidyltransferase genes (aadB, aadA and aadE) exhibited positive correlations with intI1 (r 2  = 0.83-0.94; P < 0.05), implying the significance of horizontal transfer in their proliferation. These results and facts will be helpful to understand the abundance and distribution of ARGs from antibiotic production wastewater treatment systems.

  8. Removal of bacterial cells, antibiotic resistance genes and integrase genes by on-site hospital wastewater treatment plants: surveillance of treated hospital effluent quality

    KAUST Repository

    Timraz, Kenda Hussain Hassan; Xiong, Yanghui; Al Qarni, Hamed; Hong, Pei-Ying

    2016-01-01

    This study aims to evaluate the removal efficiency of microbial contaminants, including total cell counts, antibiotic-resistant bacteria (ARB), antibiotic resistance genes (ARGs, e.g. tetO, tetZ, sul1 and sul2) and integrase genes (e.g. intl1

  9. , , , , , and Gene Expression in Single- and Co-cultured Bovine Satellite Cells and Intramuscular Preadipocytes Treated with Palmitic, Stearic, Oleic, and Linoleic Acid

    Directory of Open Access Journals (Sweden)

    S. H. Choi

    2015-03-01

    Full Text Available We previously demonstrated that bovine subcutaneous preadipocytes promote adipogenic gene expression in muscle satellite cells in a co-culture system. Herein we hypothesize that saturated fatty acids would promote adipogenic/lipogenic gene expression, whereas mono- and polyunsaturated fatty acids would have the opposite effect. Bovine semimembranosus satellite cells (BSC and intramuscular preadipocytes (IPA were isolated from crossbred steers and cultured with 10% fetal bovine serum (FBS/Dulbecco’s Modified Eagle Medium (DMEM and 1% antibiotics during the 3-d proliferation period. After proliferation, cells were treated for 3 d with 3% horse serum/DMEM (BSC or 5% FBS/DMEM (IPA with antibiotics. Media also contained 10 μg/mL insulin and 10 μg/mL pioglitazone. Subsequently, differentiating BSC and IPA were cultured in their respective media with 40 μM palmitic, stearic, oleic, or linoleic acid for 4 d. Finally, BSC and IPA were single- or co-cultured for an additional 2 h. All fatty acid treatments increased (p = 0.001 carnitine palmitoyltransferase-1 beta (CPT1β gene expression, but the increase in CPT1β gene expression was especially pronounced in IPA incubated with palmitic and stearic acid (6- to 17- fold increases. Oleic and linoleic acid decreased (p = 0.001 stearoyl-CoA desaturase (SCD gene expression over 80% in both BSC and IPA. Conversely, palmitic and stearic acid increased SCD gene expression three fold in co-cultured in IPA, and stearic acid increased AMPKα gene expression in single- and co-cultured BSC and IPA. Consistent with our hypothesis, saturated fatty acids, especially stearic acid, promoted adipogenic and lipogenic gene expression, whereas unsaturated fatty acids decreased expression of those genes associated with fatty acid metabolism.

  10. Fisetin up-regulates the expression of adiponectin in 3T3-L1 adipocytes via the activation of silent mating type information regulation 2 homologue 1 (SIRT1)-deacetylase and peroxisome proliferator-activated receptors (PPARs).

    Science.gov (United States)

    Jin, Taewon; Kim, Oh Yoen; Shin, Min-Jeong; Choi, Eun Young; Lee, Sung Sook; Han, Ye Sun; Chung, Ji Hyung

    2014-10-29

    Adiponectin, an adipokine, has been described as showing physiological benefits against obesity-related malfunctions and vascular dysfunction. Several natural compounds that promote the expression and secretion of adipokines in adipocytes could be useful for treating metabolic disorders. This study investigated the effect of fisetin, a dietary flavonoid, on the regulation of adiponectin in adipocytes using 3T3-L1 preadipocytes. The expression and secretion of adiponectin increased in 3T3-L1 cells upon treatment with fisetin in a dose-dependent manner. Fisetin-induced adiponectin secretion was inhibited by peroxisome proliferator-activated receptor (PPAR) antagonists. It was also revealed that fisetin increased the activities of PPARs and silent mating type information regulation 2 homologue 1 (SIRT1) in a dose-dependent manner. Furthermore, the up-regulation of adiponectin and the activation of PPARs induced by fisetin were prevented by a SIRT1 inhibitor. Fisetin also promoted deacetylation of PPAR γ coactivator 1 (PGC-1) and its interaction with PPARs. SIRT knockdown by siRNA significantly decreased both adiponectin production and PPARs-PGC-1 interaction. These results provide evidence that fisetin promotes the gene expression of adiponectin through the activation of SIRT1 and PPARs in adipocytes.

  11. Dietary administration of the probiotic SpPdp11: Effects on the intestinal microbiota and immune-related gene expression of farmed Solea senegalensis treated with oxytetracycline.

    Science.gov (United States)

    Tapia-Paniagua, S T; Vidal, S; Lobo, C; García de la Banda, I; Esteban, M A; Balebona, M C; Moriñigo, M A

    2015-10-01

    Few antimicrobials are currently authorised in the aquaculture industry to treat infectious diseases. Among them, oxytetracycline (OTC) is one of the first-choice drugs for nearly all bacterial diseases. The objective of this study was to evaluate the effect of the dietary administration of OTC both alone and jointly with the probiotic Shewanella putrefaciens Pdp11 (SpPdp11) on the intestinal microbiota and hepatic expression of genes related to immunity in Senegalese sole (Solea senegalensis) juveniles. The results demonstrated that the richness and diversity of the intestinal microbiota of fish treated with OTC decreased compared with those of the control group but that these effects were lessened by the simultaneous administration of SpPdp11. In addition, specimens that received OTC and SpPdp11 jointly showed a decreased intensity of the Denaturing Gradient Gel Electrophoresis (DGGE) bands related to Vibrio genus and the presence of DGGE bands related to Lactobacillus and Shewanella genera. The relationship among the intestinal microbiota of fish fed with control and OTC diets and the expression of the NADPH oxidase and CASPASE-6 genes was demonstrated by a Principal Components Analysis (PCA) carried out in this study. In contrast, a close relationship between the transcription of genes, such as NKEF, IGF-β, HSP70 and GP96, and the DGGE bands of fish treated jointly with OTC and SpPdp11 was observed in the PCA study. In summary, the results obtained in this study demonstrate that the administration of OTC results in the up-regulation of genes related to apoptosis but that the joint administration of OTC and S. putrefaciens Pdp11 increases the transcription of genes related to antiapoptotic effects and oxidative stress regulation. Further, a clear relationship between these changes and those detected in the intestinal microbiota is established. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Stress associated gene expression in blood cells is related to outcome in radiotherapy treated head and neck cancer patients

    International Nuclear Information System (INIS)

    Bøhn, Siv K; Blomhoff, Rune; Russnes, Kjell M; Sakhi, Amrit K; Thoresen, Magne; Holden, Marit; Moskaug, JanØ; Myhrstad, Mari C; Olstad, Ole K; Smeland, Sigbjørn

    2012-01-01

    We previously observed that a radiotherapy-induced biochemical response in plasma was associated with favourable outcome in head and neck squamous carcinoma cancer (HNSCC) patients. The aim of the present study was to compare stress associated blood cell gene expression between two sub-groups of HNSCC patients with different biochemical responses to radiotherapy. Out of 87 patients (histologically verified), 10 biochemical ‘responders’ having a high relative increase in plasma oxidative damage and a concomitant decrease in plasma antioxidants during radiotherapy and 10 ‘poor-responders’ were selected for gene-expression analysis and compared using gene set enrichment analysis. There was a significant induction of stress-relevant gene-sets in the responders following radiotherapy compared to the poor-responders. The relevance of the involvement of similar stress associated gene expression for HNSCC cancer and radioresistance was verified using two publicly available data sets of 42 HNSCC cases and 14 controls (GEO GSE6791), and radiation resistant and radiation sensitive HNSCC xenografts (E-GEOD-9716). Radiotherapy induces a systemic stress response, as revealed by induction of stress relevant gene expression in blood cells, which is associated to favourable outcome in a cohort of 87 HNSCC patients. Whether these changes in gene expression reflects a systemic effect or are biomarkers of the tumour micro-environmental status needs further study. Raw data are available at ArrayExpress under accession number E-MEXP-2460

  13. Expression patterns of Passiflora edulis APETALA1/FRUITFULL homologues shed light onto tendril and corona identities

    Directory of Open Access Journals (Sweden)

    Livia C. T. Scorza

    2017-02-01

    Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also

  14. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang

    2002-12-01

    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  15. The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

    Science.gov (United States)

    Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

    2017-06-01

    This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

  16. Constitutive gene expression profile segregates toxicity in locally advanced breast cancer patients treated with high-dose hyperfractionated radical radiotherapy

    International Nuclear Information System (INIS)

    Henríquez Hernández, Luis Alberto; Lara, Pedro Carlos; Pinar, Beatriz; Bordón, Elisa; Gallego, Carlos Rodríguez; Bilbao, Cristina; Pérez, Leandro Fernández; Morales, Amílcar Flores

    2009-01-01

    Breast cancer patients show a wide variation in normal tissue reactions after radiotherapy. The individual sensitivity to x-rays limits the efficiency of the therapy. Prediction of individual sensitivity to radiotherapy could help to select the radiation protocol and to improve treatment results. The aim of this study was to assess the relationship between gene expression profiles of ex vivo un-irradiated and irradiated lymphocytes and the development of toxicity due to high-dose hyperfractionated radiotherapy in patients with locally advanced breast cancer. Raw data from microarray experiments were uploaded to the Gene Expression Omnibus Database http://www.ncbi.nlm.nih.gov/geo/ (GEO accession GSE15341). We obtained a small group of 81 genes significantly regulated by radiotherapy, lumped in 50 relevant pathways. Using ANOVA and t-test statistical tools we found 20 and 26 constitutive genes (0 Gy) that segregate patients with and without acute and late toxicity, respectively. Non-supervised hierarchical clustering was used for the visualization of results. Six and 9 pathways were significantly regulated respectively. Concerning to irradiated lymphocytes (2 Gy), we founded 29 genes that separate patients with acute toxicity and without it. Those genes were gathered in 4 significant pathways. We could not identify a set of genes that segregates patients with and without late toxicity. In conclusion, we have found an association between the constitutive gene expression profile of peripheral blood lymphocytes and the development of acute and late toxicity in consecutive, unselected patients. These observations suggest the possibility of predicting normal tissue response to irradiation in high-dose non-conventional radiation therapy regimens. Prospective studies with higher number of patients are needed to validate these preliminary results

  17. Quantitative analysis of protein and gene expression in salivary glands of Sjogren's-like disease NOD mice treated by bone marrow soup.

    Directory of Open Access Journals (Sweden)

    Kaori Misuno

    Full Text Available BACKGROUND: Bone marrow cell extract (termed as BM Soup has been demonstrated to repair irradiated salivary glands (SGs and restore saliva secretion in our previous study. In the present study, we aim to investigate if the function of damaged SGs in non-obese diabetic (NOD mice can be restored by BM Soup treatment and the molecular alterations associated with the treatment. METHODS: Whole BM cells were lysed and soluble intracellular contents ("BM Soup" were injected I.V. into NOD mice. Tandem mass tagging with 2-D liquid chromatography-mass spectrometry was used to quantify proteins in the submandibular glands (SMGs between untreated and BM Soup-treated mice. Quantitative PCR was used to identify genes with altered expression in the treated mice. RESULTS BM SOUP: restored salivary flow rates to normal levels and significantly reduced the focus scores of SMGs in NOD mice. More than 1800 proteins in SMG cells were quantified by the proteomic approach. Many SMG proteins involved in inflammation and apoptosis were found to be down-regulated whereas those involved in salivary gland biology and development/regeneration were up-regulated in the BM Soup-treated mice. qPCR analysis also revealed expression changes of growth factors and cytokines in the SMGs of the treated NOD mice. CONCLUSION: BM Soup treatment is effective to restore the function of damaged SGs in NOD mice. Through gene/protein expression analysis, we have found that BM Soup treatment might effectuate via inhibiting apoptosis, focal adhesion and inflammation whereas promoting development, regeneration and differentiation of the SG cells in NOD mice. These findings provide important insights on the potential mechanisms underlying the BM Soup treatment for functional restoration of damaged SGs in NOD mice. Additional studies are needed to further confirm the identified target genes and their related signaling pathways that are responsible for the BM Soup treatment.

  18. Quantitative Analysis of Protein and Gene Expression in Salivary Glands of Sjogren’s-Like Disease NOD Mice Treated by Bone Marrow Soup

    Science.gov (United States)

    Misuno, Kaori; Khalili, Saeed; Huang, Junwei; Liu, Younan

    2014-01-01

    Background Bone marrow cell extract (termed as BM Soup) has been demonstrated to repair irradiated salivary glands (SGs) and restore saliva secretion in our previous study. In the present study, we aim to investigate if the function of damaged SGs in non-obese diabetic (NOD) mice can be restored by BM Soup treatment and the molecular alterations associated with the treatment. Methods Whole BM cells were lysed and soluble intracellular contents (“BM Soup”) were injected I.V. into NOD mice. Tandem mass tagging with 2-D liquid chromatography-mass spectrometry was used to quantify proteins in the submandibular glands (SMGs) between untreated and BM Soup-treated mice. Quantitative PCR was used to identify genes with altered expression in the treated mice. Results BM Soup restored salivary flow rates to normal levels and significantly reduced the focus scores of SMGs in NOD mice. More than 1800 proteins in SMG cells were quantified by the proteomic approach. Many SMG proteins involved in inflammation and apoptosis were found to be down-regulated whereas those involved in salivary gland biology and development/regeneration were up-regulated in the BM Soup-treated mice. qPCR analysis also revealed expression changes of growth factors and cytokines in the SMGs of the treated NOD mice. Conclusion BM Soup treatment is effective to restore the function of damaged SGs in NOD mice. Through gene/protein expression analysis, we have found that BM Soup treatment might effectuate via inhibiting apoptosis, focal adhesion and inflammation whereas promoting development, regeneration and differentiation of the SG cells in NOD mice. These findings provide important insights on the potential mechanisms underlying the BM Soup treatment for functional restoration of damaged SGs in NOD mice. Additional studies are needed to further confirm the identified target genes and their related signaling pathways that are responsible for the BM Soup treatment. PMID:24489858

  19. Quantitative analysis of protein and gene expression in salivary glands of Sjogren's-like disease NOD mice treated by bone marrow soup.

    Science.gov (United States)

    Misuno, Kaori; Tran, Simon D; Khalili, Saeed; Huang, Junwei; Liu, Younan; Hu, Shen

    2014-01-01

    Bone marrow cell extract (termed as BM Soup) has been demonstrated to repair irradiated salivary glands (SGs) and restore saliva secretion in our previous study. In the present study, we aim to investigate if the function of damaged SGs in non-obese diabetic (NOD) mice can be restored by BM Soup treatment and the molecular alterations associated with the treatment. Whole BM cells were lysed and soluble intracellular contents ("BM Soup") were injected I.V. into NOD mice. Tandem mass tagging with 2-D liquid chromatography-mass spectrometry was used to quantify proteins in the submandibular glands (SMGs) between untreated and BM Soup-treated mice. Quantitative PCR was used to identify genes with altered expression in the treated mice. restored salivary flow rates to normal levels and significantly reduced the focus scores of SMGs in NOD mice. More than 1800 proteins in SMG cells were quantified by the proteomic approach. Many SMG proteins involved in inflammation and apoptosis were found to be down-regulated whereas those involved in salivary gland biology and development/regeneration were up-regulated in the BM Soup-treated mice. qPCR analysis also revealed expression changes of growth factors and cytokines in the SMGs of the treated NOD mice. BM Soup treatment is effective to restore the function of damaged SGs in NOD mice. Through gene/protein expression analysis, we have found that BM Soup treatment might effectuate via inhibiting apoptosis, focal adhesion and inflammation whereas promoting development, regeneration and differentiation of the SG cells in NOD mice. These findings provide important insights on the potential mechanisms underlying the BM Soup treatment for functional restoration of damaged SGs in NOD mice. Additional studies are needed to further confirm the identified target genes and their related signaling pathways that are responsible for the BM Soup treatment.

  20. Liver gene expression profiles of rats treated with clofibric acid: comparison of whole liver and laser capture microdissected liver.

    Science.gov (United States)

    Michel, Cécile; Desdouets, Chantal; Sacre-Salem, Béatrice; Gautier, Jean-Charles; Roberts, Ruth; Boitier, Eric

    2003-12-01

    Clofibric acid (CLO) is a peroxisome proliferator (PP) that acts through the peroxisome proliferator activated receptor alpha, leading to hepatocarcinogenesis in rodents. CLO-induced hepatocarcinogenesis is a multi-step process, first transforming normal liver cells into foci. The combination of laser capture microdissection (LCM) and genomics has the potential to provide expression profiles from such small cell clusters, giving an opportunity to understand the process of cancer development in response to PPs. To our knowledge, this is the first evaluation of the impact of the successive steps of LCM procedure on gene expression profiling by comparing profiles from LCM samples to those obtained with non-microdissected liver samples collected after a 1 month CLO treatment in the rat. We showed that hematoxylin and eosin (H&E) staining and laser microdissection itself do not impact on RNA quality. However, the overall process of the LCM procedure affects the RNA quality, resulting in a bias in the gene profiles. Nonetheless, this bias did not prevent accurate determination of a CLO-specific molecular signature. Thus, gene-profiling analysis of microdissected foci, identified by H&E staining may provide insight into the mechanisms underlying non-genotoxic hepatocarcinogenesis in the rat by allowing identification of specific genes that are regulated by CLO in early pre-neoplastic foci.

  1. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp

    International Nuclear Information System (INIS)

    Liu Wangjing; Chang Yunshiang; Wang Chunghsiung; Kou, Guang-Hsiung; Lo Chufang

    2005-01-01

    Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter

  2. Pharmacodynamic Impact of Carboxylesterase 1 Gene Variants in Patients with Congestive Heart Failure Treated with Angiotensin-Converting Enzyme Inhibitors

    DEFF Research Database (Denmark)

    Nelveg-Kristensen, Karl Emil; Bie, Peter; Ferrero, Laura

    2016-01-01

    BACKGROUND: Variation in the carboxylesterase 1 gene (CES1) may contribute to the efficacy of ACEIs. Accordingly, we examined the impact of CES1 variants on plasma angiotensin II (ATII)/angiotensin I (ATI) ratio in patients with congestive heart failure (CHF) that underwent ACEI dose titrations. ...

  3. Longitudinal Transcriptome Analysis Reveals a Sustained Differential Gene Expression Signature in Patients Treated for Acute Lyme Disease.

    Science.gov (United States)

    Bouquet, Jerome; Soloski, Mark J; Swei, Andrea; Cheadle, Chris; Federman, Scot; Billaud, Jean-Noel; Rebman, Alison W; Kabre, Beniwende; Halpert, Richard; Boorgula, Meher; Aucott, John N; Chiu, Charles Y

    2016-02-12

    Lyme disease is a tick-borne illness caused by the bacterium Borrelia burgdorferi, and approximately 10 to 20% of patients report persistent symptoms lasting months to years despite appropriate treatment with antibiotics. To gain insights into the molecular basis of acute Lyme disease and the ensuing development of post-treatment symptoms, we conducted a longitudinal transcriptome study of 29 Lyme disease patients (and 13 matched controls) enrolled at the time of diagnosis and followed for up to 6 months. The differential gene expression signature of Lyme disease following the acute phase of infection persisted for at least 3 weeks and had fewer than 44% differentially expressed genes (DEGs) in common with other infectious or noninfectious syndromes. Early Lyme disease prior to antibiotic therapy was characterized by marked upregulation of Toll-like receptor signaling but lack of activation of the inflammatory T-cell apoptotic and B-cell developmental pathways seen in other acute infectious syndromes. Six months after completion of therapy, Lyme disease patients were found to have 31 to 60% of their pathways in common with three different immune-mediated chronic diseases. No differential gene expression signature was observed between Lyme disease patients with resolved illness to those with persistent symptoms at 6 months post-treatment. The identification of a sustained differential gene expression signature in Lyme disease suggests that a panel of selected human host-based biomarkers may address the need for sensitive clinical diagnostics during the "window period" of infection prior to the appearance of a detectable antibody response and may also inform the development of new therapeutic targets. Lyme disease is the most common tick-borne infection in the United States, and some patients report lingering symptoms lasting months to years despite antibiotic treatment. To better understand the role of the human host response in acute Lyme disease and the

  4. From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

    DEFF Research Database (Denmark)

    van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

    2017-01-01

    , but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

  5. Behaviour of the homologues of Rf and Db in complexing media

    International Nuclear Information System (INIS)

    Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

    1999-01-01

    In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

  6. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

    2011-01-01

    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

  7. The actin homologue MreB organizes the bacterial cell membrane

    NARCIS (Netherlands)

    Strahl, H.; Burmann, F.; Hamoen, L.W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

  8. Cloning and characterization of maize ZmSPK1, a homologue to ...

    African Journals Online (AJOL)

    hope&shola

    2006-03-15

    Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

  9. Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

    DEFF Research Database (Denmark)

    Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

    2006-01-01

    A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

  10. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)

    Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

  11. Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

    International Nuclear Information System (INIS)

    Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

    2006-01-01

    The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

  12. Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

    International Nuclear Information System (INIS)

    Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko

    2004-01-01

    To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

  13. Vancomycin-resistant enterococci with vanA gene in treated municipal wastewater and their association with human hospital strains.

    Science.gov (United States)

    Oravcova, Veronika; Mihalcin, Matus; Zakova, Jana; Pospisilova, Lucie; Masarikova, Martina; Literak, Ivan

    2017-12-31

    Vancomycin-resistant enterococci (VRE) are pathogens of increasing medical importance. In Brno, Czech Republic, we collected 37 samples from the effluent of a wastewater treatment plant (WWTP), 21 surface swabs from hospital settings, and 59 fecal samples from hospitalized patients and staff. Moreover, we collected 284 gull cloacal swabs from the colony situated 35km downstream the WWTP. Samples were cultured selectively. Enterococci were identified using MALDI-TOF MS, phenotypically tested for susceptibility to antibiotics, and by PCR for occurrence of resistance and virulence genes. Pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST) were used to examine genotypic diversity. VRE carrying the vanA gene were found in 32 (86%, n=37) wastewater samples, from which we obtained 49 isolates: Enterococcus faecium (44) and Enterococcus gallinarum (2), Enterococcus casseliflavus (2), and Enterococcus raffinosus (1). From 33 (69%) of 48 inpatient stool samples, we obtained 39 vanA-carrying VRE, which belonged to E. faecium (33 isolates), Enterococcus faecalis (4), and Enterococcus raffinosus (2). Nearly one-third of the samples from hospital surfaces contained VRE with the vanA gene. VRE were not detected among gulls. Sixty-seven (84%, n=80) E. faecium isolates carried virulence genes hyl and/or esp. Virulence of E. faecalis was encoded by gelE, asa1, and cylA genes. A majority of the E. faecium isolates belonged to the clinically important sequence types ST17 (WWTP: 10 isolates; hospital: 4 isolates), ST18 (9;8), and ST78 (5;0). The remaining isolates belonged to ST555 (2;0), ST262 (1;6), ST273 (3;0), ST275 (1;0), ST549 (2;0), ST19 (0;1), ST323 (3;0), and ST884 (7;17). Clinically important enterococci carrying the vanA gene were almost continually detectable in the effluent of the WWTP, indicating insufficient removal of VRE during wastewater treatment and permanent shedding of these antibiotic resistant pathogens into the environment from this

  14. Gene Therapy

    Science.gov (United States)

    Gene therapy Overview Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease. Genes contain your ... that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds a new ...

  15. CYP2D6 gene polymorphisms in Brazilian patients with breast cancer treated with adjuvant tamoxifen and its association with disease recurrence

    Science.gov (United States)

    De Ameida Melo, Mariella; De Vasconcelos-Valença, Rodrigo José; Neto, Fidelis Manes; Borges, Rafael Soares; Costa-Silva, Danylo Rafhael; Da Conceição Barros-Oliveira, Maria; Borges, Umbelina Soares; Alencar, Airlane Pereira; Silva, Vladimir Costa; Da Silva, Benedito Borges

    2016-01-01

    At present, there is controversy regarding the efficacy of tamoxifen in breast cancer patients who are carriers of cytochrome P450 2D6 (CYP2D6) gene polymorphisms, in terms of recurrence and overall survival. Thus, the aim of the present study was to investigate the association of the CYP2D6 *4, *10 and *17 gene polymorphisms with breast cancer recurrence in a Brazilian population. The cohort comprised 40 receptor-positive breast cancer patients without recurrence and 40 with distant recurrence. A 3-ml sample of peripheral blood was collected from each patient to determine the presence of the *4, *10 and *17 single nucleotide polymorphisms of the CYP2D6 gene by quantitative polymerase chain reaction analysis. There was no statistically significant difference between the two groups regarding the polymorphism frequency (P=0.246). The results revealed that intermediate metabolizers occurred in 5% of patients without recurrence and in 15% of those with distant recurrence. Poor metabolizers occurred in only 1 patient (2.5%) per group, and there was no significant difference between the groups (P=0.789). The present study concluded that the CYP2D6 gene polymorphism in women with hormone-sensitive breast cancer treated with tamoxifen was not associated with disease recurrence. PMID:27882219

  16. Longitudinal Transcriptome Analysis Reveals a Sustained Differential Gene Expression Signature in Patients Treated for Acute Lyme Disease

    Science.gov (United States)

    Bouquet, Jerome; Soloski, Mark J.; Swei, Andrea; Cheadle, Chris; Federman, Scot; Billaud, Jean-Noel; Rebman, Alison W.; Kabre, Beniwende; Halpert, Richard; Boorgula, Meher

    2016-01-01

    ABSTRACT Lyme disease is a tick-borne illness caused by the bacterium Borrelia burgdorferi, and approximately 10 to 20% of patients report persistent symptoms lasting months to years despite appropriate treatment with antibiotics. To gain insights into the molecular basis of acute Lyme disease and the ensuing development of post-treatment symptoms, we conducted a longitudinal transcriptome study of 29 Lyme disease patients (and 13 matched controls) enrolled at the time of diagnosis and followed for up to 6 months. The differential gene expression signature of Lyme disease following the acute phase of infection persisted for at least 3 weeks and had fewer than 44% differentially expressed genes (DEGs) in common with other infectious or noninfectious syndromes. Early Lyme disease prior to antibiotic therapy was characterized by marked upregulation of Toll-like receptor signaling but lack of activation of the inflammatory T-cell apoptotic and B-cell developmental pathways seen in other acute infectious syndromes. Six months after completion of therapy, Lyme disease patients were found to have 31 to 60% of their pathways in common with three different immune-mediated chronic diseases. No differential gene expression signature was observed between Lyme disease patients with resolved illness to those with persistent symptoms at 6 months post-treatment. The identification of a sustained differential gene expression signature in Lyme disease suggests that a panel of selected human host-based biomarkers may address the need for sensitive clinical diagnostics during the “window period” of infection prior to the appearance of a detectable antibody response and may also inform the development of new therapeutic targets. PMID:26873097

  17. Insights into significant pathways and gene interaction networks underlying breast cancer cell line MCF-7 treated with 17β-estradiol (E2).

    Science.gov (United States)

    Huan, Jinliang; Wang, Lishan; Xing, Li; Qin, Xianju; Feng, Lingbin; Pan, Xiaofeng; Zhu, Ling

    2014-01-01

    Estrogens are known to regulate the proliferation of breast cancer cells and to alter their cytoarchitectural and phenotypic properties, but the gene networks and pathways by which estrogenic hormones regulate these events are only partially understood. We used global gene expression profiling by Affymetrix GeneChip microarray analysis, with KEGG pathway enrichment, PPI network construction, module analysis and text mining methods to identify patterns and time courses of genes that are either stimulated or inhibited by estradiol (E2) in estrogen receptor (ER)-positive MCF-7 human breast cancer cells. Of the genes queried on the Affymetrix Human Genome U133 plus 2.0 microarray, we identified 628 (12h), 852 (24h) and 880 (48 h) differentially expressed genes (DEGs) that showed a robust pattern of regulation by E2. From pathway enrichment analysis, we found out the changes of metabolic pathways of E2 treated samples at each time point. At 12h time point, the changes of metabolic pathways were mainly focused on pathways in cancer, focal adhesion, and chemokine signaling pathway. At 24h time point, the changes were mainly enriched in neuroactive ligand-receptor interaction, cytokine-cytokine receptor interaction and calcium signaling pathway. At 48 h time point, the significant pathways were pathways in cancer, regulation of actin cytoskeleton, cell adhesion molecules (CAMs), axon guidance and ErbB signaling pathway. Of interest, our PPI network analysis and module analysis found that E2 treatment induced enhancement of PRSS23 at the three time points and PRSS23 was in the central position of each module. Text mining results showed that the important genes of DEGs have relationship with signal pathways, such as ERbB pathway (AREG), Wnt pathway (NDP), MAPK pathway (NTRK3, TH), IP3 pathway (TRA@) and some transcript factors (TCF4, MAF). Our studies highlight the diverse gene networks and metabolic and cell regulatory pathways through which E2 operates to achieve its

  18. The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

    Science.gov (United States)

    Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

    2008-02-01

    The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

  19. Serotonin- and Dopamine-Related Gene Expression in db/db Mice Islets and in MIN6 β-Cells Treated with Palmitate and Oleate

    Directory of Open Access Journals (Sweden)

    L. R. Cataldo

    2016-01-01

    Full Text Available High circulating nonesterified fatty acids (NEFAs concentration, often reported in diabetes, leads to impaired glucose-stimulated insulin secretion (GSIS through not yet well-defined mechanisms. Serotonin and dopamine might contribute to NEFA-dependent β-cell dysfunction, since extracellular signal of these monoamines decreases GSIS. Moreover, palmitate-treated β-cells may enhance the expression of the serotonin receptor Htr2c, affecting insulin secretion. Additionally, the expression of monoamine-oxidase type B (Maob seems to be lower in islets from humans and mice with diabetes compared to nondiabetic islets, which may lead to increased monoamine concentrations. We assessed the expression of serotonin- and dopamine-related genes in islets from db/db and wild-type (WT mice. In addition, the effect of palmitate and oleate on the expression of such genes, 5HT content, and GSIS in MIN6 β-cell was determined. Lower Maob expression was found in islets from db/db versus WT mice and in MIN6 β-cells in response to palmitate and oleate treatment compared to vehicle. Reduced 5HT content and impaired GSIS in response to palmitate (−25%; p<0.0001 and oleate (−43%; p<0.0001 were detected in MIN6 β-cells. In conclusion, known defects of GSIS in islets from db/db mice and MIN6 β-cells treated with NEFAs are accompanied by reduced Maob expression and reduced 5HT content.

  20. Data on gene and protein expression changes induced by apabetalone (RVX-208 in ex vivo treated human whole blood and primary hepatocytes

    Directory of Open Access Journals (Sweden)

    Sylwia Wasiak

    2016-09-01

    Full Text Available Apabetalone (RVX-208 inhibits the interaction between epigenetic regulators known as bromodomain and extraterminal (BET proteins and acetyl-lysine marks on histone tails. Data presented here supports the manuscript published in Atherosclerosis “RVX-208, a BET-inhibitor for Treating Atherosclerotic Cardiovascular Disease, Raises ApoA-I/HDL and Represses Pathways that Contribute to Cardiovascular Disease” (Gilham et al., 2016 [1]. It shows that RVX-208 and a comparator BET inhibitor (BETi JQ1 increase mRNA expression and production of apolipoprotein A-I (ApoA-I, the main protein component of high density lipoproteins, in primary human and African green monkey hepatocytes. In addition, reported here are gene expression changes from a microarray-based analysis of human whole blood and of primary human hepatocytes treated with RVX-208. Keywords: Bromodomain, BET proteins, BET inhibitor, RVX-208, JQ1, Vascular inflammation, ApoA-I, Apolipoprotein A-I, African green monkey, Primary human hepatocytes, Gene expression, Microarrays

  1. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.

    Science.gov (United States)

    García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A

    2011-08-01

    Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

  2. Rearrangements of MYC gene facilitate risk stratification in diffuse large B-cell lymphoma patients treated with rituximab-CHOP

    DEFF Research Database (Denmark)

    Tzankov, Alexandar; Xu-Monette, Zijun Y; Gerhard, Marc

    2014-01-01

    In order to address the debatable prognostic role of MYC rearrangements in diffuse large B-cell lymphoma patients treated with rituximab, cyclophosphamide, hydroxydaunorubicin, vincristine, and prednisone, we evaluated MYC rearrangements by fluorescence in situ hybridization in 563 cases using...... with the dual-fusion probes, 15 detectable only with the break-apart probes and 20 detectable with both dual-fusion probes and break-apart probes. MYC rearrangements correlated with germinal center B-cell origin (P=0.02), MYC protein expression (P=0.032), and larger tumor mass size (P=0.0003). Patients with MYC...... was prognostically additive. Radiotherapy seemed to diminish the prognostic effects of MYC rearrangements in diffuse large B-cell lymphoma patients since only 2/10 irradiated patients with MYC rearrangements died of/with disease, compared with 16/28 non-irradiated patients with MYC rearrangements. We conclude...

  3. Relationship between the rs1414334 C/G polymorphism in the HTR2C gene and smoking in patients treated with atypical antipsychotics.

    Science.gov (United States)

    Rico-Gomis, José María; Palazón-Bru, Antonio; Triano-García, Irene; Mahecha-García, Luis Fabián; García-Monsalve, Ana; Navarro-Ruiz, Andrés; Villagordo-Peñalver, Berta; Martínez-Hortelano, Alicia; Gil-Guillén, Vicente Francisco

    2018-04-15

    An association has been found between the C allele of the rs1414334 polymorphism in the HTR2C gene and the metabolic syndrome in psychiatric patients. However, no study has yet evaluated whether this allele is associated with smoking. To assess this issue, therefore, we performed a cross-sectional study with a sample of 166 adult patients treated with atypical antipsychotics in 2012-2013 in a region of Spain. The primary variable was the presence of the C allele of the rs1414334 polymorphism in the HTR2C gene. Secondary variables were the number of pack-years (number of cigarettes per day x number of smoking years ÷ 20), age, gender, schizophrenia, years since diagnosis, metabolic syndrome criteria and SCORE. A stepwise binary logistic regression model was constructed to determine associations between primary and secondary variables and their area under the ROC curve (AUC) was calculated. Of the total sample, 33 patients (19.9%) had the C allele of the polymorphism analyzed. Mean cigarette consumption was 11.6 pack-years. The multivariate analysis showed the following factors as associated with the polymorphism: higher cigarette consumption, being a woman, and not having abdominal obesity. The AUC was 0.706. An association was found between increased cigarette consumption over the years and the presence of the C allele of the rs1414334 polymorphism in the HTR2C gene.

  4. A Polymorphism within the Vitamin D Transporter Gene Predicts Outcome in Metastatic Colorectal Cancer Patients Treated with FOLFIRI/Bevacizumab or FOLFIRI/Cetuximab.

    Science.gov (United States)

    Berger, Martin D; Stintzing, Sebastian; Heinemann, Volker; Cao, Shu; Yang, Dongyun; Sunakawa, Yu; Matsusaka, Satoshi; Ning, Yan; Okazaki, Satoshi; Miyamoto, Yuji; Suenaga, Mitsukuni; Schirripa, Marta; Hanna, Diana L; Soni, Shivani; Puccini, Alberto; Zhang, Wu; Cremolini, Chiara; Falcone, Alfredo; Loupakis, Fotios; Lenz, Heinz-Josef

    2018-02-15

    Purpose: Vitamin D exerts its inhibitory influence on colon cancer growth by inhibiting Wnt signaling and angiogenesis. We hypothesized that SNPs in genes involved in vitamin D transport, metabolism, and signaling are associated with outcome in metastatic colorectal cancer (mCRC) patients treated with first-line FOLFIRI and bevacizumab. Experimental Design: 522 mCRC patients enrolled in the FIRE-3 (discovery cohort) and TRIBE (validation set) trials treated with FOLFIRI/bevacizumab were included in this study. 278 patients receiving FOLFIRI and cetuximab (FIRE-3) served as a control cohort. Six SNPs in 6 genes ( GC, CYP24A1, CYP27B1, VDR, DKK1, CST5 ) were analyzed. Results: In the discovery cohort, AA carriers of the GC rs4588 SNP encoding for the vitamin D-binding protein, and treated with FOLFIRI/bevacizumab had a shorter overall survival (OS) than those harboring any C allele (15.9 vs. 25.1 months) in both univariable ( P = 0.001) and multivariable analyses ( P = 0.047). This association was confirmed in the validation cohort in multivariable analysis (OS 18.1 vs. 26.2 months, HR, 1.83; P = 0.037). Interestingly, AA carriers in the control set exhibited a longer OS (48.0 vs. 25.2 months, HR, 0.50; P = 0.021). This association was further confirmed in a second validation cohort comprising refractory mCRC patients treated with cetuximab ± irinotecan (PFS 8.7 vs. 3.7 months) in univariable ( P = 0.033) and multivariable analyses ( P = 0.046). Conclusions: GC rs4588 SNP might serve as a predictive marker in mCRC patients treated with FOLFIRI/bevacizumab or FOLFIRI/cetuximab. Whereas AA carriers derive a survival benefit with FOLFIRI/cetuximab, treatment with FOLFIRI/bevacizumab is associated with a worse outcome. Clin Cancer Res; 24(4); 784-93. ©2017 AACR . ©2017 American Association for Cancer Research.

  5. The effect of the Taq1A variant in the dopamine D2 receptor gene and common CYP2D6 alleles on prolactin levels in risperidone-treated boys

    NARCIS (Netherlands)

    Roke, Y.; Harten, P.N. van; Franke, B.; Galesloot, T.E.; Boot, A.M.; Buitelaar, J.K.

    2013-01-01

    OBJECTIVE: To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders. METHODS:

  6. The effect of the Taq1A variant in the dopamine D-2 receptor gene and common CYP2D6 alleles on prolactin levels in risperidone-treated boys

    NARCIS (Netherlands)

    Roke, Yvette; van Harten, Peter N.; Franke, Barbara; Galesloot, Tessel E.; Boot, Annemieke M.; Buitelaar, Jan K.

    Objective To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders.Methods

  7. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  8. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

    Science.gov (United States)

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

    1997-05-01

    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  9. A spinach O-acetylserine(thiollyase homologue, SoCSaseLP, suppresses cysteine biosynthesis catalysed by other enzyme isoforms

    Directory of Open Access Journals (Sweden)

    Miki Noda

    2016-06-01

    Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.

  10. Reusing Treated Wastewater: Consideration of the Safety Aspects Associated with Antibiotic-Resistant Bacteria and Antibiotic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Pei-Ying Hong

    2018-02-01

    Full Text Available As more countries engage in water reuse, either intended or de facto, there is an urgent need to more comprehensively evaluate resulting environmental and public health concerns. While antibiotic-resistant bacteria (ARB and antibiotic resistance genes (ARGs are increasingly coming under the spotlight, as emerging contaminants, existing water reuse regulations and guidelines do not adequately address these concerns. This perspectives paper seeks to frame the various challenges that need to be resolved to identify meaningful and realistic target types and levels of antibiotic resistance benchmarks for water reuse. First, there is the need for standardized and agreed-upon methodologies to identify and quantify ARB and ARGs. Second, even if methodologies are available, identifying which ARB and ARGs to monitor that would best relate to the occurrence of disease burden remains unknown. Third, a framework tailored to assessing the risks associated with ARB and ARGs during reuse is urgently needed. Fourth, similar to protecting drinking water sources, strategies to prevent dissemination of ARB and ARGs via wastewater treatment and reuse are required to ensure that appropriate barriers are emplaced. Finally, current wastewater treatment technologies could benefit from modification or retrofit to more effectively remove ARB and ARGs while also producing a high quality product for water and resource recovery. This perspectives paper highlights the need to consider ARB and ARGs when evaluating the overall safety aspects of water reuse and ways by which this may be accomplished.

  11. Expression of Genes Related to Oxidative Stress in Yeast Treated with Ionizing Radiation and N-acetyl -L-cysteine

    International Nuclear Information System (INIS)

    Park, Ji Young; Kim, Jin Kyu; Nili, Mohammad

    2010-01-01

    Ionizing radiation (IR) induces water radiolysis, which generates highly reactive hydroxyl radicals. Reactive oxygen species (ROS) cause apoptosis and cell damage including DNA strand breaks (DSBs), base damage, protein damage and lipid-hydroperoxide. Detoxifying enzymes are immediately triggered for ROS scavenging. Yeast contains two forms of superoxide dismutase (SOD). SOD1 as a cytosolic copper-zinc superoxide dismutase is located in the cytoplasm and cytosol. SOD2 as a manganese containing enzyme is act in mitochondria matrix and mitochondrion. These enzymes scavenge superoxide radicals by catalyzing the conversion of two of these radicals into hydrogen peroxide and molecular oxygen. The hydrogen peroxide formed by superoxide dismutase and by other processes is scavenged by catalase, a ubiquitous heme protein that catalyzes the dismutation of hydrogen peroxide into water and molecular oxygen. Yeast contains two catalases. Catalase A (CTA1) and Cytosolic catalase T (CTT1) is located in peroxisome and cytoplasm, respectively. Yeast has two glutathione (GSH) peroxidases, which are GPX1 and GPX2. GPX1 and GPX2 are component of cellular component and cytoplasm, respectively. The biochemical function of GSH peroxidase is to reduce lipid-hydroperoxides to their corresponding alcohols and to reduce free hydrogen peroxide to water. Otherwise, chemicals and materials help ROS detoxification against oxidative damage. N-acetyl-Lcysteine (NAC) having a thiol, a precursor for glutathione (GSH), is known as one of the antioxidants. In this study, we examined the effect of NAC through gene expressions related to protective enzyme against oxidative stress in yeast

  12. Human Tregs Made Antigen Specific by Gene Modification: The Power to Treat Autoimmunity and Antidrug Antibodies with Precision

    Directory of Open Access Journals (Sweden)

    Patrick R. Adair

    2017-09-01

    Full Text Available Human regulatory CD4+ T cells (Tregs are potent immunosuppressive lymphocytes responsible for immune tolerance and homeostasis. Since the seminal reports identifying Tregs, vast research has been channeled into understanding their genesis, signature molecular markers, mechanisms of suppression, and role in disease. This research has opened the doors for Tregs as a potential therapeutic for diseases and disorders such as multiple sclerosis, type I diabetes, transplantation, and immune responses to protein therapeutics, like factor VIII. Seminal clinical trials have used polyclonal Tregs, but the frequency of antigen-specific Tregs among polyclonal populations is low, and polyclonal Tregs may risk non-specific immunosuppression. Antigen-specific Treg therapy, which uses genetically modified Tregs expressing receptors specific for target antigens, greatly mitigates this risk. Building on the principles of T-cell receptor cloning, chimeric antigen receptors (CARs, and a novel CAR derivative, called B-cell antibody receptors, our lab has developed different types of antigen-specific Tregs. This review discusses the current research and optimization of gene-modified antigen-specific human Tregs in our lab in several disease models. The preparations and considerations for clinical use of such Tregs also are discussed.

  13. Expression of Genes Related to Oxidative Stress in Yeast Treated with Ionizing Radiation and N-acetyl -L-cysteine

    Energy Technology Data Exchange (ETDEWEB)

    Park, Ji Young; Kim, Jin Kyu [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Nili, Mohammad [Dawnesh Radiation Research Institute, Barcelona (Spain)

    2010-10-15

    Ionizing radiation (IR) induces water radiolysis, which generates highly reactive hydroxyl radicals. Reactive oxygen species (ROS) cause apoptosis and cell damage including DNA strand breaks (DSBs), base damage, protein damage and lipid-hydroperoxide. Detoxifying enzymes are immediately triggered for ROS scavenging. Yeast contains two forms of superoxide dismutase (SOD). SOD1 as a cytosolic copper-zinc superoxide dismutase is located in the cytoplasm and cytosol. SOD2 as a manganese containing enzyme is act in mitochondria matrix and mitochondrion. These enzymes scavenge superoxide radicals by catalyzing the conversion of two of these radicals into hydrogen peroxide and molecular oxygen. The hydrogen peroxide formed by superoxide dismutase and by other processes is scavenged by catalase, a ubiquitous heme protein that catalyzes the dismutation of hydrogen peroxide into water and molecular oxygen. Yeast contains two catalases. Catalase A (CTA1) and Cytosolic catalase T (CTT1) is located in peroxisome and cytoplasm, respectively. Yeast has two glutathione (GSH) peroxidases, which are GPX1 and GPX2. GPX1 and GPX2 are component of cellular component and cytoplasm, respectively. The biochemical function of GSH peroxidase is to reduce lipid-hydroperoxides to their corresponding alcohols and to reduce free hydrogen peroxide to water. Otherwise, chemicals and materials help ROS detoxification against oxidative damage. N-acetyl-Lcysteine (NAC) having a thiol, a precursor for glutathione (GSH), is known as one of the antioxidants. In this study, we examined the effect of NAC through gene expressions related to protective enzyme against oxidative stress in yeast

  14. Reusing Treated Wastewater: Consideration of the Safety Aspects Associated with Antibiotic-Resistant Bacteria and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying

    2018-02-27

    As more countries engage in water reuse, either intended or de facto, there is an urgent need to more comprehensively evaluate resulting environmental and public health concerns. While antibiotic-resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are increasingly coming under the spotlight, as emerging contaminants, existing water reuse regulations and guidelines do not adequately address these concerns. This perspectives paper seeks to frame the various challenges that need to be resolved to identify meaningful and realistic target types and levels of antibiotic resistance benchmarks for water reuse. First, there is the need for standardized and agreed-upon methodologies to identify and quantify ARB and ARGs. Second, even if methodologies are available, identifying which ARB and ARGs to monitor that would best relate to the occurrence of disease burden remains unknown. Third, a framework tailored to assessing the risks associated with ARB and ARGs during reuse is urgently needed. Fourth, similar to protecting drinking water sources, strategies to prevent dissemination of ARB and ARGs via wastewater treatment and reuse are required to ensure that appropriate barriers are emplaced. Finally, current wastewater treatment technologies could benefit from modification or retrofit to more effectively remove ARB and ARGs while also producing a high quality product for water and resource recovery. This perspectives paper highlights the need to consider ARB and ARGs when evaluating the overall safety aspects of water reuse and ways by which this may be accomplished.

  15. Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.

    OpenAIRE

    Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas

    2015-01-01

    ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...

  16. The actin homologue MreB organizes the bacterial cell membrane

    OpenAIRE

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

  17. Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

    International Nuclear Information System (INIS)

    Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

  18. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues.

    Science.gov (United States)

    Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela

    2018-01-11

    Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  19. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

    Directory of Open Access Journals (Sweden)

    Aldo Nicosia

    2018-01-01

    Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  20. Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

    International Nuclear Information System (INIS)

    Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

    2005-01-01

    The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

  1. Lack of Association of Multidrug Resistance Gene-1 Polymorphisms with Treatment Outcome in Chronic Myeloid Leukemia Patients Treated with Imatinib

    Directory of Open Access Journals (Sweden)

    Yaya Kassogue

    2015-10-01

    Full Text Available Background: Despite the impressive results obtained with imatinib, inadequate response or resistance are observed in certain patients. It is known that imatinib is a substrate of a multidrug resistance gene (MDR1. Thus, interindividual genetic differences linked to single nucleotide polymorphisms in MDR1 may influence the metabolism of imatinib. The present study has aimed to examine the impact of MDR1 polymorphisms on the hematologic and cytogenetic responses in 70 chronic myeloid leukemia patients who received imatinib. Methods: We used a polymerase chain reaction followed by restriction fragment length polymorphism to identify different profiles of 1236C>T, 2677G>T and 3435C>T in MDR1. Results: The distribution of the three SNPs in responders and poor responders did not show any particular trend (P>0.05. The T allele was slightly higher in responders, but not significantly regardless of the type of SNP (40.3% vs. 33.8% for 1236C>T; 25% vs. 14.7% for 2677G>T and 33.3% vs. 22% for 3435C>T. The dominant model showed a similar trend (P>0.05. Diplotypes composed by the T allele in different exons were frequent in responders. Haplotype analysis showed that 1236C-2677G-3435C was slightly higher in poor responders (60.02% compared to responders (50.42%. However, 1236T-2677T-3435T was frequent in responders (16.98% compared to poor responders (13.1%. Overall, none of the haplotypes were associated with IM response in our cohort (global haplotype association test, P=0.39. Conclusion: The identification of 1236C>T, 2677G>T and 3435C>T polymorphisms may not be advantageous to predict imatinib response for our chronic myeloid leukemia patients.

  2. Breast-cancer-specific mortality in patients treated based on the 21-gene assay: a SEER population-based study.

    Science.gov (United States)

    Petkov, Valentina I; Miller, Dave P; Howlader, Nadia; Gliner, Nathan; Howe, Will; Schussler, Nicola; Cronin, Kathleen; Baehner, Frederick L; Cress, Rosemary; Deapen, Dennis; Glaser, Sally L; Hernandez, Brenda Y; Lynch, Charles F; Mueller, Lloyd; Schwartz, Ann G; Schwartz, Stephen M; Stroup, Antoinette; Sweeney, Carol; Tucker, Thomas C; Ward, Kevin C; Wiggins, Charles; Wu, Xiao-Cheng; Penberthy, Lynne; Shak, Steven

    2016-01-01

    The 21-gene Recurrence Score assay is validated to predict recurrence risk and chemotherapy benefit in hormone-receptor-positive (HR+) invasive breast cancer. To determine prospective breast-cancer-specific mortality (BCSM) outcomes by baseline Recurrence Score results and clinical covariates, the National Cancer Institute collaborated with Genomic Health and 14 population-based registries in the the Surveillance, Epidemiology, and End Results (SEER) Program to electronically supplement cancer surveillance data with Recurrence Score results. The prespecified primary analysis cohort was 40-84 years of age, and had node-negative, HR+, HER2-negative, nonmetastatic disease diagnosed between January 2004 and December 2011 in the entire SEER population, and Recurrence Score results ( N =38,568). Unadjusted 5-year BCSM were 0.4% ( n =21,023; 95% confidence interval (CI), 0.3-0.6%), 1.4% ( n =14,494; 95% CI, 1.1-1.7%), and 4.4% ( n =3,051; 95% CI, 3.4-5.6%) for Recurrence Score <18, 18-30, and ⩾31 groups, respectively ( P <0.001). In multivariable analysis adjusted for age, tumor size, grade, and race, the Recurrence Score result predicted BCSM ( P <0.001). Among patients with node-positive disease (micrometastases and up to three positive nodes; N =4,691), 5-year BCSM (unadjusted) was 1.0% ( n =2,694; 95% CI, 0.5-2.0%), 2.3% ( n =1,669; 95% CI, 1.3-4.1%), and 14.3% ( n =328; 95% CI, 8.4-23.8%) for Recurrence Score <18, 18-30, ⩾31 groups, respectively ( P <0.001). Five-year BCSM by Recurrence Score group are reported for important patient subgroups, including age, race, tumor size, grade, and socioeconomic status. This SEER study represents the largest report of prospective BCSM outcomes based on Recurrence Score results for patients with HR+, HER2-negative, node-negative, or node-positive breast cancer, including subgroups often under-represented in clinical trials.

  3. Association between the HTR2C rs1414334 C/G gene polymorphism and the development of the metabolic syndrome in patients treated with atypical antipsychotics

    Directory of Open Access Journals (Sweden)

    José María Rico-Gomis

    2016-07-01

    Full Text Available Few studies have assessed the association between the rs1414334 C/G polymorphism in the HTR2C gene and the development of the metabolic syndrome in patients treated with atypical antipsychotics. To provide further evidence, a cross-sectional study was conducted in Spain between 2012 and 2013 in 166 patients with these characteristics. In these patients, the association between the polymorphism and the presence of the metabolic syndrome was determined by implementing binary logistic regression models adjusted for variables associated with the metabolic syndrome. We did not confirm previous claims that the C allele of the polymorphism was linked to the metabolic syndrome: the association was in the opposite direction and non-significant. This conclusion held after taking gender and lifestyle variables into account.

  4. Use of whole genome deep sequencing to define emerging minority variants in virus envelope genes in herpesvirus treated with novel antimicrobial K21.

    Science.gov (United States)

    Tweedy, Joshua G; Prusty, Bhupesh K; Gompels, Ursula A

    2017-10-01

    New antivirals are required to prevent rising antimicrobial resistance from replication inhibitors. The aim of this study was to analyse the range of emerging mutations in herpesvirus by whole genome deep sequencing. We tested human herpesvirus 6 treatment with novel antiviral K21, where evidence indicated distinct effects on virus envelope proteins. We treated BACmid cloned virus in order to analyse mechanisms and candidate targets for resistance. Illumina based next generation sequencing technology enabled analyses of mutations in 85 genes to depths of 10,000 per base detecting low prevalent minority variants (<1%). After four passages in tissue culture the untreated virus accumulated mutations in infected cells giving an emerging mixed population (45-73%) of non-synonymous SNPs in six genes including two envelope glycoproteins. Strikingly, treatment with K21 did not accumulate the passage mutations; instead a high frequency mutation was selected in envelope protein gQ2, part of the gH/gL complex essential for herpesvirus infection. This introduced a stop codon encoding a truncation mutation previously observed in increased virion production. There was reduced detection of the glycoprotein complex in infected cells. This supports a novel pathway for K21 targeting virion envelopes distinct from replication inhibition. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Polymorphism at the 3'-UTR of the thymidylate synthase gene: A potential predictor for outcomes in Caucasian patients with esophageal adenocarcinoma treated with preoperative chemoradiation

    International Nuclear Information System (INIS)

    Liao Zhongxing; Liu Hongji; Swisher, Stephen G.; Wang Luo; Wu, Tsung-Teh; Correa, Arlene M.; Roth, Jack A.; Cox, James D.; Komaki, Ritsuko; Ajani, Jaffer A.; Wei Qingyi

    2006-01-01

    Purpose: To test the hypothesis that TS3'UTR polymorphisms predict outcomes in 146 Caucasian patients with esophageal adenocarcinoma treated with preoperative 5-fluorouracil-based chemoradiation. Methods and Materials: DNA was extracted from hematoxylin-and-eosin stained histologic slides of normal esophageal or gastric mucosa sections from paraffin blocks of esophagectomy specimens. Genotypes of the TS3'UTR polymorphism were determined by polymerase chain reaction for a 6-bp insertion. The genotype groups (0bp/0bp, 6bp/0bp, and 6bp/6bp) were compared for clinical features and overall survival, recurrence-free-survival, locoregional control (LRC), and distant metastasis control. Multivariable Cox regression analyses were performed to find independent predictors for the stated outcomes. Results: There was a trend of association between 6bp/6bp genotype and a decreased risk of local regional recurrence (hazards ratio = 0.211, 95% confidence interval = 0.041-1.095, p = 0.06) compared with other genotypes. There was a trend that patients with 6bp/6bp genotype had a higher 3-year probability of LRC compared with patients with the other two genotypes combined (p = 0.07); however, the difference was not statistically significant. Conclusions: The null hypotheses were not rejected in this study, probably owing to small sample size or the single gene examined. Prospective studies with adequate statistical power analyzing a family of genes involved in the 5-fluorouracil metabolism are needed to assess genetic determinants of treatment-related outcomes in esophageal adenocarcinoma

  6. Genetic link between Cabeza, a Drosophila homologue of Fused in Sarcoma (FUS), and the EGFR signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)

    2014-08-01

    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.

  7. A retrospective analysis of RET translocation, gene copy number gain and expression in NSCLC patients treated with vandetanib in four randomized Phase III studies.

    Science.gov (United States)

    Platt, Adam; Morten, John; Ji, Qunsheng; Elvin, Paul; Womack, Chris; Su, Xinying; Donald, Emma; Gray, Neil; Read, Jessica; Bigley, Graham; Blockley, Laura; Cresswell, Carl; Dale, Angela; Davies, Amanda; Zhang, Tianwei; Fan, Shuqiong; Fu, Haihua; Gladwin, Amanda; Harrod, Grace; Stevens, James; Williams, Victoria; Ye, Qingqing; Zheng, Li; de Boer, Richard; Herbst, Roy S; Lee, Jin-Soo; Vasselli, James

    2015-03-23

    To determine the prevalence of RET rearrangement genes, RET copy number gains and expression in tumor samples from four Phase III non-small-cell lung cancer (NSCLC) trials of vandetanib, a selective inhibitor of VEGFR, RET and EGFR signaling, and to determine any association with outcome to vandetanib treatment. Archival tumor samples from the ZODIAC ( NCT00312377 , vandetanib ± docetaxel), ZEAL ( NCT00418886 , vandetanib ± pemetrexed), ZEPHYR ( NCT00404924 , vandetanib vs placebo) and ZEST ( NCT00364351 , vandetanib vs erlotinib) studies were evaluated by fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) in 944 and 1102 patients. The prevalence of RET rearrangements by FISH was 0.7% (95% CI 0.3-1.5%) among patients with a known result. Seven tumor samples were positive for RET rearrangements (vandetanib, n = 3; comparator, n = 4). 2.8% (n = 26) of samples had RET amplification (innumerable RET clusters, or ≥7 copies in > 10% of tumor cells), 8.1% (n = 76) had low RET gene copy number gain (4-6 copies in ≥40% of tumor cells) and 8.3% (n = 92) were RET expression positive (signal intensity ++ or +++ in >10% of tumor cells). Of RET-rearrangement-positive patients, none had an objective response in the vandetanib arm and one patient responded in the comparator arm. Radiologic evidence of tumor shrinkage was observed in two patients treated with vandetanib and one treated with comparator drug. The objective response rate was similar in the vandetanib and comparator arms for patients positive for RET copy number gains or RET protein expression. We have identified prevalence for three RET biomarkers in a population predominated by non-Asians and smokers. RET rearrangement prevalence was lower than previously reported. We found no evidence of a differential benefit for efficacy by IHC and RET gene copy number gains. The low prevalence of RET rearrangements (0.7%) prevents firm conclusions regarding association of vandetanib treatment with

  8. Removal of bacterial contaminants and antibiotic resistance genes by conventional wastewater treatment processes in Saudi Arabia: Is the treated wastewater safe to reuse for agricultural irrigation?

    KAUST Repository

    Aljassim, Nada I.

    2015-04-01

    This study aims to assess the removal efficiency of microbial contaminants in a local wastewater treatment plant over the duration of one year, and to assess the microbial risk associated with reusing treated wastewater in agricultural irrigation. The treatment process achieved 3.5 logs removal of heterotrophic bacteria and up to 3.5 logs removal of fecal coliforms. The final chlorinated effluent had 1.8×102 MPN/100mL of fecal coliforms and fulfils the required quality for restricted irrigation. 16S rRNA gene-based high-throughput sequencing showed that several genera associated with opportunistic pathogens (e.g. Acinetobacter, Aeromonas, Arcobacter, Legionella, Mycobacterium, Neisseria, Pseudomonas and Streptococcus) were detected at relative abundance ranging from 0.014 to 21 % of the total microbial community in the influent. Among them, Pseudomonas spp. had the highest approximated cell number in the influent but decreased to less than 30 cells/100mL in both types of effluent. A culture-based approach further revealed that Pseudomonas aeruginosa was mainly found in the influent and non-chlorinated effluent but was replaced by other Pseudomonas spp. in the chlorinated effluent. Aeromonas hydrophila could still be recovered in the chlorinated effluent. Quantitative microbial risk assessment (QMRA) determined that only chlorinated effluent should be permitted for use in agricultural irrigation as it achieved an acceptable annual microbial risk lower than 10-4 arising from both P. aeruginosa and A. hydrophila. However, the proportion of bacterial isolates resistant to 6 types of antibiotics increased from 3.8% in the influent to 6.9% in the chlorinated effluent. Examples of these antibiotic-resistant isolates in the chlorinated effluent include Enterococcus and Enterobacter spp. Besides the presence of antibiotic-resistant bacterial isolates, tetracycline resistance genes tetO, tetQ, tetW, tetH, tetZ were also present at an average 2.5×102, 1.6×102, 4.4×102, 1

  9. Evaluated the Up –regulation in Gene ‎Expression of Hepatic Insulin Gene and ‎Hepatic Insulin Receptor Gene in Type 1 ‎Diabetic Rats Treated with Cuscuta chinesis ‎Lam.‎

    Directory of Open Access Journals (Sweden)

    Fadia ‎ H. Al-Sultany

    2018-02-01

    Full Text Available         This research was conducted to study the hypoglycemic activity of C. chinesis Lam on type 1 diabetic disease and investigate the  molecular and histological mechanism of  its action .many parameters was investigated , Fasting blood glucose (FBG, Fasting serum insulin,Hepatic Insulin Gene Expression, pancreas Insulin Gene Expression ,Hepatic Insulin  Receptors Gene expression  and histological sections of pancrease and liver.54 Rattus rattus male rats weighting(180 -200g were divided into 3 groups: A normal control daily administrated with Dw, B Diabetic control daily administrated with Dw  and C  diabetic group daily administrated with 400 mg/Kg body weight of C. chinesis  Lam. methanolic extract, each group consisted of  18 rats and further divided into (3 sub- groups 1 ,2  and 3. According to the period of administration  30, 60 and  90 days respectively. The results showing  the daily administration of 400 mg/Kg body weight of C. chinesis  Lam. methanolic extract for 60 day causing significance  decrease  in FBG and In the other hand each of fasting serum insulin, hepatic Insulin gene expression,pancreas Insulin gene expression and hepatic Insulin receptor gene expression was increased in group C in compare to B group and return all studied parameters involving pancrease and liver texture to the normal state ,which were statically morphologically  not appeared any significant difference from A group .this study concluded that the daily administration type 1 diabetic rats with 400 mg/Kg body weight of C. chinesis  Lam. extract for 60 day was return  fasting serum insulin and FBG to normal value by  upregulated  the gene expression of hepatic INS Gene ,INSR gene , pancreas INS Gene ,regenerate pancreatic beta- cell and returnthe texture of both liver and pancrease to the normal state

  10. Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: lessons for database annotations?

    Science.gov (United States)

    Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G

    2007-07-01

    A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD

  11. The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

    Science.gov (United States)

    Hermes, Fatemah A; Cronan, John E

    2013-10-01

    The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  12. Induction of gene expression in sheepshead minnows (Cyprinodon variegatus) treated with 17beta-estradiol, diethylstilbestrol, or ethinylestradiol: the use of mRNA fingerprints as an indicator of gene regulation.

    Science.gov (United States)

    Denslow, N D; Bowman, C J; Ferguson, R J; Lee, H S; Hemmer, M J; Folmar, L C

    2001-03-01

    The recent interest in hormonally active environmental contaminants has sparked a drive to find sensitive methods to measure their effects on wildlife. A molecular-based assay has been developed to measure the induction of gene expression in sheepshead minnows (Cyprinodon variegatus) exposed in vivo to the natural and pharmaceutical estrogens 17beta-estradiol, ethinylestradiol, and diethylstilbestrol. This method used differential display reverse transcriptase polymerase chain reaction assays to compare the expression of individual mRNAs from control and estrogen-exposed fish. Forty-eight differentially expressed cDNAs were isolated by this method, including cDNAs for vitelline envelope proteins and vitellogenin. The mRNA expression patterns for fish injected with a pharmacological dose of estradiol (5 mg/kg) were identical to those obtained in fish receiving constant aqueous exposure to 212 ng estradiol/liter. Further, the cDNA "fingerprint" pattern observed in the estradiol-treated fish also matched that obtained in fish receiving continuous-flow aqueous exposures to 192 ng ethinyl estradiol/liter and a nominal concentration of 200 ng diethylstilbestrol/liter. The results demonstrate a characteristic expression pattern for genes upregulated by exposure to a variety of natural and anthropogenic estrogens and suggest this approach may be valuable to examine the potential effects of environmental contaminants on other endocrine-mediated pathways of reproduction, growth, and development. Copyright 2001 Academic Press.

  13. A Biopsy-based 17-gene Genomic Prostate Score as a Predictor of Metastases and Prostate Cancer Death in Surgically Treated Men with Clinically Localized Disease.

    Science.gov (United States)

    Van Den Eeden, Stephen K; Lu, Ruixiao; Zhang, Nan; Quesenberry, Charles P; Shan, Jun; Han, Jeong S; Tsiatis, Athanasios C; Leimpeter, Amethyst D; Lawrence, H Jeffrey; Febbo, Phillip G; Presti, Joseph C

    2018-01-01

    A 17-gene biopsy-based reverse transcription polymerase chain reaction assay, which provides a Genomic Prostate Score (GPS-scale 0-100), has been validated as an independent predictor of adverse pathology and biochemical recurrence after radical prostatectomy (RP) in men with low- and intermediate-risk prostate cancer (PCa). To evaluate GPS as a predictor of PCa metastasis and PCa-specific death (PCD) in a large cohort of men with localized PCa and long-term follow-up. A retrospective study using a stratified cohort sampling design was performed in a cohort of men treated with RP within Kaiser Permanente Northern California. RNA from archival diagnostic biopsies was assayed to generate GPS results. We assessed the association between GPS and time to metastasis and PCD in prespecified uni- and multivariable statistical analyses, based on Cox proportional hazard models accounting for sampling weights. The final study population consisted of 279 men with low-, intermediate-, and high-risk PCa between 1995 and 2010 (median follow-up 9.8 yr), and included 64 PCD and 79 metastases. Valid GPS results were obtained for 259 (93%). In univariable analysis, GPS was strongly associated with time to PCD, hazard ratio (HR)/20 GPS units=3.23 (95% confidence interval [CI] 1.84-5.65; pstrong independent predictor of long-term outcomes in clinically localized PCa in men treated with RP and may improve risk stratification for men with newly diagnosed disease. Many prostate cancers are slow growing and unlikely to spread or threaten a man's life, while others are more aggressive and require treatment. Increasingly, doctors are using new molecular tests, such as the17-gene Genomic Prostate Score (GPS), which can be performed at the time of initial diagnosis to help determine how aggressive a given patient's cancer may be. In this study, performed in a large community-based healthcare network, GPS was shown to be a strong predictor as to whether a man's prostate cancer will spread and

  14. Chronic high-dose creatine has opposing effects on depression-related gene expression and behavior in intact and sex hormone-treated gonadectomized male and female rats.

    Science.gov (United States)

    Allen, Patricia J; DeBold, Joseph F; Rios, Maribel; Kanarek, Robin B

    2015-03-01

    Creatine is an antioxidant, neuromodulator and key regulator of energy metabolism shown to improve depressive symptoms in humans and animals, especially in females. To better understand the pharmacological effects of creatine, we examined its influence on depression-related hippocampal gene expression and behaviors in the presence and absence of sex steroids. Sham-operated and gonadectomized male and female rats were fed chow alone or chow blended with either 2% or 4% w/w creatine monohydrate for five weeks before forced swim, open field, and wire suspension tests, or seven weeks total. Before supplementation, males were chronically implanted with an empty or a testosterone-filled (T) capsule (10-mm surface release), and females were administered progesterone (P, 250 μg), estradiol benzoate (EB, 2.5 μg), EB+P, or sesame oil vehicle weekly. Relative to non-supplemented shams, all hippocampal plasticity-related mRNAs measured, including brain-derived neurotrophic factor (BDNF), tyrosine kinase B, doublecortin, calretinin, and calbindin, were downregulated in sham males given 4% creatine, and BDNF, doublecortin, and calbindin mRNAs were downregulated in sham females given 4% creatine. In contrast, combined 4% creatine+T in castrates prevented downregulation of BDNF, doublecortin, and calretinin mRNAs. Similarly, combined 4% creatine+EB+P in ovariectomized females attenuated downregulation of BDNF and calbindin mRNA levels. Moderate antidepressant and anxiolytic-like behaviors were observed in EB+P-treated ovariectomized females fed creatine, with similar trends in T-treated castrates fed creatine. Altogether, these data show that chronic, high-dose creatine has opposing effects on neuroplasticity-related genes and depressive behavior in intact and gonadectomized male and female rats. The dose and schedule of creatine used negatively impacted hippocampal neuronal integrity in otherwise healthy brains, possibly through negative compensatory changes in energy

  15. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251).

    Science.gov (United States)

    Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R

    2012-04-01

    The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  16. EGFR gene copy number as a prognostic marker in colorectal cancer patients treated with cetuximab or panitumumab: a systematic review and meta analysis.

    Directory of Open Access Journals (Sweden)

    Zheng Jiang

    Full Text Available The epidermal growth factor receptor (EGFR gene copy number (GCN has been previously demonstrated to correlate with the clinical outcome of colorectal cancer (CRC treated with anti-EGFR monoclonal antibodies (mAbs, although it remains controversial. We conducted a systematic review and meta-analysis to assess EGFR GCN as a potential biomarker of survival for patients with advanced CRC receiving treatment with anti-EGFR mAbs.We systematically identified articles investigating EGFR GCN by fluorescent or chromogenic in situ hybridization or other detection techniques in patients with metastatic CRC treated with panitumumab or cetuximab, (last search: 10 August 2012. Eligible studies had to report on overall survival (OS, progression-free survival (PFS or time-to-progression (TTP, stratified by EGFR GCN. Summary hazard ratios (HRs were calculated using random-effects models.Among 13 identified studies, 10 (776 patients, 302 with increased GCN, 8 (893 patients, 282 with increased GCN and 3 (149 patients, 66 with increased GCN were eligible for the OS, PFS and TTP meta-analyses, respectively. Increased EGFR GCN was associated with increased OS (HR = 0.62; 95% CI 0.50-0.77; P<0.001, PFS (HR = 0.65; 95% CI 0.47-0.89; P = 0.008 but not TTP (HR = 0.71; 95% CI 0.44-1.14; P = 0.157. It was also shown that EGFR GCN is independent of other factors such as KRAS status. Among those populations received second-line or higher treatment, increased EGFR GCN was strongly associated with improved survival (for OS, HR = 0.60; 95% CI 0.47-0.75; P<0.001; for PFS, HR = 0.59; 95% CI 0.47-0.75; P<0.001, whereas it did not influence survival in patients that received first-line therapy.Among the anti-EGFR-treated patients, increased EGFR GCN appears to be associated with improved survival outcomes. The effect on survival appears to be related to patients receiving the line of treatment.

  17. Relation of polymorphism C1236T and C3435T in ABCB1 gene with bone marrow suppression in chemotherapy-treated breast cancer patients

    Science.gov (United States)

    Syarifah, S.; Hamdi, T.; Widyawati, T.; Sari, M. I.; Anggraini, D. R.

    2018-03-01

    ABCB1 is agene that encoded P-glycoprotein (P-gp), a transmembrane active efflux pump for a variety of carcinogens and cytostatics.ABCB1 polymorphisms C1236T and C3435T contribute to the variability oftherapeutic outcome and side effects.The present study was conducted to investigatethe relation of C1236T and C3435T polymorphisms in ABCB1 gene with bone marrow suppression in breast cancer patients treated withchemotherapy72 Indonesian womens isolated DNA sampleswere amplified using the PCR method. The analysis process of ABCB1 C1236T and C3435T polymorphism was by using thePCR-RFLP method. The frequencies of ABCB1 C1236T genotype for homozygous CC,heterozygous CT and variant TT was 11(15.28%), 42(58.33%), 19(26.39%), respectively. No associationwas between ABCB1 C1236T and C3435T polymorphisms in both individually and haplotypes with bone marrow suppression event (p > 0.05). There was no specific deviation of allele and genotype frequency from Hardy-Weinberg Equilibrium. There was a linkage between heterozygous CT-heterozygous CT in position 1236 and 3435 within 25 people (35%).

  18. OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas.

    Science.gov (United States)

    Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A

    2010-01-01

    The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.

  19. Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

    Science.gov (United States)

    Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

    2012-10-18

    Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

  20. Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes.

    Science.gov (United States)

    Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto

    2015-10-14

    The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

  1. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  2. Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

    Science.gov (United States)

    Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

    1995-11-01

    We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

  3. The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

    International Nuclear Information System (INIS)

    Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.

    1993-01-01

    Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

  4. Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

    DEFF Research Database (Denmark)

    Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj

    2009-01-01

    hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

  5. Epigenetic Alteration by DNA Methylation of ESR1, MYOD1 and hTERT Gene Promoters is Useful for Prediction of Response in Patients of Locally Advanced Invasive Cervical Carcinoma Treated by Chemoradiation.

    Science.gov (United States)

    Sood, S; Patel, F D; Ghosh, S; Arora, A; Dhaliwal, L K; Srinivasan, R

    2015-12-01

    Locally advanced invasive cervical cancer [International Federation of Gynecology and Obstetrics (FIGO) IIB/III] is treated by chemoradiation. The response to treatment is variable within a given FIGO stage. Therefore, the aim of the present study was to evaluate the gene promoter methylation profile and corresponding transcript expression of a panel of six genes to identify genes which could predict the response of patients treated by chemoradiation. In total, 100 patients with invasive cervical cancer in FIGO stage IIB/III who underwent chemoradiation treatment were evaluated. Ten patients developed systemic metastases during therapy and were excluded. On the basis of patient follow-up, 69 patients were chemoradiation-sensitive, whereas 21 were chemoradiation-resistant. Gene promoter methylation and gene expression was determined by TaqMan assay and quantitative real-time PCR, respectively, in tissue samples. The methylation frequency of ESR1, BRCA1, RASSF1A, MLH1, MYOD1 and hTERT genes ranged from 40 to 70%. Univariate and hierarchical cluster analysis revealed that gene promoter methylation of MYOD1, ESR1 and hTERT could predict for chemoradiation response. A pattern of unmethylated MYOD1, unmethylated ESR1 and methylated hTERT promoter as well as lower ESR1 transcript levels predicted for chemoradiation resistance. Methylation profiling of a panel of three genes that includes MYOD1, ESR1 and hTERT may be useful to predict the response of invasive cervical carcinoma patients treated with standard chemoradiation therapy. Copyright © 2015 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

  6. Cytotoxicity and analysis of apoptosis gene expression in colon cancer cell line treated with cell extract of Lactobacillus casei as indigenous probiotic bacterium

    Directory of Open Access Journals (Sweden)

    Amir Mirzaie

    2017-03-01

    Full Text Available Background and aim: Nowadays, the probiotic bacteria such as lactobacilli are known as prevention factor for various disease especially cancer. The aim of this study was to investigate the cytotoxic effect of Lactobacillus casei PTCC 1608 cell extract as probiotic bacteria on colon cancer cell line (HT29 and analysis of Bax and Bcl2 apoptosis gene expression. Methods: In this experimental study, the cell extract of heat killed L. casei was prepared in 0.01, 0.1, 1, 10, 100 and 1000 µg/ml concentration and subsequently, the cytotoxicity of various cell extracts on HT29 and HEC293 cell lines were evaluated in 24 hours using MTT assay. Moreover, the Bax and Bcl2 apoptosis gene expression level in HT29 cell line was analyzed using Real Time PCR. The apoptotic effects of cell extract was determined using Flow-cytometry technique. Finally, the collected data were statistically analyzed using one-way anal­ysis of variance with the SPSS/18 software. Results: The results of MTT test show that cell extracts of L. casei is able to reduce the survival rate of HT29 cell line to 0.95±0.44, 73.45±0.21, 51.49±0.87, 39.5±0.45 and 19.7±0.55. In addition to, the Real Time PCR results indicated the expression level of Bax and Bcl2 was increased and decreased respectively, in HT29 cell line (2.76 ± 0.54 (P<0.05, 0.21 ± 0.43 (P< 0.05 in 24 h. Moreover, the flow cytometry results indicated the 35.62 % apoptosis in HT29 cell line treated with IC50 value. Conclusion: The results show that the cell extract of L. casei PTCC 1608 could induced the apoptosis in HT29 cell line and it had low toxicity on HEC293 cell line. Therefore, it seems that L. casei has potential uses as probiotic for pharmaceutical applications including prevention and treatment of colon cancer.

  7. Polymorphism of CYP3A4 and ABCB1 genes increase the risk of neuropathy in breast cancer patients treated with paclitaxel and docetaxel

    Directory of Open Access Journals (Sweden)

    Kus T

    2016-08-01

    Full Text Available Tulay Kus,1 Gokmen Aktas,1 Mehmet Emin Kalender,1 Abdullah Tuncay Demiryurek,2 Mustafa Ulasli,1 Serdar Oztuzcu,3 Alper Sevinc,1 Seval Kul,4 Celaletdin Camci1 1Department of Internal Medicine, Division of Medical Oncology, University of Gaziantep, Gaziantep Oncology Hospital, Gaziantep, Turkey; 2Department of Medical Pharmacology, 3Department of Medical Biology, Faculty of Medicine, University of Gaziantep, Gaziantep, Turkey; 4Department of Biostatistics, Faculty of Medicine, University of Gaziantep, Gaziantep, Turkey Background: Interindividual variability of pharmacogenetics may account for unpredictable neurotoxicities of taxanes. Methods: From March 2011 to June 2015, female patients with operable breast cancer who had received docetaxel- or paclitaxel-containing adjuvant chemotherapy were included in this study. All patients were treated with single-agent paclitaxel intravenously (IV 175 mg/m2 every 3 weeks for four cycles, or IV 80 mg/m2 weekly for 12 cycles, and IV 100 mg/m2 docetaxel for four cycles as adjuvant treatment. We evaluated the relationship between neurotoxicity of taxanes and single-nucleotide polymorphisms of ABCB1, CYP3A4, ERCC1, ERCC2, FGFR4, TP53, ERBB2, and CYP2C8 genes. Taxane-induced neurotoxicity during the treatment was evaluated according to the National Cancer Institute Common Toxicity Criteria version 4.03 prior to each cycle. Chi-squared tests were used to compare the two groups, and multivariate binary logistic regression models were used for determining possible risk factors of neuropathy. Results: Pharmacogenetic analysis was performed in 219 females. ABCB1 3435 TT genotype had significantly higher risk for grade ≥2 neurotoxicity (odds ratio [OR]: 2.759, 95% confidence interval [CI]: 1.172–6.493, P: 0.017 compared to TC and CC genotype, and also CYP3A4 392 AA and AG genotype had significantly higher risk for grade ≥2 neurotoxicity (OR: 2.259, 95% CI: 1.033–4.941, P: 0.038 compared to GG genotype. For

  8. 21-Gene Recurrence Score and Locoregional Recurrence in Node-Positive/ER-Positive Breast Cancer Treated With Chemo-Endocrine Therapy.

    Science.gov (United States)

    Mamounas, Eleftherios P; Liu, Qing; Paik, Soonmyung; Baehner, Frederick L; Tang, Gong; Jeong, Jong-Hyeon; Kim, S Rim; Butler, Steven M; Jamshidian, Farid; Cherbavaz, Diana B; Sing, Amy P; Shak, Steven; Julian, Thomas B; Lembersky, Barry C; Wickerham, D Lawrence; Costantino, Joseph P; Wolmark, Norman

    2017-01-01

    The 21-gene recurrence score (RS) predicts risk of locoregional recurrence (LRR) in node-negative, estrogen receptor (ER)-positive breast cancer. We evaluated the association between RS and LRR in node-positive, ER-positive patients treated with adjuvant chemotherapy plus tamoxifen in National Surgical Adjuvant Breast and Bowel Project B-28. B-28 compared doxorubicin/cyclophosphamide (AC X 4) with AC X 4 followed by paclitaxel X 4. Tamoxifen was given to patients age 50 years or older and those younger than age 50 years with ER-positive and/or progesterone receptor-positive tumors. Lumpectomy patients received breast radiotherapy. Mastectomy patients received no radiotherapy. The present study includes 1065 ER-positive, tamoxifen-treated patients with RS assessment. Cumulative incidence functions and subdistribution hazard regression models were used for LRR to account for competing risks including distant recurrence, second primary cancers, and death from other causes. Median follow-up was 11.2 years. All statistical tests were one-sided. There were 80 LRRs (7.5%) as first events (68% local/32% regional). RS was low: 36.2%; intermediate: 34.2%; and high: 29.6%. RS was a statistically significant predictor of LRR in univariate analyses (10-year cumulative incidence of LRR = 3.3%, 7.2%, and 12.2% for low, intermediate, and high RS, respectively, P < .001). In multivariable regression analysis, RS remained an independent predictor of LRR (hazard ratio [HR] = 2.59, 95% confidence interval [CI] = 1.28 to 5.26, for a 50-point difference, P = .008) along with pathologic nodal status (HR = 1.91, 95% CI = 1.20 to 3.03, for four or more vs one to three positive nodes, P = .006) and tumor size (HR = 1.28, 95% CI = 1.05 to 1.55, for a 1 cm difference, P = .02). RS statistically significantly predicts risk of LRR in node-positive, ER-positive breast cancer patients after adjuvant chemotherapy plus tamoxifen. These findings can help in the selection of

  9. Relationship between tumor gene expression and recurrence in four independent studies of patients with stage II/III colon cancer treated with surgery alone or surgery plus adjuvant fluorouracil plus leucovorin.

    Science.gov (United States)

    O'Connell, Michael J; Lavery, Ian; Yothers, Greg; Paik, Soonmyung; Clark-Langone, Kim M; Lopatin, Margarita; Watson, Drew; Baehner, Frederick L; Shak, Steven; Baker, Joffre; Cowens, J Wayne; Wolmark, Norman

    2010-09-01

    These studies were conducted to determine the relationship between quantitative tumor gene expression and risk of cancer recurrence in patients with stage II or III colon cancer treated with surgery alone or surgery plus fluorouracil (FU) and leucovorin (LV) to develop multigene algorithms to quantify the risk of recurrence as well as the likelihood of differential treatment benefit of FU/LV adjuvant chemotherapy for individual patients. We performed quantitative reverse transcription polymerase chain reaction (RT-qPCR) on RNA extracted from fixed, paraffin-embedded (FPE) tumor blocks from patients with stage II or III colon cancer who were treated with surgery alone (n = 270 from National Surgical Adjuvant Breast and Bowel Project [NSABP] C-01/C-02 and n = 765 from Cleveland Clinic [CC]) or surgery plus FU/LV (n = 308 from NSABP C-04 and n = 508 from NSABP C-06). Overall, 761 candidate genes were studied in C-01/C-02 and C-04, and a subset of 375 genes was studied in CC/C-06. A combined analysis of the four studies identified 48 genes significantly associated with risk of recurrence and 66 genes significantly associated with FU/LV benefit (with four genes in common). Seven recurrence-risk genes, six FU/LV-benefit genes, and five reference genes were selected, and algorithms were developed to identify groups of patients with low, intermediate, and high likelihood of recurrence and benefit from FU/LV. RT-qPCR of FPE colon cancer tissue applied to four large independent populations has been used to develop multigene algorithms for estimating recurrence risk and benefit from FU/LV. These algorithms are being independently validated, and their clinical utility is being evaluated in the Quick and Simple and Reliable (QUASAR) study.

  10. Gene expression profiling identifies FYN as an important molecule in tamoxifen resistance and a predictor of early recurrence in patients treated with endocrine therapy

    DEFF Research Database (Denmark)

    Elias, D; (Hansen) Vever, Henriette; Lænkholm, A-V

    2015-01-01

    To elucidate the molecular mechanisms of tamoxifen resistance in breast cancer, we performed gene array analyses and identified 366 genes with altered expression in four unique tamoxifen-resistant (TamR) cell lines vs the parental tamoxifen-sensitive MCF-7/S0.5 cell line. Most of these genes were...

  11. Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

    Energy Technology Data Exchange (ETDEWEB)

    Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson

    2011-12-31

    The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.

  12. The actin homologue MreB organizes the bacterial cell membrane.

    Science.gov (United States)

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

    2014-03-07

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

  13. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

    2012-08-21

    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  14. 4-Oxalocrotonate tautomerase, its homologue YwhB, and active vinylpyruvate hydratase : Synthesis and evaluation of 2-fluoro substrate analogues

    NARCIS (Netherlands)

    Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P

    2004-01-01

    A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in

  15. Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

    International Nuclear Information System (INIS)

    Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

    2009-01-01

    Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

  16. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development

    Directory of Open Access Journals (Sweden)

    Markéta Kostrouchová

    2017-06-01

    Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  17. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development.

    Science.gov (United States)

    Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk

    2017-01-01

    The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  18. An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus

    Science.gov (United States)

    Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.

    2010-01-01

    Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

  19. Acute Normal Tissue Reactions in Head-and-Neck Cancer Patients Treated With IMRT: Influence of Dose and Association With Genetic Polymorphisms in DNA DSB Repair Genes

    International Nuclear Information System (INIS)

    Werbrouck, Joke; Ruyck, Kim de; Duprez, Frederic; Veldeman, Liv; Claes, Kathleen; Eijkeren, Marc van; Boterberg, Tom; Willems, Petra; Vral, Anne; Neve, Wilfried de; Thierens, Hubert

    2009-01-01

    Purpose: To investigate the association between dose-related parameters and polymorphisms in DNA DSB repair genes XRCC3 (c.-1843A>G, c.562-14A>G, c.722C>T), Rad51 (c.-3429G>C, c.-3392G>T), Lig4 (c.26C>T, c.1704T>C), Ku70 (c.-1310C>G), and Ku80 (c.2110-2408G>A) and the occurrence of acute reactions after radiotherapy. Materials and Methods: The study population consisted of 88 intensity-modulated radiation therapy (IMRT)-treated head-and-neck cancer patients. Mucositis, dermatitis, and dysphagia were scored using the Common Terminology Criteria (CTC) for Adverse Events v.3.0 scale. The population was divided into a CTC0-2 and CTC3+ group for the analysis of each acute effect. The influence of the dose on critical structures was analyzed using dose-volume histograms. Genotypes were determined by polymerase chain reaction (PCR) combined with restriction fragment length polymorphism or PCR-single base extension assays. Results: The mean dose (D mean ) to the oral cavity and constrictor pharyngeus (PC) muscles was significantly associated with the development of mucositis and dysphagia, respectively. These parameters were considered confounding factors in the radiogenomics analyses. The XRCC3c.722CT/TT and Ku70c.-1310CG/GG genotypes were significantly associated with the development of severe dysphagia (CTC3+). No association was found between the investigated polymorphisms and the development of mucositis or dermatitis. A risk analysis model for severe dysphagia, which was developed based on the XRCC3c.722CT/TT and Ku70c.-1310CG/GG genotypes and the PC dose, showed a sensitivity of 78.6% and a specificity of 77.6%. Conclusions: The XRCC3c.722C>T and Ku70c.-1310C>G polymorphisms as well as the D mean to the PC muscles were highly associated with the development of severe dysphagia after IMRT. The prediction model developed using these parameters showed a high sensitivity and specificity

  20. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    International Nuclear Information System (INIS)

    Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat

    2011-01-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  1. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    Energy Technology Data Exchange (ETDEWEB)

    Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)

    2011-12-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

  2. [Expression and functions of adaptive response genes in Escherichia coli treated with mono- and bifunctional alkylating agents. Interference with SOS response].

    Science.gov (United States)

    Vasil'eva, S V; Makhova, E V; Moshkovskaia, E Iu

    1999-04-01

    The expression of genes belonging to the Ada regulon of Escherichia coli under the action of mono- and bifunctional alkylating agents--high-efficiency antitumor HMM, ACNU, and BCNU preparations--was studied. The functional specificity of the alkA, alkB, and aidB1 genes concerning both the structure and volume of DNA alkylation and the specificity of cell preadaptation was revealed. Additional experimental evidence for the role of the aidB1 gene as a unique "hazard gene", a component of the E. coli ada operon, was obtained. A phenomenon of positive interference between alternative SOS and Ada responses was observed for the first time upon gene expression.

  3. Tumor necrosis factor-alpha-independent downregulation of hepatic cholesterol 7alpha-hydroxylase gene in mice treated with lead nitrate.

    Science.gov (United States)

    Kojima, Misaki; Sekikawa, Kenji; Nemoto, Kiyomitsu; Degawa, Masakuni

    2005-10-01

    We previously reported that lead nitrate (LN), an inducer of hepatic tumor necrosis factor-alpha (TNF-alpha), downregulated gene expression of cholesterol 7alpha-hydroxylase. Herein, to clarify the role of TNF-alpha in LN-induced downregulation of cholesterol 7alpha-hydroxylase, effects of LN on gene expression of hepatic cholesterol 7alpha-hydroxylase (Cyp7a1) in TNF-alpha-knockout (KO) and TNF-alpha-wild-type (WT) mice were comparatively examined. Gene expression of hepatic Cyp7a1 in both WT and KO mice decreased to less than 5% of the corresponding controls at 6-12 h after treatment with LN (100 mumol/kg body weight, iv). Levels of hepatic TNF-alpha protein in either WT or KO mice were below the detection limit, although expression levels of the TNF-alpha gene markedly increased at 6 h in WT mice by LN treatment, but not in KO mice. In contrast, in both WT and KO mice, levels of hepatic IL-1beta protein, which is known to be a suppressor of the cholesterol 7alpha-hydroxylase gene in hamsters, were significantly increased 3-6 h after LN treatment. Furthermore, LN-induced downregulation of the Cyp7a1 gene did not necessarily result from altered gene expression of hepatic transcription factors, including positive regulators (liver X receptor alpha, retinoid X receptor alpha, fetoprotein transcription factor, and hepatocyte nuclear factor 4alpha) and a negative regulator small heterodimer partner responsible for expression of the Cyp7a1 gene. The present findings indicated that LN-induced downregulation of the Cyp7a1 gene in mice did not necessarily occur through a TNF-alpha-dependent pathway and might occur mainly through an IL-1beta-dependent pathway.

  4. Doublesex: a conserved downstream gene controlled by diverse ...

    Indian Academy of Sciences (India)

    The Drosophila doublesex (dsx) gene at the bottom of the sex-determination cascade is the best characterized candidate so far, and is conserved from worms (mab3 of Caenorhabditis elegans) to mammals (Dmrt-1). Studies of dsx homologues from insect species belonging to different orders position them at the bottom of ...

  5. Transcriptome analysis of H2O2-treated wheat seedlings reveals a H2O2-responsive fatty acid desaturase gene participating in powdery mildew resistance.

    Directory of Open Access Journals (Sweden)

    Aili Li

    Full Text Available Hydrogen peroxide (H(2O(2 plays important roles in plant biotic and abiotic stress responses. However, the effect of H(2O(2 stress on the bread wheat transcriptome is still lacking. To investigate the cellular and metabolic responses triggered by H(2O(2, we performed an mRNA tag analysis of wheat seedlings under 10 mM H(2O(2 treatment for 6 hour in one powdery mildew (PM resistant (PmA and two susceptible (Cha and Han lines. In total, 6,156, 6,875 and 3,276 transcripts were found to be differentially expressed in PmA, Han and Cha respectively. Among them, 260 genes exhibited consistent expression patterns in all three wheat lines and may represent a subset of basal H(2O(2 responsive genes that were associated with cell defense, signal transduction, photosynthesis, carbohydrate metabolism, lipid metabolism, redox homeostasis, and transport. Among genes specific to PmA, 'transport' activity was significantly enriched in Gene Ontology analysis. MapMan classification showed that, while both up- and down- regulations were observed for auxin, abscisic acid, and brassinolides signaling genes, the jasmonic acid and ethylene signaling pathway genes were all up-regulated, suggesting H(2O(2-enhanced JA/Et functions in PmA. To further study whether any of these genes were involved in wheat PM response, 19 H(2O(2-responsive putative defense related genes were assayed in wheat seedlings infected with Blumeria graminis f. sp. tritici (Bgt. Eight of these genes were found to be co-regulated by H(2O(2 and Bgt, among which a fatty acid desaturase gene TaFAD was then confirmed by virus induced gene silencing (VIGS to be required for the PM resistance. Together, our data presents the first global picture of the wheat transcriptome under H(2O(2 stress and uncovers potential links between H(2O(2 and Bgt responses, hence providing important candidate genes for the PM resistance in wheat.

  6. Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

    DEFF Research Database (Denmark)

    Riess, O; Weber, B; Nørremølle, Anne

    1992-01-01

    as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

  7. Expression of Hormonal Carcinogenesis Genes and Related Regulatory microRNAs in Uterus and Ovaries of DDT-Treated Female Rats.

    Science.gov (United States)

    Kalinina, T S; Kononchuk, V V; Gulyaeva, L F

    2017-10-01

    The insecticide dichlorodiphenyltrichloroethane (DDT) is a nonmutagenic xenobiotic compound able to exert estrogen-like effects resulting in activation of estrogen receptor-α (ERα) followed by changed expression of its downstream target genes. In addition, studies performed over recent years suggest that DDT may also influence expression of microRNAs. However, an impact of DDT on expression of ER, microRNAs, and related target genes has not been fully elucidated. Here, using real-time PCR, we assessed changes in expression of key genes involved in hormonal carcinogenesis as well as potentially related regulatory oncogenic/tumor suppressor microRNAs and their target genes in the uterus and ovaries of female Wistar rats during single and chronic multiple-dose DDT exposure. We found that applying DDT results in altered expression of microRNAs-221, -222, -205, -126a, and -429, their target genes (Pten, Dicer1), as well as genes involved in hormonal carcinogenesis (Esr1, Pgr, Ccnd1, Cyp19a1). Notably, Cyp19a1 expression seems to be also regulated by microRNAs-221, -222, and -205. The data suggest that epigenetic effects induced by DDT as a potential carcinogen may be based on at least two mechanisms: (i) activation of ERα followed by altered expression of the target genes encoding receptor Pgr and Ccnd1 as well as impaired expression of Cyp19a1, affecting, thereby, cell hormone balance; and (ii) changed expression of microRNAs resulting in impaired expression of related target genes including reduced level of Cyp19a1 mRNA.

  8. Removal of bacterial contaminants and antibiotic resistance genes by conventional wastewater treatment processes in Saudi Arabia: Is the treated wastewater safe to reuse for agricultural irrigation?

    KAUST Repository

    Aljassim, Nada I.; Ansari, Mohd Ikram; Harb, Moustapha; Hong, Pei-Ying

    2015-01-01

    This study aims to assess the removal efficiency of microbial contaminants in a local wastewater treatment plant over the duration of one year, and to assess the microbial risk associated with reusing treated wastewater in agricultural irrigation

  9. Medroxyprogesterone acetate-treated human, primary endometrial epithelial cells reveal unique gene expression signature linked to innate immunity and HIV-1 susceptibility.

    Science.gov (United States)

    Woods, Matthew W; Zahoor, Muhammad Atif; Dizzell, Sara; Verschoor, Chris P; Kaushic, Charu

    2018-01-01

    Medroxyprogesterone acetate (MPA), a progestin-based hormonal contraceptive designed to mimic progesterone, has been linked to increased human immunodeficiency virus (HIV-1) susceptibility. Genital epithelial cells (GECs) form the mucosal lining of the female genital tract (FGT) and provide the first line of protection against HIV-1. The impact of endogenous sex hormones or MPA on the gene expression profile of GECs has not been comprehensively documented. Using microarray analysis, we characterized the transcriptional profile of primary endometrial epithelial cells grown in physiological levels of E2, P4, and MPA. Each hormone treatment altered the gene expression profile of GECs in a unique manner. Interestingly, although MPA is a progestogen, the gene expression profile induced by it was distinct from P4. MPA increased gene expression of genes related to inflammation and cholesterol synthesis linked to innate immunity and HIV-1 susceptibility. The analysis of gene expression profiles provides insights into the effects of sex hormones and MPA on GECs and allows us to posit possible mechanisms of the MPA-mediated increase in HIV-1 acquisition. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Equilibrium evaporation behavior of polonium and its homologue tellurium in liquid lead-bismuth eutectic

    International Nuclear Information System (INIS)

    Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru

    2006-01-01

    Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)

  11. Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT

    Science.gov (United States)

    Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David

    2011-01-01

    High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

  12. Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues

    Science.gov (United States)

    Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.

    2017-10-01

    Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.

  13. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.

    Science.gov (United States)

    Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano

    2009-12-01

    Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

  14. Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

    Energy Technology Data Exchange (ETDEWEB)

    Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)

    2008-02-01

    The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

  15. Stereoselectivity of the demethylation of nicotine piperidine homologues by Nicotiana plumbaginifolia cell suspension cultures.

    Science.gov (United States)

    Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J

    2005-08-01

    The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.

  16. The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.

    Science.gov (United States)

    Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi

    2016-01-01

    We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

  18. Effect of temperature on the fate of genes encoding tetracycline resistance and the integrase of class 1 integrons within anaerobic and aerobic digesters treating municipal wastewater solids.

    Science.gov (United States)

    Diehl, David L; LaPara, Timothy M

    2010-12-01

    The objective of this research was to investigate the ability of anaerobic and aerobic digesters to reduce the quantity of antibiotic resistant bacteria in wastewater solids. Lab-scale digesters were operated at different temperatures (22 °C, 37 °C, 46 °C, and 55 °C) under both anaerobic and aerobic conditions and fed wastewater solids collected from a full-scale treatment facility. Quantitative PCR was used to track five genes encoding tetracycline resistance (tet(A), tet(L), tet(O), tet(W), and tet(X)) and the gene encoding the integrase (intI1) of class 1 integrons. Statistically significant reductions in the quantities of these genes occurred in the anaerobic reactors at 37 °C, 46 °C, and 55 °C, with the removal rates and removal efficiencies increasing as a function of temperature. The aerobic digesters, in contrast, were generally incapable of significantly decreasing gene quantities, although these digesters were operated at much shorter mean hydraulic residence times. This research suggests that high temperature anaerobic digestion of wastewater solids would be a suitable technology for eliminating various antibiotic resistance genes, an emerging pollutant of concern.

  19. Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns.

    Science.gov (United States)

    Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael

    2006-08-15

    Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

  20. Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

    Directory of Open Access Journals (Sweden)

    Zhitao Qi

    2015-01-01

    Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

  1. The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora.

    Science.gov (United States)

    Bernhards, Yasmine; Pöggeler, Stefanie

    2011-04-01

    Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.

  2. An Epichloë festucae homologue of MOB3, a component of the STRIPAK complex, is required for the establishment of a mutualistic symbiotic interaction with Lolium perenne

    Science.gov (United States)

    Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.

    2016-01-01

    Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141

  3. Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue.

    Science.gov (United States)

    Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S

    1999-04-30

    Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

  4. Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling.

    Science.gov (United States)

    Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M

    2000-04-01

    The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

  5. Stress-induced activation of the brainstem Bcl-xL gene expression in rats treated with fluoxetine: correlations with serotonin metabolism and depressive-like behavior.

    Science.gov (United States)

    Shishkina, Galina T; Kalinina, Tatyana S; Berezova, Inna V; Dygalo, Nikolay N

    2012-01-01

    Mechanisms underlying stress-induced depression and antidepressant drug action were shown to involve alterations in serotonergic (5-HT) neurotransmission and expression of genes coding for proteins associated with neurotrophic signaling pathways and cell-survival in the hippocampus and cortex. Expression of these genes in the brainstem containing 5-HT neurons may also be related to vulnerability or resilience to stress-related psychopathology. Here we investigated 5-HT markers and expression of genes for Brain-Derived Neurotrophic Factor (BDNF) and apoptotic proteins in the brainstem in relation to swim stress-induced behavioral despair. We found that anti-apoptotic Bcl-xL gene is sensitive to stress during the course of fluoxetine administration. Responsiveness of this gene to stress appeared concomitantly with an antidepressant-like effect of fluoxetine in the forced swim test. Bcl-xL transcript levels showed negative correlations with duration of immobility in the test and 5-HT turnover in the brainstem. In contrast, BDNF and pro-apoptotic protein Bax mRNA levels were unchanged by either fluoxetine or stress, suggesting specificity of Bcl-xL gene responses to these treatments. We also found that the levels of mRNAs for tryptophan hydroxylase-2 (TPH2) and 5-HT transporter (5-HTT) were significantly down-regulated following prolonged treatment with fluoxetine, but were not affected by stress. Unlike TPH2 and 5-HTT, 5-HT1A receptor mRNA levels were not altered by fluoxetine but significantly increased in response to swim stress. These data show that long-term fluoxetine treatment leads to changes in 5-HT and Bcl-xL responses to stress associated with antidepressant-like effects of the drug. This article is part of a Special Issue entitled 'Anxiety and Depression'. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Concerted transcription of auxin and carbohydrate homeostasis-related genes underlies improved adventitious rooting of microcuttings derived from far-red treated Eucalyptus globulus Labill mother plants.

    Science.gov (United States)

    Ruedell, Carolina Michels; de Almeida, Márcia Rodrigues; Fett-Neto, Arthur Germano

    2015-12-01

    Economically important plant species, such as Eucalyptus globulus, are often rooting recalcitrant. We have previously shown that far-red light enrichment applied to E. globulus donor-plants improved microcutting rooting competence and increased rooting zone/shoot carbohydrate ratio. To better understand this developmental response, the relative expression profiles of genes involved in auxin signaling (ARF6, ARF8, AGO1), biosynthesis (YUC3) and transport (AUX1, PIN1, PIN2); sucrose cleavage (SUS1, CWINV1), transport (SUC5), hexose phosphorylation (HXK1, FLN1) and starch biosynthesis (SS3) were quantified during adventitious rooting of E. globulus microcuttings derived from donor plants exposed to far-red or white light. Expression of auxin transport-related genes increased in the first days of root induction. Far-red enrichment of donor plants induced ARF6, ARF8 and AGO1 in microcuttings. The first two gene products could activate GH3 and other rooting related genes, whereas AGO1 deregulation of the repressor ARF17 may relief rooting inhibition. Increased sink strength at the basal stem with sucrose unloading in root tissue mediated by SUC and subsequent hydrolysis by SUS1 were also supported by gene expression profile. Fructose phosphorylation and starch biosynthesis could also contribute to proper carbon allocation at the site of rooting, as evidenced by increased expression of related genes. These data are in good agreement with increased contents of hexoses and starch at the cutting base severed from far-red exposed donor plants. To sum up, pathways integrating auxin and carbohydrate metabolism were activated in microcuttings derived from donor plants exposed to far red light enrichment, thereby improving rooting response in E. globulus. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  7. Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

    Directory of Open Access Journals (Sweden)

    Bart eGeurten

    2012-03-01

    Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

  8. Mono-, di- and trimethylated homologues of isoprenoid tetraether lipid cores in archaea and environmental samples: mass spectrometric identification and significance.

    Science.gov (United States)

    Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan

    2015-12-01

    Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.

  9. Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

    International Nuclear Information System (INIS)

    Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

  10. Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

    Science.gov (United States)

    Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

    2013-01-01

    Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

  11. The effects of lymph node status on predicting outcome in ER+ /HER2- tamoxifen treated breast cancer patients using gene signatures

    International Nuclear Information System (INIS)

    Cockburn, Jessica G.; Hallett, Robin M.; Gillgrass, Amy E.; Dias, Kay N.; Whelan, T.; Levine, M. N.; Hassell, John A.; Bane, Anita

    2016-01-01

    Lymph node (LN) status is the most important prognostic variable used to guide ER positive (+) breast cancer treatment. While a positive nodal status is traditionally associated with a poor prognosis, a subset of these patients respond well to treatment and achieve long-term survival. Several gene signatures have been established as a means of predicting outcome of breast cancer patients, but the development and indication for use of these assays varies. Here we compare the capacity of two approved gene signatures and a third novel signature to predict outcome in distinct LN negative (-) and LN+ populations. We also examine biological differences between tumours associated with LN- and LN+ disease. Gene expression data from publically available data sets was used to compare the ability of Oncotype DX and Prosigna to predict Distant Metastasis Free Survival (DMFS) using an in silico platform. A novel gene signature (Ellen) was developed by including patients with both LN- and LN+ disease and using Prediction Analysis of Microarrays (PAM) software. Gene Set Enrichment Analysis (GSEA) was used to determine biological pathways associated with patient outcome in both LN- and LN+ tumors. The Oncotype DX gene signature, which only used LN- patients during development, significantly predicted outcome in LN- patients, but not LN+ patients. The Prosigna gene signature, which included both LN- and LN+ patients during development, predicted outcome in both LN- and LN+ patient groups. Ellen was also able to predict outcome in both LN- and LN+ patient groups. GSEA suggested that epigenetic modification may be related to poor outcome in LN- disease, whereas immune response may be related to good outcome in LN+ disease. We demonstrate the importance of incorporating lymph node status during the development of prognostic gene signatures. Ellen may be a useful tool to predict outcome of patients regardless of lymph node status, or for those with unknown lymph node status. Finally we

  12. Tricky Treats

    Centers for Disease Control (CDC) Podcasts

    The Eagle Books are a series of four books that are brought to life by wise animal characters - Mr. Eagle, Miss Rabbit, and Coyote - who engage Rain That Dances and his young friends in the joy of physical activity, eating healthy foods, and learning from their elders about health and diabetes prevention. Tricky Treats shows children the difference between healthy snacks and sweet treats.

  13. Rheumatoid Factor Positivity Is Associated with Increased Joint Destruction and Upregulation of Matrix Metalloproteinase 9 and Cathepsin K Gene Expression in the Peripheral Blood in Rheumatoid Arthritic Patients Treated with Methotrexate

    Directory of Open Access Journals (Sweden)

    Elena V. Tchetina

    2013-01-01

    Full Text Available We evaluated changes in gene expression of mTOR, p21, caspase-3, ULK1, TNFα, matrix metalloproteinase (MMP-9, and cathepsin K in the whole blood of rheumatoid arthritic (RA patients treated with methotrexate (MTX in relation to their rheumatoid factor status, clinical, immunological, and radiological parameters, and therapeutic response after a 24-month follow-up. The study group consisted of 35 control subjects and 33 RA patients without previous history of MTX treatment. Gene expression was measured using real-time RT-PCR. Decreased disease activity in patients at the end of the study was associated with significant downregulation of TNFα expression. Downregulation of mTOR was observed in seronegative patients, while no significant changes in the expression of p21, ULK1, or caspase-3 were noted in any RA patients at the end of the study. The increase in erosion numbers observed in the seropositive patients at the end of the follow-up was accompanied by upregulation of MMP-9 and cathepsin K, while seronegative patients demonstrated an absence of significant changes in MMP-9 and cathepsin K expression and no increase in the erosion score. Our results suggest that increased expression of MMP-9 and cathepsin K genes in the peripheral blood might indicate higher bone tissue destruction activity in RA patients treated with methotrexate. The clinical study registration number is 0120.0810610.

  14. Diversity of nifH gene pools in the rhizosphere of two cultivars of sorghum (Sorghum bicolor) treated with contrasting levels of nitrogen fertilizer

    NARCIS (Netherlands)

    Coelho, M.R.R.; Vos, de M.; Carneiro, N.P.; Marriel, I.E.; Paiva, E.; Seldin, L.

    2008-01-01

    The diversity of nitrogen-fixing bacteria was assessed in the rhizospheres of two cultivars of sorghum (IS 5322-C and IPA 1011) sown in Cerrado soil amended with two levels of nitrogen fertilizer (12 and 120 kg ha(-1)). The nifH gene was amplified directly from DNA extracted from the rhizospheres,

  15. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

    2004-01-01

    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  16. Combinations of Polymorphisms in Genes Involved in the 5-Fluorouracil Metabolism Pathway Are Associated with Gastrointestinal Toxicity in Chemotherapy-Treated Colorectal Cancer Patients

    DEFF Research Database (Denmark)

    Afzal, Shoaib; Gusella, Milena; Vainer, Ben

    2011-01-01

    PURPOSE: The purpose of this study was to investigate whether specific combinations of polymorphisms in genes encoding proteins involved in 5-fluorouracil (5-FU) pharmacokinetics and pharmacodynamics are associated with increased risk of treatment-induced toxicity. EXPERIMENTAL DESIGN: We analyze...

  17. Expression changes of serotonin receptor gene subtype 5HT3a in peripheral blood mononuclear cells from schizophrenic patients treated with haloperidol and Olanzapin.

    Science.gov (United States)

    Shariati, Gholam Reza; Ahangari, Ghasem; Hossein-nezhad, Arash; Asadi, Seyed Mohammad; Pooyafard, Farzaneh; Ahmadkhaniha, Hamid Reza

    2009-09-01

    Serotonin receptors are involved in pathophysiology of schizophrenia and may mediate other neurotransmitter effects. We investigated serotonin receptors gene expression in peripheral blood mononuclear cells (PBMC) of naïve schizophrenic patients, before and after treatment. Also serotonin receptor gene expression was compared in two treatment groups including Haloperidol and Olanzapine. The PBMC was separated from whole blood by Ficoll-hypaque. The total cellular RNA was extracted and the cDNA was synthesized. This process was followed by real-time PCR using primer pairs specific for 5HT(3a) serotonin receptor mRNA and beta-actin as internal control. The results showed the presence of subtype of serotonin receptor in lymphocytes. Serotonin gene expression showed significant changes in Olanzapine treatment group which correlated with Clinical Global Impression (CGI) score improvement. In conclusion, the present study has shown that human PBMC express serotonin receptors 5HT(3a). Moreover, clinical symptom improvement of Olanzapin may be demonstrated by a change in serotonin receptor gene expression.

  18. The human homologue of unc-93 maps to chromosome 6q27 – characterisation and analysis in sporadic epithelial ovarian cancer

    Directory of Open Access Journals (Sweden)

    Charnock F Mark L

    2002-10-01

    Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.

  19. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan

    2013-01-01

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  20. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  1. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng

    2013-05-22

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  2. Synthesis, electrochemistry, and electrogenerated chemiluminescence of two BODIPY-appended bipyridine homologues.

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J

    2013-09-11

    Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.

  3. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Yanyan Lu

    2018-04-01

    Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

  4. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

    Science.gov (United States)

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

    2018-01-01

    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  5. Neurophysiological Evidence That Musical Training Influences the Recruitment of Right Hemispheric Homologues for Speech Perception

    Directory of Open Access Journals (Sweden)

    McNeel Gordon Jantzen

    2014-03-01

    Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.

  6. Synthesis, Electrochemistry and Electrogenerated Chemiluminesce of two BODIPY-Appended Bipyridine Homologues

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.

    2014-01-01

    Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850

  7. Global Liver Gene Expression Analysis on a Murine Metabolic Syndrome Model Treated by Low-molecular-weight Lychee Fruit Polyphenol (Oligonol®).

    Science.gov (United States)

    Uchiyama, Hironobu; Uehara, Kaori; Nagashima, Takayuki; Nakata, Akifumi; Sato, Keisuke; Mihara, Yoshihiro; Komatsu, Ken-Ich; Takanari, Jun; Shimizu, Shigeomi; Wakame, Koji

    2016-07-01

    Oligonol® (OLG) is a low-molecular-weight lychee fruit polyphenol mainly containing catechin-type monomers and oligomers of proanthocyanidins. Dietary OLG supplementation reportedly improves lipid metabolism disorder and lowers the visceral fat level in animal and human studies. Thus, we investigated the mechanism behind the protective and beneficial effects of OLG on a Western diet (WD)-induced metabolic syndrome (MetS) of a murine model. Using the C57BL/6J mouse for the MetS model, mice were divided into three groups: control (normal diet: ND), Western diet (WD) and WD + 0.5% OLG (OLG) groups. The WD group was fed a high-calorie (high fructose plus high fat) diet for 12 weeks to develop MetS. At week 12, all mice were sacrificed and the blood and liver were obtained for histological and biological examinations and RNA sequencing (RNA-Seq). Body weight, liver weight, plasma triglycerides (TG), total cholesterol (T-Cho) and alanine aminotransferase (ATS) levels of both OLG groups were significantly lower than those of the WD group. On histological examination of the liver, the area of fatty deposits was shown to be suppressed by OLG administration. Expression gene analysis in the liver of WD- versus OLG-fed mice by RNA-Seq showed that 464/45,706 genes exhibited a significant change of expression (corrected p-value metabolism-related genes Lpin1, Adig and Cidea were regulated by OLG administration. OLG may function to suppress MetS and the progression of geriatric diseases in WD-fed mice by regulating the expression of lipid metabolism, inflammation and tumor-related genes in the liver. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  8. PAI-1 4G/5G gene polymorphism is associated with angiographic patency in ST-elevation myocardial infarction patients treated with thrombolytic therapy.

    Science.gov (United States)

    Ozkan, Bugra; Cagliyan, Caglar E; Elbasan, Zafer; Uysal, Onur K; Kalkan, Gulhan Y; Bozkurt, Mehmet; Tekin, Kamuran; Bozdogan, Sevcan T; Ozalp, Ozge; Duran, Mustafa; Sahin, Durmus Y; Cayli, Murat

    2012-09-01

    In this study, we examined the relationship between PAI-1 4G/5G polymorphism and patency of the infarct-related artery after thrombolysis in patients with ST-elevation myocardial infarction (STEMI). Acute STEMI patients who received thrombolytic therapy within first 12 h were included in our study. The PAI-1 4G/5G promoter region insertion/deletion polymorphism was studied from venous blood samples. Patients with the PAI-1 4G/5G gene polymorphism were included in group 1 and the others were included in group 2. Coronary angiography was performed in all patients in the first 24 h after receiving thrombolytic therapy. Thrombolysis in myocardial infarction (TIMI) 0-1 flow in the infarct-related artery was considered as 'no flow', TIMI 2 flow as 'slow flow', and TIMI 3 flow as 'normal flow'. A total of 61 patients were included in our study. Thirty patients (49.2%) were positive for the PAI-1 4G/5G gene polymorphism, whereas 31 of them (50.8%) were in the control group. There were significantly more patients with 'no flow' (14 vs. 6; P=0.02) and less patients with 'normal flow' (8 vs. 19; P=0.02) in group 1. In addition, time to thrombolytic therapy (TTT) was maximum in the 'no flow' group and minimum in the 'normal flow' group (P=0.005). In the logistic regression analysis, TTT (odds ratio: 0.9898; 95% confidence interval: 0.982-0.997; P=0.004) and the PAI-1 4G/5G gene polymorphism (odds ratio: 4.621; 95% confidence interval: 1.399-15.268; P5G gene polymorphism and TTT are associated independently with 'no flow' after thrombolysis in patients with STEMI.

  9. Expression of selected genes of dendritic and Treg cells in blood and skin of morphea patients treated with UVA1 phototherapy

    Science.gov (United States)

    Osmola-Mańkowska, Agnieszka J.; Kowalczyk, Michał J.; Żaba, Ryszard W.; Adamski, Zygmunt; Dańczak-Pazdrowska, Aleksandra

    2018-01-01

    Introduction Morphea is a chronic autoimmune disease characterized by fibrosis of the skin. Dendritic cells (DC) and regulatory T cells (Tregs) play a significant role in development of autoimmune and tolerance mechanisms. The aim of the study was to establish the expression of selected genes of plasmacytoid and myeloid DC, Treg cells, and the microenvironment of cytokines (interleukin-17A (IL-17A), transforming growth factor β (TGF-β)) in blood and skin of morphea patients. In addition, the effect of UVA1 phototherapy on expression of the aforementioned genes was evaluated. Material and methods The study was performed on 15 blood and 10 skin samples from patients with morphea. The evaluation included expression of CLEC4C (C-type lectin domain family 4, member C receptor), Lymphocyte antigen 75 (LY75), Forkhead box p3 (foxp3) transcription factor, IL-17A and TGF-β genes in peripheral blood mononuclear cells (PBMC) and in skin samples both before and after UVA1 phototherapy using real-time polymerase chain reaction. Results The study revealed lower expression of CLEC4C before (p = 0.010) and after (p = 0.009) phototherapy and lower expression of IL-17A before (p = 0.038) phototherapy in PBMC of patients with morphea vs. the control group. Expression of CLEC4C in PBMC correlated negatively (rho = –0.90; p = 0.001) with activity of disease after phototherapy. No significant differences were found between expression of analysed genes before and after UVA1 therapy in PBMC and skin of morphea patients. Conclusions The results do not confirm the involvement of analysed subsets of DC and Tregs in UVA1 phototherapy in morphea, but point to CLEC4C as a possible biomarker associated with the disease activity. PMID:29593811

  10. An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.

    Science.gov (United States)

    Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo

    2006-10-01

    Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.

  11. Up-regulation of glutathione-related genes, enzyme activities and transport proteins in human cervical cancer cells treated with doxorubicin.

    Science.gov (United States)

    Drozd, Ewa; Krzysztoń-Russjan, Jolanta; Marczewska, Jadwiga; Drozd, Janina; Bubko, Irena; Bielak, Magda; Lubelska, Katarzyna; Wiktorska, Katarzyna; Chilmonczyk, Zdzisław; Anuszewska, Elżbieta; Gruber-Bzura, Beata

    2016-10-01

    Doxorubicin (DOX), one of the most effective anticancer drugs, acts in a variety of ways including DNA damage, enzyme inhibition and generation of reactive oxygen species. Glutathione (GSH) and glutathione-related enzymes including: glutathione peroxidase (GPX), glutathione reductase (GSR) and glutathione S-transferases (GST) may play a role in adaptive detoxification processes in response to the oxidative stress, thus contributing to drug resistance phenotype. In this study, we investigated effects of DOX treatment on expression and activity of GSH-related enzymes and multidrug resistance-associated proteins in cultured human cervical cancer cells displaying different resistance against this drug (HeLa and KB-V1). Determination of expression level of genes encoding GST isoforms and MRP proteins (GCS, GPX, GSR, GSTA1-3, GSTM1, GSTP1, ABCC1-3, MGST1-3) was performed using StellARray™ Technology. Enzymatic activities of GPX and GSR were measured using biochemical methods. Expression of MRP1 was examined by immunofluorescence microscopy. This study showed that native expression levels of GSTM1 and GSTA3 were markedly higher in KB-V1 cells (2000-fold and 200-fold) compared to HeLa cells. Resistant cells have also shown significantly elevated expression of GSTA1 and GSTA2 genes (200-fold and 50-fold) as a result of DOX treatment. In HeLa cells, exposure to DOX increased expression of all genes: GSTM1 (7-fold) and GSTA1-3 (550-fold, 150-fold and 300-fold). Exposure to DOX led to the slight increase of GCS expression as well as GPX activity in KB-V1 cells, while in HeLa cells it did not. Expression of ABCC1 (MRP1) was not increased in any of the tested cell lines. Our results indicate that expression of GSTM1 and GSTA1-3 genes is up-regulated by DOX treatment and suggest that activity of these genes may be associated with drug resistance of the tested cells. At the same time, involvement of MRP1 in DOX resistance in the given experimental conditions is unlikely

  12. Coupling Neurogenetics (GARS™) and a Nutrigenomic Based Dopaminergic Agonist to Treat Reward Deficiency Syndrome (RDS): Targeting Polymorphic Reward Genes for Carbohydrate Addiction Algorithms.

    Science.gov (United States)

    Blum, Kenneth; Simpatico, Thomas; Badgaiyan, Rajendra D; Demetrovics, Zsolt; Fratantonio, James; Agan, Gozde; Febo, Marcelo; Gold, Mark S

    Earlier work from our laboratory, showing anti-addiction activity of a nutraceutical consisting of amino-acid precursors and enkephalinase inhibition properties and our discovery of the first polymorphic gene (Dopamine D2 Receptor Gene [DRD2]) to associate with severe alcoholism serves as a blue-print for the development of "Personalized Medicine" in addiction. Prior to the later genetic finding, we developed the concept of Brain Reward Cascade, which continues to act as an important component for stratification of addiction risk through neurogenetics. In 1996 our laboratory also coined the term "Reward Deficiency Syndrome (RDS)" to define a common genetic rubric for both substance and non-substance related addictive behaviors. Following many reiterations we utilized polymorphic targets of a number of reward genes (serotonergic, Opioidergic, GABAergic and Dopaminergic) to customize KB220 [Neuroadaptogen- amino-acid therapy (NAAT)] by specific algorithms. Identifying 1,000 obese subjects in the Netherlands a subsequent small subset was administered various KB220Z formulae customized according to respective DNA polymorphisms individualized that translated to significant decreases in both Body Mass Index (BMI) and weight in pounds. Following these experiments, we have been successfully developing a panel of genes known as "Genetic Addiction Risk Score" (GARSp DX )™. Selection of 10 genes with appropriate variants, a statistically significant association between the ASI-Media Version-alcohol and drug severity scores and GARSp Dx was found A variant of KB220Z in abstinent heroin addicts increased resting state functional connectivity in a putative network including: dorsal anterior cingulate, medial frontal gyrus, nucleus accumbens, posterior cingulate, occipital cortical areas, and cerebellum. In addition, we show that KB220Z significantly activates, above placebo, seed regions of interest including the left nucleus accumbens, cingulate gyrus, anterior thalamic

  13. Coupling Neurogenetics (GARS™) and a Nutrigenomic Based Dopaminergic Agonist to Treat Reward Deficiency Syndrome (RDS): Targeting Polymorphic Reward Genes for Carbohydrate Addiction Algorithms

    Science.gov (United States)

    Blum, Kenneth; Simpatico, Thomas; Badgaiyan, Rajendra D.; Demetrovics, Zsolt; Fratantonio, James; Agan, Gozde; Febo, Marcelo; Gold, Mark S.

    2016-01-01

    Earlier work from our laboratory, showing anti-addiction activity of a nutraceutical consisting of amino-acid precursors and enkephalinase inhibition properties and our discovery of the first polymorphic gene (Dopamine D2 Receptor Gene [DRD2]) to associate with severe alcoholism serves as a blue-print for the development of “Personalized Medicine” in addiction. Prior to the later genetic finding, we developed the concept of Brain Reward Cascade, which continues to act as an important component for stratification of addiction risk through neurogenetics. In 1996 our laboratory also coined the term “Reward Deficiency Syndrome (RDS)” to define a common genetic rubric for both substance and non-substance related addictive behaviors. Following many reiterations we utilized polymorphic targets of a number of reward genes (serotonergic, Opioidergic, GABAergic and Dopaminergic) to customize KB220 [Neuroadaptogen- amino-acid therapy (NAAT)] by specific algorithms. Identifying 1,000 obese subjects in the Netherlands a subsequent small subset was administered various KB220Z formulae customized according to respective DNA polymorphisms individualized that translated to significant decreases in both Body Mass Index (BMI) and weight in pounds. Following these experiments, we have been successfully developing a panel of genes known as “Genetic Addiction Risk Score” (GARSpDX)™. Selection of 10 genes with appropriate variants, a statistically significant association between the ASI-Media Version-alcohol and drug severity scores and GARSpDx was found A variant of KB220Z in abstinent heroin addicts increased resting state functional connectivity in a putative network including: dorsal anterior cingulate, medial frontal gyrus, nucleus accumbens, posterior cingulate, occipital cortical areas, and cerebellum. In addition, we show that KB220Z significantly activates, above placebo, seed regions of interest including the left nucleus accumbens, cingulate gyrus, anterior

  14. Genetic variations in DNA repair genes, radiosensitivity to cancer and susceptibility to acute tissue reactions in radiotherapy-treated cancer patients

    International Nuclear Information System (INIS)

    Chistiakov, Dimitry A.; Voronova, Natalia V.; Chistiakov, Pavel A.

    2008-01-01

    Ionizing radiation is a well established carcinogen for human cells. At low doses, radiation exposure mainly results in generation of double strand breaks (DSBs). Radiation-related DSBs could be directly linked to the formation of chromosomal rearrangements as has been proven for radiation-induced thyroid tumors. Repair of DSBs presumably involves two main pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). A number of known inherited syndromes, such as ataxia telangiectasia, ataxia-telangiectasia like-disorder, radiosensitive severe combined immunodeficiency, Nijmegen breakage syndrome, and LIG4 deficiency are associated with increased radiosensitivity and/or cancer risk. Many of them are caused by mutations in DNA repair genes. Recent studies also suggest that variations in the DNA repair capacity in the general population may influence cancer susceptibility. In this paper, we summarize the current status of DNA repair proteins as potential targets for radiation-induced cancer risk. We will focus on genetic alterations in genes involved in HR- and NHEJ-mediated repair of DSBs, which could influence predisposition to radiation-related cancer and thereby explain interindividual differences in radiosensitivity or radioresistance in a general population

  15. Diversity of nifH gene pools in the rhizosphere of two cultivars of sorghum (Sorghum bicolor) treated with contrasting levels of nitrogen fertilizer.

    Science.gov (United States)

    Coelho, Marcia Reed Rodrigues; de Vos, Marjon; Carneiro, Newton Portilho; Marriel, Ivanildo Evódio; Paiva, Edilson; Seldin, Lucy

    2008-02-01

    The diversity of nitrogen-fixing bacteria was assessed in the rhizospheres of two cultivars of sorghum (IS 5322-C and IPA 1011) sown in Cerrado soil amended with two levels of nitrogen fertilizer (12 and 120 kg ha(-1)). The nifH gene was amplified directly from DNA extracted from the rhizospheres, and the PCR products cloned and sequenced. Four clone libraries were generated from the nifH fragments and 245 sequences were obtained. Most of the clones (57%) were closely related to nifH genes of uncultured bacteria. NifH clones affiliated with Azohydromonas spp., Ideonella sp., Rhizobium etli and Bradyrhizobium sp. were found in all libraries. Sequences affiliated with Delftia tsuruhatensis were found in the rhizosphere of both cultivars sown with high levels of nitrogen, while clones affiliated with Methylocystis sp. were detected only in plants sown under low levels of nitrogen. Moreover, clones affiliated with Paenibacillus durus could be found in libraries from the cultivar IS 5322-C sown either in high or low amounts of fertilizer. This study showed that the amount of nitrogen used for fertilization is the overriding determinative factor that influenced the nitrogen-fixing community structures in sorghum rhizospheres cultivated in Cerrado soil.

  16. Genetic variations in DNA repair genes, radiosensitivity to cancer and susceptibility to acute tissue reactions in radiotherapy-treated cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Chistiakov, Dimitry A. (Dept. of Pathology, Univ. of Pittsburgh, Pittsburgh (US)); Voronova, Natalia V. (Dept. of Molecular Diagnostics, National Research Center GosNIIgenetika, Moscow (RU)); Chistiakov, Pavel A. (Dept. of Radiology, Cancer Research Center, Moscow (RU))

    2008-06-15

    Ionizing radiation is a well established carcinogen for human cells. At low doses, radiation exposure mainly results in generation of double strand breaks (DSBs). Radiation-related DSBs could be directly linked to the formation of chromosomal rearrangements as has been proven for radiation-induced thyroid tumors. Repair of DSBs presumably involves two main pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). A number of known inherited syndromes, such as ataxia telangiectasia, ataxia-telangiectasia like-disorder, radiosensitive severe combined immunodeficiency, Nijmegen breakage syndrome, and LIG4 deficiency are associated with increased radiosensitivity and/or cancer risk. Many of them are caused by mutations in DNA repair genes. Recent studies also suggest that variations in the DNA repair capacity in the general population may influence cancer susceptibility. In this paper, we summarize the current status of DNA repair proteins as potential targets for radiation-induced cancer risk. We will focus on genetic alterations in genes involved in HR- and NHEJ-mediated repair of DSBs, which could influence predisposition to radiation-related cancer and thereby explain interindividual differences in radiosensitivity or radioresistance in a general population

  17. Using Patient-Specific Induced Pluripotent Stem Cells and Wild-Type Mice to Develop a Gene Augmentation-Based Strategy to Treat CLN3-Associated Retinal Degeneration.

    Science.gov (United States)

    Wiley, Luke A; Burnight, Erin R; Drack, Arlene V; Banach, Bailey B; Ochoa, Dalyz; Cranston, Cathryn M; Madumba, Robert A; East, Jade S; Mullins, Robert F; Stone, Edwin M; Tucker, Budd A

    2016-10-01

    Juvenile neuronal ceroid lipofuscinosis (JNCL) is a childhood neurodegenerative disease with early-onset, severe central vision loss. Affected children develop seizures and CNS degeneration accompanied by severe motor and cognitive deficits. There is no cure for JNCL, and patients usually die during the second or third decade of life. In this study, independent lines of induced pluripotent stem cells (iPSCs) were generated from two patients with molecularly confirmed mutations in CLN3, the gene mutated in JNCL. Clinical-grade adeno-associated adenovirus serotype 2 (AAV2) carrying the full-length coding sequence of human CLN3 was generated in a U.S. Food and Drug Administration-registered cGMP facility. AAV2-CLN3 was efficacious in restoring full-length CLN3 transcript and protein in patient-specific fibroblasts and iPSC-derived retinal neurons. When injected into the subretinal space of wild-type mice, purified AAV2-CLN3 did not show any evidence of retinal toxicity. This study provides proof-of-principle for initiation of a clinical trial using AAV-mediated gene augmentation for the treatment of children with CLN3-associated retinal degeneration.

  18. Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

    Science.gov (United States)

    Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

    2014-10-01

    Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  19. Tricky Treats

    Centers for Disease Control (CDC) Podcasts

    2008-08-04

    The Eagle Books are a series of four books that are brought to life by wise animal characters - Mr. Eagle, Miss Rabbit, and Coyote - who engage Rain That Dances and his young friends in the joy of physical activity, eating healthy foods, and learning from their elders about health and diabetes prevention. Tricky Treats shows children the difference between healthy snacks and sweet treats.  Created: 8/4/2008 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 8/5/2008.

  20. A novel role for the Bombyx Slbo homologue, BmC/EBP, in insect choriogenesis.

    Science.gov (United States)

    Sourmeli, S; Papantonis, A; Lecanidou, R

    2005-11-18

    One previously unidentified cDNA clone coding for a C/EBP factor, BmC/EBP, was isolated from Bombyx mori follicular cells. This is the first time that a C/EBP factor has been isolated and characterized in Lepidoptera. We provide information concerning structural features and developmental specificity, as well as in vitro interaction properties with chorion gene promoter modules. BmC/EBP was capable of effectively recognizing homologous binding sites from chorion gene promoters derived from flies and other moths, despite significant diversity of chorion structure, gene organization, and gene expression profiles. We propose that the relative concentration of BmC/EBP, in relation to its differential binding affinity for promoter cis-elements, results in activation or repression of silkmoth chorion gene expression.

  1. Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus

    DEFF Research Database (Denmark)

    Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt

    2010-01-01

    The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...

  2. Evaluation of Single Nucleotide Polymorphisms (SNPs) in the p53 Binding Protein 1 (TP53BP1) Gene in Breast Cancer Patients Treated With Breast-Conserving Surgery and Whole-Breast Irradiation (BCS + RT)

    International Nuclear Information System (INIS)

    Haffty, Bruce G.; Goyal, Sharad; Kulkarni, Diptee; Green, Camille; Vazquez, Alexi; Schiff, Devora; Moran, Meena S.; Yang Qifeng; Ganesan, Shridar; Hirsfield, Kim M.

    2011-01-01

    Purpose: TP53BP1 is a key component of radiation-induced deoxyribonucleic acid damage repair. The purpose of this study was to evaluate the significance of a known common single nucleotide polymorphism in this gene (rs560191) in patients treated with breast-conserving surgery and whole-breast irradiation (BCS + RT). Methods and Materials: The population consisted of 176 premenopausal women treated with BCS + RT (median follow-up, 12 years). Genomic deoxyribonucleic acid was processed by use of TaqMan assays. Each allele for rs560191 was either C or G, so each patient was therefore classified as CC, CG, or GG. Patients were grouped as GG if they were homozygous for the variant G allele or CC-CG if they carried at least one copy of the common C allele (CC or CG). Results: Of the 176 women, 124 (71%) were CC-CG and 52 (29%) were GG. The mean age was 44 years for GG vs. 38 years for CC-CG (p < 0.001). GG was more common in African-American women than white women (69% vs. 13%, p < 0.001) and more commonly estrogen receptor negative (70% vs. 49%, p = 0.02). There were no significant correlations of rs560191 with other critical variables. Despite the fact that GG patients were older, the 10-year rate of local relapses was higher (22% for GG vs. 12% for CC-CG, p = 0.04). Conclusions: This novel avenue of investigation of polymorphisms in radiation repair/response genes in patients treated with BCS + RT suggests a correlation to local relapse. Additional evaluation is needed to assess the biological and functional significance of these single nucleotide polymorphisms, and larger confirmatory validation studies will be required to determine the clinical implications.

  3. BRAF Gene Copy Number and Mutant Allele Frequency Correlate with Time to Progression in Metastatic Melanoma Patients Treated with MAPK Inhibitors.

    Science.gov (United States)

    Stagni, Camilla; Zamuner, Carolina; Elefanti, Lisa; Zanin, Tiziana; Bianco, Paola Del; Sommariva, Antonio; Fabozzi, Alessio; Pigozzo, Jacopo; Mocellin, Simone; Montesco, Maria Cristina; Chiarion-Sileni, Vanna; De Nicolo, Arcangela; Menin, Chiara

    2018-06-01

    Metastatic melanoma is characterized by complex genomic alterations, including a high rate of mutations in driver genes and widespread deletions and amplifications encompassing various chromosome regions. Among them, chromosome 7 is frequently gained in BRAF -mutant melanoma, inducing a mutant allele-specific imbalance. Although BRAF amplification is a known mechanism of acquired resistance to therapy with MAPK inhibitors, it is still unclear if BRAF copy-number variation and BRAF mutant allele imbalance at baseline can be associated with response to treatment. In this study, we used a multimodal approach to assess BRAF copy number and mutant allele frequency in pretreatment melanoma samples from 46 patients who received MAPK inhibitor-based therapy, and we analyzed the association with progression-free survival. We found that 65% patients displayed BRAF gains, often supported by chromosome 7 polysomy. In addition, we observed that 64% patients had a balanced BRAF -mutant/wild-type allele ratio, whereas 14% and 23% patients had low and high BRAF mutant allele frequency, respectively. Notably, a significantly higher risk of progression was observed in patients with a diploid BRAF status versus those with BRAF gains [HR, 2.86; 95% confidence interval (CI), 1.29-6.35; P = 0.01] and in patients with low percentage versus those with a balanced BRAF mutant allele percentage (HR, 4.54; 95% CI, 1.33-15.53; P = 0.016). Our data suggest that quantitative analysis of the BRAF gene could be useful to select the melanoma patients who are most likely to benefit from therapy with MAPK inhibitors. Mol Cancer Ther; 17(6); 1332-40. ©2018 AACR . ©2018 American Association for Cancer Research.

  4. An ex vivo evaluation of the efficacy of andrographolide in modulating differential expression of transcription factors and target genes in periodontal cells and its potential role in treating periodontal diseases.

    Science.gov (United States)

    Ambili R; Janam, Prasanthila; Saneesh Babu, P S; Prasad, Manu; Vinod, D; Anil Kumar, P R; Kumary, T V; Asha Nair, S; Radhakrishna Pillai, M

    2017-01-20

    Andrographolide is a herbal extract traditionally used in South Asian countries for treating inflammatory diseases. To evaluate the efficacy of andrographolide in management of periodontal disease which is a highly prevalent oral disease. Periodontal ligament fibroblasts (PDLF) were cultured from healthy and diseased periodontium using explant culture methods. The safe dose of AG was determined using MTT assay. LPS (lipopolysaccharide) of the most important periodontopathogen, P gingivalis was used to activate NF-κB and STAT3 in PDLF. The efficacy of AG in inhibiting NF-κB and STAT3 was analyzed using immunofluorescence. Down regulation of expression of target genes of these transcription factors related to inflammation and bone resorption were analyzed using real time PCR. AG up to the concentration of 25μM was found to be safe as determined by MTT assay. Statistically significant activation of NF-κB and STAT3 in cultured PDLF was observed in diseased group compared to healthy controls before and after LPS challenge. 5μM AG pretreatment significantly inhibited activation of NF-κB and STAT3 and down regulated expression of inflammatory and bone resorptive genes in cultured PDLF. The findings of the present study propose the adjunctive use of a novel herbal drug andrographolide as a promising host modulation agent for periodontal therapy by inhibiting NF-κB and STAT3 activation and inhibition of inflammation and bone resorption related genes. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Sequence and expression analyses of porcine ISG15 and ISG43 genes.

    Science.gov (United States)

    Huang, Jiangnan; Zhao, Shuhong; Zhu, Mengjin; Wu, Zhenfang; Yu, Mei

    2009-08-01

    The coding sequences of porcine interferon-stimulated gene 15 (ISG15) and the interferon-stimulated gene (ISG43) were cloned from swine spleen mRNA. The amino acid sequences deduced from porcine ISG15 and ISG43 genes coding sequence shared 24-75% and 29-83% similarity with ISG15s and ISG43s from other vertebrates, respectively. Structural analyses revealed that porcine ISG15 comprises two ubiquitin homologues motifs (UBQ) domain and a conserved C-terminal LRLRGG conjugating motif. Porcine ISG43 contains an ubiquitin-processing proteases-like domain. Phylogenetic analyses showed that porcine ISG15 and ISG43 were mostly related to rat ISG15 and cattle ISG43, respectively. Using quantitative real-time PCR assay, significant increased expression levels of porcine ISG15 and ISG43 genes were detected in porcine kidney endothelial cells (PK15) cells treated with poly I:C. We also observed the enhanced mRNA expression of three members of dsRNA pattern-recognition receptors (PRR), TLR3, DDX58 and IFIH1, which have been reported to act as critical receptors in inducing the mRNA expression of ISG15 and ISG43 genes. However, we did not detect any induced mRNA expression of IFNalpha and IFNbeta, suggesting that transcriptional activations of ISG15 and ISG43 were mediated through IFN-independent signaling pathway in the poly I:C treated PK15 cells. Association analyses in a Landrace pig population revealed that ISG15 c.347T>C (BstUI) polymorphism and the ISG43 c.953T>G (BccI) polymorphism were significantly associated with hematological parameters and immune-related traits.

  6. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    International Nuclear Information System (INIS)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

    2012-01-01

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

  7. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    Energy Technology Data Exchange (ETDEWEB)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

    2012-08-31

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

  8. Occurrence and transformation of veterinary antibiotics and antibiotic resistance genes in dairy manure treated by advanced anaerobic digestion and conventional treatment methods.

    Science.gov (United States)

    Wallace, Joshua S; Garner, Emily; Pruden, Amy; Aga, Diana S

    2018-05-01

    Manure treatment technologies are rapidly developing to minimize eutrophication of surrounding environments and potentially decrease the introduction of antibiotics and antibiotic resistant genes (ARGs) into the environment. While laboratory and pilot-scale manure treatment systems boast promising results, antibiotic and ARG removals in full-scale systems receiving continuous manure input have not been evaluated. The effect of treatment on ARGs is similarly lacking. This study examines the occurrence and transformation of sulfonamides, tetracyclines, tetracycline degradation products, and related ARGs throughout a full-scale advanced anaerobic digester (AAD) receiving continuous manure and antibiotic input. Manure samples were collected throughout the AAD system to evaluate baseline antibiotic and ARG input (raw manure), the effect of hygenization (post-pasteurized manure) and anaerobic digestion (post-digestion manure) on antibiotic and ARG levels. Antibiotics were analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS), and the ARGs tet(O), tet(W), sul1 and sul2 were analyzed by quantitative polymerase chain reaction (Q-PCR). Significant reductions in the concentrations of chlortetracycline, oxytetracycline, tetracycline and their degradation products were observed in manure liquids following treatment (p < 0.001), concomitant to significant increases in manure solids (p < 0.001). These results suggest sorption is the major removal route for tetracyclines during AAD. Significant decreases in the epimer-to-total residue ratios for chlortetracycline and tetracycline in manure solids further indicate degradation is desorption-limited. Moreover, sul1 and sul2 copies decreased significantly (p < 0.001) following AAD in the absence of sulfonamide antibiotics, while tetracyclines-resistant genes remained unchanged. A cross-sectional study of dairy farms utilizing natural aeration and liquid-solid separation treatments was additionally performed

  9. Differential Expression of Tyrosine Hydroxylase Protein and Apoptosis-Related Genes in Differentiated and Undifferentiated SH-SY5Y Neuroblastoma Cells Treated with MPP+

    Directory of Open Access Journals (Sweden)

    Kawinthra Khwanraj

    2015-01-01

    Full Text Available The human neuroblastoma SH-SY5Y cell line has been used as a dopaminergic cell model for Parkinson’s disease research. Whether undifferentiated or differentiated SH-SY5Y cells are more suitable remains controversial. This study aims to evaluate the expression of apoptosis-related mRNAs activated by MPP+ and evaluate the differential expression of tyrosine hydroxylase (TH in undifferentiated and retinoic acid- (RA- induced differentiated cells. The western blot results showed a gradual decrease in TH in undifferentiated cells and a gradual increase in TH in differentiated cells from days 4 to 10 after cell plating. Immunostaining revealed a gradual increase in TH along with neuritic outgrowth in differentiated cells on days 4 and 7 of RA treatment. For the study on cell susceptibility to MPP+ and the expression of apoptosis-related genes, MTT assay showed a decrease in cell viability to approximately 50% requiring 500 and 1000 μM of MPP+ for undifferentiated and RA-differentiated cells, respectively. Using real-time RT-PCR, treatment with 500 μM MPP+ led to significant increases in the Bax/Bcl-2 ratio, p53, and caspase-3 in undifferentiated cells but was without significance in differentiated cells. In conclusion, differentiated cells may be more suitable, and the shorter duration of RA differentiation may make the SH-SY5Y cell model more accessible.

  10. Gene Expression Analysis Reveals the Concurrent Activation of Proapoptotic and Antioxidant-Defensive Mechanisms in Flavokawain B-Treated Cervical Cancer HeLa Cells.

    Science.gov (United States)

    Yeap, Swee Keong; Abu, Nadiah; Akthar, Nadeem; Ho, Wan Yong; Ky, Huynh; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Kamarul, Tunku

    2017-09-01

    Flavokawain B (FKB) is known to possess promising anticancer abilities. This is demonstrated in various cancer cell lines including HeLa cells. Cervical cancer is among the most widely diagnosed cancer among women today. Though FKB has been shown to be effective in treating cancer cells, the exact molecular mechanism is still unknown. This study is aimed at understanding the effects of FKB on HeLa cells using a microarray-based mRNA expression profiling and proteome profiling of stress-related proteins. The results of this study suggest that FKB induced cell death through p21-mediated cell cycle arrest and activation of p38. However, concurrent activation of antioxidant-related pathways and iron sequestration pathway followed by activation of ER-resident stress proteins clearly indicate that FKB failed to induce apoptosis in HeLa cells via oxidative stress. This effect implies that the protection of HeLa cells by FKB from H 2 O 2 -induced cell death is via neutralization of reactive oxygen species.

  11. Gene Expression Analysis Reveals the Concurrent Activation of Proapoptotic and Antioxidant-Defensive Mechanisms in Flavokawain B–Treated Cervical Cancer HeLa Cells

    Science.gov (United States)

    Yeap, Swee Keong; Abu, Nadiah; Akthar, Nadeem; Ho, Wan Yong; Ky, Huynh; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Kamarul, Tunku

    2016-01-01

    Flavokawain B (FKB) is known to possess promising anticancer abilities. This is demonstrated in various cancer cell lines including HeLa cells. Cervical cancer is among the most widely diagnosed cancer among women today. Though FKB has been shown to be effective in treating cancer cells, the exact molecular mechanism is still unknown. This study is aimed at understanding the effects of FKB on HeLa cells using a microarray-based mRNA expression profiling and proteome profiling of stress-related proteins. The results of this study suggest that FKB induced cell death through p21-mediated cell cycle arrest and activation of p38. However, concurrent activation of antioxidant-related pathways and iron sequestration pathway followed by activation of ER-resident stress proteins clearly indicate that FKB failed to induce apoptosis in HeLa cells via oxidative stress. This effect implies that the protection of HeLa cells by FKB from H2O2–induced cell death is via neutralization of reactive oxygen species. PMID:27458249

  12. Effect of Phosphatase and Tensin Homologue on Chromosome 10 on Angiotensin II-Mediated Proliferation, Collagen Synthesis, and Akt/P27 Signaling in Neonatal Rat Cardiac Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ling Nie

    2016-01-01

    Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.

  13. GEI-8, a homologue of vertebrate nuclear receptor corepressor NCoR/SMRT, regulates gonad development and neuronal functions in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Pavol Mikoláš

    Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.

  14. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Directory of Open Access Journals (Sweden)

    Hui Xu

    2010-11-01

    Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  15. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Science.gov (United States)

    Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad

    2010-11-01

    MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  16. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Science.gov (United States)

    Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J

    2014-01-01

    Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  17. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Directory of Open Access Journals (Sweden)

    John A Zebala

    Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  18. Effects of the deletion of the Escherichia coli frataxin homologue CyaY on the respiratory NADH:ubiquinone oxidoreductase

    Directory of Open Access Journals (Sweden)

    Grauman Peter L

    2007-07-01

    Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.

  19. Functional analysis of PI-like gene in relation to flower development ...

    Indian Academy of Sciences (India)

    lying flower development in bamboo, a petal-identity gene was identified as a ... 35S::BoPI fully rescued the defective petal forma- tion in the ... Arabidopsis converted sepals to petals; BoPI-C interacted with BoAP3 on yeast two-hybrid assay, just like the full-length ... PI homologue function in regulating perianth organ forma-.

  20. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  1. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  2. The 21-gene Recurrence Score® assay predicts distant recurrence in lymph node-positive, hormone receptor-positive, breast cancer patients treated with adjuvant sequential epirubicin- and docetaxel-based or epirubicin-based chemotherapy (PACS-01 trial).

    Science.gov (United States)

    Penault-Llorca, Frédérique; Filleron, Thomas; Asselain, Bernard; Baehner, Frederick L; Fumoleau, Pierre; Lacroix-Triki, Magali; Anderson, Joseph M; Yoshizawa, Carl; Cherbavaz, Diana B; Shak, Steven; Roca, Lise; Sagan, Christine; Lemonnier, Jérôme; Martin, Anne-Laure; Roché, Henri

    2018-05-04

    The 21-gene Recurrence Score (RS) result predicts outcome and chemotherapy benefit in node-negative and node-positive (N+), estrogen receptor-positive (ER+) patients treated with endocrine therapy. The purpose of this study was to evaluate the prognostic impact of RS results in N+, hormone receptor-positive (HR+) patients treated with adjuvant chemotherapy (6 cycles of FEC100 vs. 3 cycles of FEC100 followed by 3 cycles of docetaxel 100 mg/m 2 ) plus endocrine therapy (ET) in the PACS-01 trial (J Clin Oncol 2006;24:5664-5671). The current study included 530 HR+/N+ patients from the PACS-01 parent trial for whom specimens were available. The primary objective was to evaluate the relationship between the RS result and distant recurrence (DR). There were 209 (39.4%) patients with low RS (< 18), 159 (30%) with intermediate RS (18-30) and 162 (30.6%) with high RS (≥ 31). The continuous RS result was associated with DR (hazard ratio = 4.14; 95% confidence interval: 2.67-6.43; p <  0.001), adjusting for treatment. In multivariable analysis, the RS result remained a significant predictor of DR (p <  0.001) after adjustment for number of positive nodes, tumor size, tumor grade, Ki-67 (immunohistochemical status), and chemotherapy regimen. There was no statistically significant interaction between RS result and treatment in predicting DR (p = 0.79). After adjustment for clinical covariates, the 21-gene RS result is a significant prognostic factor in N+/HR+ patients receiving adjuvant chemoendocrine therapy. Not applicable.

  3. Different bacterial communities in heat and gamma irradiation treated replant disease soils revealed by 16S rRNA gene analysis – contribution to improved aboveground apple plant growth?

    Directory of Open Access Journals (Sweden)

    Bunlong eYim

    2015-11-01

    Full Text Available Replant disease (RD severely affects apple production in propagation tree nurseries and in fruit orchards worldwide. This study aimed to investigate the effects of soil disinfection treatments on plant growth and health in a biotest in two different RD soil types under greenhouse conditions and to link the plant growth status with the bacterial community composition at the time of plant sampling. In the biotest performed we observed that the aboveground growth of apple rootstock M26 plants after eight weeks was improved in the two RD soils either treated at 50 °C or with gamma irradiation compared to the untreated RD soils. Total community DNA was extracted from soil loosely adhering to the roots and quantitative real-time PCR revealed no pronounced differences in 16S rRNA gene copy numbers. 16S rRNA gene-based bacterial community analysis by denaturing gradient gel electrophoresis (DGGE and 454-pyrosequencing revealed significant differences in the bacterial community composition even after eight weeks of plant growth. In both soils, the treatments affected different phyla but only the relative abundance of Acidobacteria was reduced by both treatments. The genera Streptomyces, Bacillus, Paenibacillus and Sphingomonas had a higher relative abundance in both heat treated soils, whereas the relative abundance of Mucilaginibacter, Devosia and Rhodanobacter was increased in the gamma-irradiated soils and only the genus Phenylobacterium was increased in both treatments. The increased abundance of genera with potentially beneficial bacteria, i.e. potential degraders of phenolic compounds might have contributed to the improved plant growth in both treatments.

  4. [Intersection point rule for the retention value with mobile phase composition and boiling point of the homologues and chlorobenzenes in soil leaching column chromatography].

    Science.gov (United States)

    Xu, F; Liang, X; Lin, B; Su, F

    1999-03-01

    Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.

  5. Alterations of the genes involved in the PI3K and estrogen-receptor pathways influence outcome in human epidermal growth factor receptor 2-positive and hormone receptor-positive breast cancer patients treated with trastuzumab-containing neoadjuvant chemotherapy

    International Nuclear Information System (INIS)

    Takada, Mamoru; Miyazaki, Masaru; Sato-Otsubo, Aiko; Ogawa, Seishi; Kaneko, Yasuhiko; Higuchi, Toru; Tozuka, Katsunori; Takei, Hiroyuki; Haruta, Masayuki; Watanabe, Junko; Kasai, Fumio; Inoue, Kenichi; Kurosumi, Masafumi

    2013-01-01

    Chemotherapy with trastuzumab is widely used for patients with human epidermal growth factor receptor 2-positive (HER2+) breast cancer, but a significant number of patients with the tumor fail to respond, or relapse. The mechanisms of recurrence and biomarkers that indicate the response to the chemotherapy and outcome are not fully investigated. Genomic alterations were analyzed using single-nucleotide polymorphism arrays in 46 HER2 immunohistochemistry (IHC) 3+ or 2+/fluorescent in situ hybridization (FISH)+ breast cancers that were treated with neoadjuvant chemotherapy with paclitaxel, cyclophosphamid, epirubicin, fluorouracil, and trastuzumab. Patients were classified into two groups based on presence or absence of alterations of 65 cancer-associated genes, and the two groups were further classified into four groups based on genomic HER2 copy numbers or hormone receptor status (HR+/−). Pathological complete response (pCR) and relapse-free survival (RFS) rates were compared between any two of the groups. The pCR rate was 54% in 37 patients, and the RFS rate at 3 years was 72% (95% CI, 0.55-0.89) in 42 patients. The analysis disclosed 8 tumors with nonamplified HER2 and 38 tumors with HER2 amplification, indicating the presence of discordance in tumors diagnosed using current HER2 testing. The 8 patients showed more difficulty in achieving pCR (P=0.019), more frequent relapse (P=0.018), and more frequent alterations of genes in the PI3K pathway (P=0.009) than the patients with HER2 amplification. The alterations of the PI3K and estrogen receptor (ER) pathway genes generally indicated worse RFS rates. The prognostic significance of the alterations was shown in patients with a HR+ tumor, but not in patients with a HR- tumor when divided. Alterations of the PI3K and ER pathway genes found in patients with a HR+ tumor with poor outcome suggested that crosstalk between the two pathways may be involved in resistance to the current chemotherapy with trastuzumab. We

  6. Cloning of a cryptochrome homologue from the holoparasitic plant Orobanche minor Sm.

    Science.gov (United States)

    Okazawa, Atsushi; Trakulnaleamsai, Chitra; Hiramatsu, Hiroya; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio

    2005-05-01

    Orobanche minor is a non-photosynthetic root holoparasitic plant. Although it is known that photosynthesis-related genes are inactivated or have been eliminated from the plastid genomes of holoparasites, little is known about the alterations in their genes involved in the signaling networks by which light regulates photosynthesis. Cryptochromes (crys), which are blue-light receptors, appear to control both photosynthesis-related and non-photosynthetic responses to light in higher plants. Because we are interested in to what extent a cry-mediated light signaling network remains in the holoparasites, we cloned CRY homologous cDNA from O. minor (OmCRY1) and used real-time RT-PCR to compare its expression under natural daylight and darkness. We found that the OmCRY1 has a high degree of homology with CRY1 s from photosynthetic plants. Expression of the OmCRY1 gene was higher in plants grown in the dark than that in the plants grown under natural daylight. This is the first report of the gene expression of a blue-light receptor in non-photosynthetic plants.

  7. The Eps15 C. elegans homologue EHS-1 is implicated in synaptic vesicle recycling

    DEFF Research Database (Denmark)

    Salcini, A E; Hilliard, M A; Croce, A

    2001-01-01

    implicated Eps15 in endocytosis, its function in the endocytic machinery remains unclear. Here we show that the Caenorhabditis elegans gene, zk1248.3 (ehs-1), is the orthologue of Eps15 in nematodes, and that its product, EHS-1, localizes to synaptic-rich regions. ehs-1-impaired worms showed temperature...

  8. Single nucleotide polymorphisms in the promoter region of the IL1B gene influence outcome in multiple myeloma patients treated with high-dose chemotherapy independently of relapse treatment with thalidomide and bortezomib

    DEFF Research Database (Denmark)

    Vangsted, Annette J.; Klausen, Tobias W.; Abildgaard, Niels

    2011-01-01

    the impact on outcome of HDT, INF-α maintenance treatment, and treatment with thalidomide and bortezomib at relapse, in relation to the major identified functional polymorphisms in the promoter region of IL1B. The wild-type C-allele of IL1B C-3737T and non-carriage of the IL1B promoter haplotype TGT (−3737T...... carrying the wild-type C-allele of IL1B C-3737T (HR, 1.6 (1.1–2.4)). Furthermore, among INF-α treated patients, gene–gene interaction studies on IL1B C-3737T and NFКB1-94ins/del ATTG revealed a fourfold increase in TTF for homozygous carriers of wild-type alleles at both loci as compared to variant allele...... carriers at both loci. No relation to genotype and outcome was found for relapse patients treated with thalidomide or bortezomib. Our results indicate that a subpopulation of myeloma patients carrying the wild-type C-allele of IL1B C-3737T and non-carriers of the promoter haplotype TGT (−3737T, −1464G...

  9. Single-nucleotide polymorphism in the 5-α-reductase gene (SRD5A2) is associated with increased prevalence of metabolic syndrome in chemotherapy-treated testicular cancer survivors.

    Science.gov (United States)

    Boer, Hink; Westerink, Nico-Derk L; Altena, Renske; Nuver, Janine; Dijck-Brouwer, D A Janneke; van Faassen, Martijn; Klont, Frank; Kema, Ido P; Lefrandt, Joop D; Zwart, Nynke; Boezen, H Marike; Smit, Andries J; Meijer, Coby; Gietema, Jourik A

    2016-02-01

    Chemotherapy-treated testicular cancer survivors are at risk for development of the metabolic syndrome, especially in case of decreased androgen levels. Polymorphisms in the gene encoding steroid 5-α-reductase type II (SRD5A2) are involved in altered androgen metabolism. We investigated whether single-nucleotide polymorphisms (SNPs) rs523349 (V89L) and rs9282858 (A49T) in SRD5A2 are associated with cardiometabolic status in testicular cancer survivors. In 173 chemotherapy-treated testicular cancer survivors, hormone levels and cardiometabolic status were evaluated cross-sectionally (median 5 years [range 3-20] after chemotherapy) and correlated with SNPs in SRD5A2. The metabolic syndrome was more prevalent in survivors who were homozygous or heterozygous variant for SRD5A2 rs523349 compared to wild type (33% versus 19%, P = 0.032). In particular, patients with lower testosterone levels (testicular cancer survivors homozygous or heterozygous variant for SNP rs523349 in SRD5A2. Altered androgen sensitivity appears to be involved in the development of adverse metabolic and vascular changes in testicular cancer survivors and is a target for intervention. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. The DD genotype of the angiotensin converting enzyme gene independently associates with CMR-derived abnormal microvascular perfusion in patients with a first anterior ST-segment elevation myocardial infarction treated with thrombolytic agents.

    Science.gov (United States)

    Bodi, Vicente; Sanchis, Juan; Nunez, Julio; Aliño, Salvador F; Herrero, Maria J; Chorro, Francisco J; Mainar, Luis; Lopez-Lereu, Maria P; Monmeneu, Jose V; Oltra, Ricardo; Chaustre, Fabian; Forteza, Maria J; Husser, Oliver; Riegger, Günter A; Llacer, Angel

    2009-12-01

    The role of the angiotensin converting enzyme (ACE) gene on the result of thrombolysis at the microvascular level has not been addressed so far. We analyzed the implications of the insertion/deletion (I/D) polymorphism of the ACE gene on the presence of abnormal cardiovascular magnetic resonance (CMR)-derived microvascular perfusion after ST-segment elevation myocardial infarction (STEMI). We studied 105 patients with a first anterior STEMI treated with thrombolytic agents and an open left anterior descending artery. Microvascular perfusion was assessed using first-pass perfusion CMR at 7+/-1 days. CMR studies were repeated 184+/-11 days after STEMI. The ACE gene insertion/deletion (I/D) polymorphism was determined using polymerase chain reaction amplification. Overall genotype frequencies were II-ID 58% and DD 42%. Abnormal perfusion (> or = 1 segment) was detected in 56% of patients. The DD genotype associated to a higher risk of abnormal microvascular perfusion (68% vs. 47%, p=0.03) and to a larger extent of perfusion deficit (median [percentile 25 - percentile 75]: 4 [0-6] vs. 0 [0-4] segments, p=0.003). Once adjusted for baseline characteristics, the DD genotype independently increased the risk of abnormal microvascular perfusion (odds ratio [95% confidence intervals]: 2.5 [1.02-5.9], p=0.04). Moreover, DD patients displayed a larger infarct size (35+/-17 vs. 27+/-15 g, p=0.01) and a lower ejection fraction at 6 months (48+/-14 vs. 54+/-14%, p=0.03). The DD genotype associates to a higher risk of abnormal microvascular perfusion after STEMI.

  11. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)

    2015-11-28

    Nov 28, 2015 ... bond of a specific adenine in 28 S rRNA (Endo and Tsurugi. 1987; Barbieri et .... model. The structures were refined using Refmac. (Murshudov et al. 1997) from the ...... kine expression in treated spleen cells of rats. Mol. Cell.

  12. Prediction of risk of distant recurrence using the 21-gene recurrence score in node-negative and node-positive postmenopausal patients with breast cancer treated with anastrozole or tamoxifen: a TransATAC study.

    Science.gov (United States)

    Dowsett, Mitch; Cuzick, Jack; Wale, Christopher; Forbes, John; Mallon, Elizabeth A; Salter, Janine; Quinn, Emma; Dunbier, Anita; Baum, Michael; Buzdar, Aman; Howell, Anthony; Bugarini, Roberto; Baehner, Frederick L; Shak, Steven

    2010-04-10

    PURPOSE To determine whether the Recurrence Score (RS) provided independent information on risk of distant recurrence (DR) in the tamoxifen and anastrozole arms of the Arimidex, Tamoxifen, Alone or in Combination (ATAC) Trial. PATIENTS AND METHODS RNA was extracted from 1,372 tumor blocks from postmenopausal patients with hormone receptor-positive primary breast cancer in the monotherapy arms of ATAC. Twenty-one genes were assessed by quantitative reverse transcriptase polymerase chain reaction, and the RS was calculated. Cox proportional hazards models assessed the value of adding RS to a model with clinical variables (age, tumor size, grade, and treatment) in node-negative (N0) and node-positive (N+) women. RESULTS Reportable scores were available from 1,231 evaluable patients (N0, n = 872; N+, n = 306; and node status unknown, n = 53); 72, 74, and six DRs occurred in N0, N+, and node status unknown patients, respectively. For both N0 and N+ patients, RS was significantly associated with time to DR in multivariate analyses (P or = 31) groups were 4%, 12%, and 25%, respectively, in N0 patients and 17%, 28%, and 49%, respectively, in N+ patients. The prognostic value of RS was similar in anastrozole- and tamoxifen-treated patients. CONCLUSION This study confirmed the performance of RS in postmenopausal HR+ patients treated with tamoxifen in a large contemporary population and demonstrated that RS is an independent predictor of DR in N0 and N+ hormone receptor-positive patients treated with anastrozole, adding value to estimates with standard clinicopathologic features.

  13. TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.

    Science.gov (United States)

    Yasuhara, Hiroki; Oe, Yuki

    2011-07-01

    TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

  14. Investigation of evaporation characteristics of polonium and its lighter homologues selenium and tellurium from liquid Pb-Bi-eutecticum

    CERN Document Server

    Neuhausen, J; Eichler, B

    2004-01-01

    The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.

  15. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

    Science.gov (United States)

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

    2017-07-01

    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  16. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

    Science.gov (United States)

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

    2010-06-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

  17. Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE.

    Science.gov (United States)

    Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M

    2018-03-01

    Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

  18. CORRELATIONS BETWEEN HOMOLOGUE CONCENTRATIONS OF PCDD/FS AND TOXIC EQUIVALENCY VALUES IN LABORATORY-, PACKAGE BOILER-, AND FIELD-SCALE INCINERATORS

    Science.gov (United States)

    The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...

  19. Identification and characterization of the ESAT-6 homologue of Mycobacterium leprae and T-cell cross-reactivity with Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.

    2002-01-01

    In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial

  20. Expression profiles of aquaporin homologues and petal movement during petal development in Tulipa gesneriana.

    Science.gov (United States)

    Azad, Abul Kalam; Hanawa, Ryosuke; Ishikawa, Takahiro; Sawa, Yoshihiro; Shibata, Hitoshi

    2013-07-01

    Previously, we have characterized two tonoplast intrinsic proteins (TIPs) and four plasma membrane intrinsic proteins (PIPs) from the 2-day-old petals of tulip (Tulipa gesneriana). In this study, we analyzed the development of tulip petals and stems, temperature-dependent petal movement, the amount of ³H₂O transported into petals and stems during petal movement, and the transcript levels of two TIP (TgTIP1;1 and TgTIP1;2) and four TgPIP genes in petals and stems, from the first day of petal opening to day 12. The development of the petals and stems was completed by days 6 and 9, respectively, after the first day of petal opening. Temperature-dependent petal movement and the amount of ³H₂O that was transported into petals could be detected at significant levels up to day 6 with petal movement reaching a peak at day 3. Real-time reverse transcription-polymerase chain reaction analysis revealed that TgTIP1;1 and TgTIP1;2 were expressed ubiquitously in petals, stems, leaves, bulbs and roots. However, the expression level of TgTIP1;2 was very low in bulbs. The expression of both TgTIP1 genes was upregulated in close association with the development of petals but not with that of the stem. The four TgPIP genes were expressed at almost the same level during the development of the petals and the stem. However, the levels of the TgTIP1 and TgPIP transcripts in petals decreased during the course of petal wilting from day 9 onwards. These results suggest that TgTIP1;1 and TgTIP1;2 may contribute to petal development. Copyright © Physiologia Plantarum 2012.

  1. Cell cycle, apoptosis, cellular uptake and whole-transcriptome microarray gene expression analysis of HeLa cells treated with a ruthenium(II)-arene complex with an isoquinoline-3-carboxylic acid ligand.

    Science.gov (United States)

    Jovanović, Katarina K; Tanić, Miljana; Ivanović, Ivanka; Gligorijević, Nevenka; Dojčinović, Biljana P; Radulović, Siniša

    2016-10-01

    Ruthenium(II)-arene complexes are promising drug candidates for the therapy of solid tumors. In previous work, seven new compounds of the general formula [Ru(η 6 -p-cymene)(L 1-7 )Cl] were synthesized and characterized, of which the complex with L=isoquinoline-3-carboxylic acid (RuT 7 ) was two times as active on HeLa cells compared to normal cell line MRC-5, as indicated by IC 50 values determined after 48h of incubation (45.4±3.0 vs. 84.2±5.7μM, respectively). In the present study, cell cycle analysis of HeLa cells treated with RuT 7 showed S phase arrest and an increase in sub-G1 population. The apoptotic potential of the title compound was confirmed with the Annexin V-FITC/PI assay together with a morphological evaluation of cells using fluorescent microscopy. Analysis of the intracellular accumulation of ruthenium showed 8.9ng Ru/10 6 cells after 6h of incubation. To gain further insight in the molecular mechanism of action of RuT 7 on HeLa cells, a whole-transcriptome microarray gene expression analysis was performed. Analysis of functional categories and signaling and biochemical pathways associated with the response of HeLa cells to treatment with RuT 7 showed that it leads the cells through the intrinsic (mitochondrial) apoptotic pathway, via indirect DNA damage due to the action of reactive oxygen species, and through direct DNA binding of RuT 7 . Statistical analysis for enrichment of gene sets associated with known drug-induced toxicities identified fewer associated toxicity profiles in RuT 7 -treated cells compared to cisplatin treatment. Altogether these results provide the basis for further development of RuT 7 in animal and pre-clinical studies as a potential drug candidate. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Molecular cloning and characterization of a ToxA-like gene from the maize pathogen Cochliobolus heterostrophus

    Science.gov (United States)

    ToxA, the first discovered fungal proteinaceous host-selective toxin, was originally identified from the tan spot fungus Pyrenophora tritici-repentis (Ptr). Homologues of the PtrToxA gene have not been identified from any other ascomycetes except the leaf/glume blotch fungus Stagonospora nodorum, w...

  3. The ATM homologue MEC1 is required for phosphorylation of replication protein A in yeast

    International Nuclear Information System (INIS)

    Brush, G.S.; Morrow, D.M.; Hieter, P.; Kelly, T.J.

    1996-01-01

    Replication protein A (RPA) is a highly conserved single-stranded DNA-binding protein, required for cellular DNA replication, repair, and recombination. In human cells, RPA is phosphorylated during the S and G2 phases of the cell cycle and also in response to ionizing or ultraviolet radiation. Saccharomyces cerevisiae exhibits a similar pattern of cell cycle-regulated RPA phosphorylation, and our studies indicate that the radiation-induced reactions occur in yeast as well. We have examined yeast RPA phosphorylation during the normal cell cycle and in response to environmental insult, and have demonstrated that the checkpoint gene MEC1 is required for the reaction under all conditions tested. Through examination of several checkpoint mutants, we have placed RPA phosphorylation in a novel pathway of the DNA damage response. MEC1 is similar in sequence to human ATM, the gene mutated in patients with ataxia-telangiectasia (A-T). A-T cells are deficient in multiple checkpoint pathways and are hypersensitive to killing by ionizing radiation. Because A-T cells exhibit a delay in ionizing radiation-induced RPA phosphorylation, our results indicate a functional similarity between MEC1 and ATM, and suggest that RPA phosphorylation is involved in a conserved eukaryotic DNA damage-response pathway defective in A-T

  4. Transcriptome study of storage protein genes of field-grown barley in response to inorganic nitrogen fertilizers

    DEFF Research Database (Denmark)

    Hansen, Michael; Bowra, Steve; Lange, Mette

    2010-01-01

    The storage proteins of barley, in terms of both amino acid profile and quantity, are traits strongly influenced by the amount of nitrogen applied. Given this, we performed a developmental expression analysis of the genes from barley grains grown under field conditions to further our understanding...... profile under different N regimes. Reviewing the expression of the storage protein homologues within the families revealed markedly different temporal profiles; for example, some alleles were expressed very early in development. Furthermore, the differential temporal expression of the homologues suggested...

  5. Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

    Directory of Open Access Journals (Sweden)

    Aleksander F Sikorski

    2007-01-01

    Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

  6. The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

    LENUS (Irish Health Repository)

    Thornton, Roibeard F

    2010-04-23

    Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.

  7. The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

    Directory of Open Access Journals (Sweden)

    Kagawa Todd F

    2010-04-01

    Full Text Available Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.

  8. An avian homologue of the human β3-adrenoceptor that demonstrates unique pharmacology

    International Nuclear Information System (INIS)

    Broxton, N.M.; Papaioannou, M.; Evans, B.A.; Summers, R.J.

    2001-01-01

    Full text: A novel β-adrenoceptor (AR) in the turkey (Tβ 4 -AR; Chen et al 1994) displays low homology with otherβ-AR subtypes thus appearing to represent a novel subtype. It has intermediate affinity for [ 125 I]-cyanopindolol (CYP), lower than that for β|- or β 2 -ARs but higher than for the hβ 3 -AR. However, the gene structure of the tβ 4 -AR closely resembles that of the rodent β 3 -AR gene. cDNAs containing the coding region of tβ 4 - and hβ 3 -ARs were cloned into the mammalian expression vector pCDNA3.1 and transiently expressed in CHO KI cells. The pharmacological properties of the tβ 4 -AR were investigated with binding ([ 125 I] CYP) and cAMP accumulation assays and compared to that of the human β 3 ,-AR. Both the tβ 4 - and hβ 3 -ARs displayed low affinities for CGP20712A (CGP;β 1 -AR selective; pK i , tβ 4 6.13±0.62; hβ 3 6.10±0.15) and ICI118551 (ICI; β 2 -AR selective; pK i tβ 4 7.12±0.54; hβ 3 6.62±0.33). Theβ 3 -AR selective antagonist SR59230 (pK i tβ 4 7.45±0.07; hβ 3 .0010.50) as well as a non-selective antagonist (-) propranolol (Prop; pK i tβ 4 8.90±0.15; hβ 3 7.40±0.74) had higher affinities for both receptors but showed different rank orders of potency. β-AR agonists isoprenaline (Iso; pK i , tβ 4 6.5810.19; hβ 3 5.95±0.10) and noradrenaline (NA; pK i , tβ 4 6.65±0.29; hβ 3 5.66±10.32) had higher affinity for the tβ 4 -AR. In cAMP accumulation assays, the rank orders of potency of agonists was Iso > NA > BRL37344 >>CL316243 for the tβ 4 -AR and BRL37344, Iso > NA > CL316243 for the hβ 3 -AR. The antagonists had rank orders of affinity similar to those determined from binding experiments; for tβ 4 -AR (-) Prop > SR > ICI > (+) Prop > CGP, and hβ 3 -AR, SR > (-)Prop > ICI> (+) Prop > CGP. Therefore the tβ 4 -AR, although resembling the hβ 3 -AR in gene structure, displays high affinity for (-) propranolol and relatively low affinity for β 3 -AR selective agonists. Copyright (2001) Australasian

  9. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  10. An archaebacterial homologue of the essential eubacterial cell division protein FtsZ.

    Science.gov (United States)

    Baumann, P; Jackson, S P

    1996-06-25

    Life falls into three fundamental domains--Archaea, Bacteria, and Eucarya (formerly archaebacteria, eubacteria, and eukaryotes,. respectively). Though Archaea lack nuclei and share many morphological features with Bacteria, molecular analyses, principally of the transcription and translation machineries, have suggested that Archaea are more related to Eucarya than to Bacteria. Currently, little is known about the archaeal cell division apparatus. In Bacteria, a crucial component of the cell division machinery is FtsZ, a GTPase that localizes to a ring at the site of septation. Interestingly, FtsZ is distantly related in sequence to eukaryotic tubulins, which also interact with GTP and are components of the eukaryotic cell cytoskeleton. By screening for the ability to bind radiolabeled nucleotides, we have identified a protein of the hyperthermophilic archaeon Pyrococcus woesei that interacts tightly and specifically with GTP. Furthermore, through screening an expression library of P. woesei genomic DNA, we have cloned the gene encoding this protein. Sequence comparisons reveal that the P. woesei GTP-binding protein is strikingly related in sequence to eubacterial FtsZ and is marginally more similar to eukaryotic tubulins than are bacterial FtsZ proteins. Phylogenetic analyses reinforce the notion that there is an evolutionary linkage between FtsZ and tubulins. These findings suggest that the archaeal cell division apparatus may be fundamentally similar to that of Bacteria and lead us to consider the evolutionary relationships between Archaea, Bacteria, and Eucarya.

  11. Characterization of MORE AXILLARY GROWTH genes in Populus.

    Directory of Open Access Journals (Sweden)

    Olaf Czarnecki

    Full Text Available Strigolactones are a new class of plant hormones that play a key role in regulating shoot branching. Studies of branching mutants in Arabidopsis, pea, rice and petunia have identified several key genes involved in strigolactone biosynthesis or signaling pathway. In the model plant Arabidopsis, MORE AXILLARY GROWTH1 (MAX1, MAX2, MAX3 and MAX4 are four founding members of strigolactone pathway genes. However, little is known about the strigolactone pathway genes in the woody perennial plants.Here we report the identification of MAX homologues in the woody model plant Populus trichocarpa. We identified the sequence homologues for each MAX protein in P. trichocarpa. Gene expression analysis revealed that Populus MAX paralogous genes are differentially expressed across various tissues and organs. Furthermore, we showed that Populus MAX genes could complement or partially complement the shoot branching phenotypes of the corresponding Arabidopsis max mutants.This study provides genetic evidence that strigolactone pathway genes are likely conserved in the woody perennial plants and lays a foundation for further characterization of strigolactone pathway and its functions in the woody perennial plants.

  12. Two fundamentally different classes of microbial genes.

    Science.gov (United States)

    Wolf, Yuri I; Makarova, Kira S; Lobkovsky, Alexander E; Koonin, Eugene V

    2016-11-07

    The evolution of bacterial and archaeal genomes is highly dynamic and involves extensive horizontal gene transfer and gene loss 1-4 . Furthermore, many microbial species appear to have open pangenomes, where each newly sequenced genome contains more than 10% ORFans, that is, genes without detectable homologues in other species 5,6 . Here, we report a quantitative analysis of microbial genome evolution by fitting the parameters of a simple, steady-state evolutionary model to the comparative genomic data on the gene content and gene order similarity between archaeal genomes. The results reveal two sharply distinct classes of microbial genes, one of which is characterized by effectively instantaneous gene replacement, and the other consists of genes with finite, distributed replacement rates. These findings imply a conservative estimate of the size of the prokaryotic genomic universe, which appears to consist of at least a billion distinct genes. Furthermore, the same distribution of constraints is shown to govern the evolution of gene complement and gene order, without the need to invoke long-range conservation or the selfish operon concept 7 .

  13. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-10-15

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  14. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-10-01

    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  15. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-01-01

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

  16. Determination of vitamin K homologues by high-performance liquid chromatography with on-line photoreactor and peroxyoxalate chemiluminescence detection

    International Nuclear Information System (INIS)

    Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka

    2007-01-01

    A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications

  17. Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam.

    Science.gov (United States)

    Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter

    2018-02-28

    Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.

  18. PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum.

    Science.gov (United States)

    Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun

    2015-12-01

    The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  19. Immune responses of B. malayi thioredoxin (TRX) and venom allergen homologue (VAH) chimeric multiple antigen for lymphatic filariasis.

    Science.gov (United States)

    Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal

    2013-12-01

    Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.

  20. Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

    International Nuclear Information System (INIS)

    Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon

    2007-01-01

    Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

  1. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

    Science.gov (United States)

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

    2017-08-01

    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  2. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    Energy Technology Data Exchange (ETDEWEB)

    Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)

    2010-07-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)

  3. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    International Nuclear Information System (INIS)

    Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.

    2010-01-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)

  4. A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

    Directory of Open Access Journals (Sweden)

    Hewitt Jane E

    2010-11-01

    Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

  5. Aplasia Ras homologue member Ⅰ overexpression inhibits tumor growth and induces apoptosis through inhibition of PI3K/Akt survival pathways in human osteosarcoma MG-63 cells in culture.

    Science.gov (United States)

    Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua

    2015-09-01

    Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.

  6. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  7. New Genes and Functional Innovation in Mammals.

    Science.gov (United States)

    Luis Villanueva-Cañas, José; Ruiz-Orera, Jorge; Agea, M Isabel; Gallo, Maria; Andreu, David; Albà, M Mar

    2017-07-01

    The birth of genes that encode new protein sequences is a major source of evolutionary innovation. However, we still understand relatively little about how these genes come into being and which functions they are selected for. To address these questions, we have obtained a large collection of mammalian-specific gene families that lack homologues in other eukaryotic groups. We have combined gene annotations and de novo transcript assemblies from 30 different mammalian species, obtaining ∼6,000 gene families. In general, the proteins in mammalian-specific gene families tend to be short and depleted in aromatic and negatively charged residues. Proteins which arose early in mammalian evolution include milk and skin polypeptides, immune response components, and proteins involved in reproduction. In contrast, the functions of proteins which have a more recent origin remain largely unknown, despite the fact that these proteins also have extensive proteomics support. We identify several previously described cases of genes originated de novo from noncoding genomic regions, supporting the idea that this mechanism frequently underlies the evolution of new protein-coding genes in mammals. Finally, we show that most young mammalian genes are preferentially expressed in testis, suggesting that sexual selection plays an important role in the emergence of new functional genes. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Cloning and characterization of a glutathione S-transferase homologue from the plant pathogenic fungus Botrytis cinerea

    NARCIS (Netherlands)

    Prins, T.W.; Wagemakers, L.; Schouten, A.; Kan, van J.A.L.

    2000-01-01

    A gene was cloned from Botrytis cinerea that encodes a protein homologous to glutathione S-transferase (GST). The gene, denominated Bcgst1, is present in a single copy and represents the first example of such a gene from a filamentous fungus. The biochemical function of GSTs is to conjugate toxic

  9. PTEN status in advanced colorectal cancer treated with cetuximab

    Science.gov (United States)

    Negri, F V; Bozzetti, C; Lagrasta, C A; Crafa, P; Bonasoni, M P; Camisa, R; Pedrazzi, G; Ardizzoni, A

    2009-01-01

    Background: Loss of phosphatase and tensin homologue deleted in chromosome 10 (PTEN) function in advanced colorectal cancer (CRC) may represent one of the resistance mechanisms to cetuximab by interfering with the epidermal growth factor receptor signal transduction pathway. Methods: PTEN expression tested by indirect immunofluorescence was evaluated both on primary (n=43) and on metastatic (n=24) sites in CRC patients treated with cetuximab. Results: The loss of PTEN expression tested on metastatic sites was negatively associated with response (100% progressive disease (PD) in PTEN-negative cases vs 30% PD in PTEN-positive cases; P<0.05), PFS (0.8 vs 8.2 months; P<0.001) and OS (2.9 vs 14.2 months; P<0.001). Conclusion: A potential role of PTEN in the anti-tumour activity of cetuximab could be hypothesised. PMID:19953097

  10. The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Nikola Kellner

    2014-01-01

    Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

  11. Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance.

    Science.gov (United States)

    Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A

    2017-11-01

    Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

  12. Basics on Genes and Genetic Disorders

    Science.gov (United States)

    ... for Educators Search English Español The Basics on Genes and Genetic Disorders KidsHealth / For Teens / The Basics ... such as treating health problems. What Is a Gene? To understand how genes work, let's review some ...

  13. In silico analysis of cacao (Theobroma cacao L.) genes that involved in pathogen and disease responses

    Science.gov (United States)

    Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah

    2017-02-01

    Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.

  14. Evidence for the intense exchange of MazG in marine cyanophages by horizontal gene transfer.

    Directory of Open Access Journals (Sweden)

    Michael J Bryan

    Full Text Available BACKGROUND: S-PM2 is a phage capable of infecting strains of unicellular cyanobacteria belonging to the genus Synechococcus. S-PM2, like other myoviruses infecting marine cyanobacteria, encodes a number of bacterial-like genes. Amongst these genes is one encoding a MazG homologue that is hypothesized to be involved in the adaption of the infected host for production of progeny phage. METHODOLOGY/PRINCIPAL FINDINGS: This study focuses on establishing the occurrence of mazG homologues in other cyanophages isolated from different oceanic locations. Degenerate PCR primers were designed using the mazG gene of S-PM2. The mazG gene was found to be widely distributed and highly conserved among Synechococcus myoviruses and podoviruses from diverse oceanic provinces. CONCLUSIONS/SIGNIFICANCE: This study provides evidence of a globally connected cyanophage gene pool, the cyanophage mazG gene having a small effective population size indicative of rapid lateral gene transfer despite being present in a substantial fraction of cyanophage. The Prochlorococcus and Synechococcus phage mazG genes do not cluster with the host mazG gene, suggesting that their primary hosts are not the source of the mazG gene.

  15. Radiation-induced damage to normal tissues after radiotherapy in patients treated for gynecologic tumors: Association with single nucleotide polymorphisms in XRCC1, XRCC3, and OGG1 genes and in vitro chromosomal radiosensitivity in lymphocytes

    International Nuclear Information System (INIS)

    Ruyck, Kim de; Eijkeren, Marc van; Claes, Kathleen; Morthier, Rudy; Paepe, Anne de; Vral, Anne; Ridder, Leo de; Thierens, Hubert

    2005-01-01

    Purpose: To examine the association of polymorphisms in XRCC1 (194Arg/Trp, 280Arg/His, 399Arg/Gln, 632Gln/Gln), XRCC3 (5' UTR 4.541A>G, IVS5-14 17.893A>G, 241Thr/Met), and OGG1 (326Ser/Cys) with the development of late radiotherapy (RT) reactions and to assess the correlation between in vitro chromosomal radiosensitivity and clinical radiosensitivity. Methods and Materials: Sixty-two women with cervical or endometrial cancer treated with RT were included in the study. According to the Common Terminology Criteria for Adverse Events, version 3.0, scale, 22 patients showed late adverse RT reactions. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays were performed to examine polymorphic sites, the G2 assay was used to measure chromosomal radiosensitivity, and patient groups were compared using actuarial methods. Results: The XRCC3 IVS5-14 polymorphic allele was significantly associated with the risk of developing late RT reactions (odds ratio 3.98, p = 0.025), and the XRCC1 codon 194 variant showed a significant protective effect (p = 0.028). Patients with three or more risk alleles in XRCC1 and XRCC3 had a significantly increased risk of developing normal tissue reactions (odds ratio 10.10, p = 0.001). The mean number of chromatid breaks per cell was significantly greater in patients with normal tissue reactions than in patients with no reactions (1.16 and 1.34, respectively; p = 0.002). Patients with high chromosomal radiosensitivity showed a 9.2-fold greater annual risk of complications than patients with intermediate chromosomal radiosensitivity. Combining the G2 analysis with the risk allele model allowed us to identify 23% of the patients with late normal tissue reactions, without false-positive results. Conclusion: The results of the present study showed that clinical radiosensitivity is associated with an enhanced G2 chromosomal radiosensitivity and is significantly associated with a combination of different polymorphisms in

  16. The ZNF75 zinc finger gene subfamily: Isolation and mapping of the four members in humans and great apes

    Energy Technology Data Exchange (ETDEWEB)

    Villa, A.; Strina, D.; Frattini, A. [Consiglio Nazionale delle Ricerche, Milan (Italy)] [and others

    1996-07-15

    We have previously reported the characterization of the human ZNF75 gene located on Xq26, which has only limited homology (less than 65%) to other ZF genes in the databases. Here, we describe three human zinc finger genes with 86 to 95% homology to ZNF75 at the nucleotide level, which represent all the members of the human ZNF75 subfamily. One of these, ZNF75B, is a pseudogene mapped to chromosome 12q13. The other two, ZNF75A and ZNF75C, maintain on ORF in the sequenced region, and at least the latter is expressed in the U937 cell line. They were mapped to chromosomes 16 and 11, respectively. All these genes are conserved in chimpanzees, gorillas, and orangutans. The ZNF75B homologue is a pseudogene in all three great apes, and in chimpanzee it is located on chromosome 10 (phylogenetic XII), at p13 (corresponding to the human 12q13). The chimpanzee homologue of ZNF75 is also located on the Xq26 chromosome, in the same region, as detected by in situ hybridization. As expected, nucleotide changes were clearly more abundant between human and organutan than between human and chimpanzee or gorilla homologues. Members of the same class were more similar to each other than to the other homologues within the same species. This suggests that the duplication and/or retrotranscription events occurred in a common ancestor long before great ape speciation. This, together with the existance of at least two genes in cows and horses, suggests a relatively high conservation of this gene family. 20 refs., 5 figs., 1 tab.

  17. Abnormal P-53 suppressor gene expression predicts for a poorer outcome in patients with locally advanced adenocarcinoma of the prostate treated by external beam radiation therapy with or without pre-radiation androgen ablation: results based on RTOG study 86-10

    International Nuclear Information System (INIS)

    Lawton, Colleen A.; Grignon, David; Caplan, Richard; Sarkar, Fazlul; Forman, Jeffrey; Mesic, John; Fu, Karen K.; Abrams, Ross

    1995-01-01

    Purpose/Objective: The purpose of this study is to establish the effect of the abnormal expression of the P-53 suppressor gene on the results of locally advanced adenocarcinoma of the prostate treated with radiation therapy with or without pre-radiation therapy androgen ablation. Materials and Methods: Patients evaluated were part of a RTOG phase III multi-institutional trial. This trial assessed the value of pre-radiation therapy androgen ablation on patients with locally advanced disease (bulky stage B and stage C). Of the 471 patients registered, pre-treatment pathological material was available for 129 patients. P-53 status was determined immunohistochemically utilizing a commercially available antibody (D07). Clinical endpoints evaluated were overall survival and development of metastases. Results: Twenty-three of the 129 patients had abnormal expression of the P-53 suppressor gene. Presence of this abnormal expression significantly correlated with lower overall survival (p=0.03) and the development of distant metastases (p=0.03). Abnormal expression of the P-53 gene was an independent prognostic indicator when evaluated against clinical stage and Gleason score. Conclusion: This data from patients entered on a phase III multi-institutional, randomized clinical trial shows that abnormal P-53 suppressor gene expression as determined immunohistochemically is an independent predictor of poorer survival and the development of distant metastases in patients with locally advanced adenocarcinoma of the prostate treated with radiation therapy with or without pre-radiation therapy androgen ablation

  18. Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense.

    Science.gov (United States)

    Kumar, L; Sridhara, S; Singh, B P; Gangal, S V

    1998-11-01

    Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

  19. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

    Science.gov (United States)

    Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

    2012-04-01

    Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

  20. The study of mutability of RYS2 gene in diploid yeast Saccharomyces

    International Nuclear Information System (INIS)

    Chernov, Yu.O.; Gordenin, D.A.; Soldatov, S.P.; Glazer, V.M.

    1985-01-01

    More than 3000 spontaneous X-ray and ultraviolet-radiation induced mutants have been obtained by LYSD gene in haploid and diploid yeast Saccharcomyces. Mutants were selected using Chattu et cet. method. Comparison of mutant frequency in haploidy and diploidy and analysis of pho 1 marker closely related with LYS2 gene allow to conclude that the main mechanism causing spontaneous and induced mutants in diploidy is mutation of LYS2 gene in one of homologues and the following mitotic homozygotization of originating mutation

  1. Gene expression profiling in respond to TBT exposure in small abalone Haliotis diversicolor.

    Science.gov (United States)

    Jia, Xiwei; Zou, Zhihua; Wang, Guodong; Wang, Shuhong; Wang, Yilei; Zhang, Ziping

    2011-10-01

    In this study, we investigated the gene expression profiling of small abalone, Haliotis diversicolor by tributyltin (TBT) exposure using a cDNA microarray containing 2473 unique transcripts. Totally, 107 up-regulated genes and 41 down-regulated genes were found. For further investigation of candidate genes from microarray data and EST analysis, quantitative real-time PCR was performed at 6 h, 24 h, 48 h, 96 h and 192 h TBT exposure. 26 genes were found to be significantly differentially expressed in different time course, 3 of them were unknown. Some gene homologues like cellulose, endo-beta-1,4-glucanase, ferritin subunit 1 and thiolester containing protein II CG7052-PB might be the good biomarker candidate for TBT monitor. The identification of stress response genes and their expression profiles will permit detailed investigation of the defense responses of small abalone genes. Published by Elsevier Ltd.

  2. Gene doping in sports.

    Science.gov (United States)

    Unal, Mehmet; Ozer Unal, Durisehvar

    2004-01-01

    Gene or cell doping is defined by the World Anti-Doping Agency (WADA) as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". New research in genetics and genomics will be used not only to diagnose and treat disease, but also to attempt to enhance human performance. In recent years, gene therapy has shown progress and positive results that have highlighted the potential misuse of this technology and the debate of 'gene doping'. Gene therapies developed for the treatment of diseases such as anaemia (the gene for erythropoietin), muscular dystrophy (the gene for insulin-like growth factor-1) and peripheral vascular diseases (the gene for vascular endothelial growth factor) are potential doping methods. With progress in gene technology, many other genes with this potential will be discovered. For this reason, it is important to develop timely legal regulations and to research the field of gene doping in order to develop methods of detection. To protect the health of athletes and to ensure equal competitive conditions, the International Olympic Committee, WADA and International Sports Federations have accepted performance-enhancing substances and methods as being doping, and have forbidden them. Nevertheless, the desire to win causes athletes to misuse these drugs and methods. This paper reviews the current status of gene doping and candidate performance enhancement genes, and also the use of gene therapy in sports medicine and ethics of genetic enhancement. Copyright 2004 Adis Data Information BV

  3. Do rice suspension-cultured cells treated with abscisic acid mimic developing seeds?

    Science.gov (United States)

    Matsuno, Koya; Fujimura, Tatsuhito

    2015-08-01

    Starch synthesis is activated in the endosperm during seed development and also in rice suspension cells cultured with abscisic acid. In the anticipation that the mechanisms of starch synthesis are similar between the endosperm and the suspension cells cultured with abscisic acid, expression of genes involved in starch synthesis was evaluated in the suspension cells after abscisic acid treatment. However, it was found that the regulatory mechanism of starch synthesis in the suspension cells cultured with abscisic acid was different from that in developing seeds. Expression analyses of genes involved in oil bodies, which accumulate in the embryo and aleurone layer, and seed storage proteins, which accumulate mainly in the endosperm, showed that the former were activated in the suspension cells cultured with abscisic acid, but the latter were not. Master regulators for embryogenesis, OsVP1 (homologue of AtABI3) and OsLFL1 (homologue of AtFUS3 or AtLFL2), were expressed in the suspension cells at levels comparable to those in the embryo. From these results, it is suggested that interactions between regulators and abscisic acid control the synthesis of phytic acid and oil bodies in the cultured cells and embryo. We suggest that the system of suspension cells cultured with abscisic acid helps to reveal the mechanisms of phytic acid and oil body synthesis in embryo.

  4. Disruption of the Arabidopsis CGI-58 homologue produces Chanarin–Dorfman-like lipid droplet accumulation in plants

    OpenAIRE

    James, Christopher N.; Horn, Patrick J.; Case, Charlene R.; Gidda, Satinder K.; Zhang, Daiyuan; Mullen, Robert T.; Dyer, John M.; Anderson, Richard G. W.; Chapman, Kent D.

    2010-01-01

    CGI-58 is the defective gene in the human neutral lipid storage disease called Chanarin-Dorfman syndrome. This disorder causes intracellular lipid droplets to accumulate in nonadipose tissues, such as skin and blood cells. Here, disruption of the homologous CGI-58 gene in Arabidopsis thaliana resulted in the accumulation of neutral lipid droplets in mature leaves. Mass spectroscopy of isolated lipid droplets from cgi-58 loss-of-function mutants showed they contain triacylglycerols with common...

  5. Bombyx mori nucleopolyhedrovirus nucleic acid binding proteins BRO-B and BRO-E associate with host T-cell intracellular antigen 1 homologue BmTRN-1 to influence protein synthesis during infection.

    Science.gov (United States)

    Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime

    2015-07-01

    Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.

  6. LPS-induced genes in intestinal tissue of the sea cucumber Holothuria glaberrima.

    Directory of Open Access Journals (Sweden)

    Francisco Ramírez-Gómez

    2009-07-01

    Full Text Available Metazoan immunity is mainly associated with specialized cells that are directly involved with the immune response. Nevertheless, both in vertebrates and invertebrates other organs might respond to immune activation and participate either directly or indirectly in the ongoing immune process. However, most of what is known about invertebrate immunity has been restricted to immune effector cells and little information is available on the immune responses of other tissues or organs. We now focus on the immune reactions of the intestinal tissue of an echinoderm. Our study employs a non-conventional model, the echinoderm Holothuria glaberrima, to identify intestinal molecules expressed after an immune challenge presented by an intra-coelomic injection of lipopolysaccharides (LPS. The expression profiles of intestinal genes expressed differentially between LPS-injected animals and control sea water-injected animals were determined using a custom-made Agilent microarray with 7209 sea cucumber intestinal ESTs. Fifty (50 unique sequences were found to be differentially expressed in the intestine of LPS-treated sea cucumbers. Seven (7 of these sequences represented homologues of known proteins, while the remaining (43 had no significant similarity with any protein, EST or RNA database. The known sequences corresponded to cytoskeletal proteins (Actin and alpha-actinin, metabolic enzymes (GAPDH, Ahcy and Gnmt, metal ion transport/metabolism (major yolk protein and defense/recognition (fibrinogen-like protein. The expression pattern of 11 genes was validated using semi-quantitative RT-PCR. Nine of these corroborated the microarray results and the remaining two showed a similar trend but without statistical significance. Our results show some of the molecular events by which the holothurian intestine responds to an immune challenge and provide important information to the study of the evolution of the immune response.

  7. The murine homologue of HIRA, a DiGeorge syndrome candidate gene, is expressed in embryonic structures affected in human CATCH22 patients

    NARCIS (Netherlands)

    L.G. Wilming (Laurens); C.A. Snoeren; A.L. Rijswijk (Angelique); C. Meijers (Carel); F.G. Grosveld (Frank)

    1997-01-01

    textabstractA wide spectrum of birth defects is caused by deletions of the DiGeorge syndrome chromosomal region at 22q11. Characteristic features include cranio-facial, cardiac and thymic malformations, which are thought to arise form disturbances in the interactions

  8. A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues

    NARCIS (Netherlands)

    Marcel, T.C.; Varshney, R.K.; Barbieri, M.; Jafary, H.; Kock, de M.J.D.; Graner, A.; Niks, R.E.

    2007-01-01

    A consensus map of barley was constructed based on three reference doubled haploid (DH) populations and three recombinant inbred line (RIL) populations. Several sets of microsatellites were used as bridge markers in the integration of those populations previously genotyped with RFLP or with AFLP

  9. Treated Effluent Disposal Facility

    Data.gov (United States)

    Federal Laboratory Consortium — Treated non-hazardous and non-radioactive liquid wastes are collected and then disposed of through the systems at the Treated Effluent Disposal Facility (TEDF). More...

  10. Process and genes for expression and overexpression of active [FeFe] hydrogenases

    Science.gov (United States)

    Seibert, Michael; King, Paul W; Ghirardi, Maria Lucia; Posewitz, Matthew C; Smolinski, Sharon L

    2014-09-16

    A process for expression of active [FeFe]-hydrogenase in a host organism that does not contain either the structural gene(s) for [FeFe]-hydrogenases and/or homologues for the maturation genes HydE, HydF and HyG, comprising: cloning the structural hydrogenase gene(s) and/or the maturation genes HydE, HydF and HydG from an organisms that contains these genes into expression plasmids; transferring the plasmids into an organism that lacks a native [FeFe]-hydrogenase or that has a disrupted [FeFe]-hydrogenase and culturing it aerobically; and inducing anaerobiosis to provide [FeFe] hydrogenase biosynthesis and H?2#191 production.

  11. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  12. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  13. Thymidylate synthase, dihydropyrimidine dehydrogenase, ERCC1, and thymidine phosphorylase gene expression in primary and metastatic gastrointestinal adenocarcinoma tissue in patients treated on a phase I trial of oxaliplatin and capecitabine

    International Nuclear Information System (INIS)

    Uchida, Kazumi; Danenberg, Peter V; Danenberg, Kathleen D; Grem, Jean L

    2008-01-01

    Over-expression of thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) in tumor tissue is associated with insensitivity to 5-fluorouracil (5-FU). Over-expression of ERCC1 correlates with insensitivity to oxaliplatin (OX) therapy, while high thymidine phosphorylase (TP) levels predict for increased sensitivity to capecitabine (Xel). Biopsies of metastatic tumor were taken before OX (130 mg/m 2 day 1) given with Xel (1200–3000 mg/m 2 in two divided doses days 1–5 and 8–12) every 3-weeks. Micro-dissected metastatic and primary tumors were analyzed for relative gene expression by real-time quantitative polymerase chain reaction. The clinical protocol prospectively identified the molecular targets of interest that would be tested. Endpoints for the molecular analyses were correlation of median, first and third quartiles for relative gene expression of each target with response, time to treatment failure (TTF), and survival. Among 91 patients participating in this trial; 97% had colorectal cancer. The median number of prior chemotherapy regimens was 2, and most had prior 5-FU and irinotecan. In paired samples, median mRNA levels were significantly higher in metastatic versus primary tumor (-fold): TS (1.9), DPD (3.8), ERCC1 (2.1) and TP (1.6). A strong positive correlation was noted between DPD and TP mRNA levels in both primary (r = 0.693, p < 0.0005) and metastatic tissue (r = 0.697, p < 0.00001). There was an association between TS gene expression and responsive and stable disease: patients whose intratumoral TS mRNA levels were above the median value had significantly greater risk of early disease progression (43% vs 17%), but this did not translate into a significant difference in TTF. ERCC1 gene expression above the third quartile was associated with a shorter TTF (median 85 vs 162 days, p = 0.046). Patients whose TS mRNA levels in metastatic tumor tissue were below the median had a longer overall survival (median 417 vs 294 days, p = 0

  14. TREAT (TREe-based Association Test)

    Science.gov (United States)

    TREAT is an R package for detecting complex joint effects in case-control studies. The test statistic is derived from a tree-structure model by recursive partitioning the data. Ultra-fast algorithm is designed to evaluate the significance of association between candidate gene and disease outcome

  15. The human homologue of unc-93 maps to chromosome 6q27 - characterisation and analysis in sporadic epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Liu, Ying; Dodds, Phillippa; Emilion, Gracy

    2002-01-01

    In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62%) on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM). To id...

  16. Complementary striped expression patterns of NK homeobox genes during segment formation in the annelid Platynereis.

    Science.gov (United States)

    Saudemont, Alexandra; Dray, Nicolas; Hudry, Bruno; Le Gouar, Martine; Vervoort, Michel; Balavoine, Guillaume

    2008-05-15

    NK genes are related pan-metazoan homeobox genes. In the fruitfly, NK genes are clustered and involved in patterning various mesodermal derivatives during embryogenesis. It was therefore suggested that the NK cluster emerged in evolution as an ancestral mesodermal patterning cluster. To test this hypothesis, we cloned and analysed the expression patterns of the homologues of NK cluster genes Msx, NK4, NK3, Lbx, Tlx, NK1 and NK5 in the marine annelid Platynereis dumerilii, a representative of trochozoans, the third great branch of bilaterian animals alongside deuterostomes and ecdysozoans. We found that most of these genes are involved, as they are in the fly, in the specification of distinct mesodermal derivatives, notably subsets of muscle precursors. The expression of the homologue of NK4/tinman in the pulsatile dorsal vessel of Platynereis strongly supports the hypothesis that the vertebrate heart derived from a dorsal vessel relocated to a ventral position by D/V axis inversion in a chordate ancestor. Additionally and more surprisingly, NK4, Lbx, Msx, Tlx and NK1 orthologues are expressed in complementary sets of stripes in the ectoderm and/or mesoderm of forming segments, suggesting an involvement in the segment formation process. A potentially ancient role of the NK cluster genes in segment formation, unsuspected from vertebrate and fruitfly studies so far, now deserves to be investigated in other bilaterian species, especially non-insect arthropods and onychophorans.

  17. The p53 gene with emphasis on its paralogues in mosquitoes

    Directory of Open Access Journals (Sweden)

    Tien-Huang Chen

    2017-12-01

    Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

  18. Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

    Czech Academy of Sciences Publication Activity Database

    Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla

    2012-01-01

    Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

  19. A density functional theory study of magneto-electric Jones birefringence of noble gases, furan homologues, and mono-substituted benzenes

    International Nuclear Information System (INIS)

    Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.

    2013-01-01

    We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes

  20. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)

    2013-11-29

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.

  1. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    International Nuclear Information System (INIS)

    Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki

    2013-01-01

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions

  2. Evaluation of the prognostic role of centromere 17 gain and HER2/topoisomerase II alpha gene status and protein expression in patients with breast cancer treated with anthracycline-containing adjuvant chemotherapy: pooled analysis of two Hellenic Cooperative Oncology Group (HeCOG) phase III trials

    International Nuclear Information System (INIS)

    Fountzilas, George; Tsolaki, Eleftheria; Televantou, Despina; Timotheadou, Eleni; Koutras, Angelos; Klouvas, George; Samantas, Epaminontas; Pisanidis, Nikolaos; Karanikiotis, Charisios; Sfakianaki, Ioanna; Pavlidis, Nicholas; Dafni, Urania; Gogas, Helen; Linardou, Helena; Kalogeras, Konstantine T; Pectasides, Dimitrios; Dimopoulos, Meletios A; Bobos, Mattheos; Kotoula, Vassiliki; Batistatou, Anna; Xanthakis, Ioannis; Papadimitriou, Christos; Kostopoulos, Ioannis; Koletsa, Triantafillia

    2013-01-01

    The HER2 gene has been established as a valid biological marker for the treatment of breast cancer patients with trastuzumab and probably other agents, such as paclitaxel and anthracyclines. The TOP2A gene has been associated with response to anthracyclines. Limited information exists on the relationship of HER2/TOP2A gene status in the presence of centromere 17 (CEP17) gain with outcome of patients treated with anthracycline-containing adjuvant chemotherapy. Formalin-fixed paraffin-embedded tumor tissue samples from 1031 patients with high-risk operable breast cancer, enrolled in two consecutive phase III trials, were assessed in a central laboratory by fluorescence in situ hybridization for HER2/TOP2A gene amplification and CEP17 gain (CEP17 probe). Amplification of HER2 and TOP2A were defined as a gene/CEP17 ratio of >2.2 and ≥2.0, respectively, or gene copy number higher than 6. Additionally, HER2, TopoIIa, ER/PgR and Ki67 protein expression was assessed by immunohistochemistry (IHC) and patients were classified according to their IHC phenotype. Treatment consisted of epirubicin-based adjuvant chemotherapy followed by hormonal therapy and radiation, as indicated. HER2 amplification was found in 23.7% of the patients and TOP2A amplification in 10.1%. In total, 41.8% of HER2-amplified tumors demonstrated TOP2A co-amplification. The median (range) of HER2, TOP2A and CEP17 gain was 2.55 (0.70-45.15), 2.20 (0.70-26.15) and 2.00 (0.70-26.55), respectively. Forty percent of the tumors had CEP17 gain (51% of those with HER2 amplification). Adjusting for treatment groups in the Cox model, HER2 amplification, TOP2A amplification, CEP17 gain and HER2/TOP2A co-amplification were not associated with time to relapse or time to death. HER2 amplification, TOP2A amplification, CEP17 gain and HER2/TOP2A co-amplification were not associated with outcome in high-risk breast cancer patients treated with anthracycline-based adjuvant chemotherapy. Australian New Zealand Clinical

  3. Evidence for a functional link between Dd-STATa and Dd-PIAS, a Dictyostelium PIAS homologue.

    Science.gov (United States)

    Kawata, Takefumi; Hirano, Tatsunori; Ogasawara, Shun; Aoshima, Ryota; Yachi, Ayako

    2011-09-01

    Several mammalian protein families inhibit the activity of signal transducer and activator of transcription (STAT) proteins. The protein inhibitor of activated STAT (PIAS) was initially identified through its ability to interact with human STAT proteins. We isolated a gene (pisA) encoding a Dictyostelium orthologue of PIAS, Dd-PIAS, which possesses almost all the representative motifs and domains of mammalian PIAS proteins. A Dd-PIAS null mutant strain displays a normal terminal morphology but with accelerated development once cells are aggregated. In contrast, Dd-PIAS overexpressor strains demonstrate delayed aggregation, almost no slug phototaxis, impaired slug motility, and a prolonged slug migration period. This strain is a near phenocopy of the Dd-STATa null mutant, although it eventually forms a fruiting body, albeit inefficiently. The expression of several Dd-STATa-activated genes is upregulated in the Dd-PIAS null mutant and there is ectopic expression of pstAB makers. The concentration of a PIAS-green fluorescent protein (GFP) fusion protein, expressed under the PIAS promoter, is greatest in the pstO cells and gradually decreases with proximity to the tip of the slug and culminant: a pattern diametrically opposite to that of Dd-STATa. Our results suggest a functional interrelationship between Dd-PIAS and Dd-STATa that influences gene expression and development. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.

  4. Three newly identified galectin homologues from triangle sail mussel (Hyriopsis cumingii) function as potential pattern-recognition receptors.

    Science.gov (United States)

    Zhao, Ling-Ling; Hui, Kaimin; Wang, Yu-Qing; Wang, Yue; Ren, Qian; Li, Xin-Cang

    2018-05-01

    Galactoside-binding lectins, also known as galectins, play crucial roles in innate immune response in invertebrates. In this study, three cDNA sequences from Hyriopsis cumingii were identified and collectively called HcGalec genes. Each of the three deduced HcGalec proteins contained a galactose-binding lectin domain or a GLECT domain. All the three HcGalec genes are mainly present in the hepatopancreas and gills, and their expression is induced at 24 h after bacterial challenge. Three recombinant HcGalec proteins can bind and agglutinate (Ca 2+ -dependent) various microorganisms, including Gram-positive and Gram-negative bacteria. These proteins can attach to mannan and peptidoglycan. Meanwhile, the expression of the three HcGalec genes in the gills were significantly down-regulated after dsRNA interference (HcGalec1-RNAi, HcGalec2-RNAi, and HcGalec3-RNAi) and Vibrio parahaemolyticus injection. The expression levels of some antimicrobial peptides, including lysozyme 1 and lysozyme 2, were also markedly decreased after dsRNA interference. Overall, these results suggested that these three HcGalec proteins may function as potential receptors participating in the innate immune responses of H. cumingii against bacterial infection. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Preliminary crystallographic data of the three homologues of the thiol–disulfide oxidoreductase DsbA in Neisseria meningitidis

    Energy Technology Data Exchange (ETDEWEB)

    Lafaye, Céline [Laboratoire des Protéines Membranaires, Institut de Biologie Structurale, CEA/CNRS/Université Joseph Fourier, 41 Rue Jules Horowitz, 38027 Grenoble CEDEX 01 (France); Iwena, Thomas; Ferrer, Jean-Luc [Laboratoire de Cristallogénèse et Cristallisation des Protéines, Institut de Biologie Structurale, CEA/CNRS/Université Joseph Fourier, 41 Rue Jules Horowitz, 38027 Grenoble CEDEX 01 (France); Kroll, J. Simon [Department of Paediatrics, Imperial College London, St Mary’s Hospital Campus, Norfolk Place, London W2 1PG (United Kingdom); Griat, Mickael; Serre, Laurence, E-mail: laurence.serre@ibs.fr [Laboratoire des Protéines Membranaires, Institut de Biologie Structurale, CEA/CNRS/Université Joseph Fourier, 41 Rue Jules Horowitz, 38027 Grenoble CEDEX 01 (France)

    2008-02-01

    The Neisseria meningitidis genome possesses three genes encoding active DsbAs. To throw light on the reason for this genetic multiplicity, the three enzymes have been purified and crystallized. Bacterial virulence depends on the correct folding of surface-exposed proteins, a process that is catalyzed by the thiol-disulfide oxidoreductase DsbA, which facilitates the synthesis of disulfide bonds in Gram-negative bacteria. Uniquely among bacteria, the Neisseria meningitidis genome possesses three genes encoding active DsbAs: DsbA1, DsbA2 and DsbA3. DsbA1 and DsbA2 have been characterized as lipoproteins involved in natural competence and in host-interactive biology, while the function of DsbA3 remains unknown. In an attempt to shed light on the reason for this multiplicity of dsbA genes, the three enzymes from N. meningitidis have been purified and crystallized in the presence of high concentrations of ammonium sulfate. The best crystals were obtained using DsbA1 and DsbA3; they belong to the orthorhombic and tetragonal systems and diffract to 1.5 and 2.7 Å resolution, respectively.

  6. The Ca{sup 2+} channel TRPML3 specifically interacts with the mammalian ATG8 homologue GATE16 to regulate autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu

    2014-01-03

    Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.

  7. In vivo metabolism of the methyl homologues of delta-8-tetrahydrocannabinol, delta-9-tetrahydrocannabinol and abn-delta-8-tetrahydrocannabinol in the mouse.

    Science.gov (United States)

    Brown, N K; Harvey, D J

    1988-04-01

    Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.

  8. Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly.

    Science.gov (United States)

    Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M

    2013-05-10

    Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad

  9. The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

    International Nuclear Information System (INIS)

    Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.

    2005-01-01

    In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures

  10. Comprehensive identification of genes driven by ERV9-LTRs reveals TNFRSF10B as a re-activatable mediator of testicular cancer cell death

    Science.gov (United States)

    Beyer, U; Krönung, S K; Leha, A; Walter, L; Dobbelstein, M

    2016-01-01

    The long terminal repeat (LTR) of human endogenous retrovirus type 9 (ERV9) acts as a germline-specific promoter that induces the expression of a proapoptotic isoform of the tumor suppressor homologue p63, GTAp63, in male germline cells. Testicular cancer cells silence this promoter, but inhibitors of histone deacetylases (HDACs) restore GTAp63 expression and give rise to apoptosis. We show here that numerous additional transcripts throughout the genome are driven by related ERV9-LTRs. 3' Rapid amplification of cDNA ends (3'RACE) was combined with next-generation sequencing to establish a large set of such mRNAs. HDAC inhibitors induce these ERV9-LTR-driven genes but not the LTRs from other ERVs. In particular, a transcript encoding the death receptor DR5 originates from an ERV9-LTR inserted upstream of the protein coding regions of the TNFRSF10B gene, and it shows an expression pattern similar to GTAp63. When treating testicular cancer cells with HDAC inhibitors as well as the death ligand TNF-related apoptosis-inducing ligand (TRAIL), rapid cell death was observed, which depended on TNFRSF10B expression. HDAC inhibitors also cooperate with cisplatin (cDDP) to promote apoptosis in testicular cancer cells. ERV9-LTRs not only drive a large set of human transcripts, but a subset of them acts in a proapoptotic manner. We propose that this avoids the survival of damaged germ cells. HDAC inhibition represents a strategy of restoring the expression of a class of ERV9-LTR-mediated genes in testicular cancer cells, thereby re-enabling tumor suppression. PMID:26024393

  11. Actin gene identification from selected medicinal plants for their use as internal controls for gene expression studies

    International Nuclear Information System (INIS)

    Mufti, F.U.D.; Banaras, S.

    2015-01-01

    Internal control genes are the constitutive genes which maintain the basic cellular functions and regularly express in both normal and stressed conditions in living organisms. They are used in normalization of gene expression studies in comparative analysis of target genes, as their expression remains comparatively unchanged in all varied conditions. Among internal control genes, actin is considered as a candidate gene for expression studies due to its vital role in shaping cytoskeleton and plant physiology. Unfortunately most of such knowledge is limited to only model plants or crops, not much is known about important medicinal plants. Therefore, we selected seven important medicinal wild plants for molecular identification of actin gene. We used gene specific primers designed from the conserved regions of several known orthologues or homologues of actin genes from other plants. The amplified products of 370-380 bp were sequenced and submitted to GeneBank after their confirmation using different bioinformatics tools. All the novel partial sequences of putative actin genes were submitted to GeneBank (Parthenium hysterophorus (KJ774023), Fagonia indica (KJ774024), Rhazya stricta (KJ774025), Whithania coagulans (KJ774026), Capparis decidua (KJ774027), Verbena officinalis (KJ774028) and Aerva javanica (KJ774029)). The comparisons of these partial sequences by Basic Local Alignment Search Tool (BLAST) and phylogenetic trees demonstrated high similarity with known actin genes of other plants. Our findings illustrated highly conserved nature of actin gene among these selected plants. These novel partial fragments of actin genes from these wild medicinal plants can be used as internal controls for future gene expression studies of these important plants after precise validations of their stable expression in such plants. (author)

  12. Functional Polymorphisms of Base Excision Repair Genes XRCC1 and APEX1 Predict Risk of Radiation Pneumonitis in Patients With Non-Small Cell Lung Cancer Treated With Definitive Radiation Therapy

    International Nuclear Information System (INIS)

    Yin Ming; Liao Zhongxing; Liu Zhensheng; Wang, Li-E; Gomez, Daniel; Komaki, Ritsuko; Wei Qingyi

    2011-01-01

    Purpose: To explore whether functional single nucleotide polymorphisms (SNPs) of base-excision repair genes are predictors of radiation treatment-related pneumonitis (RP), we investigated associations between functional SNPs of ADPRT, APEX1, and XRCC1 and RP development. Methods and Materials: We genotyped SNPs of ADPRT (rs1136410 [V762A]), XRCC1 (rs1799782 [R194W], rs25489 [R280H], and rs25487 [Q399R]), and APEX1 (rs1130409 [D148E]) in 165 patients with non-small cell lung cancer (NSCLC) who received definitive chemoradiation therapy. Results were assessed by both Logistic and Cox regression models for RP risk. Kaplan-Meier curves were generated for the cumulative RP probability by the genotypes. Results: We found that SNPs of XRCC1 Q399R and APEX1 D148E each had a significant effect on the development of Grade ≥2 RP (XRCC1: AA vs. GG, adjusted hazard ratio [HR] = 0.48, 95% confidence interval [CI], 0.24-0.97; APEX1: GG vs. TT, adjusted HR = 3.61, 95% CI, 1.64-7.93) in an allele-dose response manner (Trend tests: p = 0.040 and 0.001, respectively). The number of the combined protective XRCC1 A and APEX1 T alleles (from 0 to 4) also showed a significant trend of predicting RP risk (p = 0.001). Conclusions: SNPs of the base-excision repair genes may be biomarkers for susceptibility to RP. Larger prospective studies are needed to validate our findings.

  13. The perilipin homologue, lipid storage droplet 2, regulates sleep homeostasis and prevents learning impairments following sleep loss.

    Directory of Open Access Journals (Sweden)

    Matthew S Thimgan

    2010-08-01

    Full Text Available Extended periods of waking result in physiological impairments in humans, rats, and flies. Sleep homeostasis, the increase in sleep observed following sleep loss, is believed to counter the negative effects of prolonged waking by restoring vital biological processes that are degraded during sleep deprivation. Sleep homeostasis, as with other behaviors, is influenced by both genes and environment. We report here that during periods of starvation, flies remain spontaneously awake but, in contrast to sleep deprivation, do not accrue any of the negative consequences of prolonged waking. Specifically, the homeostatic response and learning impairments that are a characteristic of sleep loss are not observed following prolonged waking induced by starvation. Recently, two genes, brummer (bmm and Lipid storage droplet 2 (Lsd2, have been shown to modulate the response to starvation. bmm mutants have excess fat and are resistant to starvation, whereas Lsd2 mutants are lean and sensitive to starvation. Thus, we hypothesized that bmm and Lsd2 may play a role in sleep regulation. Indeed, bmm mutant flies display a large homeostatic response following sleep deprivation. In contrast, Lsd2 mutant flies, which phenocopy aspects of starvation as measured by low triglyceride stores, do not exhibit a homeostatic response following sleep loss. Importantly, Lsd2 mutant flies are not learning impaired after sleep deprivation. These results provide the first genetic evidence, to our knowledge, that lipid metabolism plays an important role in regulating the homeostatic response and can protect against neuronal impairments induced by prolonged waking.

  14. Sequence of a complete chicken BG haplotype shows dynamic expansion and contraction of two gene lineages with particular expression patterns

    DEFF Research Database (Denmark)

    Salomonsen, Jan; Chattaway, John A.; Chan, Andrew C. Y.

    2014-01-01

    complex (MHC), and show striking association with particular autoimmune diseases. In chickens, BG genes encode homologues with somewhat different domain organisation. Only a few BG genes have been characterised, one involved in actin-myosin interaction in the intestinal brush border, and another...... implicated in resistance to viral diseases. We characterise all BG genes in B12 chickens, finding a multigene family organised as tandem repeats in the BG region outside the MHC, a single gene in the MHC (the BF-BL region), and another single gene on a different chromosome. There is a precise cell and tissue...... many hybrid genes, suggesting recombination and/or deletion as major evolutionary forces. We identify BG genes in the chicken whole genome shotgun sequence, as well as by comparison to other haplotypes by fibre fluorescence in situ hybridisation, confirming dynamic expansion and contraction within...

  15. Isolation and characterization of CXC receptor genes in a range of elasmobranchs.

    Science.gov (United States)

    Goostrey, Anna; Jones, Gareth; Secombes, Christopher J

    2005-01-01

    The CXC group of chemokines exert their cellular effects via the CXCR group of G-protein coupled receptors. Six CXCR genes have been identified in humans (CXCR1-6), and homologues to some of these have been isolated from a range of vertebrate species. Here we isolate and characterize CXCR genes from a range of elasmobranch species. One CXCR1/2 gene fragment isolated from Scyliorhinus caniculus (lesser spotted catshark), and two CXCR1/2 copies from each of the elasmobranchs, Cetorhinus maximus (basking shark), Carcharodon carcharias (great white shark), and Raja naevus (cuckoo ray), exhibit high similarity to both CXCR1 and CXCR2. The two copies evident in the cuckoo ray and lamniform sharks provide strong evidence of CXCR1/2 lineage specific duplication in rays and sharks. A CXCR fragment isolated from Lamna ditropis (salmon shark) shows high similarity to a range of CXCR4 genes and strong clustering with CXCR4 gene homologues was apparent during phylogenetic reconstruction.

  16. Identification of fast-evolving genes in the scleractinian coral Acropora using comparative EST analysis.

    Directory of Open Access Journals (Sweden)

    Akira Iguchi

    Full Text Available To identify fast-evolving genes in reef-building corals, we performed direct comparative sequence analysis with expressed sequence tag (EST datasets from two acroporid species: Acropora palmata from the Caribbean Sea and A. millepora from the Great Barrier Reef in Australia. Comparison of 589 independent sequences from 1,421 A. palmata contigs, with 10,247 A. millepora contigs resulted in the identification of 196 putative homologues. Most of the homologous pairs demonstrated high amino acid similarities (over 90%. Comparisons of putative homologues showing low amino acid similarities (under 90% among the Acropora species to the near complete datasets from two other cnidarians (Hydra magnipapillata and Nematostella vectensis implied that some were non-orthologous. Within 86 homologous pairs, 39 exhibited dN/dS ratios significantly less than 1, suggesting that these genes are under purifying selection associated with functional constraints. Eight independent genes showed dN/dS ratios exceeding 1, while three deviated significantly from 1, suggesting that these genes may play important roles in the adaptive evolution of Acropora. Our results also indicated that CEL-III lectin was under positive selection, consistent with a possible role in immunity or symbiont recognition. Further studies are needed to clarify the possible functions of the genes under positive selection to provide insight into the evolutionary process of corals.

  17. Identification of fast-evolving genes in the scleractinian coral Acropora using comparative EST analysis.

    Science.gov (United States)

    Iguchi, Akira; Shinzato, Chuya; Forêt, Sylvain; Miller, David J

    2011-01-01

    To identify fast-evolving genes in reef-building corals, we performed direct comparative sequence analysis with expressed sequence tag (EST) datasets from two acroporid species: Acropora palmata from the Caribbean Sea and A. millepora from the Great Barrier Reef in Australia. Comparison of 589 independent sequences from 1,421 A. palmata contigs, with 10,247 A. millepora contigs resulted in the identification of 196 putative homologues. Most of the homologous pairs demonstrated high amino acid similarities (over 90%). Comparisons of putative homologues showing low amino acid similarities (under 90%) among the Acropora species to the near complete datasets from two other cnidarians (Hydra magnipapillata and Nematostella vectensis) implied that some were non-orthologous. Within 86 homologous pairs, 39 exhibited dN/dS ratios significantly less than 1, suggesting that these genes are under purifying selection associated with functional constraints. Eight independent genes showed dN/dS ratios exceeding 1, while three deviated significantly from 1, suggesting that these genes may play important roles in the adaptive evolution of Acropora. Our results also indicated that CEL-III lectin was under positive selection, consistent with a possible role in immunity or symbiont recognition. Further studies are needed to clarify the possible functions of the genes under positive selection to provide insight into the evolutionary process of corals.

  18. Iron metabolism mutant hbd mice have a deletion in Sec15l1, which has homology to a yeast gene for vesicle docking.

    Science.gov (United States)

    White, Robert A; Boydston, Leigh A; Brookshier, Terri R; McNulty, Steven G; Nsumu, Ndona N; Brewer, Brandon P; Blackmore, Krista

    2005-12-01

    Defects in iron absorption and utilization lead to iron deficiency and anemia. While iron transport by transferrin receptor-mediated endocytosis is well understood, it is not completely clear how iron is transported from the endosome to the mitochondria where heme is synthesized. We undertook a positional cloning project to identify the causative mutation for the hemoglobin-deficit (hbd) mouse mutant, which suffers from a microcytic, hypochromic anemia apparently due to defective iron transport in the endocytosis cycle. As shown by previous studies, reticulocyte iron accumulation in homozygous hbd/hbd mice is deficient despite normal binding of transferrin to its receptor and normal transferrin uptake in the cell. We have identified a strong candidate gene for hbd, Sec15l1, a homologue to yeast SEC15, which encodes a key protein in vesicle docking. The hbd mice have an exon deletion in Sec15l1, which is the first known mutation of a SEC gene homologue in mammals.

  19. Expression, purification, crystallization and preliminary diffraction studies of the mammalian DAG kinase homologue YegS from Escherichia coli

    International Nuclear Information System (INIS)

    Bakali H, M. Amin; Nordlund, Pär; Hallberg, B. Martin

    2006-01-01

    The overexpression, crystallization and preliminary diffraction analysis of E. coli YegS are reported. yegS is a gene encoding a 32 kDa cytosolic protein with unknown function but with strong sequence homology to a family of structurally uncharacterized eukaryotic non-protein kinases: diacylglycerol kinases, sphingosine kinases and ceramide kinases. Here, the overexpression, crystallization and preliminary diffraction analysis of Escherichia coli YegS are reported. The crystals belong to space group P2 1 , with unit-cell parameters a = 42.4, b = 166.1, c = 48.5 Å, β = 96.97°. The presence of a dimer in the asymmetric unit was estimated to give a Matthews coefficient (V M ) of 2.5 Å 3 Da −1 and a solvent content of 50.8%(v/v). Single-wavelength diffraction data were collected to a resolution of 1.9 Å using synchrotron radiation

  20. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... NP/PA laws Action center Public and patients SPOT Skin Cancer™ Community programs & events Learn about skin cancer ... and scalp problems Dandruff: How to treat public SPOT Skin Cancer™ Diseases and treatments Acne and rosacea Bumps ...

  1. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... NP/PA laws Action center Public and patients SPOT Skin Cancer™ Community programs & events Learn about skin ... and scalp problems Dandruff: How to treat public SPOT Skin Cancer™ Diseases and treatments Acne and rosacea ...

  2. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... hair, and nail care Skin care Hair care / hair loss Injured skin Nail care Anti-aging skin care ... scalp problems Alopecia areata Dandruff: How to treat Hair loss Scalp psoriasis Itchy skin Painful skin / joints Rashes ...

  3. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... hair, and nail care Skin care Hair care / hair loss Injured skin Nail care Anti-aging skin care ... sweaty skin Eczema / dermatitis Hair and scalp problems Alopecia areata Dandruff: How to treat Hair loss Scalp ...

  4. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... the causes, which appear to be complex. The most effective way to treat and control dandruff is ... when outdoors and seeking shade whenever possible. For most people, dandruff does not require medical attention. However, ...

  5. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious ... treat public SPOT Skin Cancer™ Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious ...

  6. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... C. Fox Award and Lectureship Grants from outside organizations Health Volunteers Overseas Grant Honorary International Society Meeting ... complex. The most effective way to treat and control dandruff is to use dandruff shampoo and scalp ...

  7. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... Rotation PICMED Grant Professionalism Award Resident-Fellow QI Project Award Resident International Grant Resident Scholarship to Legislative ... are still studying the causes, which appear to be complex. The most effective way to treat and ...

  8. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... treat and control dandruff is to use dandruff shampoo and scalp treatments. Follow these tips from dermatologists ... best results: Follow the instructions on the dandruff shampoo bottle: There are many different dandruff shampoos, and ...

  9. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... Skin Knowledge lesson plans and activities Video library Find a dermatologist Why see a board-certified dermatologist? ... hair, and nail care Kids’ zone Video library Find a dermatologist Dandruff: How to treat Dandruff is ...

  10. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... World Dialogues in Dermatology JAAD Mohs AUC MyDermPath+ Psoriasis Patient education resources Practice Management Center Coding and ... areata Dandruff: How to treat Hair loss Scalp psoriasis Itchy skin Painful skin / joints Rashes Scaly skin ...

  11. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... and patients Diseases and treatments Hair and scalp problems Dandruff: How to treat public SPOT Skin Cancer™ Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases Cosmetic treatments Dry / sweaty skin ...

  12. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... skin, hair, and nails Skin dictionary Camp Discovery Good Skin Knowledge lesson plans and ... Dandruff: How to treat Dandruff is a common scalp condition in which small pieces of dry ...

  13. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... Hair and scalp problems Dandruff: How to treat public SPOT Skin Cancer™ Diseases and treatments Acne and ... Member resources Practice Tools Education Meetings & events Advocacy Public & patients Academy resources for: Dermatologists in the US ...

  14. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... Mohs AUC MyDermPath+ Psoriasis Patient education resources Practice Management Center Coding and reimbursement Coding MACRA Fee schedule ... complex. The most effective way to treat and control dandruff is to use dandruff shampoo and scalp ...

  15. Electrolyte Concentrates Treat Dehydration

    Science.gov (United States)

    2009-01-01

    Wellness Brands Inc. of Boulder, Colorado, exclusively licensed a unique electrolyte concentrate formula developed by Ames Research Center to treat and prevent dehydration in astronauts returning to Earth. Marketed as The Right Stuff, the company's NASA-derived formula is an ideal measure for athletes looking to combat dehydration and boost performance. Wellness Brands also plans to expand with products that make use of the formula's effective hydration properties to help treat conditions including heat stroke, altitude sickness, jet lag, and disease.

  16. Intention-to-treat

    OpenAIRE

    Molenberghs, Geert

    2005-01-01

    The randomized clinical trial paradigm is sketched, as well as the foundations on which its validity is based. Issues that jeopardize this validity, such as patient noncompliance and early withdrawal, are discussed. Intention to treat, being an important historical answer to this problem, is introduced, together with a set of criticisms and an indication of alternative approaches. as-treated analysis;clinical trial;incomplete data;last observation carried forward;randomization

  17. Treating chancroid with enoxacin.

    Science.gov (United States)

    Naamara, W; Kunimoto, D Y; D'Costa, L J; Ndinya-Achola, J O; Nsanze, H; Ronald, A R; Plummer, F A

    1988-01-01

    Increasing resistance of Haemophilus ducreyi to antimicrobials necessitates further trials of new antimicrobial agents for treating chancroid. Enoxacin has excellent in vitro activity against H ducreyi, and a randomised clinical trial of three doses of enoxacin 400 mg at intervals of 12 hours compared with a single dose of trimethoprim/sulphametrole (TMP/SMT) 640/3200 mg was therefore conducted. Of 169 men enrolled in the study, 86 received enoxacin and 83 received TMP/SMT. Ulcers were improved or cured in 65/73 men treated with enoxacin and 57/70 men treated with TMP/SMT. This difference was not significant. At 72 hours after treatment, H ducreyi was eradicated from ulcers of 72/77 men treated with enoxacin and of 67/74 of those treated with TMP/SMT. Patients with buboes responded equally well to both treatments. Of 100 H ducreyi strains tested, all were susceptible to both 0.25 mg/l enoxacin and the combination of 0.25 mg/l TMP and 5 mg/l SMT. Although most men treated with either regimen were cured, neither regimen appeared to be the optimum treatment for chancroid. This study shows the efficacy of enoxacin for a soft tissue infection caused by Gram negative organisms. PMID:3044978

  18. Two pheromone precursor genes are transcriptionally expressed in the homothallic ascomycete Sordaria macrospora.

    Science.gov (United States)

    Pöggeler, S

    2000-06-01

    In order to analyze the involvement of pheromones in cell recognition and mating in a homothallic fungus, two putative pheromone precursor genes, named ppg1 and ppg2, were isolated from a genomic library of Sordaria macrospora. The ppg1 gene is predicted to encode a precursor pheromone that is processed by a Kex2-like protease to yield a pheromone that is structurally similar to the alpha-factor of the yeast Saccharomyces cerevisiae. The ppg2 gene encodes a 24-amino-acid polypeptide that contains a putative farnesylated and carboxy methylated C-terminal cysteine residue. The sequences of the predicted pheromones display strong structural similarity to those encoded by putative pheromones of heterothallic filamentous ascomycetes. Both genes are expressed during the life cycle of S. macrospora. This is the first description of pheromone precursor genes encoded by a homothallic fungus. Southern-hybridization experiments indicated that ppg1 and ppg2 homologues are also present in other homothallic ascomycetes.

  19. Long-term auxological and pubertal outcome of patients with hereditary insulin-like growth factor-I deficiency (Laron and growth hormone-gene deletion syndrome) treated with recombinant human insulin-like growth factor-I.

    Science.gov (United States)

    Messina, M F; Arrigo, T; Valenzise, M; Ghizzoni, L; Caruso-Nicoletti, M; Zucchini, S; Chiabotto, P; Crisafulli, G; Zirilli, G; De Luca, F

    2011-04-01

    GH-IGF-I axis is mainly involved in the complex process of somatic growth but emerging evidence suggests that it also influences hypothalamic-pituitary-gonadal (HPG) function. We report some data regarding long-term auxological and pubertal outcome of five female patients with hereditary forms of GH-IGF-I deficiency (Laron and GH-gene deletion syndrome) and a mean age of 23.4±5.3 yr (range 19-32). All the patients received recombinant human IGF-I (rhIGF-I, Pharmacia and Upjohn, Stockholm, Sweden, and rhIGF-I, Genentech, San Francisco, CA, USA) from a mean age of 8.6 yr (range 3.2-14.2) up to the final height. Final height was very disappointing (≤ -5.0 SD scores) and lower than target height in all the patients. Pubertal onset was delayed in most of them but menarche occurred spontaneously in all the patients. Median age at menarche was 15.1 yr. Menstrual cycles were regular for several years. Median duration of gynecological follow- up was 8.3 yr with the longest span of 17.2 yr. We can assert that GH-IGF-I axis has an essential role in promoting linear growth in humans and its physiological action cannot be replaced by pharmacological treatment in most patients with hereditary forms of IGF-I insufficiency as demonstrated by their subnormal final height. Our clinical observations can also support an essential role of IGF-I in genitalia growth but not in the function of HPG axis as demonstrated by the maintenance of regular menstrual cycles in the presence of subnormal levels of IGF-I after treatment discontinuation.

  20. Genomic characterization and expression profiles upon bacterial infection of a novel cystatin B homologue from disk abalone (Haliotis discus discus).

    Science.gov (United States)

    Premachandra, H K A; Wan, Qiang; Elvitigala, Don Anushka Sandaruwan; De Zoysa, Mahanama; Choi, Cheol Young; Whang, Ilson; Lee, Jehee

    2012-12-01

    Cystatins are a large family of cysteine proteinase inhibitors which are involved in diverse biological and pathological processes. In the present study, we identified a gene related to cystatin superfamily, AbCyt B, from disk abalone Haliotis discus discus by expressed sequence tag (EST) analysis and BAC library screening. The complete cDNA sequence of AbCyt B is comprised of 1967 nucleotides with a 306 bp open reading frame (ORF) encoding for 101 amino acids. The amino acid sequence consists of a single cystatin-like domain, which has a cysteine proteinase inhibitor signature, a conserved Gly in N-terminal region, QVVAG motif and a variant of PW motif. No signal peptide, disulfide bonds or carbohydrate side chains were identified. Analysis of deduced amino acid sequence revealed that AbCyt B shares up to 44.7% identity and 65.7% similarity with the cystatin B genes from other organisms. The genomic sequence of AbCyt B is approximately 8.4 Kb, consisting of three exons and two introns. Phylogenetic tree analysis showed that AbCyt B was closely related to the cystatin B from pacific oyster (Crassostrea gigas) under the family 1.Functional analysis of recombinant AbCyt B protein exhibited inhibitory activity against the papain, with almost 84% inhibition at a concentration of 3.5 μmol/L. In tissue expression analysis, AbCyt B transcripts were expressed abundantly in the hemocyte, gill, mantle, and digestive tract, while weakly in muscle, testis, and hepatopancreas. After the immune challenge with Vibrio parahemolyticus, the AbCyt B showed significant (P<0.05) up-regulation of relative mRNA expression in gill and hemocytes at 24 and 6 h of post infection, respectively. These results collectively suggest that AbCyst B is a potent inhibitor of cysteine proteinases and is also potentially involved in immune responses against invading bacterial pathogens in abalone. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. A retinoic acid-inducible mRNA from F9 teratocarcinoma cells encodes a novel protease inhibitor homologue.

    Science.gov (United States)

    Wang, S Y; Gudas, L J

    1990-09-15

    We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.

  2. TM6SF2 and MAC30, new enzyme homologues in sterol metabolism and common metabolic disease.

    Directory of Open Access Journals (Sweden)

    Luis eSanchez-Pulido

    2014-12-01

    Full Text Available Carriers of the Glu167Lys coding variant in the TM6SF2 gene have recently been identified as being more susceptible to non-alcoholic fatty liver disease (NAFLD, yet exhibit lower levels of circulating lipids and hence are protected against cardiovascular disease. Despite the physiological importance of these observations, the molecular function of TM6SF2 remains unknown, and no sequence similarity with functionally characterised proteins has been identified. In order to trace its evolutionary history and to identify functional domains, we embarked on a computational protein sequence analysis of TM6SF2. We identified a new domain, the EXPERA domain, which is conserved among TM6SF, MAC30/TMEM97 and EBP (D8,D7 sterol isomerase protein families. EBP mutations are the cause of chondrodysplasia punctata 2 X-linked dominant (CDPX2, also known as Conradi-Hünermann-Happle syndrome, a defective cholesterol biosynthesis disorder. Our analysis of evolutionary conservation among EXPERA domain-containing families and the previously suggested catalytic mechanism for the EBP enzyme, indicate that TM6SF and MAC30/TMEM97 families are both highly likely to possess, as for the EBP family, catalytic activity as sterol isomerases. This unexpected prediction of enzymatic functions for TM6SF and MAC30/TMEM97 is important because it now permits detailed experiments to investigate the function of these key proteins in various human pathologies, from cardiovascular disease to cancer.

  3. Suppression of bcr-abl synthesis by siRNAs or tyrosine kinase activity by Glivec alters different oncogenes, apoptotic/antiapoptotic genes and cell proliferation factors (microarray study).

    Science.gov (United States)

    Zhelev, Zhivko; Bakalova, Rumiana; Ohba, Hideki; Ewis, Ashraf; Ishikawa, Mitsuru; Shinohara, Yasuo; Baba, Yoshinobu

    2004-07-16

    Short 21-mer double-stranded/small-interfering RNAs (ds/siRNAs) were designed to target bcr-abl mRNA in chronic myelogenous leukemia. The ds/siRNAs were transfected into bcr-abl-positive K-562 (derived from blast crisis chronic myelogenous leukemia), using lipofectamine. Penetrating of ds/siRNAs into the cells was detected by fluorescent confocal microscopy, using fluorescein-labeled ds/siRNAs. The cells were treated with mix of three siRNA sequences (3 x 60 nM) during 6 days with three repetitive transfections. The siRNA-treatment was accompanied with significant reduction of bcr-abl mRNA, p210, protein tyrosine kinase activity and cell proliferation index. Treatment of cells with Glivec (during 8 days with four repetitive doses, 180 nM single dose) resulted in analogous reduction of cell proliferation activity, stronger suppression of protein tyrosine kinase activity, and very low reduction of p210. siRNA-mix and Glivec did not affect significantly the viability of normal lymphocytes. Microarray analysis of siRNA- and Glivec-treated K-562 cells demonstrated that both pathways of bcr-abl suppression were accompanied with overexpression and suppression of many different oncogenes, apoptotic/antiapoptotic and cell proliferation factors. The following genes of interest were found to decrease in relatively equal degree in both siRNA- and Glivec-treated cells: Bcd orf1 and orf2 proto-oncogene, chromatin-specific transcription elongation factor FACT 140-kDa subunit mRNA, gene encoding splicing factor SF1, and mRNA for Tec protein tyrosine kinase. siRNA-mix and Glivec provoked overexpression of the following common genes: c-jun proto-oncogene, protein kinase C-alpha, pvt-1 oncogene homologue (myc activator), interleukin-6, 1-8D gene from interferon-inducible gene family, tumor necrosis factor receptor superfamily (10b), and STAT-induced STAT inhibitor.

  4. Process for treating biomass

    Science.gov (United States)

    Campbell, Timothy J.; Teymouri, Farzaneh

    2018-04-10

    This invention is directed to a process for treating biomass. The biomass is treated with a biomass swelling agent within the vessel to swell or rupture at least a portion of the biomass. A portion of the swelling agent is removed from a first end of the vessel following the treatment. Then steam is introduced into a second end of the vessel different from the first end to further remove swelling agent from the vessel in such a manner that the swelling agent exits the vessel at a relatively low water content.

  5. Genome-wide identification, phylogeny and expression analyses of SCARECROW-LIKE(SCL) genes in millet (Setaria italica).

    Science.gov (United States)

    Liu, Hongyun; Qin, Jiajia; Fan, Hui; Cheng, Jinjin; Li, Lin; Liu, Zheng

    2017-07-01

    As a member of the GRAS gene family, SCARECROW - LIKE ( SCL ) genes encode transcriptional regulators that are involved in plant information transmission and signal transduction. In this study, 44 SCL genes including two SCARECROW genes in millet were identified to be distributed on eight chromosomes, except chromosome 6. All the millet genes contain motifs 6-8, indicating that these motifs are conserved during the evolution. SCL genes of millet were divided into eight groups based on the phylogenetic relationship and classification of Arabidopsis SCL genes. Several putative millet orthologous genes in Arabidopsis , maize and rice were identified. High throughput RNA sequencing revealed that the expressions of millet SCL genes in root, stem, leaf, spica, and along leaf gradient varied greatly. Analyses combining the gene expression patterns, gene structures, motif compositions, promoter cis -elements identification, alternative splicing of transcripts and phylogenetic relationship of SCL genes indicate that the these genes may play diverse functions. Functionally characterized SCL genes in maize, rice and Arabidopsis would provide us some clues for future characterization of their homologues in millet. To the best of our knowledge, this is the first study of millet SCL genes at the genome wide level. Our work provides a useful platform for functional analysis of SCL genes in millet, a model crop for C 4 photosynthesis and bioenergy studies.

  6. Intracellular Protein Delivery for treating Breast Cancer

    Science.gov (United States)

    2013-06-01

    concentration increases, but not as dramatic as cytoplamic fractions possible due to slower nuclear transport than cellular internalization. The nucleus...polymers, dendrimers , and hydrogels for drug delivery. Pharmaceutical research 29, 902-921. Wilson, J.M. (2005). Gendicine: the first commercial gene...sequences were not ccessible to the transport machinery. In stark contrast, hen HeLa cells were treated with S S Rho—APO NC, strong ed fluorescence of

  7. The CD11a partner in Sus scrofa lymphocyte function-associated antigen-1 (LFA-1: mRNA cloning, structure analysis and comparison with mammalian homologues

    Directory of Open Access Journals (Sweden)

    Thomas Anne VT

    2005-10-01

    Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.

  8. MicroRNA-15a finetunes the level of Delta-like 1 homologue (DLK1) in proliferating 3T3-L1 preadipocytes

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael

    2010-01-01

    Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...

  9. First report of a thioredoxin homologue in jellyfish: molecular cloning, expression and antioxidant activity of CcTrx1 from Cyanea capillata.

    Directory of Open Access Journals (Sweden)

    Zengliang Ruan

    Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.

  10. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew

    2016-01-01

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  11. Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion.

    Science.gov (United States)

    Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine

    2015-07-30

    Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

  12. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen

    2016-06-23

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  13. Identification of the Mycobacterium marinum Apa antigen O-mannosylation sites reveals important glycosylation variability with the M. tuberculosis Apa homologue.

    Science.gov (United States)

    Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann

    2012-10-22

    The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Co-precipitation of phosphate and iron limits mitochondrial phosphate availability in Saccharomyces cerevisiae lacking the yeast frataxin homologue (YFH1).

    Science.gov (United States)

    Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel

    2011-02-25

    Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.

  15. Are mice pigmentary genes throwing light on humans?

    Directory of Open Access Journals (Sweden)

    Bose S

    1993-01-01

    Full Text Available In this article the rapid advances made in the molecular genetics of inherited disorders of hypo and hyperpigmentation during the past three years are reviewed. The main focus is on studies in mice as compared to homologues in humans. The main hypomelanotic diseases included are, piebaldism (white spotting due to mutations of c-KIT, PDGF and MGF genes; vitiligo (microphathalmia mice mutations of c-Kit and c-fms genes; Waardenburg syndrome (splotch locus mutations of mice PAX-3 or human Hup-2 genes; albinism (mutations of tyrosinase genes, Menkes disease (Mottled mouse, premature graying (mutations in light/brown locus/gp75/ TRP-1; Griscelli disease (mutations in TRP-1 and steel; Prader-willi and Angelman syndromes, tyrosinase-positive oculocutaneous albinism and hypomelanosis of lto (mutations of pink-eyed dilution gene/mapping to human chromosomes 15 q 11.2 - q12; and human platelet storage pool deficiency diseases due to defects in pallidin, an erythrocyte membrane protein (pallid mouse / mapping to 4.2 pallidin gene. The genetic characterization of hypermelanosis includes, neurofibromatosis 1 (Café-au-lait spots and McCune-Albright Syndrome. Rapid evolving knowledge about pigmentary genes will increase further the knowledge about these hypo and hyperpigmentary disorders.

  16. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... see a board-certified dermatologist? Home Public and patients Diseases and treatments Hair and scalp problems Dandruff: How to treat ... can properly diagnose your condition and recommend a treatment plan that best meets your needs. FIND A FREE SPOTme® SKIN CANCER SCREENING ... & patients Academy resources for: Dermatologists in the US and ...

  17. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... which appear to be complex. The most effective way to treat and control dandruff is to use dandruff shampoo and scalp treatments. Follow these tips from dermatologists to get the best results: Follow the instructions on the dandruff shampoo ...

  18. Treat upgrade fuel fabrication

    International Nuclear Information System (INIS)

    Davidson, K.V.; Schell, D.H.

    1979-01-01

    An extrusion and thermal treatment process was developed to produce graphite fuel rods containing a dispersion of enriched UO 2 . These rods will be used in an upgraded version of the Transient Reactor Test Facility (TREAT). The improved fuel provides a higher graphite matrix density, better fuel dispersion and higher thermal capabilities than the existing fuel

  19. Dandruff: How to Treat

    Medline Plus

    Full Text Available ... problems Dandruff: How to treat public SPOT Skin Cancer™ Diseases and treatments Acne and rosacea Bumps and growths Color problems ... can properly diagnose your condition and recommend a treatment plan that best meets your needs. FIND A FREE SPOTme® ... FIND A DERMATOLOGIST Advanced Search Explore the ...

  20. Treating hydrocarbon oils

    Energy Technology Data Exchange (ETDEWEB)

    Knottenbelt, H W

    1910-04-13

    An improved process of treating petroleum and shale oils is disclosed consisting in separating by distillation fractions suitable after treatment as a substitute for turpentine and for illuminating purposes respectively such treatment consisting in separating any tar bodies that may be present and subjecting the fractions to the action of a solution of ammonia carrying litmus, substantially as and for the purpose set forth.

  1. C7L family of poxvirus host range genes inhibits antiviral activities induced by type I interferons and interferon regulatory factor 1.

    Science.gov (United States)

    Meng, Xiangzhi; Schoggins, John; Rose, Lloyd; Cao, Jingxin; Ploss, Alexander; Rice, Charles M; Xiang, Yan

    2012-04-01

    Vaccinia virus (VACV) K1L and C7L function equivalently in many mammalian cells to support VACV replication and antagonize antiviral activities induced by type I interferons (IFNs). While K1L is limited to orthopoxviruses, genes that are homologous to C7L are found in diverse mammalian poxviruses. In this study, we showed that the C7L homologues from sheeppox virus and swinepox virus could rescue the replication defect of a VACV mutant deleted of both K1L and C7L (vK1L(-)C7L(-)). Interestingly, the sheeppox virus C7L homologue could rescue the replication of vK1L(-)C7L(-) in human HeLa cells but not in murine 3T3 and LA-4 cells, in contrast to all other C7L homologues. Replacing amino acids 134 and 135 of the sheeppox virus C7L homologue, however, made it functional in the two murine cell lines, suggesting that these two residues are critical for antagonizing a putative host restriction factor which has some subtle sequence variation in human and murine cells. Furthermore, the C7L family of host range genes from diverse mammalian poxviruses were all capable of antagonizing type I IFN-induced antiviral activities against VACV. Screening of a library of more than 350 IFN-stimulated genes (ISGs) identified interferon-regulated factor 1 (IRF1) as an inhibitor of vK1L(-)C7L(-) but not wild-type VACV. Expression of either K1L or C7L, however, rendered vK1L(-)C7L(-) resistant to IRF1-induced antiviral activities. Altogether, our data show that K1L and C7L antagonize IRF1-induced antiviral activities and that the host modulation function of C7L is evolutionally conserved in all poxviruses that can readily replicate in tissue-cultured mammalian cells.

  2. The TFIID components human TAF(II)140 and Drosophila BIP2 (TAF(II)155) are novel metazoan homologues of yeast TAF(II)47 containing a histone fold and a PHD finger.

    Science.gov (United States)

    Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I

    2001-08-01

    The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.

  3. Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1

    Science.gov (United States)

    Nilsson, G.; Svensson, G.

    2001-01-01

    Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

  4. Short-chain chlorinated paraffins in soil, paddy seeds (Oryza sativa) and snails (Ampullariidae) in an e-waste dismantling area in China: Homologue group pattern, spatial distribution and risk assessment.

    Science.gov (United States)

    Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin

    2017-01-01

    Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

    DEFF Research Database (Denmark)

    Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl

    2010-01-01

    The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

  6. Evolution and functional analysis of the Pif97 gene of the Pacific oyster Crassostrea gigas

    Directory of Open Access Journals (Sweden)

    Xiaotong WANG, Xiaorui SONG, Tong WANG, Qihui ZHU, Guoying MIAO, Yuanxin CHEN, Xiaodong FANG, Huayong QUE, Li LI, Guofan ZHANG

    2013-02-01

    Full Text Available Mollusc shell matrix proteins (SMPs are important functional components embedded in the shell and play a role in shell formation. A SMP (Pif177 was identified previously from the nacreous layer of the Japanese pearl oyster Pinctada fucata, and its cleavage products (named pfPif97 and pfPif80 proteins were found to bind to the chitin framework and induce aragonite crystal formation and orient the c axis. In this study, a homologue of pfPif177 was cloned from the mantle of the Pacific oyster Crassostrea gigas, containing the homologue of pfPif97 only and not pfPif80. This finding hints at the large divergence in gene structure between the two species. This homologue (cgPif97 shares characteristics with pfPif97, and suggests that the biological functions of these two proteins may be similar. The expression pattern of cgPif97 in different tissues and development stages indicates that it may play an important role in shell formation of the adult oyster. The morphology of the inner shell surface was affected by injected siRNA of cgPif97 and the calcite laths of the shell became thinner and narrower when the siRNA dose increased, suggesting that the cgPif97 gene plays an important role in calcite shell formation in C. gigas. In conclusion, we found evidence that the Pif177 gene evolved very fast but still retains a similar function among species [Current Zoology 59 (1: 109–115, 2013].

  7. Exclusion of RAI2 as the causative gene for Nance-Horan syndrome.

    Science.gov (United States)

    Walpole, S M; Ronce, N; Grayson, C; Dessay, B; Yates, J R; Trump, D; Toutain, A

    1999-05-01

    Nance-Horan syndrome (NHS) is an X-linked condition characterised by congenital cataracts, microphthalmia and/or microcornea, unusual dental morphology, dysmorphic facial features, and developmental delay in some cases. Recent linkage studies have mapped the NHS disease gene to a 3.5-cM interval on Xp22.2 between DXS1053 and DXS443. We previously identified a human homologue of a mouse retinoic-acid-induced gene (RAI2) within the NHS critical flanking interval and have tested the gene as a candidate for Nance-Horan syndrome in nine NHS-affected families. Direct sequencing of the RAI2 gene and predicted promoter region has revealed no mutations in the families screened; RAI2 is therefore unlikely to be associated with NHS.

  8. Differential evolution of antiretroviral restriction factors in pteropid bats as revealed by APOBEC3 gene complexity.

    Science.gov (United States)

    Hayward, Joshua A; Tachedjian, Mary; Cui, Jie; Cheng, Adam Z; Johnson, Adam; Baker, Michelle; Harris, Reuben S; Wang, Lin-Fa; Tachedjian, Gilda

    2018-03-29

    Bats have attracted attention in recent years as important reservoirs of viruses deadly to humans and other mammals. These infections are typically nonpathogenic in bats raising questions about innate immune differences that might exist between bats and other mammals. The APOBEC3 gene family encodes antiviral DNA cytosine deaminases with important roles in the suppression of diverse viruses and genomic parasites. Here we characterize pteropid APOBEC3 genes and show that species within the genus Pteropus possess the largest and most diverse array of APOBEC3 genes identified in any mammal reported to date. Several bat APOBEC3 proteins are antiviral as demonstrated by restriction of retroviral infectivity using HIV-1 as a model, and recombinant A3Z1 subtypes possess strong DNA deaminase activity. These genes represent the first group of antiviral restriction factors identified in bats with extensive diversification relative to homologues in other mammals.

  9. Unique variability of tocopherol composition in various seed oils recovered from by-products of apple industry: rapid and simple determination of all four homologues (α, β, γ and δ) by RP-HPLC/FLD.

    Science.gov (United States)

    Górnaś, Paweł

    2015-04-01

    The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Gene therapy in animal models of autosomal dominant retinitis pigmentosa

    Science.gov (United States)

    Rossmiller, Brian; Mao, Haoyu

    2012-01-01

    Gene therapy for dominantly inherited genetic disease is more difficult than gene-based therapy for recessive disorders, which can be treated with gene supplementation. Treatment of dominant disease may require gene supplementation partnered with suppression of the expression of the mutant gene either at the DNA level, by gene repair, or at the RNA level by RNA interference or transcriptional repression. In this review, we examine some of the gene delivery approaches used to treat animal models of autosomal dominant retinitis pigmentosa, focusing on those models associated with mutations in the gene for rhodopsin. We conclude that combinatorial approaches have the greatest promise for success. PMID:23077406

  11. Process of treating tars

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, C; Hempel, H; Weissenburger, H

    1955-05-05

    A process is described for treating tars or tar oils, especially carbonization tars, characterized in that the tars or tar oils are mixed with benzene or light oils which contain no aromatic material or only slight amounts, or with gas oil in such amounts that the asphalt precipitates, and after separation of the precipitated material the mixture is treated with caustic solution for separation of the phenols, and after separation of the phenolate liquor the mixture is subjected to heating for removal of the dilution medium, then the remaining oil can be used as heating oil or it is submitted to distillation for the purpose of recovering a fuel suitable for diesel motors, while the phenolate liquor is worked up into phenols.

  12. Treating mine water

    Energy Technology Data Exchange (ETDEWEB)

    Matlak, E S; Kochegarova, L V; Zaslavskaya, I Yu

    1980-10-01

    Taking into account the negative influence of mine waters with suspended matter on the natural environment on the surface, the maximum treatment of mine water underground, is proposed. It is noted that full treatment of mine water, using conventional filtration methods, would be rather expensive, but a limited treatment of mine water is possible. Such treated mine water can be used in dust suppression and fire fighting systems. Mine water treated underground should be free of any odor, with pH level ranging from 6 to 9.5, with suspended matter content not exceeding 50 mg/l and coli-titre not less than 300 cm$SUP$3. It is suggested that water treatment to produce water characterized by these parameters is possible and economical. Recommendations on construction of underground sedimentation tanks and channels, and a hydraulic system of cleaning sedimentation tanks are proposed. The settling would be stored underground in abandoned workings. (2 refs.) (In Russian)

  13. Method of treating depression

    Science.gov (United States)

    Henn, Fritz [East Patchogue, NY

    2012-01-24

    Methods for treatment of depression-related mood disorders in mammals, particularly humans are disclosed. The methods of the invention include administration of compounds capable of enhancing glutamate transporter activity in the brain of mammals suffering from depression. ATP-sensitive K.sup.+ channel openers and .beta.-lactam antibiotics are used to enhance glutamate transport and to treat depression-related mood disorders and depressive symptoms.

  14. Inhibition of Breast Cancer-Induced Angiogenesis by a Diverged Homeobox Gene

    Science.gov (United States)

    2005-05-01

    Frizzled homolog 2 (FZD2) Signal transduction 30.4 ɘ.0001 NM 025151 Rab coupling protein ( RCP ) Signal transduction 30.1 0.0026 A1678679 Bone morphogenetic...with smooth muscle a actin, whereas Prx2 of the aorta, declines in the neonate and lymphatic development is the observation expression is highly...Fold change P Up-regulated Genes L37882 Frizzled homologue 2 (FZD2) Signal transduction 30.4 ɘ.0001 NM_025151 Rab coupling protein ( RCP ) Signal

  15. Studies of variability in the PTEN gene among Danish caucasian patients with Type II diabetes mellitus

    DEFF Research Database (Denmark)

    Hansen, L; Jensen, J N; Ekstrøm, C T

    2001-01-01

    Phosphatase and tensin homologue deleted from chromosome ten (PTEN) has recently been characterized as a novel member in the expanding network of proteins regulating the intracellular effects of insulin. By dephosphorylation of phosphatidyl-inositol-(3, 4, 5)-trisphosphate (PIP3) the PTEN protein...... regulates the insulin-dependent phosphoinositide 3-kinase (PI3K) signalling cassette and accordingly might function as a regulator of insulin sensitivity in skeletal muscle and adipose tissue. In this study we tested PTEN as a candidate gene for insulin resistance and late-onset Type II (non...

  16. Differential Expression of Histone H3.3 Genes and Their Role in Modulating Temperature Stress Response in Caenorhabditis elegans.

    Science.gov (United States)

    Delaney, Kamila; Mailler, Jonathan; Wenda, Joanna M; Gabus, Caroline; Steiner, Florian A

    2018-04-10

    Replication-independent variant histones replace canonical histones in nucleosomes and act as important regulators of chromatin function. H3.3 is a major variant of histone H3 that is remarkably conserved across all taxa and is distinguished from canonical H3 by just four key amino acids. Most genomes contain two or more genes expressing H3.3, and complete loss of the protein usually causes sterility or embryonic lethality. Here we investigated the developmental expression pattern of the five Caenorhabditis elegans H3.3 homologues and identified two previously uncharacterized homologues to be restricted to the germ line. We demonstrate an essential role for the conserved histone chaperone HIRA in the nucleosomal loading of all H3.3 variants. This requirement can be bypassed by mutation of the H3.3-specific residues to those found in H3. Analysis of H3.3 knockout mutants revealed a surprising absence of developmental phenotypes. While removal of all H3.3 homologues did not result in lethality, it led to reduced fertility and viability in response to high temperature stress. Our results thus show that H3.3 is non-essential in C. elegans , but is critical for ensuring adequate response to stress. Copyright © 2018, Genetics.

  17. The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.

    Science.gov (United States)

    Ren, Jun; Prescott, John F

    2004-11-15

    An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.

  18. Molecular characterization of a fungal gene paralogue of the penicillin penDE gene of Penicillium chrysogenum

    Science.gov (United States)

    2009-01-01

    Background Penicillium chrysogenum converts isopenicillin N (IPN) into hydrophobic penicillins by means of the peroxisomal IPN acyltransferase (IAT), which is encoded by the penDE gene. In silico analysis of the P. chrysogenum genome revealed the presence of a gene, Pc13g09140, initially described as paralogue of the IAT-encoding penDE gene. We have termed this gene ial because it encodes a protein with high similarity to IAT (IAL for IAT-Like). We have conducted an investigation to characterize the ial gene and to determine the role of the IAL protein in the penicillin biosynthetic pathway. Results The IAL contains motifs characteristic of the IAT such as the processing site, but lacks the peroxisomal targeting sequence ARL. Null ial mutants and overexpressing strains indicated that IAL lacks acyltransferase (penicillin biosynthetic) and amidohydrolase (6-APA forming) activities in vivo. When the canonical ARL motif (leading to peroxisomal targeting) was added to the C-terminus of the IAL protein (IALARL) by site-directed mutagenesis, no penicillin biosynthetic activity was detected. Since the IAT is only active after an accurate self-processing of the preprotein into α and β subunits, self-processing of the IAL was tested in Escherichia coli. Overexpression experiments and SDS-PAGE analysis revealed that IAL is also self-processed in two subunits, but despite the correct processing, the enzyme remained inactive in vitro. Conclusion No activity related to the penicillin biosynthesis was detected for the IAL. Sequence comparison among the P. chrysogenum IAL, the A. nidulans IAL homologue and the IAT, revealed that the lack of enzyme activity seems to be due to an alteration of the essential Ser309 in the thioesterase active site. Homologues of the ial gene have been found in many other ascomycetes, including non-penicillin producers. Our data suggest that like in A. nidulans, the ial and penDE genes might have been formed from a single ancestral gene that became

  19. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Moti