Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved
Directory of Open Access Journals (Sweden)
Manasi S. Apte
2012-01-01
Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.
Characterization and cloning of TMV resistance gene N homologues ...
African Journals Online (AJOL)
Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...
Detection of a Yersinia pestis gene homologue in rodent samples
Directory of Open Access Journals (Sweden)
Timothy A. Giles
2016-08-01
Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.
Directory of Open Access Journals (Sweden)
Bateman Alex
2009-09-01
Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication
Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M
2007-01-01
Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...
Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved
Apte, Manasi S.; Meller, Victoria H.
2011-01-01
Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...
Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A
2003-05-01
Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.
Directory of Open Access Journals (Sweden)
Phelan Anne
2007-06-01
Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.
The Mycobacterium tuberculosis homologue of the Mycobacterium ...
African Journals Online (AJOL)
With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...
Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.
1996-01-01
In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...
The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK
Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A
2014-01-01
A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930
Phosphatase and tensin homologue deleted on chromosome 10 ...
African Journals Online (AJOL)
Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...
Directory of Open Access Journals (Sweden)
Watanabe Haruo
2005-10-01
Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...
Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J
2017-10-02
The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.
Shao, Chung-Ping; Hor, Lien-I
2001-01-01
Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950
Isolation and characterization of an AGAMOUS homologue from cocoa
Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.
2006-01-01
We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that
Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean
Institute of Scientific and Technical Information of China (English)
Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair
2014-01-01
Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.
Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.
1994-01-01
The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...
International Nuclear Information System (INIS)
Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi
1990-01-01
Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types
The role of the leukemia-associated ETO homologue repressors in hematopoiesis
Olsson, André
2006-01-01
The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...
Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron
2011-11-01
Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.
Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.
2004-01-01
Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Directory of Open Access Journals (Sweden)
Moore Landon L
2008-02-01
Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.
La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H
2012-11-30
Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.
Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli
Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger
2015-10-01
To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work
A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue
Spassieva, S; Hille, J
Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed
Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes
International Nuclear Information System (INIS)
Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver
2005-01-01
Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin
International Nuclear Information System (INIS)
Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu
2007-01-01
RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1
Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas
Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu
2017-01-01
Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036
International Nuclear Information System (INIS)
Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.
2003-01-01
Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L
Development of the Zebra Danio Model: Carcinogenesis and Gene Transfer Studies
1996-09-01
Volhard, C. (1992). The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of...protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo
A Biotin Biosynthesis Gene Restricted to Helicobacter
Bi, Hongkai; Zhu, Lei; Jia, Jia; Cronan, John E.
2016-01-01
In most bacteria the last step in synthesis of the pimelate moiety of biotin is cleavage of the ester bond of pimeloyl-acyl carrier protein (ACP) methyl ester. The paradigm cleavage enzyme is Escherichia coli BioH which together with the BioC methyltransferase allows synthesis of the pimelate moiety by a modified fatty acid biosynthetic pathway. Analyses of the extant bacterial genomes showed that bioH is absent from many bioC-containing bacteria and is replaced by other genes. Helicobacter pylori lacks a gene encoding a homologue of the known pimeloyl-ACP methyl ester cleavage enzymes suggesting that it encodes a novel enzyme that cleaves this intermediate. We isolated the H. pylori gene encoding this enzyme, bioV, by complementation of an E. coli bioH deletion strain. Purified BioV cleaved the physiological substrate, pimeloyl-ACP methyl ester to pimeloyl-ACP by use of a catalytic triad, each member of which was essential for activity. The role of BioV in biotin biosynthesis was demonstrated using a reconstituted in vitro desthiobiotin synthesis system. BioV homologues seem the sole pimeloyl-ACP methyl ester esterase present in the Helicobacter species and their occurrence only in H. pylori and close relatives provide a target for development of drugs to specifically treat Helicobacter infections. PMID:26868423
Isolation of a cotton NADP(H oxidase homologue induced by drought stress
Directory of Open Access Journals (Sweden)
NEPOMUCENO ALEXANDRE LIMA
2000-01-01
Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.
Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA
Directory of Open Access Journals (Sweden)
Goldman Gustavo H
2010-01-01
Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin
Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.
Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain
2015-03-01
NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
Monolayer structures of alkyl aldehydes: Odd-membered homologues
International Nuclear Information System (INIS)
Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.
2011-01-01
Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.
Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee
2013-09-15
Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.
Satoh, Kouji; Saji, Shoko; Ito, Shoko; Shimizu, Hideyuki; Saji, Hikaru; Kikuchi, Shoshi
2014-01-01
Throughout Asia, including Japan, rice plants are cultivated in a wide range of areas from lowlands to highlands and are frequently exposed to fog, including acid fog. Some physiological studies have shown that acid fog can be a stress factor for plants. We analyzed the gene expression profiles of rice plants treated with artificially prepared simulated acid fog (SiAF) or simulated neutral fog (SiNF) for 1 or 7 days. Microarray analysis results suggested that both the SiAF and the SiNF treatments induced the expression of genes involved in the defense and stress responses in rice plants. Induction of such genes was detected in plants treated with SiAF for 1 day, and the number of induced genes increased in plants treated with SiAF for 7 days. The genes for defense and stress responses were also induced by SiNF for 7 days, although they were not induced by SiNF for 1 day. The gene expression profiles of the SiAF-treated and the SiNF-treated plants were compared to those of plants treated with other stress factors. The comparison revealed that both SiAF and SiNF treatments have similar effects to biotic stresses and ozone stress. The genes encoding NADPH oxidase and germin, which function in apoplasts, were also induced by SiAF, SiNF and biotic stresses. These findings suggest that both the SiAF and the SiNF treatments may result in oxidative stress through the apoplastic production of reactive oxygen species.
Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma
Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev
2012-01-01
Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205
Energy Technology Data Exchange (ETDEWEB)
Garcia, V.
2001-12-15
The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)
Directory of Open Access Journals (Sweden)
Knüchel Ruth
2008-05-01
Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian
Directory of Open Access Journals (Sweden)
Adriano Senatore
Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
Characterization of MORE AXILLARY GROWTH genes in Populus.
Directory of Open Access Journals (Sweden)
Olaf Czarnecki
Full Text Available Strigolactones are a new class of plant hormones that play a key role in regulating shoot branching. Studies of branching mutants in Arabidopsis, pea, rice and petunia have identified several key genes involved in strigolactone biosynthesis or signaling pathway. In the model plant Arabidopsis, MORE AXILLARY GROWTH1 (MAX1, MAX2, MAX3 and MAX4 are four founding members of strigolactone pathway genes. However, little is known about the strigolactone pathway genes in the woody perennial plants.Here we report the identification of MAX homologues in the woody model plant Populus trichocarpa. We identified the sequence homologues for each MAX protein in P. trichocarpa. Gene expression analysis revealed that Populus MAX paralogous genes are differentially expressed across various tissues and organs. Furthermore, we showed that Populus MAX genes could complement or partially complement the shoot branching phenotypes of the corresponding Arabidopsis max mutants.This study provides genetic evidence that strigolactone pathway genes are likely conserved in the woody perennial plants and lays a foundation for further characterization of strigolactone pathway and its functions in the woody perennial plants.
Gene expression profiles in BCL11B-siRNA treated malignant T cells
Directory of Open Access Journals (Sweden)
Grabarczyk Piotr
2011-05-01
Full Text Available Abstract Background Downregulation of the B-cell chronic lymphocytic leukemia (CLL/lymphoma11B (BCL11B gene by small interfering RNA (siRNA leads to growth inhibition and apoptosis of the human T-cell acute lymphoblastic leukemia (T-ALL cell line Molt-4. To further characterize the molecular mechanism, a global gene expression profile of BCL11B-siRNA -treated Molt-4 cells was established. The expression profiles of several genes were further validated in the BCL11B-siRNA -treated Molt-4 cells and primary T-ALL cells. Results 142 genes were found to be upregulated and 109 genes downregulated in the BCL11B-siRNA -treated Molt-4 cells by microarray analysis. Among apoptosis-related genes, three pro-apoptotic genes, TNFSF10, BIK, BNIP3, were upregulated and one anti-apoptotic gene, BCL2L1 was downregulated. Moreover, the expression of SPP1 and CREBBP genes involved in the transforming growth factor (TGF-β pathway was down 16-fold. Expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP were also examined by real-time PCR. A similar expression pattern of TNFSF10, BCL2L1, and SPP1 was identified. However, CREBBP was not downregulated in the BLC11B-siRNA -treated Molt-4 cells. Conclusion BCL11B-siRNA treatment altered expression profiles of TNFSF10, BCL2L1, and SPP1 in both Molt-4 T cell line and primary T-ALL cells.
Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)
International Nuclear Information System (INIS)
Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo
2006-01-01
The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system
Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.
Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D
2007-07-01
Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.
Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4
International Nuclear Information System (INIS)
Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko
2004-01-01
To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family
Energy Technology Data Exchange (ETDEWEB)
McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.
1997-12-15
Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)
Gene expression profiles in adenosine-treated human mast cells ...
African Journals Online (AJOL)
Gene expression profiles in adenosine-treated human mast cells. ... SW Kang, JE Jeong, CH Kim, SH Choi, SH Chae, SA Jun, HJ Cha, JH Kim, YM Lee, YS ... beta 4, ring finger protein, high-mobility group, calmodulin 2, RAN binding protein, ...
The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements
LENUS (Irish Health Repository)
Thornton, Roibeard F
2010-04-23
Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.
The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements
Directory of Open Access Journals (Sweden)
Kagawa Todd F
2010-04-01
Full Text Available Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.
Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil
2012-01-01
Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988
Status of therapeutic gene transfer to treat canine dilated cardiomyopathy in dogs.
Sleeper, Meg M; Bish, Lawrence T; Sweeney, H Lee
2010-07-01
Therapeutic gene transfer holds promise as a way to treat dilated cardiomyopathy from any underlying cause because the approach attempts to address metabolic disturbances that occur at the molecular level of the failing heart. Calcium-handling abnormalities and increased rates of apoptosis are abnormalities that occur in many types of heart disease, and gene therapies that target these metabolic defects have proven to be beneficial in numerous rodent models of heart disease. The authors are currently evaluating this approach to treat canine idiopathic dilated cardiomyopathy.
International Nuclear Information System (INIS)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-01-01
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-09-18
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.
HerDing: herb recommendation system to treat diseases using genes and chemicals.
Choi, Wonjun; Choi, Chan-Hun; Kim, Young Ran; Kim, Seon-Jong; Na, Chang-Su; Lee, Hyunju
2016-01-01
In recent years, herbs have been researched for new drug candidates because they have a long empirical history of treating diseases and are relatively free from side effects. Studies to scientifically prove the medical efficacy of herbs for target diseases often spend a considerable amount of time and effort in choosing candidate herbs and in performing experiments to measure changes of marker genes when treating herbs. A computational approach to recommend herbs for treating diseases might be helpful to promote efficiency in the early stage of such studies. Although several databases related to traditional Chinese medicine have been already developed, there is no specialized Web tool yet recommending herbs to treat diseases based on disease-related genes. Therefore, we developed a novel search engine, HerDing, focused on retrieving candidate herb-related information with user search terms (a list of genes, a disease name, a chemical name or an herb name). HerDing was built by integrating public databases and by applying a text-mining method. The HerDing website is free and open to all users, and there is no login requirement. Database URL: http://combio.gist.ac.kr/herding. © The Author(s) 2016. Published by Oxford University Press.
Isolation and characterization of CXC receptor genes in a range of elasmobranchs.
Goostrey, Anna; Jones, Gareth; Secombes, Christopher J
2005-01-01
The CXC group of chemokines exert their cellular effects via the CXCR group of G-protein coupled receptors. Six CXCR genes have been identified in humans (CXCR1-6), and homologues to some of these have been isolated from a range of vertebrate species. Here we isolate and characterize CXCR genes from a range of elasmobranch species. One CXCR1/2 gene fragment isolated from Scyliorhinus caniculus (lesser spotted catshark), and two CXCR1/2 copies from each of the elasmobranchs, Cetorhinus maximus (basking shark), Carcharodon carcharias (great white shark), and Raja naevus (cuckoo ray), exhibit high similarity to both CXCR1 and CXCR2. The two copies evident in the cuckoo ray and lamniform sharks provide strong evidence of CXCR1/2 lineage specific duplication in rays and sharks. A CXCR fragment isolated from Lamna ditropis (salmon shark) shows high similarity to a range of CXCR4 genes and strong clustering with CXCR4 gene homologues was apparent during phylogenetic reconstruction.
The actin homologue MreB organizes the bacterial cell membrane
Strahl, H.; Burmann, F.; Hamoen, L.W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate
Directory of Open Access Journals (Sweden)
Hewitt Jane E
2010-11-01
Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.
Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.
Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross
2002-12-01
The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.
The urokinase receptor and its structural homologue C4.4A in human cancer
DEFF Research Database (Denmark)
Jacobsen, B; Ploug, M
2008-01-01
The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...
Gene therapy as a potential tool for treating neuroblastoma-a focused review.
Kumar, M D; Dravid, A; Kumar, A; Sen, D
2016-05-01
Neuroblastoma, a solid tumor caused by rapid division of undifferentiated neuroblasts, is the most common childhood malignancy affecting children aged genes is restored to normalcy. Gene therapy is a powerful tool with the potential to inhibit the deleterious effects of oncogenes by inserting corrected/normal genes into the genome. Both viral and non-viral vector-based gene therapies have been developed and adopted to deliver the target genes into neuroblastoma cells. These attempts have given hope to bringing in a new regime of treatment against neuroblastoma. A few gene-therapy-based treatment strategies have been tested in limited clinical trials yielding some positive results. This mini review is an attempt to provide an overview of the available options of gene therapy to treat neuroblastoma.
Energy Technology Data Exchange (ETDEWEB)
Villa, A.; Strina, D.; Frattini, A. [Consiglio Nazionale delle Ricerche, Milan (Italy)] [and others
1996-07-15
We have previously reported the characterization of the human ZNF75 gene located on Xq26, which has only limited homology (less than 65%) to other ZF genes in the databases. Here, we describe three human zinc finger genes with 86 to 95% homology to ZNF75 at the nucleotide level, which represent all the members of the human ZNF75 subfamily. One of these, ZNF75B, is a pseudogene mapped to chromosome 12q13. The other two, ZNF75A and ZNF75C, maintain on ORF in the sequenced region, and at least the latter is expressed in the U937 cell line. They were mapped to chromosomes 16 and 11, respectively. All these genes are conserved in chimpanzees, gorillas, and orangutans. The ZNF75B homologue is a pseudogene in all three great apes, and in chimpanzee it is located on chromosome 10 (phylogenetic XII), at p13 (corresponding to the human 12q13). The chimpanzee homologue of ZNF75 is also located on the Xq26 chromosome, in the same region, as detected by in situ hybridization. As expected, nucleotide changes were clearly more abundant between human and organutan than between human and chimpanzee or gorilla homologues. Members of the same class were more similar to each other than to the other homologues within the same species. This suggests that the duplication and/or retrotranscription events occurred in a common ancestor long before great ape speciation. This, together with the existance of at least two genes in cows and horses, suggests a relatively high conservation of this gene family. 20 refs., 5 figs., 1 tab.
DEFF Research Database (Denmark)
Koch, Birgit; Nybroe, Ole
2006-01-01
A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...
Differential gene expression profile in pig adipose tissue treated with/without clenbuterol
Directory of Open Access Journals (Sweden)
Deng Xue M
2007-11-01
Full Text Available Abstract Background Clenbuterol, a beta-agonist, can dramatically reduce pig adipose accumulation at high dosages. However, it has been banned in pig production because people who eat pig products treated with clenbuterol can be poisoned by the clenbuterol residues. To understand the molecular mechanism for this fat reduction, cDNA microarray, real-time PCR, two-dimensional electrophoresis and mass spectra were used to study the differential gene expression profiles of pig adipose tissues treated with/without clenbuterol. The objective of this research is to identify novel genes and physiological pathways that potentially facilitate clenbuterol induced reduction of adipose accumulation. Results Clenbuterol was found to improve the lean meat percentage about 10 percent (P Conclusion Pig fat accumulation was reduced dramatically with clenbuterol treatment. Histological sections and global evaluation of gene expression after administration of clenbuterol in pigs identified profound changes in adipose cells. With clenbuterol stimulation, adipose cell volumes decreased and their gene expression profile changed, which indicate some metabolism processes have been also altered. Although the biological functions of the differentially expressed genes are not completely known, higher expressions of these molecules in adipose tissue might contribute to the reduction of fat accumulation. Among these genes, five lipid metabolism related genes were of special interest for further study, including apoD and apoR. The apoR expression was increased at both the RNA and protein levels. The apoR may be one of the critical molecules through which clenbuterol reduces fat accumulation.
Evidence for the intense exchange of MazG in marine cyanophages by horizontal gene transfer.
Directory of Open Access Journals (Sweden)
Michael J Bryan
Full Text Available BACKGROUND: S-PM2 is a phage capable of infecting strains of unicellular cyanobacteria belonging to the genus Synechococcus. S-PM2, like other myoviruses infecting marine cyanobacteria, encodes a number of bacterial-like genes. Amongst these genes is one encoding a MazG homologue that is hypothesized to be involved in the adaption of the infected host for production of progeny phage. METHODOLOGY/PRINCIPAL FINDINGS: This study focuses on establishing the occurrence of mazG homologues in other cyanophages isolated from different oceanic locations. Degenerate PCR primers were designed using the mazG gene of S-PM2. The mazG gene was found to be widely distributed and highly conserved among Synechococcus myoviruses and podoviruses from diverse oceanic provinces. CONCLUSIONS/SIGNIFICANCE: This study provides evidence of a globally connected cyanophage gene pool, the cyanophage mazG gene having a small effective population size indicative of rapid lateral gene transfer despite being present in a substantial fraction of cyanophage. The Prochlorococcus and Synechococcus phage mazG genes do not cluster with the host mazG gene, suggesting that their primary hosts are not the source of the mazG gene.
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W
2015-01-01
"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Curcumin administration suppress acetylcholinesterase gene expression in cadmium treated rats.
Akinyemi, Ayodele Jacob; Oboh, Ganiyu; Fadaka, Adewale Oluwaseun; Olatunji, Babawale Peter; Akomolafe, Seun
2017-09-01
Curcumin, the main polyphenolic component of turmeric (Curcuma longa) rhizomes have been reported to exert anticholinesterase potential with limited information on how they regulate acetylcholinesterase (AChE) gene expression. Hence, this study sought to evaluate the effect of curcumin on cerebral cortex acetylcholinesterase (AChE) activity and their mRNA gene expression level in cadmium (Cd)-treated rats. Furthermore, in vitro effect of different concentrations of curcumin (1-5μg/mL) on rat cerebral cortex AChE activity was assessed. Animals were divided into six groups (n=6): group 1 serve as control (without Cd) and receive saline/vehicle, group 2 receive saline plus curcumin at 25mg/kg, group 3 receive saline plus curcumin 50mg/kg, group 4 receive Cd plus vehicle, group 5 receive Cd plus curcumin at 25mg/kg and group 6 receive Cd plus curcumin at 50mg/kg. Rats received Cd (2.5mg/kg) and curcumin (25 and 50mg/kg, respectively) by oral gavage for 7days. Acetylcholinesterase activity was measured by Ellman's method and AChE expression was carried out by a quantitative reverse transcriptase polymerase chain reaction (RT-qPCR) assay. We observed that acute administration of Cd increased acetylcholinesterase activity and in addition caused a significant (Pcurcumin inhibited AChE activity and alters AChE mRNA levels when compared to Cd-treated group. In addition, curcumin inhibits rat cerebral cortex AChE activity in vitro. In conclusion, curcumin exhibit anti-acetylcholinesterase activity and suppressed AChE mRNA gene expression level in Cd exposed rats, thus providing some biochemical and molecular evidence on the therapeutic effect of this turmeric-derived compound in treating neurological disorders including Alzheimer's disease. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D
2011-01-01
The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah
2017-02-01
Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.
International Nuclear Information System (INIS)
Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo
2012-01-01
A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution
Energy Technology Data Exchange (ETDEWEB)
Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)
2012-08-31
A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.
DEFF Research Database (Denmark)
Gravgaard Thomsen, Karina Hedelund; Lyng, Maria Bibi; Elias, Daniel
2015-01-01
predictive of outcome of ER+ breast cancer patients treated with AIs are needed. Global gene expression analysis was performed on ER+ primary breast cancers from patients treated with adjuvant AI monotherapy; half experienced recurrence (median follow-up 6.7 years). Gene expression alterations were validated...... by qRT-PCR, and functional studies evaluating the effect of siRNA-mediated gene knockdown on cell growth were performed. Twenty-six genes, including TFF3, DACH1, RGS5, and GHR, were shown to exhibit altered expression in tumors from patients with recurrence versus non-recurrent (fold change ≥1.5, p ....05), and the gene expression alterations were confirmed using qRT-PCR. Ten of these 26 genes could be linked in a network associated with cellular proliferation, growth, and development. TFF3, which encodes for trefoil factor 3 and is an estrogen-responsive oncogene shown to play a functional role in tamoxifen...
Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J
2017-04-01
Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cloning and characterization of maize ZmSPK1, a homologue to ...
African Journals Online (AJOL)
hope&shola
2006-03-15
Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.
Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli
Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger
2015-03-01
Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Directory of Open Access Journals (Sweden)
Petar Petrov
Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions
DEFF Research Database (Denmark)
van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.
2017-01-01
, but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...
Doublesex: a conserved downstream gene controlled by diverse ...
Indian Academy of Sciences (India)
The Drosophila doublesex (dsx) gene at the bottom of the sex-determination cascade is the best characterized candidate so far, and is conserved from worms (mab3 of Caenorhabditis elegans) to mammals (Dmrt-1). Studies of dsx homologues from insect species belonging to different orders position them at the bottom of ...
Behaviour of the homologues of Rf and Db in complexing media
International Nuclear Information System (INIS)
Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.
1999-01-01
In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)
García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A
2011-08-01
Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs
The actin homologue MreB organizes the bacterial cell membrane
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...
Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.
2010-01-01
Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083
International Nuclear Information System (INIS)
Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine
2005-01-01
The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry
The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages
International Nuclear Information System (INIS)
Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo
2005-01-01
We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways
2009-01-01
Background Penicillium chrysogenum converts isopenicillin N (IPN) into hydrophobic penicillins by means of the peroxisomal IPN acyltransferase (IAT), which is encoded by the penDE gene. In silico analysis of the P. chrysogenum genome revealed the presence of a gene, Pc13g09140, initially described as paralogue of the IAT-encoding penDE gene. We have termed this gene ial because it encodes a protein with high similarity to IAT (IAL for IAT-Like). We have conducted an investigation to characterize the ial gene and to determine the role of the IAL protein in the penicillin biosynthetic pathway. Results The IAL contains motifs characteristic of the IAT such as the processing site, but lacks the peroxisomal targeting sequence ARL. Null ial mutants and overexpressing strains indicated that IAL lacks acyltransferase (penicillin biosynthetic) and amidohydrolase (6-APA forming) activities in vivo. When the canonical ARL motif (leading to peroxisomal targeting) was added to the C-terminus of the IAL protein (IALARL) by site-directed mutagenesis, no penicillin biosynthetic activity was detected. Since the IAT is only active after an accurate self-processing of the preprotein into α and β subunits, self-processing of the IAL was tested in Escherichia coli. Overexpression experiments and SDS-PAGE analysis revealed that IAL is also self-processed in two subunits, but despite the correct processing, the enzyme remained inactive in vitro. Conclusion No activity related to the penicillin biosynthesis was detected for the IAL. Sequence comparison among the P. chrysogenum IAL, the A. nidulans IAL homologue and the IAT, revealed that the lack of enzyme activity seems to be due to an alteration of the essential Ser309 in the thioesterase active site. Homologues of the ial gene have been found in many other ascomycetes, including non-penicillin producers. Our data suggest that like in A. nidulans, the ial and penDE genes might have been formed from a single ancestral gene that became
DEFF Research Database (Denmark)
Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj
2009-01-01
hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....
Predictive value of MSH2 gene expression in colorectal cancer treated with capecitabine
DEFF Research Database (Denmark)
Jensen, Lars H; Danenberg, Kathleen D; Danenberg, Peter V
2007-01-01
was associated with a hazard ratio of 0.5 (95% confidence interval, 0.23-1.11; P = 0.083) in survival analysis. CONCLUSION: The higher gene expression of MSH2 in responders and the trend for predicting overall survival indicates a predictive value of this marker in the treatment of advanced CRC with capecitabine.......PURPOSE: The objective of the present study was to evaluate the gene expression of the DNA mismatch repair gene MSH2 as a predictive marker in advanced colorectal cancer (CRC) treated with first-line capecitabine. PATIENTS AND METHODS: Microdissection of paraffin-embedded tumor tissue, RNA...
Gene expression profiling of liver from dairy cows treated intra-mammary with lipopolysaccharide
DEFF Research Database (Denmark)
Jiang, Li; Sørensen, Peter; Røntved, Christine
2008-01-01
Liver plays a profound role in the acute phase response (APR) observed in the early phase of acute bovine mastitis caused by Escherichia coli (E. coli). To gain an insight into the genes and pathways involved in hepatic APR of dairy cows we performed a global gene expression analysis of liver...... also seemed to participate in APR. CONCLUSIONS: Performing global gene expression analysis on liver tissue from IM LPS treated cows verified that the liver plays a major role in the APR of E. coli mastitis, and that the bovine hepatic APR follows the same pattern as other mammals when...
Gene expression of panaxydol-treated human melanoma cells using radioactive cDNA microarrays
International Nuclear Information System (INIS)
Cho, Joong Youn; Yu, Su Jin; Soh, Jeong Won; Kim, Meyoung Kon
2001-01-01
Polyacetylenic alcohols derived from Panax ginseng have been studied to be an anticancer reagent previously. One of the Panax ginseng polyacetylenic alcohols, i.e., panaxydol, has been studied to possess an antiproliferative effect on human melanoma cell line (SK-MEL-1). In ths study, radioactive cDNA microarrays enabled an efficient approach to analyze the pattern of gene expression (3.194 genes in a total) simultaneously. The bioinformatics selection of human cDNAs, which is specifically designed for immunology, apoptosis and signal transduction, were arrayed on nylon membranes. Using with 33 P labeled probes, this method provided highly sensitive gene expression profiles of our interest including apoptosis, cell proliferation, cell cycle, and signal transduction. Gene expression profiles were also classified into several categories in accordance with the duration of panaxydol treatment. Consequently, the gene profiles of our interest were significantly up (199 genes, > 2.0 of Z-ratio) or down-(196 genes, < 2.0 of Z-ratio) regulated in panaxydol-treated human melanoma cells
Gene expression of panaxydol-treated human melanoma cells using radioactive cDNA microarrays
Energy Technology Data Exchange (ETDEWEB)
Cho, Joong Youn; Yu, Su Jin; Soh, Jeong Won; Kim, Meyoung Kon [College of Medicine, Korea Univ., Seoul (Korea, Republic of)
2001-07-01
Polyacetylenic alcohols derived from Panax ginseng have been studied to be an anticancer reagent previously. One of the Panax ginseng polyacetylenic alcohols, i.e., panaxydol, has been studied to possess an antiproliferative effect on human melanoma cell line (SK-MEL-1). In ths study, radioactive cDNA microarrays enabled an efficient approach to analyze the pattern of gene expression (3.194 genes in a total) simultaneously. The bioinformatics selection of human cDNAs, which is specifically designed for immunology, apoptosis and signal transduction, were arrayed on nylon membranes. Using with {sup 33}P labeled probes, this method provided highly sensitive gene expression profiles of our interest including apoptosis, cell proliferation, cell cycle, and signal transduction. Gene expression profiles were also classified into several categories in accordance with the duration of panaxydol treatment. Consequently, the gene profiles of our interest were significantly up (199 genes, > 2.0 of Z-ratio) or down-(196 genes, < 2.0 of Z-ratio) regulated in panaxydol-treated human melanoma cells.
Sequence and expression analyses of porcine ISG15 and ISG43 genes.
Huang, Jiangnan; Zhao, Shuhong; Zhu, Mengjin; Wu, Zhenfang; Yu, Mei
2009-08-01
The coding sequences of porcine interferon-stimulated gene 15 (ISG15) and the interferon-stimulated gene (ISG43) were cloned from swine spleen mRNA. The amino acid sequences deduced from porcine ISG15 and ISG43 genes coding sequence shared 24-75% and 29-83% similarity with ISG15s and ISG43s from other vertebrates, respectively. Structural analyses revealed that porcine ISG15 comprises two ubiquitin homologues motifs (UBQ) domain and a conserved C-terminal LRLRGG conjugating motif. Porcine ISG43 contains an ubiquitin-processing proteases-like domain. Phylogenetic analyses showed that porcine ISG15 and ISG43 were mostly related to rat ISG15 and cattle ISG43, respectively. Using quantitative real-time PCR assay, significant increased expression levels of porcine ISG15 and ISG43 genes were detected in porcine kidney endothelial cells (PK15) cells treated with poly I:C. We also observed the enhanced mRNA expression of three members of dsRNA pattern-recognition receptors (PRR), TLR3, DDX58 and IFIH1, which have been reported to act as critical receptors in inducing the mRNA expression of ISG15 and ISG43 genes. However, we did not detect any induced mRNA expression of IFNalpha and IFNbeta, suggesting that transcriptional activations of ISG15 and ISG43 were mediated through IFN-independent signaling pathway in the poly I:C treated PK15 cells. Association analyses in a Landrace pig population revealed that ISG15 c.347T>C (BstUI) polymorphism and the ISG43 c.953T>G (BccI) polymorphism were significantly associated with hematological parameters and immune-related traits.
DEFF Research Database (Denmark)
Hansen, Michael; Bowra, Steve; Lange, Mette
2010-01-01
The storage proteins of barley, in terms of both amino acid profile and quantity, are traits strongly influenced by the amount of nitrogen applied. Given this, we performed a developmental expression analysis of the genes from barley grains grown under field conditions to further our understanding...... profile under different N regimes. Reviewing the expression of the storage protein homologues within the families revealed markedly different temporal profiles; for example, some alleles were expressed very early in development. Furthermore, the differential temporal expression of the homologues suggested...
Structural studies on a non-toxic homologue of type II RIPs from ...
Indian Academy of Sciences (India)
Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...
Gene expression profiling in rat liver treated with compounds inducing phospholipidosis
International Nuclear Information System (INIS)
Hirode, Mitsuhiro; Ono, Atsushi; Miyagishima, Toshikazu; Nagao, Taku; Ohno, Yasuo; Urushidani, Tetsuro
2008-01-01
We have constructed a large-scale transcriptome database of rat liver treated with various drugs. In an effort to identify a biomarker for diagnosis of hepatic phospholipidosis, we extracted 78 probe sets of rat hepatic genes from data of 5 drugs, amiodarone, amitriptyline, clomipramine, imipramine, and ketoconazole, which actually induced this phenotype. Principal component analysis (PCA) using these probes clearly separated dose- and time-dependent clusters of treated groups from their controls. Moreover, 6 drugs (chloramphenicol, chlorpromazine, gentamicin, perhexiline, promethazine, and tamoxifen), which were reported to cause phospholipidosis but judged as negative by histopathological examination, were designated as positive by PCA using these probe sets. Eight drugs (carbon tetrachloride, coumarin, tetracycline, metformin, hydroxyzine, diltiazem, 2-bromoethylamine, and ethionamide), which showed phospholipidosis-like vacuolar formation in the histopathology, could be distinguished from the typical drugs causing phospholipidosis. Moreover, the possible induction of phospholipidosis was predictable by the expression of these genes 24 h after single administration in some of the drugs. We conclude that these identified 78 probe sets could be useful for diagnosis of phospholipidosis, and that toxicogenomics would be a promising approach for prediction of this type of toxicity
DEFF Research Database (Denmark)
Riess, O; Weber, B; Nørremølle, Anne
1992-01-01
as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...
The study of mutability of RYS2 gene in diploid yeast Saccharomyces
International Nuclear Information System (INIS)
Chernov, Yu.O.; Gordenin, D.A.; Soldatov, S.P.; Glazer, V.M.
1985-01-01
More than 3000 spontaneous X-ray and ultraviolet-radiation induced mutants have been obtained by LYSD gene in haploid and diploid yeast Saccharcomyces. Mutants were selected using Chattu et cet. method. Comparison of mutant frequency in haploidy and diploidy and analysis of pho 1 marker closely related with LYS2 gene allow to conclude that the main mechanism causing spontaneous and induced mutants in diploidy is mutation of LYS2 gene in one of homologues and the following mitotic homozygotization of originating mutation
Process and genes for expression and overexpression of active [FeFe] hydrogenases
Seibert, Michael; King, Paul W; Ghirardi, Maria Lucia; Posewitz, Matthew C; Smolinski, Sharon L
2014-09-16
A process for expression of active [FeFe]-hydrogenase in a host organism that does not contain either the structural gene(s) for [FeFe]-hydrogenases and/or homologues for the maturation genes HydE, HydF and HyG, comprising: cloning the structural hydrogenase gene(s) and/or the maturation genes HydE, HydF and HydG from an organisms that contains these genes into expression plasmids; transferring the plasmids into an organism that lacks a native [FeFe]-hydrogenase or that has a disrupted [FeFe]-hydrogenase and culturing it aerobically; and inducing anaerobiosis to provide [FeFe] hydrogenase biosynthesis and H?2#191 production.
Warner, T S; Sinclair, D A; Fitzpatrick, K A; Singh, M; Devlin, R H; Honda, B M
1998-04-01
Mutations in a number of genes affect eye colour in Drosophila melanogaster; some of these "eye-colour" genes have been shown to be involved in various aspects of cellular transport processes. In addition, combinations of viable mutant alleles of some of these genes, such as carnation (car) combined with either light (lt) or deep-orange (dor) mutants, show lethal interactions. Recently, dor was shown to be homologous to the yeast gene PEP3 (VPS18), which is known to be involved in intracellular trafficking. We have undertaken to extend our earlier work on the lt gene, in order to examine in more detail its expression pattern and to characterize its gene product via sequencing of a cloned cDNA. The gene appears to be expressed at relatively high levels in all stages and tissues examined, and shows strong homology to VPS41, a gene involved in cellular-protein trafficking in yeast and higher eukaryotes. Further genetic experiments also point to a role for lt in transport processes: we describe lethal interactions between viable alleles of lt and dor, as well as phenotypic interactions (reductions in eye pigment) between allels of lt and another eye-colour gene, garnet (g), whose gene product has close homology to a subunit of the human adaptor complex, AP-3.
Profiling of hepatic gene expression in rats treated with fibric acid analogs
International Nuclear Information System (INIS)
Cornwell, Paul D.; Souza, Angus T. de; Ulrich, Roger G.
2004-01-01
Peroxisome proliferator-activated receptors (PPARs) are a group of nuclear receptors whose ligands include fatty acids, eicosanoids and the fibrate class of drugs. In humans, fibrates are used to treat dyslipidemias. In rodents, fibrates cause peroxisome proliferation, a change that might explain the observed hepatomegaly. In this study, rats were treated with multiple dose levels of six fibric acid analogs (including fenofibrate) for up to two weeks. Pathological analysis identified hepatocellular hypertrophy as the only sign of hepatotoxicity, and only one compound at the highest dose caused any significant increase in serum ALT or AST activity. RNA profiling revealed that the expression of 1288 genes was related to dose or length of treatment and correlated with hepatocellular hypertrophy. This gene list included expression changes that were consistent with increased mitochondrial and peroxisomal β-oxidation, increased fatty acid transport, increased hepatic uptake of LDL-cholesterol, decreased hepatic uptake of glucose, decreased gluconeogenesis and decreased glycolysis. These changes are likely linked to many of the clinical benefits of fibrate drugs, including decreased serum triglycerides, decreased serum LDL-cholesterol and increased serum HDL-cholesterol. In light of the fact that all six compounds stimulated similar or identical changes in the expression of this set of 1288 genes, these results indicate that hepatomegaly is due to PPARα activation, although signaling through other receptors (e.g. PPARγ, RXR) or through non-receptor pathways cannot be excluded
The p53 gene with emphasis on its paralogues in mosquitoes
Directory of Open Access Journals (Sweden)
Tien-Huang Chen
2017-12-01
Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival
International Nuclear Information System (INIS)
Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.
1997-01-01
Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)
Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue
DEFF Research Database (Denmark)
Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard
2006-01-01
A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...
Yu, Xiao-Zhang; Lin, Yu-Juan; Lu, Chun-Jiao; Zhang, Xue-Hong
2017-09-01
Involvement of genes (CYS-A1, CYS-C1 and NIT4) encoded with cysteine synthase, β-cyanoalanine synthase, nitrilase and cyanide metabolisms are evident in Arabidopsis. In the present study, identifications of CYS-A1, CYS-C1 and NIT4, predictions of conserved motifs, and constructions of phylogenetic relationships, based on their amino acid sequences in rice, were conducted. In order to elucidate the transcriptional responses of these cyanide-degrading genes, two candidate homologues were selected for each gene to test their expression changes upon exposure to exogenous KCN in rice seedlings using RT-PCR. Results showed that all selected candidate homologous genes were differentially expressed at different exposure points in roots and shoots of rice seedlings, suggesting their distinct roles during cyanide assimilation. Both candidate homologues for CYS-A1 constantly exhibited more abundant transcripts in comparison to control. However, only one candidate homologue for CYS-C1 and NIT4 showed a remarkable up-regulation during KCN exposure. Analysis of both tissue and solution cyanide indicated that rice seedlings were quickly able to metabolize exogenous KCN with minor accumulation in plant tissues. In conclusion, significant up-regulation of CYS-A1 suggested that the endogenous pool of cysteine catalyzed by cysteine synthase does not restrict the conversion of exogenous KCN into cyanoalanine through the β-cyanoalanine pathway. However, insufficient responses of the transcription level of NIT4 suggested that NIT enzyme may be a limiting factor for cyanoalanine assimilation by rice seedlings.
Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.
Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng
2012-10-18
Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.
Profiling of hepatic gene expression in rats treated with fibric acid analogs
Energy Technology Data Exchange (ETDEWEB)
Cornwell, Paul D.; Souza, Angus T. de; Ulrich, Roger G
2004-05-18
Peroxisome proliferator-activated receptors (PPARs) are a group of nuclear receptors whose ligands include fatty acids, eicosanoids and the fibrate class of drugs. In humans, fibrates are used to treat dyslipidemias. In rodents, fibrates cause peroxisome proliferation, a change that might explain the observed hepatomegaly. In this study, rats were treated with multiple dose levels of six fibric acid analogs (including fenofibrate) for up to two weeks. Pathological analysis identified hepatocellular hypertrophy as the only sign of hepatotoxicity, and only one compound at the highest dose caused any significant increase in serum ALT or AST activity. RNA profiling revealed that the expression of 1288 genes was related to dose or length of treatment and correlated with hepatocellular hypertrophy. This gene list included expression changes that were consistent with increased mitochondrial and peroxisomal {beta}-oxidation, increased fatty acid transport, increased hepatic uptake of LDL-cholesterol, decreased hepatic uptake of glucose, decreased gluconeogenesis and decreased glycolysis. These changes are likely linked to many of the clinical benefits of fibrate drugs, including decreased serum triglycerides, decreased serum LDL-cholesterol and increased serum HDL-cholesterol. In light of the fact that all six compounds stimulated similar or identical changes in the expression of this set of 1288 genes, these results indicate that hepatomegaly is due to PPAR{alpha} activation, although signaling through other receptors (e.g. PPAR{gamma}, RXR) or through non-receptor pathways cannot be excluded.
Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael
2006-08-15
Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).
Lü, Guodong; Zhang, Wenbao; Wang, Jianhua; Xiao, Yunfeng; Zhao, Jun; Zhao, Jianqin; Sun, Yimin; Zhang, Chuanshan; Wang, Junhua; Lin, Renyong; Liu, Hui; Zhang, Fuchun; Wen, Hao
2014-12-01
Cystic echinoccocosis (CE) is a neglected zoonosis that is caused by the dog-tapeworm Echinococcus granulosus. The disease is endemic worldwide. There is an urgent need for searching effective drug for the treatment of the disease. In this study, we sequenced a cDNA library constructed using RNA isolated from oncospheres, protoscoleces, cyst membrane and adult worms of E. granulosus. A total of 9065 non-redundant or unique sequences were obtained and spotted on chips as uniEST probes to profile the gene expression in protoscoleces of E. granulosus treated with the anthelmintic drugs albendazole and artemisinin, respectively. The results showed that 7 genes were up-regulated and 38 genes were down-regulated in the protoscoleces treated with albendazole. Gene analysis showed that these genes are responsible for energy metabolism, cell cycle and assembly of cell structure. We also identified 100 genes up-regulated and 6 genes down-regulated in the protoscoleces treated with artemisinin. These genes play roles in the transduction of environmental signals, and metabolism. Albendazole appeared its drug efficacy in damaging cell structure, while artemisinin was observed to increase the formation of the heterochromatin in protoscolex cells. Our results highlight the utility of using cDNA microarray methods to detect gene expression profiles of E. granulosus and, in particular, to understand the pharmacologic mechanism of anti-echinococcosis drugs. Copyright © 2014 Elsevier B.V. All rights reserved.
Kang, Hui-Yuan; Wang, Xin-Rong; Gao, Li; Wang, Wei; Li, Mian-Yang; Wang, Li-Li; Wang, Cheng-Bin; Yu, Li
2015-04-01
To evaluate significance of ID4 gene mehtylation in demethylating myelodysplastic syndrome(MDS) cell Line MUTZ1 and 2 patients with MDS. The methylation-specific PCR (MS-PCR) and reverse transcription-PCR (RT-PCR) were applied to identify the methylation status and gene expression of ID4 gene in MDS cell line MUTZ1, a patient with aplastic anemia(AA) and a donor with normal bone marrow (NBM). RT-PCR was applied to detect the ID4 gene expression status in MUTZ1 cell line treated with decitabine at 3 different concentrations. Then bisulfite sequencing PCR (BSP) was applied to detect ID4 gene methylation status in 2 MDS parients treated with decitabine. The MDS cell line MUTZ-1 displayed a complete methylation of ID4 gene promoter with little mRNA expression. Inversely, bone marrow of an AA patient and NBM showed complete unmethylation of this gene with intensity mRNA expression. With the increase of decitabine concentration, ID4 gene mRNA expression was more and more increased. After decitabine treatment, ID4 gene methylation-positive frequencies of both the 2 MDS patients were much more decreased than that of the first treatment. So, ID4 gene mRNA expression inhibited by promoter hypemethylation could be recovered by using demethylation medicine. ID4 as a new potential anti-oncogene suggests that its methylation may become a marker for selection and assessment of therapeutic schedules in patients with MDS.
Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu
2008-02-01
The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.
Homologues of CsLOB1 in citrus function as disease susceptibility genes in citrus canker.
Zhang, Junli; Huguet-Tapia, Jose Carlos; Hu, Yang; Jones, Jeffrey; Wang, Nian; Liu, Sanzhen; White, Frank F
2017-08-01
The lateral organ boundary domain (LBD) genes encode a group of plant-specific proteins that function as transcription factors in the regulation of plant growth and development. Citrus sinensis lateral organ boundary 1 (CsLOB1) is a member of the LBD family and functions as a disease susceptibility gene in citrus bacterial canker (CBC). Thirty-four LBD members have been identified from the Citrus sinensis genome. We assessed the potential for additional members of LBD genes in citrus to function as surrogates for CsLOB1 in CBC, and compared host gene expression on induction of different LBD genes. Using custom-designed transcription activator-like (TAL) effectors, two members of the same clade as CsLOB1, named CsLOB2 and CsLOB3, were found to be capable of functioning similarly to CsLOB1 in CBC. RNA sequencing and quantitative reverse transcription-polymerase chain reaction analyses revealed a set of cell wall metabolic genes that are associated with CsLOB1, CsLOB2 and CsLOB3 expression and may represent downstream genes involved in CBC. © 2016 BSPP AND JOHN WILEY & SONS LTD.
Evolution and functional analysis of the Pif97 gene of the Pacific oyster Crassostrea gigas
Directory of Open Access Journals (Sweden)
Xiaotong WANG, Xiaorui SONG, Tong WANG, Qihui ZHU, Guoying MIAO, Yuanxin CHEN, Xiaodong FANG, Huayong QUE, Li LI, Guofan ZHANG
2013-02-01
Full Text Available Mollusc shell matrix proteins (SMPs are important functional components embedded in the shell and play a role in shell formation. A SMP (Pif177 was identified previously from the nacreous layer of the Japanese pearl oyster Pinctada fucata, and its cleavage products (named pfPif97 and pfPif80 proteins were found to bind to the chitin framework and induce aragonite crystal formation and orient the c axis. In this study, a homologue of pfPif177 was cloned from the mantle of the Pacific oyster Crassostrea gigas, containing the homologue of pfPif97 only and not pfPif80. This finding hints at the large divergence in gene structure between the two species. This homologue (cgPif97 shares characteristics with pfPif97, and suggests that the biological functions of these two proteins may be similar. The expression pattern of cgPif97 in different tissues and development stages indicates that it may play an important role in shell formation of the adult oyster. The morphology of the inner shell surface was affected by injected siRNA of cgPif97 and the calcite laths of the shell became thinner and narrower when the siRNA dose increased, suggesting that the cgPif97 gene plays an important role in calcite shell formation in C. gigas. In conclusion, we found evidence that the Pif177 gene evolved very fast but still retains a similar function among species [Current Zoology 59 (1: 109–115, 2013].
Jechalke, Sven; Kopmann, Christoph; Rosendahl, Ingrid; Groeneweg, Joost; Weichelt, Viola; Krögerrecklenfort, Ellen; Brandes, Nikola; Nordwig, Mathias; Ding, Guo-Chun; Siemens, Jan; Heuer, Holger
2013-01-01
Spreading manure containing antibiotics in agriculture is assumed to stimulate the dissemination of antibiotic resistance in soil bacterial populations. Plant roots influencing the soil environment and its microflora by exudation of growth substrates might considerably increase this effect. In this study, the effects of manure from pigs treated with sulfadiazine (SDZ), here called SDZ manure, on the abundance and transferability of sulfonamide resistance genes sul1 and sul2 in the rhizosphere of maize and grass were compared to the effects in bulk soil in a field experiment. In plots that repeatedly received SDZ manure, a significantly higher abundance of both sul genes was detected compared to that in plots where manure from untreated pigs was applied. Significantly lower abundances of sul genes relative to bacterial ribosomal genes were encountered in the rhizosphere than in bulk soil. However, in contrast to results for bulk soil, the sul gene abundance in the SDZ manure-treated rhizosphere constantly deviated from control treatments over a period of 6 weeks after manuring, suggesting ongoing antibiotic selection over this period. Transferability of sulfonamide resistance was analyzed by capturing resistance plasmids from soil communities into Escherichia coli. Increased rates of plasmid capture were observed in samples from SDZ manure-treated bulk soil and the rhizosphere of maize and grass. More than 97% of the captured plasmids belonged to the LowGC type (having low G+C content), giving further evidence for their important contribution to the environmental spread of antibiotic resistance. In conclusion, differences between bulk soil and rhizosphere need to be considered when assessing the risks associated with the spreading of antibiotic resistance. PMID:23315733
Two fundamentally different classes of microbial genes.
Wolf, Yuri I; Makarova, Kira S; Lobkovsky, Alexander E; Koonin, Eugene V
2016-11-07
The evolution of bacterial and archaeal genomes is highly dynamic and involves extensive horizontal gene transfer and gene loss 1-4 . Furthermore, many microbial species appear to have open pangenomes, where each newly sequenced genome contains more than 10% ORFans, that is, genes without detectable homologues in other species 5,6 . Here, we report a quantitative analysis of microbial genome evolution by fitting the parameters of a simple, steady-state evolutionary model to the comparative genomic data on the gene content and gene order similarity between archaeal genomes. The results reveal two sharply distinct classes of microbial genes, one of which is characterized by effectively instantaneous gene replacement, and the other consists of genes with finite, distributed replacement rates. These findings imply a conservative estimate of the size of the prokaryotic genomic universe, which appears to consist of at least a billion distinct genes. Furthermore, the same distribution of constraints is shown to govern the evolution of gene complement and gene order, without the need to invoke long-range conservation or the selfish operon concept 7 .
Directory of Open Access Journals (Sweden)
Wang Haiyang
2002-12-01
Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.
Functional analysis of PI-like gene in relation to flower development ...
Indian Academy of Sciences (India)
lying flower development in bamboo, a petal-identity gene was identified as a ... 35S::BoPI fully rescued the defective petal forma- tion in the ... Arabidopsis converted sepals to petals; BoPI-C interacted with BoAP3 on yeast two-hybrid assay, just like the full-length ... PI homologue function in regulating perianth organ forma-.
International Nuclear Information System (INIS)
Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.
2009-01-01
Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex
Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.
2010-01-01
PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within
Do rice suspension-cultured cells treated with abscisic acid mimic developing seeds?
Matsuno, Koya; Fujimura, Tatsuhito
2015-08-01
Starch synthesis is activated in the endosperm during seed development and also in rice suspension cells cultured with abscisic acid. In the anticipation that the mechanisms of starch synthesis are similar between the endosperm and the suspension cells cultured with abscisic acid, expression of genes involved in starch synthesis was evaluated in the suspension cells after abscisic acid treatment. However, it was found that the regulatory mechanism of starch synthesis in the suspension cells cultured with abscisic acid was different from that in developing seeds. Expression analyses of genes involved in oil bodies, which accumulate in the embryo and aleurone layer, and seed storage proteins, which accumulate mainly in the endosperm, showed that the former were activated in the suspension cells cultured with abscisic acid, but the latter were not. Master regulators for embryogenesis, OsVP1 (homologue of AtABI3) and OsLFL1 (homologue of AtFUS3 or AtLFL2), were expressed in the suspension cells at levels comparable to those in the embryo. From these results, it is suggested that interactions between regulators and abscisic acid control the synthesis of phytic acid and oil bodies in the cultured cells and embryo. We suggest that the system of suspension cells cultured with abscisic acid helps to reveal the mechanisms of phytic acid and oil body synthesis in embryo.
Directory of Open Access Journals (Sweden)
Akira Iguchi
Full Text Available To identify fast-evolving genes in reef-building corals, we performed direct comparative sequence analysis with expressed sequence tag (EST datasets from two acroporid species: Acropora palmata from the Caribbean Sea and A. millepora from the Great Barrier Reef in Australia. Comparison of 589 independent sequences from 1,421 A. palmata contigs, with 10,247 A. millepora contigs resulted in the identification of 196 putative homologues. Most of the homologous pairs demonstrated high amino acid similarities (over 90%. Comparisons of putative homologues showing low amino acid similarities (under 90% among the Acropora species to the near complete datasets from two other cnidarians (Hydra magnipapillata and Nematostella vectensis implied that some were non-orthologous. Within 86 homologous pairs, 39 exhibited dN/dS ratios significantly less than 1, suggesting that these genes are under purifying selection associated with functional constraints. Eight independent genes showed dN/dS ratios exceeding 1, while three deviated significantly from 1, suggesting that these genes may play important roles in the adaptive evolution of Acropora. Our results also indicated that CEL-III lectin was under positive selection, consistent with a possible role in immunity or symbiont recognition. Further studies are needed to clarify the possible functions of the genes under positive selection to provide insight into the evolutionary process of corals.
Iguchi, Akira; Shinzato, Chuya; Forêt, Sylvain; Miller, David J
2011-01-01
To identify fast-evolving genes in reef-building corals, we performed direct comparative sequence analysis with expressed sequence tag (EST) datasets from two acroporid species: Acropora palmata from the Caribbean Sea and A. millepora from the Great Barrier Reef in Australia. Comparison of 589 independent sequences from 1,421 A. palmata contigs, with 10,247 A. millepora contigs resulted in the identification of 196 putative homologues. Most of the homologous pairs demonstrated high amino acid similarities (over 90%). Comparisons of putative homologues showing low amino acid similarities (under 90%) among the Acropora species to the near complete datasets from two other cnidarians (Hydra magnipapillata and Nematostella vectensis) implied that some were non-orthologous. Within 86 homologous pairs, 39 exhibited dN/dS ratios significantly less than 1, suggesting that these genes are under purifying selection associated with functional constraints. Eight independent genes showed dN/dS ratios exceeding 1, while three deviated significantly from 1, suggesting that these genes may play important roles in the adaptive evolution of Acropora. Our results also indicated that CEL-III lectin was under positive selection, consistent with a possible role in immunity or symbiont recognition. Further studies are needed to clarify the possible functions of the genes under positive selection to provide insight into the evolutionary process of corals.
Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.
Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D
1995-11-01
We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.
van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C
1997-05-01
We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.
Mandal, Chanchal; Kim, Sun Hwa; Chai, Jin Choul; Oh, Seon Mi; Lee, Young Seek; Jung, Kyoung Hwa; Chai, Young Gyu
2016-01-01
Fetal alcohol spectrum disorder is a collective term representing fetal abnormalities associated with maternal alcohol consumption. Prenatal alcohol exposure and related anomalies are well characterized, but the molecular mechanism behind this phenomenon is not well characterized. In this present study, our aim is to profile important genes that regulate cellular development during fetal development. Human embryonic carcinoma cells (NCCIT) are cultured to form embryoid bodies and then treated in the presence and absence of ethanol (50 mM). We employed RNA sequencing to profile differentially expressed genes in the ethanol-treated embryoid bodies from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH data sets. A total of 632, 205 and 517 differentially expressed genes were identified from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH, respectively. Functional annotation using bioinformatics tools reveal significant enrichment of differential cellular development and developmental disorders. Furthermore, a group of 42, 15 and 35 transcription factor-encoding genes are screened from all of the differentially expressed genes obtained from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH, respectively. We validated relative gene expression levels of several transcription factors from these lists by quantitative real-time PCR. We hope that our study substantially contributes to the understanding of the molecular mechanism underlying the pathology of alcohol-mediated anomalies and ease further research.
Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto
2015-10-14
The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.
Dobrovolsky, Vasily N; Revollo, Javier; Pearce, Mason G; Pacheco-Martinez, M Monserrat; Lin, Haixia
2015-10-01
A major question concerning the scientific and regulatory acceptance of the rodent red blood cell-based Pig-a gene mutation assay is the extent to which mutants identified by their phenotype in the assay are caused by mutations in the Pig-a gene. In this study, we identified T-lymphocytes deficient for the glycosylphosphatidylinositol-anchored surface marker, CD48, in control and 7,12-dimethylbenz[a]anthracene (DMBA)-treated rats using a flow cytometric assay and determined the spectra of mutations in the endogenous Pig-a gene in these cells. CD48-deficient T-cells were seeded by sorting at one cell per well into 96-well plates, expanded into clones, and exons of their genomic Pig-a were sequenced. The majority (78%) of CD48-deficient T-cell clones from DMBA-treated rats had mutations in the Pig-a gene. The spectrum of DMBA-induced Pig-a mutations was dominated by mutations at A:T, with the mutated A being on the nontranscribed strand and A → T transversion being the most frequent change. The spectrum of Pig-a mutations in DMBA-treated rats was different from the spectrum of Pig-a mutations in N-ethyl-N-nitrosourea (ENU)-treated rats, but similar to the spectrum of DMBA mutations for another endogenous X-linked gene, Hprt. Only 15% of CD48-deficient mutants from control animals contained Pig-a mutations; T-cell biology may be responsible for a relatively large fraction of false Pig-a mutant lymphocytes in control animals. Among the verified mutants from control rats, the most common were frameshifts and deletions. The differences in the spectra of spontaneous, DMBA-, and ENU-induced Pig-a mutations suggest that the flow cytometric Pig-a assay detects de novo mutation in the endogenous Pig-a gene. © 2015 Wiley Periodicals, Inc.
Is the Prosthetic Homologue Necessary for Embodiment?
Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael
2016-01-01
Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.
Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam
2017-10-01
In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.
Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.
Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji
2015-08-01
Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.
Susca, Antonia; Proctor, Robert H; Butchko, Robert A E; Haidukowski, Miriam; Stea, Gaetano; Logrieco, Antonio; Moretti, Antonio
2014-12-01
The ability to produce fumonisin mycotoxins varies among members of the black aspergilli. Previously, analyses of selected genes in the fumonisin biosynthetic gene (fum) cluster in black aspergilli from California grapes indicated that fumonisin-nonproducing isolates of Aspergillus welwitschiae lack six fum genes, but nonproducing isolates of Aspergillus niger do not. In the current study, analyses of black aspergilli from grapes from the Mediterranean Basin indicate that the genomic context of the fum cluster is the same in isolates of A. niger and A. welwitschiae regardless of fumonisin-production ability and that full-length clusters occur in producing isolates of both species and nonproducing isolates of A. niger. In contrast, the cluster has undergone an eight-gene deletion in fumonisin-nonproducing isolates of A. welwitschiae. Phylogenetic analyses suggest each species consists of a mixed population of fumonisin-producing and nonproducing individuals, and that existence of both production phenotypes may provide a selective advantage to these species. Differences in gene content of fum cluster homologues and phylogenetic relationships of fum genes suggest that the mutation(s) responsible for the nonproduction phenotype differs, and therefore arose independently, in the two species. Partial fum cluster homologues were also identified in genome sequences of four other black Aspergillus species. Gene content of these partial clusters and phylogenetic relationships of fum sequences indicate that non-random partial deletion of the cluster has occurred multiple times among the species. This in turn suggests that an intact cluster and fumonisin production were once more widespread among black aspergilli. Copyright © 2014 Elsevier Inc. All rights reserved.
ToxA, the first discovered fungal proteinaceous host-selective toxin, was originally identified from the tan spot fungus Pyrenophora tritici-repentis (Ptr). Homologues of the PtrToxA gene have not been identified from any other ascomycetes except the leaf/glume blotch fungus Stagonospora nodorum, w...
Timraz, Kenda Hussain Hassan
2016-12-15
This study aims to evaluate the removal efficiency of microbial contaminants, including total cell counts, antibiotic-resistant bacteria (ARB), antibiotic resistance genes (ARGs, e.g. tetO, tetZ, sul1 and sul2) and integrase genes (e.g. intl1 and intl2), by wastewater treatment plants (WWTPs) operated on-site of two hospitals (i.e., SH WWTP and IH WWTP). Both SH and IH WWTPs utilize the conventional activated sludge process but differences in the removal efficiencies were observed. Over the 2 week sampling period, IH WWTP outperformed SH WWTP, and achieved an approximate 0.388 to 2.49-log log removal values (LRVs) for total cell counts compared to the 0.010 to 0.162-log removal in SH WWTP. Although ARB were present in the hospital influent, the treatment process of both hospitals effectively removed ARB from most of the effluent samples. In instances where ARB were recovered in the effluent, none of the viable isolates were identified to be opportunistic pathogenic species based on 16S rRNA gene sequencing. However, sul1 and intl1 genes remained detectable at up to 105 copies per mL or 8 x 10(-1) copies per 16S rRNA gene in the treated effluent, with an LRV of less than 1.2. When the treated effluent is discharged from hospital WWTPs into the public sewer for further treatment as per requirement in many countries, the detected amount of ARGs and integrase genes in the hospital effluent can become a potential source of horizontal gene dissemination in the municipal WWTP. Proper on-site wastewater treatment and surveillance of the effluent quality for emerging contaminants are therefore highly recommended.
Saudemont, Alexandra; Dray, Nicolas; Hudry, Bruno; Le Gouar, Martine; Vervoort, Michel; Balavoine, Guillaume
2008-05-15
NK genes are related pan-metazoan homeobox genes. In the fruitfly, NK genes are clustered and involved in patterning various mesodermal derivatives during embryogenesis. It was therefore suggested that the NK cluster emerged in evolution as an ancestral mesodermal patterning cluster. To test this hypothesis, we cloned and analysed the expression patterns of the homologues of NK cluster genes Msx, NK4, NK3, Lbx, Tlx, NK1 and NK5 in the marine annelid Platynereis dumerilii, a representative of trochozoans, the third great branch of bilaterian animals alongside deuterostomes and ecdysozoans. We found that most of these genes are involved, as they are in the fly, in the specification of distinct mesodermal derivatives, notably subsets of muscle precursors. The expression of the homologue of NK4/tinman in the pulsatile dorsal vessel of Platynereis strongly supports the hypothesis that the vertebrate heart derived from a dorsal vessel relocated to a ventral position by D/V axis inversion in a chordate ancestor. Additionally and more surprisingly, NK4, Lbx, Msx, Tlx and NK1 orthologues are expressed in complementary sets of stripes in the ectoderm and/or mesoderm of forming segments, suggesting an involvement in the segment formation process. A potentially ancient role of the NK cluster genes in segment formation, unsuspected from vertebrate and fruitfly studies so far, now deserves to be investigated in other bilaterian species, especially non-insect arthropods and onychophorans.
Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao
2017-06-01
This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.
Hermes, Fatemah A; Cronan, John E
2013-10-01
The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Jin, Taewon; Kim, Oh Yoen; Shin, Min-Jeong; Choi, Eun Young; Lee, Sung Sook; Han, Ye Sun; Chung, Ji Hyung
2014-10-29
Adiponectin, an adipokine, has been described as showing physiological benefits against obesity-related malfunctions and vascular dysfunction. Several natural compounds that promote the expression and secretion of adipokines in adipocytes could be useful for treating metabolic disorders. This study investigated the effect of fisetin, a dietary flavonoid, on the regulation of adiponectin in adipocytes using 3T3-L1 preadipocytes. The expression and secretion of adiponectin increased in 3T3-L1 cells upon treatment with fisetin in a dose-dependent manner. Fisetin-induced adiponectin secretion was inhibited by peroxisome proliferator-activated receptor (PPAR) antagonists. It was also revealed that fisetin increased the activities of PPARs and silent mating type information regulation 2 homologue 1 (SIRT1) in a dose-dependent manner. Furthermore, the up-regulation of adiponectin and the activation of PPARs induced by fisetin were prevented by a SIRT1 inhibitor. Fisetin also promoted deacetylation of PPAR γ coactivator 1 (PGC-1) and its interaction with PPARs. SIRT knockdown by siRNA significantly decreased both adiponectin production and PPARs-PGC-1 interaction. These results provide evidence that fisetin promotes the gene expression of adiponectin through the activation of SIRT1 and PPARs in adipocytes.
Substitution rates in the X- and Y-linked genes of the plants, Silene latifolia and S. dioica.
Filatov, Dmitry A; Charlesworth, Deborah
2002-06-01
Theory predicts that selection should be less effective in the nonrecombining genes of Y-chromosomes, relative to the situation for genes on the other chromosomes, and this should lead to the accumulation of deleterious nonsynonymous substitutions. In addition, synonymous substitution rates may differ between X- and Y-linked genes because of the male-driven evolution effect and also because of actual differences in per-replication mutation rates between the sex chromosomes. Here, we report the first study of synonymous and nonsynonymous substitution rates on plant sex chromosomes. We sequenced two pairs of sex-linked genes, SlX1-SlY1 and SlX4-SlY4, from dioecious Silene latifolia and S. dioica, and their non-sex-linked homologues from nondioecious S. vulgaris and Lychnis flos-jovis, respectively. The rate of nonsynonymous substitutions in the SlY4 gene is significantly higher than that in the SlX4 gene. Silent substitution rates are also significantly higher in both Y-linked genes, compared with their X-linked homologues. The higher nonsynonymous substitution rate in the SlY4 gene is therefore likely to be caused by a mutation rate difference between the sex chromosomes. The difference in silent substitution rates between the SlX4 and SlY4 genes is too great to be explained solely by a higher per-generation mutation rate in males than females. It is thus probably caused by a difference in per-replication mutation rates between the sex chromosomes. This suggests that the local mutation rate can change in a relatively short evolutionary time.
Directory of Open Access Journals (Sweden)
Jianrao HU, Mingfu CAO, Jiong Chen
2009-10-01
Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].
The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.
Ren, Jun; Prescott, John F
2004-11-15
An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.
Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R
2012-04-01
The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.
Microarray gene expression during early healing of GBR-treated calvarial critical size defects.
Al-Kattan, R; Retzepi, M; Calciolari, E; Donos, N
2017-10-01
To investigate the gene expression and molecular pathways implicated in the regulation of the osseous healing process following guided bone regeneration (GBR). Six 6-month-old Wistar male rats were used. Standardized 5-mm critical size defects were created in the parietal bones of each animal and treated with an extracranial and intracranial ePTFE membrane, according to the GBR principle. Three animals were randomly sacrificed after 7 and 15 days of healing. Total RNA was extracted from each sample and prepared for gene expression analysis. RNA quality and quantity were assessed, followed by hybridization of the cRNA to Affymetrix GeneChip Rat Genome 230 2.0 Arrays. The Affymetrix data were processed, and first-order analysis, quality control and statistical analysis were performed. Biological interpretation was performed via pathway and Gene Ontology (GO) analysis. Between the 7- and 15-day samples, 538 genes were differently regulated. At day 7, inflammatory and immune responses were clearly upregulated. In addition, GO terms related to angiogenesis and cell cycle regulation were overexpressed. At day 15, a more complex cellular activity and cell metabolism were evident. The bone formation processes were significantly overexpressed, with several genes encoding growth factors, enzyme activity, and extracellular matrix formation found as upregulated. Remarkably, a negative regulation of Wnt signalling pathway was observed at 15 days. The gene expression profile of the cells participating in osseous formation varied depending on the healing stage. A number of candidate genes that seem differentially expressed during early stages of intramembranous bone regeneration was suggested. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim
2005-01-01
E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation
Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.
Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas
2015-01-01
ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...
Directory of Open Access Journals (Sweden)
Bart eGeurten
2012-03-01
Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.
International Nuclear Information System (INIS)
Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.
1997-01-01
Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)
Tabassum, Shahina; Ullah Munshi, Saif; Hossain, Marufa; Imam, Akhter
2014-01-01
ABSTRACT Background and aim Assessment of therapeutic response is important for monitoring the prognosis and to take decision for cessation of nucleoside analogues therapy in chronic hepatitis B patients. In addition to serum alanine aminotransferase (ALT), hepatitis B virus (HBV) deoxyribonucleic acid (DNA) load and HBeAg status, identification of molecular markers associated with host immune response would be essential to assess therapeutic response. In this regard the current study was performed with the aim to detect expression of platelet endothelial cell adhesion molecule (PECAM)-I gene in peripheral blood monocytes (PBMCs) of treated chronic hepatitis B patients and also to correlate expression of this gene with serum HBV DNA load and serum ALT levels. Materials and methods The study analyzed 60 chronic hepatitis B (CHB) patients, including 30 untreated and 30 nucleoside analogs treated and 10 healthy controls. PECAM-1 gene expression/ transcripts were detected by conventional RT-PCR. Results The expression PECAM-1 mRNA in the PBMCs of CHB patients was significantly higher in untreated (3.17 ± 0.75) than the treated patients (1.64 ± 0.29) (p Tabassum S, Munshi SU, Hossain M, Imam A. Nucleoside Analog-treated Chronic Hepatitis B Patients showed Reduced Expression of PECAM-1 Gene in Peripheral Blood Mononuclear Cells in Bangladesh. Euroasian J Hepato-Gastroenterol 2014;4(2):87-91. PMID:29699354
Zhelev, Zhivko; Bakalova, Rumiana; Ohba, Hideki; Ewis, Ashraf; Ishikawa, Mitsuru; Shinohara, Yasuo; Baba, Yoshinobu
2004-07-16
Short 21-mer double-stranded/small-interfering RNAs (ds/siRNAs) were designed to target bcr-abl mRNA in chronic myelogenous leukemia. The ds/siRNAs were transfected into bcr-abl-positive K-562 (derived from blast crisis chronic myelogenous leukemia), using lipofectamine. Penetrating of ds/siRNAs into the cells was detected by fluorescent confocal microscopy, using fluorescein-labeled ds/siRNAs. The cells were treated with mix of three siRNA sequences (3 x 60 nM) during 6 days with three repetitive transfections. The siRNA-treatment was accompanied with significant reduction of bcr-abl mRNA, p210, protein tyrosine kinase activity and cell proliferation index. Treatment of cells with Glivec (during 8 days with four repetitive doses, 180 nM single dose) resulted in analogous reduction of cell proliferation activity, stronger suppression of protein tyrosine kinase activity, and very low reduction of p210. siRNA-mix and Glivec did not affect significantly the viability of normal lymphocytes. Microarray analysis of siRNA- and Glivec-treated K-562 cells demonstrated that both pathways of bcr-abl suppression were accompanied with overexpression and suppression of many different oncogenes, apoptotic/antiapoptotic and cell proliferation factors. The following genes of interest were found to decrease in relatively equal degree in both siRNA- and Glivec-treated cells: Bcd orf1 and orf2 proto-oncogene, chromatin-specific transcription elongation factor FACT 140-kDa subunit mRNA, gene encoding splicing factor SF1, and mRNA for Tec protein tyrosine kinase. siRNA-mix and Glivec provoked overexpression of the following common genes: c-jun proto-oncogene, protein kinase C-alpha, pvt-1 oncogene homologue (myc activator), interleukin-6, 1-8D gene from interferon-inducible gene family, tumor necrosis factor receptor superfamily (10b), and STAT-induced STAT inhibitor.
Exclusion of RAI2 as the causative gene for Nance-Horan syndrome.
Walpole, S M; Ronce, N; Grayson, C; Dessay, B; Yates, J R; Trump, D; Toutain, A
1999-05-01
Nance-Horan syndrome (NHS) is an X-linked condition characterised by congenital cataracts, microphthalmia and/or microcornea, unusual dental morphology, dysmorphic facial features, and developmental delay in some cases. Recent linkage studies have mapped the NHS disease gene to a 3.5-cM interval on Xp22.2 between DXS1053 and DXS443. We previously identified a human homologue of a mouse retinoic-acid-induced gene (RAI2) within the NHS critical flanking interval and have tested the gene as a candidate for Nance-Horan syndrome in nine NHS-affected families. Direct sequencing of the RAI2 gene and predicted promoter region has revealed no mutations in the families screened; RAI2 is therefore unlikely to be associated with NHS.
Gene expression profile of colon cancer cell lines treated with SN-38
DEFF Research Database (Denmark)
Wallin, A; Francis, P; Nilbert, M
2010-01-01
the incidence in fact has increased. To improve chemotherapy and enable personalised treatment, the need of biomarkers is of great significance. In this study, we evaluated the gene expression profiles of the colon cancer cell lines treated with SN-38, the active metabolite of topoisomerase-1 inhibitor......Colorectal cancer is the third most common form of cancer in the industrial countries. Due to advances regarding the treatments, primarily development of improved surgical methods and the ability to make the earlier diagnosis, the mortality has remained constant during the past decades even though...
CAR expression and inducibility of CYP2B genes in liver of rats treated with PB-like inducers
International Nuclear Information System (INIS)
Pustylnyak, Vladimir O.; Gulyaeva, Lyudmila F.; Lyakhovich, Vyacheslav V.
2005-01-01
The expression of the CAR gene and inducibility of CYP2B protein in the liver of male Wistar rats treated with phenobarbital (PB) and triphenyldioxane (TPD) were investigated. To clarify the role of phosphorylation/dephosphorylation in these processes, rats were treated with inhibitors of Ca 2+ /calmodulin-dependent kinase II (W 7 ) or protein phosphatases PP1 and PP2A (OA) before induction. Constitutive expression of the CAR gene in livers of untreated rats was detected by multiplex RT-PCR. Treatment with W 7 resulted in a 2.8-fold induction of CAR gene expression, whereas OA led to a 2.4-fold decrease of the mRNA level. The same results were obtained for CYP2B genes expression, which were increased by W 7 treatment (two-fold) and decreased by OA (2.3-fold). PB-induction did not lead to significant alteration in the level of CAR gene expression, although CYP2B genes expression was enhanced two-fold over control values. TPD caused a two-fold increase of both CAR and CYP2B mRNA levels. Both inducers reduced the effects of inhibitors on CAR gene expression. Results of EMSA showed that PB, TPD or W 7 alone induced formation of complexes of NR1 with nuclear proteins. Appearance of the complexes correlated with an increase in CYP2B expression, and their intensities were modulated by the protein kinase inhibitors. Thus, our results demonstrate that constitutive expressions of CAR as well as CYP2B during induction are regulated by phosphorylation/dephosphorylation processes
Directory of Open Access Journals (Sweden)
Miki Noda
2016-06-01
Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.
Characterization, expression and complex formation of the murine Fanconi anaemia gene product Fancg.
van de Vrugt, Henri J; Koomen, Mireille; Berns, Mariska A D; de Vries, Yne; Rooimans, Martin A; van der Weel, Laura; Blom, Eric; de Groot, Jan; Schepers, Rik J; Stone, Stacie; Hoatlin, Maureen E; Cheng, Ngan Ching; Joenje, Hans; Arwert, Fré
2002-03-01
Fanconi anaemia (FA) is an autosomal recessive chromosomal instability disorder. Six distinct FA disease genes have been identified, the products of which function in an integrated pathway that is thought to support a nuclear caretaker function. Comparison of FA gene characteristics in different species may help to unravel the molecular function of the FA pathway. We have cloned the murine homologue of the Fanconi anaemia complementation group G gene, FANCG/XRCC9. The murine Fancg protein shows an 83% similarity to the human protein sequence, and has a predicted molecular weight of 68.5 kDa. Expression of mouse Fancg in human FA-G lymphoblasts fully corrects their cross-linker hypersensitivity. At mRNA and protein levels we detected the co-expression of Fancg and Fanca in murine tissues. In addition, mouse Fancg and Fanca proteins co-purify by immunoprecipitation. Upon transfection into Fanca-deficient mouse embryonic fibroblasts EGFP-Fancg chimeric protein was detectable in the nucleus. We identified a murine cDNA, Fancg, which cross-complements the cellular defect of human FA-G cells and thus represents a true homologue of human FANCG. Spleen, thymus and testis showed the highest Fancg expression levels. Although Fancg and Fanca are able to form a complex, this interaction is not required for Fancg to accumulate in the nuclear compartment.
Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N
1995-02-15
The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.
Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk
2017-01-01
The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.
Meng, Xiangzhi; Schoggins, John; Rose, Lloyd; Cao, Jingxin; Ploss, Alexander; Rice, Charles M; Xiang, Yan
2012-04-01
Vaccinia virus (VACV) K1L and C7L function equivalently in many mammalian cells to support VACV replication and antagonize antiviral activities induced by type I interferons (IFNs). While K1L is limited to orthopoxviruses, genes that are homologous to C7L are found in diverse mammalian poxviruses. In this study, we showed that the C7L homologues from sheeppox virus and swinepox virus could rescue the replication defect of a VACV mutant deleted of both K1L and C7L (vK1L(-)C7L(-)). Interestingly, the sheeppox virus C7L homologue could rescue the replication of vK1L(-)C7L(-) in human HeLa cells but not in murine 3T3 and LA-4 cells, in contrast to all other C7L homologues. Replacing amino acids 134 and 135 of the sheeppox virus C7L homologue, however, made it functional in the two murine cell lines, suggesting that these two residues are critical for antagonizing a putative host restriction factor which has some subtle sequence variation in human and murine cells. Furthermore, the C7L family of host range genes from diverse mammalian poxviruses were all capable of antagonizing type I IFN-induced antiviral activities against VACV. Screening of a library of more than 350 IFN-stimulated genes (ISGs) identified interferon-regulated factor 1 (IRF1) as an inhibitor of vK1L(-)C7L(-) but not wild-type VACV. Expression of either K1L or C7L, however, rendered vK1L(-)C7L(-) resistant to IRF1-induced antiviral activities. Altogether, our data show that K1L and C7L antagonize IRF1-induced antiviral activities and that the host modulation function of C7L is evolutionally conserved in all poxviruses that can readily replicate in tissue-cultured mammalian cells.
Gene expression profiling in respond to TBT exposure in small abalone Haliotis diversicolor.
Jia, Xiwei; Zou, Zhihua; Wang, Guodong; Wang, Shuhong; Wang, Yilei; Zhang, Ziping
2011-10-01
In this study, we investigated the gene expression profiling of small abalone, Haliotis diversicolor by tributyltin (TBT) exposure using a cDNA microarray containing 2473 unique transcripts. Totally, 107 up-regulated genes and 41 down-regulated genes were found. For further investigation of candidate genes from microarray data and EST analysis, quantitative real-time PCR was performed at 6 h, 24 h, 48 h, 96 h and 192 h TBT exposure. 26 genes were found to be significantly differentially expressed in different time course, 3 of them were unknown. Some gene homologues like cellulose, endo-beta-1,4-glucanase, ferritin subunit 1 and thiolester containing protein II CG7052-PB might be the good biomarker candidate for TBT monitor. The identification of stress response genes and their expression profiles will permit detailed investigation of the defense responses of small abalone genes. Published by Elsevier Ltd.
Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela
2018-01-11
Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.
Directory of Open Access Journals (Sweden)
Aldo Nicosia
2018-01-01
Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.
An animal model for Norrie disease (ND): gene targeting of the mouse ND gene.
Berger, W; van de Pol, D; Bächner, D; Oerlemans, F; Winkens, H; Hameister, H; Wieringa, B; Hendriks, W; Ropers, H H
1996-01-01
In order to elucidate the cellular and molecular processes which are involved in Norrie disease (ND), we have used gene targeting technology to generate ND mutant mice. The murine homologue of the ND gene was cloned and shown to encode a polypeptide that shares 94% of the amino acid sequence with its human counterpart. RNA in situ hybridization revealed expression in retina, brain and the olfactory bulb and epithelium of 2 week old mice. Hemizygous mice carrying a replacement mutation in exon 2 of the ND gene developed retrolental structures in the vitreous body and showed an overall disorganization of the retinal ganglion cell layer. The outer plexiform layer disappears occasionally, resulting in a juxtaposed inner and outer nuclear layer. At the same regions, the outer segments of the photoreceptor cell layer are no longer present. These ocular findings are consistent with observations in ND patients and the generated mouse line provides a faithful model for study of early pathogenic events in this severe X-linked recessive neurological disorder.
Activation of pur Gene Expression by a Homologue of the Bacillus subtilis PurR repressor:
DEFF Research Database (Denmark)
Kilstrup, Mogens; Martinussen, Jan
1998-01-01
R encoded repressor from Bacillus subtilis. The wildtype purR gene complements the purine auxotrophy of a purR::Iss1mutant, and it was shown that the purR::Iss1 mutation lowers transcription from the purine regulated L. lactis purD promoter. In a parallel study on the regulation of purC and purD expression....... We have identified a PurBox sequence overlapping the -35 region of the L. lactis purR promoter and found, by studies of a purR-lacLM fusion plasmid, that purR is autoregulated. Because of the high similarity of the PurR proteins from B. subtilis and L. lactis, we looked for PurBox sequences...... in the promoter regions of the PurR regulated genes in B. subtilis, and identified a perfectly matching PurBox in the purA promoter region, and slightly degenerate PurBox like sequences in the promoter regions for the pur operon and the purR gene....
Gene expression profiling of liver from dairy cows treated intra-mammary with lipopolysaccharide
Directory of Open Access Journals (Sweden)
Vels Lotte
2008-09-01
Full Text Available Abstract Background Liver plays a profound role in the acute phase response (APR observed in the early phase of acute bovine mastitis caused by Escherichia coli (E. coli. To gain an insight into the genes and pathways involved in hepatic APR of dairy cows we performed a global gene expression analysis of liver tissue sampled at different time points before and after intra-mammary (IM exposure to E. coli lipopolysaccharide (LPS treatment. Results Approximately 20% target transcripts were differentially expressed and eight co-expression clusters were identified. Each cluster had a unique time-dependent expression profile and consisted of genes involved in different biological processes. Our findings suggest that APR in the liver is triggered by the activation of signaling pathways that are involved with common and hepatic-specific transcription factors and pro-inflammatory cytokines. These mediators in turn stimulated or repressed the expression of genes encoding acute phase proteins (APP, collectins, complement components, chemokines, cell adhesion molecules and key metabolic enzymes during the APR. Hormones, anti-inflammatory and other hypothalamus-pituitary-adrenal axis (HPAA linked mediators also seemed to participate in APR. Conclusion Performing global gene expression analysis on liver tissue from IM LPS treated cows verified that the liver plays a major role in the APR of E. coli mastitis, and that the bovine hepatic APR follows the same pattern as other mammals when they are challenged with LPS. Our work presents the first insight into the dynamic changes in gene expression in the liver that influences the induction, kinetics and clinical outcome of the APR in dairy cows.
An X-linked homologue of the autosomal inprinted gene ZNF127 escapes X inactivation
Energy Technology Data Exchange (ETDEWEB)
Longstreet, M.; Nicholls, R.D.; Willard, H.F. [Case Western Reserve Univ., Cleveland, OH (United States)] [and others
1994-09-01
The ZNF127 gene has been shown to be subject to parental imprinting in both humans and the mouse and maps to within the Prader-Willi/Angelman Syndrome critical region on chromosome 15. We have cloned two X-linked related loci, one of which, ZNFXp is a transcribed gene while the other, ZNFXq, is an untranscribed pseudogene. ZNFXp is 83.6% identical to ZNFXq and 65.4% identical to ZNF127 over 1.4 kb of open reading frame they share in common, Like ZNF127, the predicted protein sequence of ZNFXp contains a C{sub 3}HC{sub 4} zinc finger domain and C{sub 3}H zinc finger-like motifs. Whereas ZNF127 has three C{sub 3}H motifs, ZNFXp has four. A strong CpG island is located within 1 kb 5{prime} of the predicted amino terminus of ZNFXp. Expression of ZNFXp has been detected from mouse/human somatic cell hybrids containing either an active (n=2) or an inactive (n=4) chromosome, and thus escapes X inactivation. Probes made from the 3{prime} UTR of ZNFXp detect a number of related loci in both human and murine DNA, none of which is the ZNF127 locus on chromosome 15. None of the detectable murine bands shows dosage differences between males and females as would be expected for X-linked loci. This raises the possibility that ZNFXp inserted into the human X chromosome after its divergence from a common ancestor with the murine X. We have mapped ZNFXp to Xp11.4 by Southern blotting and PCR of hybrid DNAs and by fluorescence in situ hybridization (FISH). ZNFXq maps within the X Inactivation Center (XIC) region on Xq13.2, approximately 300 kb distal to the XIST gene. We find it intriguing, and perhaps significant, that two members of this gene family are subject to epigenetic regulation -- one autosomal imprinting, and the other escape from X inactivation. These results could imply an evolutionary and mechanistic relationship between these two processes.
Xu, F; Liang, X; Lin, B; Su, F
1999-03-01
Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.
Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G
2007-07-01
A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD
Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan
2015-12-01
Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Jubin N Shah
2016-10-01
Full Text Available Molecular dissection of apomixis - an asexual reproductive mode - is anticipated to solve the enigma of loss of meiotic sex, and to help fixing elite agronomic traits. The Brassicaceae genus Boechera comprises of both sexual and apomictic species, permitting comparative analyses of meiotic circumvention (apomeiosis and parthenogenesis. Whereas previous studies reported local transcriptome changes during these events, it remained unclear whether global changes associated with hybridization, polyploidy and environmental adaptation that arose during evolution of Boechera might hint as (epigenetic regulators of early development prior apomictic initiation. To identify these signatures during vegetative stages, we compared seedling RNA-seq transcriptomes of an obligate triploid apomict and a diploid sexual, both isolated from a drought-prone habitat. Uncovered were several genes differentially expressed between sexual and apomictic seedlings, including homologues of meiotic genes ASYNAPTIC 1 (ASY1 and MULTIPOLAR SPINDLE 1 (MPS1 that were down-regulated in apomicts. An intriguing class of apomict-specific deregulated genes included several NAC transcription factors, homologues of which are known to be transcriptionally reprogrammed during abiotic stress in other plants. Deregulation of both meiotic and stress-response genes during seedling stages might possibly be important in preparation for meiotic circumvention, as similar transcriptional alteration was discernible in apomeiotic floral buds too. Furthermore, we noted that the apomict showed better tolerance to osmotic stress in vitro than the sexual, in conjunction with significant upregulation of a subset of NAC genes. In support of the current model that DNA methylation epigenetically regulates stress, ploidy, hybridization and apomixis, we noted that ASY1, MPS1 and NAC019 homologues were deregulated in Boechera seedlings upon DNA demethylation, and ASY1 in particular seems to be repressed by
Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J
2018-02-01
WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...
Directory of Open Access Journals (Sweden)
Livia C. T. Scorza
2017-02-01
Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also
Inhibition of Breast Cancer-Induced Angiogenesis by a Diverged Homeobox Gene
2005-05-01
Frizzled homolog 2 (FZD2) Signal transduction 30.4 ɘ.0001 NM 025151 Rab coupling protein ( RCP ) Signal transduction 30.1 0.0026 A1678679 Bone morphogenetic...with smooth muscle a actin, whereas Prx2 of the aorta, declines in the neonate and lymphatic development is the observation expression is highly...Fold change P Up-regulated Genes L37882 Frizzled homologue 2 (FZD2) Signal transduction 30.4 ɘ.0001 NM_025151 Rab coupling protein ( RCP ) Signal
Wiles, Travis J.; Lewis, Adam J.; Mobley, Harry L. T.; Casjens, Sherwood R.; Mulvey, Matthew A.
2013-01-01
In bacteria, laterally acquired genes are often concentrated within chromosomal regions known as genomic islands. Using a recently developed zebrafish infection model, we set out to identify unique factors encoded within genomic islands that contribute to the fitness and virulence of a reference urosepsis isolate—extraintestinal pathogenic Escherichia coli strain CFT073. By screening a series of deletion mutants, we discovered a previously uncharacterized gene, neaT, that is conditionally required by the pathogen during systemic infections. In vitro assays indicate that neaT can limit bacterial interactions with host phagocytes and alter the aggregative properties of CFT073. The neaT gene is localized within an integrated P2-like bacteriophage in CFT073, but was rarely found within other proteobacterial genomes. Sequence-based analyses revealed that neaT homologues are present, but discordantly conserved, within a phyletically diverse set of bacterial species. In CFT073, neaT appears to be unameliorated, having an exceptionally A+T-rich composition along with a notably altered codon bias. These data suggest that neaT was recently brought into the proteobacterial pan-genome from an extra-phyletic source. Interestingly, even in G+C-poor genomes, as found within the Firmicutes lineage, neaT-like genes are often unameliorated. Sequence-level features of neaT homologues challenge the common supposition that the A+T-rich nature of many recently acquired genes reflects the nucleotide composition of their genomes of origin. In total, these findings highlight the complexity of the evolutionary forces that can affect the acquisition, utilization, and assimilation of rare genes that promote the niche-dependent fitness and virulence of a bacterial pathogen. PMID:23459509
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K
2010-06-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.
New Genes and Functional Innovation in Mammals.
Luis Villanueva-Cañas, José; Ruiz-Orera, Jorge; Agea, M Isabel; Gallo, Maria; Andreu, David; Albà, M Mar
2017-07-01
The birth of genes that encode new protein sequences is a major source of evolutionary innovation. However, we still understand relatively little about how these genes come into being and which functions they are selected for. To address these questions, we have obtained a large collection of mammalian-specific gene families that lack homologues in other eukaryotic groups. We have combined gene annotations and de novo transcript assemblies from 30 different mammalian species, obtaining ∼6,000 gene families. In general, the proteins in mammalian-specific gene families tend to be short and depleted in aromatic and negatively charged residues. Proteins which arose early in mammalian evolution include milk and skin polypeptides, immune response components, and proteins involved in reproduction. In contrast, the functions of proteins which have a more recent origin remain largely unknown, despite the fact that these proteins also have extensive proteomics support. We identify several previously described cases of genes originated de novo from noncoding genomic regions, supporting the idea that this mechanism frequently underlies the evolution of new protein-coding genes in mammals. Finally, we show that most young mammalian genes are preferentially expressed in testis, suggesting that sexual selection plays an important role in the emergence of new functional genes. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
White, Robert A; Boydston, Leigh A; Brookshier, Terri R; McNulty, Steven G; Nsumu, Ndona N; Brewer, Brandon P; Blackmore, Krista
2005-12-01
Defects in iron absorption and utilization lead to iron deficiency and anemia. While iron transport by transferrin receptor-mediated endocytosis is well understood, it is not completely clear how iron is transported from the endosome to the mitochondria where heme is synthesized. We undertook a positional cloning project to identify the causative mutation for the hemoglobin-deficit (hbd) mouse mutant, which suffers from a microcytic, hypochromic anemia apparently due to defective iron transport in the endocytosis cycle. As shown by previous studies, reticulocyte iron accumulation in homozygous hbd/hbd mice is deficient despite normal binding of transferrin to its receptor and normal transferrin uptake in the cell. We have identified a strong candidate gene for hbd, Sec15l1, a homologue to yeast SEC15, which encodes a key protein in vesicle docking. The hbd mice have an exon deletion in Sec15l1, which is the first known mutation of a SEC gene homologue in mammals.
Iser, I C; de Campos, R P; Bertoni, A P S; Wink, M R
2015-10-01
There is growing evidence that mesenchymal stem cells (MSCs) can be important players in the tumor microenvironment. They can affect the glioma progression through the modulation of different genes. This modulation can be evaluated through a very useful model, treating the tumor cells with MSC-conditioned medium. However, for an accurate and reliable gene expression analysis, normalization of gene expression data against reference genes is a prerequisite. We performed a systematic review in an attempt to find a reference gene to use when analyzing gene expression in C6 glioma cells lines. Considering that we were not able to find a reference gene originated by an appropriate validation, in this study we evaluated candidate genes to be used as reference gene in C6 cells under different treatments with adipose-derived stem cells conditioned medium (CM-ADSCs). β-actin (ACTB); glyceraldehyde-3-phosphate dehydrogenase (GAPDH); hypoxanthine-guanine phosphoribosyltransferase I (HPRT-1); TATA box binding protein (TBP) and beta-2-microglobulin (B2M) were evaluated by real-time reverse transcription PCR (RT-qPCR). The mean Cq, the maximum fold change (MFC) and NormFinder software were used for reference gene evaluation and selection. The GAPDH and ACTB genes have been the most widely used reference genes to normalize among the different investigated genes in our review, however, controversially these genes underwent a substantial variability among the genes evaluated in the present work. Individually, TBP gene was more stable when compared with other genes analyzed and the combination of TBP and HPRT-1 was even more stable. These results evidence the importance of appropriate validation of reference genes before performing qPCR experiments. Besides, our data will contribute with researchers that work analyzing the role of ADSCs in glioma microenvironment through gene expression. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Markéta Kostrouchová
2017-06-01
Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.
Nakajima, T; Kuribayashi, T; Moore, J E; Millar, B C; Yamamoto, S; Matsuda, Motoo
2016-01-01
Thermophilic Campylobacter are important bacterial pathogens of foodborne diseases worldwide. These organisms' physiology requires a microaerophilic atmosphere. To date, little is known about the protective catalase mechanism in urease-positive thermophilic campylobacters (UPTC); hence, it was the aim of this study to identify and characterise catalase and catalase-like protein genes in these organisms. Catalase (katA) and catalase (Kat)-like protein genes from the Japanese UPTC CF89-12 strain were molecularly analysed and compared with C. lari RM2100 and other C. lari and thermophilic Campylobacter reference isolates. A possible open reading frame of 1,422 base pairs, predicted to encode a peptide of 474 amino acid residues, with calculated molecular weight of 52.7 kilo Daltons for katA, was identified within UPTC CF89-12. A probable ribosome binding site, two putative promoters and a putative ρ-independent transcription terminator were also identified within katA. A similar katA cluster also existed in the C. lari RM2100 strain, except that this strain carries no DcuB genes. However, the Kat-like protein gene or any other homologue(s) were never identified in the C. lari RM2100 strain, or in C. jejuni and C. upsaliensis. This study demonstrates the presence of catalase/catalase-like protein genes in UPTC organisms. These findings are significant in that they suggest that UPTC organisms have the protective genetic capability of helping protect the organisms from toxic oxygen stress, which may help them to survive in physiologically harsh environments, both within human and animal hosts, as well as in the natural environment.
Energy Technology Data Exchange (ETDEWEB)
Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)
2014-08-01
Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.
A suicide gene therapy approach to treat epidermolysis bullosa-associated skin cancer
International Nuclear Information System (INIS)
Gruber, C.
2009-01-01
Recessive dystrophic epidermolysis bullosa (RDEB) is an inherited disease causing extensive blister formation within the basal membrane zone (BMZ) of the skin and mucous membranes. It is caused by premature STOP mutations in the COL7A1 gene, which is indispensable for proper skin assembling. RDEB is associated with the development of a highly malignant skin cancer (squamous cell carcinoma, SCC) in early adulthood that displays a life threatening complication within this patient group. To date, neither chemo- nor radiotherapies showed successful results and due to the high metastatic potential of RDEB SCC wide surgical excision is still favoured. In this study we could reveal a new promising cancer treatment using spliceosome mediated RNA trans-splicing (SMaRT) using a suicide gene therapy approach. First we identified the tumour marker gene MMP-9 expressed by RDEB SCC cells in cell culture which was used to generate various pre-mRNA trans-splicing molecules (PTM). PTMs are able to facilitate trans-splicing between a tumour target gene and a cell death inducing peptide/toxin, encoded by the PTM. As a consequence the toxin is expressed in cancer cells leading to the induction of cell death. This technique offers high specificity in cancer cell targeting compared to other conventional cDNA expression studies. Various trans-splicing molecules were pre-evaluated in a fluorescence screening model for their best trans-splicing efficiency with the target molecule. Herein we identified two potent PTMs (PTM BD0 and PTM BD6), that were further adapted for endogenous suicide studies by inserting the toxin streptolysin O. In two independent in vitro cell culture assays we were able to confirm that the trans-splicing molecules are able to induce expression of the toxin resulting in cell membrane permeabilization and increased cell death induction. The results indicate that SMaRT technology offers a new platform for a suicide gene therapy approach to treat malignant squamous cell
Directory of Open Access Journals (Sweden)
E Wyroba
2009-08-01
Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.
Cao, Yongguo; Xie, Xufeng; Zhang, Wenlong; Wu, Dianjun; Tu, Changchun
2018-06-01
Currently, accumulating evidence is challenging subtherapeutic therapy. Low-dose Norfloxacin (Nor) has been reported to suppress the immune response and worsen leptospirosis. In this study, we investigated the influence of low-dose Nor (0.03 μg/ml, 0.06 μg/ml, 0.125 μg/ml) on leptospiral gene expression and analyzed the immunomodulatory effects of low-dose Nor-treated leptospires in J774A.1 cells. To study the expression profiles of low-dose Nor-treated leptospires, we chose LipL71/LipL21 as reference genes determined by the geNorm applet in this experiment. The results showed that low-dose Nor up-regulated the expression of FlaB and inhibited the expression of 16S rRNA, LipL32, LipL41, Loa22, KdpA, and KdpB compared with the untreated leptospires. These results indicated that low-dose Nor could regulate leptospiral gene expression. Using RT-PCR, the gene expression of IL-1β and TNF-α in J774A.1 cells was detected. Nor-treated leptospires induced higher expression levels of both IL-1β and TNF-α. However, when analyzed by ELISA, the release of mature IL-1β was reduced compared with that observed in cells induced with no Nor-treated leptospires, although the TNF-α protein level showed no significant change. Our study indicated that the gene expression of leptospires could be modulated by low-dose Nor, which induced less IL-1β release in J774A.1 cells. Copyright © 2018 Elsevier Ltd. All rights reserved.
Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.
2002-01-01
In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial
Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P
2004-01-01
A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in
International Nuclear Information System (INIS)
Mufti, F.U.D.; Banaras, S.
2015-01-01
Internal control genes are the constitutive genes which maintain the basic cellular functions and regularly express in both normal and stressed conditions in living organisms. They are used in normalization of gene expression studies in comparative analysis of target genes, as their expression remains comparatively unchanged in all varied conditions. Among internal control genes, actin is considered as a candidate gene for expression studies due to its vital role in shaping cytoskeleton and plant physiology. Unfortunately most of such knowledge is limited to only model plants or crops, not much is known about important medicinal plants. Therefore, we selected seven important medicinal wild plants for molecular identification of actin gene. We used gene specific primers designed from the conserved regions of several known orthologues or homologues of actin genes from other plants. The amplified products of 370-380 bp were sequenced and submitted to GeneBank after their confirmation using different bioinformatics tools. All the novel partial sequences of putative actin genes were submitted to GeneBank (Parthenium hysterophorus (KJ774023), Fagonia indica (KJ774024), Rhazya stricta (KJ774025), Whithania coagulans (KJ774026), Capparis decidua (KJ774027), Verbena officinalis (KJ774028) and Aerva javanica (KJ774029)). The comparisons of these partial sequences by Basic Local Alignment Search Tool (BLAST) and phylogenetic trees demonstrated high similarity with known actin genes of other plants. Our findings illustrated highly conserved nature of actin gene among these selected plants. These novel partial fragments of actin genes from these wild medicinal plants can be used as internal controls for future gene expression studies of these important plants after precise validations of their stable expression in such plants. (author)
Are mice pigmentary genes throwing light on humans?
Directory of Open Access Journals (Sweden)
Bose S
1993-01-01
Full Text Available In this article the rapid advances made in the molecular genetics of inherited disorders of hypo and hyperpigmentation during the past three years are reviewed. The main focus is on studies in mice as compared to homologues in humans. The main hypomelanotic diseases included are, piebaldism (white spotting due to mutations of c-KIT, PDGF and MGF genes; vitiligo (microphathalmia mice mutations of c-Kit and c-fms genes; Waardenburg syndrome (splotch locus mutations of mice PAX-3 or human Hup-2 genes; albinism (mutations of tyrosinase genes, Menkes disease (Mottled mouse, premature graying (mutations in light/brown locus/gp75/ TRP-1; Griscelli disease (mutations in TRP-1 and steel; Prader-willi and Angelman syndromes, tyrosinase-positive oculocutaneous albinism and hypomelanosis of lto (mutations of pink-eyed dilution gene/mapping to human chromosomes 15 q 11.2 - q12; and human platelet storage pool deficiency diseases due to defects in pallidin, an erythrocyte membrane protein (pallid mouse / mapping to 4.2 pallidin gene. The genetic characterization of hypermelanosis includes, neurofibromatosis 1 (Café-au-lait spots and McCune-Albright Syndrome. Rapid evolving knowledge about pigmentary genes will increase further the knowledge about these hypo and hyperpigmentary disorders.
Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana
2013-01-01
Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should
International Nuclear Information System (INIS)
Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.
1993-01-01
Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined
The actin homologue MreB organizes the bacterial cell membrane.
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W
2014-03-07
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.
Torun, D; Torun, Z Ö; Demirkaya, K; Sarper, M; Elçi, M P; Avcu, F
2017-11-01
Triethylene glycol dimethacrylate (TEGDMA) is an important resin monomer commonly used in the structure of dental restorative materials. Recent studies have shown that unpolymerized resin monomers may be released into the oral environment and cause harmful biological effects. We investigated changes in the gene expression profiles of TEGDMA-treated human dental pulp cells (hDPCs) following short- (1-day) and long-term (7-days) exposure. HDPCs were exposed to a noncytotoxic concentration of TEGDMA, and gene expression profiles were evaluated by microarray analysis. The results were confirmed by quantitative reverse-transcriptase PCR (qRT PCR). In total, 1282 and 1319 genes (up- or down-regulated) were differentially expressed compared with control group after the 1- and 7-day incubation periods, respectively. Biological ontology-based analyses revealed that metabolic, cellular, and developmental processes constituted the largest groups of biological functional processes. qRT-PCR analysis on bone morphogenetic protein-2 (BMP-2), BMP-4, secreted protein, acidic, cysteine-rich, collagen type I alpha 1, oxidative stress-induced growth inhibitor 1, MMP3, interleukin-6, and heme oxygenase-1 genes confirmed the changes in expression observed in the microarray analysis. Our results suggest that TEGDMA can change the many functions of hDPCs through large changes in gene expression levels and complex interactions with different signaling pathways.
Lin, Hsiu Chin; Wong, Yue Him; Tsang, Ling Ming; Chu, Ka Hou; Qian, Pei Yuan; Chan, Benny K K
2013-01-01
This is the first study applying Next-Generation Sequencing (NGS) technology to survey the kinds, expression location, and pattern of adhesion-related genes in a membranous-based barnacle. A total of 77,528,326 and 59,244,468 raw sequence reads of total RNA were generated from the prosoma and the basis of Tetraclita japonica formosana, respectively. In addition, 55,441 and 67,774 genes were further assembled and analyzed. The combined sequence data from both body parts generates a total of 79,833 genes of which 47.7% were shared. Homologues of barnacle cement proteins - CP-19K, -52K, and -100K - were found and all were dominantly expressed at the basis where the cement gland complex is located. This is the main area where transcripts of cement proteins and other potential adhesion-related genes were detected. The absence of another common barnacle cement protein, CP-20K, in the adult transcriptome suggested a possible life-stage restricted gene function and/or a different mechanism in adhesion between membranous-based and calcareous-based barnacles. © 2013 © 2013 Taylor & Francis.
Lin, Hsiu Chin
2013-12-12
This is the first study applying Next-Generation Sequencing (NGS) technology to survey the kinds, expression location, and pattern of adhesion-related genes in a membranous-based barnacle. A total of 77,528,326 and 59,244,468 raw sequence reads of total RNA were generated from the prosoma and the basis of Tetraclita japonica formosana, respectively. In addition, 55,441 and 67,774 genes were further assembled and analyzed. The combined sequence data from both body parts generates a total of 79,833 genes of which 47.7% were shared. Homologues of barnacle cement proteins - CP-19K, -52K, and -100K - were found and all were dominantly expressed at the basis where the cement gland complex is located. This is the main area where transcripts of cement proteins and other potential adhesion-related genes were detected. The absence of another common barnacle cement protein, CP-20K, in the adult transcriptome suggested a possible life-stage restricted gene function and/or a different mechanism in adhesion between membranous-based and calcareous-based barnacles. © 2013 © 2013 Taylor & Francis.
Pöggeler, S
2000-06-01
In order to analyze the involvement of pheromones in cell recognition and mating in a homothallic fungus, two putative pheromone precursor genes, named ppg1 and ppg2, were isolated from a genomic library of Sordaria macrospora. The ppg1 gene is predicted to encode a precursor pheromone that is processed by a Kex2-like protease to yield a pheromone that is structurally similar to the alpha-factor of the yeast Saccharomyces cerevisiae. The ppg2 gene encodes a 24-amino-acid polypeptide that contains a putative farnesylated and carboxy methylated C-terminal cysteine residue. The sequences of the predicted pheromones display strong structural similarity to those encoded by putative pheromones of heterothallic filamentous ascomycetes. Both genes are expressed during the life cycle of S. macrospora. This is the first description of pheromone precursor genes encoded by a homothallic fungus. Southern-hybridization experiments indicated that ppg1 and ppg2 homologues are also present in other homothallic ascomycetes.
Gene therapy Overview Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease. Genes contain your ... that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds a new ...
DEFF Research Database (Denmark)
Nelveg-Kristensen, Karl E.; Madsen, Majbritt B.; Torp-Pedersen, Christian
2016-01-01
OBJECTIVE: Most angiotensin-converting enzyme inhibitors (ACEIs) are prodrugs activated by carboxylesterase 1 (CES1). We investigated the prognostic importance of CES1 gene (CES1) copy number variation and the rs3815583 single-nucleotide polymorphism in CES1 among ACEI-treated patients with conge...
Simbaqueba, Jaime; Catanzariti, Ann-Maree; González, Carolina; Jones, David A
2018-05-22
RNAseq reads from cape-gooseberry plants (Physalis peruviana) infected with Fusarium oxysporum f. sp. physali (Foph) were mapped against the lineage-specific transcriptome of Fusarium oxysporum f. sp. lycopersici (Fol) to look for putative effector genes. Homologues of Fol SIX1 (designated SIX1a and SIX1b), SIX7, SIX10, SIX12, SIX15 and Ave1 were identified. The near identity of the Foph and Fol SIX7, SIX10 and SIX12 genes and their intergenic regions suggest that this gene cluster may have undergone recent lateral transfer. Foph SIX1a and SIX1b were tested for their ability to complement a SIX1 knockout mutant of Fol. This mutant has reduced pathogenicity on susceptible tomato plants, but is able to infect otherwise resistant tomato plants carrying the I-3 gene for Fusarium wilt resistance (SIX1 corresponds to Avr3). Neither, SIX1a nor SIX1b could restore full pathogenicity on susceptible tomato plants, suggesting that any role they may play in pathogenicity is likely to be specific to cape gooseberry. SIX1b, but not SIX1a, was able to restore avirulence on tomato plants carrying I-3. These findings separate the recognition of SIX1 from its role as an effector and suggest direct recognition by I-3. A hypervariable region of SIX1 undergoing diversifying selection within the F. oxysporum species complex is likely to play an important role in SIX1 recognition. These findings also indicate that I-3 could potentially be deployed as a transgene in cape gooseberry to protect this emerging crop from Foph. Alternatively, cape gooseberry germplasm could be explored for I-3 homologues capable of providing resistance to Foph. This article is protected by copyright. All rights reserved. © 2018 BSPP and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Grauman Peter L
2007-07-01
Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.
Younossi, Zobair M; Baranova, Ancha; Afendy, Arian; Collantes, Rochelle; Stepanova, Maria; Manyam, Ganiraju; Bakshi, Anita; Sigua, Christopher L; Chan, Joanne P; Iverson, Ayuko A; Santini, Christopher D; Chang, Sheng-Yung P
2009-03-01
Responsiveness to hepatitis C virus (HCV) therapy depends on viral and host factors. Our aim was to assess sustained virologic response (SVR)-associated early gene expression in patients with HCV receiving pegylated interferon-alpha2a (PEG-IFN-alpha2a) or PEG-IFN-alpha2b and ribavirin with the duration based on genotypes. Blood samples were collected into PAXgene tubes prior to treatment as well as 1, 7, 28, and 56 days after treatment. From the peripheral blood cells, total RNA was extracted, quantified, and used for one-step reverse transcription polymerase chain reaction to profile 154 messenger RNAs. Expression levels of messenger RNAs were normalized with six "housekeeping" genes and a reference RNA. Multiple regression and stepwise selection were performed to assess differences in gene expression at different time points, and predictive performance was evaluated for each model. A total of 68 patients were enrolled in the study and treated with combination therapy. The results of gene expression showed that SVR could be predicted by the gene expression of signal transducer and activator of transcription-6 (STAT-6) and suppressor of cytokine signaling-1 in the pretreatment samples. After 24 hours, SVR was predicted by the expression of interferon-dependent genes, and this dependence continued to be prominent throughout the treatment. Early gene expression during anti-HCV therapy may elucidate important molecular pathways that may be influencing the probability of achieving virologic response.
Nilsson, G.; Svensson, G.
2001-01-01
Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.
Delaney, Kamila; Mailler, Jonathan; Wenda, Joanna M; Gabus, Caroline; Steiner, Florian A
2018-04-10
Replication-independent variant histones replace canonical histones in nucleosomes and act as important regulators of chromatin function. H3.3 is a major variant of histone H3 that is remarkably conserved across all taxa and is distinguished from canonical H3 by just four key amino acids. Most genomes contain two or more genes expressing H3.3, and complete loss of the protein usually causes sterility or embryonic lethality. Here we investigated the developmental expression pattern of the five Caenorhabditis elegans H3.3 homologues and identified two previously uncharacterized homologues to be restricted to the germ line. We demonstrate an essential role for the conserved histone chaperone HIRA in the nucleosomal loading of all H3.3 variants. This requirement can be bypassed by mutation of the H3.3-specific residues to those found in H3. Analysis of H3.3 knockout mutants revealed a surprising absence of developmental phenotypes. While removal of all H3.3 homologues did not result in lethality, it led to reduced fertility and viability in response to high temperature stress. Our results thus show that H3.3 is non-essential in C. elegans , but is critical for ensuring adequate response to stress. Copyright © 2018, Genetics.
DEFF Research Database (Denmark)
Salomonsen, Jan; Chattaway, John A.; Chan, Andrew C. Y.
2014-01-01
complex (MHC), and show striking association with particular autoimmune diseases. In chickens, BG genes encode homologues with somewhat different domain organisation. Only a few BG genes have been characterised, one involved in actin-myosin interaction in the intestinal brush border, and another...... implicated in resistance to viral diseases. We characterise all BG genes in B12 chickens, finding a multigene family organised as tandem repeats in the BG region outside the MHC, a single gene in the MHC (the BF-BL region), and another single gene on a different chromosome. There is a precise cell and tissue...... many hybrid genes, suggesting recombination and/or deletion as major evolutionary forces. We identify BG genes in the chicken whole genome shotgun sequence, as well as by comparison to other haplotypes by fibre fluorescence in situ hybridisation, confirming dynamic expansion and contraction within...
Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family
International Nuclear Information System (INIS)
Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain
2003-01-01
The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA
Liu, Miaomiao; Ding, Ran; Zhang, Yu; Gao, Yingxin; Tian, Zhe; Zhang, Tong; Yang, Min
2014-10-15
The behaviors of the Macrolide-Lincosamide-Streptogramin (MLS) resistance genes were investigated in an anaerobic-aerobic pilot-scale system treating spiramycin (SPM) production wastewater. After screening fifteen typical MLS resistance genes with different mechanisms using conventional PCR, eight detected genes were determined by quantitative PCR, together with three mobile elements. Aerobic sludge in the pilot system exhibited a total relative abundance of MLS resistance genes (per 16S rRNA gene) 2.5 logs higher than those in control samples collected from sewage and inosine wastewater treatment systems (P resistance genes. However, the total relative gene abundance in anaerobic sludge (4.3 × 10(-1)) was lower than that in aerobic sludge (3.7 × 10(0)) despite of the higher SPM level in anaerobic reactor, showing the advantage of anaerobic treatment in reducing the production of MLS resistance genes. The rRNA methylase genes (erm(B), erm(F), erm(X)) were the most abundant in the aerobic sludge (5.3 × 10(-1)-1.7 × 10(0)), followed by esterase gene ere(A) (1.3 × 10(-1)) and phosphorylase gene mph(B) (5.7 × 10(-2)). In anaerobic sludge, erm(B), erm(F), ere(A), and msr(D) were the major ones (1.2 × 10(-2)-3.2 × 10(-1)). These MLS resistance genes (except for msr(D)) were positively correlated with Class 1 integron (r(2) = 0.74-0.93, P < 0.05), implying the significance of horizontal transfer in their proliferation. Copyright © 2014 Elsevier Ltd. All rights reserved.
PTEN status in advanced colorectal cancer treated with cetuximab
Negri, F V; Bozzetti, C; Lagrasta, C A; Crafa, P; Bonasoni, M P; Camisa, R; Pedrazzi, G; Ardizzoni, A
2009-01-01
Background: Loss of phosphatase and tensin homologue deleted in chromosome 10 (PTEN) function in advanced colorectal cancer (CRC) may represent one of the resistance mechanisms to cetuximab by interfering with the epidermal growth factor receptor signal transduction pathway. Methods: PTEN expression tested by indirect immunofluorescence was evaluated both on primary (n=43) and on metastatic (n=24) sites in CRC patients treated with cetuximab. Results: The loss of PTEN expression tested on metastatic sites was negatively associated with response (100% progressive disease (PD) in PTEN-negative cases vs 30% PD in PTEN-positive cases; P<0.05), PFS (0.8 vs 8.2 months; P<0.001) and OS (2.9 vs 14.2 months; P<0.001). Conclusion: A potential role of PTEN in the anti-tumour activity of cetuximab could be hypothesised. PMID:19953097
International Nuclear Information System (INIS)
Jambaldorj, Jamiyansuren; Makino, Satoshi; Munkhbat, Batmunkh; Tamiya, Gen
2012-01-01
Highlights: ► We identified the mouse homologue of neuron-specific TAF1 (N-Taf1). ► Taf1 mRNA was expressed in most tissues and cell lines. ► N-Taf1 mRNA was expressed in the brain and Neuroblastoma N2a cell lines. ► Taf1 and N-Taf1 showed different expression profile in development stage and aging. -- Abstract: TATA-box binding protein associated factor 1 (TAF1) protein is the largest and the essential component of the TFIID complex in the pathway of RNA polymerase II–mediated gene transcription, and it regulates transcription of a large number of genes related to cell division. The neuron-specific isoform of the TAF1 gene (N-TAF1), which we reported previously, may have an essential role in neurons through transcriptional regulation of many neuron-specific genes. In the present study, we cloned the full-length cDNA that encodes the mouse homologue of N-TAF1 (N-Taf1) protein. By carrying out of real time RT-PCR, we investigated the expression analysis of the N-Taf1 mRNA in mouse tissues and cell lines. As well as the human N-TAF1, the N-Taf1 showed limited expression in the brain and neuroblastoma, whereas Taf1 expressed elsewhere. Furthermore, in mouse embryo head or mouse brain, mRNA expression of TAF1 changes dramatically during development but N-Taf1 showed sustained expression. Our result suggests that the N-Taf1 gene has an important role in non-dividing neuronal cell rather than in cell division and proliferation during neurogenesis.
Energy Technology Data Exchange (ETDEWEB)
Jambaldorj, Jamiyansuren [Department of Pharmacology, Institute of Health Biosciences, Graduate School, The University of Tokushima, Tokushima 770-8503 (Japan); Advanced Molecular Epidemiology Research Institute, Yamagata University Faculty of Medicine, Yamagata 990-9585 (Japan); Central Scientific Research Laboratory, Institute of Medical Sciences, Ulaanbaatar (Mongolia); Makino, Satoshi, E-mail: smakino@genetix-h.com [Molecular Neuroscience Research Center, Shiga University of Medical Science, Otsu 520-2192 (Japan); Munkhbat, Batmunkh [Central Scientific Research Laboratory, Institute of Medical Sciences, Ulaanbaatar (Mongolia); Tamiya, Gen [Advanced Molecular Epidemiology Research Institute, Yamagata University Faculty of Medicine, Yamagata 990-9585 (Japan)
2012-08-24
Highlights: Black-Right-Pointing-Pointer We identified the mouse homologue of neuron-specific TAF1 (N-Taf1). Black-Right-Pointing-Pointer Taf1 mRNA was expressed in most tissues and cell lines. Black-Right-Pointing-Pointer N-Taf1 mRNA was expressed in the brain and Neuroblastoma N2a cell lines. Black-Right-Pointing-Pointer Taf1 and N-Taf1 showed different expression profile in development stage and aging. -- Abstract: TATA-box binding protein associated factor 1 (TAF1) protein is the largest and the essential component of the TFIID complex in the pathway of RNA polymerase II-mediated gene transcription, and it regulates transcription of a large number of genes related to cell division. The neuron-specific isoform of the TAF1 gene (N-TAF1), which we reported previously, may have an essential role in neurons through transcriptional regulation of many neuron-specific genes. In the present study, we cloned the full-length cDNA that encodes the mouse homologue of N-TAF1 (N-Taf1) protein. By carrying out of real time RT-PCR, we investigated the expression analysis of the N-Taf1 mRNA in mouse tissues and cell lines. As well as the human N-TAF1, the N-Taf1 showed limited expression in the brain and neuroblastoma, whereas Taf1 expressed elsewhere. Furthermore, in mouse embryo head or mouse brain, mRNA expression of TAF1 changes dramatically during development but N-Taf1 showed sustained expression. Our result suggests that the N-Taf1 gene has an important role in non-dividing neuronal cell rather than in cell division and proliferation during neurogenesis.
Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M
2000-04-01
The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.
Calpain-5 gene variants are associated with diastolic blood pressure and cholesterol levels
Directory of Open Access Journals (Sweden)
Morón Francisco J
2007-01-01
Full Text Available Abstract Background Genes implicated in common complex disorders such as obesity, type 2 diabetes mellitus (T2DM or cardiovascular diseases are not disease specific, since clinically related disorders also share genetic components. Cysteine protease Calpain 10 (CAPN10 has been associated with T2DM, hypertension, hypercholesterolemia, increased body mass index (BMI and polycystic ovary syndrome (PCOS, a reproductive disorder of women in which isunlin resistance seems to play a pathogenic role. The calpain 5 gene (CAPN5 encodes a protein homologue of CAPN10. CAPN5 has been previously associated with PCOS by our group. In this new study, we have analysed the association of four CAPN5 gene variants(rs948976A>G, rs4945140G>A, rs2233546C>T and rs2233549G>A with several cardiovascular risk factors related to metabolic syndrome in general population. Methods Anthropometric measurements, blood pressure, insulin, glucose and lipid profiles were determined in 606 individuals randomly chosen from a cross-sectional population-based epidemiological survey in the province of Segovia in Central Spain (Castille, recruited to investigate the prevalence of anthropometric and physiological parameters related to obesity and other components of the metabolic syndrome. Genotypes at the four polymorphic loci in CAPN5 gene were detected by polymerase chain reaction (PCR. Results Genotype association analysis was significant for BMI (p ≤ 0.041, diastolic blood pressure (p = 0.015 and HDL-cholesterol levels (p = 0.025. Different CAPN5 haplotypes were also associated with diastolic blood pressure (DBP (0.0005 ≤ p ≤ 0.006 and total cholesterol levels (0.001 ≤ p ≤ 0.029. In addition, the AACA haplotype, over-represented in obese individuals, is also more frequent in individuals with metabolic syndrome defined by ATPIII criteria (p = 0.029. Conclusion As its homologue CAPN10, CAPN5 seems to influence traits related to increased risk for cardiovascular diseases. Our
Directory of Open Access Journals (Sweden)
Tosser-Klopp G
2006-07-01
Full Text Available Abstract FSH, which binds to specific receptors on granulosa cells in mammals, plays a key role in folliculogenesis. Its biological activity involves stimulation of intercellular communication and upregulation of steroidogenesis, but the entire spectrum of the genes regulated by FSH has yet to be fully characterized. In order to find new regulated transcripts, however rare, we have used a Suppression Subtractive Hybridization approach (SSH on pig granulosa cells in primary culture treated or not with FSH. Two SSH libraries were generated and 76 clones were sequenced after selection by differential screening. Sixty four different sequences were identified, including 3 novel sequences. Experiments demonstrated the presence of 25 regulated transcripts. A gene ontology analysis of these 25 genes revealed (1 catalytic; (2 transport; (3 signal transducer; (4 binding; (5 anti-oxidant and (6 structural activities. These findings may deepen our understanding of FSH's effects. Particularly, they suggest that FSH is involved in the modulation of peroxidase activity and remodelling of chromatin.
Bernhards, Yasmine; Pöggeler, Stefanie
2011-04-01
Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.
Directory of Open Access Journals (Sweden)
Nathan M. Good
2015-04-01
Full Text Available Methyloversatilis universalis FAM5 utilizes single carbon compounds such as methanol or methylamine as a sole source of carbon and energy. Expression profiling reveals distinct sets of genes altered during growth on methylamine vs methanol. As expected, all genes for the N-methylglutamate pathway were induced during growth on methylamine. Among other functions responding to the aminated source of C1-carbon, are a heme-containing amine dehydrogenase (Qhp, a distant homologue of formaldehyde activating enzyme (Fae3, molybdenum-containing formate dehydrogenase, ferredoxin reductase, a set of homologues to urea/ammonium transporters and amino-acid permeases. Mutants lacking one of the functional subunits of the amine dehydrogenase (ΔqhpA or Δfae3 showed no growth defect on C1-compounds. M. universalis FAM5 strains with a lesion in the H4-folate pathway were not able to use any C1-compound, methanol or methylamine. Genes essential for C1-assimilation (the serine cycle and glyoxylate shunt and H4MTP-pathway for formaldehyde oxidation showed similar levels of expression on both C1-carbon sources. M. universalis FAM5 possesses three homologs of the formaldehyde activating enzyme, a key enzyme of the H4MTP-pathway. Strains lacking the canonical Fae (fae1 lost the ability to grow on both C1-compounds. However, upon incubation on methylamine the fae1-mutant produced revertants (Δfae1R, which regained the ability to grow on methylamine. Double and triple mutants (Δfae1RΔfae3, or Δfae1RΔfae2 or Δfae1RΔfae2Δfae3 constructed in the revertant strain background showed growth similar to the Δfae1R phenotype. The metabolic pathways for utilization of methanol and methylamine in Methyloversatilis universalis FAM5 are reconstructed based on these gene expression and phenotypic data.
Indian Academy of Sciences (India)
Madhu
The discovery of the. RNAi-based gene silencing process called meiotic silencing by unpaired DNA now provides an explana- tion for how normal sequence strains come to be selected. Meiotic silencing silences genes that are unpaired in meiosis, as well as their homologues, regardless of whether or not the homologues ...
Directory of Open Access Journals (Sweden)
Kaori Misuno
Full Text Available BACKGROUND: Bone marrow cell extract (termed as BM Soup has been demonstrated to repair irradiated salivary glands (SGs and restore saliva secretion in our previous study. In the present study, we aim to investigate if the function of damaged SGs in non-obese diabetic (NOD mice can be restored by BM Soup treatment and the molecular alterations associated with the treatment. METHODS: Whole BM cells were lysed and soluble intracellular contents ("BM Soup" were injected I.V. into NOD mice. Tandem mass tagging with 2-D liquid chromatography-mass spectrometry was used to quantify proteins in the submandibular glands (SMGs between untreated and BM Soup-treated mice. Quantitative PCR was used to identify genes with altered expression in the treated mice. RESULTS BM SOUP: restored salivary flow rates to normal levels and significantly reduced the focus scores of SMGs in NOD mice. More than 1800 proteins in SMG cells were quantified by the proteomic approach. Many SMG proteins involved in inflammation and apoptosis were found to be down-regulated whereas those involved in salivary gland biology and development/regeneration were up-regulated in the BM Soup-treated mice. qPCR analysis also revealed expression changes of growth factors and cytokines in the SMGs of the treated NOD mice. CONCLUSION: BM Soup treatment is effective to restore the function of damaged SGs in NOD mice. Through gene/protein expression analysis, we have found that BM Soup treatment might effectuate via inhibiting apoptosis, focal adhesion and inflammation whereas promoting development, regeneration and differentiation of the SG cells in NOD mice. These findings provide important insights on the potential mechanisms underlying the BM Soup treatment for functional restoration of damaged SGs in NOD mice. Additional studies are needed to further confirm the identified target genes and their related signaling pathways that are responsible for the BM Soup treatment.
Misuno, Kaori; Tran, Simon D; Khalili, Saeed; Huang, Junwei; Liu, Younan; Hu, Shen
2014-01-01
Bone marrow cell extract (termed as BM Soup) has been demonstrated to repair irradiated salivary glands (SGs) and restore saliva secretion in our previous study. In the present study, we aim to investigate if the function of damaged SGs in non-obese diabetic (NOD) mice can be restored by BM Soup treatment and the molecular alterations associated with the treatment. Whole BM cells were lysed and soluble intracellular contents ("BM Soup") were injected I.V. into NOD mice. Tandem mass tagging with 2-D liquid chromatography-mass spectrometry was used to quantify proteins in the submandibular glands (SMGs) between untreated and BM Soup-treated mice. Quantitative PCR was used to identify genes with altered expression in the treated mice. restored salivary flow rates to normal levels and significantly reduced the focus scores of SMGs in NOD mice. More than 1800 proteins in SMG cells were quantified by the proteomic approach. Many SMG proteins involved in inflammation and apoptosis were found to be down-regulated whereas those involved in salivary gland biology and development/regeneration were up-regulated in the BM Soup-treated mice. qPCR analysis also revealed expression changes of growth factors and cytokines in the SMGs of the treated NOD mice. BM Soup treatment is effective to restore the function of damaged SGs in NOD mice. Through gene/protein expression analysis, we have found that BM Soup treatment might effectuate via inhibiting apoptosis, focal adhesion and inflammation whereas promoting development, regeneration and differentiation of the SG cells in NOD mice. These findings provide important insights on the potential mechanisms underlying the BM Soup treatment for functional restoration of damaged SGs in NOD mice. Additional studies are needed to further confirm the identified target genes and their related signaling pathways that are responsible for the BM Soup treatment.
Directory of Open Access Journals (Sweden)
Anne Kathrin Hett
Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.
Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin
2017-01-01
Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.
Martinelli, Cosimo; Spring, Jürg
2005-09-12
Most animals are classified as Bilateria and only four phyla are still extant as outgroups, namely Porifera, Placozoa, Cnidaria and Ctenophora. These non-bilaterians were not considered to have a mesoderm and hence mesoderm-specific genes. However, the T-box gene Brachyury could be isolated from sponges, placozoans and cnidarians. Here, we describe the first Brachyury and a Tbx2/3 homologue from a ctenophore. In addition, analysing T-box and homeobox genes under comparable conditions in all four basal phyla lead to the discovery of novel T-box genes in sponges and cnidarians and a Tlx homeobox gene in the ctenophore Pleurobrachia pileus. The conservation of the T-box and the homeobox genes suggest that distinct subfamilies with different roles in bilaterians were already split in non-bilaterians.
Directory of Open Access Journals (Sweden)
Charnock F Mark L
2002-10-01
Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.
DEFF Research Database (Denmark)
Wassenaar, Trudy M; Ussery, David; Nielsen, Lene Nørby
2015-01-01
The qac genes of Staphylococcus species encode multidrug efflux pumps: membrane proteins that export toxic molecules and thus increase tolerance to a variety of compounds such as disinfecting agents, including quaternary ammonium compounds (for which they are named), intercalating dyes and some...... described in the literature for qac detection may miss particular qac genes due to lack of DNA conservation. Despite their resemblance in substrate specificity, the Qac proteins belonging to the two protein families have little in common. QacA and QacB are highly conserved in Staphylococcus species, while...... qacA was also detected in Enterococcus faecalis, suggesting that these plasmid-born genes have spread across bacterial genera. Nevertheless, these qacA and qacB genes are quite dissimilar to their closest homologues in other organisms. In contrast, SMR-type Qac proteins display considerable sequence...
Kurat, Christoph F; Lambert, Jean-Philippe; Petschnigg, Julia; Friesen, Helena; Pawson, Tony; Rosebrock, Adam; Gingras, Anne-Claude; Fillingham, Jeffrey; Andrews, Brenda
2014-09-30
DNA replication occurs during the synthetic (S) phase of the eukaryotic cell cycle and features a dramatic induction of histone gene expression for concomitant chromatin assembly. Ectopic production of core histones outside of S phase is toxic, underscoring the critical importance of regulatory pathways that ensure proper expression of histone genes. Several regulators of histone gene expression in the budding yeast Saccharomyces cerevisiae are known, yet the key oscillator responsible for restricting gene expression to S phase has remained elusive. Here, we show that suppressor of Ty (Spt)10, a putative histone acetyltransferase, and its binding partner Spt21 are key determinants of S-phase-specific histone gene expression. We show that Spt21 abundance is restricted to S phase in part by anaphase promoting complex Cdc20-homologue 1 (APC(Cdh1)) and that it is recruited to histone gene promoters in S phase by Spt10. There, Spt21-Spt10 enables the recruitment of a cascade of regulators, including histone chaperones and the histone-acetyltransferase general control nonderepressible (Gcn) 5, which we hypothesize lead to histone acetylation and consequent transcription activation.
Kurat, Christoph F.; Lambert, Jean-Philippe; Petschnigg, Julia; Friesen, Helena; Pawson, Tony; Rosebrock, Adam; Gingras, Anne-Claude; Fillingham, Jeffrey; Andrews, Brenda
2014-01-01
DNA replication occurs during the synthetic (S) phase of the eukaryotic cell cycle and features a dramatic induction of histone gene expression for concomitant chromatin assembly. Ectopic production of core histones outside of S phase is toxic, underscoring the critical importance of regulatory pathways that ensure proper expression of histone genes. Several regulators of histone gene expression in the budding yeast Saccharomyces cerevisiae are known, yet the key oscillator responsible for restricting gene expression to S phase has remained elusive. Here, we show that suppressor of Ty (Spt)10, a putative histone acetyltransferase, and its binding partner Spt21 are key determinants of S-phase–specific histone gene expression. We show that Spt21 abundance is restricted to S phase in part by anaphase promoting complex Cdc20-homologue 1 (APCCdh1) and that it is recruited to histone gene promoters in S phase by Spt10. There, Spt21-Spt10 enables the recruitment of a cascade of regulators, including histone chaperones and the histone-acetyltransferase general control nonderepressible (Gcn) 5, which we hypothesize lead to histone acetylation and consequent transcription activation. PMID:25228766
Expression of Msx genes in regenerating and developing limbs of axolotl.
Koshiba, K; Kuroiwa, A; Yamamoto, H; Tamura, K; Ide, H
1998-12-15
Msx genes, homeobox-containing genes, have been isolated as homologues of the Drosophila msh gene and are thought to play important roles in the development of chick or mouse limb buds. We isolated two Msx genes, Msx1 and Msx2, from regenerating blastemas of axolotl limbs and examined their expression patterns using Northern blot and whole mount in situ hybridization during regeneration and development. Northern blot analysis revealed that the expression level of both Msx genes increased during limb regeneration. The Msx2 expression level increased in the blastema at the early bud stage, and Msx1 expression level increased at the late bud stage. Whole mount in situ hybridization revealed that Msx2 was expressed in the distal mesenchyme and Msx1 in the entire mesenchyme of the blastema at the late bud stage. In the developing limb bud, Msx1 was expressed in the entire mesenchyme, while Msx2 was expressed in the distal and peripheral mesenchyme. The expression patterns of Msx genes in the blastemas and limb buds of the axolotl were different from those reported for chick or mouse limb buds. These expression patterns of axolotl Msx genes are discussed in relation to the blastema or limb bud morphology and their possible roles in limb patterning.
Zikhali, Meluleki; Wingen, Luzie U.; Griffiths, Simon
2016-01-01
Earliness per se (Eps) genes account for the variation in flowering time when vernalization and photoperiod requirements are satisfied. Genomics and bioinformatics approaches were used to describe allelic variation for 40 Triticum aestivum genes predicted, by synteny with Brachypodium distachyon, to be in the 1DL Eps region. Re-sequencing 1DL genes revealed that varieties carrying early heading alleles at this locus, Spark and Cadenza, carry a subtelomeric deletion including several genes. The equivalent region in Rialto and Avalon is intact. A bimodal distribution in the segregating Spark X Rialto single seed descent (SSD) populations enabled the 1DL QTL to be defined as a discrete Mendelian factor, which we named Eps-D1. Near isogenic lines (NILs) and NIL derived key recombinants between markers flanking Eps-D1 suggest that the 1DL deletion contains the gene(s) underlying Eps-D1. The deletion spans the equivalent of the Triticum monoccocum Eps-A m 1 locus, and hence includes MODIFIER OF TRANSCRIPTION 1 (MOT1) and FTSH PROTEASE 4 (FTSH4), the candidates for Eps-A m 1. The deletion also contains T. aestivum EARLY FLOWERING 3-D1 (TaELF3-D1) a homologue of the Arabidopsis thaliana circadian clock gene EARLY FLOWERING 3. Eps-D1 is possibly a homologue of Eps-B1 on chromosome 1BL. NILs carrying the Eps-D1 deletion have significantly reduced total TaELF3 expression and altered TaGIGANTEA (TaGI) expression compared with wild type. Altered TaGI expression is consistent with an ELF3 mutant, hence we propose TaELF3-D1 as the more likely candidate for Eps-D1. This is the first direct fine mapping of Eps effect in bread wheat. PMID:26476691
Zikhali, Meluleki; Wingen, Luzie U; Griffiths, Simon
2016-01-01
Earliness per se (Eps) genes account for the variation in flowering time when vernalization and photoperiod requirements are satisfied. Genomics and bioinformatics approaches were used to describe allelic variation for 40 Triticum aestivum genes predicted, by synteny with Brachypodium distachyon, to be in the 1DL Eps region. Re-sequencing 1DL genes revealed that varieties carrying early heading alleles at this locus, Spark and Cadenza, carry a subtelomeric deletion including several genes. The equivalent region in Rialto and Avalon is intact. A bimodal distribution in the segregating Spark X Rialto single seed descent (SSD) populations enabled the 1DL QTL to be defined as a discrete Mendelian factor, which we named Eps-D1. Near isogenic lines (NILs) and NIL derived key recombinants between markers flanking Eps-D1 suggest that the 1DL deletion contains the gene(s) underlying Eps-D1. The deletion spans the equivalent of the Triticum monoccocum Eps-A (m) 1 locus, and hence includes MODIFIER OF TRANSCRIPTION 1 (MOT1) and FTSH PROTEASE 4 (FTSH4), the candidates for Eps-A (m) 1. The deletion also contains T. aestivum EARLY FLOWERING 3-D1 (TaELF3-D1) a homologue of the Arabidopsis thaliana circadian clock gene EARLY FLOWERING 3. Eps-D1 is possibly a homologue of Eps-B1 on chromosome 1BL. NILs carrying the Eps-D1 deletion have significantly reduced total TaELF3 expression and altered TaGIGANTEA (TaGI) expression compared with wild type. Altered TaGI expression is consistent with an ELF3 mutant, hence we propose TaELF3-D1 as the more likely candidate for Eps-D1. This is the first direct fine mapping of Eps effect in bread wheat. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Differentially expressed genes in embryonic cardiac tissues of mice lacking Folr1 gene activity
Directory of Open Access Journals (Sweden)
Schwartz Robert J
2007-11-01
Full Text Available Abstract Background Heart anomalies are the most frequently observed among all human congenital defects. As with the situation for neural tube defects (NTDs, it has been demonstrated that women who use multivitamins containing folic acid peri-conceptionally have a reduced risk for delivering offspring with conotruncal heart defects 123. Cellular folate transport is mediated by a receptor or binding protein and by an anionic transporter protein system. Defective function of the Folr1 (also known as Folbp1; homologue of human FRα gene in mice results in inadequate transport, accumulation, or metabolism of folate during cardiovascular morphogenesis. Results We have observed cardiovascular abnormalities including outflow tract and aortic arch arterial defects in genetically compromised Folr1 knockout mice. In order to investigate the molecular mechanisms underlying the failure to complete development of outflow tract and aortic arch arteries in the Folr1 knockout mouse model, we examined tissue-specific gene expression difference between Folr1 nullizygous embryos and morphologically normal heterozygous embryos during early cardiac development (14-somite stage, heart tube looping (28-somite stage, and outflow track septation (38-somite stage. Microarray analysis was performed as a primary screening, followed by investigation using quantitative real-time PCR assays. Gene ontology analysis highlighted the following ontology groups: cell migration, cell motility and localization of cells, structural constituent of cytoskeleton, cell-cell adhesion, oxidoreductase, protein folding and mRNA processing. This study provided preliminary data and suggested potential candidate genes for further description and investigation. Conclusion The results suggested that Folr1 gene ablation and abnormal folate homeostasis altered gene expression in developing heart and conotruncal tissues. These changes affected normal cytoskeleton structures, cell migration and
Tang, Mei; Dou, Xiaomin; Wang, Chunyan; Tian, Zhe; Yang, Min; Zhang, Yu
2017-12-01
The occurrence of antibiotic-resistant bacteria and antibiotic resistance genes (ARGs) has been intensively investigated for wastewater treatment systems treating single class of antibiotic in recent years. However, the impacts of alternately occurring antibiotics in antibiotic production wastewater on the behavior of ARGs in biological treatment systems were not well understood yet. Herein, techniques including high-capacity quantitative PCR and quantitative PCR (qPCR) were used to investigate the behavior of ARGs in an anaerobic-aerobic full-scale system. The system alternately treated three kinds of antibiotic production wastewater including ribostamycin, spiramycin and paromomycin, which referred to stages 1, 2 and 3. The aminoglycoside ARGs (52.1-79.3%) determined using high-capacity quantitative PCR were the most abundant species in all sludge samples of the three stages. The total relative abundances of macrolide-lincosamide-streptogramin (MLS) resistance genes and aminoglycoside resistance genes measured using qPCR were significantly higher (P 0.05) in both aerobic and anaerobic sludge samples. In aerobic sludge, one acetyltransferase gene (aacA4) and the other three nucleotidyltransferase genes (aadB, aadA and aadE) exhibited positive correlations with intI1 (r 2 = 0.83-0.94; P < 0.05), implying the significance of horizontal transfer in their proliferation. These results and facts will be helpful to understand the abundance and distribution of ARGs from antibiotic production wastewater treatment systems.
Gene expression in SK-Mel-28 human melanoma cells treated with the snake venom jararhagin.
Klein, Anelise; Capitanio, Juliana Silva; Maria, Durvanei Augusto; Ruiz, Itamar Romano Garcia
2011-01-01
Alternative approaches to improve the treatment of advanced melanomas are highly needed. The disintegrin domain of metalloproteinases binds integrin receptors on tumor cells, blocking migration, invasion, and metastatization. Previous studies showed that jararhagin, from the Bothrops jararaca snake venom, induces changes in the morphology and viability of SK-Mel-28 human melanoma cells, and decreases the number of metastases in mice injected with pre-treated cells. The purpose of this study was to evaluate the molecular effects of jararhagin on SK-Mel-28 cells and fibroblasts, concerning the expression of integrins, cadherins, caspases, and TP53 genes. Sub-toxic doses of jararhagin were administered to confluent cells. RT-PCR was performed following extraction of total RNA. Jararhagin treatments induced similar morphological alterations in both normal and tumor cells, with higher IC50 values for fibroblasts. Integrin genes were downregulated in untreated cells, except for ITGA6a,b, ITGAv, and ITGB3 which were highly expressed in SK-Mel-28. The integrin expression profiles were not affected by the toxin. However, jararhagin 30ng/μl upregulated genes TP53, CDKN1A, CDKN2A, CASP3, CASP5, CASP6, CASP8, and E-CDH in SK-Mel-28, and genes ITGB6, ITGB7, CASP3, TP53, and CDKN1B in fibroblasts. Appropriate jararhagin concentration can have apoptotic and suppressant effects on SK-Mel-28 cells, rather than on fibroblasts, and can be used to develop potential anti-cancer drugs. Copyright © 2010 Elsevier Ltd. All rights reserved.
Hayward, Joshua A; Tachedjian, Mary; Cui, Jie; Cheng, Adam Z; Johnson, Adam; Baker, Michelle; Harris, Reuben S; Wang, Lin-Fa; Tachedjian, Gilda
2018-03-29
Bats have attracted attention in recent years as important reservoirs of viruses deadly to humans and other mammals. These infections are typically nonpathogenic in bats raising questions about innate immune differences that might exist between bats and other mammals. The APOBEC3 gene family encodes antiviral DNA cytosine deaminases with important roles in the suppression of diverse viruses and genomic parasites. Here we characterize pteropid APOBEC3 genes and show that species within the genus Pteropus possess the largest and most diverse array of APOBEC3 genes identified in any mammal reported to date. Several bat APOBEC3 proteins are antiviral as demonstrated by restriction of retroviral infectivity using HIV-1 as a model, and recombinant A3Z1 subtypes possess strong DNA deaminase activity. These genes represent the first group of antiviral restriction factors identified in bats with extensive diversification relative to homologues in other mammals.
Clark, Jo-Anna B J; Tully, Sara J; Dawn Marshall, H
2014-12-01
Hereditary hyperplastic gingivitis (HHG) is an autosomal recessive disease that presents with progressive gingival proliferation in farmed silver foxes. Hereditary gingival fibromatosis (HGF) is an analogous condition in humans that is genetically heterogeneous with several known autosomal dominant loci. For one locus the causative mutation is in the Son of sevenless homologue 1 (SOS1) gene. For the remaining loci, the molecular mechanisms are unknown but Ras pathway involvement is suspected. Here we compare sequences for the SOS1 gene, and two adjacent genes in the Ras pathway, growth receptor bound protein 2 (GRB2) and epidermal growth factor receptor (EGFR), between HHG-affected and unaffected foxes. We conclude that the known HGF causative mutation does not cause HHG in foxes, nor do the coding regions or intron-exon boundaries of these three genes contain any candidate mutations for fox gum disease. Patterns of molecular evolution among foxes and other mammals reflect high conservation and strong functional constraints for SOS1 and GRB2 but reveal a lineage-specific pattern of variability in EGFR consistent with mutational rate differences, relaxed functional constraints, and possibly positive selection.
Energy Technology Data Exchange (ETDEWEB)
Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)
2012-08-21
DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.
A murC gene in Porphyromonas gingivalis 381.
Ansai, T; Yamashita, Y; Awano, S; Shibata, Y; Wachi, M; Nagai, K; Takehara, T
1995-09-01
The gene encoding a 51 kDa polypeptide of Porphyromonas gingivalis 381 was isolated by immunoblotting using an antiserum raised against P. gingivalis alkaline phosphatase. DNA sequence analysis of a 2.5 kb DNA fragment containing a gene encoding the 51 kDa protein revealed one complete and two incomplete ORFs. Database searches using the FASTA program revealed significant homology between the P. gingivalis 51 kDa protein and the MurC protein of Escherichia coli, which functions in peptidoglycan synthesis. The cloned 51 kDa protein encoded a functional product that complemented an E. coli murC mutant. Moreover, the ORF just upstream of murC coded for a protein that was 31% homologous with the E. coli MurG protein. The ORF just downstream of murC coded for a protein that was 17% homologous with the Streptococcus pneumoniae penicillin-binding protein 2B (PBP2B), which functions in peptidoglycan synthesis and is responsible for antibiotic resistance. These results suggest that P. gingivalis contains a homologue of the E. coli peptidoglycan synthesis gene murC and indicate the possibility of a cluster of genes responsible for cell division and cell growth, as in the E. coli mra region.
Directory of Open Access Journals (Sweden)
Burgess Stewart TG
2012-02-01
Full Text Available Abstract Background Sheep scab is caused by the ectoparasitic mite Psoroptes ovis which initiates a profound cutaneous inflammatory response, leading to the development of the skin lesions which are characteristic of the disease. Existing control strategies rely upon injectable endectocides and acaricidal dips but concerns over residues, eco-toxicity and the development of acaricide resistance limit the sustainability of this approach. In order to identify alternative means of disease control, a deeper understanding of both the parasite and its interaction with the host are required. Methods Herein we describe the development and utilisation of an annotated P. ovis cDNA microarray containing 3,456 elements for the measurement of gene expression in this economically important ectoparasite. The array consists of 981 P. ovis EST sequences printed in triplicate along with 513 control elements. Array performance was validated through the analysis of gene expression differences between fed and starved P. ovis mites. Results Sequences represented on the array include homologues of major house dust mite allergens and tick salivary proteins, along with factors potentially involved in mite reproduction and xenobiotic metabolism. In order to validate the performance of this unique resource under biological conditions we used the array to analyse gene expression differences between fed and starved P. ovis mites. These analyses identified a number of house dust mite allergen homologues up-regulated in fed mites and P. ovis transcripts involved in stress responses, autophagy and chemosensory perception up-regulated in starved mites. Conclusion The P. ovis cDNA microarray described here has been shown to be both robust and reproducible and will enable future studies to analyse gene expression in this important ectoparasite.
The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis.
Zhao, D; Yu, Q; Chen, M; Ma, H
2001-07-01
The Arabidopsis floral regulatory genes APETALA3 (AP3) and PISTILLATA (PI) are required for the B function according to the ABC model for floral organ identity. AP3 and PI expression are positively regulated by the LEAFY (LFY) and UNUSUAL FLORAL ORGANS (UFO) genes. UFO encodes an F-box protein, and we have shown previously that UFO genetically interacts with the ASK1 gene encoding a SKP1 homologue; both the F-box containing protein and SKP1 are subunits of ubiquitin ligases. We show here that the ask1-1 mutation can enhance the floral phenotypes of weak lfy and ap3 mutants; therefore, like UFO, ASK1 also interacts with LFY and AP3 genetically. Furthermore, our results from RNA in situ hybridizations indicate that ASK1 regulates early AP3 and PI expression. These results support the idea that UFO and ASK1 together positively regulate AP3 and PI expression. We propose that the UFO and ASK1 proteins are components of a ubiquitin ligase that mediates the proteolysis of a repressor of AP3 and PI expression. Our genetic studies also indicate that ASK1 and UFO play a role in regulating the number of floral organ primordia, and we discuss possible mechanisms for such a regulation.
Liver steatosis study_PFAA treated mouse gene array data
U.S. Environmental Protection Agency — This file contains a link for Gene Expression Omnibus and the GSE designations for the publicly available gene expression data used in the study and reflected in...
Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus
DEFF Research Database (Denmark)
Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt
2010-01-01
The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...
Misuno, Kaori; Khalili, Saeed; Huang, Junwei; Liu, Younan
2014-01-01
Background Bone marrow cell extract (termed as BM Soup) has been demonstrated to repair irradiated salivary glands (SGs) and restore saliva secretion in our previous study. In the present study, we aim to investigate if the function of damaged SGs in non-obese diabetic (NOD) mice can be restored by BM Soup treatment and the molecular alterations associated with the treatment. Methods Whole BM cells were lysed and soluble intracellular contents (“BM Soup”) were injected I.V. into NOD mice. Tandem mass tagging with 2-D liquid chromatography-mass spectrometry was used to quantify proteins in the submandibular glands (SMGs) between untreated and BM Soup-treated mice. Quantitative PCR was used to identify genes with altered expression in the treated mice. Results BM Soup restored salivary flow rates to normal levels and significantly reduced the focus scores of SMGs in NOD mice. More than 1800 proteins in SMG cells were quantified by the proteomic approach. Many SMG proteins involved in inflammation and apoptosis were found to be down-regulated whereas those involved in salivary gland biology and development/regeneration were up-regulated in the BM Soup-treated mice. qPCR analysis also revealed expression changes of growth factors and cytokines in the SMGs of the treated NOD mice. Conclusion BM Soup treatment is effective to restore the function of damaged SGs in NOD mice. Through gene/protein expression analysis, we have found that BM Soup treatment might effectuate via inhibiting apoptosis, focal adhesion and inflammation whereas promoting development, regeneration and differentiation of the SG cells in NOD mice. These findings provide important insights on the potential mechanisms underlying the BM Soup treatment for functional restoration of damaged SGs in NOD mice. Additional studies are needed to further confirm the identified target genes and their related signaling pathways that are responsible for the BM Soup treatment. PMID:24489858
Role of plnB gene in the regulation of bacteriocin production in Lactobacillus paraplantarum L-XM1.
Zhang, Xiangmei; Shang, Nan; Zhang, Xu; Gui, Meng; Li, Pinglan
2013-06-12
Homologues of plnB gene have been shown to participate in regulation of bacteriocin production through quorum sensing system in other organisms, to investigate the possible role of plnB gene in Lactobacillus paraplantarum L-XM1, we cloned and insertionally inactivated the plnB gene. The plnB knockout mutant ΔplnB21 showed loss of bacteriocin production, its Bac⁺ phenotype could not be restored even after the addition of PlnA. Furthermore, reverse transcription-PCR analysis from total RNA preparations showed that the bacteriocin structural genes of the plnEF and plnJK were not transcribed in the plnB knockout mutant compared with the wild-type strain. It was therefore concluded that plnB is invovled in a quorum sensing based bacteriocin production. This is the first demonstration of a role for plnB by gene knockout in L. paraplantarum. Copyright © 2012 Elsevier GmbH. All rights reserved.
Homozygous deletion of the α- and β1-interferon genes in human leukemia and derived cell lines
International Nuclear Information System (INIS)
Diaz, M.O.; Ziemin, S.; Le Beau, M.M.; Pitha, P.; Smith, S.D.; Chilcote, R.R.; Rowley, J.D.
1988-01-01
The loss of bands p21-22 from one chromosome 9 homologue as a consequence of a deletion of the short arm [del(9p)], unbalanced translocation, or monosomy 9 is frequently observed in the malignant cells of patients with lymphoid neoplasias, including acute lymphoblastic leukemia and non-Hodgkin lymphoma. The α- and β 1 -interferon genes have been assigned to this chromosome region (9p21-22). The authors now present evidence of the homozygous deletion of the interferon genes in neoplastic hematopoietic cell lines and primary leukemia cells in the presence or absence of chromosomal deletions that are detectable at the level of the light microscope. In these cell lines, the deletion of the interferon genes is accompanied by a deficiency of 5'-methylthioadenosine phosphorylase, an enzyme of purine metabolism. These homozygous deletions may be associated with the loss of a tumor-suppressor gene that is involved in the development of these neoplasias. The relevant genes may be either the interferon genes themselves or a gene that has a tumor-suppressor function and is closely linked to them
Rapid evolution of cancer/testis genes on the X chromosome
Directory of Open Access Journals (Sweden)
Simpson Andrew J
2007-05-01
Full Text Available Abstract Background Cancer/testis (CT genes are normally expressed only in germ cells, but can be activated in the cancer state. This unusual property, together with the finding that many CT proteins elicit an antigenic response in cancer patients, has established a role for this class of genes as targets in immunotherapy regimes. Many families of CT genes have been identified in the human genome, but their biological function for the most part remains unclear. While it has been shown that some CT genes are under diversifying selection, this question has not been addressed before for the class as a whole. Results To shed more light on this interesting group of genes, we exploited the generation of a draft chimpanzee (Pan troglodytes genomic sequence to examine CT genes in an organism that is closely related to human, and generated a high-quality, manually curated set of human:chimpanzee CT gene alignments. We find that the chimpanzee genome contains homologues to most of the human CT families, and that the genes are located on the same chromosome and at a similar copy number to those in human. Comparison of putative human:chimpanzee orthologues indicates that CT genes located on chromosome X are diverging faster and are undergoing stronger diversifying selection than those on the autosomes or than a set of control genes on either chromosome X or autosomes. Conclusion Given their high level of diversifying selection, we suggest that CT genes are primarily responsible for the observed rapid evolution of protein-coding genes on the X chromosome.
Directory of Open Access Journals (Sweden)
Zhitao Qi
2015-01-01
Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.
Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I
2001-08-01
The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.
Energy Technology Data Exchange (ETDEWEB)
Heighway, J.; Betticher, D.C.; Altermatt, H.J. [Univ. Hospital of Berne (Switzerland)] [and others
1996-07-01
Analysis of a region of DNA, coamplified in tumors with KRAS2, resulted in the identification of the human homologue of the mouse KRAG gene. The gene was widely expressed in range of cell lines, tumors, and normal tissue and demonstrated a high degree of alternate splicing. A human KRAG cDNA sequence, with a structure similar to that encoded by the amplified gene in mouse Y1 adrenal carcinoma cells, was isolated by RT-PCR. The predicted amino acid similarity between the two sequences was 91%, and hydrophobicity plots suggested a structure closely resembling that of transmembrane 4 superfamily members. Identification of a PCR-based restriction fragment length polymorphism allele-specific splicing differences in tumors. Northern analysis of mRNA derived from a range of tissues suggested high level expression in muscle and confirmed alternate splicing. To facilitate the analysis of exon junctions, a YAC clone encoding the genomic sequence was identified. This allowed the localization of KRAG to human chromosome 12p11.2. Isolation of one end of this nonchimeric clone demonstrated a perfect match with a 247-bp sequence within the 3{prime} untranslated region of the type 2 1,4,5-inositol triphosphate receptor gene. Multiplex PCR confirmed the inclusion of both genes. Multiplex PCR confirmed the inclusion of both genes in the KRAS2 amplicon in human malignancy, suggesting that either may contribute to the malignant phenotypes. 35 refs., 6 figs., 1 tab.
Directory of Open Access Journals (Sweden)
Dorota Magdalena Krzyżanowska
2016-05-01
Full Text Available Dickeya solani and Pectobacterium carotovorum subsp. brasili¬ense are recently established species of bacterial plant pathogens causing black leg and soft rot of many vegetables and ornamental plants. Pseudomonas sp. strain P482 inhibits the growth of these pathogens, a desired trait considering the limited measures to combat these diseases. In this study, we determined the genetic background of the antibacterial activity of P482, and established the phylogenetic position of this strain.Pseudomonas sp. P482 was classified as Pseudomonas donghuensis. Genome mining revealed that the P482 genome does not contain genes determining the synthesis of known antimicrobials. However, the ClusterFinder algorithm, designed to detect atypical or novel classes of secondary metabolite gene clusters, predicted 18 such clusters in the genome. Screening of a Tn5 mutant library yielded an antimicrobial negative transposon mutant. The transposon insertion was located in a gene encoding an HpcH/HpaI aldolase/citrate lyase family protein. This gene is located in a hypothetical cluster predicted by the ClusterFinder, together with the downstream homologues of four nfs genes, that confer production of a nonfluorescent siderophore by P. donghuensis HYST. Site-directed inactivation of the HpcH/HpaI aldolase gene, the adjacent short chain dehydrogenase gene, as well as a homologue of an essential nfs cluster gene, all abolished the antimicrobial activity of the P482, suggesting their involvement in a common biosynthesis pathway. However, none of the mutants showed a decreased siderophore yield, neither was the antimicrobial activity of the wild type P482 compromised by high iron bioavailability.A genomic region comprising the nfs cluster and three upstream genes is involved in the antibacterial activity of P. donghuensis P482 against D. solani and P. carotovorum subsp. brasiliense. The genes studied are unique to the two known P. donghuensis strains. This study
Genome-wide analysis of esterase-like genes in the striped rice stem borer, Chilo suppressalis.
Wang, Baoju; Wang, Ying; Zhang, Yang; Han, Ping; Li, Fei; Han, Zhaojun
2015-06-01
The striped rice stem borer, Chilo suppressalis, a destructive pest of rice, has developed high levels of resistance to certain insecticides. Esterases are reported to be involved in insecticide resistance in several insects. Therefore, this study systematically analyzed esterase-like genes in C. suppressalis. Fifty-one esterase-like genes were identified in the draft genomic sequences of the species, and 20 cDNA sequences were derived which encoded full- or nearly full-length proteins. The putative esterase proteins derived from these full-length genes are overall highly diversified. However, key residues that are functionally important including the serine residue in the active site are conserved in 18 out of the 20 proteins. Phylogenetic analysis revealed that most of these genes have homologues in other lepidoptera insects. Genes CsuEst6, CsuEst10, CsuEst11, and CsuEst51 were induced by the insecticide triazophos, and genes CsuEst9, CsuEst11, CsuEst14, and CsuEst51 were induced by the insecticide chlorantraniliprole. Our results provide a foundation for future studies of insecticide resistance in C. suppressalis and for comparative research with esterase genes from other insect species.
Impairments of mecA gene detection in bovine Staphylococcus spp.
Directory of Open Access Journals (Sweden)
Dayanne Araújo de Melo
2014-09-01
Full Text Available Staphylococcus aureus antimicrobial resistance, especially to beta-lactams, favors treatment failures and its persistence in herd environment. This work aimed to develop a more specific primer for mecA gene detection based on the comparison of the conserved regions from distinct host origins and also investigated the presence of homologue mecA LGA251 in bovine strains. A total of 43 Staphylococcus spp. were included in this study, comprising 38 bovine S. aureus, two human and three equine coagulase-negative staphylococci (CNS. Phenotypical methicillin-resistance detection was performed through oxacillin agar-screening and cefoxitin disk-diffusion test. None isolate tested positive for mecA LGA251 gene. For mecA gene PCR, new primers were designed based on the sequences of human S. aureus (HE681097 and bovine S. sciuri (AY820253 mecA. The new primers based on the S. aureus mecA sequence amplified fragments of human and equine CNS and the ones based on S. sciuri mecA sequence only yielded fragments for S. aureus bovine strains. Multiples alignments of mecA gene sequences from bovine, human and equine revealed punctual but significant differences in bovine strains that can lead to the mecA gene detection impairment. The observed divergences of mecA gene sequences are not a matter of animal or human origin, it is a specificity of bovine samples.
International Nuclear Information System (INIS)
Li, Shuai; Zhang, Shenghua; Ye, Chengsong; Lin, Wenfang; Zhang, Menglu; Chen, Lihua; Li, Jinmei; Yu, Xin
2017-01-01
Antibiotics are heavily used in Chinese mariculture, but only a small portion of the added antibiotics are absorbed by living creatures. Biofilm processes are universally used in mariculture wastewater treatment. In this study, removal of antibiotics (norfloxacin, rifampicin, and oxytetracycline) from wastewater by moving bed biofilm reactors (MBBRs) and the influence of antibiotics on reactor biofilm were investigated. The results demonstrated that there was no significant effect of sub-μg/L–sub-mg/L concentrations of antibiotics on TOC removal. Moreover, the relative abundance of antibiotic resistance genes (ARGs) and antibiotic resistance bacteria (ARB) in MBBR biofilm increased because of selective pressure of antibiotics. In addition, antibiotics decreased the diversity of the biofilm bacterial community and altered bacterial community structure. These findings provide an empirical basis for the development of appropriate practices for mariculture, and suggest that disinfection and advanced oxidation should be applied to eliminate antibiotics, ARGs, and ARB from mariculture wastewater. - Highlights: • The removal of antibiotics by Moving Bed Biofilm Reactors (MBBR) was investigated. • Biofilm process such as MBBR had little effect on the removal of the antibiotics. • The antibiotics decreased the diversity of biofilm bacterial community and altered bacterial community structure. • Biofilm processes in treating mariculture wastewater may be a reservoir of antibiotic resistance genes.
Directory of Open Access Journals (Sweden)
Sirigineedi Sasibhushan
2013-02-01
Full Text Available Investigation of differential expression of diapause related genes (five metabolic, five heat shock protein and one translational regulatory in HCl-treated (non-diapause and untreated (diapause eggs of B. mori during early embryogenesis (up to 48h following oviposition revealed the up-regulation of sorbitol dehydrogenase upon HCl treatment, indicating increased glycogen synthesis for further embryonic development but, down-regulation of phosphofructo kinase gene expression after 18h of oviposition indicating an arrest of glycerol and sorbitol conversion. The expression of poly A binding protein gene expression was higher upon HCl treatment, revealing the initiation of translation. The expression levels of other genes analyzed did not vary significantly, except for Hsp90 and Hsp40, which were up-regulated on acid treatment until 18h. Thus, Sorbitoldehydrogenase and phosphofructo kinasegenes have a crucial role in diapause termination as evidenced by HCl treatment, while the other genes did not have major roles.
A 1-month-old infant with chylomicronemia due to gene mutation treated by plasmapheresis
Directory of Open Access Journals (Sweden)
Mo Kyung Jung
2017-03-01
Full Text Available Chylomicronemia is a severe type of hypertriglyceridemia characterized by chylomicron accumulation that arises from a genetic defect in intravascular lipolysis. It requires urgent and proper management, because serious cases can be accompanied by pancreatic necrosis or persistent multiple organ failure. We present the case of a 1-month-old infant with chylomicronemia treated by plasmapheresis. His chylomicronemia was discovered incidentally when lactescent plasma was noticed during routine blood sampling during a hospital admission for fever and irritability. Laboratory investigation revealed marked triglyceridemia (>5,000 mg/dL with high chylomicron levels. We therefore decided to perform a therapeutic plasmapheresis to prevent acute pancreatitis. Sequence analysis revealed a homozygous novel mutation in exon 4 of GPIHBP1: c.476delG (p.Gly159Alafs. Glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1 (GPIHBP1 stabilizes the binding of chylomicrons near lipoprotein lipase and supports lipolysis. Mutations of GPIHBP1, the most recently discovered gene, can lead to severe hyperlipidemia and are known to make up only 2% of the monogenic mutations associated with chylomicronemia. The patient maintains mild hypertriglyceridemia without rebound after single plasmapheresis and maintenance fibrate medication so far. Here, we report an infant with chylomicronemia due to GPIHBP1 mutation, successfully treated by plasmapheresis.
Directory of Open Access Journals (Sweden)
Jacobs Michael A
2007-05-01
Full Text Available Abstract Background Maintenance of homeostasis requires that an organism perceive selected physical and chemical signals within an informationally dense environment. Functionally, an organism uses a variety of signal transduction arrays to amplify and convert these perceived signals into appropriate gene transcriptional responses. These changes in gene expression serve to modify selective metabolic processes and thus optimize reproductive success. Here we analyze a chloroplast-encoded His-to-Asp signal transduction circuit in the stramenopile Heterosigma akashiwo (Hada Hada ex Y. Hara et Chihara [syn. H. carterae (Hulburt F.J.R. Taylor]. The presence, structure and putative function of this protein pair are discussed in the context of their evolutionary homologues. Results Bioinformatic analysis of the Heterosigma akashiwo chloroplast genome sequence revealed the presence of a single two-component His-to-Asp (designated Tsg1/Trg1 pair in this stramenopile (golden-brown alga. These data represent the first documentation of a His-to-Asp array in stramenopiles and counter previous reports suggesting that such regulatory proteins are lacking in this taxonomic cluster. Comparison of the 43 kDa H. akashiwo Tsg1 with bacterial sensor kinases showed that the algal protein exhibits a moderately maintained PAS motif in the sensor kinase domain as well as highly conserved H, N, G1 and F motifs within the histidine kinase ATP binding site. Molecular modelling of the 27 kDa H. akashiwo Trg1 regulator protein was consistent with a winged helix-turn-helix identity – a class of proteins that is known to impact gene expression at the level of transcription. The occurrence of Trg1 protein in actively growing H. akashiwo cells was verified by Western analysis. The presence of a PhoB-like RNA polymerase loop in Trg1 and its homologues in the red-algal lineage support the hypothesis that Trg1 and its homologues interact with a sigma 70 (σ70 subunit (encoded by
Espineda, Cromwell E.; Linford, Alicia S.; Devine, Domenica; Brusslan, Judy A.
1999-01-01
Chlorophyll b is synthesized from chlorophyll a and is found in the light-harvesting complexes of prochlorophytes, green algae, and both nonvascular and vascular plants. We have used conserved motifs from the chlorophyll a oxygenase (CAO) gene from Chlamydomonas reinhardtii to isolate a homologue from Arabidopsis thaliana. This gene, AtCAO, is mutated in both leaky and null chlorina1 alleles, and DNA sequence changes cosegregate with the mutant phenotype. AtCAO mRNA levels are higher in three different mutants that have reduced levels of chlorophyll b, suggesting that plants that do not have sufficient chlorophyll b up-regulate AtCAO gene expression. Additionally, AtCAO mRNA levels decrease in plants that are grown under dim-light conditions. We have also found that the six major Lhcb proteins do not accumulate in the null ch1-3 allele. PMID:10468639
Directory of Open Access Journals (Sweden)
Sylwia Wasiak
2016-09-01
Full Text Available Apabetalone (RVX-208 inhibits the interaction between epigenetic regulators known as bromodomain and extraterminal (BET proteins and acetyl-lysine marks on histone tails. Data presented here supports the manuscript published in Atherosclerosis “RVX-208, a BET-inhibitor for Treating Atherosclerotic Cardiovascular Disease, Raises ApoA-I/HDL and Represses Pathways that Contribute to Cardiovascular Disease” (Gilham et al., 2016 [1]. It shows that RVX-208 and a comparator BET inhibitor (BETi JQ1 increase mRNA expression and production of apolipoprotein A-I (ApoA-I, the main protein component of high density lipoproteins, in primary human and African green monkey hepatocytes. In addition, reported here are gene expression changes from a microarray-based analysis of human whole blood and of primary human hepatocytes treated with RVX-208. Keywords: Bromodomain, BET proteins, BET inhibitor, RVX-208, JQ1, Vascular inflammation, ApoA-I, Apolipoprotein A-I, African green monkey, Primary human hepatocytes, Gene expression, Microarrays
Tapia-Paniagua, S T; Vidal, S; Lobo, C; García de la Banda, I; Esteban, M A; Balebona, M C; Moriñigo, M A
2015-10-01
Few antimicrobials are currently authorised in the aquaculture industry to treat infectious diseases. Among them, oxytetracycline (OTC) is one of the first-choice drugs for nearly all bacterial diseases. The objective of this study was to evaluate the effect of the dietary administration of OTC both alone and jointly with the probiotic Shewanella putrefaciens Pdp11 (SpPdp11) on the intestinal microbiota and hepatic expression of genes related to immunity in Senegalese sole (Solea senegalensis) juveniles. The results demonstrated that the richness and diversity of the intestinal microbiota of fish treated with OTC decreased compared with those of the control group but that these effects were lessened by the simultaneous administration of SpPdp11. In addition, specimens that received OTC and SpPdp11 jointly showed a decreased intensity of the Denaturing Gradient Gel Electrophoresis (DGGE) bands related to Vibrio genus and the presence of DGGE bands related to Lactobacillus and Shewanella genera. The relationship among the intestinal microbiota of fish fed with control and OTC diets and the expression of the NADPH oxidase and CASPASE-6 genes was demonstrated by a Principal Components Analysis (PCA) carried out in this study. In contrast, a close relationship between the transcription of genes, such as NKEF, IGF-β, HSP70 and GP96, and the DGGE bands of fish treated jointly with OTC and SpPdp11 was observed in the PCA study. In summary, the results obtained in this study demonstrate that the administration of OTC results in the up-regulation of genes related to apoptosis but that the joint administration of OTC and S. putrefaciens Pdp11 increases the transcription of genes related to antiapoptotic effects and oxidative stress regulation. Further, a clear relationship between these changes and those detected in the intestinal microbiota is established. Copyright © 2015 Elsevier Ltd. All rights reserved.
Li, Bo; Bi, Chang Long; Lang, Ning; Li, Yu Ze; Xu, Chao; Zhang, Ying Qi; Zhai, Ai Xia; Cheng, Zhi Feng
2014-01-01
Type 1 diabetes is a chronic autoimmune disease in which pancreatic beta cells are killed by the infiltrating immune cells as well as the cytokines released by these cells. Many studies indicate that inflammatory mediators have an essential role in this disease. In the present study, we profiled the transcriptome in human islets of langerhans under control conditions or following exposure to the pro-inflammatory cytokines based on the RNA sequencing dataset downloaded from SRA database. After filtered the low-quality ones, the RNA readers was aligned to human genome hg19 by TopHat and then assembled by Cufflinks. The expression value of each transcript was calculated and consequently differentially expressed genes were screened out. Finally, a total of 63 differentially expressed genes were identified including 60 up-regulated and three down-regulated genes. GBP5 and CXCL9 stood out as the top two most up-regulated genes in cytokines treated samples with the log2 fold change of 12.208 and 10.901, respectively. Meanwhile, PTF1A and REG3G were identified as the top two most down-regulated genes with the log2 fold change of -3.759 and -3.606, respectively. Of note, we also found 262 lncRNAs (long non-coding RNA), 177 of which were inferred as novel lncRNAs. Further in-depth follow-up analysis of the transcriptional regulation reported in this study may shed light on the specific function of these lncRNA.
Structure of Rot, a global regulator of virulence genes in Staphylococcus aureus.
Zhu, Yuwei; Fan, Xiaojiao; Zhang, Xu; Jiang, Xuguang; Niu, Liwen; Teng, Maikun; Li, Xu
2014-09-01
Staphylococcus aureus is a highly versatile pathogen that can infect human tissue by producing a large arsenal of virulence factors that are tightly regulated by a complex regulatory network. Rot, which shares sequence similarity with SarA homologues, is a global regulator that regulates numerous virulence genes. However, the recognition model of Rot for the promoter region of target genes and the putative regulation mechanism remain elusive. In this study, the 1.77 Å resolution X-ray crystal structure of Rot is reported. The structure reveals that two Rot molecules form a compact homodimer, each of which contains a typical helix-turn-helix module and a β-hairpin motif connected by a flexible loop. Fluorescence polarization results indicate that Rot preferentially recognizes AT-rich dsDNA with ~30-base-pair nucleotides and that the conserved positively charged residues on the winged-helix motif are vital for binding to the AT-rich dsDNA. It is proposed that the DNA-recognition model of Rot may be similar to that of SarA, SarR and SarS, in which the helix-turn-helix motifs of each monomer interact with the major grooves of target dsDNA and the winged motifs contact the minor grooves. Interestingly, the structure shows that Rot adopts a novel dimerization model that differs from that of other SarA homologues. As expected, perturbation of the dimer interface abolishes the dsDNA-binding ability of Rot, suggesting that Rot functions as a dimer. In addition, the results have been further confirmed in vivo by measuring the transcriptional regulation of α-toxin, a major virulence factor produced by most S. aureus strains.
Liu, Hongyun; Qin, Jiajia; Fan, Hui; Cheng, Jinjin; Li, Lin; Liu, Zheng
2017-07-01
As a member of the GRAS gene family, SCARECROW - LIKE ( SCL ) genes encode transcriptional regulators that are involved in plant information transmission and signal transduction. In this study, 44 SCL genes including two SCARECROW genes in millet were identified to be distributed on eight chromosomes, except chromosome 6. All the millet genes contain motifs 6-8, indicating that these motifs are conserved during the evolution. SCL genes of millet were divided into eight groups based on the phylogenetic relationship and classification of Arabidopsis SCL genes. Several putative millet orthologous genes in Arabidopsis , maize and rice were identified. High throughput RNA sequencing revealed that the expressions of millet SCL genes in root, stem, leaf, spica, and along leaf gradient varied greatly. Analyses combining the gene expression patterns, gene structures, motif compositions, promoter cis -elements identification, alternative splicing of transcripts and phylogenetic relationship of SCL genes indicate that the these genes may play diverse functions. Functionally characterized SCL genes in maize, rice and Arabidopsis would provide us some clues for future characterization of their homologues in millet. To the best of our knowledge, this is the first study of millet SCL genes at the genome wide level. Our work provides a useful platform for functional analysis of SCL genes in millet, a model crop for C 4 photosynthesis and bioenergy studies.
DEFF Research Database (Denmark)
Hansen, L; Jensen, J N; Ekstrøm, C T
2001-01-01
Phosphatase and tensin homologue deleted from chromosome ten (PTEN) has recently been characterized as a novel member in the expanding network of proteins regulating the intracellular effects of insulin. By dephosphorylation of phosphatidyl-inositol-(3, 4, 5)-trisphosphate (PIP3) the PTEN protein...... regulates the insulin-dependent phosphoinositide 3-kinase (PI3K) signalling cassette and accordingly might function as a regulator of insulin sensitivity in skeletal muscle and adipose tissue. In this study we tested PTEN as a candidate gene for insulin resistance and late-onset Type II (non...
Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo
2006-10-01
Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.
Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).
Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T
2002-09-01
Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.
Yu, Dayu; Xu, Fuchao; Valiente, Jonathan; Wang, Siyuan; Zhan, Jixun
2013-01-01
A putative indigoidine biosynthetic gene cluster was located in the genome of Streptomyces chromofuscus ATCC 49982. The silent 9.4-kb gene cluster consists of five open reading frames, named orf1, Sc-indC, Sc-indA, Sc-indB, and orf2, respectively. Sc-IndC was functionally characterized as an indigoidine synthase through heterologous expression of the enzyme in both Streptomyces coelicolor CH999 and Escherichia coli BAP1. The yield of indigoidine in E. coli BAP1 reached 2.78 g/l under the optimized conditions. The predicted protein product of Sc-indB is unusual and much larger than any other reported IndB-like protein. The N-terminal portion of this enzyme resembles IdgB and the C-terminal portion is a hypothetical protein. Sc-IndA and/or Sc-IndB were co-expressed with Sc-IndC in E. coli BAP1, which demonstrated the involvement of Sc-IndB, but not Sc-IndA, in the biosynthetic pathway of indigoidine. The yield of indigoidine was dramatically increased by 41.4 % (3.93 g/l) when Sc-IndB was co-expressed with Sc-IndC in E. coli BAP1. Indigoidine is more stable at low temperatures.
The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases.
Wang, Tao; Xiong, Jian-Qiong
2016-02-01
The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated by TLX and its homologues in specific tissues during various developmental stages. This review aims to summarize previous studies including many recent updates from different aspects concerning TLX and its homologues in Drosophila and mouse.
Directory of Open Access Journals (Sweden)
Joshua Park
Full Text Available The objective of this study was to investigate the efficacy of using quantitative magnetic resonance imaging (MRI as a non-invasive tool for the monitoring of gene therapy for muscular dystrophy. The clinical investigations for this family of diseases often involve surgical biopsy which limits the amount of information that can be obtained due to the invasive nature of the procedure. Thus, other non-invasive tools may provide more opportunities for disease assessment and treatment responses. In order to explore this, dystrophic mdx4cv mice were systemically treated with a recombinant adeno-associated viral (AAV vector containing a codon-optimized micro-dystrophin gene. Multi-parametric MRI of T2, magnetization transfer, and diffusion effects alongside 3-D volume measurements were then utilized to monitor disease/treatment progression. Mice were imaged at 10 weeks of age for pre-treatment, then again post-treatment at 8, 16, and 24 week time points. The efficacy of treatment was assessed by physiological assays for improvements in function and quantification of expression. Tissues from the hindlimbs were collected for histological analysis after the final time point for comparison with MRI results. We found that introduction of the micro-dystrophin gene restored some aspects of normal muscle histology and pathology such as decreased necrosis and resistance to contraction-induced injury. T2 relaxation values showed percentage decreases across all muscle types measured (tibialis anterior, gastrocnemius, and soleus when treated groups were compared to untreated groups. Additionally, the differences between groups were statistically significant for the tibialis anterior as well. The diffusion measurements showed a wider range of percentage changes and less statistical significance while the magnetization transfer effect measurements showed minimal change. MR images displayed hyper-intense regions of muscle that correlated with muscle pathology in
Patterns of gene expression in a scleractinian coral undergoing natural bleaching.
Seneca, Francois O; Forêt, Sylvain; Ball, Eldon E; Smith-Keune, Carolyn; Miller, David J; van Oppen, Madeleine J H
2010-10-01
Coral bleaching is a major threat to coral reefs worldwide and is predicted to intensify with increasing global temperature. This study represents the first investigation of gene expression in an Indo-Pacific coral species undergoing natural bleaching which involved the loss of algal symbionts. Quantitative real-time polymerase chain reaction experiments were conducted to select and evaluate coral internal control genes (ICGs), and to investigate selected coral genes of interest (GOIs) for changes in gene expression in nine colonies of the scleractinian coral Acropora millepora undergoing bleaching at Magnetic Island, Great Barrier Reef, Australia. Among the six ICGs tested, glyceraldehyde 3-phosphate dehydrogenase and the ribosomal protein genes S7 and L9 exhibited the most constant expression levels between samples from healthy-looking colonies and samples from the same colonies when severely bleached a year later. These ICGs were therefore utilised for normalisation of expression data for seven selected GOIs. Of the seven GOIs, homologues of catalase, C-type lectin and chromoprotein genes were significantly up-regulated as a result of bleaching by factors of 1.81, 1.46 and 1.61 (linear mixed models analysis of variance, P coral bleaching response genes. In contrast, three genes, including one putative ICG, showed highly variable levels of expression between coral colonies. Potential variation in microhabitat, gene function unrelated to the stress response and individualised stress responses may influence such differences between colonies and need to be better understood when designing and interpreting future studies of gene expression in natural coral populations.
Directory of Open Access Journals (Sweden)
Sébastien Halary
Full Text Available The fungal kingdom displays a fascinating diversity of sex-determination systems. Recent advances in genomics provide insights into the molecular mechanisms of sex, mating type determination, and evolution of sexual reproduction in many fungal species in both ancient and modern phylogenetic lineages. All major fungal groups have evolved sexual differentiation and recombination pathways. However, sexuality is unknown in arbuscular mycorrhizal fungi (AMF of the phylum Glomeromycota, an ecologically vital group of obligate plant root symbionts. AMF are commonly considered an ancient asexual lineage dating back to the Ordovician, approximately 460 M years ago. In this study, we used genomic and transcriptomic surveys of several AMF species to demonstrate the presence of conserved putative sex pheromone-sensing mitogen-activated protein (MAP kinases, comparable to those described in Ascomycota and Basidiomycota. We also find genes for high mobility group (HMG transcription factors, homologous to SexM and SexP genes in the Mucorales. The SexM genes show a remarkable sequence diversity among multiple copies in the genome, while only a single SexP sequence was detected in some isolates of Rhizophagus irregularis. In the Mucorales and Microsporidia, the sexM gene is flanked by genes for a triosephosphate transporter (TPT and a RNA helicase, but we find no evidence for synteny in the vicinity of the Sex locus in AMF. Nonetheless, our results, together with previous observations on meiotic machinery, suggest that AMF could undergo a complete sexual reproduction cycle.
Energy Technology Data Exchange (ETDEWEB)
Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)
1997-03-01
An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.
Jeibmann, Astrid; Eikmeier, Kristin; Linge, Anna; Kool, Marcel; Koos, Björn; Schulz, Jacqueline; Albrecht, Stefanie; Bartelheim, Kerstin; Frühwald, Michael C.; Pfister, Stefan M.; Paulus, Werner; Hasselblatt, Martin
2014-06-01
Atypical teratoid/rhabdoid tumours (AT/RT) are malignant brain tumours. Unlike most other human brain tumours, AT/RT are characterized by inactivation of one single gene, SMARCB1. SMARCB1 is a member of the evolutionarily conserved SWI/SNF chromatin remodelling complex, which has an important role in the control of cell differentiation and proliferation. Little is known, however, about the pathways involved in the oncogenic effects of SMARCB1 inactivation, which might also represent targets for treatment. Here we report a comprehensive genetic screen in the fruit fly that revealed several genes not yet associated with loss of snr1, the Drosophila homologue of SMARCB1. We confirm the functional role of identified genes (including merlin, kibra and expanded, known to regulate hippo signalling pathway activity) in human rhabdoid tumour cell lines and AT/RT tumour samples. These results demonstrate that fly models can be employed for the identification of clinically relevant pathways in human cancer.
Berger, Martin D; Stintzing, Sebastian; Heinemann, Volker; Cao, Shu; Yang, Dongyun; Sunakawa, Yu; Matsusaka, Satoshi; Ning, Yan; Okazaki, Satoshi; Miyamoto, Yuji; Suenaga, Mitsukuni; Schirripa, Marta; Hanna, Diana L; Soni, Shivani; Puccini, Alberto; Zhang, Wu; Cremolini, Chiara; Falcone, Alfredo; Loupakis, Fotios; Lenz, Heinz-Josef
2018-02-15
Purpose: Vitamin D exerts its inhibitory influence on colon cancer growth by inhibiting Wnt signaling and angiogenesis. We hypothesized that SNPs in genes involved in vitamin D transport, metabolism, and signaling are associated with outcome in metastatic colorectal cancer (mCRC) patients treated with first-line FOLFIRI and bevacizumab. Experimental Design: 522 mCRC patients enrolled in the FIRE-3 (discovery cohort) and TRIBE (validation set) trials treated with FOLFIRI/bevacizumab were included in this study. 278 patients receiving FOLFIRI and cetuximab (FIRE-3) served as a control cohort. Six SNPs in 6 genes ( GC, CYP24A1, CYP27B1, VDR, DKK1, CST5 ) were analyzed. Results: In the discovery cohort, AA carriers of the GC rs4588 SNP encoding for the vitamin D-binding protein, and treated with FOLFIRI/bevacizumab had a shorter overall survival (OS) than those harboring any C allele (15.9 vs. 25.1 months) in both univariable ( P = 0.001) and multivariable analyses ( P = 0.047). This association was confirmed in the validation cohort in multivariable analysis (OS 18.1 vs. 26.2 months, HR, 1.83; P = 0.037). Interestingly, AA carriers in the control set exhibited a longer OS (48.0 vs. 25.2 months, HR, 0.50; P = 0.021). This association was further confirmed in a second validation cohort comprising refractory mCRC patients treated with cetuximab ± irinotecan (PFS 8.7 vs. 3.7 months) in univariable ( P = 0.033) and multivariable analyses ( P = 0.046). Conclusions: GC rs4588 SNP might serve as a predictive marker in mCRC patients treated with FOLFIRI/bevacizumab or FOLFIRI/cetuximab. Whereas AA carriers derive a survival benefit with FOLFIRI/cetuximab, treatment with FOLFIRI/bevacizumab is associated with a worse outcome. Clin Cancer Res; 24(4); 784-93. ©2017 AACR . ©2017 American Association for Cancer Research.
Rand, Lucinda; Hinds, Jason; Springer, Burkhard; Sander, Peter; Buxton, Roger S; Davis, Elaine O
2003-11-01
In many species of bacteria most inducible DNA repair genes are regulated by LexA homologues and are dependent on RecA for induction. We have shown previously by analysing the induction of recA that two mechanisms for the induction of gene expression following DNA damage exist in Mycobacterium tuberculosis. Whereas one of these depends on RecA and LexA in the classical way, the other mechanism is independent of both of these proteins and induction occurs in the absence of RecA. Here we investigate the generality of each of these mechanisms by analysing the global response to DNA damage in both wild-type M. tuberculosis and a recA deletion strain of M. tuberculosis using microarrays. This revealed that the majority of the genes that were induced remained inducible in the recA mutant stain. Of particular note most of the inducible genes with known or predicted functions in DNA repair did not depend on recA for induction. Amongst these are genes involved in nucleotide excision repair, base excision repair, damage reversal and recombination. Thus, it appears that this novel mechanism of gene regulation is important for DNA repair in M. tuberculosis.
Fraisier, V; Dorbe, M F; Daniel-Vedele, F
2001-01-01
Higher plants have both high- and low-affinity nitrate uptake systems (HATS and LATS respectively). Here we report the isolation and characterization of two genes, NpNRT1.1 and NpNRT1.2, from Nicotiana plumbaginifolia whose structural features suggest that they both belong to the NRT1 gene family, which is involved in the LATS. Amino acid sequence alignment showed that the N. plumbaginifolia proteins have greater similarity to their corresponding tomato homologues than to each other. Genomic Southern blot analysis indicates that there are probably more than two members of this family in N. plumbaginifolia. Northern blot analysis shows that NpNRT1.2 expression is restricted strictly to roots, whereas NpNRT1.1, in addition to roots, is expressed at a basal level in all other plant organs. Likewise, differential expression in response to external treatments with various N sources was observed for these two genes: NpNRT1.1 can be considered as a constitutively expressed gene whereas NpNRT1.2 expression is dependent strictly on high nitrate concentrations. Finally, over-expression of a gene involved in the HATS does not lead to any modification of LATS gene expression.
A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast
DEFF Research Database (Denmark)
Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.
2007-01-01
and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...
Flores-Monterroso, Aranzazu; Canales, Javier; de la Torre, Fernando; Ávila, Concepción; Cánovas, Francisco M
2013-06-01
Ectomycorrhizal associations are of major ecological importance in temperate and boreal forests. The development of a functional ectomycorrhiza requires many genetic and biochemical changes. In this study, suppressive subtraction hybridization was used to identify differentially expressed genes in the roots of maritime pine (Pinus pinaster Aiton) inoculated with Laccaria bicolor, a mycorrhizal fungus. A total number of 200 unigenes were identified as being differentially regulated in maritime pine roots during the development of mycorrhiza. These unigenes were classified into 10 categories according to the function of their homologues in the GenBank database. Approximately, 40 % of the differentially expressed transcripts were genes that coded for unknown proteins in the databases or that had no homology to known genes. A group of these differentially expressed genes was selected to validate the results using quantitative real-time PCR. The transcript levels of the representative genes were compared between the non-inoculated and inoculated plants at 1, 5, 15 and 30 days after inoculation. The observed expression patterns indicate (1) changes in the composition of the wall cell, (2) tight regulation of defence genes during the development of mycorrhiza and (3) changes in carbon and nitrogen metabolism. Ammonium excess or deficiency dramatically affected the stability of ectomycorrhiza and altered gene expression in maritime pine roots.
Sood, S; Patel, F D; Ghosh, S; Arora, A; Dhaliwal, L K; Srinivasan, R
2015-12-01
Locally advanced invasive cervical cancer [International Federation of Gynecology and Obstetrics (FIGO) IIB/III] is treated by chemoradiation. The response to treatment is variable within a given FIGO stage. Therefore, the aim of the present study was to evaluate the gene promoter methylation profile and corresponding transcript expression of a panel of six genes to identify genes which could predict the response of patients treated by chemoradiation. In total, 100 patients with invasive cervical cancer in FIGO stage IIB/III who underwent chemoradiation treatment were evaluated. Ten patients developed systemic metastases during therapy and were excluded. On the basis of patient follow-up, 69 patients were chemoradiation-sensitive, whereas 21 were chemoradiation-resistant. Gene promoter methylation and gene expression was determined by TaqMan assay and quantitative real-time PCR, respectively, in tissue samples. The methylation frequency of ESR1, BRCA1, RASSF1A, MLH1, MYOD1 and hTERT genes ranged from 40 to 70%. Univariate and hierarchical cluster analysis revealed that gene promoter methylation of MYOD1, ESR1 and hTERT could predict for chemoradiation response. A pattern of unmethylated MYOD1, unmethylated ESR1 and methylated hTERT promoter as well as lower ESR1 transcript levels predicted for chemoradiation resistance. Methylation profiling of a panel of three genes that includes MYOD1, ESR1 and hTERT may be useful to predict the response of invasive cervical carcinoma patients treated with standard chemoradiation therapy. Copyright © 2015 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.
Lifescience Database Archive (English)
Full Text Available ene and FLC gene homologue concerning induction of flowering, the one of the homologue region of the top of A. thaliana chromosome 5 5 pO160E1 LG_O03 ... 2.6 ... 10.1139/g01-082 11681610
Lifescience Database Archive (English)
Full Text Available ene and FLC gene homologue concerning induction of flowering, the one of the homologue region of the top of A. thaliana chromosome 5 5 pN59E5 LG_O09 ... 2.7 ... 10.1139/g01-082 11681610
Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves
Energy Technology Data Exchange (ETDEWEB)
Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson
2011-12-31
The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.
Directory of Open Access Journals (Sweden)
Neutelings Godfrey
2010-04-01
Full Text Available Abstract Background Quantitative real-time PCR (qRT-PCR is currently the most accurate method for detecting differential gene expression. Such an approach depends on the identification of uniformly expressed 'housekeeping genes' (HKGs. Extensive transcriptomic data mining and experimental validation in different model plants have shown that the reliability of these endogenous controls can be influenced by the plant species, growth conditions and organs/tissues examined. It is therefore important to identify the best reference genes to use in each biological system before using qRT-PCR to investigate differential gene expression. In this paper we evaluate different candidate HKGs for developmental transcriptomic studies in the economically-important flax fiber- and oil-crop (Linum usitatissimum L. Results Specific primers were designed in order to quantify the expression levels of 20 different potential housekeeping genes in flax roots, internal- and external-stem tissues, leaves and flowers at different developmental stages. After calculations of PCR efficiencies, 13 HKGs were retained and their expression stabilities evaluated by the computer algorithms geNorm and NormFinder. According to geNorm, 2 Transcriptional Elongation Factors (TEFs and 1 Ubiquitin gene are necessary for normalizing gene expression when all studied samples are considered. However, only 2 TEFs are required for normalizing expression in stem tissues. In contrast, NormFinder identified glyceraldehyde-3-phosphate dehydrogenase (GADPH as the most stably expressed gene when all samples were grouped together, as well as when samples were classed into different sub-groups. qRT-PCR was then used to investigate the relative expression levels of two splice variants of the flax LuMYB1 gene (homologue of AtMYB59. LuMYB1-1 and LuMYB1-2 were highly expressed in the internal stem tissues as compared to outer stem tissues and other samples. This result was confirmed with both ge
Huis, Rudy; Hawkins, Simon; Neutelings, Godfrey
2010-04-19
Quantitative real-time PCR (qRT-PCR) is currently the most accurate method for detecting differential gene expression. Such an approach depends on the identification of uniformly expressed 'housekeeping genes' (HKGs). Extensive transcriptomic data mining and experimental validation in different model plants have shown that the reliability of these endogenous controls can be influenced by the plant species, growth conditions and organs/tissues examined. It is therefore important to identify the best reference genes to use in each biological system before using qRT-PCR to investigate differential gene expression. In this paper we evaluate different candidate HKGs for developmental transcriptomic studies in the economically-important flax fiber- and oil-crop (Linum usitatissimum L). Specific primers were designed in order to quantify the expression levels of 20 different potential housekeeping genes in flax roots, internal- and external-stem tissues, leaves and flowers at different developmental stages. After calculations of PCR efficiencies, 13 HKGs were retained and their expression stabilities evaluated by the computer algorithms geNorm and NormFinder. According to geNorm, 2 Transcriptional Elongation Factors (TEFs) and 1 Ubiquitin gene are necessary for normalizing gene expression when all studied samples are considered. However, only 2 TEFs are required for normalizing expression in stem tissues. In contrast, NormFinder identified glyceraldehyde-3-phosphate dehydrogenase (GADPH) as the most stably expressed gene when all samples were grouped together, as well as when samples were classed into different sub-groups.qRT-PCR was then used to investigate the relative expression levels of two splice variants of the flax LuMYB1 gene (homologue of AtMYB59). LuMYB1-1 and LuMYB1-2 were highly expressed in the internal stem tissues as compared to outer stem tissues and other samples. This result was confirmed with both geNorm-designated- and Norm
Evaluating Functional Annotations of Enzymes Using the Gene Ontology.
Holliday, Gemma L; Davidson, Rebecca; Akiva, Eyal; Babbitt, Patricia C
2017-01-01
The Gene Ontology (GO) (Ashburner et al., Nat Genet 25(1):25-29, 2000) is a powerful tool in the informatics arsenal of methods for evaluating annotations in a protein dataset. From identifying the nearest well annotated homologue of a protein of interest to predicting where misannotation has occurred to knowing how confident you can be in the annotations assigned to those proteins is critical. In this chapter we explore what makes an enzyme unique and how we can use GO to infer aspects of protein function based on sequence similarity. These can range from identification of misannotation or other errors in a predicted function to accurate function prediction for an enzyme of entirely unknown function. Although GO annotation applies to any gene products, we focus here a describing our approach for hierarchical classification of enzymes in the Structure-Function Linkage Database (SFLD) (Akiva et al., Nucleic Acids Res 42(Database issue):D521-530, 2014) as a guide for informed utilisation of annotation transfer based on GO terms.
Górnaś, Paweł
2015-04-01
The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.
Treating Duchenne Cardiomyopathy in the Mouse Model by Gene Repair
2017-08-01
Photoregulated Gene Expression for Spatiotemporal Control of Morphogenesis Time Commitments: 0 Supporting Agency: NSF Career Award, CBET-1151035...vector toolkit for human gene therapy. Mol Ther 2006, 14:316-327. 20. Gao G, Vandenberghe LH, Wilson JM: New recombinant serotypes of AAV vectors. Curr
Chloroplast two-component systems: evolution of the link between photosynthesis and gene expression.
Puthiyaveetil, Sujith; Allen, John F
2009-06-22
Two-component signal transduction, consisting of sensor kinases and response regulators, is the predominant signalling mechanism in bacteria. This signalling system originated in prokaryotes and has spread throughout the eukaryotic domain of life through endosymbiotic, lateral gene transfer from the bacterial ancestors and early evolutionary precursors of eukaryotic, cytoplasmic, bioenergetic organelles-chloroplasts and mitochondria. Until recently, it was thought that two-component systems inherited from an ancestral cyanobacterial symbiont are no longer present in chloroplasts. Recent research now shows that two-component systems have survived in chloroplasts as products of both chloroplast and nuclear genes. Comparative genomic analysis of photosynthetic eukaryotes shows a lineage-specific distribution of chloroplast two-component systems. The components and the systems they comprise have homologues in extant cyanobacterial lineages, indicating their ancient cyanobacterial origin. Sequence and functional characteristics of chloroplast two-component systems point to their fundamental role in linking photosynthesis with gene expression. We propose that two-component systems provide a coupling between photosynthesis and gene expression that serves to retain genes in chloroplasts, thus providing the basis of cytoplasmic, non-Mendelian inheritance of plastid-associated characters. We discuss the role of this coupling in the chronobiology of cells and in the dialogue between nuclear and cytoplasmic genetic systems.
Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.
Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang
2012-04-01
Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress
Cold stress decreases the capacity for respiratory NADH oxidation in potato leaves
DEFF Research Database (Denmark)
Svensson, Å.S.; Johansson, F.I.; Møller, I.M.
2002-01-01
is 10% of the original level. This decrease is accompanied by specific decreases of immunodetected NDA protein and internal rotenone-insensitive NADH oxidation in mitochondria isolated from cold-treated plants. The alternative oxidase is not cold-induced neither at the protein nor at the activity level......Cold stress effects on the expression of genes for respiratory chain enzymes were investigated in potato (Solarium tuberosum L., cv. Desiree) leaves. The nda1 and ndb1 genes, homologues to genes encoding the non-proton-pumping respiratory chain NADH dehydrogenases of Escherichia coli and yeast......, were compared to genes encoding catalytic subunits of the proton-pumping NADH dehydrogenase (complex I). Using a real-time PCR system, we demonstrate a specific and gradual decrease of the NDA1 transcript after exposing the plants to 5 C. After 6 days of cold treatment the NDA1 transcript abundance...
Auxins upregulate nif and fix genes.
Bianco, Carmen; Defez, Roberto
2010-10-01
In a recent publication we analyzed the global effects triggered by IAA overproduction in S. meliloti RD64 under free-living conditions by comparing the gene expression pattern of wild type 1021 with that of RD64 and 1021 treated with IAA and other four chemically or functionally related molecules. Among the genes differentially expressed in RD64 and IAA-treated 1021 cells we found two genes of pho operon, phoT and phoC. Based on this finding we examined the mechanisms for mineral P solubilization in RD64 and the potential ability of this strain to improve Medicago growth under P-starved conditions. Here, we further analyze the expression profiles obtained in microarray analysis and evaluate the specificity and the extent of overlap between all treatments. Venn diagrams indicated that IAA- and 2,4-D-regulated genes were closely related. Furthermore, most differentially expressed genes from pSymA were induced in 1021 cells treated with 2,4-D, ICA, IND and Trp as compared to the untreated 1021 cells. RT-PCR analysis was employed to analyze the differential expression patterns of nitrogen fixation genes under free-living and symbiotic conditions. Under symbiotic condition, the relative expression levels of nif and fix genes were significantly induced in Mt- RD64 plants and in Mt-1021 plants treated with IAA and 2,4-D whereas they were unchanged or repressed in Mt-1021 plants treated with the other selected compounds when compared to the untreated Mt-1021 plants. © 2010 Landes Bioscience
Transcription profiling and identification of infection-related genes in Phytophthora cactorum.
Chen, Xiao-Ren; Huang, Shen-Xin; Zhang, Ye; Sheng, Gui-Lin; Zhang, Bo-Yue; Li, Qi-Yuan; Zhu, Feng; Xu, Jing-You
2018-04-01
Phytophthora cactorum, an oomycete pathogen, infects more than 200 plant species within several plant families. To gain insight into the repertoire of the infection-related genes of P. cactorum, Illumina RNA-Seq was used to perform a global transcriptome analysis of three life cycle stages of the pathogen, mycelia (MY), zoospores (ZO) and germinating cysts with germ tubes (GC). From over 9.8 million Illumina reads for each library, 18,402, 18,569 and 19,443 distinct genes were identified for MY, ZO and GC libraries, respectively. Furthermore, the transcriptome difference among MY, ZO and GC stages was investigated. Gene ontology (GO) and KEGG pathway enrichment analyses revealed diverse biological functions and processes. Comparative analysis identified a large number of genes that are associated with specific stages and pathogenicity, including 166 effector genes. Of them, most of RXLR and NLP genes showed induction while the majority of CRN genes were down-regulated in GC, the important pre-infection stage, compared to either MY or ZO. And 14 genes encoding small cysteine-rich (SCR) secretory proteins showed differential expression during the developmental stages and in planta. Ectopic expression in the Solanaceae indicated that SCR113 and one elicitin PcINF1 can trigger cell death on Nicotiana benthamiana, tobacco (N. tabacum) and tomato (Solanum lycopersicum) leaves. Neither conserved domain nor homologues of SCR113 in other organisms can be identified. Collectively, our study provides a comprehensive examination of gene expression across three P. cactorum developmental stages and describes pathogenicity-related genes, all of which will help elucidate the pathogenicity mechanism of this destructive pathogen.
TaSYP71, a Qc-SNARE, Contributes to Wheat Resistance against Puccinia striiformis f. sp. tritici
Directory of Open Access Journals (Sweden)
Minjie eLiu
2016-04-01
Full Text Available N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs are involved in plant resistance; however, the role of SYP71 in the regulation of plant–pathogen interactions is not well known. In this study, we characterized a plant-specific SNARE in wheat, TaSYP71, which contains a Qc-SNARE domain. Three homologues are localized on chromosome 1AL, 1BL and 1DL. Using Agrobacterium-mediated transient expression, TaSYP71 was localized to the plasma membrane in Nicotiana benthamiana. Quantitative real-time PCR assays revealed that TaSYP71 homologues was induced by NaCl, H2O2 stress and infection by virulent and avirulent Puccinia striiformis f. sp. tritici (Pst isolates. Heterologous expression of TaSYP71 in Schizosaccharomyces pombe elevated tolerance to H2O2. Meanwhile, H2O2 scavenging gene (TaCAT was downregulated in TaSYP71 silenced plants treated by H2O2 compared to that in control, which indicated that TaSYP71 enhanced tolerance to H2O2 stress possibly by influencing the expression of TaCAT to remove the excessive H2O2 accumulation. When TaSYP71 homologues were all silenced in wheat by the virus-induced gene silencing system, wheat plants were more susceptible to Pst, with larger infection area and more haustoria number, but the necrotic area of wheat mesophyll cells were larger, one possible explanation that minor contribution of resistance to Pst was insufficient to hinder pathogen extension when TaSYP71were silenced, and the necrotic area was enlarged accompanied with the pathogen growth. Of course, later cell death could not be excluded. In addition, the expression of pathogenesis-related genes were down-regulated in TaSYP71 silenced wheat plants. These results together suggest that TaSYP71 play a positive role in wheat defence against Pst.
Characterization of class II alpha genes and DLA-D region allelic associations in the dog.
Sarmiento, U M; Storb, R F
1988-10-01
Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the alpha genes of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (BamHI, EcoRI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I and Bgl II), separated by agarose gel electrophoresis and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabelled HLA cDNA probes corresponding to DQ, DP, DZ and DR alpha genes. Clear evidence was obtained for the canine homologues of DQ and DR alpha genes with simple bi- or tri-allelic polymorphism respectively. Evidence for a single, nonpolymorphic DP alpha gene was also obtained. However, the presence of a DZ alpha gene could not be clearly demonstrated in canine genomic DNA. This report extends our previous RFLP analysis documenting polymorphism of DLA class II beta genes in the same panel of homozygous typing cell dogs, and provides the basis for DLA-D genotyping at a population level. This study also characterizes the RFLP-defined preferential allelic associations across the DLA-D region in nine different homozygous typing cell specificities.
Fan, Lavender Yuen-Nam; Saavedra-García, Paula; Lam, Eric Wing-Fai
2017-04-01
The data presented in this article are related to the review article entitled 'Unravelling the role of fatty acid metabolism in cancer through the FOXO3-FOXM1 axis' (Saavedra-Garcia et al., 2017) [24]. Here, we have matched the DAF-16/FOXO3 downstream genes with their respective human orthologues and reviewed the roles of these targeted genes in FA metabolism. The list of genes listed in this article are precisely selected from literature reviews based on their functions in mammalian FA metabolism. The nematode Caenorhabditis elegans gene orthologues of the genes are obtained from WormBase, the online biological database of C. elegans. This dataset has not been uploaded to a public repository yet.
Roke, Y.; Harten, P.N. van; Franke, B.; Galesloot, T.E.; Boot, A.M.; Buitelaar, J.K.
2013-01-01
OBJECTIVE: To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders. METHODS:
Roke, Yvette; van Harten, Peter N.; Franke, Barbara; Galesloot, Tessel E.; Boot, Annemieke M.; Buitelaar, Jan K.
Objective To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders.Methods
LPS-induced genes in intestinal tissue of the sea cucumber Holothuria glaberrima.
Directory of Open Access Journals (Sweden)
Francisco Ramírez-Gómez
2009-07-01
Full Text Available Metazoan immunity is mainly associated with specialized cells that are directly involved with the immune response. Nevertheless, both in vertebrates and invertebrates other organs might respond to immune activation and participate either directly or indirectly in the ongoing immune process. However, most of what is known about invertebrate immunity has been restricted to immune effector cells and little information is available on the immune responses of other tissues or organs. We now focus on the immune reactions of the intestinal tissue of an echinoderm. Our study employs a non-conventional model, the echinoderm Holothuria glaberrima, to identify intestinal molecules expressed after an immune challenge presented by an intra-coelomic injection of lipopolysaccharides (LPS. The expression profiles of intestinal genes expressed differentially between LPS-injected animals and control sea water-injected animals were determined using a custom-made Agilent microarray with 7209 sea cucumber intestinal ESTs. Fifty (50 unique sequences were found to be differentially expressed in the intestine of LPS-treated sea cucumbers. Seven (7 of these sequences represented homologues of known proteins, while the remaining (43 had no significant similarity with any protein, EST or RNA database. The known sequences corresponded to cytoskeletal proteins (Actin and alpha-actinin, metabolic enzymes (GAPDH, Ahcy and Gnmt, metal ion transport/metabolism (major yolk protein and defense/recognition (fibrinogen-like protein. The expression pattern of 11 genes was validated using semi-quantitative RT-PCR. Nine of these corroborated the microarray results and the remaining two showed a similar trend but without statistical significance. Our results show some of the molecular events by which the holothurian intestine responds to an immune challenge and provide important information to the study of the evolution of the immune response.
A polymerase chain reaction-based methodology to detect gene doping.
Carter, Adam; Flueck, Martin
2012-04-01
The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.
Directory of Open Access Journals (Sweden)
Younossi Zobair M
2012-02-01
Full Text Available Abstract Background Recent studies of CH-C patients have demonstrated a strong association between IL28B CC genotype and sustained virologic response (SVR after PEG-IFN/RBV treatment. We aimed to assess whether IL28B alleles rs12979860 genotype influences gene expression in response to PEG-IFN/RBV in CH-C patients. Methods Clinical data and gene expression data were available for 56 patients treated with PEG-IFN/RBV. Whole blood was used to determine IL28B genotypes. Differential expression of 153 human genes was assessed for each treatment time point (Days: 0, 1, 7, 28, 56 and was correlated with IL28B genotype (IL28B C/C or non-C/C over the course of the PEG-IFN/RBV treatment. Genes with statistically significant changes in their expression at each time point were used as an input for pathway analysis using KEGG Pathway Painter (KPP. Pathways were ranked based on number of gene involved separately per each study cohort. Results The most striking difference between the response patterns of patients with IL28B C/C and T* genotypes during treatment, across all pathways, is a sustained pattern of treatment-induced gene expression in patients carrying IL28B C/C. In the case of IL28B T* genotype, pre-activation of genes, the lack of sustained pattern of gene expression or a combination of both were observed. This observation could potentially provide an explanation for the lower rate of SVR observed in these patients. Additionally, when the lists of IL28B genotype-specific genes which were differentially expressed in patients without SVR were compared at their baseline, IRF2 and SOCS1 genes were down-regulated regardless of patients' IL28B genotype. Furthermore, our data suggest that CH-C patients who do not have the SOCS1 gene silenced have a better chance of achieving SVR. Our observations suggest that the action of SOCS1 is independent of IL28B genotype. Conclusions IL28B CC genotype patients with CH-C show a sustained treatment-induced gene
Younossi, Zobair M; Birerdinc, Aybike; Estep, Mike; Stepanova, Maria; Afendy, Arian; Baranova, Ancha
2012-02-07
Recent studies of CH-C patients have demonstrated a strong association between IL28B CC genotype and sustained virologic response (SVR) after PEG-IFN/RBV treatment. We aimed to assess whether IL28B alleles rs12979860 genotype influences gene expression in response to PEG-IFN/RBV in CH-C patients. Clinical data and gene expression data were available for 56 patients treated with PEG-IFN/RBV. Whole blood was used to determine IL28B genotypes. Differential expression of 153 human genes was assessed for each treatment time point (Days: 0, 1, 7, 28, 56) and was correlated with IL28B genotype (IL28B C/C or non-C/C) over the course of the PEG-IFN/RBV treatment. Genes with statistically significant changes in their expression at each time point were used as an input for pathway analysis using KEGG Pathway Painter (KPP). Pathways were ranked based on number of gene involved separately per each study cohort. The most striking difference between the response patterns of patients with IL28B C/C and T* genotypes during treatment, across all pathways, is a sustained pattern of treatment-induced gene expression in patients carrying IL28B C/C. In the case of IL28B T* genotype, pre-activation of genes, the lack of sustained pattern of gene expression or a combination of both were observed. This observation could potentially provide an explanation for the lower rate of SVR observed in these patients. Additionally, when the lists of IL28B genotype-specific genes which were differentially expressed in patients without SVR were compared at their baseline, IRF2 and SOCS1 genes were down-regulated regardless of patients' IL28B genotype. Furthermore, our data suggest that CH-C patients who do not have the SOCS1 gene silenced have a better chance of achieving SVR. Our observations suggest that the action of SOCS1 is independent of IL28B genotype. IL28B CC genotype patients with CH-C show a sustained treatment-induced gene expression profile which is not seen in non-CC genotype patients
Hyper-radiation sensitivity of murine scid mutation and mapping of the human homologue HYRC1 gene
International Nuclear Information System (INIS)
Komatsu, Kenshi; Ohta, Tohru; Niikawa, Norio; Okumura, Yutaka; Kubota, Nobuo.
1994-01-01
The murine severe combined immunodeficient mutation (scid) is characterized by a lack of both B and T cells, due to a defect in lymphoid variable-(diversity)-joining(V(D)J) rearrangement. Scid cells are highly sensitive to both radiation-induced killing and chromosomal aberrations. Present experiments also demonstrated the high sensitivity of scid cells to killing, because of a deficient repair of double strand breaks(DSB). Scid cells can repair only 60% of radiation-induced DSB for 3 hours, while normal cells repair 85% of the DSB. Significantly reduced Do and n values were obtained from survival curves of scid cells and were similar to ataxia-telangiectasia(AT) cells (a unique human disease conferring whole body radiosensitivity). However, the kinetics of DNA synthesis after irradiation were different between the two cell types. In contrast with the radioresistant DNA synthesis of AT cells, DNA synthesis of scid cells was markedly inhibited after irradiation. The existence of different mutations was also supported by evidence of complementation in somatic cell hybrids between scid cells and AT cells. Using these hybrid cells, fragments of human chromosome 8 were introduced into scid cells HPRT mutant via X-irradiation and somatic cell fusion. The resulting hybrid clones contained human DNA fragment(s) which complemented the hyper-radiosensitivity of the scid cells. Alu-PCR products from these hybrids were used for chromosome painting using the technique of chromosome in situ suppression hybridization, allowing assignment of the human HYRC1 (hyper-radiosensitivity of murine scid mutation, complementing 1) gene, a candidate for a V(D)J recombinant gene, to human chromosome 8q11. (author)
Directory of Open Access Journals (Sweden)
Lavender Yuen-Nam Fan
2017-04-01
Full Text Available The data presented in this article are related to the review article entitled ‘Unravelling the role of fatty acid metabolism in cancer through the FOXO3-FOXM1 axis’ (Saavedra-Garcia et al., 2017 [24]. Here, we have matched the DAF-16/FOXO3 downstream genes with their respective human orthologues and reviewed the roles of these targeted genes in FA metabolism. The list of genes listed in this article are precisely selected from literature reviews based on their functions in mammalian FA metabolism. The nematode Caenorhabditis elegans gene orthologues of the genes are obtained from WormBase, the online biological database of C. elegans. This dataset has not been uploaded to a public repository yet.
International Nuclear Information System (INIS)
Goodfellow, P.J.; Mondello, C.; Darling, S.M.; Pym, B.; Little, P.; Goodfellow, P.N.
1988-01-01
The authors have identified and characterized a Hpa II tiny fragment (HTF) island associated with the promoter region of the pseudoautosomal gene MIC2. The MIC2 HTF island is unmethylated on both the active and inactive X chromosome and is similarly unmethylated on the Y chromosome. Unlike the majority of genes borne on the X chromosome, MIC2 fails to undergo X chromosome inactivation. HTF islands associated with X chromosome-liked genes that are inactivated are highly methylated on the inactive or transcriptionally silent homologue. The failure of MIC2 to undergo X chromosome inactivation correlates with the lack of methylation of HTF island at the 5' end of the gene. These results provide further evidence that DNA methylation plays an important role in the phenomenon of X chromosome inactivation
Molecular fingerprinting of TGFbeta-treated embryonic maxillary mesenchymal cells.
Pisano, M M; Mukhopadhyay, P; Greene, R M
2003-11-01
The transforming growth factor-beta (TGF(beta)) family represents a class of signaling molecules that plays a central role in normal embryonic development, specifically in development of the craniofacial region. Members of this family are vital to development of the secondary palate where they regulate maxillary and palate mesenchymal cell proliferation and extracellular matrix synthesis. The function of this growth factor family is particularly critical in that perturbation of either process results in a cleft of the palate. While the cellular and phenotypic effects of TGF(beta) on embryonic craniofacial tissue have been extensively cataloged, the specific genes that function as downstream mediators of TGF(beta) in maxillary/palatal development are poorly defined. Gene expression arrays offer the ability to conduct a rapid, simultaneous assessment of hundreds to thousands of differentially expressed genes in a single study. Inasmuch as the downstream sequelae of TGF(beta) action are only partially defined, a complementary DNA (cDNA) expression array technology (Clontech's Atlas Mouse cDNA Expression Arrays), was utilized to delineate a profile of differentially expressed genes from TGF(beta)-treated primary cultures of murine embryonic maxillary mesenchymal cells. Hybridization of a membrane-based cDNA array (1178 genes) was performed with 32P-labeled cDNA probes synthesized from RNA isolated from either TGF(beta)-treated or vehicle-treated embryonic maxillary mesenchymal cells. Resultant phosphorimages were subject to AtlasImage analysis in order to determine differences in gene expression between control and TGF(beta)-treated maxillary mesenchymal cells. Of the 1178 arrayed genes, 552 (47%) demonstrated detectable levels of expression. Steady state levels of 22 genes were up-regulated, while those of 8 other genes were down-regulated, by a factor of twofold or greater in response to TGF(beta). Affected genes could be grouped into three general functional
Energy Technology Data Exchange (ETDEWEB)
Lyu, Kai; Zhu, Xuexia; Chen, Rui [Jiangsu Key Laboratory for Biodiversity and Biotechnology, School of Biological Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210023 (China); Chen, Yafen [State Key Laboratory for Lake Science and Environment, Nanjing Institute of Geography and Limnology, the Chinese Academy of Sciences, Nanjing 210008 (China); Yang, Zhou, E-mail: yangzhou@njnu.edu.cn [Jiangsu Key Laboratory for Biodiversity and Biotechnology, School of Biological Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210023 (China)
2014-03-01
Graphical abstract: - Highlights: • Daphnia magna MnSOD (Dm-MnSOD) was identified and revealed MnSOD-family features. • The expression of Dm-MnSOD decreased with increased developmental stages. • Dm-MnSOD transcript was kinetically up-regulated by microcystin, nitrite and Cd. • Response of SOD to ubiquitous waterborne pollutants in D. magna was elucidated. • Dm-MnSOD gene is a potential biomarker indicating pollutants in the environment. - Abstract: Superoxide dismutases (SODs) are metalloenzymes that represent one important line of defense against oxidative stress produced by reactive oxygen species in aerobic organisms. Generally, waterborne pollutants caused by irregular anthropogenic activities often result in oxidative damage in aquatic organisms. The aim of this study was to molecularly characterize the manganese superoxide dismutase gene (Dm-MnSOD) in the waterflea, Daphnia magna, and evaluate the mRNA expression patterns quantified by real-time PCR after exposure to three common waterborne pollutants (microcystin-LR, nitrite, and cadmium). The results showed that the full-length Dm-MnSOD sequence consists of 954 bp nucleotides, encoding 215 amino acids, showing well-conserved domains that are required for metal binding and several common characteristics, such as two MnSOD domains. The deduced amino acid sequence of Dm-MnSOD shared over 70% similarity with homologues from Bythograea thermydron, Dromia personata, Cancer pagurus, and Scylla paramamosain. Dm-MnSOD gene expression was up-regulated in response to exposure to the three chemicals tested. The overall results indicated that Dm-MnSOD gene is an inducible gene and potential biomarker indicating these pollutants in the environment.
Patel, Chirag; Cooper-Charles, Lisa; McMullan, Dominic J; Walker, Judith M; Davison, Val; Morton, Jenny
2011-06-01
Gilles de la Tourette syndrome is a complex neuropsychiatric disorder with a strong genetic basis. We identified a male patient with Tourette syndrome-like tics and an apparently balanced de novo translocation [46,XY,t(2;7)(p24.2;q31)]. Further analysis using array comparative genomic hybridisation (CGH) revealed a cryptic deletion at 7q31.1-7q31.2. Breakpoints disrupting this region have been reported in one isolated and one familial case of Tourette syndrome. In our case, IMMP2L, a gene coding for a human homologue of the yeast inner mitochondrial membrane peptidase subunit 2, was disrupted by the breakpoint on 7q31.1, with deletion of exons 1-3 of the gene. The IMMP2L gene has previously been proposed as a candidate gene for Tourette syndrome, and our case provides further evidence of its possible role in the pathogenesis. The deleted region (7q31.1-7q31.2) of 7.2 Mb of genomic DNA also encompasses numerous genes, including FOXP2, associated with verbal dyspraxia, and the CFTR gene.
Muller, L A H; Craciun, A R; Ruytinx, J; Lambaerts, M; Verbruggen, N; Vangronsveld, J; Colpaert, J V
2007-10-01
Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in different classes of expression pattern, were isolated and sequenced. Thirty-six of the represented genes showed homology to function-known genes, whereas 6 matched unknown protein coding sequences, and 102 were possibly novel. Although relatively few TDFs were found to be responsive to the different zinc treatments, their modulated expression levels may suggest a different transcriptional response to zinc treatments in both isolates. Among the identified genes that could be related to heavy-metal detoxification or the tolerance trait were genes encoding for homologues of a heat-shock protein, a putative metal transporter, a hydrophobin, and several proteins involved in ubiquitin-dependent proteolysis.
Fustiñana, Maria Sol; Ariel, Pablo; Federman, Noel; Freudenthal, Ramiro; Romano, Arturo
2010-09-01
Human β-amyloid, the main component in the neuritic plaques found in patients with Alzheimer's disease, is generated by cleavage of the β-amyloid precursor protein. Beyond the role in pathology, members of this protein family are synaptic proteins and have been associated with synaptogenesis, neuronal plasticity and memory, both in vertebrates and in invertebrates. Consolidation is necessary to convert a short-term labile memory to a long-term and stable form. During consolidation, gene expression and de novo protein synthesis are regulated in order to produce key proteins for the maintenance of plastic changes produced during the acquisition of new information. Here we partially cloned and sequenced the beta-amyloid precursor protein like gene homologue in the crab Chasmagnathus (cappl), showing a 37% of identity with the fruit fly Drosophila melanogaster homologue and 23% with Homo sapiens but with much higher degree of sequence similarity in certain regions. We observed a wide distribution of cappl mRNA in the nervous system as well as in muscle and gills. The protein localized in all tissues analyzed with the exception of muscle. Immunofluorescence revealed localization of cAPPL in associative and sensory brain areas. We studied gene and protein expression during long-term memory consolidation using a well characterized memory model: the context-signal associative memory in this crab species. mRNA levels varied at different time points during long-term memory consolidation and correlated with cAPPL protein levels cAPPL mRNA and protein is widely distributed in the central nervous system of the crab and the time course of expression suggests a role of cAPPL during long-term memory formation.
Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A
2010-01-01
The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.
Early phenylpropanoid biosynthetic steps in Cannabis sativa: link between genes and metabolites.
Docimo, Teresa; Consonni, Roberto; Coraggio, Immacolata; Mattana, Monica
2013-06-28
Phenylalanine ammonia-lyase (PAL), Cinnamic acid 4-hydroxylase (C4H) and 4-Coumarate: CoA ligase (4CL) catalyze the first three steps of the general phenylpropanoid pathway whereas chalcone synthase (CHS) catalyzes the first specific step towards flavonoids production. This class of specialized metabolites has a wide range of biological functions in plant development and defence and a broad spectrum of therapeutic activities for human health. In this study, we report the isolation of hemp PAL and 4CL cDNA and genomic clones. Through in silico analysis of their deduced amino acid sequences, more than an 80% identity with homologues genes of other plants was shown and phylogenetic relationships were highlighted. Quantitative expression analysis of the four above mentioned genes, PAL and 4CL enzymatic activities, lignin content and NMR metabolite fingerprinting in different Cannabis sativa tissues were evaluated. Furthermore, the use of different substrates to assay PAL and 4CL enzymatic activities indicated that different isoforms were active in different tissues. The diversity in secondary metabolites content observed in leaves (mainly flavonoids) and roots (mainly lignin) was discussed in relation to gene expression and enzymatic activities data.
Early Phenylpropanoid Biosynthetic Steps in Cannabis sativa: Link between Genes and Metabolites
Directory of Open Access Journals (Sweden)
Immacolata Coraggio
2013-06-01
Full Text Available Phenylalanine ammonia-lyase (PAL, Cinnamic acid 4-hydroxylase (C4H and 4-Coumarate: CoA ligase (4CL catalyze the first three steps of the general phenylpropanoid pathway whereas chalcone synthase (CHS catalyzes the first specific step towards flavonoids production. This class of specialized metabolites has a wide range of biological functions in plant development and defence and a broad spectrum of therapeutic activities for human health. In this study, we report the isolation of hemp PAL and 4CL cDNA and genomic clones. Through in silico analysis of their deduced amino acid sequences, more than an 80% identity with homologues genes of other plants was shown and phylogenetic relationships were highlighted. Quantitative expression analysis of the four above mentioned genes, PAL and 4CL enzymatic activities, lignin content and NMR metabolite fingerprinting in different Cannabis sativa tissues were evaluated. Furthermore, the use of different substrates to assay PAL and 4CL enzymatic activities indicated that different isoforms were active in different tissues. The diversity in secondary metabolites content observed in leaves (mainly flavonoids and roots (mainly lignin was discussed in relation to gene expression and enzymatic activities data.
Twenty Years of European Union Support to Gene Therapy and Gene Transfer.
Gancberg, David
2017-11-01
For 20 years and throughout its research programmes, the European Union has supported the entire innovation chain for gene transfer and gene therapy. The fruits of this investment are ripening as gene therapy products are reaching the European market and as clinical trials are demonstrating the safety of this approach to treat previously untreatable diseases.
Ueshima, Junichi; Shoji, Mikio; Ratnayake, Dinath B; Abe, Kihachiro; Yoshida, Shinichi; Yamamoto, Kenji; Nakayama, Koji
2003-03-01
The periodontopathogen Porphyromonas gingivalis is an obligate anaerobe that is devoid of catalase but exhibits a relatively high degree of resistance to peroxide stress. In the present study, we demonstrate that P. gingivalis contains a Dps homologue that plays an important role in the protection of cells from peroxide stress. The Dps protein isolated from P. gingivalis displayed a ferritin-like spherical polymer consisting of 19-kDa subunits. Molecular cloning and sequencing of the gene encoding this protein revealed that it had a high similarity in nucleotide and amino acid sequences to Dps proteins from other species. The expression of Dps was significantly increased by exposure of P. gingivalis to atmospheric oxygen in an OxyR-dependent manner, indicating that it is regulated by the reactive oxygen species-regulating gene oxyR. The Dps-deficient mutants, including the dps single mutant and the ftn dps double mutant, showed no viability loss upon exposure to atmospheric oxygen for 6 h. In contrast to the wild type, however, these mutants exhibited the high susceptibility to hydrogen peroxide, thereby disrupting the viability. On the other hand, no significant difference in sensitivity to mitomycin C and metronidazole was observed between the wild type and the mutants. Furthermore, the dps single mutant, compared with the wild type, showed a lower viability in infected human umbilical vein endothelial cells.
International Nuclear Information System (INIS)
Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.
2009-01-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family
Energy Technology Data Exchange (ETDEWEB)
Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)
2009-10-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.
Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J
2005-08-01
The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.
Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M
2018-03-01
Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so
Kannan, Lavanya; Li, Hua; Rubinstein, Boris; Mushegian, Arcady
2013-12-19
The problem of probabilistic inference of gene content in the last common ancestor of several extant species with completely sequenced genomes is: for each gene that is conserved in all or some of the genomes, assign the probability that its ancestral gene was present in the genome of their last common ancestor. We have developed a family of models of gene gain and gene loss in evolution, and applied the maximum-likelihood approach that uses phylogenetic tree of prokaryotes and the record of orthologous relationships between their genes to infer the gene content of LUCA, the Last Universal Common Ancestor of all currently living cellular organisms. The crucial parameter, the ratio of gene losses and gene gains, was estimated from the data and was higher in models that take account of the number of in-paralogs in genomes than in models that treat gene presences and absences as a binary trait. While the numbers of genes that are placed confidently into LUCA are similar in the ML methods and in previously published methods that use various parsimony-based approaches, the identities of genes themselves are different. Most of the models of either kind treat the genes found in many existing genomes in a similar way, assigning to them high probabilities of being ancestral ("high ancestrality"). The ML models are more likely than others to assign high ancestrality to the genes that are relatively rare in the present-day genomes.
Altered Gene Transcription in Human Cells Treated with Ludox® Silica Nanoparticles
Directory of Open Access Journals (Sweden)
Caterina Fede
2014-08-01
Full Text Available Silica (SiO2 nanoparticles (NPs have found extensive applications in industrial manufacturing, biomedical and biotechnological fields. Therefore, the increasing exposure to such ultrafine particles requires studies to characterize their potential cytotoxic effects in order to provide exhaustive information to assess the impact of nanomaterials on human health. The understanding of the biological processes involved in the development and maintenance of a variety of pathologies is improved by genome-wide approaches, and in this context, gene set analysis has emerged as a fundamental tool for the interpretation of the results. In this work we show how the use of a combination of gene-by-gene and gene set analyses can enhance the interpretation of results of in vitro treatment of A549 cells with Ludox® colloidal amorphous silica nanoparticles. By gene-by-gene and gene set analyses, we evidenced a specific cell response in relation to NPs size and elapsed time after treatment, with the smaller NPs (SM30 having higher impact on inflammatory and apoptosis processes than the bigger ones. Apoptotic process appeared to be activated by the up-regulation of the initiator genes TNFa and IL1b and by ATM. Moreover, our analyses evidenced that cell treatment with LudoxÒ silica nanoparticles activated the matrix metalloproteinase genes MMP1, MMP10 and MMP9. The information derived from this study can be informative about the cytotoxicity of Ludox® and other similar colloidal amorphous silica NPs prepared by solution processes.
Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis
Energy Technology Data Exchange (ETDEWEB)
Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)
2008-02-01
The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.
Vaginal Gene Expression During Treatment With Aromatase Inhibitors.
Kallak, Theodora Kunovac; Baumgart, Juliane; Nilsson, Kerstin; Åkerud, Helena; Poromaa, Inger Sundström; Stavreus-Evers, Anneli
2015-12-01
Aromatase inhibitor (AI) treatment suppresses estrogen biosynthesis and causes genitourinary symptoms of menopause such as vaginal symptoms, ultimately affecting the quality of life for many postmenopausal women with breast cancer. Thus, the aim of this study was to examine vaginal gene expression in women during treatment with AIs compared with estrogen-treated women. The secondary aim was to study the presence and localization of vaginal aromatase. Vaginal biopsies were collected from postmenopausal women treated with AIs and from age-matched control women treated with vaginal estrogen therapy. Differential gene expression was studied with the Affymetrix Gene Chip Gene 1.0 ST Array (Affymetrix Inc, Santa Clara, CA) system, Ingenuity pathway analysis, quantitative real-time polymerase chain reaction, and immunohistochemistry. The expression of 279 genes differed between the 2 groups; AI-treated women had low expression of genes involved in cell differentiation, proliferation, and cell adhesion. Some differentially expressed genes were found to interact indirectly with the estrogen receptor alpha. In addition, aromatase protein staining was evident in the basal and the intermediate vaginal epithelium layers, and also in stromal cells with a slightly stronger staining intensity found in AI-treated women. In this study, we demonstrated that genes involved in cell differentiation, proliferation, and cell adhesion are differentially expressed in AI-treated women. The expression of vaginal aromatase suggests that this could be the result of local and systemic inhibition of aromatase. Our results emphasize the role of estrogen for vaginal cell differentiation and proliferation and future drug candidates should be aimed at improving cell differentiation and proliferation. Copyright © 2015 Elsevier Inc. All rights reserved.
Petrusma, Mirjan; Hessels, Gerda; Dijkhuizen, Lubbert; van der Geize, Robert
2011-01-01
The well-known large catabolic potential of rhodococci is greatly facilitated by an impressive gene multiplicity. This study reports on the multiplicity of kshA, encoding the oxygenase component of 3-ketosteroid 9 alpha-hydroxylase, a key enzyme in steroid catabolism. Five kshA homologues (kshA1 to kshA5) were previously identified in Rhodococcus rhodochrous DSM43269. These KshA(DSM43269) homologues are distributed over several phylogenetic groups. The involvement of these KshA homologues in ...
Pharmacotherapeutic approaches for treating psoriasis in difficult-to-treat areas.
Kivelevitch, Dario; Frieder, Jillian; Watson, Ian; Paek, So Yeon; Menter, M Alan
2018-04-01
Despite great therapeutic advancements in psoriasis, four notable difficult-to-treat areas including the scalp, nails, intertriginous (including genitals), and palmoplantar regions, pose a challenge to both physicians and patients. Localized disease of these specific body regions inflicts a significant burden on patients' quality of life and requires an adequate selection of treatments. Areas covered: This manuscript discusses appropriate therapies and important treatment considerations for these difficult-to-treat areas based on the available clinical data from the literature. Expert opinion: Clinical trials assessing therapies for the difficult-to-treat areas have been inadequate. With the first biological clinical trial for genital psoriasis pending publication, it is with hope that other biological agents will be evaluated for region-specific psoriasis. A greater understanding of the genetic and immunologic aspects of regional psoriasis, as well as identification of unique biomarkers, will further guide management decisions. For example, the recent discovery of the IL-36 receptor gene for generalized pustular psoriasis may prove valuable for other forms of psoriasis. Ultimately, identification of the most beneficial treatments for each psoriasis subtype and difficult-to-treat area will provide patients with maximal quality of life.
Liver Gene Expression Profiles of Rats Treated with Clofibric Acid
Michel, Cécile; Desdouets, Chantal; Sacre-Salem, Béatrice; Gautier, Jean-Charles; Roberts, Ruth; Boitier, Eric
2003-01-01
Clofibric acid (CLO) is a peroxisome proliferator (PP) that acts through the peroxisome proliferator activated receptor α, leading to hepatocarcinogenesis in rodents. CLO-induced hepatocarcinogenesis is a multi-step process, first transforming normal liver cells into foci. The combination of laser capture microdissection (LCM) and genomics has the potential to provide expression profiles from such small cell clusters, giving an opportunity to understand the process of cancer development in response to PPs. To our knowledge, this is the first evaluation of the impact of the successive steps of LCM procedure on gene expression profiling by comparing profiles from LCM samples to those obtained with non-microdissected liver samples collected after a 1 month CLO treatment in the rat. We showed that hematoxylin and eosin (H&E) staining and laser microdissection itself do not impact on RNA quality. However, the overall process of the LCM procedure affects the RNA quality, resulting in a bias in the gene profiles. Nonetheless, this bias did not prevent accurate determination of a CLO-specific molecular signature. Thus, gene-profiling analysis of microdissected foci, identified by H&E staining may provide insight into the mechanisms underlying non-genotoxic hepatocarcinogenesis in the rat by allowing identification of specific genes that are regulated by CLO in early pre-neoplastic foci. PMID:14633594
Directory of Open Access Journals (Sweden)
Stanca Michele A
2010-04-01
Full Text Available Abstract Background Epigenetic phenomena have been associated with the regulation of active and silent chromatin states achieved by modifications of chromatin structure through DNA methylation, and histone post-translational modifications. The latter is accomplished, in part, through the action of PcG (Polycomb group protein complexes which methylate nucleosomal histone tails at specific sites, ultimately leading to chromatin compaction and gene silencing. Different PcG complex variants operating during different developmental stages have been described in plants. In particular, the so-called FIE/MEA/FIS2 complex governs the expression of genes important in embryo and endosperm development in Arabidopsis. In our effort to understand the epigenetic mechanisms regulating seed development in barley (Hordeum vulgare, an agronomically important monocot plant cultivated for its endosperm, we set out to characterize the genes encoding barley PcG proteins. Results Four barley PcG gene homologues, named HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were identified and structurally and phylogenetically characterized. The corresponding genes HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were mapped onto barley chromosomes 7H, 4H, 2H and 5H, respectively. Expression analysis of the PcG genes revealed significant differences in gene expression among tissues and seed developmental stages and between barley cultivars with varying seed size. Furthermore, HvFIE and HvE(Z gene expression was responsive to the abiotic stress-related hormone abscisic acid (ABA known to be involved in seed maturation, dormancy and germination. Conclusion This study reports the first characterization of the PcG homologues, HvFIE, HvE(Z, HvSu(z12a and HvSu(z12b in barley. All genes co-localized with known chromosomal regions responsible for malting quality related traits, suggesting that they might be used for developing molecular markers to be applied in marker assisted selection. The Pc
Beyer, U; Krönung, S K; Leha, A; Walter, L; Dobbelstein, M
2016-01-01
The long terminal repeat (LTR) of human endogenous retrovirus type 9 (ERV9) acts as a germline-specific promoter that induces the expression of a proapoptotic isoform of the tumor suppressor homologue p63, GTAp63, in male germline cells. Testicular cancer cells silence this promoter, but inhibitors of histone deacetylases (HDACs) restore GTAp63 expression and give rise to apoptosis. We show here that numerous additional transcripts throughout the genome are driven by related ERV9-LTRs. 3' Rapid amplification of cDNA ends (3'RACE) was combined with next-generation sequencing to establish a large set of such mRNAs. HDAC inhibitors induce these ERV9-LTR-driven genes but not the LTRs from other ERVs. In particular, a transcript encoding the death receptor DR5 originates from an ERV9-LTR inserted upstream of the protein coding regions of the TNFRSF10B gene, and it shows an expression pattern similar to GTAp63. When treating testicular cancer cells with HDAC inhibitors as well as the death ligand TNF-related apoptosis-inducing ligand (TRAIL), rapid cell death was observed, which depended on TNFRSF10B expression. HDAC inhibitors also cooperate with cisplatin (cDDP) to promote apoptosis in testicular cancer cells. ERV9-LTRs not only drive a large set of human transcripts, but a subset of them acts in a proapoptotic manner. We propose that this avoids the survival of damaged germ cells. HDAC inhibition represents a strategy of restoring the expression of a class of ERV9-LTR-mediated genes in testicular cancer cells, thereby re-enabling tumor suppression. PMID:26024393
Pócsi, István; Miskei, Márton; Karányi, Zsolt; Emri, Tamás; Ayoubi, Patricia; Pusztahelyi, Tünde; Balla, György; Prade, Rolf A
2005-01-01
Background In addition to their cytotoxic nature, reactive oxygen species (ROS) are also signal molecules in diverse cellular processes in eukaryotic organisms. Linking genome-wide transcriptional changes to cellular physiology in oxidative stress-exposed Aspergillus nidulans cultures provides the opportunity to estimate the sizes of peroxide (O22-), superoxide (O2•-) and glutathione/glutathione disulphide (GSH/GSSG) redox imbalance responses. Results Genome-wide transcriptional changes triggered by diamide, H2O2 and menadione in A. nidulans vegetative tissues were recorded using DNA microarrays containing 3533 unique PCR-amplified probes. Evaluation of LOESS-normalized data indicated that 2499 gene probes were affected by at least one stress-inducing agent. The stress induced by diamide and H2O2 were pulse-like, with recovery after 1 h exposure time while no recovery was observed with menadione. The distribution of stress-responsive gene probes among major physiological functional categories was approximately the same for each agent. The gene group sizes solely responsive to changes in intracellular O22-, O2•- concentrations or to GSH/GSSG redox imbalance were estimated at 7.7, 32.6 and 13.0 %, respectively. Gene groups responsive to diamide, H2O2 and menadione treatments and gene groups influenced by GSH/GSSG, O22- and O2•- were only partly overlapping with distinct enrichment profiles within functional categories. Changes in the GSH/GSSG redox state influenced expression of genes coding for PBS2 like MAPK kinase homologue, PSK2 kinase homologue, AtfA transcription factor, and many elements of ubiquitin tagging, cell division cycle regulators, translation machinery proteins, defense and stress proteins, transport proteins as well as many enzymes of the primary and secondary metabolisms. Meanwhile, a separate set of genes encoding transport proteins, CpcA and JlbA amino acid starvation-responsive transcription factors, and some elements of sexual development
Directory of Open Access Journals (Sweden)
S. H. Choi
2015-03-01
Full Text Available We previously demonstrated that bovine subcutaneous preadipocytes promote adipogenic gene expression in muscle satellite cells in a co-culture system. Herein we hypothesize that saturated fatty acids would promote adipogenic/lipogenic gene expression, whereas mono- and polyunsaturated fatty acids would have the opposite effect. Bovine semimembranosus satellite cells (BSC and intramuscular preadipocytes (IPA were isolated from crossbred steers and cultured with 10% fetal bovine serum (FBS/Dulbecco’s Modified Eagle Medium (DMEM and 1% antibiotics during the 3-d proliferation period. After proliferation, cells were treated for 3 d with 3% horse serum/DMEM (BSC or 5% FBS/DMEM (IPA with antibiotics. Media also contained 10 μg/mL insulin and 10 μg/mL pioglitazone. Subsequently, differentiating BSC and IPA were cultured in their respective media with 40 μM palmitic, stearic, oleic, or linoleic acid for 4 d. Finally, BSC and IPA were single- or co-cultured for an additional 2 h. All fatty acid treatments increased (p = 0.001 carnitine palmitoyltransferase-1 beta (CPT1β gene expression, but the increase in CPT1β gene expression was especially pronounced in IPA incubated with palmitic and stearic acid (6- to 17- fold increases. Oleic and linoleic acid decreased (p = 0.001 stearoyl-CoA desaturase (SCD gene expression over 80% in both BSC and IPA. Conversely, palmitic and stearic acid increased SCD gene expression three fold in co-cultured in IPA, and stearic acid increased AMPKα gene expression in single- and co-cultured BSC and IPA. Consistent with our hypothesis, saturated fatty acids, especially stearic acid, promoted adipogenic and lipogenic gene expression, whereas unsaturated fatty acids decreased expression of those genes associated with fatty acid metabolism.
2013-01-01
Background The problem of probabilistic inference of gene content in the last common ancestor of several extant species with completely sequenced genomes is: for each gene that is conserved in all or some of the genomes, assign the probability that its ancestral gene was present in the genome of their last common ancestor. Results We have developed a family of models of gene gain and gene loss in evolution, and applied the maximum-likelihood approach that uses phylogenetic tree of prokaryotes and the record of orthologous relationships between their genes to infer the gene content of LUCA, the Last Universal Common Ancestor of all currently living cellular organisms. The crucial parameter, the ratio of gene losses and gene gains, was estimated from the data and was higher in models that take account of the number of in-paralogs in genomes than in models that treat gene presences and absences as a binary trait. Conclusion While the numbers of genes that are placed confidently into LUCA are similar in the ML methods and in previously published methods that use various parsimony-based approaches, the identities of genes themselves are different. Most of the models of either kind treat the genes found in many existing genomes in a similar way, assigning to them high probabilities of being ancestral (“high ancestrality”). The ML models are more likely than others to assign high ancestrality to the genes that are relatively rare in the present-day genomes. Reviewers This article was reviewed by Martijn A Huynen, Toni Gabaldón and Fyodor Kondrashov. PMID:24354654
Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape
Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping
2012-01-01
Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514
Zhu, Ling; Song, Linsheng; Zhang, Huan; Zhao, Jianmin; Li, Chenghua; Xu, Wei
2008-06-01
Apoptosis is an active process of cell death, which is an integral part of growth and development in multicellular organisms. The defender against cell death 1 (DAD1), the regulatory protein to inhibit the apoptosis process, was first cloned from the bay scallop Argopecten irradians by randomly sequencing a whole tissue cDNA library and rapid amplification of cDNA end (RACE). The full-length cDNA of the A. irradians DAD1 was 607 bp, consist of a 5'-terminal untranslated region (UTR) of 63 bp, a 3'-terminal UTR of 205 bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 339 bp. The deduced amino acid sequence of the A. irradians DAD1 showed 75.5% identity to Araneus ventricosus, 74.5% to Drosophila melanogaster, and 73.6% to Homo sapiens, Sus scrofa, Mesocricetus auratus, Rattus norvegicus and Mus musculus. Excluding the Saccharomyces cerevisiae DAD1 homologue, all animal DAD1 including A. irradians DAD1 homologue formed a subgroup and all plant DAD1 proteins formed another subgroup in the phylogenetic analysis. The A. irradians DAD1 was expressed in all examined tissues including adductor muscle, mantle, gills, digestive gland, gonad and hemolymph, suggesting that A. irradians DAD1 is expressed in most body tissues. Furthermore, the mRNA expression levels of A. irradians DAD1 gene of hemolymph were particularly high after injury, suggesting that the gene is responsive to injury stimuli.
Directory of Open Access Journals (Sweden)
Grégory Hoff
2016-11-01
Full Text Available Non homologous end-joining (NHEJ is a double strand break (DSB repair pathway which does not require any homologous template and can ligate two DNA ends together. The basic bacterial NHEJ machinery involves two partners: the Ku protein, a DNA end binding protein for DSB recognition and the multifunctional LigD protein composed a ligase, a nuclease and a polymerase domain, for end processing and ligation of the broken ends. In silico analyses performed in the 38 sequenced genomes of Streptomyces species revealed the existence of a large panel of NHEJ-like genes. Indeed, ku genes or ligD domain homologues are scattered throughout the genome in multiple copies and can be distinguished in two categories: the core NHEJ gene set constituted of conserved loci and the variable NHEJ gene set constituted of NHEJ-like genes present in only a part of the species. In Streptomyces ambofaciens ATCC 23877, not only the deletion of core genes but also that of variable genes led to an increased sensitivity to DNA damage induced by electron beam irradiation. Multiple mutants of ku, ligase or polymerase encoding genes showed an aggravated phenotype compared to single mutants. Biochemical assays revealed the ability of Ku-like proteins to protect and to stimulate ligation of DNA ends. RT-qPCR and GFP fusion experiments suggested that ku-like genes show a growth phase dependent expression profile consistent with their involvement in DNA repair during spores formation and/or germination.
Mouse Homologue of the Schizophrenia Susceptibility Gene ZNF804A as a Target of Hoxc8
Directory of Open Access Journals (Sweden)
Hyun Joo Chung
2010-01-01
Full Text Available Using a ChIP-cloning technique, we identified a Zinc finger protein 804a (Zfp804a as one of the putative Hoxc8 downstream target genes. We confirmed binding of Hoxc8 to an intronic region of Zfp804a by ChIP-PCR in F9 cells as well as in mouse embryos. Hoxc8 upregulated Zfp804a mRNA levels and augmented minimal promoter activity in vitro. In E11.5 mouse embryos, Zfp804a and Hoxc8 were coexpressed. Recent genome-wide studies identified Zfp804a (or ZNF804A in humans as a plausible marker for schizophrenia, leading us to hypothesize that this embryogenic regulatory control might also exert influence in development of complex traits such as psychosis.
Differentially expressed microRNAs in diapausing versus HCl-treated Bombyx embryos.
Directory of Open Access Journals (Sweden)
Wentao Fan
Full Text Available Differentially expressed microRNAs were detected to explore the molecular mechanisms of diapause termination. The total small RNA of diapause-destined silkworm eggs and HCl-treated eggs was extracted and then sequenced using HiSeq high-throughput method. 44 novel miRNAs were discovered. Compared to those in the diapause-destined eggs, 61 miRNAs showed significant changes in the acid-treated eggs, with 23 being up-regulated and 38 being down-regulated. The potential target genes of differentially expressed miRNAs were predicted by miRanda. Gene Ontology and KEGG pathway enrichment analysis of these potential target genes revealed that they were mainly located within cells and organelles, involved in cellular and metabolic processes, and participated in protein production, processing and transportation. Two differentially expressed genes, Bombyx mori SDH and Bmo-miR-2761-3p, were further analyzed with qRT-PCR. BmSDH was significantly up-regulated in the HCl-treated eggs, while Bmo-miR-2761-3p was down-regulated. These results suggested that these two genes were well coordinated in silkworm eggs. Dual luciferase reporter assay demonstrated that Bmo-miR-2761-3p inhibited the expression of BmSDH.
Duplication and relocation of the functional DPY19L2 gene within low copy repeats
Directory of Open Access Journals (Sweden)
Cheung Joseph
2006-03-01
Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.
TREAT (TREe-based Association Test)
TREAT is an R package for detecting complex joint effects in case-control studies. The test statistic is derived from a tree-structure model by recursive partitioning the data. Ultra-fast algorithm is designed to evaluate the significance of association between candidate gene and disease outcome
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S
1999-04-30
Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.
Basics on Genes and Genetic Disorders
... for Educators Search English Español The Basics on Genes and Genetic Disorders KidsHealth / For Teens / The Basics ... such as treating health problems. What Is a Gene? To understand how genes work, let's review some ...
Kumar, L; Sridhara, S; Singh, B P; Gangal, S V
1998-11-01
Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.
Hoff-Risseti, Caroline; Dörr, Felipe Augusto; Schaker, Patricia Dayane Carvalho; Pinto, Ernani; Werner, Vera Regina; Fiore, Marli Fatima
2013-01-01
The Cylindrospermopsis raciborskii population from Brazilian freshwater is known to produce saxitoxin derivatives (STX), while cylindrospermopsin (CYN), which is commonly detected in isolates from Australia and Asia continents, has thus far not been detected in South American strains. However, during the investigation for the presence of cyrA, cyrB, cyrC and cyrJ CYN synthetase genes in the genomes of four laboratory-cultured C. raciborskii Brazilian strains, the almost complete cyrA gene sequences were obtained for all strains, while cyrB and cyrC gene fragments were observed in two strains. These nucleotide sequences were translated into amino acids, and the predicted protein functions and domains confirmed their identity as CYN synthetase genes. Attempts to PCR amplify cyrJ gene fragments from the four strains were unsuccessful. Phylogenetic analysis grouped the nucleotide sequences together with their homologues found in known CYN synthetase clusters of C. raciborskii strains with high bootstrap support. In addition, fragments of sxtA, sxtB and sxtI genes involved in STX production were also obtained. Extensive LC-MS analyses were unable to detect CYN in the cultured strains, whereas the production of STX and its analogues was confirmed in CENA302, CENA305 and T3. To our knowledge, this is the first study reporting the presence of cyr genes in South American strains of C. raciborskii and the presence of sxt and cyr genes in a single C. raciborskii strain. This discovery suggests a shift in the type of cyanotoxin production over time of South American strains of C. raciborskii and contributes to the reconstruction of the evolutionary history and diversification of cyanobacterial toxins. PMID:24015317
Directory of Open Access Journals (Sweden)
Caroline Hoff-Risseti
Full Text Available The Cylindrospermopsis raciborskii population from Brazilian freshwater is known to produce saxitoxin derivatives (STX, while cylindrospermopsin (CYN, which is commonly detected in isolates from Australia and Asia continents, has thus far not been detected in South American strains. However, during the investigation for the presence of cyrA, cyrB, cyrC and cyrJ CYN synthetase genes in the genomes of four laboratory-cultured C. raciborskii Brazilian strains, the almost complete cyrA gene sequences were obtained for all strains, while cyrB and cyrC gene fragments were observed in two strains. These nucleotide sequences were translated into amino acids, and the predicted protein functions and domains confirmed their identity as CYN synthetase genes. Attempts to PCR amplify cyrJ gene fragments from the four strains were unsuccessful. Phylogenetic analysis grouped the nucleotide sequences together with their homologues found in known CYN synthetase clusters of C. raciborskii strains with high bootstrap support. In addition, fragments of sxtA, sxtB and sxtI genes involved in STX production were also obtained. Extensive LC-MS analyses were unable to detect CYN in the cultured strains, whereas the production of STX and its analogues was confirmed in CENA302, CENA305 and T3. To our knowledge, this is the first study reporting the presence of cyr genes in South American strains of C. raciborskii and the presence of sxt and cyr genes in a single C. raciborskii strain. This discovery suggests a shift in the type of cyanotoxin production over time of South American strains of C. raciborskii and contributes to the reconstruction of the evolutionary history and diversification of cyanobacterial toxins.
Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua
2015-09-01
Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.
Early embryonic failure: Expression and imprinted status of candidate genes on human chromosome 21
Energy Technology Data Exchange (ETDEWEB)
Sherman, L.S.; Bennett, P.R.; Moore, G.E. [Queen Charlotte`s and Chelsea Hospital, London (United Kingdom)
1994-09-01
Two cases of maternal uniparental (hetero)disomy for human chromosome 21 (mUPD21) have been identified in a systematic search for UPD in 23 cases of early embryonic failure (EEF). Bi-parental origin of the other chromosome pairs was confirmed using specific VNTR probes or dinucleotide repeat analysis. Both maternally and paternally derived isochromosomes 21q have previously been identified in two individuals with normal phenotypes. Full UPD21 has a different mechanism of origin than uniparental isochromosome 21q and its effect on imprinted genes and phenotypic outcome will therefore not necessarily be the same. EEF associated with mUPD21 suggests that developmentally important genes on HSA 21 may be imprinted such that they are only expressed from either the maternally or paternally derived alleles. We have searched for monoallelic expression of candidate genes on HSA 21 in human pregnancy (CBS, IFNAR, COL6A1) using intragenic DNA polymorphisms. These genes were chosen either because their murine homologues lie in imprinted regions or because they are potentially important in embryogenesis. Once imprinted candidate genes have been identified, their methylation status and expression in normal, early embryonic failure and uniparental disomy 21 pregnancies will be studied. At the same time, a larger number of cases of EEF are being examined to further investigate the incidence of UPD21 in this group.
Directory of Open Access Journals (Sweden)
Fustiñana Maria
2010-09-01
Full Text Available Abstract Background Human β-amyloid, the main component in the neuritic plaques found in patients with Alzheimer's disease, is generated by cleavage of the β-amyloid precursor protein. Beyond the role in pathology, members of this protein family are synaptic proteins and have been associated with synaptogenesis, neuronal plasticity and memory, both in vertebrates and in invertebrates. Consolidation is necessary to convert a short-term labile memory to a long-term and stable form. During consolidation, gene expression and de novo protein synthesis are regulated in order to produce key proteins for the maintenance of plastic changes produced during the acquisition of new information. Results Here we partially cloned and sequenced the beta-amyloid precursor protein like gene homologue in the crab Chasmagnathus (cappl, showing a 37% of identity with the fruit fly Drosophila melanogaster homologue and 23% with Homo sapiens but with much higher degree of sequence similarity in certain regions. We observed a wide distribution of cappl mRNA in the nervous system as well as in muscle and gills. The protein localized in all tissues analyzed with the exception of muscle. Immunofluorescence revealed localization of cAPPL in associative and sensory brain areas. We studied gene and protein expression during long-term memory consolidation using a well characterized memory model: the context-signal associative memory in this crab species. mRNA levels varied at different time points during long-term memory consolidation and correlated with cAPPL protein levels Conclusions cAPPL mRNA and protein is widely distributed in the central nervous system of the crab and the time course of expression suggests a role of cAPPL during long-term memory formation.
Gene expression profile change and growth inhibition in Drosophila larvae treated with azadirachtin.
Lai, Duo; Jin, Xiaoyong; Wang, Hao; Yuan, Mei; Xu, Hanhong
2014-09-20
Azadirachtin is a botanical insecticide that affects various biological processes. The effects of azadirachtin on the digital gene expression profile and growth inhibition in Drosophila larvae have not been investigated. In this study, we applied high-throughput sequencing technology to detect the differentially expressed genes of Drosophila larvae regulated by azadirachtin. A total of 15,322 genes were detected, and 28 genes were found to be significantly regulated by azadirachtin. Biological process and pathway analysis showed that azadirachtin affected starch and sucrose metabolism, defense response, signal transduction, instar larval or pupal development, and chemosensory behavior processes. The genes regulated by azadirachtin were mainly enriched in starch and sucrose metabolism. This study provided a general digital gene expression profile of dysregulated genes in response to azadirachtin and showed that azadirachtin provoked potent growth inhibitory effects in Drosophila larvae by regulating the genes of cuticular protein, amylase, and odorant-binding protein. Finally, we propose a potential mechanism underlying the dysregulation of the insulin/insulin-like growth factor signaling pathway by azadirachtin. Copyright © 2014 Elsevier B.V. All rights reserved.
Tan, Fu-Qing; Ma, Xiao-Xin; Zhu, Jun-Quan; Yang, Wan-Xi
2013-12-10
In this study, we investigated the gene sequence and characteristic of kifc1 in Sepiella maindroni through PCR and RACE technology. Our research aimed particularly at the spatio-temporal expression pattern of kifc1 in the developmental testis through in situ hybridization. The particular role of kifc1 in the spermatogenesis of S. maindroni was our particular interest. Based on multiple protein sequence alignments of KIFC1 homologues, kifc1 gene from the testis of S. maindroni was identified, which consisted of 2432bp including a 2109 in-frame ORF corresponding to 703 continuous amino acids. The encoded polypeptide shared highest similarity with Octopus tankahkeei. Through the prediction of the secondary and tertiary structures, the motor domain of KIFC1 was conserved at the C-terminal, having putative ATP-binding and microtubule-binding motifs, while the N-terminal was more specific to bind various cargoes for cellular events. The stalk domain connecting between the C-terminal and N-terminal determined the direction of movement. According to RT-PCR results, the kifc1 gene is not tissue-specific, commonly detected in different tissues, for example, the testis, liver, stomach, muscle, caecum and gills. Through an in situ hybridization method, the expression pattern of KIFC1 protein mimics in the spermatogenesis of S. maindroni. During the primary stage of the spermatogenesis, the kifc1 mRNA signal was barely detectable. At the early spermatids, the signal started to be present. With the elongation of spermatids, the signals increased substantially. It peaked and gathered around the acrosome area when the spermatids began to transform to spindle shape. As the spermatids developed into mature sperm, the signal vanished. In summary, the expression of kfic1 at specific stages during spermiogenesis and its distribution shed light on the potential functions of this motor in major cytological transformations. The KIFC1 homologue may provide a direct shaping force to the
International Nuclear Information System (INIS)
Shaposhnikov, M.V.; Zainullin, V.G.
2003-01-01
Full text: In primary study on Drosophila it was found that irradiated male X-chromosomes induce recessive lethals in unirradiated female homologues (Abeleva et al., 1961, Radiobiologya. 1:123-126). The same effects were obtained in Drosophila in some recent investigations. The mechanisms of these effects is unknown. However it may be responsible for low-dose radiation effects as it induce mutations in unirradiated DNA. We assume that this effect may be a result of activation of error prone repair in response to preliminary DNA lesions in irradiated chromosome. In this research we analyse the frequencies of the recessive lethal mutations in the X-chromosome of Drosophila females mated with irradiated Basc males. We used acute irradiation with a dose rate of 10 Gy. For testing our hypothesis we use the mus209 and mei-41 mutant females. Mus209 is a PCNA gene homologue and mei-41 is a homologue of ATM gene. These genes are involved in post-replication DNA repair which may be error prone repair in Drosophila. It was obtained the tendency to decreasing the mutation rate at the mei-41[D5] background and decreasing mutation rate in mus209[B1] background in comparison with wild type strains CS (p<0.05). The obtained results demonstrate the possible role of mus209[B1] and mei-41[D5] genes in the inducing of mutations in the unirradiated X-chromosome in the presence of irradiated homologue
O'Connell, Michael J; Lavery, Ian; Yothers, Greg; Paik, Soonmyung; Clark-Langone, Kim M; Lopatin, Margarita; Watson, Drew; Baehner, Frederick L; Shak, Steven; Baker, Joffre; Cowens, J Wayne; Wolmark, Norman
2010-09-01
These studies were conducted to determine the relationship between quantitative tumor gene expression and risk of cancer recurrence in patients with stage II or III colon cancer treated with surgery alone or surgery plus fluorouracil (FU) and leucovorin (LV) to develop multigene algorithms to quantify the risk of recurrence as well as the likelihood of differential treatment benefit of FU/LV adjuvant chemotherapy for individual patients. We performed quantitative reverse transcription polymerase chain reaction (RT-qPCR) on RNA extracted from fixed, paraffin-embedded (FPE) tumor blocks from patients with stage II or III colon cancer who were treated with surgery alone (n = 270 from National Surgical Adjuvant Breast and Bowel Project [NSABP] C-01/C-02 and n = 765 from Cleveland Clinic [CC]) or surgery plus FU/LV (n = 308 from NSABP C-04 and n = 508 from NSABP C-06). Overall, 761 candidate genes were studied in C-01/C-02 and C-04, and a subset of 375 genes was studied in CC/C-06. A combined analysis of the four studies identified 48 genes significantly associated with risk of recurrence and 66 genes significantly associated with FU/LV benefit (with four genes in common). Seven recurrence-risk genes, six FU/LV-benefit genes, and five reference genes were selected, and algorithms were developed to identify groups of patients with low, intermediate, and high likelihood of recurrence and benefit from FU/LV. RT-qPCR of FPE colon cancer tissue applied to four large independent populations has been used to develop multigene algorithms for estimating recurrence risk and benefit from FU/LV. These algorithms are being independently validated, and their clinical utility is being evaluated in the Quick and Simple and Reliable (QUASAR) study.
Labandeira-Rey, Maria; Janowicz, Diane M; Blick, Robert J; Fortney, Kate R; Zwickl, Beth; Katz, Barry P; Spinola, Stanley M; Hansen, Eric J
2009-08-01
Haemophilus ducreyi 35000HP contains a homologue of the luxS gene, which encodes an enzyme that synthesizes autoinducer 2 (AI-2) in other gram-negative bacteria. H. ducreyi 35000HP produced AI-2 that functioned in a Vibrio harveyi-based reporter system. A H. ducreyi luxS mutant was constructed by insertional inactivation of the luxS gene and lost the ability to produce AI-2. Provision of the H. ducreyi luxS gene in trans partially restored AI-2 production by the mutant. The luxS mutant was compared with its parent for virulence in the human challenge model of experimental chancroid. The pustule-formation rate in 5 volunteers was 93.3% (95% confidence interval, 81.7%-99.9%) at 15 parent sites and 60.0% (95% confidence interval, 48.3%-71.7%) at 15 mutant sites (1-tailed P < .001). Thus, the luxS mutant was partially attenuated for virulence. This is the first report of AI-2 production contributing to the pathogenesis of a genital ulcer disease.
Comparative effects of DHEA and DHT on gene expression in human LNCaP prostate cancer cells.
Steele, Vernon E; Arnold, Julia T; Lei, Hanh; Izmirlian, Grant; Blackman, Marc R
2006-01-01
DHEA is widely used as a dietary supplement in older men. Because DHEA can be converted to androgens or estrogens, such use may promote prostate cancer. In this study, the effects of DHEA were compared with those of DHT using gene expression array profiles in human LNCaP prostate cancer cells. LNCaP cells were exposed to DHEA (300 nM), DHT (300 nM), or vehicle for 48 h, and mRNA expression was measured using Affymetrix HU-95 gene chips. Gene expression values were sorted in ascending order on the p-values corresponding to the extent of differential RNA expression between control and either hormone treatment. S100 calcium binding protein, neurotensin, 24-dehydrocholesterol reductase, and anterior-gradient 2 homologue were the four most differentially expressed genes (p-values all DHT treatment (p DHT were used for pathway analysis. DHT decreased expression of more genes involved in intercellular communication, signal transduction, nucleic acid binding and transport, and in structural components, such as myosin and golgin, than DHEA. These data revealed consistent, measurable changes in gene expression patterns following treatment of LNCaP prostate cancer cells with DHEA and DHT. Understanding the mechanisms of DHEA versus DHT actions in the prostate may help clarify the separate and interactive effects of androgenic and estrogenic actions in prostate cancer progression.
Gene function in early mouse embryonic stem cell differentiation
Directory of Open Access Journals (Sweden)
Campbell Pearl A
2007-03-01
Full Text Available Abstract Background Little is known about the genes that drive embryonic stem cell differentiation. However, such knowledge is necessary if we are to exploit the therapeutic potential of stem cells. To uncover the genetic determinants of mouse embryonic stem cell (mESC differentiation, we have generated and analyzed 11-point time-series of DNA microarray data for three biologically equivalent but genetically distinct mESC lines (R1, J1, and V6.5 undergoing undirected differentiation into embryoid bodies (EBs over a period of two weeks. Results We identified the initial 12 hour period as reflecting the early stages of mESC differentiation and studied probe sets showing consistent changes of gene expression in that period. Gene function analysis indicated significant up-regulation of genes related to regulation of transcription and mRNA splicing, and down-regulation of genes related to intracellular signaling. Phylogenetic analysis indicated that the genes showing the largest expression changes were more likely to have originated in metazoans. The probe sets with the most consistent gene changes in the three cell lines represented 24 down-regulated and 12 up-regulated genes, all with closely related human homologues. Whereas some of these genes are known to be involved in embryonic developmental processes (e.g. Klf4, Otx2, Smn1, Socs3, Tagln, Tdgf1, our analysis points to others (such as transcription factor Phf21a, extracellular matrix related Lama1 and Cyr61, or endoplasmic reticulum related Sc4mol and Scd2 that have not been previously related to mESC function. The majority of identified functions were related to transcriptional regulation, intracellular signaling, and cytoskeleton. Genes involved in other cellular functions important in ESC differentiation such as chromatin remodeling and transmembrane receptors were not observed in this set. Conclusion Our analysis profiles for the first time gene expression at a very early stage of m
De Ameida Melo, Mariella; De Vasconcelos-Valença, Rodrigo José; Neto, Fidelis Manes; Borges, Rafael Soares; Costa-Silva, Danylo Rafhael; Da Conceição Barros-Oliveira, Maria; Borges, Umbelina Soares; Alencar, Airlane Pereira; Silva, Vladimir Costa; Da Silva, Benedito Borges
2016-01-01
At present, there is controversy regarding the efficacy of tamoxifen in breast cancer patients who are carriers of cytochrome P450 2D6 (CYP2D6) gene polymorphisms, in terms of recurrence and overall survival. Thus, the aim of the present study was to investigate the association of the CYP2D6 *4, *10 and *17 gene polymorphisms with breast cancer recurrence in a Brazilian population. The cohort comprised 40 receptor-positive breast cancer patients without recurrence and 40 with distant recurrence. A 3-ml sample of peripheral blood was collected from each patient to determine the presence of the *4, *10 and *17 single nucleotide polymorphisms of the CYP2D6 gene by quantitative polymerase chain reaction analysis. There was no statistically significant difference between the two groups regarding the polymorphism frequency (P=0.246). The results revealed that intermediate metabolizers occurred in 5% of patients without recurrence and in 15% of those with distant recurrence. Poor metabolizers occurred in only 1 patient (2.5%) per group, and there was no significant difference between the groups (P=0.789). The present study concluded that the CYP2D6 gene polymorphism in women with hormone-sensitive breast cancer treated with tamoxifen was not associated with disease recurrence. PMID:27882219
Nock, Catherine J; Baten, Abdul; Barkla, Bronwyn J; Furtado, Agnelo; Henry, Robert J; King, Graham J
2016-11-17
The large Gondwanan plant family Proteaceae is an early-diverging eudicot lineage renowned for its morphological, taxonomic and ecological diversity. Macadamia is the most economically important Proteaceae crop and represents an ancient rainforest-restricted lineage. The family is a focus for studies of adaptive radiation due to remarkable species diversification in Mediterranean-climate biodiversity hotspots, and numerous evolutionary transitions between biomes. Despite a long history of research, comparative analyses in the Proteaceae and macadamia breeding programs are restricted by a paucity of genetic information. To address this, we sequenced the genome and transcriptome of the widely grown Macadamia integrifolia cultivar 741. Over 95 gigabases of DNA and RNA-seq sequence data were de novo assembled and annotated. The draft assembly has a total length of 518 Mb and spans approximately 79% of the estimated genome size. Following annotation, 35,337 protein-coding genes were predicted of which over 90% were expressed in at least one of the leaf, shoot or flower tissues examined. Gene family comparisons with five other eudicot species revealed 13,689 clusters containing macadamia genes and 1005 macadamia-specific clusters, and provides evidence for linage-specific expansion of gene families involved in pathogen recognition, plant defense and monoterpene synthesis. Cyanogenesis is an important defense strategy in the Proteaceae, and a detailed analysis of macadamia gene homologues potentially involved in cyanogenic glycoside biosynthesis revealed several highly expressed candidate genes. The gene space of macadamia provides a foundation for comparative genomics, gene discovery and the acceleration of molecular-assisted breeding. This study presents the first available genomic resources for the large basal eudicot family Proteaceae, access to most macadamia genes and opportunities to uncover the genetic basis of traits of importance for adaptation and crop
Analysis of the function of the agouti gene in obesity and diabetes
Energy Technology Data Exchange (ETDEWEB)
Mynatt, R.L.; Miltenberger, R.J.; Klebig, M.L. [and others
1996-09-01
This chapter discusses the agouti gene and dominant mutations in that gene that lead to agouti-induced obesity, and recent work with transgenic mice to elucidate the role of agouti in obesity. Agouti was cloned in 1992 by the lab of Rick Woychik at Oak Ridge National Laboratory, making it the first of many recently cloned mouse obesity genes. Sequence analysis predicted that mouse agouti is a secreted protein of 131 amino acids. The mature protein has a basic central region (lys57-arg85), a proline-rich domain (pro86-pro91) and a C-terminal region (cys 92-cys 13 1) containing 10 cysteine residues which form 5 disulfide bonds. The human homologue of agouti has also been cloned by the Woychik lab and maps to human chromosome 20q 11.2. Human agouti is 132 amino acids long and is 85% similar to the mouse agouti protein and is normally expressed in adipose tissue. The researchers have been able to recapitulate obesity, hyperinsulinemia, and hyperglycemia with the ubiquitous expression of agouti. Agouti expression in either liver and adipose tissue alone does not cause obesity, and there`s a dose-dependent effect of agouti on body weight, food efficiency, body temperature, and insulin and glucose levels.
DEFF Research Database (Denmark)
Liu, M; Kirpekar, F; Van Wezel, G P
2000-01-01
tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...
Directory of Open Access Journals (Sweden)
Ouali Ahmed
2008-04-01
Full Text Available Abstract Background The superfamily of serine proteinase inhibitors (serpins is involved in numerous fundamental biological processes as inflammation, blood coagulation and apoptosis. Our interest is focused on the SERPINA3 sub-family. The major human plasma protease inhibitor, α1-antichymotrypsin, encoded by the SERPINA3 gene, is homologous to genes organized in clusters in several mammalian species. However, although there is a similar genic organization with a high degree of sequence conservation, the reactive-centre-loop domains, which are responsible for the protease specificity, show significant divergences. Results We provide additional information by analyzing the situation of SERPINA3 in the bovine genome. A cluster of eight genes and one pseudogene sharing a high degree of identity and the same structural organization was characterized. Bovine SERPINA3 genes were localized by radiation hybrid mapping on 21q24 and only spanned over 235 Kilobases. For all these genes, we propose a new nomenclature from SERPINA3-1 to SERPINA3-8. They share approximately 70% of identity with the human SERPINA3 homologue. In the cluster, we described an original sub-group of six members with an unexpected high degree of conservation for the reactive-centre-loop domain, suggesting a similar peptidase inhibitory pattern. Preliminary expression analyses of these bovSERPINA3s showed different tissue-specific patterns and diverse states of glycosylation and phosphorylation. Finally, in the context of phylogenetic analyses, we improved our knowledge on mammalian SERPINAs evolution. Conclusion Our experimental results update data of the bovine genome sequencing, substantially increase the bovSERPINA3 sub-family and enrich the phylogenetic tree of serpins. We provide new opportunities for future investigations to approach the biological functions of this unusual subset of serine proteinase inhibitors.
A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.
Rogalski, T M; Riddle, D L
1988-01-01
The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.
Duodenal ulcer promoting gene of Helicobacter pylori.
Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio
2005-04-01
Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.
Comprehensive identification of Vibrio vulnificus genes required for growth in human serum.
Carda-Diéguez, M; Silva-Hernández, F X; Hubbard, T P; Chao, M C; Waldor, M K; Amaro, C
2018-12-31
Vibrio vulnificus can be a highly invasive pathogen capable of spreading from an infection site to the bloodstream, causing sepsis and death. To survive and proliferate in blood, the pathogen requires mechanisms to overcome the innate immune defenses and metabolic limitations of this host niche. We created a high-density transposon mutant library in YJ016, a strain representative of the most virulent V. vulnificus lineage (or phylogroup) and used transposon insertion sequencing (TIS) screens to identify loci that enable the pathogen to survive and proliferate in human serum. Initially, genes underrepresented for insertions were used to estimate the V. vulnificus essential gene set; comparisons of these genes with similar TIS-based classification of underrepresented genes in other vibrios enabled the compilation of a common Vibrio essential gene set. Analysis of the relative abundance of insertion mutants in the library after exposure to serum suggested that genes involved in capsule biogenesis are critical for YJ016 complement resistance. Notably, homologues of two genes required for YJ016 serum-resistance and capsule biogenesis were not previously linked to capsule biogenesis and are largely absent from other V. vulnificus strains. The relative abundance of mutants after exposure to heat inactivated serum was compared with the findings from the serum screen. These comparisons suggest that in both conditions the pathogen relies on its Na + transporting NADH-ubiquinone reductase (NQR) complex and type II secretion system to survive/proliferate within the metabolic constraints of serum. Collectively, our findings reveal the potency of comparative TIS screens to provide knowledge of how a pathogen overcomes the diverse limitations to growth imposed by serum.
International Nuclear Information System (INIS)
Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.
2013-01-01
We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes
We recently described a general method that can improve microarray analysis of toxicant-exposed cells that uses the intrinsic power of transcriptional coupling and toxicant concentration-expression response data. In this analysis, we characterized changes in global gene expressio...
DEFF Research Database (Denmark)
Sweeney, N.J.; Klemm, Per; McCormick, Beth A.
1996-01-01
Escherichia coli F-18 is a human fecal isolate that makes type 1 fimbriae, encoded by the fim gene cluster, and is an excellent colonizer of the streptomycin-treated mouse intestine. E. coli F-18 fimA::tet, lacking type 1 fimbriae, was constructed by bacteriophage P1 transduction of the fim regio...
Czech Academy of Sciences Publication Activity Database
Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla
2012-01-01
Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012
Treating Combat Hearing Loss with Atoh1 Gene Therapy
2015-06-01
K, Hibino H, Kubo T (2009) Analysis of gene expression profiles along the tonotopic map of mouse cochlea by cDNA microarrays. Acta Otolaryngol Suppl...Murata, J., Tokunaga, A., Okano, H., and Kubo , T. (2006). Mapping of notch activation during cochlear development in mice: implications for determination
Gene therapy in animal models of autosomal dominant retinitis pigmentosa
Rossmiller, Brian; Mao, Haoyu
2012-01-01
Gene therapy for dominantly inherited genetic disease is more difficult than gene-based therapy for recessive disorders, which can be treated with gene supplementation. Treatment of dominant disease may require gene supplementation partnered with suppression of the expression of the mutant gene either at the DNA level, by gene repair, or at the RNA level by RNA interference or transcriptional repression. In this review, we examine some of the gene delivery approaches used to treat animal models of autosomal dominant retinitis pigmentosa, focusing on those models associated with mutations in the gene for rhodopsin. We conclude that combinatorial approaches have the greatest promise for success. PMID:23077406
Directory of Open Access Journals (Sweden)
Chaozheng Li
Full Text Available The nuclear factor-kappa B (NF-κB pathways play important roles in innate immune responses. IκB is the main cytoplasmic inhibitor of NF-κB. In this study, we identified the LvCactus gene from Litopenaeus vannamei, which is the first cloned IκB homologue in subphylum Crustacea. LvCactus contains six predicted ankyrin repeats, which show similarities to those of Cactus proteins from insects. LvCactus localizes in cytoplasm and interacts with LvDorsal, an L. vannamei homologue to Drosophila melanogaster Dorsal belonging to class II NF-κB family, to prevent its nuclear translocation. Contrary to that of LvDorsal, over-expression of LvCactus down-regulates the activities of shrimp antimicrobial peptides promoters, suggesting LvCactus is an inhibitor of LvDorsal. The promoter of LvCactus was predicted to contain five putative NF-κB binding motifs, among which four were proved to be bound by LvDorsal by chromatin immunoprecipitation assays. Dual-luciferase reporter assays also showed that transcription of LvCactus was promoted by LvDorsal but inhibited by LvCactus itself, indicating a feedback regulatory pathway between LvCactus and LvDorsal. Expression of LvCactus was up-regulated after Lipopolysaccharides, poly (I:C, Vibrio parahaemolyticus, and Staphylococcus aureus injections, suggesting an activation response of LvCactus to bacterial and immune stimulant challenges. Differently, the LvCactus expression levels obviously decreased during white spot syndrome virus (WSSV infection, indicating the feedback regulatory pathway of LvCactus/LvDorsal could be modified by WSSV.
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
International Nuclear Information System (INIS)
Singh, S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
Energy Technology Data Exchange (ETDEWEB)
Singh,S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the
Directory of Open Access Journals (Sweden)
Lin-Lin Liu
Full Text Available Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is a powerful technique for examining gene expression changes during tumorigenesis. Target gene expression is generally normalized by a stably expressed endogenous reference gene; however, reference gene expression may differ among tissues under various circumstances. Because no valid reference genes have been documented for human breast cancer cell lines containing different cancer subtypes treated with transient transfection, we identified appropriate and reliable reference genes from thirteen candidates in a panel of 10 normal and cancerous human breast cell lines under experimental conditions with/without transfection treatments with two transfection reagents. Reference gene expression stability was calculated using four algorithms (geNorm, NormFinder, BestKeeper and comparative delta Ct, and the recommended comprehensive ranking was provided using geometric means of the ranking values using the RefFinder tool. GeNorm analysis revealed that two reference genes should be sufficient for all cases in this study. A stability analysis suggests that 18S rRNA-ACTB is the best reference gene combination across all cell lines; ACTB-GAPDH is best for basal breast cancer cell lines; and HSPCB-ACTB is best for ER+ breast cancer cells. After transfection, the stability ranking of the reference gene fluctuated, especially with Lipofectamine 2000 transfection reagent in two subtypes of basal and ER+ breast cell lines. Comparisons of relative target gene (HER2 expression revealed different expressional patterns depending on the reference genes used for normalization. We suggest that identifying the most stable and suitable reference genes is critical for studying specific cell lines under certain circumstances.
Quantum selfish gene (biological evolution in terms of quantum mechanics)
Ozhigov, Yuri I.
2013-01-01
I propose to treat the biological evolution of genoms by means of quantum mechanical tools. We start with the concept of meta- gene, which specifies the "selfish gene" of R.Dawkins. Meta- gene encodes the abstract living unity, which can live relatively independently of the others, and can contain a few real creatures. Each population of living creatures we treat as the wave function on meta- genes, which module squared is the total number of creatures with the given meta-gene, and the phase ...
Gene expression profiles in adenosine-treated human mast cells
African Journals Online (AJOL)
ajl yemi
2011-10-26
Oct 26, 2011 ... assignment (Ewing and Green, 1998a; Ewing et al., 1998b). The trace files were trimmed with trim-alt 0.05 (P-score>20). In addition, vector trimming was conducted with cross-match software. Each gene expression pattern was analyzed by clustering. (30 bp or more 94% homology) and assembly.
Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S
2015-06-01
Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.
The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.
Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi
2016-01-01
We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.
Huan, Jinliang; Wang, Lishan; Xing, Li; Qin, Xianju; Feng, Lingbin; Pan, Xiaofeng; Zhu, Ling
2014-01-01
Estrogens are known to regulate the proliferation of breast cancer cells and to alter their cytoarchitectural and phenotypic properties, but the gene networks and pathways by which estrogenic hormones regulate these events are only partially understood. We used global gene expression profiling by Affymetrix GeneChip microarray analysis, with KEGG pathway enrichment, PPI network construction, module analysis and text mining methods to identify patterns and time courses of genes that are either stimulated or inhibited by estradiol (E2) in estrogen receptor (ER)-positive MCF-7 human breast cancer cells. Of the genes queried on the Affymetrix Human Genome U133 plus 2.0 microarray, we identified 628 (12h), 852 (24h) and 880 (48 h) differentially expressed genes (DEGs) that showed a robust pattern of regulation by E2. From pathway enrichment analysis, we found out the changes of metabolic pathways of E2 treated samples at each time point. At 12h time point, the changes of metabolic pathways were mainly focused on pathways in cancer, focal adhesion, and chemokine signaling pathway. At 24h time point, the changes were mainly enriched in neuroactive ligand-receptor interaction, cytokine-cytokine receptor interaction and calcium signaling pathway. At 48 h time point, the significant pathways were pathways in cancer, regulation of actin cytoskeleton, cell adhesion molecules (CAMs), axon guidance and ErbB signaling pathway. Of interest, our PPI network analysis and module analysis found that E2 treatment induced enhancement of PRSS23 at the three time points and PRSS23 was in the central position of each module. Text mining results showed that the important genes of DEGs have relationship with signal pathways, such as ERbB pathway (AREG), Wnt pathway (NDP), MAPK pathway (NTRK3, TH), IP3 pathway (TRA@) and some transcript factors (TCF4, MAF). Our studies highlight the diverse gene networks and metabolic and cell regulatory pathways through which E2 operates to achieve its
Codon usage is associated with the evolutionary age of genes in metazoan genomes
Directory of Open Access Journals (Sweden)
Linial Nathan
2009-12-01
Full Text Available Abstract Background Codon usage may vary significantly between different organisms and between genes within the same organism. Several evolutionary processes have been postulated to be the predominant determinants of codon usage: selection, mutation, and genetic drift. However, the relative contribution of each of these factors in different species remains debatable. The availability of complete genomes for tens of multicellular organisms provides an opportunity to inspect the relationship between codon usage and the evolutionary age of genes. Results We assign an evolutionary age to a gene based on the relative positions of its identified homologues in a standard phylogenetic tree. This yields a classification of all genes in a genome to several evolutionary age classes. The present study starts from the observation that each age class of genes has a unique codon usage and proceeds to provide a quantitative analysis of the codon usage in these classes. This observation is made for the genomes of Homo sapiens, Mus musculus, and Drosophila melanogaster. It is even more remarkable that the differences between codon usages in different age groups exhibit similar and consistent behavior in various organisms. While we find that GC content and gene length are also associated with the evolutionary age of genes, they can provide only a partial explanation for the observed codon usage. Conclusion While factors such as GC content, mutational bias, and selection shape the codon usage in a genome, the evolutionary history of an organism over hundreds of millions of years is an overlooked property that is strongly linked to GC content, protein length, and, even more significantly, to the codon usage of metazoan genomes.
Directory of Open Access Journals (Sweden)
Zeuli Massimo
2010-04-01
Full Text Available Abstract Background Responsiveness to Cetuximab alone can be mediated by an increase of Epidermal Growth factor Receptor (EGFR Gene Copy Number (GCN. Aim of this study was to assess the role of EGFR-GCN in advanced colorectal cancer (CRC patients receiving chemotherapy plus Cetuximab. Methods One hundred and one advanced CRC patients (43 untreated- and 58 pre-treated were retrospectively studied by fluorescence in situ hybridization (FISH to assess EGFR-GCN and by immunohistochemistry (IHC to determine EGFR expression. Sixty-one out of 101 patients were evaluated also for k-ras status by direct sequencing. Clinical end-points were response rate (RR, progression-free survival (PFS and overall survival (OS. Results Increased EGFR-GCN was found in 60/101 (59% tumor samples. There was no correlation between intensity of EGFR-IHC and EGFR-GCN (p = 0.43. Patients receiving chemotherapy plus Cetuximab as first line treatment had a RR of 70% (30/43 while it was 18% (10/56 in the group with previous lines of therapy (p Conclusion In metastatic CRC patients treated with chemotherapy plus Cetuximab number of chemotherapy lines and increased EGFR-GCN were significantly associated with a better clinical outcome, independent of k-ras status.
International Nuclear Information System (INIS)
Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.
2005-01-01
In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures
DEFF Research Database (Denmark)
Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl
2010-01-01
The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....
Energy Technology Data Exchange (ETDEWEB)
Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu
2014-01-03
Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.
Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT
Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David
2011-01-01
High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025
Directory of Open Access Journals (Sweden)
Simao Teixeira da Rocha
2009-02-01
Full Text Available Genomic imprinting is a normal process that causes genes to be expressed according to parental origin. The selective advantage conferred by imprinting is not understood but is hypothesised to act on dosage-critical genes. Here, we report a unique model in which the consequences of a single, double, and triple dosage of the imprinted Dlk1/Pref1, normally repressed on the maternally inherited chromosome, can be assessed in the growing embryo. BAC-transgenic mice were generated that over-express Dlk1 from endogenous regulators at all sites of embryonic activity. Triple dosage causes lethality associated with major organ abnormalities. Embryos expressing a double dose of Dlk1, recapitulating loss of imprinting, are growth enhanced but fail to thrive in early life, despite the early growth advantage. Thus, any benefit conferred by increased embryonic size is offset by postnatal lethality. We propose a negative correlation between gene dosage and survival that fixes an upper limit on growth promotion by Dlk1, and we hypothesize that trade-off between growth and lethality might have driven imprinting at this locus.
Directory of Open Access Journals (Sweden)
Pavol Mikoláš
Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.
Gene therapy: theoretical and bioethical concepts.
Smith, Kevin R
2003-01-01
Gene therapy holds great promise. Somatic gene therapy has the potential to treat a wide range of disorders, including inherited conditions, cancers, and infectious diseases. Early progress has already been made in the treatment of a range of disorders. Ethical issues surrounding somatic gene therapy are primarily those concerned with safety. Germline gene therapy is theoretically possible but raises serious ethical concerns concerning future generations.
International Nuclear Information System (INIS)
Megeed, A.A.
2011-01-01
The potential for two overlapping fragments of DNA from a clone of newly isolated alkanes degrading bacterium Pseudomonas frederiksbergensis encoding sequences with similar homology to two parts of functional proteins is described. One strand contains a sequence with high homology to alkanes monooxygenase (alkB), a member of the alkanes hydroxylase family, and the other strand contains a sequence with some homology to alcohol dehydrogenase gene (alkJ). Overlapping of the genes on opposite strands has been reported in eukaryotic species, and is now reported in a bacterial species. The sequence comparisons and ORFS results revealed that the regulation and the genes organization involved in alkane oxidation represented in Pseudomonas frederiksberghensis varies among the different known alkane degrading bacteria. The alk gene cluster containing homologues to the known alkane monooxygenase (alkB), and rubredoxin (alkG) are oriented in the same direction, whereas alcohol dehydrogenase (alkJ) is oriented in the opposite direction. Such genomes encode messages on both strands of the DNA, or in an overlapping but different reading frames, of the same strand of DNA. The possibility of creating novel genes from pre-existing sequences, known as overprinting, which is a widespread phenomenon in small viruses. Here, the origin and evolution of the gene overlap to bacteriophages belonging to the family Microviridae have been investigated. Such a phenomenon is most widely described in extremely small genomes such as those of viruses or small plasmids, yet here is a unique phenomenon. (author)
Isolation and characterization of differentially expressed genes in ...
African Journals Online (AJOL)
USER
Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.
Directory of Open Access Journals (Sweden)
L. R. Cataldo
2016-01-01
Full Text Available High circulating nonesterified fatty acids (NEFAs concentration, often reported in diabetes, leads to impaired glucose-stimulated insulin secretion (GSIS through not yet well-defined mechanisms. Serotonin and dopamine might contribute to NEFA-dependent β-cell dysfunction, since extracellular signal of these monoamines decreases GSIS. Moreover, palmitate-treated β-cells may enhance the expression of the serotonin receptor Htr2c, affecting insulin secretion. Additionally, the expression of monoamine-oxidase type B (Maob seems to be lower in islets from humans and mice with diabetes compared to nondiabetic islets, which may lead to increased monoamine concentrations. We assessed the expression of serotonin- and dopamine-related genes in islets from db/db and wild-type (WT mice. In addition, the effect of palmitate and oleate on the expression of such genes, 5HT content, and GSIS in MIN6 β-cell was determined. Lower Maob expression was found in islets from db/db versus WT mice and in MIN6 β-cells in response to palmitate and oleate treatment compared to vehicle. Reduced 5HT content and impaired GSIS in response to palmitate (−25%; p<0.0001 and oleate (−43%; p<0.0001 were detected in MIN6 β-cells. In conclusion, known defects of GSIS in islets from db/db mice and MIN6 β-cells treated with NEFAs are accompanied by reduced Maob expression and reduced 5HT content.
International Nuclear Information System (INIS)
Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru
2006-01-01
Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)
Candidate innate immune system gene expression in the ecological model Daphnia.
Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J
2011-10-01
The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive
International Nuclear Information System (INIS)
Konlechner, Cornelia; Türktaş, Mine; Langer, Ingrid; Vaculík, Marek; Wenzel, Walter W.; Puschenreiter, Markus; Hauser, Marie-Theres
2013-01-01
Salix caprea is well suited for phytoextraction strategies. In a previous survey we showed that genetically distinct S. caprea plants isolated from metal-polluted and unpolluted sites differed in their zinc (Zn) and cadmium (Cd) tolerance and accumulation abilities. To determine the molecular basis of this difference we examined putative homologues of genes involved in heavy metal responses and identified over 200 new candidates with a suppression subtractive hybridization (SSH) screen. Quantitative expression analyses of 20 genes in leaves revealed that some metallothioneins and cell wall modifying genes were induced irrespective of the genotype's origin and metal uptake capacity while a cysteine biosynthesis gene was expressed constitutively higher in the metallicolous genotype. The third and largest group of genes was only induced in the metallicolous genotype. These data demonstrate that naturally adapted woody non-model species can help to discover potential novel molecular mechanisms for metal accumulation and tolerance. -- Highlights: ► The transcriptional Zn/Cd response of the willow Salix caprea was quantified. ► Two genotypes from a highly contaminated and a control environment were compared. ► In addition to candidate genes an SSH library revealed over 200 metal induced genes. ► Constitutive upregulation and isolate-specific induction of genes were revealed. ► Willows adapt to environmental Zn/Cd contamination on the transcriptional level. -- Expression analyzes reveal different responses to Cd and Zn exposure of S. caprea genotypes with different heavy metal accumulation abilities
Liu, Li Xue; Li, Qin Qin; Zhang, Yun Zeng; Hu, Yue; Jiao, Jian; Guo, Hui Juan; Zhang, Xing Xing; Zhang, Biliang; Chen, Wen Xin; Tian, Chang Fu
2017-12-01
Receiving nodulation and nitrogen fixation genes does not guarantee rhizobia an effective symbiosis with legumes. Here, variations in gene content were determined for three Sinorhizobium species showing contrasting symbiotic efficiency on soybeans. A nitrate-reduction gene cluster absent in S. sojae was found to be essential for symbiotic adaptations of S. fredii and S. sp. III. In S. fredii, the deletion mutation of the nap (nitrate reductase), instead of nir (nitrite reductase) and nor (nitric oxide reductase), led to defects in nitrogen-fixation (Fix - ). By contrast, none of these core nitrate-reduction genes were required for the symbiosis of S. sp. III. However, within the same gene cluster, the deletion of hemN1 (encoding oxygen-independent coproporphyrinogen III oxidase) in both S. fredii and S. sp. III led to the formation of nitrogen-fixing (Fix + ) but ineffective (Eff - ) nodules. These Fix + /Eff - nodules were characterized by significantly lower enzyme activity of glutamine synthetase indicating rhizobial modulation of nitrogen-assimilation by plants. A distant homologue of HemN1 from S. sojae can complement this defect in S. fredii and S. sp. III, but exhibited a more pleotropic role in symbiosis establishment. These findings highlighted the lineage-dependent optimization of symbiotic functions in different rhizobial species associated with the same host. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Andrej Benjak
2017-10-01
Full Text Available Mycobacterium lepraemurium is the causative agent of murine leprosy, a chronic, granulomatous disease similar to human leprosy. Due to the similar clinical manifestations of human and murine leprosy and the difficulty of growing both bacilli axenically, Mycobacterium leprae and M. lepraemurium were once thought to be closely related, although it was later suggested that M. lepraemurium might be related to Mycobacterium avium. In this study, the complete genome of M. lepraemurium was sequenced using a combination of PacBio and Illumina sequencing. Phylogenomic analyses confirmed that M. lepraemurium is a distinct species within the M. avium complex (MAC. The M. lepraemurium genome is 4.05 Mb in length, which is considerably smaller than other MAC genomes, and it comprises 2,682 functional genes and 1,139 pseudogenes, which indicates that M. lepraemurium has undergone genome reduction. An error-prone repair homologue of the DNA polymerase III α-subunit was found to be nonfunctional in M. lepraemurium, which might contribute to pseudogene formation due to the accumulation of mutations in nonessential genes. M. lepraemurium has retained the functionality of several genes thought to influence virulence among members of the MAC.
Directory of Open Access Journals (Sweden)
Young-Mi Lim
Full Text Available Sensory organs are constantly exposed to physical and chemical stresses that collectively threaten the survival of sensory neurons. Failure to protect stressed neurons leads to age-related loss of neurons and sensory dysfunction in organs in which the supply of new sensory neurons is limited, such as the human auditory system. Transducin β-like protein 1 (TBL1 is a candidate gene for ocular albinism with late-onset sensorineural deafness, a form of X-linked age-related hearing loss. TBL1 encodes an evolutionarily conserved F-box-like and WD40 repeats-containing subunit of the nuclear receptor co-repressor/silencing mediator for retinoid and thyroid hormone receptor and other transcriptional co-repressor complexes. Here we report that a Drosophila homologue of TBL1, Ebi, is required for maintenance of photoreceptor neurons. Loss of ebi function caused late-onset neuronal apoptosis in the retina and increased sensitivity to oxidative stress. Ebi formed a complex with activator protein 1 (AP-1 and was required for repression of Drosophila pro-apoptotic and anti-apoptotic genes expression. These results suggest that Ebi/AP-1 suppresses basal transcription levels of apoptotic genes and thereby protects sensory neurons from degeneration.
Directory of Open Access Journals (Sweden)
Turenne Christine
2009-08-01
Full Text Available Abstract Background In the past decade, the availability of complete genome sequence data has greatly facilitated comparative genomic research aimed at addressing genetic variability within species. More recently, analysis across species has become feasible, especially in genera where genome sequencing projects of multiple species have been initiated. To understand the genesis of the pathogen Mycobacterium tuberculosis within a genus where the majority of species are harmless environmental organisms, we have used genome sequence data from 16 mycobacteria to look for evidence of horizontal gene transfer (HGT associated with the emergence of pathogenesis. First, using multi-locus sequence analysis (MLSA of 20 housekeeping genes across these species, we derived a phylogeny that serves as the basis for HGT assignments. Next, we performed alignment searches for the 3989 proteins of M. tuberculosis H37Rv against 15 other mycobacterial genomes, generating a matrix of 59835 comparisons, to look for genetic elements that were uniquely found in M. tuberculosis and closely-related pathogenic mycobacteria. To assign when foreign genes were likely acquired, we designed a bioinformatic program called mycoHIT (mycobacterial homologue investigation tool to analyze these data in conjunction with the MLSA-based phylogeny. Results The bioinformatic screen predicted that 137 genes had been acquired by HGT at different phylogenetic strata; these included genes coding for metabolic functions and modification of mycobacterial lipids. For the majority of these genes, corroborating evidence of HGT was obtained, such as presence of phage or plasmid, and an aberrant GC%. Conclusion M. tuberculosis emerged through vertical inheritance along with the step-wise addition of genes acquired via HGT events, a process that may more generally describe the evolution of other pathogens.
Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.
Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao
2011-04-01
Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J
2014-01-01
Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.
Directory of Open Access Journals (Sweden)
John A Zebala
Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.
Xiang, Longkuan; Moore, Bradley S.
2003-01-01
The novel benzoyl coenzyme A (benzoyl-CoA) biosynthesis pathway in “Streptomyces maritimus” was investigated through a series of target-directed mutations. Genes involved in benzoyl-CoA formation were disrupted through single-crossover homologous recombination, and the resulting mutants were analyzed for their ability to biosynthesize the benzoyl-CoA-primed polyketide antibiotic enterocin. Inactivation of the unique phenylalanine ammonia-lyase-encoding gene encP was previously shown to be absolutely required for benzoyl-CoA formation in “S. maritimus”. The fatty acid β-oxidation-related genes encH, -I, and -J, on the other hand, are necessary but not required. In each case, the yield of benzoyl-CoA-primed enterocin dropped below wild-type levels. We attribute the reduced benzoyl-CoA formation in these specific mutants to functional substitution and cross-talk between the products of genes encH, -I, and -J and the enzyme homologues of primary metabolism. Disruption of the benzoate-CoA ligase encN gene did not perturb enterocin production, however, demonstrating that encN is extraneous and that benzoic acid is not a pathway intermediate. EncN rather serves as a substitute pathway for utilizing exogenous benzoic acid. These experiments provide further support that benzoyl-CoA is formed in a novel bacterial pathway that resembles the eukaryotic assembly of benzoyl-CoA from phenylalanine via a β-oxidative path. PMID:12511484
Insulin gene therapy for type 1 diabetes mellitus.
Handorf, Andrew M; Sollinger, Hans W; Alam, Tausif
2015-04-01
Type 1 diabetes mellitus is an autoimmune disease resulting from the destruction of pancreatic β cells. Current treatments for patients with type 1 diabetes mellitus include daily insulin injections or whole pancreas transplant, each of which are associated with profound drawbacks. Insulin gene therapy, which has shown great efficacy in correcting hyperglycemia in animal models, holds great promise as an alternative strategy to treat type 1 diabetes mellitus in humans. Insulin gene therapy refers to the targeted expression of insulin in non-β cells, with hepatocytes emerging as the primary therapeutic target. In this review, we present an overview of the current state of insulin gene therapy to treat type 1 diabetes mellitus, including the need for an alternative therapy, important features dictating the success of the therapy, and current obstacles preventing the translation of this treatment option to a clinical setting. In so doing, we hope to shed light on insulin gene therapy as a viable option to treat type 1 diabetes mellitus.
Gene discovery for the carcinogenic human liver fluke, Opisthorchis viverrini
Directory of Open Access Journals (Sweden)
Gasser Robin B
2007-06-01
Full Text Available Abstract Background Cholangiocarcinoma (CCA – cancer of the bile ducts – is associated with chronic infection with the liver fluke, Opisthorchis viverrini. Despite being the only eukaryote that is designated as a 'class I carcinogen' by the International Agency for Research on Cancer, little is known about its genome. Results Approximately 5,000 randomly selected cDNAs from the adult stage of O. viverrini were characterized and accounted for 1,932 contigs, representing ~14% of the entire transcriptome, and, presently, the largest sequence dataset for any species of liver fluke. Twenty percent of contigs were assigned GO classifications. Abundantly represented protein families included those involved in physiological functions that are essential to parasitism, such as anaerobic respiration, reproduction, detoxification, surface maintenance and feeding. GO assignments were well conserved in relation to other parasitic flukes, however, some categories were over-represented in O. viverrini, such as structural and motor proteins. An assessment of evolutionary relationships showed that O. viverrini was more similar to other parasitic (Clonorchis sinensis and Schistosoma japonicum than to free-living (Schmidtea mediterranea flatworms, and 105 sequences had close homologues in both parasitic species but not in S. mediterranea. A total of 164 O. viverrini contigs contained ORFs with signal sequences, many of which were platyhelminth-specific. Examples of convergent evolution between host and parasite secreted/membrane proteins were identified as were homologues of vaccine antigens from other helminths. Finally, ORFs representing secreted proteins with known roles in tumorigenesis were identified, and these might play roles in the pathogenesis of O. viverrini-induced CCA. Conclusion This gene discovery effort for O. viverrini should expedite molecular studies of cholangiocarcinogenesis and accelerate research focused on developing new interventions
Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton
2017-07-01
The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.
Human gene therapy: novel approaches to improve the current gene delivery systems.
Cucchiarini, Magali
2016-06-01
Even though gene therapy made its way through the clinics to treat a number of human pathologies since the early years of experimental research and despite the recent approval of the first gene-based product (Glybera) in Europe, the safe and effective use of gene transfer vectors remains a challenge in human gene therapy due to the existence of barriers in the host organism. While work is under active investigation to improve the gene transfer systems themselves, the use of controlled release approaches may offer alternative, convenient tools of vector delivery to achieve a performant gene transfer in vivo while overcoming the various physiological barriers that preclude its wide use in patients. This article provides an overview of the most significant contributions showing how the principles of controlled release strategies may be adapted for human gene therapy.
Mottram, J C; McCready, B P; Brown, K G; Grant, K M
1996-11-01
The generation of homozygous null mutants for the crk1 Cdc2-Related Kinase of Leishmania mexicana was attempted using targeted gene disruption. Promastigote mutants heterozygous for crk1 were readily isolated with a hyg-targeting fragment, but attempts to create null mutants by second-round transfections with a bie-targeting fragment yielded two classes of mutant, neither of which was null. First, the transfected fragment formed an episome; second, the cloned transfectants were found to contain wild-type crk1 alleles as well as hyg and ble integrations. DNA-content analysis revealed that these mutants were triploid or tetraploid. Plasticity in chromosome number following targeting has been proposed as a means by which Leishmania avoids deletion of essential genes. These data support this theory and implicate crk1 as an essential gene, validating CRK1 as a potential drug target. L mexicana transfected with a Trypanosoma brucel homologue, tbcrk1, was shown to be viable in an immcrk1 null background, thus showing complementation of function between these trypanosomatid genes. The expression of crk1 was further manipulated by engineering a six-histidine tag at the C-terminus of the kinase, allowing purification of the active complex by affinity selection on Nl(2+)-nitriloacetic acid (NTA) agarose.
Zeman, M; Mašlaňová, I; Indráková, A; Šiborová, M; Mikulášek, K; Bendíčková, K; Plevka, P; Vrbovská, V; Zdráhal, Z; Doškař, J; Pantůček, R
2017-04-13
Staphylococcus sciuri is a bacterial pathogen associated with infections in animals and humans, and represents a reservoir for the mecA gene encoding methicillin-resistance in staphylococci. No S. sciuri siphophages were known. Here the identification and characterization of two temperate S. sciuri phages from the Siphoviridae family designated ϕ575 and ϕ879 are presented. The phages have icosahedral heads and flexible noncontractile tails that end with a tail spike. The genomes of the phages are 42,160 and 41,448 bp long and encode 58 and 55 ORFs, respectively, arranged in functional modules. Their head-tail morphogenesis modules are similar to those of Staphylococcus aureus ϕ13-like serogroup F phages, suggesting their common evolutionary origin. The genome of phage ϕ575 harbours genes for staphylokinase and phospholipase that might enhance the virulence of the bacterial hosts. In addition both of the phages package a homologue of the mecA gene, which is a requirement for its lateral transfer. Phage ϕ879 transduces tetracycline and aminoglycoside pSTS7-like resistance plasmids from its host to other S. sciuri strains and to S. aureus. Furthermore, both of the phages efficiently adsorb to numerous staphylococcal species, indicating that they may contribute to interspecies horizontal gene transfer.
Fengler, Svenja; Spirer, Ina; Neef, Maren; Ecke, Margret; Hauslage, Jens; Hampp, Rüdiger
2016-06-01
Cell cultures of the plant model organism Arabidopsis thaliana were exposed to partial- g forces during parabolic flight and clinostat experiments (0.16 g, 0.38 g and 0.5 g were tested). In order to investigate gravity-dependent alterations in gene expression, samples were metabolically quenched by the fixative RNA later Ⓡ to stabilize nucleic acids and used for whole-genome microarray analysis. An attempt to identify the potential threshold acceleration for the gravity-dependent response showed that the smaller the experienced g-force, the greater was the susceptibility of the cell cultures. Compared to short-term μ g during a parabolic flight, the number of differentially expressed genes under partial- g was lower. In addition, the effect on the alteration of amounts of transcripts decreased during partial- g parabolic flight due to the sequence of the different parabolas (0.38 g, 0.16 g and μ g). A time-dependent analysis under simulated 0.5 g indicates that adaptation occurs within minutes. Differentially expressed genes (at least 2-fold up- or down-regulated in expression) under real flight conditions were to some extent identical with those affected by clinorotation. The highest number of homologuous genes was detected within seconds of exposure to 0.38 g (both flight and clinorotation). To a considerable part, these genes deal with cell wall properties. Additionally, responses specific for clinorotation were observed.
Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M
2013-05-10
Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad
Nanthini, Jayaram; Ong, Su Yean; Sudesh, Kumar
2017-09-10
Rubber materials have greatly contributed to human civilization. However, being a polymeric material does not decompose easily, it has caused huge environmental problems. On the other hand, only few bacteria are known to degrade rubber, with studies pertaining them being intensively focusing on the mechanism involved in microbial rubber degradation. The Streptomyces sp. strain CFMR 7, which was previously confirmed to possess rubber-degrading ability, was subjected to whole genome sequencing using the single molecule sequencing technology of the PacBio® RS II system. The genome was further analyzed and compared with previously reported rubber-degrading bacteria in order to identify the potential genes involved in rubber degradation. This led to the interesting discovery of three homologues of latex-clearing protein (Lcp) on the chromosome of this strain, which are probably responsible for rubber degrading activities. Genes encoding oxidoreductase α-subunit (oxiA) and oxidoreductase β-subunit (oxiB) were also found downstream of two lcp genes which are located adjacent to each other. In silico analysis reveals genes that have been identified to be involved in the microbial degradation of rubber in the Streptomyces sp. strain CFMR 7. This is the first whole genome sequence of a clear-zone-forming natural rubber- degrading Streptomyces sp., which harbours three Lcp homologous genes with the presence of oxiA and oxiB genes compared to the previously reported Gordonia polyisoprenivorans strain VH2 (with two Lcp homologous genes) and Nocardia nova SH22a (with only one Lcp gene). Copyright © 2017 Elsevier B.V. All rights reserved.
Vizzini, Aiti; Di Falco, Felicia; Parrinello, Daniela; Sanfratello, Maria Antonietta; Cammarata, Matteo
2016-02-01
Transforming growth factor (TGF-β) is a well-known component of a regulatory cytokines superfamily that has pleiotropic functions in a broad range of cell types and is involved, in vertebrates, in numerous physiological and pathological processes. In the current study, we report on Ciona intestinalis molecular characterisation and expression of a transforming growth factor β homologue (CiTGF-β). The gene organisation, phylogenetic tree and modelling supported the close relationship with the mammalian TGF suggesting that the C. intestinalis TGF-β gene shares a common ancestor in the chordate lineages. Functionally, real-time PCR analysis showed that CiTGF-β was transcriptionally upregulated in the inflammatory process induced by LPS inoculation, suggesting that is involved in the first phase and significant in the secondary phase of the inflammatory response in which cell differentiation occurs. In situ hybridisation assays revealed that the genes transcription was upregulated in the pharynx, the main organ of the ascidian immune system, and expressed by cluster of hemocytes inside the pharynx vessels. These data supported the view that CiTGF-β is a potential molecule in immune defence systems against bacterial infection. Copyright © 2015 Elsevier Ltd. All rights reserved.
Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J
2013-09-11
Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.
Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.
Directory of Open Access Journals (Sweden)
Yanyan Lu
2018-04-01
Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.
Characterization of a novel organic solute transporter homologue from Clonorchis sinensis
Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok
2018-01-01
Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646
Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.
2014-01-01
Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850
Weterings, K; Schrauwen, J; Wullems, G; Twell, D
1995-07-01
Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.
de Cambiaire, Jean-Charles; Otis, Christian; Lemieux, Claude; Turmel, Monique
2006-01-01
Background The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. While the basal position of the Prasinophyceae is well established, the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae (UTC) remains uncertain. The five complete chloroplast DNA (cpDNA) sequences currently available for representatives of these classes display considerable variability in overall structure, gene content, gene density, intron content and gene order. Among these genomes, that of the chlorophycean green alga Chlamydomonas reinhardtii has retained the least ancestral features. The two single-copy regions, which are separated from one another by the large inverted repeat (IR), have similar sizes, rather than unequal sizes, and differ radically in both gene contents and gene organizations relative to the single-copy regions of prasinophyte and ulvophyte cpDNAs. To gain insights into the various changes that underwent the chloroplast genome during the evolution of chlorophycean green algae, we have sequenced the cpDNA of Scenedesmus obliquus, a member of a distinct chlorophycean lineage. Results The 161,452 bp IR-containing genome of Scenedesmus features single-copy regions of similar sizes, encodes 96 genes, i.e. only two additional genes (infA and rpl12) relative to its Chlamydomonas homologue and contains seven group I and two group II introns. It is clearly more compact than the four UTC algal cpDNAs that have been examined so far, displays the lowest proportion of short repeats among these algae and shows a stronger bias in clustering of genes on the same DNA strand compared to Chlamydomonas cpDNA. Like the latter genome, Scenedesmus cpDNA displays only a few ancestral gene clusters. The two chlorophycean genomes share 11 gene clusters that are not found in previously sequenced trebouxiophyte and ulvophyte cpDNAs as well as a few genes that have an unusual structure; however, their single-copy regions differ
DEFF Research Database (Denmark)
Rendtorff, Nanna Dahl; Frödin, M; Attié-Bitach, T
2001-01-01
hybridization or reverse transcription-polymerase chain reaction. The cDNA of the mouse homologue was also cloned and mapped about 80 cM from the top of mouse chromosome 2. In mouse, Mial was also expressed in the cochlea and the vestibule of the inner ear, as well as in brain, eye, limb, and ovary. Expression...... in mammalian cell cultures showed that MIAL is translated as an approximately 15-kDa polypeptide that is assembled into a covalently linked homodimer, modified by sulfation, and secreted from the cells via the Golgi apparatus. In the human MIAL gene, a frequent polymorphism was discovered in the translation...
Molecular Characterization and Expression Pattern of Gene IGFBP-5 in the Cashmere Goat (
Directory of Open Access Journals (Sweden)
X. J. Wang
2012-05-01
Full Text Available Insulin-like growth factor-binding protein-5 (IGFBP-5 is one of the six members of IGFBP family, important for cell growth, apoptosis and other IGF-stimulated signaling pathways. In order to explore the significance of IGFBP-5 in cells of the Inner Mongolian Cashmere goat (Capra hircus, IGFBP-5 gene complementary DNA (cDNA was amplified by reverse transcription polymerase chain reaction (RT-PCR from the animal’s fetal fibroblasts and tissue-specific expression analysis was performed by semi-quantitative RT-PCR. The gene is 816 base pairs (bp in length and includes the complete open reading frame, encoding 271 amino acids (GenBank accession number JF720883. The full cDNA nucleotide sequence has a 99% identity with sheep, 98% with cattle and 95% with human. The amino acids sequence shares identity with 99%, 99% and 99%, respectively. The bioinformatics analysis showed that IGFBP-5 has an insulin growth factor-binding protein homologues (IB domain and a thyroglobulin type-1 (TY domain, four protein kinase C phosphorylation sites, five casein kinase II phosphorylation sites, three prenyl group binding sites (CaaX box. The IGFBP-5 gene was expressed in all the tested tissues including testis, brain, liver, lung, mammary gland, spleen, and kidney, suggesting that IGFBP-5 plays an important role in goat cells.
Candidate gene association studies in syndromic and non-syndromic cleft lip and palate
Energy Technology Data Exchange (ETDEWEB)
Daack-Hirsch, S.; Basart, A.; Frischmeyer, P. [Univ. of Iowa, IA (United States)] [and others
1994-09-01
Using ongoing case ascertainment through a birth defects registry, we have collected 219 nuclear families with non-syndromic cleft lip and/or palate and 111 families with a collection of syndromic forms. Syndromic cases include 24 with recognized forms and 72 with unrecognized syndromes. Candidate gene studies as well as genome-wide searches for evidence of microdeletions and isodisomy are currently being carried out. Candidate gene association studies, to date, have made use of PCR-based polymorphisms for TGFA, MSX1, CLPG13 (a CA repeat associated with a human homologue of a locus that results in craniofacial dysmorphogenesis in the mouse) and an STRP found in a Van der Woude syndrome microdeletion. Control tetranucleotide repeats, which insure that population-based differences are not responsible for any observed associations, are also tested. Studies of the syndromic cases have included the same list of candidate genes searching for evidence of microdeletions and a genome-wide search using tri- and tetranucleotide polymorphic markers to search for isodisomy or structural rearrangements. Significant associations have previously been identified for TGFA, and, in this report, identified for MSX1 and nonsyndromic cleft palate only (p = 0.04, uncorrected). Preliminary results of the genome-wide scan for isodisomy has returned no true positives and there has been no evidence for microdeletion cases.
Structure models of G72, the product of a susceptibility gene to schizophrenia.
Kato, Yusuke; Fukui, Kiyoshi
2017-02-01
The G72 gene is one of the most susceptible genes to schizophrenia and is contained exclusively in the genomes of primates. The product of the G72 gene modulates the activity of D-amino acid oxidase (DAO) and is a small protein prone to aggregate, which hampers its structural studies. In addition, lack of a known structure of a homologue makes it difficult to use the homology modelling method for the prediction of the structure. Thus, we first developed a hybrid ab initio approach for small proteins prior to the prediction of the structure of G72. The approach uses three known ab initio algorithms. To evaluate the hybrid approach, we tested our prediction of the structure of the amino acid sequences whose structures were already solved and compared the predicted structures with the experimentally solved structures. Based on these comparisons, the average accuracy of our approach was calculated to be ∼5 Å. We then applied the approach to the sequence of G72 and successfully predicted the structures of the N- and C-terminal domains (ND and CD, respectively) of G72. The predicted structures of ND and CD were similar to membrane-bound proteins and adaptor proteins, respectively. © The Authors 2016. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.
Directory of Open Access Journals (Sweden)
Hui Xu
2010-11-01
Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.
MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.
Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad
2010-11-01
MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.
Levine, Timothy P; Daniels, Rachel D; Gatta, Alberto T; Wong, Louise H; Hayes, Matthew J
2013-02-15
Fronto-temporal dementia (FTD) and amyotrophic lateral sclerosis (ALS, also called motor neuron disease, MND) are severe neurodegenerative diseases that show considerable overlap at the clinical and cellular level. The most common single mutation in families with FTD or ALS has recently been mapped to a non-coding repeat expansion in the uncharacterized gene C9ORF72. Although a plausible mechanism for disease is that aberrant C9ORF72 mRNA poisons splicing, it is important to determine the cellular function of C9ORF72, about which nothing is known. Sensitive homology searches showed that C9ORF72 is a full-length distant homologue of proteins related to Differentially Expressed in Normal and Neoplasia (DENN), which is a GDP/GTP exchange factor (GEF) that activates Rab-GTPases. Our results suggest that C9ORF72 is likely to regulate membrane traffic in conjunction with Rab-GTPase switches, and we propose to name the gene and its product DENN-like 72 (DENNL72).
Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues
Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.
2017-10-01
Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.
Transport of Magnesium by a Bacterial Nramp-Related Gene
Rodionov, Dmitry A.; Freedman, Benjamin G.; Senger, Ryan S.; Winkler, Wade C.
2014-01-01
Magnesium is an essential divalent metal that serves many cellular functions. While most divalent cations are maintained at relatively low intracellular concentrations, magnesium is maintained at a higher level (∼0.5–2.0 mM). Three families of transport proteins were previously identified for magnesium import: CorA, MgtE, and MgtA/MgtB P-type ATPases. In the current study, we find that expression of a bacterial protein unrelated to these transporters can fully restore growth to a bacterial mutant that lacks known magnesium transporters, suggesting it is a new importer for magnesium. We demonstrate that this transport activity is likely to be specific rather than resulting from substrate promiscuity because the proteins are incapable of manganese import. This magnesium transport protein is distantly related to the Nramp family of proteins, which have been shown to transport divalent cations but have never been shown to recognize magnesium. We also find gene expression of the new magnesium transporter to be controlled by a magnesium-sensing riboswitch. Importantly, we find additional examples of riboswitch-regulated homologues, suggesting that they are a frequent occurrence in bacteria. Therefore, our aggregate data discover a new and perhaps broadly important path for magnesium import and highlight how identification of riboswitch RNAs can help shed light on new, and sometimes unexpected, functions of their downstream genes. PMID:24968120
Positive selection on MHC class II DRB and DQB genes in the bank vole (Myodes glareolus).
Scherman, Kristin; Råberg, Lars; Westerdahl, Helena
2014-05-01
The major histocompatibility complex (MHC) class IIB genes show considerable sequence similarity between loci. The MHC class II DQB and DRB genes are known to exhibit a high level of polymorphism, most likely maintained by parasite-mediated selection. Studies of the MHC in wild rodents have focused on DRB, whilst DQB has been given much less attention. Here, we characterised DQB genes in Swedish bank voles Myodes glareolus, using full-length transcripts. We then designed primers that specifically amplify exon 2 from DRB (202 bp) and DQB (205 bp) and investigated molecular signatures of natural selection on DRB and DQB alleles. The presence of two separate gene clusters was confirmed using BLASTN and phylogenetic analysis, where our seven transcripts clustered according to either DQB or DRB homologues. These gene clusters were again confirmed on exon 2 data from 454-amplicon sequencing. Our DRB primers amplify a similar number of alleles per individual as previously published DRB primers, though our reads are longer. Traditional d N/d S analyses of DRB sequences in the bank vole have not found a conclusive signal of positive selection. Using a more advanced substitution model (the Kumar method) we found positive selection in the peptide binding region (PBR) of both DRB and DQB genes. Maximum likelihood models of codon substitutions detected positively selected sites located in the PBR of both DQB and DRB. Interestingly, these analyses detected at least twice as many positively selected sites in DQB than DRB, suggesting that DQB has been under stronger positive selection than DRB over evolutionary time.
Gechev, T.S.; Gadjev, I.Z.; Hille, J.
2004-01-01
A T-DNA knockout of the Arabidopsis homologue of the tomato disease resistance gene Asc was obtained. The asc gene renders plants sensitive to programmed cell death (PCD) triggered by the fungal AAL toxin. To obtain more insights into the nature of AAL-toxin-induced cell death and to identify genes
Potential mechanisms for cell-based gene therapy to treat HIV/AIDS.
Herrera-Carrillo, Elena; Berkhout, Ben
2015-02-01
An estimated 35 million people are infected with HIV worldwide. Anti-retroviral therapy (ART) has reduced the morbidity and mortality of HIV-infected patients but efficacy requires strict adherence and the treatment is not curative. Most importantly, the emergence of drug-resistant virus strains and drug toxicity can restrict the long-term therapeutic efficacy in some patients. Therefore, novel treatment strategies that permanently control or eliminate the virus and restore the damaged immune system are required. Gene therapy against HIV infection has been the topic of intense investigations for the last two decades because it can theoretically provide such a durable anti-HIV control. In this review we discuss two major gene therapy strategies to combat HIV. One approach aims to kill HIV-infected cells and the other is based on the protection of cells from HIV infection. We discuss the underlying molecular mechanisms for candidate approaches to permanently block HIV infection, including the latest strategies and future therapeutic applications. Hematopoietic stem cell-based gene therapy for HIV/AIDS may eventually become an alternative for standard ART and should ideally provide a functional cure in which the virus is durably controlled without medication. Recent results from preclinical research and early-stage clinical trials support the feasibility and safety of this novel strategy.
Gene therapy and genome surgery in the retina.
DiCarlo, James E; Mahajan, Vinit B; Tsang, Stephen H
2018-06-01
Precision medicine seeks to treat disease with molecular specificity. Advances in genome sequence analysis, gene delivery, and genome surgery have allowed clinician-scientists to treat genetic conditions at the level of their pathology. As a result, progress in treating retinal disease using genetic tools has advanced tremendously over the past several decades. Breakthroughs in gene delivery vectors, both viral and nonviral, have allowed the delivery of genetic payloads in preclinical models of retinal disorders and have paved the way for numerous successful clinical trials. Moreover, the adaptation of CRISPR-Cas systems for genome engineering have enabled the correction of both recessive and dominant pathogenic alleles, expanding the disease-modifying power of gene therapies. Here, we highlight the translational progress of gene therapy and genome editing of several retinal disorders, including RPE65-, CEP290-, and GUY2D-associated Leber congenital amaurosis, as well as choroideremia, achromatopsia, Mer tyrosine kinase- (MERTK-) and RPGR X-linked retinitis pigmentosa, Usher syndrome, neovascular age-related macular degeneration, X-linked retinoschisis, Stargardt disease, and Leber hereditary optic neuropathy.
Okeke, Malachy Ifeanyi; Hansen, Hilde; Traavik, Terje
2012-01-01
Human orthopoxvirus (OPV) infections in Europe are usually caused by cowpox virus (CPXV). The genetic heterogeneity of CPXVs may in part be due to recombination with other OPV species. We describe the characterization of an atypical CPXV (CPXV-No-H2) isolated from a human patient in Norway. CPXV-No-H2 was characterized on the basis of A-type inclusion (ATI) phenotype as well as the DNA region containing the p4c and atip open reading frames. CPXV-No-H2 produced atypical V(+/) ATI, in which virions are on the surface of ATI but not within the ATI matrix. Phylogenetic analysis showed that the atip gene of CPXV-No-H2 clustered closely with that of ectromelia virus (ECTV) with a bootstrap support of 100% whereas its p4c gene is diverged compared to homologues in other OPV species. By recombination analysis we identified a putative crossover event at nucleotide 147, downstream the start of the atip gene. Our results suggest that CPXV-No-H2 originated from a recombination between CPXV and ECTV. Our findings are relevant to the evolution of OPVs. Copyright © 2011 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Hu, R.-M.; Yang, T.-C.; Yang, S.-H.; Tseng, Y.-H.
2005-01-01
Xanthomonas campestris pv. campestris (Xcc), a close relative to Pseudomonas aeruginosa, is the pathogen causing black rot in cruciferous plants. In P. aeruginosa, FleQ serves as a cognate activator of σ 54 in transcription from several σ 54 -dependent promoters of flagellar genes. These P. aeruginosa promoters have been analyzed for FleQ-binding sequences; however, no consensus was deduced. Xcc, although lacks fleSR, has a fleQ homologue residing among over 40 contiguously clustered flagellar genes. A fleQ mutant, Xc17fleQ, constructed by insertional mutation is deficient in FleQ protein, non-flagellated, and immobile. Transcriptional fusion assays on six putative σ 54 -dependent promoters of the flagellar genes, fliE, fliQ, fliL, flgG, flgB, and flhF, indicated that each of them is also FleQ dependent. Each of these promoters has a sequence with weak consensus to 5'-gaaacCCgccgCcgctTt-3', immediately upstream of the predicted σ 54 -binding site, with an imperfect inverted repeat containing a GC-rich center flanked by several A and T at 5'- and 3'-ends, respectively. Replacing this region in fliE promoter with a HindIII recognition sequence abolished the transcription, indicating that this region responds to transcription activation by FleQ
The POU-er of gene nomenclature
DEFF Research Database (Denmark)
Frankenberg, Stephen R; Frank, Dale; Harland, Richard
2014-01-01
The pluripotency factor POU5F1 (OCT4) is well known as a key regulator of stem cell fate. Homologues of POU5F1 exist throughout vertebrates, but the evolutionary and functional relationships between the various family members have been unclear. The level to which function has been conserved withi...
DEFF Research Database (Denmark)
Tipsmark, Christian Kølbæk
2008-01-01
identified. Phylogenetic analysis suggests that six isoforms are homologues to the previously identified FXYD2, FXYD5, FXYD6, FXYD7, FXYD8 and FXYD9, while two additional isoforms were found (FXYD11 and FXYD12). Using quantitative PCR, tissue dependent expression of the different isoforms was analyzed......). In osmoregulatory tissues, one isoform was expressed predominantly in gill (FXYD11), one in kidney (FXYD2) and one equally in kidney and intestine (FXYD12). Expression of several FXYD genes in kidney and gill differed between fresh water and seawater salmon suggesting significance during osmoregulatory adaptations....... In addition to identify novel FXYD isoforms, these studies are the first to show the tissue dependence in their expression and modulation by salinity in any teleosts. Key words: Atlantic salmon, Na+,K+-ATPase, Osmoregulation, Salmo salar, QPCR....
DDC and COBL, flanking the imprinted GRB10 gene on 7p12, are biallelically expressed.
Hitchins, Megan P; Bentley, Louise; Monk, David; Beechey, Colin; Peters, Jo; Kelsey, Gavin; Ishino, Fumitoshi; Preece, Michael A; Stanier, Philip; Moore, Gudrun E
2002-12-01
Maternal duplication of human 7p11.2-p13 has been associated with Silver-Russell syndrome (SRS) in two familial cases. GRB10 is the only imprinted gene identified within this region to date. GRB10 demonstrates an intricate tissue- and isoform-specific imprinting profile in humans, with paternal expression in fetal brain and maternal expression of one isoform in skeletal muscle. The mouse homolog is maternally transcribed. The GRB10 protein is a potent growth inhibitor and represents a candidate for SRS, which is characterized by pre- and postnatal growth retardation and a spectrum of additional dysmorphic features. Since imprinted genes tend to be grouped in clusters, we investigated the imprinting status of the dopa-decarboxylase gene (DDC) and the Cordon-bleu gene (COBL) which flank GRB10 within the 7p11.2-p13 SRS duplicated region. Although both genes were found to replicate asynchronously, suggestive of imprinting, SNP expression analyses showed that neither gene was imprinted in multiple human fetal tissues. The mouse homologues, Ddc and Cobl, which map to the homologous imprinted region on proximal Chr 11, were also biallelically expressed in mice with uniparental maternal or paternal inheritance of this region. With the intent of using mouse Grb10 as an imprinted control, biallelic expression was consistently observed in fetal, postnatal, and adult brain of these mice, in contrast to the maternal-specific transcription previously demonstrated in brain in inter-specific F1 progeny. This may be a further example of over-expression of maternally derived transcripts in inter-specific mouse crosses. GRB10 remains the only imprinted gene identified within 7p11.2-p13.
Li, Huamin; Cui, Yanhua; Wu, Lixian; Tu, Ran; Chen, Sanfeng
2011-12-20
Our previous study indicated org35 was involved in chemotaxis and interacted with nitrogen fixation transcriptional activator NifA via PAS domain. In order to reveal the role of org35 in nitrogen regulation, the downstream target genes of org35 were identified. We here report differentially expressed genes in org35 mutants comparing with wild type Sp7 by means of cDNA-AFLP. Four up-regulated transcript-derived fragments (TDFs) homologues of chemotaxis transduction proteins were found, including CheW, methyl-accepting chemotaxis protein and response regulator CheY-like receiver. Three distinct TDFs (AB46, AB58 and AB63) were similar to PHB de-polymerase C-terminus, cell shape-determining protein and flagellin domain protein. And 11 TDFs showed similarities with signal transduction proteins, including homologous protein of the nitrogen regulation protein NtrY and nitrate/nitrite response regulator protein NarL. These data suggested that the Azospirillum brasilense org35 was a multi-effecter and involved in chemotaxis, cyst development and regulation of nitrogen fixation. Copyright © 2010 Elsevier GmbH. All rights reserved.
Hamada, Aska; Miyawaki, Katsuyuki; Honda-sumi, Eri; Tomioka, Kenji; Mito, Taro; Ohuchi, Hideyo; Noji, Sumihare
2009-08-01
In order to explore a possibility that the cricket Gryllus bimaculatus would be a useful model to unveil molecular mechanisms of human diseases, we performed loss-of-function analyses of Gryllus genes homologous to human genes that are responsible for human disorders, fragile X mental retardation 1 (fmr1) and Dopamine receptor (DopR). We cloned cDNAs of their Gryllus homologues, Gb'fmr1, Gb'DopRI, and Gb'DopRII, and analyzed their functions with use of nymphal RNA interference (RNAi). For Gb'fmr1, three major phenotypes were observed: (1) abnormal wing postures, (2) abnormal calling song, and (3) loss of the circadian locomotor rhythm, while for Gb'DopRI, defects of wing posture and morphology were found. These results indicate that the cricket has the potential to become a novel model system to explore human neuronal pathogenic mechanisms and to screen therapeutic drugs by RNAi. Copyright (c) 2009 Wiley-Liss, Inc.
Brown, N K; Harvey, D J
1988-04-01
Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.
International Nuclear Information System (INIS)
Lee, Kyung Han
2002-01-01
In addition to the well-established use of positron emission tomography (PET) in clinical oncology, novel roles for PET are rapidly emerging in the field of gene therapy. Methods for controlled gene delivery to living bodies, made available through advances in molecular biology, are currently being employed in animals for reasearch purposes and in humans to treat diseases such as cancer. Although gene therapy is still in its early developmental stage, it is perceived that many serious illnesses could be treated successfully by the use of therapeutic gene delivery. A major challenge for the widespread use of human gene therapy is to achieve a controlled and effective delivery of foreign genes to target cells and subsequently, adequate levels of expression. As such, the availability of noninvasive imaging methods to accurately assess the location, duration, and level of transgene expression is critical for optimizing gene therapy strategies. Current endeavors to achieve this goal include methods that utilize magnetic resonance imaging, optical imaging, and nuclear imaging techniques. As for PET, reporter systems that utilize gene encoding enzymes that accumulate postion labeled substrates and those transcribing surface receptors that bind specific positron labeled ligands have been successfully developed. More recent advances in this area include improved reporter gene constructs and radiotracers, introduction of potential strategies to monitor endogenous gene expression, and human pilot studies evaluating the distribution and safety of reporter PET tracers. The remarkably rapid progress occuring in gene imaging technology indicates its importance and wide range of application. As such, gene imaging is likely to become a major and exciting new area for future application of PET technology
Energy Technology Data Exchange (ETDEWEB)
Lee, Kyung Han [School of Medicine, Sungkyunkwan Univ., Seoul (Korea, Republic of)
2002-02-01
In addition to the well-established use of positron emission tomography (PET) in clinical oncology, novel roles for PET are rapidly emerging in the field of gene therapy. Methods for controlled gene delivery to living bodies, made available through advances in molecular biology, are currently being employed in animals for reasearch purposes and in humans to treat diseases such as cancer. Although gene therapy is still in its early developmental stage, it is perceived that many serious illnesses could be treated successfully by the use of therapeutic gene delivery. A major challenge for the widespread use of human gene therapy is to achieve a controlled and effective delivery of foreign genes to target cells and subsequently, adequate levels of expression. As such, the availability of noninvasive imaging methods to accurately assess the location, duration, and level of transgene expression is critical for optimizing gene therapy strategies. Current endeavors to achieve this goal include methods that utilize magnetic resonance imaging, optical imaging, and nuclear imaging techniques. As for PET, reporter systems that utilize gene encoding enzymes that accumulate postion labeled substrates and those transcribing surface receptors that bind specific positron labeled ligands have been successfully developed. More recent advances in this area include improved reporter gene constructs and radiotracers, introduction of potential strategies to monitor endogenous gene expression, and human pilot studies evaluating the distribution and safety of reporter PET tracers. The remarkably rapid progress occuring in gene imaging technology indicates its importance and wide range of application. As such, gene imaging is likely to become a major and exciting new area for future application of PET technology.
Rico-Gomis, José María; Palazón-Bru, Antonio; Triano-García, Irene; Mahecha-García, Luis Fabián; García-Monsalve, Ana; Navarro-Ruiz, Andrés; Villagordo-Peñalver, Berta; Martínez-Hortelano, Alicia; Gil-Guillén, Vicente Francisco
2018-04-15
An association has been found between the C allele of the rs1414334 polymorphism in the HTR2C gene and the metabolic syndrome in psychiatric patients. However, no study has yet evaluated whether this allele is associated with smoking. To assess this issue, therefore, we performed a cross-sectional study with a sample of 166 adult patients treated with atypical antipsychotics in 2012-2013 in a region of Spain. The primary variable was the presence of the C allele of the rs1414334 polymorphism in the HTR2C gene. Secondary variables were the number of pack-years (number of cigarettes per day x number of smoking years ÷ 20), age, gender, schizophrenia, years since diagnosis, metabolic syndrome criteria and SCORE. A stepwise binary logistic regression model was constructed to determine associations between primary and secondary variables and their area under the ROC curve (AUC) was calculated. Of the total sample, 33 patients (19.9%) had the C allele of the polymorphism analyzed. Mean cigarette consumption was 11.6 pack-years. The multivariate analysis showed the following factors as associated with the polymorphism: higher cigarette consumption, being a woman, and not having abdominal obesity. The AUC was 0.706. An association was found between increased cigarette consumption over the years and the presence of the C allele of the rs1414334 polymorphism in the HTR2C gene.
Apolipoprotein gene involved in lipid metabolism
Rubin, Edward; Pennacchio, Len A.
2007-07-03
Methods and materials for studying the effects of a newly identified human gene, APOAV, and the corresponding mouse gene apoAV. The sequences of the genes are given, and transgenic animals which either contain the gene or have the endogenous gene knocked out are described. In addition, single nucleotide polymorphisms (SNPs) in the gene are described and characterized. It is demonstrated that certain SNPs are associated with diseases involving lipids and triglycerides and other metabolic diseases. These SNPs may be used alone or with SNPs from other genes to study individual risk factors. Methods for intervention in lipid diseases, including the screening of drugs to treat lipid-related or diabetic diseases are also disclosed.
Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.
2016-01-01
Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141
SolRgene: an online database to explore disease resistance genes in tuber-bearing Solanum species
Directory of Open Access Journals (Sweden)
Vleeshouwers Vivianne GAA
2011-08-01
Full Text Available Abstract Background The cultivated potato (Solanum tuberosum L. is an important food crop, but highly susceptible to many pathogens. The major threat to potato production is the Irish famine pathogen Phytophthora infestans, which causes the devastating late blight disease. Potato breeding makes use of germplasm from wild relatives (wild germplasm to introduce resistances into cultivated potato. The Solanum section Petota comprises tuber-bearing species that are potential donors of new disease resistance genes. The aim of this study was to explore Solanum section Petota for resistance genes and generate a widely accessible resource that is useful for studying and implementing disease resistance in potato. Description The SolRgene database contains data on resistance to P. infestans and presence of R genes and R gene homologues in Solanum section Petota. We have explored Solanum section Petota for resistance to late blight in high throughput disease tests under various laboratory conditions and in field trials. From resistant wild germplasm, segregating populations were generated and assessed for the presence of resistance genes. All these data have been entered into the SolRgene database. To facilitate genetic and resistance gene evolution studies, phylogenetic data of the entire SolRgene collection are included, as well as a tool for generating phylogenetic trees of selected groups of germplasm. Data from resistance gene allele-mining studies are incorporated, which enables detection of R gene homologs in related germplasm. Using these resources, various resistance genes have been detected and some of these have been cloned, whereas others are in the cloning pipeline. All this information is stored in the online SolRgene database, which allows users to query resistance data, sequences, passport data of the accessions, and phylogenic classifications. Conclusion Solanum section Petota forms the basis of the SolRgene database, which contains a
Kirschner, Doris B; vom Baur, Elmar; Thibault, Christelle; Sanders, Steven L; Gangloff, Yann-Gaël; Davidson, Irwin; Weil, P Anthony; Tora, Làszlò
2002-05-01
The RNA polymerase II transcription factor TFIID, composed of the TATA-binding protein (TBP) and TBP-associated factors (TAF(II)s), nucleates preinitiation complex formation at protein-coding gene promoters. SAGA, a second TAF(II)-containing multiprotein complex, is involved in transcription regulation in Saccharomyces cerevisiae. One of the essential protein components common to SAGA and TFIID is yTAF(II)25. We define a minimal evolutionarily conserved 91-amino-acid region of TAF(II)25 containing a histone fold domain that is necessary and sufficient for growth in vivo. Different temperature-sensitive mutations of yTAF(II)25 or chimeras with the human homologue TAF(II)30 arrested cell growth at either the G(1) or G(2)/M cell cycle phase and displayed distinct phenotypic changes and gene expression patterns. Immunoprecipitation studies revealed that TAF(II)25 mutation-dependent gene expression and phenotypic changes correlated at least partially with the integrity of SAGA and TFIID. Genome-wide expression analysis revealed that the five TAF(II)25 temperature-sensitive mutant alleles individually affect the expression of between 18 and 33% of genes, whereas taken together they affect 64% of all class II genes. Thus, different yTAF(II)25 mutations induce distinct phenotypes and affect the regulation of different subsets of genes, demonstrating that no individual TAF(II) mutant allele reflects the full range of its normal functions.
Neuhausen, J; Eichler, B
2004-01-01
The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.
TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.
Yasuhara, Hiroki; Oe, Yuki
2011-07-01
TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.
Directory of Open Access Journals (Sweden)
Seyed Mehdi Hosseini Mazinani
2014-12-01
Full Text Available Olive is one of the most important fruit crops throughout the Mediterranean Basin, mainly propagated by cuttings. The adventitious root development is a key stage in vegetative propagation however the low rooting capacity of some cultivars severely affects the efficiency of olive clonal propagation. Auxin Influx Carrier gene (AUX1, plays a key role in lateral root formation in many plant species promoting the export of IAA from newly developing leaves to lateral root primordia. Putative olive homologues were amplified by using degenerate primers designed on the conserved regions of AUX1 transcripts identified in other plants. Transcript and amino acid sequences in root (OeAUX1R and base of cutting (OeAUX1B were different causes of polymorphisms relating to possible distinct roles in these tissues. In order to investigate the gene expression patterns, Real-time PCR was performed on cuttings during the rooting stage collected from genotypes characterized by high and low rooting ability. Moreover, the gene expression was investigated on different olive tissues. Preliminary results showed that the expression of OeAUX1B and OeAUX1R in base of cuttings and roots of the high-rooting genotype were higher which suggests the hypothesis of the involvement of OeAUX1 in olive rooting. Bioinformatics analysis revealed that AUX1 gene had 8 exons in olive and the sequence of this gene in plant was conserved during evolution.
Energy Technology Data Exchange (ETDEWEB)
Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)
2007-02-15
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
International Nuclear Information System (INIS)
Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying
2007-01-01
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
The effects of antenatal depression and antidepressant treatment on placental gene expression
Directory of Open Access Journals (Sweden)
Jocelien DA Olivier
2015-01-01
Full Text Available The effects of antenatal depression and antidepressant treatment during pregnancy on both mother and child are vigorously studied, but the underlying biology for these effects is largely unknown. The placenta plays a crucial role in the growth and development of the fetus. We performed a gene expression study on the fetal side of the placenta to investigate gene expression patterns in mothers with antenatal depression and in mothers using antidepressant treatment during pregnancy.Placental samples from mothers with normal pregnancies, from mothers with antenatal depression, and from mothers using antidepressants were collected. We performed a pilot microarray study to investigate alterations in the gene expression and selected several genes from the microarray for biological validation with qPCR in a larger sample.In mothers with antenatal depression 108 genes were differentially expressed, whereas 109 genes were differentially expressed in those using antidepressants. Validation of the microarray revealed more robust gene expression differences in the seven genes picked for confirmation in antidepressant-treated women than in depressed women. Among the genes that were validated ROCK2 and C12orf39 were differentially expressed in both depressed and antidepressant-treated women, whereas ROCK1, GCC2, KTN1, and DNM1L were only differentially expressed in the antidepressant-treated women. In conclusion, antenatal depression and antidepressant exposure during pregnancy are associated with altered gene expression in the placenta. Findings on those genes picked for validation were more robust among antidepressant-treated women than in depressed women, possibly due to the fact that depression is a multifactorial condition with varying degrees of endocrine disruption. It remains to be established whether the alterations found in the gene expression of the placenta are found in the fetus as well.
Detection of biosurfactants in Bacillus species: genes and products identification.
Płaza, G; Chojniak, J; Rudnicka, K; Paraszkiewicz, K; Bernat, P
2015-10-01
To screen environmental Bacillus strains for detection of genes encoding the enzymes involved in biosurfactant synthesis and to evaluate their products e.g. surfactin, iturin and fengycin. The taxonomic identification of isolated from the environment Bacillus strains was performed by Microgene ID Bacillus panel and GEN III Biolog system. The polymerase chain reaction (PCR) strategy for screening of genes in Bacillus strains was set up. Liquid chromatography-mass spectrometry (LC-MS/MS) method was used for the identification of lipopeptides (LPs). All studied strains exhibited the presence of srfAA gene and produced surfactin mostly as four homologues (C13 to C16). Moreover, in 2 strains (KP7, T'-1) simultaneous co-production of 3 biosurfactants: surfactin, iturin and fengycin was observed. Additionally, it was found out that isolate identified as Bacillus subtilis ssp. subtilis (KP7), beside LPs co-production, synthesizes surfactin with the efficiency much higher than other studied strains (40·2 mg l(-1) ) and with the yield ranging from 0·8 to 8·3 mg l(-1) . We showed that the combined methodology based on PCR and LC-MS/MS technique is an optimal tool for the detection of genes encoding enzymes involved in biosurfactant synthesis as well as their products, e.g. surfactin, iturin and fengycin. This approach improves the screening and the identification of environmental Bacillus co-producing biosurfactants-stimulating and facilitating the development of this area of science. The findings of this work will help to improve screening of biosurfactant producers. Discovery of novel biosurfactants and biosurfactants co-production ability has shed light on their new application fields and for the understanding of their interactions and properties. © 2015 The Society for Applied Microbiology.
Korovesi, Artemis G; Ntertilis, Maria; Kouvelis, Vassili N
2018-05-12
The nuclear ribosomal protein S3 (Rps3) is implicated in the assembly of the ribosomal small subunit. Fungi and plants present a gene copy in their mitochondrial (mt) genomes. An analysis of 303 complete fungal mt genomes showed that, when rps3 is found, it is either a free-standing gene or an anchored gene within the omega intron of the rnl gene. Early divergent fungi, Basidiomycota and all yeasts but the CTG group belong to the first case, and Pezizomycotina to the second. Its position, size and genetic code employed are conserved within species of the same Order. Size variability is attributed to different number of repeats. These repeats consist of AT-rich sequences. MtRps3 proteins lack the KH domain, necessary for binding to rRNA, in their N-terminal region. Their C-terminal region is conserved in all Domains of life. Phylogenetic analysis showed that nuclear and mt Rps3 proteins are descendants of archaeal and a-proteobacterial homologues, respectively. Thus, fungal mt-rps3 gene is an ancient gene which evolved within the endosymbiotic model and presents different evolutionary routes: (a) coming from a-proteobacteria, it was relocated to another region of the mt genome, (b) via its insertion to the omega intron, it was transferred to the nucleus and/or got lost, and (c) it was re-routed to the mt genome again. Today, Basidiomycota and Saccharomycetales seem to follow the first evolutionary route and almost all Pezizomycotina support the second scenario with their exceptions being the result of the third scenario, i.e., the gene's re-entry to the mt genome. Copyright © 2018. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Tianqi Jia
Full Text Available Longan (Dimocarpus longan L. is a tropical/subtropical fruit tree of significant economic importance in Southeast Asia. However, a lack of transcriptomic and genomic information hinders research on longan traits, such as the control of flowering. In this study, high-throughput RNA sequencing (RNA-Seq was used to investigate differentially expressed genes between a unique longan cultivar 'Sijimi'(S which flowers throughout the year and a more typical cultivar 'Lidongben'(L which flowers only once in the season, with the aim of identifying candidate genes associated with continuous flowering. 36,527 and 40,982 unigenes were obtained by de novo assembly of the clean reads from cDNA libraries of L and S cultivars. Additionally 40,513 unigenes were assembled from combined reads of these libraries. A total of 32,475 unigenes were annotated by BLAST search to NCBI non-redundant protein (NR, Swiss-Prot, Clusters of Orthologous Groups (COGs and Kyoto Encyclopedia of Genes and Genomes (KEGG databases. Of these, almost fifteen thousand unigenes were identified as significantly differentially expressed genes (DEGs by using Reads Per kb per Million reads (RPKM method. A total of 6,415 DEGs were mapped to 128 KEGG pathways, and 8,743 DEGs were assigned to 54 Gene Ontology categories. After blasting the DEGs to public sequence databases, 539 potential flowering-related DEGs were identified. In addition, 107 flowering-time genes were identified in longan, their expression levels between two longan samples were compared by RPKM method, of which the expression levels of 15 were confirmed by real-time quantitative PCR. Our results suggest longan homologues of SHORT VEGETATIVE PHASE (SVP, GIGANTEA (GI, F-BOX 1 (FKF1 and EARLY FLOWERING 4 (ELF4 may be involved this flowering trait and ELF4 may be a key gene. The identification of candidate genes related to continuous flowering will provide new insight into the molecular process of regulating flowering time in woody
Tindwa, Hamisi; Jo, Yong Hun; Patnaik, Bharat Bhusan; Noh, Mi Young; Kim, Dong Hyun; Kim, Iksoo; Han, Yeon Soo; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung
2015-01-01
Macroautophagy (autophagy) is an evolutionarily conserved catabolic process involved in physiological and developmental processes including cell survival, death, and innate immunity. Homologues of most of 36 originally discovered autophagy-related (ATG) genes in yeast have been characterized in higher eukaryotes including insects. In this study, the homologues of ATG3 (TmATG3) and ATG5 (TmATG5) were isolated from the coleopteran beetle, Tenebrio molitor by expressed sequence tag and RNAseq approaches. The cDNA of TmATG3 and TmATG5 comprise open-reading frame sizes of 963 and 792 bp encoding polypeptides of 320 and 263 amino acid residues, respectively. TmATG3 and TmATG5 mRNA are expressed in all developmental stages, and mainly in fat body and hemocytes of larvae. TmATG3 and TmATG5 showed an overall sequence identity of 58-95% to other insect Atg proteins. There exist clear one-to-one orthologs of TmATG3 and TmATG5 in Tribolium and that they clustered together in the gene tree. Depletion of TmATG3 and TmATG5 by RNA interference led to a significant reduction in survival ability of T. molitor larvae against an intracellular pathogen, Listeria monocytogenes. Six days post-Listeria challenge, the survival rate in the dsEGFP-injected (where EGFP is enhanced green fluorescent protein) control larvae was significantly higher (55%) compared to 4 and 3% for TmATG3 and TmATG5 double-stranded RNA injected larvae, respectively. These data suggested that TmATG3 and TmATG5 may play putative role in mediating autophagy-based clearance of Listeria in T. molitor model. © 2014 Wiley Periodicals, Inc.
Cheng, Robert Y S; Zhao, Ailian; Alvord, W Gregory; Powell, Douglas A; Bare, Robert M; Masuda, Akira; Takahashi, Takashi; Anderson, Lucy M; Kasprzak, Kazimierz S
2003-08-15
Occupational exposure to nickel compounds is associated with lung cancer risk; both genotoxic and epigenetic mechanisms have been proposed. For comprehensive examination of the acute effects of nickel(II) acetate on gene expression in cultured human peripheral lung epithelial HPL1D cells, microarray analyses were carried out with cDNA chips (approximately 8000 cDNAs). Cells were exposed for 24 h to nontoxic (50, 100, and 200 microM) or toxic (400, 800, and 1600 microM) nickel(II) concentrations. Cluster analysis was applied to the 868 genes with > or = 2-fold change at any concentration. Two main clusters showed marked up- or down-regulation at the highest, toxic concentrations. The data further subdivided into 10 highly cohesive clusters with high probability, and of these only 2 had the same response trend at low nontoxic as at high concentrations, an observation of clear relevance to the process of high- to low-dose extrapolation in risk assessment. There were 113 genes showing > or = 2-fold change at the three lower nontoxic concentrations, those most relevant to in vivo carcinogenesis. In addition to expected responses of metallothionein, ferritin, and heat-shock proteins, the results revealed for the first time changed expression of some potential cancer-related genes in response to low-dose Ni(II): RhoA, dyskerin, interferon regulatory factor 1, RAD21 homologue, and tumor protein, translationally controlled. Overall, most of the genes impacted by nontoxic concentrations of nickel(II) acetate related to gene transcription, protein synthesis and stability, cytoskeleton, signaling, metabolism, cell membrane, and extracellular matrix.
Cloning, characterization and promoter analysis of common carp
Indian Academy of Sciences (India)
Some members of hairy/Enhancer-of-split-related gene (HES) family have important effects on axial mesoderm segmentation and the establishment and maintenance of the somite fringe. In fishes, the her6 gene, a member of the HES family, is the homologue of hes1 in mammals and chicken. In this study, the her6 gene ...
A remarkably stable TipE gene cluster: evolution of insect Para sodium channel auxiliary subunits
Directory of Open Access Journals (Sweden)
Li Jia
2011-11-01
Full Text Available Abstract Background First identified in fruit flies with temperature-sensitive paralysis phenotypes, the Drosophila melanogaster TipE locus encodes four voltage-gated sodium (NaV channel auxiliary subunits. This cluster of TipE-like genes on chromosome 3L, and a fifth family member on chromosome 3R, are important for the optional expression and functionality of the Para NaV channel but appear quite distinct from auxiliary subunits in vertebrates. Here, we exploited available arthropod genomic resources to trace the origin of TipE-like genes by mapping their evolutionary histories and examining their genomic architectures. Results We identified a remarkably conserved synteny block of TipE-like orthologues with well-maintained local gene arrangements from 21 insect species. Homologues in the water flea, Daphnia pulex, suggest an ancestral pancrustacean repertoire of four TipE-like genes; a subsequent gene duplication may have generated functional redundancy allowing gene losses in the silk moth and mosquitoes. Intronic nesting of the insect TipE gene cluster probably occurred following the divergence from crustaceans, but in the flour beetle and silk moth genomes the clusters apparently escaped from nesting. Across Pancrustacea, TipE gene family members have experienced intronic nesting, escape from nesting, retrotransposition, translocation, and gene loss events while generally maintaining their local gene neighbourhoods. D. melanogaster TipE-like genes exhibit coordinated spatial and temporal regulation of expression distinct from their host gene but well-correlated with their regulatory target, the Para NaV channel, suggesting that functional constraints may preserve the TipE gene cluster. We identified homology between TipE-like NaV channel regulators and vertebrate Slo-beta auxiliary subunits of big-conductance calcium-activated potassium (BKCa channels, which suggests that ion channel regulatory partners have evolved distinct lineage
Platt, Adam; Morten, John; Ji, Qunsheng; Elvin, Paul; Womack, Chris; Su, Xinying; Donald, Emma; Gray, Neil; Read, Jessica; Bigley, Graham; Blockley, Laura; Cresswell, Carl; Dale, Angela; Davies, Amanda; Zhang, Tianwei; Fan, Shuqiong; Fu, Haihua; Gladwin, Amanda; Harrod, Grace; Stevens, James; Williams, Victoria; Ye, Qingqing; Zheng, Li; de Boer, Richard; Herbst, Roy S; Lee, Jin-Soo; Vasselli, James
2015-03-23
To determine the prevalence of RET rearrangement genes, RET copy number gains and expression in tumor samples from four Phase III non-small-cell lung cancer (NSCLC) trials of vandetanib, a selective inhibitor of VEGFR, RET and EGFR signaling, and to determine any association with outcome to vandetanib treatment. Archival tumor samples from the ZODIAC ( NCT00312377 , vandetanib ± docetaxel), ZEAL ( NCT00418886 , vandetanib ± pemetrexed), ZEPHYR ( NCT00404924 , vandetanib vs placebo) and ZEST ( NCT00364351 , vandetanib vs erlotinib) studies were evaluated by fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) in 944 and 1102 patients. The prevalence of RET rearrangements by FISH was 0.7% (95% CI 0.3-1.5%) among patients with a known result. Seven tumor samples were positive for RET rearrangements (vandetanib, n = 3; comparator, n = 4). 2.8% (n = 26) of samples had RET amplification (innumerable RET clusters, or ≥7 copies in > 10% of tumor cells), 8.1% (n = 76) had low RET gene copy number gain (4-6 copies in ≥40% of tumor cells) and 8.3% (n = 92) were RET expression positive (signal intensity ++ or +++ in >10% of tumor cells). Of RET-rearrangement-positive patients, none had an objective response in the vandetanib arm and one patient responded in the comparator arm. Radiologic evidence of tumor shrinkage was observed in two patients treated with vandetanib and one treated with comparator drug. The objective response rate was similar in the vandetanib and comparator arms for patients positive for RET copy number gains or RET protein expression. We have identified prevalence for three RET biomarkers in a population predominated by non-Asians and smokers. RET rearrangement prevalence was lower than previously reported. We found no evidence of a differential benefit for efficacy by IHC and RET gene copy number gains. The low prevalence of RET rearrangements (0.7%) prevents firm conclusions regarding association of vandetanib treatment with
Functional analysis of the ComK protein of Bacillus coagulans
Kovács, Á.T.; Eckhardt, T.H.; Hartskamp, van M.; Kranenburg, van R.; Kuipers, O.P.
2013-01-01
The genes for DNA uptake and recombination in Bacilli are commonly regulated by the transcriptional factor ComK. We have identified a ComK homologue in Bacillus coagulans, an industrial relevant organism that is recalcitrant for transformation. Introduction of B. coagulans comK gene under its own
Functional Analysis of the ComK Protein of Bacillus coagulans
Kovacs, Akos; Eckhardt, Thomas; van Kranenburg, Richard; Kuipers, Oscar
2013-01-01
The genes for DNA uptake and recombination in Bacilli are commonly regulated by the transcriptional factor ComK. We have identified a ComK homologue in Bacillus coagulans, an industrial relevant organism that is recalcitrant for transformation. Introduction of B. coagulans comK gene under its own
TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.
Directory of Open Access Journals (Sweden)
Shuai Wang
Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.
Denslow, N D; Bowman, C J; Ferguson, R J; Lee, H S; Hemmer, M J; Folmar, L C
2001-03-01
The recent interest in hormonally active environmental contaminants has sparked a drive to find sensitive methods to measure their effects on wildlife. A molecular-based assay has been developed to measure the induction of gene expression in sheepshead minnows (Cyprinodon variegatus) exposed in vivo to the natural and pharmaceutical estrogens 17beta-estradiol, ethinylestradiol, and diethylstilbestrol. This method used differential display reverse transcriptase polymerase chain reaction assays to compare the expression of individual mRNAs from control and estrogen-exposed fish. Forty-eight differentially expressed cDNAs were isolated by this method, including cDNAs for vitelline envelope proteins and vitellogenin. The mRNA expression patterns for fish injected with a pharmacological dose of estradiol (5 mg/kg) were identical to those obtained in fish receiving constant aqueous exposure to 212 ng estradiol/liter. Further, the cDNA "fingerprint" pattern observed in the estradiol-treated fish also matched that obtained in fish receiving continuous-flow aqueous exposures to 192 ng ethinyl estradiol/liter and a nominal concentration of 200 ng diethylstilbestrol/liter. The results demonstrate a characteristic expression pattern for genes upregulated by exposure to a variety of natural and anthropogenic estrogens and suggest this approach may be valuable to examine the potential effects of environmental contaminants on other endocrine-mediated pathways of reproduction, growth, and development. Copyright 2001 Academic Press.
TRAP230/ARC240 and TRAP240/ARC250 Mediator subunits are functionally conserved through evolution
DEFF Research Database (Denmark)
Samuelsen, Camilla O; Baraznenok, Vera; Khorosjutina, Olga
2003-01-01
In Saccharomyces cerevisiae Mediator, a subgroup of proteins (Srb8, Srb9, Srb10, and Srb11) form a module, which is involved in negative regulation of transcription. Homologues of Srb10 and Srb11 are found in some mammalian Mediator preparations, whereas no clear homologues have been reported...... for Srb8 and Srb9. Here, we identify a TRAP240/ARC250 homologue in Schizosaccharomyces pombe and demonstrate that this protein, spTrap240, is stably associated with a larger form of Mediator, which also contains conserved homologues of Srb8, Srb10, and Srb11. We find that spTrap240 and Sch. pombe Srb8 (sp......Srb8) regulate the same distinct subset of genes and have indistinguishable phenotypic characteristics. Importantly, Mediator containing the spSrb8/spTrap240/spSrb10/spSrb11 subunits is isolated only in free form, devoid of RNA polymerase II. In contrast, Mediator lacking this module associates...
Caffeine exposure alters cardiac gene expression in embryonic cardiomyocytes
Fang, Xiefan; Mei, Wenbin; Barbazuk, William B.; Rivkees, Scott A.
2014-01-01
Previous studies demonstrated that in utero caffeine treatment at embryonic day (E) 8.5 alters DNA methylation patterns, gene expression, and cardiac function in adult mice. To provide insight into the mechanisms, we examined cardiac gene and microRNA (miRNA) expression in cardiomyocytes shortly after exposure to physiologically relevant doses of caffeine. In HL-1 and primary embryonic cardiomyocytes, caffeine treatment for 48 h significantly altered the expression of cardiac structural genes (Myh6, Myh7, Myh7b, Tnni3), hormonal genes (Anp and BnP), cardiac transcription factors (Gata4, Mef2c, Mef2d, Nfatc1), and microRNAs (miRNAs; miR208a, miR208b, miR499). In addition, expressions of these genes were significantly altered in embryonic hearts exposed to in utero caffeine. For in utero experiments, pregnant CD-1 dams were treated with 20–60 mg/kg of caffeine, which resulted in maternal circulation levels of 37.3–65.3 μM 2 h after treatment. RNA sequencing was performed on embryonic ventricles treated with vehicle or 20 mg/kg of caffeine daily from E6.5-9.5. Differential expression (DE) analysis revealed that 124 genes and 849 transcripts were significantly altered, and differential exon usage (DEU) analysis identified 597 exons that were changed in response to prenatal caffeine exposure. Among the DE genes identified by RNA sequencing were several cardiac structural genes and genes that control DNA methylation and histone modification. Pathway analysis revealed that pathways related to cardiovascular development and diseases were significantly affected by caffeine. In addition, global cardiac DNA methylation was reduced in caffeine-treated cardiomyocytes. Collectively, these data demonstrate that caffeine exposure alters gene expression and DNA methylation in embryonic cardiomyocytes. PMID:25354728
Peng, Wei; Zheng, Wenping; Handler, Alfred M; Zhang, Hongyu
2015-12-01
Transformer (tra) is a switch gene in the somatic sex-determination hierarchy that regulates sexual dimorphism based on RNA splicing in many insects. In tephritids, a Y-linked male determining gene (M) controls sex in the sex-determination pathway. Here, homologues of Drosophila tra and transformer-2 (tra-2) genes were isolated and characterized in Bactrocera dorsalis (Hendel), one of the most destructive agricultural insect pests in many Asian countries. Two male-specific and one female-specific isoforms of B. dorsalis transformer (Bdtra) were identified. The presence of multiple TRA/TRA-2 binding sites in Bdtra suggests that the TRA/TRA-2 proteins are splicing regulators promoting and maintaining, epigenetically, female sex determination by a tra positive feedback loop in XX individuals during development. The expression patterns of female-specific Bdtra transcripts during early embryogenesis shows that a peak appears at 15 h after egg laying. Using dsRNA to knock-down Bdtra expression in the embryo and adult stages, we showed that sexual formation is determined early in the embryo stage and that parental RNAi does not lead to the production of all male progeny as in Tribolium castaneum. RNAi results from adult abdominal dsRNA injections show that Bdtra has a positive influence on female yolk protein gene (Bdyp1) expression and fecundity.
Directory of Open Access Journals (Sweden)
Ling Nie
2016-01-01
Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.
Directory of Open Access Journals (Sweden)
Ruby Chandna
Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.
National Research Council Canada - National Science Library
Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M
2004-01-01
.... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...
Energy Technology Data Exchange (ETDEWEB)
Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)
2013-11-29
Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.
International Nuclear Information System (INIS)
Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki
2013-01-01
Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions
The value of oncolysis virus in treating liver cancer
International Nuclear Information System (INIS)
Xiong Zhuang; Wang Jianhua
2007-01-01
The effect of traditional therapy is limited for liver cancer, gene therapy gets more and more recognition in recent years. Oncolysis virus is a kind of conditionally replicating virus, with special reproductivity in cancer cells, and then kills them. Gene agents are usually introduced into tumor tissue by intra-tumor and intra-arterial injection, and the technique of interventional therapy is able to satisfy the demand excellently. So, some breakthrough is expected in treating liver cancer by skillfully combining oncolysis virus and interventional technique. (authors)
Directory of Open Access Journals (Sweden)
Elena V. Tchetina
2013-01-01
Full Text Available We evaluated changes in gene expression of mTOR, p21, caspase-3, ULK1, TNFα, matrix metalloproteinase (MMP-9, and cathepsin K in the whole blood of rheumatoid arthritic (RA patients treated with methotrexate (MTX in relation to their rheumatoid factor status, clinical, immunological, and radiological parameters, and therapeutic response after a 24-month follow-up. The study group consisted of 35 control subjects and 33 RA patients without previous history of MTX treatment. Gene expression was measured using real-time RT-PCR. Decreased disease activity in patients at the end of the study was associated with significant downregulation of TNFα expression. Downregulation of mTOR was observed in seronegative patients, while no significant changes in the expression of p21, ULK1, or caspase-3 were noted in any RA patients at the end of the study. The increase in erosion numbers observed in the seropositive patients at the end of the follow-up was accompanied by upregulation of MMP-9 and cathepsin K, while seronegative patients demonstrated an absence of significant changes in MMP-9 and cathepsin K expression and no increase in the erosion score. Our results suggest that increased expression of MMP-9 and cathepsin K genes in the peripheral blood might indicate higher bone tissue destruction activity in RA patients treated with methotrexate. The clinical study registration number is 0120.0810610.
Biodegradable nanoparticles for gene therapy technology
International Nuclear Information System (INIS)
Hosseinkhani, Hossein; He, Wen-Jie; Chiang, Chiao-Hsi; Hong, Po-Da; Yu, Dah-Shyong; Domb, Abraham J.; Ou, Keng-Liang
2013-01-01
Rapid propagations in materials technology together with biology have initiated great hopes in the possibility of treating many diseases by gene therapy technology. Viral and non-viral gene carriers are currently applied for gene delivery. Non-viral technology is safe and effective for the delivery of genetic materials to cells and tissues. Non-viral systems are based on plasmid expression containing a gene encoding a therapeutic protein and synthetic biodegradable nanoparticles as a safe carrier of gene. Biodegradable nanoparticles have shown great interest in drug and gene delivery systems as they are easy to be synthesized and have no side effect in cells and tissues. This review provides a critical view of applications of biodegradable nanoparticles on gene therapy technology to enhance the localization of in vitro and in vivo and improve the function of administered genes
Genome-wide pharmacogenetics of antidepressant response in the GENDEP project
DEFF Research Database (Denmark)
Uher, Rudolf; Perroud, Nader; Ng, Mandy Y.M.
2010-01-01
. A set of 72 a priori-selected candidate genes did not show pharmacogenetic associations above a chance level, but an association with response to escitalopram was detected in the interleukin-6 gene, which is a close homologue of IL11. Conclusions: While limited statistical power means that a number...
Bone Marrow Gene Therapy for HIV/AIDS
Directory of Open Access Journals (Sweden)
Elena Herrera-Carrillo
2015-07-01
Full Text Available Bone marrow gene therapy remains an attractive option for treating chronic immunological diseases, including acquired immunodeficiency syndrome (AIDS caused by human immunodeficiency virus (HIV. This technology combines the differentiation and expansion capacity of hematopoietic stem cells (HSCs with long-term expression of therapeutic transgenes using integrating vectors. In this review we summarize the potential of bone marrow gene therapy for the treatment of HIV/AIDS. A broad range of antiviral strategies are discussed, with a particular focus on RNA-based therapies. The idea is to develop a durable gene therapy that lasts the life span of the infected individual, thus contrasting with daily drug regimens to suppress the virus. Different approaches have been proposed to target either the virus or cellular genes encoding co-factors that support virus replication. Some of these therapies have been tested in clinical trials, providing proof of principle that gene therapy is a safe option for treating HIV/AIDS. In this review several topics are discussed, ranging from the selection of the antiviral molecule and the viral target to the optimal vector system for gene delivery and the setup of appropriate preclinical test systems. The molecular mechanisms used to formulate a cure for HIV infection are described, including the latest antiviral strategies and their therapeutic applications. Finally, a potent combination of anti-HIV genes based on our own research program is described.
Directory of Open Access Journals (Sweden)
Zhimin Yang
Full Text Available Tall fescue (Festuca arundinacea Schreb. is widely utilized as a major forage and turfgrass species in the temperate regions of the world and is a valuable plant material for studying molecular mechanisms of grass stress tolerance due to its superior drought and heat tolerance among cool-season species. Selection of suitable reference genes for quantification of target gene expression is important for the discovery of molecular mechanisms underlying improved growth traits and stress tolerance. The stability of nine potential reference genes (ACT, TUB, EF1a, GAPDH, SAND, CACS, F-box, PEPKR1 and TIP41 was evaluated using four programs, GeNorm, NormFinder, BestKeeper, and RefFinder. The combinations of SAND and TUB or TIP41 and TUB were most stably expressed in salt-treated roots or leaves. The combinations of GAPDH with TIP41 or TUB were stable in roots and leaves under drought stress. TIP41 and PEPKR1 exhibited stable expression in cold-treated roots, and the combination of F-box, TIP41 and TUB was also stable in cold-treated leaves. CACS and TUB were the two most stable reference genes in heat-stressed roots. TIP41 combined with TUB and ACT was stably expressed in heat-stressed leaves. Finally, quantitative real-time polymerase chain reaction (qRT-PCR assays of the target gene FaWRKY1 using the identified most stable reference genes confirmed the reliability of selected reference genes. The selection of suitable reference genes in tall fescue will allow for more accurate identification of stress-tolerance genes and molecular mechanisms conferring stress tolerance in this stress-tolerant species.
Kulaeva, Olga A; Zhernakov, Aleksandr I; Afonin, Alexey M; Boikov, Sergei S; Sulima, Anton S; Tikhonovich, Igor A; Zhukov, Vladimir A
2017-01-01
Pea (Pisum sativum L.) is the oldest model object of plant genetics and one of the most agriculturally important legumes in the world. Since the pea genome has not been sequenced yet, identification of genes responsible for mutant phenotypes or desirable agricultural traits is usually performed via genetic mapping followed by candidate gene search. Such mapping is best carried out using gene-based molecular markers, as it opens the possibility for exploiting genome synteny between pea and its close relative Medicago truncatula Gaertn., possessing sequenced and annotated genome. In the last 5 years, a large number of pea gene-based molecular markers have been designed and mapped owing to the rapid evolution of "next-generation sequencing" technologies. However, the access to the complete set of markers designed worldwide is limited because the data are not uniformed and therefore hard to use. The Pea Marker Database was designed to combine the information about pea markers in a form of user-friendly and practical online tool. Version 1 (PMD1) comprises information about 2484 genic markers, including their locations in linkage groups, the sequences of corresponding pea transcripts and the names of related genes in M. truncatula. Version 2 (PMD2) is an updated version comprising 15944 pea markers in the same format with several advanced features. To test the performance of the PMD, fine mapping of pea symbiotic genes Sym13 and Sym27 in linkage groups VII and V, respectively, was carried out. The results of mapping allowed us to propose the Sen1 gene (a homologue of SEN1 gene of Lotus japonicus (Regel) K. Larsen) as the best candidate gene for Sym13, and to narrow the list of possible candidate genes for Sym27 to ten, thus proving PMD to be useful for pea gene mapping and cloning. All information contained in PMD1 and PMD2 is available at www.peamarker.arriam.ru.
Dual-therapeutic reporter genes fusion for enhanced cancer gene therapy and imaging.
Sekar, T V; Foygel, K; Willmann, J K; Paulmurugan, R
2013-05-01
Two of the successful gene-directed enzyme prodrug therapies include herpes simplex virus-thymidine kinase (HSV1-TK) enzyme-ganciclovir prodrug and the Escherichia coli nitroreductase (NTR) enzyme-CB1954 prodrug strategies; these enzyme-prodrug combinations produce activated cytotoxic metabolites of the prodrugs capable of tumor cell death by inhibiting DNA synthesis and killing quiescent cells, respectively. Both these strategies also affect significant bystander cell killing of neighboring tumor cells that do not express these enzymes. We have developed a dual-combination gene strategy, where we identified HSV1-TK and NTR fused in a particular orientation can effectively kill tumor cells when the tumor cells are treated with a fusion HSV1-TK-NTR gene- along with a prodrug combination of GCV and CB1954. In order to determine whether the dual-system demonstrate superior therapeutic efficacy than either HSV1-TK or NTR systems alone, we conducted both in vitro and in vivo tumor xenograft studies using triple negative SUM159 breast cancer cells, by evaluating the efficacy of cell death by apoptosis and necrosis upon treatment with the dual HSV1-TK genes-GCV-CB1954 prodrugs system, and compared the efficiency to HSV1-TK-GCV and NTR-CB1954. Our cell-based studies, tumor regression studies in xenograft mice, histological analyses of treated tumors and bystander studies indicate that the dual HSV1-TK-NTR-prodrug system is two times more efficient even with half the doses of both prodrugs than the respective single gene-prodrug system, as evidenced by enhanced apoptosis and necrosis of tumor cells in vitro in culture and xenograft of tumor tissues in animals.
Functional Analysis of Breast Cancer Susceptibility Gene BRCA2
National Research Council Canada - National Science Library
Wang, Yingcai
1999-01-01
...- specific RecA homologue, but not with XRCC2, Rad51D or the replication Protein (RPA). The specific interaction of BRCA2 and hsDMCl suggests that BRCA2 may be involved in DNA recombination and repair both in germ and somatic cells...
A selfish gene chastened: Tribolium castaneum Medea M4 is silenced by a complementary gene.
Thomson, M Scott
2014-04-01
Maternal-effect dominant embryonic arrest (Medea) of Tribolium castaneum are autosomal factors that act maternally to cause the death of any progeny that do not inherit them. This selfish behavior is thought to result from a maternally expressed poison and zygotically expressed antidote. Medea factors and the hybrid incompatibility factor, H, have a negative interaction consistent with complementary genes of the Dobzhansky-Muller model for post-zygotic isolation. This negative interaction may result from H suppression of Medea zygotic antidote, leaving zygotes incompletely protected from maternal poison. I report here a test of the hypothesis that H also suppresses the Medea maternal poison. Viable F1 females were generated from a cross of Medea M4 strain males to H strain females. These females, heterozygous for both M4 and H, failed to express M4 maternal lethal activity when crossed to their male sibs. Transmission of non-M4 homologues from these females was confirmed using a dominant transgenic enhanced green fluorescent protein eye color marker, tightly linked in cis to M4. M4 beetles, lacking H, were selected from the F2 population. Female descendants of these clearly expressed M4 maternal lethal activity, indicating restoration of this activity after H was segregated away. I conclude that H, or a factor tightly linked to H, suppresses Medea M4 maternal poison.
Desjardins , Stephane; Belkai , Emilie; Crete , Dominique; Cordonnier , Laurie; Scherrmann , Jean-Michel; Noble , Florence; Marie-Claire , Cynthia
2008-01-01
International audience; Chronic morphine treatment alters gene expression in brain structures. There are increasing evidences showing a correlation, in gene expression modulation, between blood cells and brain in psychological troubles. To test whether gene expression regulation in blood cells could be found in drug addiction, we investigated gene expression profiles in peripheral blood mononuclear (PBMC) cells of saline and morphine-treated rats. In rats chronically treated with morphine, th...
The homodimeric GBS1074 from Streptococcus agalactiae
International Nuclear Information System (INIS)
Shukla, Anshuman; Pallen, Mark; Anthony, Mark; White, Scott A.
2010-01-01
The homodimeric nature of the ESAT-6 homologue GBS1074 and the potential for fibre-like assemblies are revealed by the 2 Å resolution crystal structure. ESAT-6 is a well characterized secreted protein from Mycobacterium tuberculosis and represents the archetype of the WXG100 family of proteins. Genes encoding ESAT-6 homologues have been identified in the genome of the human pathogen Streptococcus agalactiae; one of these genes, esxA, has been cloned and the recombinant protein has been crystallized. In contrast to M. tuberculosis ESAT-6, the crystal structure of GBS1074 reveals a homodimeric structure similar to homologous structures from Staphylococcus aureus and Helicobacter pylori. Intriguingly, GBS1074 forms elongated fibre-like assemblies in the crystal structure
The plant PTS1 receptor : similarities and differences to its human and yeast counterparts
Wimmer, C; Schmid, Markus; Veenhuis, M; Gietl, C
1998-01-01
Two targeting signals, PTS1 and PTS2, mediate import of proteins into the peroxisomal matrix. We have cloned and sequenced the watermelon (Citrullus vulgaris) cDNA homologue to the PTS1 receptor gene (PEX5). Its gene product, CvPex5p, belongs to the family of tetratricopeptide repeat (TPR)
Unal, Mehmet; Ozer Unal, Durisehvar
2004-01-01
Gene or cell doping is defined by the World Anti-Doping Agency (WADA) as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". New research in genetics and genomics will be used not only to diagnose and treat disease, but also to attempt to enhance human performance. In recent years, gene therapy has shown progress and positive results that have highlighted the potential misuse of this technology and the debate of 'gene doping'. Gene therapies developed for the treatment of diseases such as anaemia (the gene for erythropoietin), muscular dystrophy (the gene for insulin-like growth factor-1) and peripheral vascular diseases (the gene for vascular endothelial growth factor) are potential doping methods. With progress in gene technology, many other genes with this potential will be discovered. For this reason, it is important to develop timely legal regulations and to research the field of gene doping in order to develop methods of detection. To protect the health of athletes and to ensure equal competitive conditions, the International Olympic Committee, WADA and International Sports Federations have accepted performance-enhancing substances and methods as being doping, and have forbidden them. Nevertheless, the desire to win causes athletes to misuse these drugs and methods. This paper reviews the current status of gene doping and candidate performance enhancement genes, and also the use of gene therapy in sports medicine and ethics of genetic enhancement. Copyright 2004 Adis Data Information BV
Directory of Open Access Journals (Sweden)
Zahida Zahoor
Full Text Available During its life cycle, the helminth parasite Schistosoma mansoni uses the freshwater snail Biomphalaria glabrata as an intermediate host to reproduce asexually generating cercariae for infection of the human definitive host. Following invasion of the snail, the parasite develops from a miracidium to a mother sporocyst and releases excretory-secretory products (ESPs that likely influence the outcome of host infection. To better understand molecular interactions between these ESPs and the host snail defence system, we determined gene expression profiles of haemocytes from S. mansoni-resistant or -susceptible strains of B. glabrata exposed in vitro to S. mansoni ESPs (20 μg/ml for 1 h, using a 5K B. glabrata cDNA microarray. Ninety-eight genes were found differentially expressed between haemocytes from the two snail strains, 57 resistant specific and 41 susceptible specific, 60 of which had no known homologue in GenBank. Known differentially expressed resistant-snail genes included the nuclear factor kappa B subunit Relish, elongation factor 1α, 40S ribosomal protein S9, and matrilin; known susceptible-snail specific genes included cathepsins D and L, and theromacin. Comparative analysis with other gene expression studies revealed 38 of the 98 identified genes to be uniquely differentially expressed in haemocytes in the presence of ESPs, thus identifying for the first time schistosome ESPs as important molecules that influence global snail host-defence cell gene expression profiles. Such immunomodulation may benefit the schistosome, enabling its survival and successful development in the snail host.
Soh, Hyuncheol; Choi, Yongsang; Lee, Taek-Kyun; Yeo, Up-Dong; Han, Kyeongsik; Auh, Chungkyun; Lee, Sukchan
2012-08-01
Arabidopsis gene expression microarray (44 K) was used to detect genes highly induced under simulated microgravity stress (SMS). Ten SMS-inducible genes were selected from the microarray data and these 10 genes were found to be abundantly expressed in 3-week-old plants. Nine out of the 10 SMS-inducible genes were also expressed in response to the three abiotic stresses of drought, touch, and wounding in 3-week-old Arabidopsis plants respectively. However, WRKY46 was elevated only in response to SMS. Six other WRKY genes did not respond to SMS. To clarify the characteristics of the genes expressed at high levels in response to SMS, 20 cis-elements in the promoters of the 40 selected genes including the 10 SMS-inducible genes, the 6 WRKY genes, and abiotic stress-inducible genes were analyzed and their spatial positions on each promoter were determined. Four cis-elements (M/T-G-T-P from MYB1AT or TATABOX5, GT1CONSENSUS, TATABOX5, and POLASIG1) showed a unique spatial arrangement in most SMS-inducible genes including WRKY46. Therefore the M/T-G-T-P cis-element patterns identified in the promoter of WRKY46 may play important roles in regulating gene expression in response to SMS. The presences of the cis-element patterns suggest that the order or spatial positioning of certain groups of cis-elements is more important than the existence or numbers of specific cis-elements. Taken together, our data indicate that WRKY46 is a novel SMS inducible transcription factor and the unique spatial arrangement of cis-elements shown in WRKY46 promoter may play an important role for its response to SMS.
Learning gene regulatory networks from gene expression data using weighted consensus
Fujii, Chisato; Kuwahara, Hiroyuki; Yu, Ge; Guo, Lili; Gao, Xin
2016-01-01
An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.
Learning gene regulatory networks from gene expression data using weighted consensus
Fujii, Chisato
2016-08-25
An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.
International Nuclear Information System (INIS)
Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka
2007-01-01
A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications
Spinal interleukin-10 therapy to treat peripheral neuropathic pain.
Milligan, Erin D; Penzkover, Kathryn R; Soderquist, Ryan G; Mahoney, Melissa J
2012-01-01
Current research indicates that chronic peripheral neuropathic pain includes a role for glia and the actions of proinflammatory factors. This review briefly discusses the glial and cytokine responses that occur following peripheral nerve damage in support of utilizing anti-inflammatory cytokine interleukin-10 (IL-10) therapy to suppress chronic peripheral neuropathic pain. SPINAL NONVIRAL INTERLEUKIN-10 GENE THERAPY: IL-10 is one of the most powerful endogenous counter-regulators of proinflammatory cytokine function that acts in the nervous system. Subarachnoid (intrathecal) spinal injection of the gene encoding IL-10 delivered by nonviral vectors has several advantages over virally mediated gene transfer methods and leads to profound pain relief in several animal models. NONVIRAL GENE DELIVERY: Lastly, data are reviewed that nonviral deoxyribonucleic acid (DNA) encapsulated by a biologically safe copolymer, poly(lactic-co-glycolic) acid (PLGA), thought to protect DNA, leads to significantly improved therapeutic gene transfer in animal models, which additionally and significantly extends pain relief. The impact of these early studies exploring anti-inflammatory genes emphasizes the exceptional therapeutic potential of new biocompatible intrathecal nonviral gene delivery approaches such as PLGA microparticles. Ultimately, ongoing expression of therapeutic genes is a viable option to treat chronic neuropathic pain in the clinic. © 2012 International Neuromodulation Society.
International Nuclear Information System (INIS)
Uchiyama, Toru; Kumaki, Satoru; Ishikawa, Yoshinori; Onodera, Masafumi; Sato, Miki; Du, Wei; Sasahara, Yoji; Tanaka, Nobuyuki; Sugamura, Kazuo; Tsuchiya, Shigeru
2006-01-01
Recently, a serious adverse effect of uncontrolled clonal T cell proliferation due to insertional mutagenesis of retroviral vector was reported in X-SCID gene therapy clinical trial. To offset the side effect, we have incorporated a suicide gene into therapeutic retroviral vector for selective elimination of transduced cells. In this study, B-cell lines from two X-SCID patients were transduced with bicistronic retroviral vector carrying human γc chain cDNA and Herpes simplex virus thymidine kinase gene. After confirmation of functional reconstitution of the γc chain, the cells were treated with ganciclovir (GCV). The γc chain positive cells were eliminated under low concentration without cytotoxicity on untransduced cells and have not reappeared at least for 5 months. Furthermore, the γc chain transduced cells were still sensitive to GCV after five months. These results demonstrated the efficacy of the suicide gene therapy although further in vivo studies are required to assess feasibility of this approach in clinical trial
Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne
2012-01-01
The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell
Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun
2015-12-01
The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard
2017-03-06
Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.
Directory of Open Access Journals (Sweden)
Ya-jun WANG
2016-09-01
Full Text Available Objective To detect the expression profile changes of apoptosis-related genes in trichostatin A (TSA-induced drug-resisted lung cancer cells A549/CDDP by microarray, in order to screen the target genes in TSA treating cisplatin-resisted lung cancer. Methods A549/CDDP cells were treated by TSA for 24 hours. Total RNA was extracted and reversely transcribed into cDNA. Gene expression levels were detected by the NimbleGen whole genome microarray. Differences of expression profiles between TSA-treated and control group were measured by NimbleScan 2.5 software and GO analysis. Apoptosis and proliferation related genes were screened from the expression changed genes. Results Compared with the control group, 85 apoptosis-related genes were up-regulated and 43 growth or proliferation related genes were down-regulated in the TSA-treated group. GO analysis showed that the functions of these genes are mainly regulating apoptosis, cell resistance to chem ical stimuli protein, as well as regulating cell growth, proliferation and the biological process of maintaining the cell biological quality. TSA-activated not only the mitochondrial apoptotic pathways, but also the death receptor related apoptosis pathway, and down-regulated the drug resistance related genes BAG3 and ABCC2. Conclusion TSA may cause the expression changes of apoptotic and proliferation genes in A549/CDDP cells, these genes may play a role in TSA treating cisplatin-resisted lung cancer. DOI: 10.11855/j.issn.0577-7402.2016.08.07
Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter
2018-02-28
Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.
Simple Comparative Analyses of Differentially Expressed Gene Lists May Overestimate Gene Overlap.
Lawhorn, Chelsea M; Schomaker, Rachel; Rowell, Jonathan T; Rueppell, Olav
2018-04-16
Comparing the overlap between sets of differentially expressed genes (DEGs) within or between transcriptome studies is regularly used to infer similarities between biological processes. Significant overlap between two sets of DEGs is usually determined by a simple test. The number of potentially overlapping genes is compared to the number of genes that actually occur in both lists, treating every gene as equal. However, gene expression is controlled by transcription factors that bind to a variable number of transcription factor binding sites, leading to variation among genes in general variability of their expression. Neglecting this variability could therefore lead to inflated estimates of significant overlap between DEG lists. With computer simulations, we demonstrate that such biases arise from variation in the control of gene expression. Significant overlap commonly arises between two lists of DEGs that are randomly generated, assuming that the control of gene expression is variable among genes but consistent between corresponding experiments. More overlap is observed when transcription factors are specific to their binding sites and when the number of genes is considerably higher than the number of different transcription factors. In contrast, overlap between two DEG lists is always lower than expected when the genetic architecture of expression is independent between the two experiments. Thus, the current methods for determining significant overlap between DEGs are potentially confounding biologically meaningful overlap with overlap that arises due to variability in control of expression among genes, and more sophisticated approaches are needed.
Ridge, Justin P; Lin, Marianne; Larsen, Eloise I; Fegan, Mark; McEwan, Alastair G; Sly, Lindsay I
2007-04-01
Pedomicrobium sp. ACM 3067 is a budding-hyphal bacterium belonging to the alpha-Proteobacteria which is able to oxidize soluble Mn2+ to insoluble manganese oxide. A cosmid, from a whole-genome library, containing the putative genes responsible for manganese oxidation was identified and a primer-walking approach yielded 4350 bp of novel sequence. Analysis of this sequence showed the presence of a predicted three-gene operon, moxCBA. The moxA gene product showed homology to multicopper oxidases (MCOs) and contained the characteristic four copper-binding motifs (A, B, C and D) common to MCOs. An insertion mutation of moxA showed that this gene was essential for both manganese oxidation and laccase-like activity. The moxB gene product showed homology to a family of outer membrane proteins which are essential for Type I secretion in Gram-negative bacteria. moxBA has not been observed in other manganese-oxidizing bacteria but homologues were identified in the genomes of several bacteria including Sinorhizobium meliloti 1021 and Agrobacterium tumefaciens C58. These results suggest that moxBA and its homologues constitute a family of genes encoding an MCO and a predicted component of the Type I secretion system.
Directory of Open Access Journals (Sweden)
Roy C. Y. Choi
2011-01-01
Full Text Available Danggui Buxue Tang (DBT, a Chinese herbal decoction used to treat ailments in women, contains Radix Astragali (Huangqi; RA and Radix Angelicae Sinensis (Danggui; RAS. When DBT was applied onto cultured MG-63 cells, an increase of cell proliferation and differentiation of MG-63 cell were revealed: both of these effects were significantly higher in DBT than RA or RAS extract. To search for the biological markers that are specifically regulated by DBT, DNA microarray was used to reveal the gene expression profiling of DBT in MG-63 cells as compared to that of RA- or RAS-treated cells. Amongst 883 DBT-regulated genes, 403 of them are specifically regulated by DBT treatment, including CCL-2, CCL-7, CCL-8, and galectin-9. The signaling cascade of this DBT-regulated gene expression was also elucidated in cultured MG-63 cells. The current results reveal the potential usage of this herbal decoction in treating osteoporosis and suggest the uniqueness of Chinese herbal decoction that requires a well-defined formulation. The DBT-regulated genes in the culture could serve as biological responsive markers for quality assurance of the herbal preparation.
LENUS (Irish Health Repository)
Douillard, Francois P
2010-04-08
Abstract Background Helicobacter pylori is the causative agent for gastritis, and peptic and duodenal ulcers. The bacterium displays 5-6 polar sheathed flagella that are essential for colonisation and persistence in the gastric mucosa. The biochemistry and genetics of flagellar biogenesis in H. pylori has not been fully elucidated. Bioinformatics analysis suggested that the gene HP0256, annotated as hypothetical, was a FliJ homologue. In Salmonella, FliJ is a chaperone escort protein for FlgN and FliT, two proteins that themselves display chaperone activity for components of the hook, the rod and the filament. Results Ablation of the HP0256 gene in H. pylori significantly reduced motility. However, flagellin and hook protein synthesis was not affected in the HP0256 mutant. Transmission electron transmission microscopy revealed that the HP0256 mutant cells displayed a normal flagellum configuration, suggesting that HP0256 was not essential for assembly and polar localisation of the flagella in the cell. Interestingly, whole genome microarrays of an HP0256 mutant revealed transcriptional changes in a number of genes associated with the flagellar regulon and the cell envelope, such as outer membrane proteins and adhesins. Consistent with the array data, lack of the HP0256 gene significantly reduced adhesion and the inflammatory response in host cells. Conclusions We conclude that HP0256 is not a functional counterpart of FliJ in H. pylori. However, it is required for full motility and it is involved, possibly indirectly, in expression of outer membrane proteins and adhesins involved in pathogenesis and adhesion.
Intracellular Protein Delivery for treating Breast Cancer
2013-06-01
concentration increases, but not as dramatic as cytoplamic fractions possible due to slower nuclear transport than cellular internalization. The nucleus...polymers, dendrimers , and hydrogels for drug delivery. Pharmaceutical research 29, 902-921. Wilson, J.M. (2005). Gendicine: the first commercial gene...sequences were not ccessible to the transport machinery. In stark contrast, hen HeLa cells were treated with S S Rho—APO NC, strong ed fluorescence of
Isolation and characterization of differentially expressed genes in ...
African Journals Online (AJOL)
Among them, six proteins (putative fatty acid oxygenase, heat shock sks2, PriA homologue, Ap-1 like transcription factor YAP7, mung bean seed albumin, and C2H2 Zinc finger domain protein) and one protein (peroxisomal biogenesis factor 6) showed increased expression levels at the fruiting process and the mycelial ...
Shchetynsky, Klementy; Diaz-Gallo, Lina-Marcella; Folkersen, Lasse; Hensvold, Aase Haj; Catrina, Anca Irinel; Berg, Louise; Klareskog, Lars; Padyukov, Leonid
2017-02-02
Here we integrate verified signals from previous genetic association studies with gene expression and pathway analysis for discovery of new candidate genes and signaling networks, relevant for rheumatoid arthritis (RA). RNA-sequencing-(RNA-seq)-based expression analysis of 377 genes from previously verified RA-associated loci was performed in blood cells from 5 newly diagnosed, non-treated patients with RA, 7 patients with treated RA and 12 healthy controls. Differentially expressed genes sharing a similar expression pattern in treated and untreated RA sub-groups were selected for pathway analysis. A set of "connector" genes derived from pathway analysis was tested for differential expression in the initial discovery cohort and validated in blood cells from 73 patients with RA and in 35 healthy controls. There were 11 qualifying genes selected for pathway analysis and these were grouped into two evidence-based functional networks, containing 29 and 27 additional connector molecules. The expression of genes, corresponding to connector molecules was then tested in the initial RNA-seq data. Differences in the expression of ERBB2, TP53 and THOP1 were similar in both treated and non-treated patients with RA and an additional nine genes were differentially expressed in at least one group of patients compared to healthy controls. The ERBB2, TP53. THOP1 expression profile was successfully replicated in RNA-seq data from peripheral blood mononuclear cells from healthy controls and non-treated patients with RA, in an independent collection of samples. Integration of RNA-seq data with findings from association studies, and consequent pathway analysis implicate new candidate genes, ERBB2, TP53 and THOP1 in the pathogenesis of RA.
Accelerated evolution of the ASPM gene controlling brain size begins prior to human brain expansion.
Directory of Open Access Journals (Sweden)
Natalay Kouprina
2004-05-01
Full Text Available Primary microcephaly (MCPH is a neurodevelopmental disorder characterized by global reduction in cerebral cortical volume. The microcephalic brain has a volume comparable to that of early hominids, raising the possibility that some MCPH genes may have been evolutionary targets in the expansion of the cerebral cortex in mammals and especially primates. Mutations in ASPM, which encodes the human homologue of a fly protein essential for spindle function, are the most common known cause of MCPH. Here we have isolated large genomic clones containing the complete ASPM gene, including promoter regions and introns, from chimpanzee, gorilla, orangutan, and rhesus macaque by transformation-associated recombination cloning in yeast. We have sequenced these clones and show that whereas much of the sequence of ASPM is substantially conserved among primates, specific segments are subject to high Ka/Ks ratios (nonsynonymous/synonymous DNA changes consistent with strong positive selection for evolutionary change. The ASPM gene sequence shows accelerated evolution in the African hominoid clade, and this precedes hominid brain expansion by several million years. Gorilla and human lineages show particularly accelerated evolution in the IQ domain of ASPM. Moreover, ASPM regions under positive selection in primates are also the most highly diverged regions between primates and nonprimate mammals. We report the first direct application of TAR cloning technology to the study of human evolution. Our data suggest that evolutionary selection of specific segments of the ASPM sequence strongly relates to differences in cerebral cortical size.