WorldWideScience

Sample records for gene heteroduplex formation

  1. Replication Stalling and Heteroduplex Formation within CAG/CTG Trinucleotide Repeats by Mismatch Repair

    KAUST Repository

    Viterbo, David

    2016-03-16

    Trinucleotide repeat expansions are responsible for at least two dozen neurological disorders. Mechanisms leading to these large expansions of repeated DNA are still poorly understood. It was proposed that transient stalling of the replication fork by the repeat tract might trigger slippage of the newly-synthesized strand over its template, leading to expansions or contractions of the triplet repeat. However, such mechanism was never formally proven. Here we show that replication fork pausing and CAG/CTG trinucleotide repeat instability are not linked, stable and unstable repeats exhibiting the same propensity to stall replication forks when integrated in a yeast natural chromosome. We found that replication fork stalling was dependent on the integrity of the mismatch-repair system, especially the Msh2p-Msh6p complex, suggesting that direct interaction of MMR proteins with secondary structures formed by trinucleotide repeats in vivo, triggers replication fork pauses. We also show by chromatin immunoprecipitation that Msh2p is enriched at trinucleotide repeat tracts, in both stable and unstable orientations, this enrichment being dependent on MSH3 and MSH6. Finally, we show that overexpressing MSH2 favors the formation of heteroduplex regions, leading to an increase in contractions and expansions of CAG/CTG repeat tracts during replication, these heteroduplexes being dependent on both MSH3 and MSH6. These heteroduplex regions were not detected when a mutant msh2-E768A gene in which the ATPase domain was mutated was overexpressed. Our results unravel two new roles for mismatch-repair proteins: stabilization of heteroduplex regions and transient blocking of replication forks passing through such repeats. Both roles may involve direct interactions between MMR proteins and secondary structures formed by trinucleotide repeat tracts, although indirect interactions may not be formally excluded.

  2. Model Building to Facilitate Understanding of Holliday Junction and Heteroduplex Formation, and Holliday Junction Resolution

    Science.gov (United States)

    Selvarajah, Geeta; Selvarajah, Susila

    2016-01-01

    Students frequently expressed difficulty in understanding the molecular mechanisms involved in chromosomal recombination. Therefore, we explored alternative methods for presenting the two concepts of the double-strand break model: Holliday junction and heteroduplex formation, and Holliday junction resolution. In addition to a lecture and…

  3. Heteroduplex analysis of the dystrophin gene: Application to point mutation and carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Papp, A.C.; Snyder, P.J.; Sedra, M.S.; Western, L.M.; Bartolo, C.; Mendell, J.R. [Ohio State Univ., Columbus, OH (United States); Moxley, R.T. [Univ. of Rochester Medical Center, NY (United States)

    1994-03-01

    Approximately one-third of Duchenne muscular dystrophy patients have undefined mutations in the dystrophin gene. For carrier and prenatal studies in families without detectable mutations, the indirect restriction fragment length polymorphism linkage approach is used. Using a multiplex amplification and heteroduplex analysis of dystrophin exons, the authors identified nonsense mutations in two DMD patients. Although the nonsense mutations are predicted to severely truncate the dystrophin protein, both patients presented with mild clinical courses of the disease. As a result of identifying the mutation in the affected boys, direct carrier studies by heteroduplex analysis were extended to other relatives. The authors conclude that the technique is not only ideal for mutation detection but is also useful for diagnostic testing. 29 refs., 4 figs.

  4. Heteroduplex formation, mismatch resolution, and genetic sectoring during homologous recombination in the hyperthermophilic archaeon Sulfolobus acidocaldarius

    Directory of Open Access Journals (Sweden)

    Dennis W. Grogan

    2012-06-01

    Full Text Available Hyperthermophilic archaea exhibit certain molecular-genetic features not seen in bacteria or eukaryotes, and their systems of homologous recombination (HR remain largely unexplored in vivo. We transformed a Sulfolobus acidocaldarius pyrE mutant with short DNAs that contained multiple non-selected genetic markers within the pyrE gene. From 20 to 40% of the resulting colonies were found to contain two Pyr+ clones with distinct sets of the non-selected markers. The dual-genotype colonies could not be attributed to multiple DNAs entering the cells or conjugation between transformed and non-transformed cells. These colonies thus appear to represent genetic sectoring in which stretches of heteroduplex DNA formed during HR and segregated without complete resolution of inter-strand differences. Surprisingly, sectoring was also frequent in transformation with single-stranded DNAs. Oligonucleotides, for example, produced somewhat more sectored transformants when electroporated as single strands than as a duplex, although all forms (positive-strand, negative-strand, and duplex produced a diversity of genotypes from the limited number of markers. The marker patterns in the recombinants indicate that S. acidocaldarius resolves individual mismatches through un-coordinated short-patch excision followed by re-filling of the resulting gap. These gene-conversion events exhibit little strand bias, and can occur in pre-formed heteroduplex. These properties suggest that this process does not play a central role in the fidelity of genome replication, but may generate 3’ single-strand tails, and thereby initiate the incorporation of duplex DNA into the recipient chromosome. Regardless of the molecular details of its mechanism, HR between the S. acidocaldarius chromosome and a multiply-marked DNA produces a strikingly high level of genetic diversity in a very short chromosomal interval, and suggests that HR in Sulfolobus has significant mutagenic potential if not

  5. The combination of heteroduplex analysis and protein truncation test for exact detection of the APC gene mutations

    International Nuclear Information System (INIS)

    Tomka, M.; Kirchhoff, T.; Stefurkova, V.; Zajac, V.; Kulcsar, L.

    1998-01-01

    Familial adenomatous polyposis (FAP) is usually associated with mutation in the adenomatous polyposis coli (APC) gene. To examine the occurrence of these mutations in the number of FAP suspected families from the whole Slovakia effectively, we have applied heteroduplex analysis (HDA) and protein truncation test (PTT) for the analyses of 2-5 base pair deletions and point mutations of the APC gene. In the analyzed exon 15 of the APC gene determined by the primers 15Efor-15Grev for HDA and 15ET7-15J3 for PTT more than 70% of mutations should be deletions [3, 12], which are detectable by HDA. In our collection of 5 FAP families mutations in the APC gene were found in families 10, 27 and 41 using HDA. By PTT test the formation of truncated APC protein in FAP families 2, 10, 16 and 27 were revealed. The necessity of combination of at least HDA and PTT techniques for exact detection of APC mutations in analyzed APC region is discussed. (authors)

  6. Heteroduplex DNA mismatch repair system of Streptococcus pneumoniae: cloning and expression of the hexA gene

    International Nuclear Information System (INIS)

    Balganesh, T.S.; Lacks, S.A.

    1985-01-01

    Mutations affecting heteroduplex DNA mismatch repair in Streptococcus pneumoniae were localized in two genes, hexA and hexB, by fractionation of restriction fragments carrying mutant alleles. A fragment containing the hexA4 allele was cloned in the S. pneumoniae cloning system, and the hexA + allele was introduced into the recombinant plasmid by chromosomal facilitation of plasmid transfer. Subcloning localized the functional hexA gene to a 3.5-kilobase segment of the cloned pneumococcal DNA. The product of this gene was shown in Bacillus subtilis minicells to be a polypeptide with an M/sub r/ of 86,000. Two mutant alleles of hexA showed partial expression of the repair system when present in multicopy plasmids. A model for mismatch repair, which depends on the interaction of two protein components to recognize the mismatched base pair and excise a segment of DNA between strand breaks surrounding the mismatch, is proposed

  7. MDE heteroduplex analysis of PCR products spanning each exon of the fibrillin (FBN1) gene greatly increases the efficiency of mutation detection in the Marfan syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Nijbroek, G.; Dietz, H.C. [Johns Hopkins Univ. School of Med., Baltimore, MD (United States); Pereira, L.; Ramirz, F. [Mount Sinai School of Med., New York, NY (United States)

    1994-09-01

    Defects in fibrillin (FNB1) cause the Marfan syndrome (MFS). Classic Marfan phenotype cosegregates with intragenic and/or flanking marker alleles in all families tested and a significant number of FBN1 mutations have been identified in affected individuals. Using a standard method of mutation detection, SSCP analysis of overlapping RT-PCR amplimers that span the entire coding sequence, the general experience has been a low yield of identifiable mutations, ranging from 10-20%. Possible explanations included low sensitivity of mutation screening procedures, under-representation of mutant transcript in patient samples either due to deletions or mutant alleles containing premature termination codons, clustering of mutations in yet uncharacterized regions of the gene, including regulatory elements, or genetic heterogeneity. In order to compensate for a potential reduced mutant transcript stability, we have devised a method to screen directly from genomic DNA. The intronic boundaries flanking each of the 65 FBN1 exons were characterized and primer pairs were fashioned such that all splice junctions would be included in the resultant amplimers. The entire gene was screened for a panel of 9 probands with classic Marfan syndrome using mutation detection enhancement (MDE) gel heteroduplex analysis. A mutation was identified in 5/9 (55%) of patient samples. All were either missense mutations involving a cysteine residue or small deletions that did not create a frame shift. In addition, 10 novel polymorphisms were found. We conclude that the majority of mutations causing Marfan syndrome reside in the FBN1 gene and that mutations creating premature termination codons are not the predominant cause of inefficient mutation detection using RT-PCR. We are currently modifying screening methods to increase sensitivity and targeting putative FBN1 gene promoter sequences for study.

  8. Use of the heteroduplex mobility assay and cell sorting to select genome sequences of the CCR5 gene in HEK 293T cells edited by transcription activator-like effector nucleases

    Science.gov (United States)

    Nerys-Junior, Arildo; Costa, Lendel C.; Braga-Dias, Luciene P.; Oliveira, Márcia; Rossi, Átila D.; da Cunha, Rodrigo Delvecchio; Gonçalves, Gabriel S.; Tanuri, Amilcar

    2014-01-01

    Engineered nucleases such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN) are one of the most promising tools for modifying genomes. These site-specific enzymes cause double-strand breaks that allow gene disruption or gene insertion, thereby facilitating genetic manipulation. The major problem associated with this approach is the labor-intensive procedures required to screen and confirm the cellular modification by nucleases. In this work, we produced a TALEN that targets the human CCR5 gene and developed a heteroduplex mobility assay for HEK 293T cells to select positive colonies for sequencing. This approach provides a useful tool for the quick detection and easy assessment of nuclease activity. PMID:24688299

  9. Heteroduplex analysis: a useful screening method for glycogen storage disease type Ia.

    Science.gov (United States)

    Narita, T; Tsuruta, Y; Chiba, K

    1998-04-01

    Glycogen storage disease type Ia (GSDIa), also known as von Gierke disease, is the most common and severe disease of glycogenoses and is caused by a deficiency of glucose-6-phosphatase (G6Pase) and transmitted by an autosomal recessive trait. The encoding gene of G6Pase is composed of only five exons and each exon is short. With heteroduplex analysis (HDA) method, we analyzed the genomic DNA from a patient diagnosed with GSDIa and from her parents. Exons II and IV of the patient showed heteroduplex bands. The mother had a heteroduplex band of exon II, and the father had a heteroduplex band of exon IV. In a mini-slab electrophoresis, exons II and IV of the patient did not show clear heteroduplex bands, but they appeared broader than the others, which made us suspect that they were heteroduplex bands. HDA is an easy and simple method and can verify mutant homozygous DNA fragments by adding wild-type DNA. We think that HDA may be a very useful screening method for the detection of novel genomic mutation in GSDIa in large-scale and mini-slab electrophoresis.

  10. Reduction of heteroduplex formation in PCR amplification

    Czech Academy of Sciences Publication Activity Database

    Michu, Elleni; Mráčková, Martina; Vyskot, Boris; Žlůvová, Jitka

    2010-01-01

    Roč. 54, č. 1 (2010), s. 173-176 ISSN 0006-3134 R&D Projects: GA AV ČR(CZ) KJB600040801; GA ČR(CZ) GD204/09/H002; GA AV ČR(CZ) IAA600040801; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : polymerase chain reaction * reconditioning PCR * mixed-template PCR Subject RIV: BO - Biophysics Impact factor: 1.582, year: 2010

  11. Screening of BRCA1 sequence variants within exon 11 by heteroduplex analysis

    Directory of Open Access Journals (Sweden)

    Lucian Negura

    2013-03-01

    Full Text Available Germ-line mutations of either BRCA1 or BRCA2 represents the major hereditary risk to breast and ovariancancer. Screening for mutations in these genes is now standard practice in molecular diagnosis, opening the way tooncogenetic counselling and follow-up. Because mutations in both BRCA1 and BRCA2 are distributed throughout theloci, accepted clinical protocols involve screening their entire coding regions. Systematic Sanger sequencing is time andmoney consuming. Therefore, a lot of pre-screening techniques evolved over time in order to identify anomalousamplicons prior to sequencing. Because BRCA mutations are always heterozygous, heteroduplex analysis proved to be asuitable pre-screening step. We previously implemented mismatch specific endonuclease heteroduplex analysis forBRCA1 exon7. Here we show the utility of the same method for mutations and SNPs found in BRCA1 exon 11

  12. Cleavage of mispaired heteroduplex DNA substrates by numerous restriction enzymes.

    Science.gov (United States)

    Langhans, Mark T; Palladino, Michael J

    2009-01-01

    The utility of restriction endonucleases as a tool in molecular biology is in large part due to the high degree of specificity with which they cleave well-characterized DNA recognition sequences. The specificity of restriction endonucleases is not absolute, yet many commonly used assays of biological phenomena and contemporary molecular biology techniques rely on the premise that restriction enzymes will cleave only perfect cognate recognition sites. In vitro, mispaired heteroduplex DNAs are commonly formed, especially subsequent to polymerase chain reaction amplification. We investigated a panel of restriction endonucleases to determine their ability to cleave mispaired heteroduplex DNA substrates. Two straightforward, non-radioactive assays are used to evaluate mispaired heteroduplex DNA cleavage: a PCR amplification method and an oligonucleotide-based assay. These assays demonstrated that most restriction endonucleases are capable of site-specific double-strand cleavage with heteroduplex mispaired DNA substrates, however, certain mispaired substrates do effectively abrogate cleavage to undetectable levels. These data are consistent with mispaired substrate cleavage previously reported for Eco RI and, importantly, extend our knowledge of mispaired heteroduplex substrate cleavage to 13 additional enzymes.

  13. Optimization of heteroduplex analysis for the detection of BRCA mutations and SNPs

    Directory of Open Access Journals (Sweden)

    Lucian Negura

    2011-02-01

    Full Text Available BRCA1 and BRCA2 are tumour suppressor genes whose mutant phenotypes predispose to breast and ovarian cancer. Screening for mutations in these genes is now standard practice for hereditary breast and ovarian cancer (HBOC cases in Europe, and permits medical follow-up and genetic counselling adapted to the needs of individuals in such families. Currently, most laboratories performing diagnostic analysis of the BRCA genes use PCR of exons and intron-exon boundaries coupled to a pre-screening step to identify anomalous amplicons. The techniques employed for the detection of mutations and SNPs have evolved over time and vary in sensitivity, specificity and cost-effectiveness. As a variant for pre-screening techniques, we chose the recently developed Surveyor® heteroduplex cleavage method as a sensitive and specific technique to reveal anomalous amplicons of the BRCA genes, using only basic laboratory equipment and agarose gel electrophoresis. Here we present the detection of either mutations or SNPs within the BRCA1 exon 7, using heteroduplex analysis (HA by mismatch-specific endonuclease, confirmed by dideoxy sequencing.

  14. Replication Fidelity of Escherichia Coli DNA Polymerase III Holoenzyme in Vitro and Repair of Heteroduplex DNA with Multibase Loops in Vivo.

    Science.gov (United States)

    Carraway, Margaretha Bernardina Maria

    The genetic integrity of an organism is maintained by accurate replication and correction of asymmetry in the DNA. To study replication fidelity, single-stranded plasmid DNA containing the mnt gene, was replicated in vitro with DNA polymerase III holoenzyme by extension of a complimentary annealed primer. On this plasmid the mnt region is fused to a promoterless tet gene. Accurate replication of mnt generates a tetracycline sensitive phenotype, errors in replication are identified by mutation to tetracycline resistance. Mismatch repair deficient mutH cells were transformed to ampicillin-resistance by replicated circles. The mutations in mnt were identified by replica plating and selecting for tetracycline resistant cells. The mutation rate was 1 in 100,000. DNA sequence analysis of 65 isolates identified 33 single base changes, 20 deletions and 12 concurrent deletions and insertions. Except for the deletions and substitutions, identical mutations were isolated in vivo in mismatch repair deficient cells. Therefore, in vitro replication errors resemble those isolated in vivo. Heteroduplexes with loops occur as a result of replication or recombination. To examine if E. coli converts these molecules to a homoduplex via DNA repair, plasmid heteroduplexes with loops of 5, 7, 9, 192, 410 or 514 bases in mnt were constructed. Conversion was examined by tranforming the plasmid heteroduplexes into E. coli lysogens which had a non-functional mnt gene fused to a promoterless lac gene. Repair of the heteroduplex to wild type yields white/tetracycline sensitive colonies; repair to the mutant yields red/tetracycline resistant colonies and no repair results in red-white (mixed)/tetracycline resistant colonies. No significant change in colony color distribution was observed when the heteroduplexes were transformed into wild type and the following mutant strains: pcnB, mutS, recA, recD, recBC sbcBC, recF, recJ, recR, recN, recO, recG ruvC, ruvB, lexA3, lexA51, uvrA, recBC sbcBC rec

  15. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  16. Detection of complex alleles by direct analysis of DNA heteroduplexes.

    Science.gov (United States)

    Sorrentino, R; Iannicola, C; Costanzi, S; Chersi, A; Tosi, R

    1991-01-01

    DNA molecules derived from three alleles of the HLA-DRB3 locus and differing from each other at several nucleotide sites were denatured and cross-hybridized. Each allelic combination was found to generate a pair of heteroduplexes of different mobility. Their retardation as compared to homoduplexes was proportional to the number of mismatches. In each heteroduplexes pair the component possessing the highest number of Pyr-Pyr oppositions was the most retarded. The results are those predicted by a theoretical model implying a correlation between base-pair opening and bending of the DNA double helix. These observations introduce a new HLA typing method at the genomic level and indicate an experimental approach to the analysis of the superhelical DNA conformation as related to different types of base oppositions.

  17. Detection of gsp somatic mutation through direct sequencing of heteroduplex alleles disclosed by denaturing gradient gel electrophoresis.

    Science.gov (United States)

    Fragoso, Maria C Barisson Villares; Lando, Valeria S; Latronico, Ana C; Frazzatto, Eliana T Salgado; Russell, Alan J; Mendonca, Berenice B

    2002-01-01

    The identification of somatic mutations in tissues is often difficult when the number of normal alleles in the tissue far exceeds the number of mutant ones. We found that the identification of gsp mutation was not possible by direct sequencing and present a new approach that improves the identification of gsp somatic mutations. Genomic DNA was extracted from frozen tissue of a human ovarian stromal Leydig cell tumor. Exons 8 and 9 of the Gsa gene were amplified by PCR and despite the abnormal migration pattern at this first DGGE, direct sequencing of the PCR product did not reveal mutations, probably due to the small amount of mutant alleles. To improve this amount, the PCR products were re-amplified using as template the excised products of the mutant homoduplex and heteroduplex bands obtained at the first DGGE. This approach resulted in the enhancing of the mutant homoduplex bands whereas the heteroduplex bands remained unchanged at the second DGGE. Direct sequencing of the second round PCR clearly identified the mutation R201C in the ovarian Leydig cell tumor. We have demonstrated a relatively rapid, convenient and reliable method to improve gsp somatic mutation detection combining a second DGGE of the PCR products obtained from the heteroduplexes and mutant homoduplex bands disclosed in a first DGGE followed by direct sequencing.

  18. Heterology of mitochondrial DNA from mammals detected by electron microscopic heteroduplex analyses

    DEFF Research Database (Denmark)

    Christiansen, Gunna; Christiansen, C

    1983-01-01

    Heteroduplex analysis of mitochondrial DNA (mtDNA) from evolutionary closely related mammals (rat vs. mouse, man vs. monkey) are analyzed and compared to heteroduplex analysis of mt-DNA from more distantly related mammals (rat vs. man, rat vs. monkey, mouse vs. man, mouse vs. monkey and man vs. cow...

  19. [Cloning the representative strains of China HIV-1 subtypes B, C and E for heteroduplex mobility analysis (HMA)].

    Science.gov (United States)

    Xiao, Y; Yao, J; Shao, Y

    1999-03-01

    To clone the HIV-1 env gene and establish the HMA reagents suitable for use with the Chinese HIV strains. Using Nest-PCR technique, we amplified env gene from representative strains which contain the most proximate consensus of China HIV-1 subtypes B, C and E. The genes were then cloned into pGEM-Teasy vector for HMA subtyping. The env gene of representative strains of China HIV-1 subtypes B, C and E were amplified and cloned into plasmids. The plasmids were used in HMA and compared with those standard env gene of other countries. The heteroduplex bands obtained with ours env genes were more proximate to homoduplex bands. The homogeneity of the corresponding China HIV-1 subtypes with standard TH14(B), IND868(C), MA959 (C) and TH22(E) are 90.2%(B), 88.3%(C), 83.7(C)% and 92.3%(E) respectively. The HMA reagents we established in this study have higher sensitivity in HMA analysis for China HIV-1 strains when compared with the international HMA reagents. The HMA reagents also provide new reference reagents for UNAIDS HIV isolation network.

  20. A parylene-based dual channel microelectrophoresis system for rapid mutation detection via heteroduplex analysis

    NARCIS (Netherlands)

    Sukas, S.; Erson, Ayse Elif; Sert, Cuneyt; Kulah, Haluk

    2008-01-01

    A new dual channel micro-electrophoresis system for rapid mutation detection based on heteroduplex analysis was designed and implemented. Mutation detection was successfully achieved in a total separation length of 250 μm in less than 3 min for a 590 bp DNA sample harboring a 3 bp mutation causing

  1. Mechanisms of Ectopic Gene Conversion

    Directory of Open Access Journals (Sweden)

    P.J. Hastings

    2010-11-01

    Full Text Available Gene conversion (conversion, the unidirectional transfer of DNA sequence information, occurs as a byproduct of recombinational repair of broken or damaged DNA molecules. Whereas excision repair processes replace damaged DNA by copying the complementary sequence from the undamaged strand of duplex DNA, recombinational mechanisms copy similar sequence, usually in another molecule, to replace the damaged sequence. In mitotic cells the other molecule is usually a sister chromatid, and the repair does not lead to genetic change. Less often a homologous chromosome or homologous sequence in an ectopic position is used. Conversion results from repair in two ways. First, if there was a double-strand gap at the site of a break, homologous sequence will be used as the template for synthesis to fill the gap, thus transferring sequence information in both strands. Second, recombinational repair uses complementary base pairing, and the heteroduplex molecule so formed is a source of conversion, both as heteroduplex and when donor (undamaged template information is retained after correction of mismatched bases in heteroduplex. There are mechanisms that favour the use of sister molecules that must fail before ectopic homology can be used. Meiotic recombination events lead to the formation of crossovers required in meiosis for orderly segregation of pairs of homologous chromosomes. These events result from recombinational repair of programmed double-strand breaks, but in contrast with mitotic recombination, meiotic recombinational events occur predominantly between homologous chromosomes, so that transfer of sequence differences by conversion is very frequent. Transient recombination events that do not form crossovers form both between homologous chromosomes and between regions of ectopic homology, and leave their mark in the occurrence of frequent non-crossover conversion, including ectopic conversion.

  2. Gene expression analysis of human fetal ovarian primordial follicle formation.

    Science.gov (United States)

    Fowler, Paul A; Flannigan, Samantha; Mathers, Anna; Gillanders, Kim; Lea, Richard G; Wood, Maureen J; Maheshwari, Abha; Bhattacharya, Siladitya; Collie-Duguid, Elaina S R; Baker, Paul J; Monteiro, Ana; O'Shaughnessy, Peter J

    2009-04-01

    Primordial follicle formation dictates the maximal potential female reproductive capacity and establishes the ovarian reserve. Currently, little is known about this process in the human. The aim of the study was to identify genes associated with the onset of human fetal primordial follicle formation in morphologically normal human fetuses. We conducted an observational study of the female fetal gonad, comparing gene expression before and during primordial follicle formation. The study was conducted at the Universities of Aberdeen, Glasgow, and Nottingham. Ovaries were collected from 51 morphologically normal human female fetuses of women undergoing elective termination of normal second trimester pregnancies. We performed fetal ovarian transcript expression by Affymetrix array and quantitative RT-PCR and gene product expression and localization by Western blot and immunohistochemistry. Five transcripts were down-regulated and 61 were up-regulated in ovaries from older fetuses (18-20 wk) in which primordial follicle formation had started compared with younger (15-16 wk) fetuses in which no primordial follicles were observed. The altered genes contribute to major functions, including gene expression, tissue morphology, and apoptosis, that are essential for ovarian development. NALP5, the most highly regulated transcript, is an oocyte-specific maternal effect gene that is regulated downstream of FIGLA. NALP5 probably plays a key role in the onset of human primordial follicle formation and thus the establishment of ovarian reserve in women.

  3. Novel mechanism of conjoined gene formation in the human genome.

    Science.gov (United States)

    Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

    2012-03-01

    Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

  4. Characterisation of genes induced during memory formation in the chick

    International Nuclear Information System (INIS)

    Bailey, K.A.; Luermans, J.; Gibbs, M.

    2002-01-01

    Full text: Memory formation can be divided into short-term and long-term. Short-term memory involves electro-chemical activity in the neurons whereas long-term memory requires a permanent change that includes protein synthesis. One of the problems involved with identifying late memory related genes is determining an optimal system in which to study gene expression. We have used a discriminated passive avoidance task in chicks to identify genes that are differentially regulated during memory formation. A mRNA subtraction method was previously used to specifically identify several genes that are expressed in the chick intermediate medial hyperstriatum ventrale (IMHV) within two hours of training. Eight bands ranging in size from 400bp to 1100bp were obtained in the initially screen. We are currently cloning these PCR products into suitable vectors for further analysis. Two of these clones have been sequenced and analysed using both the blastn and blastx programs in ANGIS. The first clone was found to correspond to cytochrome c oxidase subunit 2. Cytochrome C oxidase (COX) is a transmembrane protein localized in the inner mitochondrial membrane and forms part of the mitochondrial respiratory chain complex. The second clone codes for the ferritin heavy chain. Ferritin is a ubiquitous protein that is involved in iron homeostasis. At present it is unclear what role these two proteins play in memory formation but further studies are being undertaken to determine the expression profiles of these genes following memory induction. Copyright (2002) Australian Neuroscience Society

  5. Ethylene-Related Gene Expression Networks in Wood Formation

    Directory of Open Access Journals (Sweden)

    Carolin Seyfferth

    2018-03-01

    Full Text Available Thickening of tree stems is the result of secondary growth, accomplished by the meristematic activity of the vascular cambium. Secondary growth of the stem entails developmental cascades resulting in the formation of secondary phloem outwards and secondary xylem (i.e., wood inwards of the stem. Signaling and transcriptional reprogramming by the phytohormone ethylene modifies cambial growth and cell differentiation, but the molecular link between ethylene and secondary growth remains unknown. We addressed this shortcoming by analyzing expression profiles and co-expression networks of ethylene pathway genes using the AspWood transcriptome database which covers all stages of secondary growth in aspen (Populus tremula stems. ACC synthase expression suggests that the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC is synthesized during xylem expansion and xylem cell maturation. Ethylene-mediated transcriptional reprogramming occurs during all stages of secondary growth, as deduced from AspWood expression profiles of ethylene-responsive genes. A network centrality analysis of the AspWood dataset identified EIN3D and 11 ERFs as hubs. No overlap was found between the co-expressed genes of the EIN3 and ERF hubs, suggesting target diversification and hence independent roles for these transcription factor families during normal wood formation. The EIN3D hub was part of a large co-expression gene module, which contained 16 transcription factors, among them several new candidates that have not been earlier connected to wood formation and a VND-INTERACTING 2 (VNI2 homolog. We experimentally demonstrated Populus EIN3D function in ethylene signaling in Arabidopsis thaliana. The ERF hubs ERF118 and ERF119 were connected on the basis of their expression pattern and gene co-expression module composition to xylem cell expansion and secondary cell wall formation, respectively. We hereby establish data resources for ethylene-responsive genes and

  6. THE EFFECT OF MISMATCH REPAIR AND HETERODUPLEX FORMATION ON SEXUAL ISOLATION IN BACILLUS. (R825348)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  7. Selenium affects biosilica formation in the demosponge Suberites domuncula. Effect on gene expression and spicule formation.

    Science.gov (United States)

    Müller, Werner E G; Borejko, Alexandra; Brandt, David; Osinga, Ronald; Ushijima, Hiroshi; Hamer, Bojan; Krasko, Anatoli; Xupeng, Cao; Müller, Isabel M; Schröder, Heinz C

    2005-08-01

    Selenium is a trace element found in freshwater and the marine environment. We show that it plays a major role in spicule formation in the demosponge Suberites domuncula. If added to primmorphs, an in vitro sponge cell culture system, it stimulates the formation of siliceous spicules. Using differential display of transcripts, we demonstrate that, after a 72-h exposure of primmorphs to selenium, two genes are up-regulated; one codes for selenoprotein M and the other for a novel spicule-associated protein. The deduced protein sequence of selenoprotein M (14 kDa) shows characteristic features of metazoan selenoproteins. The spicule-associated protein (26 kDa) comprises six characteristic repeats of 20 amino acids, composed of 10 distinct hydrophobic regions ( approximately 9 amino acids in length). Recombinant proteins were prepared, and antibodies were raised against these two proteins. Both were found to stain the central axial filament, which comprises the silicatein, as well as the surface of the spicules. In the presence of selenium, only the genes for selenoprotein M and spicule-associated protein are up-regulated, whereas the expression of the silicatein gene remains unchanged. Finally we show that, in the presence of selenium, larger silica aggregates are formed. We conclude that selenium has a stimulatory effect on the formation of siliceous spicules in sponges, and it may be involved in the enzymatic synthesis of biosilica components.

  8. Study of HIV-1 subtypes in serodiscordant couples attending an integrated counselling and testing centre in Mumbai using heteroduplex mobility analysis and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Mehta P

    2010-01-01

    Full Text Available Aims: To determine the prevalent subtypes of HIV-1 in serodiscordant couples. Setting: Integrated Counselling and Testing Centre (ICTC, Department of Microbiology. Study Design: Prospective pilot study. Participants: Thirty HIV-1 serodiscordant couples. Inclusion Criteria: a Documentation of HIV-1 infection in one partner and seronegative status in the other, current history of continued unprotected sexual activity within the partnership, demonstration that they have been in a partnership for at least 1 year and are not currently on highly active antiretroviral therapy HAART; b willingness of both partners to provide written informed consent including consent to continued couple counselling for 3 months. Materials and Methods: HIV-1 subtyping was carried out by heteroduplex mobility analysis (HMA by amplifying env region; and DNA sequencing by amplifying gag region. Results: HIV-1 env gene was amplified successfully in 10/30 samples; gag gene, in 25/30 samples; and both env and gag gene were amplified successfully in 5/30 samples. HIV-1 subtype C was detected from 21 samples; subtype B, from 7; and subtype A, from 2. Sample from 1 positive partner was detected as subtype C by env HMA and subtype B by gag sequencing. Conclusion: HIV-1 subtype C was found to be the predominant subtype of HIV-1 in serodiscordant couples attending our ICTC, followed by HIV-1 subtype B and HIV-1 subtype A, respectively. DNA sequencing was found to be the most reliable method for determining the subtypes of HIV-1.

  9. The interconnection between biofilm formation and horizontal gene transfer

    DEFF Research Database (Denmark)

    Madsen, Jonas Stenløkke; Burmølle, Mette; Hansen, Lars H.

    2012-01-01

    of their believed importance in the understanding of the adaptation and subsequent evolution of social traits in bacteria. Here, we discuss current evidence for such interconnectedness centred on plasmids. Horizontal transfer rates are typically higher in biofilm communities compared with those in planktonic states....... Biofilms, furthermore, promote plasmid stability and may enhance the host range of mobile genetic elements that are transferred horizontally. Plasmids, on the other hand, are very well suited to promote the evolution of social traits such as biofilm formation. This, essentially, transpires because plasmids...... stable social interactions. It also indicates that horizontal gene transfer ultimately enhances the relatedness of bacteria carrying the mobile genetic elements of the same origin. The perspective of this review extends to an overall interconnectedness between horizontal gene transfer, mobile genetic...

  10. Mechanisms of copy number variation and hybrid gene formation in the KIR immune gene complex.

    Science.gov (United States)

    Traherne, James A; Martin, Maureen; Ward, Rosemary; Ohashi, Maki; Pellett, Fawnda; Gladman, Dafna; Middleton, Derek; Carrington, Mary; Trowsdale, John

    2010-03-01

    The fine-scale structure of the majority of copy number variation (CNV) regions remains unknown. The killer immunoglobulin receptor (KIR) gene complex exhibits significant CNV. The evolutionary plasticity of the KIRs and their broad biomedical relevance makes it important to understand how these immune receptors evolve. In this paper, we describe haplotype re-arrangement creating novel loci at the KIR complex. We completely sequenced, after fosmid cloning, two rare contracted haplotypes. Evidence of frequent hybrid KIR genes in samples from many populations suggested that re-arrangements may be frequent and selectively advantageous. We propose mechanisms for formation of novel hybrid KIR genes, facilitated by protrusive non-B DNA structures at transposon recombination sites. The heightened propensity to generate novel hybrid KIR receptors may provide a proactive evolutionary measure, to militate against pathogen evasion or subversion. We propose that CNV in KIR is an evolutionary strategy, which KIR typing for disease association must take into account.

  11. The Paraoxonase Gene Cluster Protects Against Abdominal Aortic Aneurysm Formation.

    Science.gov (United States)

    Yan, Yun-Fei; Pei, Jian-Fei; Zhang, Yang; Zhang, Ran; Wang, Fang; Gao, Peng; Zhang, Zhu-Qin; Wang, Ting-Ting; She, Zhi-Gang; Chen, Hou-Zao; Liu, De-Pei

    2017-02-01

    Abdominal aortic aneurysm (AAA) is a life-threatening vascular pathology, the pathogenesis of which is closely related to oxidative stress. However, an effective pharmaceutical treatment is lacking because the exact cause of AAA remains unknown. Here, we aimed at delineating the role of the paraoxonases (PONs) gene cluster (PC), which prevents atherosclerosis through the detoxification of oxidized substrates, in AAA formation. PC transgenic (Tg) mice were crossed to an Apoe -/- background, and an angiotensin II-induced AAA mouse model was used to analyze the effect of the PC on AAA formation. Four weeks after angiotensin II infusion, PC-Tg Apoe -/- mice had a lower AAA incidence, smaller maximal abdominal aortic external diameter, and less medial elastin degradation than Apoe -/- mice. Importantly, PC-Tg Apoe -/- mice exhibited lower aortic reactive oxidative species production and oxidative stress than did the Apoe -/- control mice. As a consequence, the PC transgene alleviated angiotensin II-induced arterial inflammation and suppressed arterial extracellular matrix degradation. Specifically, on angiotensin II stimulation, PC-Tg vascular smooth muscle cells exhibited lower levels of reactive oxidative species production and a decrease in the activities and expression levels of matrix metalloproteinase-2 and matrix metalloproteinase-9. Moreover, PC-Tg serum also enhanced vascular smooth muscle cell oxidative stress resistance and further decreased the expression levels of matrix metalloproteinase-2 and matrix metalloproteinase-9, indicating that circulatory and vascular smooth muscle cell PC members suppress oxidative stress in a synergistic manner. Our findings reveal, for the first time, a protective role of the PC in AAA formation and suggest PONs as promising targets for AAA prevention. © 2016 American Heart Association, Inc.

  12. Genome-Wide Analysis of Heteroduplex DNA in Mismatch Repair–Deficient Yeast Cells Reveals Novel Properties of Meiotic Recombination Pathways

    Science.gov (United States)

    Martini, Emmanuelle; Borde, Valérie; Legendre, Matthieu; Audic, Stéphane; Regnault, Béatrice; Soubigou, Guillaume; Dujon, Bernard; Llorente, Bertrand

    2011-01-01

    Meiotic DNA double-strand breaks (DSBs) initiate crossover (CO) recombination, which is necessary for accurate chromosome segregation, but DSBs may also repair as non-crossovers (NCOs). Multiple recombination pathways with specific intermediates are expected to lead to COs and NCOs. We revisited the mechanisms of meiotic DSB repair and the regulation of CO formation, by conducting a genome-wide analysis of strand-transfer intermediates associated with recombination events. We performed this analysis in a SK1 × S288C Saccharomyces cerevisiae hybrid lacking the mismatch repair (MMR) protein Msh2, to allow efficient detection of heteroduplex DNAs (hDNAs). First, we observed that the anti-recombinogenic activity of MMR is responsible for a 20% drop in CO number, suggesting that in MMR–proficient cells some DSBs are repaired using the sister chromatid as a template when polymorphisms are present. Second, we observed that a large fraction of NCOs were associated with trans–hDNA tracts constrained to a single chromatid. This unexpected finding is compatible with dissolution of double Holliday junctions (dHJs) during repair, and it suggests the existence of a novel control point for CO formation at the level of the dHJ intermediate, in addition to the previously described control point before the dHJ formation step. Finally, we observed that COs are associated with complex hDNA patterns, confirming that the canonical double-strand break repair model is not sufficient to explain the formation of most COs. We propose that multiple factors contribute to the complexity of recombination intermediates. These factors include repair of nicks and double-stranded gaps, template switches between non-sister and sister chromatids, and HJ branch migration. Finally, the good correlation between the strand transfer properties observed in the absence of and in the presence of Msh2 suggests that the intermediates detected in the absence of Msh2 reflect normal intermediates. PMID

  13. Genome-wide analysis of heteroduplex DNA in mismatch repair-deficient yeast cells reveals novel properties of meiotic recombination pathways.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Martini

    2011-09-01

    Full Text Available Meiotic DNA double-strand breaks (DSBs initiate crossover (CO recombination, which is necessary for accurate chromosome segregation, but DSBs may also repair as non-crossovers (NCOs. Multiple recombination pathways with specific intermediates are expected to lead to COs and NCOs. We revisited the mechanisms of meiotic DSB repair and the regulation of CO formation, by conducting a genome-wide analysis of strand-transfer intermediates associated with recombination events. We performed this analysis in a SK1 × S288C Saccharomyces cerevisiae hybrid lacking the mismatch repair (MMR protein Msh2, to allow efficient detection of heteroduplex DNAs (hDNAs. First, we observed that the anti-recombinogenic activity of MMR is responsible for a 20% drop in CO number, suggesting that in MMR-proficient cells some DSBs are repaired using the sister chromatid as a template when polymorphisms are present. Second, we observed that a large fraction of NCOs were associated with trans-hDNA tracts constrained to a single chromatid. This unexpected finding is compatible with dissolution of double Holliday junctions (dHJs during repair, and it suggests the existence of a novel control point for CO formation at the level of the dHJ intermediate, in addition to the previously described control point before the dHJ formation step. Finally, we observed that COs are associated with complex hDNA patterns, confirming that the canonical double-strand break repair model is not sufficient to explain the formation of most COs. We propose that multiple factors contribute to the complexity of recombination intermediates. These factors include repair of nicks and double-stranded gaps, template switches between non-sister and sister chromatids, and HJ branch migration. Finally, the good correlation between the strand transfer properties observed in the absence of and in the presence of Msh2 suggests that the intermediates detected in the absence of Msh2 reflect normal intermediates.

  14. Spicule formation in calcareous sponges: Coordinated expression of biomineralization genes and spicule-type specific genes.

    Science.gov (United States)

    Voigt, Oliver; Adamska, Maja; Adamski, Marcin; Kittelmann, André; Wencker, Lukardis; Wörheide, Gert

    2017-04-13

    The ability to form mineral structures under biological control is widespread among animals. In several species, specific proteins have been shown to be involved in biomineralization, but it is uncertain how they influence the shape of the growing biomineral and the resulting skeleton. Calcareous sponges are the only sponges that form calcitic spicules, which, based on the number of rays (actines) are distinguished in diactines, triactines and tetractines. Each actine is formed by only two cells, called sclerocytes. Little is known about biomineralization proteins in calcareous sponges, other than that specific carbonic anhydrases (CAs) have been identified, and that uncharacterized Asx-rich proteins have been isolated from calcitic spicules. By RNA-Seq and RNA in situ hybridization (ISH), we identified five additional biomineralization genes in Sycon ciliatum: two bicarbonate transporters (BCTs) and three Asx-rich extracellular matrix proteins (ARPs). We show that these biomineralization genes are expressed in a coordinated pattern during spicule formation. Furthermore, two of the ARPs are spicule-type specific for triactines and tetractines (ARP1 or SciTriactinin) or diactines (ARP2 or SciDiactinin). Our results suggest that spicule formation is controlled by defined temporal and spatial expression of spicule-type specific sets of biomineralization genes.

  15. A strategy for characterization of persistent heteroduplex DNA in higher plants.

    Science.gov (United States)

    Dong, Chun-Bo; Mao, Jian-Feng; Suo, Yu-Jing; Shi, Le; Wang, Jun; Zhang, Ping-Dong; Kang, Xiang-Yang

    2014-10-01

    Heteroduplex DNA (hDNA) generated during homologous recombination (HR) is an important component that shapes genetic diversity in sexually reproducing organisms. However, studies of this process in higher plants are limited. This is because hDNAs are difficult to capture in higher plants as their reproductive developmental model only produces normal gametes and does not preserve the mitotic products of the post-meiotic segregation (PMS) process which is crucial for studying hDNAs. In this study, using the model system for tree and woody perennial plant biology (Populus), we propose a strategy for characterizing hDNAs in higher plants. We captured hDNAs by constructing triploid hybrids originating from a cross between unreduced 2n eggs (containing hDNA information as a result of inhibition chromosome segregation at the PMS stage) with normal male gametes. These triploid hybrids allowed us to detect the frequency and location of persistent hDNAs resulting from HR at the molecular level. We found that the frequency of persistent hDNAs, which ranged from 5.3 to 76.6%, was related to locations of the simple sequence repeat markers at the chromosomes, such as the locus-centromere distance, the surrounding DNA sequence and epigenetic information, and the richness of protein-coding transcripts at these loci. In summary, this study provides a method for characterizing persistent hDNAs in higher plants. When high-throughput sequencing techniques can be incorporated, genome-wide persistent hDNA assays for higher plants can be easily carried out using the strategy presented in this study. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  16. Identification of genes directly involved in shell formation and their functions in pearl oyster, Pinctada fucata.

    Directory of Open Access Journals (Sweden)

    Dong Fang

    Full Text Available Mollusk shell formation is a fascinating aspect of biomineralization research. Shell matrix proteins play crucial roles in the control of calcium carbonate crystallization during shell formation in the pearl oyster, Pinctada fucata. Characterization of biomineralization-related genes during larval development could enhance our understanding of shell formation. Genes involved in shell biomineralization were isolated by constructing three suppression subtractive hybridization (SSH libraries that represented genes expressed at key points during larval shell formation. A total of 2,923 ESTs from these libraries were sequenced and gave 990 unigenes. Unigenes coding for secreted proteins and proteins with tandem-arranged repeat units were screened in the three SSH libraries. A set of sequences coding for genes involved in shell formation was obtained. RT-PCR and in situ hybridization assays were carried out on five genes to investigate their spatial expression in several tissues, especially the mantle tissue. They all showed a different expression pattern from known biomineralization-related genes. Inhibition of the five genes by RNA interference resulted in different defects of the nacreous layer, indicating that they all were involved in aragonite crystallization. Intriguingly, one gene (UD_Cluster94.seq.Singlet1 was restricted to the 'aragonitic line'. The current data has yielded for the first time, to our knowledge, a suite of biomineralization-related genes active during the developmental stages of P. fucata, five of which were responsible for nacreous layer formation. This provides a useful starting point for isolating new genes involved in shell formation. The effects of genes on the formation of the 'aragonitic line', and other areas of the nacreous layer, suggests a different control mechanism for aragonite crystallization initiation from that of mature aragonite growth.

  17. Identification of Genes Directly Involved in Shell Formation and Their Functions in Pearl Oyster, Pinctada fucata

    Science.gov (United States)

    Fang, Dong; Xu, Guangrui; Hu, Yilin; Pan, Cong; Xie, Liping; Zhang, Rongqing

    2011-01-01

    Mollusk shell formation is a fascinating aspect of biomineralization research. Shell matrix proteins play crucial roles in the control of calcium carbonate crystallization during shell formation in the pearl oyster, Pinctada fucata. Characterization of biomineralization-related genes during larval development could enhance our understanding of shell formation. Genes involved in shell biomineralization were isolated by constructing three suppression subtractive hybridization (SSH) libraries that represented genes expressed at key points during larval shell formation. A total of 2,923 ESTs from these libraries were sequenced and gave 990 unigenes. Unigenes coding for secreted proteins and proteins with tandem-arranged repeat units were screened in the three SSH libraries. A set of sequences coding for genes involved in shell formation was obtained. RT-PCR and in situ hybridization assays were carried out on five genes to investigate their spatial expression in several tissues, especially the mantle tissue. They all showed a different expression pattern from known biomineralization-related genes. Inhibition of the five genes by RNA interference resulted in different defects of the nacreous layer, indicating that they all were involved in aragonite crystallization. Intriguingly, one gene (UD_Cluster94.seq.Singlet1) was restricted to the ‘aragonitic line’. The current data has yielded for the first time, to our knowledge, a suite of biomineralization-related genes active during the developmental stages of P.fucata, five of which were responsible for nacreous layer formation. This provides a useful starting point for isolating new genes involved in shell formation. The effects of genes on the formation of the ‘aragonitic line’, and other areas of the nacreous layer, suggests a different control mechanism for aragonite crystallization initiation from that of mature aragonite growth. PMID:21747964

  18. Detección rápida de resistencia a drogas en Mycobacterium tuberculosis mediante PCR-SSCP y PCR- Heteroduplex

    Directory of Open Access Journals (Sweden)

    Róger Calderón E

    2003-04-01

    Full Text Available Objetivo: Detectar tempranamente la susceptibilidad a las drogas antituberculosas rifampicina e isoniacida mediante PCR y electroforesis conformacional. Materiales y métodos: Se implementaron dos ensayos de amplificación de los genes rpoB y katG y mediante Heteroduplex y SSCP se determinó la susceptibilidad antituberculosa de 31 muestras clínicas procedentes de pacientes con diagnóstico de tuberculosis pulmonar baciloscopía positiva. La caracterización fenotípica de la susceptibilidad, se realizó empleando el método de las proporciones. Resultados: Los ensayos de PCR detectaron hasta 2,5 pg de ADN genómico de M. tuberculosis; no amplificando ADN de otras micobacterias y bacterias comunes de la flora bucal. Se encontró una concordancia general entre la detección molecular y convencional de la susceptibilidad a rifampicina e isoniacida de 96,7% y 83,9% (p<0,05, respectivamente. Sin embargo, sólo en pacientes con antecedente de tratamiento se presentó una concordancia del 100% y 90,9% (p<0,05 para rifampicina e isoniacida, respectivamente. Además, este sistema de detección de resistencia puede emitir resultados 48 horas después de la recepción de la muestra clínica. Conclusiones: Estos sistemas se presentan como una excelente alternativa para la identificación temprana de pacientes infectados con bacilos de M. tuberculosis drogoresistentes. Potencialmente, se podrán dirigir óptimos y oportunos esquemas terapéuticos que contribuirán con el control y prevención de la transmisión de cepas multidrogo-resistentes que afectan en gran medida a la salud pública de nuestro país.

  19. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  20. Nonradioactive heteroduplex tracking assay for the detection of minority-variant chloroquine-resistant Plasmodium falciparum in Madagascar

    Directory of Open Access Journals (Sweden)

    Mwapasa Victor

    2009-03-01

    Full Text Available Abstract Background Strains of Plasmodium falciparum genetically resistant to chloroquine (CQ due to the presence of pfcrt 76T appear to have been recently introduced to the island of Madagascar. The prevalence of such resistant genotypes is reported to be low (P. falciparum isolates on the island. Previously, minority variant chloroquine resistant parasites were described in Malawian patients using an isotopic heteroduplex tracking assay (HTA, which can detect pfcrt 76T-bearing P. falciparum minority variants in individual patients that were undetectable by conventional PCR. However, as this assay required a radiolabeled probe, it could not be used in many resource-limited settings. Methods This study describes a digoxigenin (DIG-labeled chemiluminescent heteroduplex tracking assay (DIG-HTA to detect pfcrt 76T-bearing minority variant P. falciparum. This assay was compared to restriction fragment length polymorphism (RFLP analysis and to the isotopic HTA for detection of genetically CQ-resistant parasites in clinical samples. Results Thirty one clinical P. falciparum isolates (15 primary isolates and 16 recurrent isolates from 17 Malagasy children treated with CQ for uncomplicated malaria were genotyped for the pfcrt K76T mutation. Two (11.7% of 17 patients harboured genetically CQ-resistant P. falciparum strains after therapy as detected by HTA. RFLP analysis failed to detect any pfcrt K76T-bearing isolates. Conclusion These findings indicate that genetically CQ-resistant P. falciparum are more common than previously thought in Madagascar even though the fitness of the minority variant pfcrt 76T parasites remains unclear. In addition, HTAs for malaria drug resistance alleles are promising tools for the surveillance of anti-malarial resistance. The use of a non-radioactive label allows for the use of HTAs in malaria endemic countries.

  1. Analysis of biofilm formation and associated gene detection in ...

    African Journals Online (AJOL)

    Yomi

    2012-01-26

    Jan 26, 2012 ... optical microscope after silver staining. Slices in wells containing uninoculated medium served as negative controls and biofilm qualitative results obtained through SEM served as positive controls. (Li et al., 2003). Crystal violet staining. Slices were incubated as described above for biofilm formation, and.

  2. Analysis of biofilm formation and associated gene detection in ...

    African Journals Online (AJOL)

    Yomi

    2012-01-26

    Jan 26, 2012 ... Key words: Bovine mastitis Staphylococcus, biofilm, silver staining, crystal violet staining. INTRODUCTION. Staphylococcus, with several ... Silicone elastomer slice biofilm formation assays and silver staining. Silicone elastomer slices (1 × 1 cm2) were cut from 1 mm-thick medical grade silicone elastomer ...

  3. Analysis of biofilm formation and associated gene detection in ...

    African Journals Online (AJOL)

    The objective of this study was to investigate the biofilm-forming ability and distribution of biofilm associated genes in clinically isolated Staphylococcus in bovine mastitis. Silver staining, scanning electron microscopy (SEM) and crystal violet staining were conducted for the detection of biofilmforming ability in 24-well plates.

  4. Identification of genes that promote or inhibit olfactory memory formation in Drosophila.

    Science.gov (United States)

    Walkinshaw, Erica; Gai, Yunchao; Farkas, Caitlin; Richter, Daniel; Nicholas, Eric; Keleman, Krystyna; Davis, Ronald L

    2015-04-01

    Genetic screens in Drosophila melanogaster and other organisms have been pursued to filter the genome for genetic functions important for memory formation. Such screens have employed primarily chemical or transposon-mediated mutagenesis and have identified numerous mutants including classical memory mutants, dunce and rutabaga. Here, we report the results of a large screen using panneuronal RNAi expression to identify additional genes critical for memory formation. We identified >500 genes that compromise memory when inhibited (low hits), either by disrupting the development and normal function of the adult animal or by participating in the neurophysiological mechanisms underlying memory formation. We also identified >40 genes that enhance memory when inhibited (high hits). The dunce gene was identified as one of the low hits and further experiments were performed to map the effects of the dunce RNAi to the α/β and γ mushroom body neurons. Additional behavioral experiments suggest that dunce knockdown in the mushroom body neurons impairs memory without significantly affecting acquisition. We also characterized one high hit, sickie, to show that RNAi knockdown of this gene enhances memory through effects in dopaminergic neurons without apparent effects on acquisition. These studies further our understanding of two genes involved in memory formation, provide a valuable list of genes that impair memory that may be important for understanding the neurophysiology of memory or neurodevelopmental disorders, and offer a new resource of memory suppressor genes that will aid in understanding restraint mechanisms employed by the brain to optimize resources. Copyright © 2015 by the Genetics Society of America.

  5. Identification of Genes Affecting Hydrogen Sulfide Formation in Saccharomyces cerevisiae▿

    Science.gov (United States)

    Linderholm, Angela L.; Findleton, Carrie L.; Kumar, Gagandeep; Hong, Yeun; Bisson, Linda F.

    2008-01-01

    A screen of the Saccharomyces cerevisiae deletion strain set was performed to identify genes affecting hydrogen sulfide (H2S) production. Mutants were screened using two assays: colony color on BiGGY agar, which detects the basal level of sulfite reductase activity, and production of H2S in a synthetic juice medium using lead acetate detection of free sulfide in the headspace. A total of 88 mutants produced darker colony colors than the parental strain, and 4 produced colonies significantly lighter in color. There was no correlation between the appearance of a dark colony color on BiGGY agar and H2S production in synthetic juice media. Sixteen null mutations were identified as leading to the production of increased levels of H2S in synthetic juice using the headspace analysis assay. All 16 mutants also produced H2S in actual juices. Five of these genes encode proteins involved in sulfur containing amino acid or precursor biosynthesis and are directly associated with the sulfate assimilation pathway. The remaining genes encode proteins involved in a variety of cellular activities, including cell membrane integrity, cell energy regulation and balance, or other metabolic functions. The levels of hydrogen sulfide production of each of the 16 strains varied in response to nutritional conditions. In most cases, creation of multiple deletions of the 16 mutations in the same strain did not lead to a further increase in H2S production, instead often resulting in decreased levels. PMID:18192430

  6. Temporal patterns of gene expression associated with tuberous root formation and development in sweetpotato (Ipomoea batatas).

    Science.gov (United States)

    Wang, Zhangying; Fang, Boping; Chen, Xinliang; Liao, Minghuan; Chen, Jingyi; Zhang, Xiongjian; Huang, Lifei; Luo, Zhongxia; Yao, Zhufang; Li, Yujun

    2015-07-16

    The tuberous root of sweetpotato is undisputedly an important organ from agronomic and biological perspectives. Little is known regarding the regulatory networks programming tuberous root formation and development. Here, as a first step toward understanding these networks, we analyzed and characterized the genome-wide transcriptional profiling and dynamics of sweetpotato root in seven distinct developmental stages using a customized microarray containing 39,724 genes. Analysis of these genes identified temporal programs of gene expression, including hundreds of transcription factor (TF) genes. We found that most genes active in roots were shared across all developmental stages, although significant quantitative changes in gene abundance were observed for 5,368 (including 435 TFs) genes. Clustering analysis of these differentially expressed genes pointed out six distinct expression patterns during root development. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis revealed that genes involved in different processes were enriched at specific stages of root development. In contrast with the large number of shared expressed genes in root development, each stage or period of root development has only a small number of specific genes. In total, 712 (including 27 TFs) and 1,840 (including 115 TFs) genes were identified as root-stage and root-period specific, respectively at the level of microarray. Several of the specific TF genes are known regulators of root development, including DA1-related protein, SHORT-ROOT and BEL1-like. The remaining TFs with unknown roles would also play critical regulatory roles during sweetpotato tuberous root formation and development. The results generated in this study provided spatiotemporal patterns of root gene expression in support of future efforts for understanding the underlying molecular mechanism that control sweetpotato yield and quality.

  7. Relationship of biofilm formation and different virulence genes in uropathogenic Escherichia coli isolates from Northwest Iran

    Directory of Open Access Journals (Sweden)

    Fattahi, Sargol

    2015-07-01

    Full Text Available Background and objectives: The ( bacterium is one of the main causative agents of urinary tract infections (UTI worldwide. The ability of this bacterium to form biofilms on medical devices such as catheters plays an important role in the development of UTI. The aim of the present study was to investigate the possible relationship between virulence factors and biofilm formation of isolates responsible for urinary tract infection.Materials and methods: A total of 100 isolates isolated from patients with UTI were collected and characterized by routine bacteriological methods. In vitro biofilm formation by these isolates was determined using the 96-well microtiter-plate test, and the presence of , , and virulence genes was examined by PCR assay. Data analysis was performed using SPSS 16.0 software.Results: From 100 isolates isolated from UTIs, 92% were shown to be biofilm positive. The genes , , and were detected in 43%, 94% and 26% of isolates, respectively. Biofilm formation in isolates that expressed , , and genes was 100%, 93%, and 100%, respectively. A significant relationship was found between presence of the gene and biofilm formation in isolates isolated from UTI (<0.01, but there was no statistically significant correlation between presence of and genes with biofilm formation (<0.072, <0.104. Conclusion: Results showed that and genes do not seem to be necessary or sufficient for the production of biofilm in , but the presence of correlates with increased biofilm formation of urinary tract isolates. Overall, the presence of , , and virulence genes coincides with in vitro biofilm formation in uropathogenic

  8. The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

    Science.gov (United States)

    Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

    2002-03-01

    Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

  9. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  10. A potato skin SSH library yields new candidate genes for suberin biosynthesis and periderm formation.

    Science.gov (United States)

    Soler, Marçal; Serra, Olga; Fluch, Silvia; Molinas, Marisa; Figueras, Mercè

    2011-05-01

    Potato (Solanum tuberosum) tubers are underground storage organs covered by the skin or periderm, a suberized layer that protects inner flesh from dehydration and pathogens. Understanding the molecular processes associated with periderm formation is of great importance for a better knowledge of this protective tissue and for improving the storage life of tubers. Here, to isolate new candidate genes for potato periderm, a suppression subtractive hybridization library from potato skin was performed. This library yielded a comprehensive list of 108 candidate genes that were manually sorted in functional categories according to the main cellular and metabolic processes in periderm. As expected, the list contains Suberin and wax genes, including some genes with a demonstrated role in the biosynthesis of these cell wall aliphatic compounds. Moreover, Regulation and Stress and defence genes are highly abundant in the library in general agreement with previous potato skin proteomic studies. The putative function of the genes in periderm is discussed.

  11. Influence of isolate origin and presence of various genes on biofilm formation by Enterococcus faecium.

    Science.gov (United States)

    Almohamad, Sam; Somarajan, Sudha R; Singh, Kavindra V; Nallapareddy, Sreedhar R; Murray, Barbara E

    2014-04-01

    Enterococcus faecium, a major cause of nosocomial infections, is often isolated from conditions where biofilm is considered to be important in the establishment of infections. We investigated biofilm formation among E. faecium isolates from diverse sources and found that the occurrence and amount of biofilm formation were significantly greater in clinical isolates than fecal isolates from community volunteers. We also found that the presence of the empfm (E. faecium pilus) operon was associated with the amount of biofilm formation. Furthermore, we analyzed the possible association between the distribution of 16 putative virulence genes and the occurrence of biofilm production. Even though the prevalence of these virulence genes was significantly higher in clinical isolates, we did not observe any correlation with the occurrence of biofilm formation. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  12. Digital gene expression tag profiling of bat digits provides robust candidates contributing to wing formation

    Directory of Open Access Journals (Sweden)

    Young Rebecca L

    2010-11-01

    Full Text Available Abstract Background As the only truly flying mammals, bats use their unique wing - consisting of four elongated digits (digits II-V connected by membranes - to power their flight. In addition to the elongated digits II-V, the forelimb contains one shorter digit (digit I that is morphologically similar to the hindlimb digits. Here, we capitalized on the morphological variation among the bat forelimb digits to investigate the molecular mechanisms underlying digit elongation and wing formation. Using next generation sequencing technology, we performed digital gene expression tag profiling (DGE-tag profiling of developing digits in a pooled sample of two Myotis ricketti and validated our sequencing results using real-time quantitative PCR (RT-qPCR of gene expression in the developing digits of two Hipposideros armiger. Results Among hundreds of genes exhibiting significant differences in expression between the short and long digits, we highlight 14 genes most related to digit elongation. These genes include two Tbx genes (Tbx3 and Tbx15, five BMP pathway genes (Bmp3, RGMB, Smad1, Smad4 and Nog, four Homeobox genes (Hoxd8, Hoxd9, Hoxa1 and Satb1, and three other genes (Twist1, Tmeff2 and Enpp2 related to digit malformations or cell proliferation. In addition, our results suggest that Tbx4 and Pitx2 contribute to the morphological similarity and five genes (Acta1, Tnnc2, Atp2a1, Hrc and Myoz1 contribute to the functional similarity between the thumb and hindlimb digits. Conclusions Results of this study not only implicate many developmental genes as robust candidates underlying digit elongation and wing formation in bats, but also provide a better understanding of the genes involved in autopodial development in general.

  13. Magnesium ions mitigate biofilm formation of Bacillus species via downregulation of matrix genes expression

    Directory of Open Access Journals (Sweden)

    Hilla eOknin

    2015-09-01

    Full Text Available The objective of this study was to investigate the effect of Mg2+ ions on biofilm formation by Bacillus species, which are considered as problematic microorganisms in the food industry. We found that magnesium ions are capable to inhibit significantly biofilm formation of Bacillus species at 50 mM concentration and higher. We further report that Mg2+ ions don't inhibit bacterial growth at elevated concentrations; hence, the mode of action of Mg2+ ions is apparently specific to inhibition of biofilm formation. Biofilm formation depends on the synthesis of extracellular matrix, whose production in Bacillus subtilis is specified by two major operons: the epsA-O and tapA operons. We analyzed the effect of Mg2+ ions on matrix gene expression using transcriptional fusions of the promoters for eps and tapA to the gene encoding β galactosidase. The expression of the two matrix operons was reduced drastically in response to Mg2+ ions suggesting about their inhibitory effect on expression of the matrix genes in B. subtilis. Since the matrix gene expression is tightly controlled by Spo0A dependent pathway, we conclude that Mg2+ ions could affect the signal transduction for biofilm formation through this pathway.

  14. Temporal Profile of Biofilm Formation, Gene Expression and Virulence Analysis in Candida albicans Strains.

    Science.gov (United States)

    de Barros, Patrícia Pimentel; Rossoni, Rodnei Dennis; De Camargo Ribeiro, Felipe; Junqueira, Juliana Campos; Jorge, Antonio Olavo Cardoso

    2017-04-01

    The characterization of Candida albicans strains with different degrees of virulence became very useful to understand the mechanisms of fungal virulence. Then, the objective of this study was to assess and compare the temporal profiles of biofilms formation, gene expression of ALS1, ALS3, HWP1, BCR1, EFG1, TEC1, SAP5, PLB2 and LIP9 and virulence in Galleria mellonella of C. albicans ATCC18804 and a clinical sample isolated from an HIV-positive patient (CA60). Although the CFU/mL counting was higher in biofilms formed in vitro by ATCC strain, the temporal profile of the analysis of the transcripts of the C. albicans strains was elevated to Ca60 compared to strain ATCC, especially in the genes HWP1, ALS3, SAP5, PLB2 and LIP9 (up regulation). Ca60 was more pathogenic for G. mellonella in the survival assay (p = 0.0394) and hemocytes density (p = 0.0349), agreeing with upregulated genes that encode the expression of hyphae and hydrolase genes of Ca60. In conclusion, the C. albicans strains used in this study differ in the amount of biofilm formation, virulence in vivo and transcriptional profiles of genes analyzed that can change factors associated with colonization, proliferation and survival of C. albicans at different niches. SAP5 and HWP1 were the genes more expressed in the formation of biofilm in vitro.

  15. Class I KNOX genes are associated with organogenesis during bulbil formation in Agave tequilana.

    Science.gov (United States)

    Abraham-Juárez, María Jazmín; Martínez-Hernández, Aída; Leyva-González, Marco Antonio; Herrera-Estrella, Luis; Simpson, June

    2010-09-01

    Bulbil formation in Agave tequilana was analysed with the objective of understanding this phenomenon at the molecular and cellular levels. Bulbils formed 14-45 d after induction and were associated with rearrangements in tissue structure and accelerated cell multiplication. Changes at the cellular level during bulbil development were documented by histological analysis. In addition, several cDNA libraries produced from different stages of bulbil development were generated and partially sequenced. Sequence analysis led to the identification of candidate genes potentially involved in the initiation and development of bulbils in Agave, including two putative class I KNOX genes. Real-time reverse transcription-PCR and in situ hybridization revealed that expression of the putative Agave KNOXI genes occurs at bulbil initiation and specifically in tissue where meristems will develop. Functional analysis of Agave KNOXI genes in Arabidopsis thaliana showed the characteristic lobed phenotype of KNOXI ectopic expression in leaves, although a slightly different phenotype was observed for each of the two Agave genes. An Arabidopsis KNOXI (knat1) mutant line (CS30) was successfully complemented with one of the Agave KNOX genes and partially complemented by the other. Analysis of the expression of the endogenous Arabidopsis genes KNAT1, KNAT6, and AS1 in the transformed lines ectopically expressing or complemented by the Agave KNOX genes again showed different regulatory patterns for each Agave gene. These results show that Agave KNOX genes are functionally similar to class I KNOX genes and suggest that spatial and temporal control of their expression is essential during bulbil formation in A. tequilana.

  16. Burkholderia cenocepacia ShvR-regulated genes that influence colony morphology, biofilm formation, and virulence.

    Science.gov (United States)

    Subramoni, Sujatha; Nguyen, David T; Sokol, Pamela A

    2011-08-01

    Burkholderia cenocepacia is an opportunistic pathogen that primarily infects cystic fibrosis (CF) patients. Previously, we reported that ShvR, a LysR regulator, influences colony morphology, virulence, and biofilm formation and regulates the expression of an adjacent 24-kb genomic region encoding 24 genes. In this study, we report the functional characterization of selected genes in this region. A Tn5 mutant with shiny colony morphology was identified with a polar mutation in BCAS0208, predicted to encode an acyl-coenzyme A dehydrogenase. Mutagenesis of BCAS0208 and complementation analyses revealed that BCAS0208 is required for rough colony morphology, biofilm formation, and virulence on alfalfa seedlings. It was not possible to complement with BCAS0208 containing a mutation in the catalytic site. BCAS0201, encoding a putative flavin adenine dinucleotide (FAD)-dependent oxidoreductase, and BCAS0207, encoding a putative citrate synthase, do not influence colony morphology but are required for optimum levels of biofilm formation and virulence. Both BCAS0208 and BCAS0201 contribute to pellicle formation, although individual mutations in each of these genes had no appreciable effect on pellicle formation. A mutant with a polar insertion in BCAS0208 was significantly less virulent in a rat model of chronic lung infection as well as in the alfalfa model. Genes in this region were shown to influence utilization of branched-chain fatty acids, tricarboxylic acid cycle substrates, l-arabinose, and branched-chain amino acids. Together, our data show that the ShvR-regulated genes BCAS0208 to BCAS0201 are required for the rough colony morphotype, biofilm and pellicle formation, and virulence in B. cenocepacia.

  17. The Gene Expression Program for the Formation of Wing Cuticle in Drosophila.

    Directory of Open Access Journals (Sweden)

    Lukasz F Sobala

    2016-05-01

    Full Text Available The cuticular exoskeleton of insects and other arthropods is a remarkably versatile material with a complex multilayer structure. We made use of the ability to isolate cuticle synthesizing cells in relatively pure form by dissecting pupal wings and we used RNAseq to identify genes expressed during the formation of the adult wing cuticle. We observed dramatic changes in gene expression during cuticle deposition, and combined with transmission electron microscopy, we were able to identify candidate genes for the deposition of the different cuticular layers. Among genes of interest that dramatically change their expression during the cuticle deposition program are ones that encode cuticle proteins, ZP domain proteins, cuticle modifying proteins and transcription factors, as well as genes of unknown function. A striking finding is that mutations in a number of genes that are expressed almost exclusively during the deposition of the envelope (the thin outermost layer that is deposited first result in gross defects in the procuticle (the thick chitinous layer that is deposited last. An attractive hypothesis to explain this is that the deposition of the different cuticle layers is not independent with the envelope instructing the formation of later layers. Alternatively, some of the genes expressed during the deposition of the envelope could form a platform that is essential for the deposition of all cuticle layers.

  18. The Influence of Gene Expression Time Delays on Gierer–Meinhardt Pattern Formation Systems

    KAUST Repository

    Seirin Lee, S.

    2010-03-23

    There are numerous examples of morphogen gradients controlling long range signalling in developmental and cellular systems. The prospect of two such interacting morphogens instigating long range self-organisation in biological systems via a Turing bifurcation has been explored, postulated, or implicated in the context of numerous developmental processes. However, modelling investigations of cellular systems typically neglect the influence of gene expression on such dynamics, even though transcription and translation are observed to be important in morphogenetic systems. In particular, the influence of gene expression on a large class of Turing bifurcation models, namely those with pure kinetics such as the Gierer-Meinhardt system, is unexplored. Our investigations demonstrate that the behaviour of the Gierer-Meinhardt model profoundly changes on the inclusion of gene expression dynamics and is sensitive to the sub-cellular details of gene expression. Features such as concentration blow up, morphogen oscillations and radical sensitivities to the duration of gene expression are observed and, at best, severely restrict the possible parameter spaces for feasible biological behaviour. These results also indicate that the behaviour of Turing pattern formation systems on the inclusion of gene expression time delays may provide a means of distinguishing between possible forms of interaction kinetics. Finally, this study also emphasises that sub-cellular and gene expression dynamics should not be simply neglected in models of long range biological pattern formation via morphogens. © 2010 Society for Mathematical Biology.

  19. Targeted mutation of the SC3 hydrophobin gene of Schizophyllum commune affects formation of aerial hyphae

    NARCIS (Netherlands)

    vanWetter, MA; Schuren, FHJ; Schuurs, TA; Wessels, JGH

    1996-01-01

    The SC3 hydrophobin gene of Schizophyllum commune was disrupted by homologous integration of an SC3 genomic fragment interrupted by a phleomycin resistance cassette. The phenotype of the mutant was particularly clear in sealed plates in which formation of aerial hyphae was blocked. In non-sealed

  20. Inhibitory effects of flavonoids on biofilm formation by Staphylococcus aureus that overexpresses efflux protein genes.

    Science.gov (United States)

    Lopes, Laênia Angélica Andrade; Dos Santos Rodrigues, Jéssica Bezerra; Magnani, Marciane; de Souza, Evandro Leite; de Siqueira-Júnior, José P

    2017-06-01

    This study evaluated the efficacy of glycone (myricitrin, hesperidin and phloridzin) and aglycone flavonoids (myricetin, hesperetin and phloretin) in inhibiting biofilm formation by Staphylococcus aureus RN4220 and S. aureus SA1199B that overexpress the msrA and norA efflux protein genes, respectively. The minimum inhibitory concentration (MIC) and minimum biofilm inhibitory concentration (MBIC 50 - defined as the lowest concentration that resulted in ≥50% inhibition of biofilm formation) of flavonoids were determined using microdilution in broth procedures. The flavonoids showed MIC >1024 μg/mL against S. aureus RN4220 and S. aureus SA1199B; however, these compounds at lower concentrations (1-256 μg/mL) showed inhibitory effects on biofilm formation by these strains. Aglycone flavonoids showed lower MBIC 50 values than their respective glycone forms. The lowest MBIC 50 values (1 and 4 μg/mL) were observed against S. aureus RN4220. Myricetin, hesperetin and phloretin exhibited biofilm formation inhibition >70% for S. aureus RN4220, and lower biofilm formation inhibition against S. aureus SA1199B. These results indicate that sub-MICs of the tested flavonoids inhibit biofilm formation by S. aureus strains that overexpress efflux protein genes. These effects are more strongly established by aglycone flavonoids. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Homeotic Genes and the ABCDE Model for Floral Organ Formation in Wheat

    Directory of Open Access Journals (Sweden)

    Koji Murai

    2013-06-01

    Full Text Available Floral organ formation has been the subject of intensive study for over 20 years, particularly in the model dicot species Arabidopsis thaliana. These studies have led to the establishment of a general model for the development of floral organs in higher plants, the so-called ABCDE model, in which floral whorl-specific combinations of class A, B, C, D, or E genes specify floral organ identity. In Arabidopsis, class A, B, C, D, E genes encode MADS-box transcription factors except for the class A gene APETALA2. Mutation of these genes induces floral organ homeosis. In this review, I focus on the roles of these homeotic genes in bread wheat (Triticum aestivum, particularly with respect to the ABCDE model. Pistillody, the homeotic transformation of stamens into pistil-like structures, occurs in cytoplasmic substitution (alloplasmic wheat lines that have the cytoplasm of the related wild species Aegilops crassa. This phenomenon is a valuable tool for analysis of the wheat ABCDE model. Using an alloplasmic line, the wheat ortholog of DROOPING LEAF (TaDL, a member of the YABBY gene family, has been shown to regulate pistil specification. Here, I describe the current understanding of the ABCDE model for floral organ formation in wheat.

  2. Homeotic Genes and the ABCDE Model for Floral Organ Formation in Wheat.

    Science.gov (United States)

    Murai, Koji

    2013-06-25

    Floral organ formation has been the subject of intensive study for over 20 years, particularly in the model dicot species Arabidopsis thaliana. These studies have led to the establishment of a general model for the development of floral organs in higher plants, the so-called ABCDE model, in which floral whorl-specific combinations of class A, B, C, D, or E genes specify floral organ identity. In Arabidopsis, class A, B, C, D, E genes encode MADS-box transcription factors except for the class A gene APETALA2. Mutation of these genes induces floral organ homeosis. In this review, I focus on the roles of these homeotic genes in bread wheat (Triticum aestivum), particularly with respect to the ABCDE model. Pistillody, the homeotic transformation of stamens into pistil-like structures, occurs in cytoplasmic substitution (alloplasmic) wheat lines that have the cytoplasm of the related wild species Aegilops crassa. This phenomenon is a valuable tool for analysis of the wheat ABCDE model. Using an alloplasmic line, the wheat ortholog of DROOPING LEAF (TaDL), a member of the YABBY gene family, has been shown to regulate pistil specification. Here, I describe the current understanding of the ABCDE model for floral organ formation in wheat.

  3. Isolation of genes involved in biofilm formation of a Klebsiella pneumoniae strain causing pyogenic liver abscess.

    Directory of Open Access Journals (Sweden)

    Meng-Chuan Wu

    Full Text Available BACKGROUND: Community-acquired pyogenic liver abscess (PLA complicated with meningitis and endophthalmitis caused by Klebsiella pneumoniae is an emerging infectious disease. To investigate the mechanisms and effects of biofilm formation of K. pneumoniae causing PLA, microtiter plate assays were used to determine the levels of biofilm formed by K. pneumoniae clinical isolates and to screen for biofilm-altered mutants from a transposon mutant library of a K. pneumoniae PLA-associated strain. METHODOLOGY/PRINCIPAL FINDINGS: The biofilm formation of K. pneumoniae was examined by microtiter plate assay. Higher levels of biofilm formation were demonstrated by K. pneumoniae strains associated with PLA. A total of 23 biofilm-decreased mutants and 4 biofilm-increased mutants were identified. Among these mutants, a biofilm-decreased treC mutant displayed less mucoviscosity and produced less capsular polysaccharide (CPS, whereas a biofilm-increased sugE mutant displayed higher mucoviscosity and produced more CPS. The biofilm phenotypes of treC and sugE mutants also were confirmed by glass slide culture. Deletion of treC, which encodes trehalose-6-phosphate hydrolase, impaired bacterial trehalose utilization. Addition of glucose to the culture medium restored the capsule production and biofilm formation in the treC mutant. Transcriptional profile analysis suggested that the increase of CPS production in ΔsugE may reflect elevated cps gene expression (upregulated through rmpA in combination with increased treC expression. In vivo competition assays demonstrated that the treC mutant strain was attenuated in competitiveness during intragastric infection in mice. CONCLUSIONS/SIGNIFICANCE: Genes important for biofilm formation by K. pneumoniae PLA strain were identified using an in vitro assay. Among the identified genes, treC and sugE affect biofilm formation by modulating CPS production. The importance of treC in gastrointestinal tract colonization suggests

  4. Fifteen novel FBN1 mutations causing Marfan syndrome detected by heteroduplex analysis of genomic amplicons

    Energy Technology Data Exchange (ETDEWEB)

    Nijbroek, G.; Sood, S.; McIntosh, I. [John Hopkins Univ. School of Medicine, Baltimore, MD (United States)] [and others

    1995-07-01

    Mutations in the gene encoding fibrillin-1 (FBN1), a component of the extracellular microfibril, cause the Marfan syndrome (MFS). This statement is supported by the observations that the classic Marfan phenotype cosegregates with intragenic and/or flanking marker alleles in all families tested and that a significant number of FBN1 mutations have been identified in affected individuals. We have now devised a method to screen the entire coding sequence and flanking splice junctions of FBN1. On completion for a panel of nine probands with classic MFS, six new mutations were identified that accounted for disease in seven (78%) of nine patients. Nine additional new mutations have been characterized in the early stages of a larger screening project. These 15 mutations were equally distributed throughout the gene and, with one exception, were specific to single families. One-third of mutations created premature termination codons, and 6 of 15 substituted residues with putative significance for calcium finding to epidermal growth factor (EGF)-like domains. Mutations causing severe and rapidly progressive disease that presents in the neonatal period can occur in a larger region of the gene than previously demonstrated, and the nature of the mutation is as important a determinant as its location, in predisposing to this phenotype. 56 refs., 5 figs., 3 tabs.

  5. Biofilm formation, phenotypic production of cellulose and gene expression in Salmonella enterica decrease under anaerobic conditions.

    Science.gov (United States)

    Lamas, A; Miranda, J M; Vázquez, B; Cepeda, A; Franco, C M

    2016-12-05

    Salmonella enterica subsp. enterica is one of the main food-borne pathogens. This microorganism combines an aerobic life outside the host with an anaerobic life within the host. One of the main concerns related to S. enterica is biofilm formation and cellulose production. In this study, biofilm formation, morphotype, cellulose production and transcription of biofilm and quorum sensing-related genes of 11 S. enterica strains were tested under three different conditions: aerobiosis, microaerobiosis, and anaerobiosis. The results showed an influence of oxygen levels on biofilm production. Biofilm formation was significantly higher (Penterica strains tested. This gene expression levels were less reduced in S. Typhimurium and S. Enteritidis compared to the tested serotypes. There was a relationship between the expression of biofilm and quorum sensing-related genes. Thus, the results from this study indicate that biofilm formation and cellulose production are highly influenced by atmospheric conditions. This must be taken into account as contamination with these bacteria can occur during food processing under vacuum or modified atmospheres. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Identification and expression analysis of genes associated with bovine blastocyst formation

    Directory of Open Access Journals (Sweden)

    Van Zeveren Alex

    2007-06-01

    Full Text Available Abstract Background Normal preimplantation embryo development encompasses a series of events including first cleavage division, activation of the embryonic genome, compaction and blastocyst formation. First lineage differentiation starts at the blastocyst stage with the formation of the trophectoderm and the inner cell mass. The main objective of this study was the detection, identification and expression analysis of genes associated with blastocyst formation in order to help us better understand this process. This information could lead to improvements of in vitro embryo production procedures. Results A subtractive cDNA library was constructed enriched for transcripts preferentially expressed at the blastocyst stage compared to the 2-cell and 8-cell stage. Sequence information was obtained for 65 randomly selected clones. The RNA expression levels of 12 candidate genes were determined throughout 3 stages of preimplantation embryo development (2-cell, 8-cell and blastocyst and compared with the RNA expression levels of in vivo "golden standard" embryos using real-time PCR. The RNA expression profiles of 9 (75% transcripts (KRT18, FN1, MYL6, ATP1B3, FTH1, HINT1, SLC25A5, ATP6V0B, RPL10 were in agreement with the subtractive cDNA cloning approach, whereas for the remaining 3 (25% (ACTN1, COPE, EEF1A1 the RNA expression level was equal or even higher at the earlier developmental stages compared to the blastocyst stage. Moreover, significant differences in RNA expression levels were observed between in vitro and in vivo produced embryos. By immunofluorescent labelling, the protein expression of KRT18, FN1 and MYL6 was determined throughout bovine preimplantation embryo development and showed the same pattern as the RNA expression analyses. Conclusion By subtractive cDNA cloning, candidate genes involved in blastocyst formation were identified. For several candidate genes, important differences in gene expression were observed between in vivo and in

  7. Identification of Chloride Intracellular Channel Protein 3 as a Novel Gene Affecting Human Bone Formation

    DEFF Research Database (Denmark)

    Brum, A M; Leije, M; J, Schreuders-Koedam

    2017-01-01

    is diminished and more adipocytes are seen in the bone marrow, suggesting a shift in MSC lineage commitment. Identification of specific factors that stimulate osteoblast differentiation from human MSCs may deliver therapeutic targets to treat osteoporosis. The aim of this study was to identify novel genes...... an in vivo human bone formation model in which hMSCs lentivirally transduced with the CLIC3 overexpression construct were loaded onto a scaffold (hydroxyapatite-tricalcium-phosphate), implanted under the skin of NOD-SCID mice, and analyzed for bone formation 8 weeks later. CLIC3 overexpression led to a 15...

  8. Osteoblast Differentiation and Bone Formation Gene Expression in Strontium-inducing Bone Marrow Mesenchymal Stem Cell

    OpenAIRE

    SILA-ASNA, MONNIPHA; BUNYARATVEJ, AHNOND; Maeda, Sakan; Kitaguchi, Hiromichi; BUNYARATAVEJ, NARONG

    2007-01-01

    Osteoblastic differentiation from human mesenchymal stem cell (hMSCs) is animportant step of bone formation. We studied the in vitro induction of hMSCs byusing strontium ranelate, a natural trace amount in water, food and human skeleton.The mRNA synthesis of various osteoblast specific genes was assessed by means ofreverse transcription polymerase chain reaction (RT-PCR). In the hMSCs culture,strontium ranelate could enhance the induction of hMSCs to differentiate intoosteoblasts. Cbfa1 gene ...

  9. Gene expression and proteomic analysis of the formation of Phakopsora pachyrhizi appressoria.

    Science.gov (United States)

    Stone, Christine L; McMahon, Michael B; Fortis, Laurie L; Nuñez, Alberto; Smythers, Gary W; Luster, Douglas G; Frederick, Reid D

    2012-06-22

    Phakopsora pachyrhizi is an obligate fungal pathogen causing Asian soybean rust (ASR). A dual approach was taken to examine the molecular and biochemical processes occurring during the development of appressoria, specialized infection structures by which P. pachyrhizi invades a host plant. Suppression subtractive hybridization (SSH) was utilized to generate a cDNA library enriched for transcripts expressed during appressoria formation. Two-dimensional gel electrophoresis and mass spectroscopy analysis were used to generate a partial proteome of proteins present during appressoria formation. Sequence analysis of 1133 expressed sequence tags (ESTs) revealed 238 non-redundant ESTs, of which 53% had putative identities assigned. Twenty-nine of the non-redundant ESTs were found to be specific to the appressoria-enriched cDNA library, and did not occur in a previously constructed germinated urediniospore cDNA library. Analysis of proteins against a custom database of the appressoria-enriched ESTs plus Basidiomycota EST sequences available from NCBI revealed 256 proteins. Fifty-nine of these proteins were not previously identified in a partial proteome of P. pachyrhizi germinated urediniospores. Genes and proteins identified fell into functional categories of metabolism, cell cycle and DNA processing, protein fate, cellular transport, cellular communication and signal transduction, and cell rescue. However, 38% of ESTs and 24% of proteins matched only to hypothetical proteins of unknown function, or showed no similarity to sequences in the current NCBI database. Three novel Phakopsora genes were identified from the cDNA library along with six potentially rust-specific genes. Protein analysis revealed eight proteins of unknown function, which possessed classic secretion signals. Two of the extracellular proteins are reported as potential effector proteins. Several genes and proteins were identified that are expressed in P. pachyrhizi during appressoria formation

  10. Probiotic Lactobacillus sp. inhibit growth, biofilm formation and gene expression of caries-inducing Streptococcus mutans.

    Science.gov (United States)

    Wasfi, Reham; Abd El-Rahman, Ola A; Zafer, Mai M; Ashour, Hossam M

    2018-03-01

    Streptococcus mutans contributes significantly to dental caries, which arises from homoeostasic imbalance between host and microbiota. We hypothesized that Lactobacillus sp. inhibits growth, biofilm formation and gene expression of Streptococcus mutans. Antibacterial (agar diffusion method) and antibiofilm (crystal violet assay) characteristics of probiotic Lactobacillus sp. against Streptococcus mutans (ATCC 25175) were evaluated. We investigated whether Lactobacillus casei (ATCC 393), Lactobacillus reuteri (ATCC 23272), Lactobacillus plantarum (ATCC 14917) or Lactobacillus salivarius (ATCC 11741) inhibit expression of Streptococcus mutans genes involved in biofilm formation, quorum sensing or stress survival using quantitative real-time polymerase chain reaction (qPCR). Growth changes (OD600) in the presence of pH-neutralized, catalase-treated or trypsin-treated Lactobacillus sp. supernatants were assessed to identify roles of organic acids, peroxides and bacteriocin. Susceptibility testing indicated antibacterial (pH-dependent) and antibiofilm activities of Lactobacillus sp. against Streptococcus mutans. Scanning electron microscopy revealed reduction in microcolony formation and exopolysaccharide structural changes. Of the oral normal flora, L. salivarius exhibited the highest antibiofilm and peroxide-dependent antimicrobial activities. All biofilm-forming cells treated with Lactobacillus sp. supernatants showed reduced expression of genes involved in exopolysaccharide production, acid tolerance and quorum sensing. Thus, Lactobacillus sp. can inhibit tooth decay by limiting growth and virulence properties of Streptococcus mutans. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  11. The dam replacing gene product enhances Neisseria gonorrhoeae FA1090 viability and biofilm formation.

    Science.gov (United States)

    Kwiatek, Agnieszka; Bacal, Pawel; Wasiluk, Adrian; Trybunko, Anastasiya; Adamczyk-Poplawska, Monika

    2014-01-01

    Many Neisseriaceae do not exhibit Dam methyltransferase activity and, instead of the dam gene, possess drg (dam replacing gene) inserted in the leuS/dam locus. The drg locus in Neisseria gonorrhoeae FA1090 has a lower GC-pairs content (40.5%) compared to the whole genome of N. gonorrhoeae FA1090 (52%). The gonococcal drg gene encodes a DNA endonuclease Drg, with GmeATC specificity. Disruption of drg or insertion of the dam gene in gonococcal genome changes the level of expression of genes as shown by transcriptome analysis. For the drg-deficient N. gonorrhoeae mutant, a total of 195 (8.94% of the total gene pool) genes exhibited an altered expression compared to the wt strain by at least 1.5 fold. In dam-expressing N. gonorrhoeae mutant, the expression of 240 genes (11% of total genes) was deregulated. Most of these deregulated genes were involved in translation, DNA repair, membrane biogenesis and energy production as shown by cluster of orthologous group analysis. In vivo, the inactivation of drg gene causes the decrease of the number of live neisserial cells and long lag phase of growth. The insertion of dam gene instead of drg locus restores cell viability. We have also shown that presence of the drg gene product is important for N. gonorrhoeae FA1090 in adhesion, including human epithelial cells, and biofilm formation. Biofilm produced by drg-deficient strain is formed by more dispersed cells, compared to this one formed by parental strain as shown by scanning electron and confocal microscopy. Also adherence assays show a significantly smaller biomass of formed biofilm (OD570 = 0.242 ± 0.038) for drg-deficient strain, compared to wild-type strain (OD570 = 0.378 ± 0.057). Dam-expressing gonococcal cells produce slightly weaker biofilm with cells embedded in an extracellular matrix. This strain has also a five times reduced ability for adhesion to human epithelial cells. In this context, the presence of Drg is more advantageous for N. gonorrhoeae biology than

  12. Selenium controls transcription of paralogous formate dehydrogenase genes in the termite gut acetogen, Treponema primitia.

    Science.gov (United States)

    Matson, Eric G; Zhang, Xinning; Leadbetter, Jared R

    2010-08-01

    The termite gut spirochete, Treponema primitia, is a CO(2)-reductive acetogen that is phylogenetically distinct from other distantly related and more extensively studied acetogens such as Moorella thermoacetica. Research on T. primitia has revealed details about the role of spirochetes in CO(2)-reductive acetogenesis, a process important to the mutualism occurring between termites and their gut microbial communities. Here, a locus of the T. primitia genome containing Wood-Ljungdahl pathway genes for CO(2)-reductive acetogenesis was sequenced. This locus contained methyl-branch genes of the pathway (i.e. for the reduction of CO(2) to the level of methyl-tetrahydrofolate) including paralogous genes for cysteine and selenocysteine (Sec) variants of formate dehydrogenase (FDH) and genes for Sec incorporation. The FDH variants affiliated phylogenetically with hydrogenase-linked FDH enzymes, suggesting that T. primitia FDH enzymes utilize electrons derived directly from molecular H(2). Sub-nanomolar concentrations of selenium decreased transcript levels of the cysteine variant FDH gene. Selenium concentration did not markedly influence the level of mRNA upstream of the Sec-codon in the Sec variant FDH; however, the level of transcript extending downstream of the Sec-codon increased incrementally with increasing selenium concentrations. The features and regulation of these FDH genes are an indication that T. primitia may experience dynamic selenium availability in its H(2)-rich gut environment. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  13. Identification of putative candidate genes involved in cuticle formation in Prunus avium (sweet cherry) fruit.

    Science.gov (United States)

    Alkio, Merianne; Jonas, Uwe; Sprink, Thorben; van Nocker, Steven; Knoche, Moritz

    2012-07-01

    The cuticular membrane (CM) of Prunus avium (sweet cherry) and other fleshy fruit is under stress. Previous research indicates that the resultant strain promotes microscopic cuticular cracking. Microcracks impair the function of the CM as a barrier against pathogens and uncontrolled water loss/uptake. Stress and strain result from a cessation of CM deposition during early development, while the fruit surface continues to expand. The cessation of CM deposition, in turn, may be related to an early downregulation of CM-related genes. The aims of this study were to identify genes potentially involved in CM formation in sweet cherry fruit and to quantify their expression levels. Fruit growth and CM deposition were quantified weekly from anthesis to maturity and rates of CM deposition were calculated. Sequences of genes expressed in the sweet cherry fruit skin (exocarp) were generated using high-throughput sequencing of cDNA and de novo assembly and analysed using bioinformatics tools. Relative mRNA levels of selected genes were quantified in the exocarp and fruit flesh (mesocarp) weekly using reverse transcriptase-quantitative real-time PCR and compared with the calculated CM deposition rate over time. The rate of CM deposition peaked at 93 (±5) μg per fruit d(-1) about 19 d after anthesis. Based on sequence analyses, 18 genes were selected as potentially involved in CM formation. Selected sweet cherry genes shared up to 100 and 98 % similarity with the respective Prunus persica (peach) and Arabidopsis thaliana genes. Expression of 13 putative CM-related genes was restricted to the exocarp and correlated positively with the CM deposition rate. The results support the view that the cessation of CM deposition during early sweet cherry fruit development is accounted for by a downregulation of genes involved in CM deposition. Genes that merit further investigation include PaWINA, PaWINB, PaLipase, PaLTPG1, PaATT1, PaLCR, PaGPAT4/8, PaLACS2, PaLACS1 and PaCER1.

  14. Signalling pathways involved in adult heart formation revealed by gene expression profiling in Drosophila.

    Directory of Open Access Journals (Sweden)

    Bruno Zeitouni

    2007-10-01

    Full Text Available Drosophila provides a powerful system for defining the complex genetic programs that drive organogenesis. Under control of the steroid hormone ecdysone, the adult heart in Drosophila forms during metamorphosis by a remodelling of the larval cardiac organ. Here, we evaluated the extent to which transcriptional signatures revealed by genomic approaches can provide new insights into the molecular pathways that underlie heart organogenesis. Whole-genome expression profiling at eight successive time-points covering adult heart formation revealed a highly dynamic temporal map of gene expression through 13 transcript clusters with distinct expression kinetics. A functional atlas of the transcriptome profile strikingly points to the genomic transcriptional response of the ecdysone cascade, and a sharp regulation of key components belonging to a few evolutionarily conserved signalling pathways. A reverse genetic analysis provided evidence that these specific signalling pathways are involved in discrete steps of adult heart formation. In particular, the Wnt signalling pathway is shown to participate in inflow tract and cardiomyocyte differentiation, while activation of the PDGF-VEGF pathway is required for cardiac valve formation. Thus, a detailed temporal map of gene expression can reveal signalling pathways responsible for specific developmental programs and provides here substantial grasp into heart formation.

  15. Study of formation of green eggshell color in ducks through global gene expression.

    Directory of Open Access Journals (Sweden)

    Fa Qiong Xu

    Full Text Available The green eggshell color produced by ducks is a threshold trait that can be influenced by various factors, such as hereditary, environment and nutrition. The aim of this study was to investigate the genetic regulation of the formation of eggs with green shells in Youxian ducks. We performed integrative analysis of mRNAs and miRNAs expression profiling in the shell gland samples from ducks by RNA-Seq. We found 124 differentially expressed genes that were associated with various pathways, such as the ATP-binding cassette (ABC transporter and solute carrier supper family pathways. A total of 31 differentially expressed miRNAs were found between ducks laying green eggs and white eggs. KEGG pathway analysis of the predicted miRNA target genes also indicated the functional characteristics of these miRNAs; they were involved in the ABC transporter pathway and the solute carrier (SLC supper family. Analysis with qRT-PCR was applied to validate the results of global gene expression, which showed a correlation between results obtained by RNA-seq and RT-qPCR. Moreover, a miRNA-mRNA interaction network was established using correlation analysis of differentially expressed mRNA and miRNA. Compared to ducks that lay white eggs, ducks that lay green eggs include six up-regulated miRNAs that had regulatory effects on 35 down-regulated genes, and seven down-regulated miRNAs which influenced 46 up-regulated genes. For example, the ABC transporter pathway could be regulated by expressing gga-miR-144-3p (up-regulated with ABCG2 (up-regulated and other miRNAs and genes. This study provides valuable information about mRNA and miRNA regulation in duck shell gland tissues, and provides foundational information for further study on the eggshell color formation and marker-assisted selection for Youxian duck breeding.

  16. A novel mutation of adenomatous polyposis coli (APC) gene results in the formation of supernumerary teeth.

    Science.gov (United States)

    Yu, Fang; Cai, Wenping; Jiang, Beizhan; Xu, Laijun; Liu, Shangfeng; Zhao, Shouliang

    2018-01-01

    Supernumerary teeth are teeth that are present in addition to normal teeth. Although several hypotheses and some molecular signalling pathways explain the formation of supernumerary teeth, but their exact disease pathogenesis is unknown. To study the molecular mechanisms of supernumerary tooth-related syndrome (Gardner syndrome), a deeper understanding of the aetiology of supernumerary teeth and the associated syndrome is needed, with the goal of inhibiting disease inheritance via prenatal diagnosis. We recruited a Chinese family with Gardner syndrome. Haematoxylin and eosin staining of supernumerary teeth and colonic polyp lesion biopsies revealed that these patients exhibited significant pathological characteristics. APC gene mutations were detected by PCR and direct sequencing. We revealed the pathological pathway involved in human supernumerary tooth development and the mouse tooth germ development expression profile by RNA sequencing (RNA-seq). Sequencing analysis revealed that an APC gene mutation in exon 15, namely 4292-4293-Del GA, caused Gardner syndrome in this family. This mutation not only initiated the various manifestations typical of Gardner syndrome but also resulted in odontoma and supernumerary teeth in this case. Furthermore, RNA-seq analysis of human supernumerary teeth suggests that the APC gene is the key gene involved in the development of supernumerary teeth in humans. The mouse tooth germ development expression profile shows that the APC gene plays an important role in tooth germ development. We identified a new mutation in the APC gene that results in supernumerary teeth in association with Gardner syndrome. This information may shed light on the molecular pathogenesis of supernumerary teeth. Gene-based diagnosis and gene therapy for supernumerary teeth may become available in the future, and our study provides a high-resolution reference for treating other syndromes associated with supernumerary teeth. © 2017 The Authors. Journal of

  17. Transposon mutagenesis identifies novel genes associated with Staphylococcus aureus persister formation

    Directory of Open Access Journals (Sweden)

    Wang ewenjie

    2015-12-01

    Full Text Available Pathogenic bacterial persisters are responsible for the recalcitrance of chronic and persistent infections to antimicrobial therapy. Although the mechanisms of persister formation and survival have been widely studied in Escherichia coli, persistence mechanisms in S. aureus remain largely unknown. Here, we screened a transposon mutant library of a clinical methicillin-resistant Staphylococcus aureus(MRSA)strain, USA500 (ST8, under antibiotic pressure and identified 13 genes whose insertion mutations resulted in a defect in persistence. These candidate genes were further confirmed by evaluating the survival of the mutants upon exposure to levofloxacin and several other stress conditions. We found 13 insertion mutants with significantly lower persister numbers under several stress conditions, including sdhA, sdhB, ureG, mnhG1, fbaA, ctaB, clpX, parE, HOU_0223, HOU_0587, HOU_2091, HOU_2315 and HOU_2346, which mapped into pathways of oxidative phosphorylation, TCA cycle, glycolysis, cell cycle and ABC transporters, suggesting that these genes and pathways may play an important role in persister formation and survival. The newly constructed knockout strains of ureG, sdhA and sdhB and their complemented strains were also tested for defect in persisters following exposure to levofloxacin and several other stress conditions. The results from these experiments were consistent with the screening results, which indicated that deletion of these genes in MRSA USA500 leads to persister defect. These findings provide novel insights into the mechanisms of persister formation and survival in S. aureus and offer new targets for the development of persister-directed antibiotics for the improved treatment of chronic and persistent infections.

  18. Gene expression correlated with delay in shell formation in larval Pacific oysters (Crassostrea gigas) exposed to experimental ocean acidification provides insights into shell formation mechanisms.

    Science.gov (United States)

    De Wit, Pierre; Durland, Evan; Ventura, Alexander; Langdon, Chris J

    2018-02-22

    Despite recent work to characterize gene expression changes associated with larval development in oysters, the mechanism by which the larval shell is first formed is still largely unknown. In Crassostrea gigas, this shell forms within the first 24 h post fertilization, and it has been demonstrated that changes in water chemistry can cause delays in shell formation, shell deformations and higher mortality rates. In this study, we use the delay in shell formation associated with exposure to CO 2 -acidified seawater to identify genes correlated with initial shell deposition. By fitting linear models to gene expression data in ambient and low aragonite saturation treatments, we are able to isolate 37 annotated genes correlated with initial larval shell formation, which can be categorized into 1) ion transporters, 2) shell matrix proteins and 3) protease inhibitors. Clustering of the gene expression data into co-expression networks further supports the result of the linear models, and also implies an important role of dynein motor proteins as transporters of cellular components during the initial shell formation process. Using an RNA-Seq approach with high temporal resolution allows us to identify a conceptual model for how oyster larval calcification is initiated. This work provides a foundation for further studies on how genetic variation in these identified genes could affect fitness of oyster populations subjected to future environmental changes, such as ocean acidification.

  19. Network analysis reveals a causal role of mitochondrial gene activity in atherosclerotic lesion formation.

    Science.gov (United States)

    Vilne, Baiba; Skogsberg, Josefin; Foroughi Asl, Hassan; Talukdar, Husain Ahammad; Kessler, Thorsten; Björkegren, Johan L M; Schunkert, Heribert

    2017-12-01

    Mitochondrial damage and augmented production of reactive oxygen species (ROS) may represent an intermediate step by which hypercholesterolemia exacerbates atherosclerotic lesion formation. To test this hypothesis, in mice with severe but genetically reversible hypercholesterolemia (i.e. the so called Reversa mouse model), we performed time-resolved analyses of mitochondrial transcriptome in the aortic arch employing a systems-level network approach. During hypercholesterolemia, we observed a massive down-regulation (>28%) of mitochondrial genes, specifically at the time of rapid atherosclerotic lesion expansion and foam cell formation, i.e. between 30 and 40 weeks of age. Both phenomena - down-regulation of mitochondrial genes and lesion expansion - were largely reversible by genetically lowering plasma cholesterol (by >80%, from 427 to 54 ± 31 mg/L) at 30 weeks. Co-expression network analysis revealed that both mitochondrial signature genes were highly connected in two modules, negatively correlating with lesion size and supported as causal for coronary artery disease (CAD) in humans, as expression-associated single nucleotide polymorphisms (eSNPs) representing their genes overlapped markedly with established disease risk loci. Within these modules, we identified the transcription factor estrogen related receptor (ERR)-α and its co-factors PGC1-α and -β, i.e. two members of the peroxisome proliferator-activated receptor γ co-activator 1 family of transcription regulators, as key regulatory genes. Together, these factors are known as major orchestrators of mitochondrial biogenesis and antioxidant responses. Using a network approach, we demonstrate how hypercholesterolemia could hamper mitochondrial activity during atherosclerosis progression and pinpoint potential therapeutic targets to counteract these processes. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  20. Calcium and magnesium levels in primary tooth enamel and genetic variation in enamel formation genes.

    Science.gov (United States)

    Halusic, Alina M; Sepich, Victoria R; Shirley, Daniel C; Granjeiro, José M; Costa, Marcelo C; Küchler, Erika C; Vieira, Alexandre R

    2014-01-01

    Evidence exists that a genetic component in caries susceptibility is related to variation in enamel formation genes. The purpose of this study was to explore the trends of demineralization and remineralization of teeth from individuals whose genotypes for selected genes (ENAM, MMP20, TUFT, TFIP, and AMBN) are known. In this study, primary baseline teeth (20) were exposed to an artificial caries solution, followed by a remineralizing solution. Biopsies of each tooth category (baseline, carious, and fluoridated) were completed via an acid wash solution. Concentrations of magnesium and calcium were measured using an optical emission spectrometer instrument. Allele and genotype frequencies for calcium and magnesium levels were compared between each tooth category. To help interpret the results, we also calculated odds ratios. Calcium levels exceeded magnesium levels in each sample. In addition, mineral concentration varied among samples. Associations could be seen between genetic variation in ENAM (P=.0003 baseline values for calcium, P<.001 baseline values for magnesium, P<.04 artificial caries values for magnesium) and AMBN (P<.02 artificial caries values for calcium) with mineral concentration. Our results suggest that genetic variation of enamel formation genes may influence calcium and magnesium concentrations of teeth and impact the development of caries.

  1. The formation of estrogen-like tamoxifen metabolites and their influence on enzyme activity and gene expression of ADME genes.

    Science.gov (United States)

    Johänning, Janina; Kröner, Patrick; Thomas, Maria; Zanger, Ulrich M; Nörenberg, Astrid; Eichelbaum, Michel; Schwab, Matthias; Brauch, Hiltrud; Schroth, Werner; Mürdter, Thomas E

    2018-03-01

    Tamoxifen, a standard therapy for breast cancer, is metabolized to compounds with anti-estrogenic as well as estrogen-like action at the estrogen receptor. Little is known about the formation of estrogen-like metabolites and their biological impact. Thus, we characterized the estrogen-like metabolites tamoxifen bisphenol and metabolite E for their metabolic pathway and their influence on cytochrome P450 activity and ADME gene expression. The formation of tamoxifen bisphenol and metabolite E was studied in human liver microsomes and Supersomes™. Cellular metabolism and impact on CYP enzymes was analyzed in upcyte® hepatocytes. The influence of 5 µM of tamoxifen, anti-estrogenic and estrogen-like metabolites on CYP activity was measured by HPLC MS/MS and on ADME gene expression using RT-PCR analyses. Metabolite E was formed from tamoxifen by CYP2C19, 3A and 1A2 and from desmethyltamoxifen by CYP2D6, 1A2 and 3A. Tamoxifen bisphenol was mainly formed from (E)- and (Z)-metabolite E by CYP2B6 and CYP2C19, respectively. Regarding phase II metabolism, UGT2B7, 1A8 and 1A3 showed highest activity in glucuronidation of tamoxifen bisphenol and metabolite E. Anti-estrogenic metabolites (Z)-4-hydroxytamoxifen, (Z)-endoxifen and (Z)-norendoxifen inhibited the activity of CYP2C enzymes while tamoxifen bisphenol consistently induced CYPs similar to rifampicin and phenobarbital. On the transcript level, highest induction up to 5.6-fold was observed for CYP3A4 by tamoxifen, (Z)-4-hydroxytamoxifen, tamoxifen bisphenol and (E)-metabolite E. Estrogen-like tamoxifen metabolites are formed in CYP-dependent reactions and are further metabolized by glucuronidation. The induction of CYP activity by tamoxifen bisphenol and the inhibition of CYP2C enzymes by anti-estrogenic metabolites may lead to drug-drug-interactions.

  2. Hairpin formation within the enhancer region of the human enkephalin gene

    Energy Technology Data Exchange (ETDEWEB)

    McMurray, C.T.; Douglass, J.O. (Oregon Health Sciences Univ., Portland (United States)); Wilson, W.D. (Georgia State Univ., Atlanta (United States))

    1991-01-15

    The 3{prime},5{prime}-cyclic adenosine monophosphate (cAMP)-inducible enhancer of the human enkephaline gene is located within an imperfect palindrom of 23 base pairs. The authors have found that a 23-base-pair oligonucleotide duplex containing the enhancer undergoes a reversible conformational transition from the duplex to two individual hairpin structures each formed from one strand of the duplex. Each individual hairpin forms with mismatched base pairs, one containing two GT pairs and the other containing two AC pairs. The conformational transition is stabilized by proton transfer to the hairpin containing AC mismatched pairs. The unique physical and thermodynamic properties of the enkephalin enhancer DNA suggest a model in which DNA secondary structure within the enhancer region plays and active role incAMP-inducible activation of the human enkephalin gene via formation of cruciform structures.

  3. Transcriptome Sequencing of Chemically Induced Aquilaria sinensis to Identify Genes Related to Agarwood Formation.

    Science.gov (United States)

    Ye, Wei; Wu, Hongqing; He, Xin; Wang, Lei; Zhang, Weimin; Li, Haohua; Fan, Yunfei; Tan, Guohui; Liu, Taomei; Gao, Xiaoxia

    2016-01-01

    Agarwood is a traditional Chinese medicine used as a clinical sedative, carminative, and antiemetic drug. Agarwood is formed in Aquilaria sinensis when A. sinensis trees are threatened by external physical, chemical injury or endophytic fungal irritation. However, the mechanism of agarwood formation via chemical induction remains unclear. In this study, we characterized the transcriptome of different parts of a chemically induced A. sinensis trunk sample with agarwood. The Illumina sequencing platform was used to identify the genes involved in agarwood formation. A five-year-old Aquilaria sinensis treated by formic acid was selected. The white wood part (B1 sample), the transition part between agarwood and white wood (W2 sample), the agarwood part (J3 sample), and the rotten wood part (F5 sample) were collected for transcriptome sequencing. Accordingly, 54,685,634 clean reads, which were assembled into 83,467 unigenes, were obtained with a Q20 value of 97.5%. A total of 50,565 unigenes were annotated using the Nr, Nt, SWISS-PROT, KEGG, COG, and GO databases. In particular, 171,331,352 unigenes were annotated by various pathways, including the sesquiterpenoid (ko00909) and plant-pathogen interaction (ko03040) pathways. These pathways were related to sesquiterpenoid biosynthesis and defensive responses to chemical stimulation. The transcriptome data of the different parts of the chemically induced A. sinensis trunk provide a rich source of materials for discovering and identifying the genes involved in sesquiterpenoid production and in defensive responses to chemical stimulation. This study is the first to use de novo sequencing and transcriptome assembly for different parts of chemically induced A. sinensis. Results demonstrate that the sesquiterpenoid biosynthesis pathway and WRKY transcription factor play important roles in agarwood formation via chemical induction. The comparative analysis of the transcriptome data of agarwood and A. sinensis lays the foundation

  4. Gene expression and proteomic analysis of the formation of Phakopsora pachyrhizi appressoria

    Directory of Open Access Journals (Sweden)

    Stone Christine L

    2012-06-01

    Full Text Available Abstract Background Phakopsora pachyrhizi is an obligate fungal pathogen causing Asian soybean rust (ASR. A dual approach was taken to examine the molecular and biochemical processes occurring during the development of appressoria, specialized infection structures by which P. pachyrhizi invades a host plant. Suppression subtractive hybridization (SSH was utilized to generate a cDNA library enriched for transcripts expressed during appressoria formation. Two-dimensional gel electrophoresis and mass spectroscopy analysis were used to generate a partial proteome of proteins present during appressoria formation. Results Sequence analysis of 1133 expressed sequence tags (ESTs revealed 238 non-redundant ESTs, of which 53% had putative identities assigned. Twenty-nine of the non-redundant ESTs were found to be specific to the appressoria-enriched cDNA library, and did not occur in a previously constructed germinated urediniospore cDNA library. Analysis of proteins against a custom database of the appressoria-enriched ESTs plus Basidiomycota EST sequences available from NCBI revealed 256 proteins. Fifty-nine of these proteins were not previously identified in a partial proteome of P. pachyrhizi germinated urediniospores. Genes and proteins identified fell into functional categories of metabolism, cell cycle and DNA processing, protein fate, cellular transport, cellular communication and signal transduction, and cell rescue. However, 38% of ESTs and 24% of proteins matched only to hypothetical proteins of unknown function, or showed no similarity to sequences in the current NCBI database. Three novel Phakopsora genes were identified from the cDNA library along with six potentially rust-specific genes. Protein analysis revealed eight proteins of unknown function, which possessed classic secretion signals. Two of the extracellular proteins are reported as potential effector proteins. Conclusions Several genes and proteins were identified that are expressed

  5. Differential gene expression from microarray analysis distinguishes woven and lamellar bone formation in the rat ulna following mechanical loading.

    Directory of Open Access Journals (Sweden)

    Jennifer A McKenzie

    Full Text Available Formation of woven and lamellar bone in the adult skeleton can be induced through mechanical loading. Although much is known about the morphological appearance and structural properties of the newly formed bone, the molecular responses to loading are still not well understood. The objective of our study was to use a microarray to distinguish the molecular responses between woven and lamellar bone formation induced through mechanical loading. Rat forelimb loading was completed in a single bout to induce the formation of woven bone (WBF loading or lamellar bone (LBF loading. A set of normal (non-loaded rats were used as controls. Microarrays were performed at three timepoints after loading: 1 hr, 1 day and 3 days. Confirmation of microarray results was done for a select group of genes using quantitative real-time PCR (qRT-PCR. The micorarray identified numerous genes and pathways that were differentially regulated for woven, but not lamellar bone formation. Few changes in gene expression were evident comparing lamellar bone formation to normal controls. A total of 395 genes were differentially expressed between formation of woven and lamellar bone 1 hr after loading, while 5883 and 5974 genes were differentially expressed on days 1 and 3, respectively. Results suggest that not only are the levels of expression different for each type of bone formation, but that distinct pathways are activated only for woven bone formation. A strong early inflammatory response preceded an increase in angiogenic and osteogenic gene expression for woven bone formation. Furthermore, at later timepoints there was evidence of bone resorption after WBF loading. In summary, the vast coverage of the microarray offers a comprehensive characterization of the early differences in expression between woven and lamellar bone formation.

  6. ALS1 and ALS3 gene expression and biofilm formation in Candida albicans isolated from vulvovaginal candidiasis

    Directory of Open Access Journals (Sweden)

    Shahla Roudbarmohammadi

    2016-01-01

    Conclusion: The results attained indicated that there is an association between the expression of ALS1 and ALS3 genes and fluconazole resistance in C. albicans. A considerable percent of the isolates expressing the ALS1 and ALS3 genes may have contributed to their adherence to vagina and biofilm formation.

  7. [Identification and analysis of differentially expressed genes during wood formation in Chinese fir by SSH].

    Science.gov (United States)

    Wang, Gui-Feng; Gao, Yan; Yang, Li-Wei; Shi, Ji-Sen

    2007-04-01

    Wood is an important raw material for the global industry with rapidly increasing demand. To isolate the differentially expressed genes in xylogenesis of Chinese fir [Cunninghamia lanceolata (Lamb.) Hook], a forward subtractive cDNA library was constructed using suppression subtractive hybridization (SSH) method, which was performed using the cDNA from the mutant Dugansha clone as the tester and the cDNA from the normal Jurong 0 clone as the driver. Six hundred and eighteen clones were obtained. Recombinants were identified using PCR with universal T7 and SP6 primers and using EcoR digestion. To further eliminate false positive, dot hybridization was used with four DIG-labeled probes (FSP, RSP, UTP, and UDP). Real-time PCR was performed to confirm the results. A total of 260 unique ESTs were obtained, 60% of the ESTs exhibiting homologies with proteins of known function fell into 4 major classes: metabolism, cell wall biogenesis and remodeling, signal transduction and stress. The systematic analysis of genes involved in wood formation in Chinese fir provides valuable insights into the molecular mechanisms involved in xylem differentiation, is important resources for forest research directed toward understanding the genetic control of wood formation and future endeavors to modify wood and fiber properties for industrial use.

  8. Identification of novel genes associated with renal tertiary lymphoid organ formation in aging mice.

    Science.gov (United States)

    Huang, Yuan; Caputo, Christina R; Noordmans, Gerda A; Yazdani, Saleh; Monteiro, Luiz Henrique; van den Born, Jaap; van Goor, Harry; Heeringa, Peter; Korstanje, Ron; Hillebrands, Jan-Luuk

    2014-01-01

    A hallmark of aging-related organ deterioration is a dysregulated immune response characterized by pathologic leukocyte infiltration of affected tissues. Mechanisms and genes involved are as yet unknown. To identify genes associated with aging-related renal infiltration, we analyzed kidneys from aged mice (≥20 strains) for infiltrating leukocytes followed by Haplotype Association Mapping (HAM) analysis. Immunohistochemistry revealed CD45+ cell clusters (predominantly T and B cells) in perivascular areas coinciding with PNAd+ high endothelial venules and podoplanin+ lymph vessels indicative of tertiary lymphoid organs. Cumulative cluster size increased with age (analyzed at 6, 12 and 20 months). Based on the presence or absence of clusters in male and female mice at 20 months, HAM analysis revealed significant associations with loci on Chr1, Chr2, Chr8 and Chr14 in male mice, and with loci on Chr4, Chr7, Chr13 and Chr14 in female mice. Wisp2 (Chr2) showed the strongest association (P = 5.00×10(-137)) in male mice; Ctnnbip1 (P = 6.42×10(-267)) and Tnfrsf8 (P = 5.42×10(-245)) (both on Chr4) showed the strongest association in female mice. Both Wisp2 and Ctnnbip1 are part of the Wnt-signaling pathway and the encoded proteins were expressed within the tertiary lymphoid organs. In conclusion, this study revealed differential lymphocytic infiltration and tertiary lymphoid organ formation in aged mouse kidneys across different inbred mouse strains. HAM analysis identified candidate genes involved in the Wnt-signaling pathway that may be causally linked to tertiary lymphoid organ formation.

  9. Multi-target trapping in constrained environments using gene regulatory network-based pattern formation

    Directory of Open Access Journals (Sweden)

    Xingguang Peng

    2016-10-01

    Full Text Available Inspired by the morphogenesis of biological organisms, gene regulatory network-based methods have been used in complex pattern formation of swarm robotic systems. In this article, obstacle information was embedded into the gene regulatory network model to make the robots trap targets with an expected pattern while avoiding obstacles in a distributed manner. Based on the modified gene regulatory network model, an implicit function method was adopted to represent the expected pattern which is easily adjusted by adding extra feature points. Considering environmental constraints (e.g. tunnels or gaps in which robots must adjust their pattern to conduct trapping task, a pattern adaptation strategy was proposed for the pattern modeler to adaptively adjust the expected pattern. Also to trap multiple targets, a splitting pattern adaptation strategy was proposed for diffusively moving targets so that the robots can trap each target separately with split sub-patterns. The proposed model and strategies were verified through a set of simulation with complex environmental constraints and non-consensus movements of targets.

  10. Differential effects of antifungal agents on expression of genes related to formation of Candida albicans biofilms.

    Science.gov (United States)

    Chatzimoschou, Athanasios; Simitsopoulou, Maria; Antachopoulos, Charalampos; Walsh, Thomas J; Roilides, Emmanuel

    2016-01-01

    The purpose of this study was to analyse specific molecular mechanisms involved in the intrinsic resistance of C. albicans biofilms to antifungals. We investigated the transcriptional profile of three genes (BGL2, SUN41, ECE1) involved in Candida cell wall formation in response to voriconazole or anidulafungin after the production of intermediate and mature biofilms. C. albicans M61, a well-documented biofilm producer strain, was used for the development of intermediate (12 h and 18 h) and completely mature biofilms (48 h). After exposure of cells from each biofilm growth mode to voriconazole (128 and 512 mg l(-1)) or anidulafungin (0.25 and 1 mg l(-1)) for 12-24 h, total RNA samples extracted from biofilm cells were analysed by RT-PCR. The voriconazole and anidulafungin biofilm MIC was 512 and 0.5 mg l(-1) respectively. Anidulafungin caused significant up-regulation of SUN41 (3.7-9.3-fold) and BGL2 (2.2-2.8 fold) in intermediately mature biofilms; whereas, voriconazole increased gene expression in completely mature biofilms (SUN41 2.3-fold, BGL2 2.1-fold). Gene expression was primarily down-regulated by voriconazole in intermediately, but not completely mature biofilms. Both antifungals caused down-regulation of ECE1 in intermediately mature biofilms. © 2015 Blackwell Verlag GmbH.

  11. A two-cassette reporter system for assessing target gene translation and target gene product inclusion body formation

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention relates to a dual cassette reporter system capable of assessing target gene translation and target gene product folding. The present invention further relates to vectors and host cells comprising the dual cassette reporter system. In addition the invention relates to the use...... of the dual cassette reporter system for assessing target gene translation and target gene product folding....

  12. The roles of TGF-beta1 gene transfer on collagen formation during Achilles tendon healing.

    Science.gov (United States)

    Hou, Yu; Mao, ZeBing; Wei, XueLei; Lin, Lin; Chen, LianXu; Wang, HaiJun; Fu, Xin; Zhang, JiYing; Yu, ChangLong

    2009-05-29

    Collagen content and cross-linking are believed to be major determinants of tendon structural integrity and function. The current study aimed to investigate the effects of transforming growth factor (TGF)-beta1 on the collagen content and cross-linking of Achilles tendons, and on the histological and biomechanical changes occurring during Achilles tendon healing in rabbits. Bone marrow-derived mesenchymal stem cells (BMSCs) transfected with the TGF-beta1 gene were surgically implanted into experimentally injured Achilles tendons. Collagen proteins were identified by immunohistochemical staining and fiber bundle accumulation was revealed by Sirius red staining. Achilles tendons treated with TGF-beta1-transfected BMSCs showed higher concentrations of collagen I protein, more rapid matrix remodeling, and larger fiber bundles. Thus TGF-beta1 can promote mechanical strength in healing Achilles tendons by regulating collagen synthesis, cross-link formation, and matrix remodeling.

  13. Genes involved in thoracic exoskeleton formation during the pupal-to-adult molt in a social insect model, Apis mellifera.

    Science.gov (United States)

    Soares, Michelle Prioli Miranda; Barchuk, Angel Roberto; Simões, Ana Carolina Quirino; Dos Santos Cristino, Alexandre; de Paula Freitas, Flávia Cristina; Canhos, Luísa Lange; Bitondi, Márcia Maria Gentile

    2013-08-28

    The insect exoskeleton provides shape, waterproofing, and locomotion via attached somatic muscles. The exoskeleton is renewed during molting, a process regulated by ecdysteroid hormones. The holometabolous pupa transforms into an adult during the imaginal molt, when the epidermis synthe3sizes the definitive exoskeleton that then differentiates progressively. An important issue in insect development concerns how the exoskeletal regions are constructed to provide their morphological, physiological and mechanical functions. We used whole-genome oligonucleotide microarrays to screen for genes involved in exoskeletal formation in the honeybee thoracic dorsum. Our analysis included three sampling times during the pupal-to-adult molt, i.e., before, during and after the ecdysteroid-induced apolysis that triggers synthesis of the adult exoskeleton. Gene ontology annotation based on orthologous relationships with Drosophila melanogaster genes placed the honeybee differentially expressed genes (DEGs) into distinct categories of Biological Process and Molecular Function, depending on developmental time, revealing the functional elements required for adult exoskeleton formation. Of the 1,253 unique DEGs, 547 were upregulated in the thoracic dorsum after apolysis, suggesting induction by the ecdysteroid pulse. The upregulated gene set included 20 of the 47 cuticular protein (CP) genes that were previously identified in the honeybee genome, and three novel putative CP genes that do not belong to a known CP family. In situ hybridization showed that two of the novel genes were abundantly expressed in the epidermis during adult exoskeleton formation, strongly implicating them as genuine CP genes. Conserved sequence motifs identified the CP genes as members of the CPR, Tweedle, Apidermin, CPF, CPLCP1 and Analogous-to-Peritrophins families. Furthermore, 28 of the 36 muscle-related DEGs were upregulated during the de novo formation of striated fibers attached to the exoskeleton. A

  14. Variable Persister Gene Interactions with (pppGpp for Persister Formation in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Shuang Liu

    2017-09-01

    Full Text Available Persisters comprise a group of phenotypically heterogeneous metabolically quiescent bacteria with multidrug tolerance and contribute to the recalcitrance of chronic infections. Although recent work has shown that toxin-antitoxin (TA system HipAB depends on stringent response effector (pppGppin persister formation, whether other persister pathways are also dependent on stringent response has not been explored. Here we examined the relationship of (pppGpp with 15 common persister genes (dnaK, clpB, rpoS, pspF, tnaA, sucB, ssrA, smpB, recA, umuD, uvrA, hipA, mqsR, relE, dinJ using Escherichia coli as a model. By comparing the persister levels of wild type with their single gene knockout and double knockout mutants with relA, we divided their interactions into five types, namely A “dependent” (dnaK, recA, B “positive reinforcement” (rpoS, pspF, ssrA, recA, C “antagonistic” (clpB, sucB, umuD, uvrA, hipA, mqsR, relE, dinJ, D “epistasis” (clpB, rpoS, tnaA, ssrA, smpB, hipA, and E “irrelevant” (dnaK, clpB, rpoS, tnaA, sucB, smpB, umuD, uvrA, hipA, mqsR, relE, dinJ. We found that the persister gene interactions are intimately dependent on bacterial culture age, cell concentrations (diluted versus undiluted culture, and drug classifications, where the same gene may belong to different groups with varying antibiotics, culture age or cell concentrations. Together, this study represents the first attempt to systematically characterize the intricate relationships among the different mechanisms of persistence and as such provide new insights into the complexity of the persistence phenomenon at the level of persister gene network interactions.

  15. Transcriptome analysis of differentially expressed genes provides insight into stolon formation in Tulipa edulis

    Directory of Open Access Journals (Sweden)

    Yuanyuan eMiao

    2016-03-01

    Full Text Available Tulipa edulis (Miq. Baker is an important medicinal plant with a variety of anti-cancer properties. The stolon is one of the main asexual reproductive organs of T. edulis and possesses a unique morphology. To explore the molecular mechanism of stolon formation, we performed an RNA-seq analysis of the transcriptomes of stolons at three developmental stages. In the present study, 15.49 Gb of raw data were generated and assembled into 74,006 unigenes, and a total of 2,811 simple sequence repeats (SSRs were detected in T. edulis. Among the three libraries of stolons at different developmental stages, there were 5,119 differentially expressed genes (DEGs. A functional annotation analysis based on sequence similarity queries of the GO, COG, KEGG databases showed that these DEGs were mainly involved in many physiological and biochemical processes, such as material and energy metabolism, hormone signaling, cell growth, and transcription regulation. In addition, qRT-PCR (quantitative real-time PCR analysis revealed that the expression patterns of the DEGs were consistent with the transcriptome data, which further supported a role for the DEGs in stolon formation. This study provides novel resources for future genetic and molecular studies in T. edulis.

  16. Identification of Genes Involved in Polysaccharide-Independent Staphylococcus aureus Biofilm Formation

    Science.gov (United States)

    Boles, Blaise R.; Thoendel, Matthew; Roth, Aleeza J.; Horswill, Alexander R.

    2010-01-01

    Staphylococcus aureus is a potent biofilm former on host tissue and medical implants, and biofilm growth is a critical virulence determinant for chronic infections. Recent studies suggest that many clinical isolates form polysaccharide-independent biofilms. However, a systematic screen for defective mutants has not been performed to identify factors important for biofilm formation in these strains. We created a library of 14,880 mariner transposon mutants in a S. aureus strain that generates a proteinaceous and extracellular DNA based biofilm matrix. The library was screened for biofilm defects and 31 transposon mutants conferred a reproducible phenotype. In the pool, 16 mutants overproduced extracellular proteases and the protease inhibitor α2-macroglobulin restored biofilm capacity to 13 of these mutants. The other 15 mutants in the pool displayed normal protease levels and had defects in genes involved in autolysis, osmoregulation, or uncharacterized membrane proteins. Two transposon mutants of interest in the GraRS two-component system and a putative inositol monophosphatase were confirmed in a flow cell biofilm model, genetically complemented, and further verified in a community-associated methicillin-resistant S. aureus (CA-MRSA) isolate. Collectively, our screen for biofilm defective mutants identified novel loci involved in S. aureus biofilm formation and underscored the importance of extracellular protease activity and autolysis in biofilm development. PMID:20418950

  17. Identification of genes involved in polysaccharide-independent Staphylococcus aureus biofilm formation.

    Directory of Open Access Journals (Sweden)

    Blaise R Boles

    2010-04-01

    Full Text Available Staphylococcus aureus is a potent biofilm former on host tissue and medical implants, and biofilm growth is a critical virulence determinant for chronic infections. Recent studies suggest that many clinical isolates form polysaccharide-independent biofilms. However, a systematic screen for defective mutants has not been performed to identify factors important for biofilm formation in these strains. We created a library of 14,880 mariner transposon mutants in a S. aureus strain that generates a proteinaceous and extracellular DNA based biofilm matrix. The library was screened for biofilm defects and 31 transposon mutants conferred a reproducible phenotype. In the pool, 16 mutants overproduced extracellular proteases and the protease inhibitor alpha(2-macroglobulin restored biofilm capacity to 13 of these mutants. The other 15 mutants in the pool displayed normal protease levels and had defects in genes involved in autolysis, osmoregulation, or uncharacterized membrane proteins. Two transposon mutants of interest in the GraRS two-component system and a putative inositol monophosphatase were confirmed in a flow cell biofilm model, genetically complemented, and further verified in a community-associated methicillin-resistant S. aureus (CA-MRSA isolate. Collectively, our screen for biofilm defective mutants identified novel loci involved in S. aureus biofilm formation and underscored the importance of extracellular protease activity and autolysis in biofilm development.

  18. Biofilm formation and genetic variability of BCR1 gene in the Candida parapsilosis complex.

    Science.gov (United States)

    Treviño-Rangel, Rogelio de J; Rodríguez-Sánchez, Irám P; Rosas-Taraco, Adrián G; Hernández-Bello, Romel; González, José G; González, Gloria M

    2015-01-01

    Candida parapsilosis sensu stricto, Candida orthopsilosis, and Candida metapsilosis are cryptic species that belong to the C. parapsilosis complex, which has been increasingly associated to fungemia in various geographic regions, principally due to the capability of these yeasts to form biofilms on indwelling medical devices. BCR1 is one of the most studied genes related to Candida spp. biofilms. To evaluate the biofilm forming capability of a subset of 65 clinical isolates of the C. parapsilosis complex using two conventional approaches, and to look for an association between the biofilm forming phenotype and genetic variants of a fragment of BCR1. The biofilm determination was carried out by crystal violet staining and tetrazolium reduction assay. On the other hand, a segment of BCR1 gene was sequenced by Sanger methodology. C. parapsilosis sensu stricto was statistically associated with a low biofilm production phenotype, while C. orthopsilosis was significantly associated with both phenotypes (high and low biofilm producers). According to the BCR1 sequence analysis, genetic variability was detected in C. orthopsilosis and C. metapsilosis without a particular biofilm formation phenotype association. Under the adopted experimental design, C. parapsilosis sensu stricto was associated with the low biofilm phenotype and C. orthopsilosis with both phenotypes (high and low biofilm producers). On the other hand, an association between a biofilm forming phenotype and a particular genetic variant of the analyzed BCR1 fragment was not found. Copyright © 2014 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  19. Norlichexanthone Reduces Virulence Gene Expression and Biofilm Formation in Staphylococcus aureus.

    Science.gov (United States)

    Baldry, Mara; Nielsen, Anita; Bojer, Martin S; Zhao, Yu; Friberg, Cathrine; Ifrah, Dan; Glasser Heede, Nina; Larsen, Thomas O; Frøkiær, Hanne; Frees, Dorte; Zhang, Lixin; Dai, Huanqin; Ingmer, Hanne

    2016-01-01

    Staphylococcus aureus is a serious human pathogen and antibiotic resistant, community-associated strains, such as the methicillin resistant S. aureus (MRSA) strain USA300, continue to spread. To avoid resistance, anti-virulence therapy has been proposed where toxicity is targeted rather than viability. Previously we have shown that norlichexanthone, a small non-reduced tricyclic polyketide produced by fungi and lichens, reduces expression of hla encoding α-hemolysin as well as the regulatory RNAIII of the agr quorum sensing system in S. aureus 8325-4. The aim of the present study was to further characterise the mode of action of norlichexanthone and its effect on biofilm formation. We find that norlichexanthone reduces expression of both hla and RNAIII also in strain USA300. Structurally, norlichexanthone resembles ω-hydroxyemodin that recently was shown to bind the agr two component response regulator, AgrA, which controls expression of RNAIII and the phenol soluble modulins responsible for human neutrophil killing. We show that norlichexanthone reduces S. aureus toxicity towards human neutrophils and interferes directly with AgrA binding to its DNA target. In contrast to ω-hydroxyemodin however, norlichexanthone reduces staphylococcal biofilm formation. Transcriptomic analysis revealed that genes regulated by the SaeRS two-component system are repressed by norlichexanthone when compared to untreated cells, an effect that was mitigated in strain Newman carrying a partially constitutive SaeRS system. Our data show that norlichexanthone treatment reduces expression of key virulence factors in CA-MRSA strain USA300 via AgrA binding and represses biofilm formation.

  20. Norlichexanthone Reduces Virulence Gene Expression and Biofilm Formation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Mara Baldry

    Full Text Available Staphylococcus aureus is a serious human pathogen and antibiotic resistant, community-associated strains, such as the methicillin resistant S. aureus (MRSA strain USA300, continue to spread. To avoid resistance, anti-virulence therapy has been proposed where toxicity is targeted rather than viability. Previously we have shown that norlichexanthone, a small non-reduced tricyclic polyketide produced by fungi and lichens, reduces expression of hla encoding α-hemolysin as well as the regulatory RNAIII of the agr quorum sensing system in S. aureus 8325-4. The aim of the present study was to further characterise the mode of action of norlichexanthone and its effect on biofilm formation. We find that norlichexanthone reduces expression of both hla and RNAIII also in strain USA300. Structurally, norlichexanthone resembles ω-hydroxyemodin that recently was shown to bind the agr two component response regulator, AgrA, which controls expression of RNAIII and the phenol soluble modulins responsible for human neutrophil killing. We show that norlichexanthone reduces S. aureus toxicity towards human neutrophils and interferes directly with AgrA binding to its DNA target. In contrast to ω-hydroxyemodin however, norlichexanthone reduces staphylococcal biofilm formation. Transcriptomic analysis revealed that genes regulated by the SaeRS two-component system are repressed by norlichexanthone when compared to untreated cells, an effect that was mitigated in strain Newman carrying a partially constitutive SaeRS system. Our data show that norlichexanthone treatment reduces expression of key virulence factors in CA-MRSA strain USA300 via AgrA binding and represses biofilm formation.

  1. Genome-wide identification of GLABRA3 downstream genes for anthocyanin biosynthesis and trichome formation in Arabidopsis.

    Science.gov (United States)

    Gao, Chenhao; Li, Dong; Jin, Changyu; Duan, Shaowei; Qi, Shuanghui; Liu, Kaige; Wang, Hanchen; Ma, Haoli; Hai, Jiangbo; Chen, Mingxun

    2017-04-01

    GLABRA3 (GL3), a bHLH transcription factor, has previously proved to be involved in anthocyanin biosynthesis and trichome formation in Arabidopsis, however, its downstream targeted genes are still largely unknown. Here, we found that GL3 was widely present in Arabidopsis vegetative and reproductive organs. New downstream targeted genes of GL3 for anthocyanin biosynthesis and trichome formation were identified in young shoots and expanding true leaves by RNA sequencing. GL3-mediated gene expression was tissue specific in the two biological processes. This study provides new clues to further understand the GL3-mediated regulatory network of anthocyanin biosynthesis and trichome formation in Arabidopsis. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Ancient Expansion of the Hox Cluster in Lepidoptera Generated Four Homeobox Genes Implicated in Extra-Embryonic Tissue Formation

    Science.gov (United States)

    Taylor, William R.; Gibbs, Melanie; Breuker, Casper J.; Holland, Peter W. H.

    2014-01-01

    Gene duplications within the conserved Hox cluster are rare in animal evolution, but in Lepidoptera an array of divergent Hox-related genes (Shx genes) has been reported between pb and zen. Here, we use genome sequencing of five lepidopteran species (Polygonia c-album, Pararge aegeria, Callimorpha dominula, Cameraria ohridella, Hepialus sylvina) plus a caddisfly outgroup (Glyphotaelius pellucidus) to trace the evolution of the lepidopteran Shx genes. We demonstrate that Shx genes originated by tandem duplication of zen early in the evolution of large clade Ditrysia; Shx are not found in a caddisfly and a member of the basally diverging Hepialidae (swift moths). Four distinct Shx genes were generated early in ditrysian evolution, and were stably retained in all descendent Lepidoptera except the silkmoth which has additional duplications. Despite extensive sequence divergence, molecular modelling indicates that all four Shx genes have the potential to encode stable homeodomains. The four Shx genes have distinct spatiotemporal expression patterns in early development of the Speckled Wood butterfly (Pararge aegeria), with ShxC demarcating the future sites of extraembryonic tissue formation via strikingly localised maternal RNA in the oocyte. All four genes are also expressed in presumptive serosal cells, prior to the onset of zen expression. Lepidopteran Shx genes represent an unusual example of Hox cluster expansion and integration of novel genes into ancient developmental regulatory networks. PMID:25340822

  3. Comprehensive transcriptome analysis unravels the existence of crucial genes regulating primary metabolism during adventitious root formation in Petunia hybrida.

    Directory of Open Access Journals (Sweden)

    Amirhossein Ahkami

    Full Text Available To identify specific genes determining the initiation and formation of adventitious roots (AR, a microarray-based transcriptome analysis in the stem base of the cuttings of Petunia hybrida (line W115 was conducted. A microarray carrying 24,816 unique, non-redundant annotated sequences was hybridized to probes derived from different stages of AR formation. After exclusion of wound-responsive and root-regulated genes, 1,354 of them were identified which were significantly and specifically induced during various phases of AR formation. Based on a recent physiological model distinguishing three metabolic phases in AR formation, the present paper focuses on the response of genes related to particular metabolic pathways. Key genes involved in primary carbohydrate metabolism such as those mediating apoplastic sucrose unloading were induced at the early sink establishment phase of AR formation. Transcriptome changes also pointed to a possible role of trehalose metabolism and SnRK1 (sucrose non-fermenting 1- related protein kinase in sugar sensing during this early step of AR formation. Symplastic sucrose unloading and nucleotide biosynthesis were the major processes induced during the later recovery and maintenance phases. Moreover, transcripts involved in peroxisomal beta-oxidation were up-regulated during different phases of AR formation. In addition to metabolic pathways, the analysis revealed the activation of cell division at the two later phases and in particular the induction of G1-specific genes in the maintenance phase. Furthermore, results point towards a specific demand for certain mineral nutrients starting in the recovery phase.

  4. Direct activation of EXPANSIN14 by LBD18 in the gene regulatory network of lateral root formation in Arabidopsis.

    Science.gov (United States)

    Kim, Jungmook; Lee, Han Woo

    2013-02-01

    Root system architecture is important for plants to adapt to a changing environment. The major determinant of the root system is lateral roots originating from the primary root. The developmental process of lateral root formation can be divided into priming, initiation, primordium development and the emergence of lateral roots, and is well characterized in Arabidopsis. The hormone auxin plays a critical role in lateral root development, and several auxin response modules involving AUXIN RESPONSE FACTORS (ARFs), transcriptional regulators of auxin-regulated genes and Aux/IAA, negative regulators of ARFs, regulate lateral root formation. The LATERAL ORGAN BOUNDARIES DOMAIN/ASYMMETRIC LEAVES2-LIKE (LBD/ASL) gene family encodes a unique class of transcription factors harbouring a conserved plant-specific lateral organ boundary domain and plays a role in lateral organ development of plants including lateral root formation. In our previous study, we showed that LBD18 stimulates lateral root formation in combination with LBD16 downstream of ARF7 and ARF19 during the auxin response. We have recently demonstrated that LBD18 activates expression of EXP14, a gene encoding the cell-wall loosening factor, by directly binding to the EXP14 promoter to promote lateral root emergence. Here we present the molecular function of LBD18 and its gene regulatory network during lateral root formation.

  5. Identification of novel genes affecting mesoderm formation and morphogenesis through an enhanced large scale functional screen in Xenopus.

    Science.gov (United States)

    Chen, Jun-An; Voigt, Jana; Gilchrist, Mike; Papalopulu, Nancy; Amaya, Enrique

    2005-03-01

    The formation of mesoderm is an important developmental process of vertebrate embryos, which can be broken down into several steps; mesoderm induction, patterning, morphogenesis and differentiation. Although mesoderm formation in Xenopus has been intensively studied, much remains to be learned about the molecular events responsible for each of these steps. Furthermore, the interplay between mesoderm induction, patterning and morphogenesis remains obscure. Here, we describe an enhanced functional screen in Xenopus designed for large-scale identification of genes controlling mesoderm formation. In order to improve the efficiency of the screen, we used a Xenopus tropicalis unique set of cDNAs, highly enriched in full-length clones. The screening strategy incorporates two mesodermal markers, Xbra and Xmyf-5, to assay for cell fate specification and patterning, respectively. In addition we looked for phenotypes that would suggest effects in morphogenesis, such as gastrulation defects and shortened anterior-posterior axis. Out of 1728 full-length clones we isolated 82 for their ability to alter the phenotype of tadpoles and/or the expression of Xbra and Xmyf-5. Many of the clones gave rise to similar misexpression phenotypes (synphenotypes) and many of the genes within each synphenotype group appeared to be involved in similar pathways. We determined the expression pattern of the 82 genes and found that most of the genes were regionalized and expressed in mesoderm. We expect that many of the genes identified in this screen will be important in mesoderm formation.

  6. Transcriptional sequencing and analysis of major genes involved in the adventitious root formation of mango cotyledon segments.

    Science.gov (United States)

    Li, Yun-He; Zhang, Hong-Na; Wu, Qing-Song; Muday, Gloria K

    2017-06-01

    A total of 74,745 unigenes were generated and 1975 DEGs were identified. Candidate genes that may be involved in the adventitious root formation of mango cotyledon segment were revealed. Adventitious root formation is a crucial step in plant vegetative propagation, but the molecular mechanism of adventitious root formation remains unclear. Adventitious roots formed only at the proximal cut surface (PCS) of mango cotyledon segments, whereas no roots were formed on the opposite, distal cut surface (DCS). To identify the transcript abundance changes linked to adventitious root development, RNA was isolated from PCS and DCS at 0, 4 and 7 days after culture, respectively. Illumina sequencing of libraries generated from these samples yielded 62.36 Gb high-quality reads that were assembled into 74,745 unigenes with an average sequence length of 807 base pairs, and 33,252 of the assembled unigenes at least had homologs in one of the public databases. Comparative analysis of these transcriptome databases revealed that between the different time points at PCS there were 1966 differentially expressed genes (DEGs), while there were only 51 DEGs for the PCS vs. DCS when time-matched samples were compared. Of these DEGs, 1636 were assigned to gene ontology (GO) classes, the majority of that was involved in cellular processes, metabolic processes and single-organism processes. Candidate genes that may be involved in the adventitious root formation of mango cotyledon segment are predicted to encode polar auxin transport carriers, auxin-regulated proteins, cell wall remodeling enzymes and ethylene-related proteins. In order to validate RNA-sequencing results, we further analyzed the expression profiles of 20 genes by quantitative real-time PCR. This study expands the transcriptome information for Mangifera indica and identifies candidate genes involved in adventitious root formation in cotyledon segments of mango.

  7. Biphasic gene expression changes elicited by Phakopsora pachyrhizi in soybean correlate with fungal penetration and haustoria formation.

    Science.gov (United States)

    Schneider, Katherine T; van de Mortel, Martijn; Bancroft, Timothy J; Braun, Edward; Nettleton, Dan; Nelson, Rex T; Frederick, Reid D; Baum, Thomas J; Graham, Michelle A; Whitham, Steven A

    2011-09-01

    Inoculation of soybean (Glycine max) plants with Phakopsora pachyrhizi, the causal organism of Asian soybean rust, elicits a biphasic response characterized by a burst of differential gene expression in the first 12 h. A quiescent period occurs from 24 to 48 h after inoculation, in which P. pachyrhizi continues to develop but does not elicit strong host responses, followed by a second phase of intense gene expression. To correlate soybean responses with P. pachyrhizi growth and development, we inoculated the soybean cultivar Ankur (accession PI462312), which carries the Rpp3 resistance gene, with avirulent and virulent isolates of P. pachyrhizi. The avirulent isolate Hawaii 94-1 elicits hypersensitive cell death that limits fungal growth on Ankur and results in an incompatible response, while the virulent isolate Taiwan 80-2 grows extensively, sporulates profusely, and produces a compatible reaction. Inoculated leaves were collected over a 288-h time course for microarray analysis of soybean gene expression and microscopic analysis of P. pachyrhizi growth and development. The first burst in gene expression correlated with appressorium formation and penetration of epidermal cells, while the second burst of gene expression changes followed the onset of haustoria formation in both compatible and incompatible interactions. The proliferation of haustoria coincided with the inhibition of P. pachyrhizi growth in the incompatible interaction or the beginning of accelerated growth in the compatible interaction. The temporal relationships between P. pachyrhizi growth and host responses provide an important context in which to view interacting gene networks that mediate the outcomes of their interactions.

  8. A parthenogenesis gene of apomict origin elicits embryo formation from unfertilized eggs in a sexual plant.

    Science.gov (United States)

    Conner, Joann A; Mookkan, Muruganantham; Huo, Heqiang; Chae, Keun; Ozias-Akins, Peggy

    2015-09-08

    Apomixis is a naturally occurring mode of asexual reproduction in flowering plants that results in seed formation without the involvement of meiosis or fertilization of the egg. Seeds formed on an apomictic plant contain offspring genetically identical to the maternal plant. Apomixis has significant potential for preserving hybrid vigor from one generation to the next in highly productive crop plant genotypes. Apomictic Pennisetum/Cenchrus species, members of the Poaceae (grass) family, reproduce by apospory. Apospory is characterized by apomeiosis, the formation of unreduced embryo sacs derived from nucellar cells of the ovary and, by parthenogenesis, the development of the unreduced egg into an embryo without fertilization. In Pennisetum squamulatum (L.) R.Br., apospory segregates as a single dominant locus, the apospory-specific genomic region (ASGR). In this study, we demonstrate that the PsASGR-BABY BOOM-like (PsASGR-BBML) gene is expressed in egg cells before fertilization and can induce parthenogenesis and the production of haploid offspring in transgenic sexual pearl millet. A reduction of PsASGR-BBML expression in apomictic F1 RNAi transgenic plants results in fewer visible parthenogenetic embryos and a reduction of embryo cell number compared with controls. Our results endorse a key role for PsASGR-BBML in parthenogenesis and a newly discovered role for a member of the BBM-like clade of APETALA 2 transcription factors. Induction of parthenogenesis by PsASGR-BBML will be valuable for installing parthenogenesis to synthesize apomixis in crops and will have further application for haploid induction to rapidly obtain homozygous lines for breeding.

  9. A parthenogenesis gene of apomict origin elicits embryo formation from unfertilized eggs in a sexual plant

    Science.gov (United States)

    Conner, Joann A.; Mookkan, Muruganantham; Huo, Heqiang; Chae, Keun; Ozias-Akins, Peggy

    2015-01-01

    Apomixis is a naturally occurring mode of asexual reproduction in flowering plants that results in seed formation without the involvement of meiosis or fertilization of the egg. Seeds formed on an apomictic plant contain offspring genetically identical to the maternal plant. Apomixis has significant potential for preserving hybrid vigor from one generation to the next in highly productive crop plant genotypes. Apomictic Pennisetum/Cenchrus species, members of the Poaceae (grass) family, reproduce by apospory. Apospory is characterized by apomeiosis, the formation of unreduced embryo sacs derived from nucellar cells of the ovary and, by parthenogenesis, the development of the unreduced egg into an embryo without fertilization. In Pennisetum squamulatum (L.) R.Br., apospory segregates as a single dominant locus, the apospory-specific genomic region (ASGR). In this study, we demonstrate that the PsASGR-BABY BOOM-like (PsASGR-BBML) gene is expressed in egg cells before fertilization and can induce parthenogenesis and the production of haploid offspring in transgenic sexual pearl millet. A reduction of PsASGR-BBML expression in apomictic F1 RNAi transgenic plants results in fewer visible parthenogenetic embryos and a reduction of embryo cell number compared with controls. Our results endorse a key role for PsASGR-BBML in parthenogenesis and a newly discovered role for a member of the BBM-like clade of APETALA 2 transcription factors. Induction of parthenogenesis by PsASGR-BBML will be valuable for installing parthenogenesis to synthesize apomixis in crops and will have further application for haploid induction to rapidly obtain homozygous lines for breeding. PMID:26305939

  10. Mutations in Three Genes Encoding Proteins Involved in Hair Shaft Formation Cause Uncombable Hair Syndrome.

    Science.gov (United States)

    Ü Basmanav, F Buket; Cau, Laura; Tafazzoli, Aylar; Méchin, Marie-Claire; Wolf, Sabrina; Romano, Maria Teresa; Valentin, Frederic; Wiegmann, Henning; Huchenq, Anne; Kandil, Rima; Garcia Bartels, Natalie; Kilic, Arzu; George, Susannah; Ralser, Damian J; Bergner, Stefan; Ferguson, David J P; Oprisoreanu, Ana-Maria; Wehner, Maria; Thiele, Holger; Altmüller, Janine; Nürnberg, Peter; Swan, Daniel; Houniet, Darren; Büchner, Aline; Weibel, Lisa; Wagner, Nicola; Grimalt, Ramon; Bygum, Anette; Serre, Guy; Blume-Peytavi, Ulrike; Sprecher, Eli; Schoch, Susanne; Oji, Vinzenz; Hamm, Henning; Farrant, Paul; Simon, Michel; Betz, Regina C

    2016-12-01

    Uncombable hair syndrome (UHS), also known as "spun glass hair syndrome," "pili trianguli et canaliculi," or "cheveux incoiffables" is a rare anomaly of the hair shaft that occurs in children and improves with age. UHS is characterized by dry, frizzy, spangly, and often fair hair that is resistant to being combed flat. Until now, both simplex and familial UHS-affected case subjects with autosomal-dominant as well as -recessive inheritance have been reported. However, none of these case subjects were linked to a molecular genetic cause. Here, we report the identification of UHS-causative mutations located in the three genes PADI3 (peptidylarginine deiminase 3), TGM3 (transglutaminase 3), and TCHH (trichohyalin) in a total of 11 children. All of these individuals carry homozygous or compound heterozygous mutations in one of these three genes, indicating an autosomal-recessive inheritance pattern in the majority of UHS case subjects. The two enzymes PADI3 and TGM3, responsible for posttranslational protein modifications, and their target structural protein TCHH are all involved in hair shaft formation. Elucidation of the molecular outcomes of the disease-causing mutations by cell culture experiments and tridimensional protein models demonstrated clear differences in the structural organization and activity of mutant and wild-type proteins. Scanning electron microscopy observations revealed morphological alterations in hair coat of Padi3 knockout mice. All together, these findings elucidate the molecular genetic causes of UHS and shed light on its pathophysiology and hair physiology in general. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  11. The MP65 gene is required for cell wall integrity, adherence to epithelial cells and biofilm formation in Candida albicans

    Directory of Open Access Journals (Sweden)

    Girolamo Antonietta

    2011-05-01

    Full Text Available Abstract Background The MP65 gene of Candida albicans (orf19.1779 encodes a putative β-glucanase mannoprotein of 65 kDa, which plays a main role in a host-fungus relationship, morphogenesis and pathogenicity. In this study, we performed an extensive analysis of a mp65Δ mutant to assess the role of this protein in cell wall integrity, adherence to epithelial cells and biofilm formation. Results The mp65Δ mutant showed a high sensitivity to a range of cell wall-perturbing and degrading agents, especially Congo red, which induced morphological changes such as swelling, clumping and formation of hyphae. The mp65Δ mutant showed an activation of two MAPKs (Mkc1p and Cek1p, a high level of expression of two stress-related genes (DDR48 and SOD5, and a modulated expression of β-glucan epitopes, but no gross changes in cell wall polysaccharide composition. Interestingly, the mp65Δ mutant displayed a marked reduction in adhesion to BEC and Caco-2 cells and severe defects in biofilm formation when compared to the wild type. All of the mentioned properties were totally or partially recovered in a revertant strain, demonstrating the specificity of gene deletion. Conclusions We demonstrate that the MP65 gene of Candida albicans plays a significant role in maintaining cell wall integrity, as well as in adherence to epithelia and biofilm formation, which are major virulence attributes of this fungus.

  12. Lipoic acid increases the expression of genes involved in bone formation in mice fed a high-fat diet.

    Science.gov (United States)

    Xiao, Ying; Cui, Jue; Shi, Yonghui; Le, Guowei

    2011-04-01

    Antioxidant lipoic acid (LA) has been reported to have a potential prophylactic effect on bone loss induced by high-fat diet (HFD). The aim of this work was to examine the hypothesis that LA decreases bone resorption-related gene expression and increases bone formation-related gene expression in HFD-fed mice, preventing a shift in the bone metabolism balance toward resorption. Male C57BL/6 mice were fed a normal diet, HFD, or HFD plus 0.1% LA for 12 weeks. The bone metabolism-related genes differentially expressed between mice fed HFD and those fed HFD supplemented with LA were identified through complementary DNA microarray. The supplemental LA significantly increased bone mineral density and bone antioxidant capacity in mice fed HFD (P LA induced the decreased expression of genes associated with bone resorption, such as Mmp9 (1.9-fold) and Ctsk (2.3-fold), and increased those genes associated with bone formation, such as Col1a1 (1.3-fold) and Alp1 (1.5-fold). Furthermore, LA upregulated many genes involved in the Igf signaling pathway, such as Igf-1 (increased 1.7-fold), and downregulated genes involved in the p53 apoptotic pathway, such as p53 (decreased 2.3-fold), thus attenuating the HFD-induced inhibition of bone formation. Lipoic acid induced upregulation of Il12a (2.1-fold) and downregulation of Tgfbr1 (4.3-fold) and Il17a (11.3-fold), which may reduce bone resorption. In summary, LA supplementation during HFD could affect bone density, altering gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Involvement of aph(3‘-IIa in the formation of mosaic aminoglycoside resistance genes in natural environments

    Directory of Open Access Journals (Sweden)

    Markus eWoegerbauer

    2015-05-01

    Full Text Available Intragenic recombination leading to mosaic gene formation is known to alter resistance profiles for particular genes and bacterial species. Few studies have examined to what extent aminoglycoside resistance genes undergo intragenic recombination.We screened the GenBank database for mosaic gene formation in homologs of the aph(3’-IIa (nptII gene. APH(3’-IIa inactivates important aminoglycoside antibiotics. The gene is widely used as a selectable marker in biotechnology and enters the environment via laboratory discharges and the release of transgenic organisms. Such releases may provide opportunities for recombination in competent environmental bacteria.The retrieved GenBank sequences were grouped in 3 datasets comprising river water samples, duck pathogens and full-length variants from various bacterial genomes and plasmids. Analysis for recombination in these datasets was performed with the Recombination Detection Program, RDP4, and the Genetic Algorithm for Recombination Detection, GARD.From a total of 89 homologous sequences, 83% showed 99% - 100% sequence identity with aph(3’-IIa originally described as part of transposon Tn5. Fifty one were unique sequence variants eligible for recombination analysis. Only a single recombination event was identified with high confidence and indicated the involvement of aph(3’-IIa in the formation of a mosaic gene located on a plasmid of environmental origin in the multi-resistant isolate Pseudomonas aeruginosa PA96. The available data suggest that aph(3’-IIa is not an archetypical mosaic gene as the divergence between the described sequence variants and the number of detectable recombination events is low. This is in contrast to the numerous mosaic alleles reported for certain penicillin or tetracycline resistance determinants.

  14. Novel inhibitors of Staphylococcus aureus virulence gene expression and biofilm formation.

    Directory of Open Access Journals (Sweden)

    Yibao Ma

    Full Text Available Staphylococcus aureus is a major human pathogen and one of the more prominent pathogens causing biofilm related infections in clinic. Antibiotic resistance in S. aureus such as methicillin resistance is approaching an epidemic level. Antibiotic resistance is widespread among major human pathogens and poses a serious problem for public health. Conventional antibiotics are either bacteriostatic or bacteriocidal, leading to strong selection for antibiotic resistant pathogens. An alternative approach of inhibiting pathogen virulence without inhibiting bacterial growth may minimize the selection pressure for resistance. In previous studies, we identified a chemical series of low molecular weight compounds capable of inhibiting group A streptococcus virulence following this alternative anti-microbial approach. In the current study, we demonstrated that two analogs of this class of novel anti-virulence compounds also inhibited virulence gene expression of S. aureus and exhibited an inhibitory effect on S. aureus biofilm formation. This class of anti-virulence compounds could be a starting point for development of novel anti-microbial agents against S. aureus.

  15. Nucleotide sequence analysis of NIPBL gene in Indian Cornelia de Lange syndrome cases.

    Science.gov (United States)

    Bajaj, Shailesh; Ranade, Suvidya; Gambhir, Prakash

    2013-01-01

    Cornelia de Lange syndrome (CdLS) is a multisystem developmental disorder in children. The disorder is caused mainly due to mutations in Nipped-B-like protein. The molecular data for CdLS is available from developed countries, but not available in developing countries like India. In the present study, the hotspot region of NIPBL gene was screened by Polymerase Chain Reaction which includes exon 2, 22, 42, and a biggest exon 10, in six CdLS patients and ten controls. The method adopted in present study was amplification of the target exon by using polymerase chain reaction, qualitative confirmation of amplicons by Agarose Gel Electrophoresis and use of amplicons for Conformation Sensitive Gel Electrophoresis to find heteroduplex formation followed by sequencing. We report two polymorphisms in the studied region of gene NIPBL. The polymorphisms are in the region of intron 1 and in exon 10. The polymorphism C/A is present in intron 1 region and polymorphism T/G in exon 10. The intronic region polymorphism may have a role in intron splicing whereas the polymorphism in exon 10 results in amino acid change (Val to Gly). These polymorphisms are disease associated as these are found in CdLS patients only and not in controls.

  16. Novel Hypomorphic Alleles of the Mouse Tyrosinase Gene Induced by CRISPR-Cas9 Nucleases Cause Non-Albino Pigmentation Phenotypes.

    Science.gov (United States)

    Challa, Anil K; Boitet, Evan R; Turner, Ashley N; Johnson, Larry W; Kennedy, Daniel; Downs, Ethan R; Hymel, Katherine M; Gross, Alecia K; Kesterson, Robert A

    2016-01-01

    Tyrosinase is a key enzyme in melanin biosynthesis. Mutations in the gene encoding tyrosinase (Tyr) cause oculocutaneous albinism (OCA1) in humans. Alleles of the Tyr gene have been useful in studying pigment biology and coat color formation. Over 100 different Tyr alleles have been reported in mice, of which ≈24% are spontaneous mutations, ≈60% are radiation-induced, and the remaining alleles were obtained by chemical mutagenesis and gene targeting. Therefore, most mutations were random and could not be predicted a priori. Using the CRISPR-Cas9 system, we targeted two distinct regions of exon 1 to induce pigmentation changes and used an in vivo visual phenotype along with heteroduplex mobility assays (HMA) as readouts of CRISPR-Cas9 activity. Most of the mutant alleles result in complete loss of tyrosinase activity leading to an albino phenotype. In this study, we describe two novel in-frame deletion alleles of Tyr, dhoosara (Sanskrit for gray) and chandana (Sanskrit for sandalwood). These alleles are hypomorphic and show lighter pigmentation phenotypes of the body and eyes. This study demonstrates the utility of CRISPR-Cas9 system in generating domain-specific in-frame deletions and helps gain further insights into structure-function of Tyr gene.

  17. Novel Hypomorphic Alleles of the Mouse Tyrosinase Gene Induced by CRISPR-Cas9 Nucleases Cause Non-Albino Pigmentation Phenotypes.

    Directory of Open Access Journals (Sweden)

    Anil K Challa

    Full Text Available Tyrosinase is a key enzyme in melanin biosynthesis. Mutations in the gene encoding tyrosinase (Tyr cause oculocutaneous albinism (OCA1 in humans. Alleles of the Tyr gene have been useful in studying pigment biology and coat color formation. Over 100 different Tyr alleles have been reported in mice, of which ≈24% are spontaneous mutations, ≈60% are radiation-induced, and the remaining alleles were obtained by chemical mutagenesis and gene targeting. Therefore, most mutations were random and could not be predicted a priori. Using the CRISPR-Cas9 system, we targeted two distinct regions of exon 1 to induce pigmentation changes and used an in vivo visual phenotype along with heteroduplex mobility assays (HMA as readouts of CRISPR-Cas9 activity. Most of the mutant alleles result in complete loss of tyrosinase activity leading to an albino phenotype. In this study, we describe two novel in-frame deletion alleles of Tyr, dhoosara (Sanskrit for gray and chandana (Sanskrit for sandalwood. These alleles are hypomorphic and show lighter pigmentation phenotypes of the body and eyes. This study demonstrates the utility of CRISPR-Cas9 system in generating domain-specific in-frame deletions and helps gain further insights into structure-function of Tyr gene.

  18. The Arabidopsis thaliana rlp mutations revert the ectopic leaf blade formation conferred by activation tagging of the LEP gene

    DEFF Research Database (Denmark)

    van der Graaff, Eric; Nussbaumer, C; Keller, Bente

    2003-01-01

    Activation tagging of the gene LEAFY PETIOLE (LEP) with a T-DNA construct induces ectopic leaf blade formation in Arabidopsis, which results in a leafy petiole phenotype. In addition, the number of rosette leaves produced prior to the onset of bolting is reduced, and the rate of leaf initiation...... is retarded by the activation tagged LEP gene. The ectopic leaf blade results from an invasion of the petiole region by the wild-type leaf blade. In order to isolate mutants that are specifically disturbed in the outgrowth of the leaf blade, second site mutagenesis was performed using ethane methanesulphonate...... (EMS) on a transgenic line that harbours the activation-tagged LEP gene and exhibits the leafy petiole phenotype. A collection of revertant for leafy petiole (rlp lines was isolated that form petiolated rosette leaves in the presence of the activated LEP gene, and could be classified into three groups...

  19. Zebrafish embryo screen for mycobacterial genes involved in the initiation of granuloma formation reveals a newly identified ESX-1 component.

    Science.gov (United States)

    Stoop, Esther J M; Schipper, Tim; Rosendahl Huber, Sietske K; Nezhinsky, Alexander E; Verbeek, Fons J; Gurcha, Sudagar S; Besra, Gurdyal S; Vandenbroucke-Grauls, Christina M J E; Bitter, Wilbert; van der Sar, Astrid M

    2011-07-01

    The hallmark of tuberculosis (TB) is the formation of granulomas, which are clusters of infected macrophages surrounded by additional macrophages, neutrophils and lymphocytes. Although it has long been thought that granulomas are beneficial for the host, there is evidence that mycobacteria also promote the formation of these structures. In this study, we aimed to identify new mycobacterial factors involved in the initial stages of granuloma formation. We exploited the zebrafish embryo Mycobacterium marinum infection model to study initiation of granuloma formation and developed an in vivo screen to select for random M. marinum mutants that were unable to induce granuloma formation efficiently. Upon screening 200 mutants, three mutants repeatedly initiated reduced granuloma formation. One of the mutants was found to be defective in the espL gene, which is located in the ESX-1 cluster. The ESX-1 cluster is disrupted in the Mycobacterium bovis BCG vaccine strain and encodes a specialized secretion system known to be important for granuloma formation and virulence. Although espL has not been implicated in protein secretion before, we observed a strong effect on the secretion of the ESX-1 substrates ESAT-6 and EspE. We conclude that our zebrafish embryo M. marinum screen is a useful tool to identify mycobacterial genes involved in the initial stages of granuloma formation and that we have identified a new component of the ESX-1 secretion system. We are confident that our approach will contribute to the knowledge of mycobacterial virulence and could be helpful for the development of new TB vaccines.

  20. Zebrafish embryo screen for mycobacterial genes involved in the initiation of granuloma formation reveals a newly identified ESX-1 component

    Directory of Open Access Journals (Sweden)

    Esther J. M. Stoop

    2011-07-01

    The hallmark of tuberculosis (TB is the formation of granulomas, which are clusters of infected macrophages surrounded by additional macrophages, neutrophils and lymphocytes. Although it has long been thought that granulomas are beneficial for the host, there is evidence that mycobacteria also promote the formation of these structures. In this study, we aimed to identify new mycobacterial factors involved in the initial stages of granuloma formation. We exploited the zebrafish embryo Mycobacterium marinum infection model to study initiation of granuloma formation and developed an in vivo screen to select for random M. marinum mutants that were unable to induce granuloma formation efficiently. Upon screening 200 mutants, three mutants repeatedly initiated reduced granuloma formation. One of the mutants was found to be defective in the espL gene, which is located in the ESX-1 cluster. The ESX-1 cluster is disrupted in the Mycobacterium bovis BCG vaccine strain and encodes a specialized secretion system known to be important for granuloma formation and virulence. Although espL has not been implicated in protein secretion before, we observed a strong effect on the secretion of the ESX-1 substrates ESAT-6 and EspE. We conclude that our zebrafish embryo M. marinum screen is a useful tool to identify mycobacterial genes involved in the initial stages of granuloma formation and that we have identified a new component of the ESX-1 secretion system. We are confident that our approach will contribute to the knowledge of mycobacterial virulence and could be helpful for the development of new TB vaccines.

  1. A triple stranded G-quadruplex formation in the promoter region of human myosin β(Myh7) gene.

    Science.gov (United States)

    Singh, Anju; Kukreti, Shrikant

    2017-09-19

    Regulatory regions in human genome, enriched in guanine-rich DNA sequences have the propensity to fold into G-quadruplex structures. On exploring the genome for search of G-tracts, it was interesting to find that promoter of Human Myosin Gene (MYH7) contains a conserved 23-mer G-rich sequence (HM-23). Mutations in this gene are associated with familial cardiomyopathy. Enrichment of MYH7 gene in G-rich sequences could possibly play a critical role in its regulation. We used polyacrylamide gel electrophoresis (PAGE), UV-Thermal denaturation (UV-Tm) and Circular Dichroism (CD), to demonstrate the formation of a G-quadruplex by 23-mer G-rich sequence HM23 in promoter location of MYH7 gene. We observed that the wild G-rich sequence HM23 containing consecutive G 5 stretch in two stacks adopt G-quadruplexes of diverse molecularity by involvement of four-strand, three-strand and two-strands with same parallel topology. Interestingly, the mutated sequence in the absence of continuous G 5 stretch obstructs the formation of three-stranded G-quadruplex. We demonstrated that continuous G 5 stretch is mandatory for the formation of a unique three-stranded G-quadruplex. Presence of various transcription factors (TF) in vicinity of the sequence HM23 leave fair possibility of recognition by TF binding sites, and so modulate gene expression. These findings may add on our understanding about the effect of base change in the formation of varied structural species in similar solution condition. This study may give insight about structural polymorphism arising due to recognition of non-Watson-Crick G-quadruplex structures by cellular proteins and designing structure specific molecules.

  2. Effect of the luxS gene on biofilm formation and antibiotic resistance by Salmonella serovar Dublin.

    Science.gov (United States)

    Ju, Xiangyu; Li, Junjie; Zhu, Mengjiao; Lu, Zhaoxin; Lv, Fengxia; Zhu, Xiaoyu; Bie, Xiaomei

    2018-05-01

    Biofilms are communities of bacterial cells that serve to protect them from external adverse influences and enhance bacterial resistance to antibiotics and sanitizers. Here, we studied the regulatory effects of glucose and sodium chloride on biofilm formation in Salmonella serovar Dublin (S. Dublin). To analyze expression levels of the quorum sensing gene luxS, we created a luxS knockout mutant. Also, antimicrobial resistance, hydrophobicity and autoinducer-2 (AI-2) activity of both the wild-type (WT) and the mutant strain were investigated. Our results revealed that glucose was not essential for S. Dublin biofilm formation but had an inhibitory effect on biofilm formation when the concentration was over 0.1%. NaCl was found to be indispensable in forming biofilm, and it also exerted an inhibitory effect at high concentrations (>1.0%). Both the WT and the mutant strains displayed significant MIC growth after biofilm formation. An increase of up to 32,768 times in the resistance of S. Dublin in biofilm phonotype against antibiotic (ampicillin) compared to its planktonic phonotype was observed. However, S. Dublin luxS knockout mutant only showed slight differences compared to the WT strain in the antimicrobial tests although it displayed better biofilm-forming capacity than the WT strain. The mutant strain also exhibited higher hydrophobicity than the WT strain, which was a feature related to biofilm formation. The production of the quorum sensing autoinducer-2 (AI-2) was significantly lower in the mutant strain than in the WT strain since the LuxS enzyme, encoded by the luxS gene, plays an essential role in AI-2 synthesis. However, the limited biofilm-forming ability in the WT strain indicated AI-2 was not directly related to S. Dublin biofilm formation. Furthermore, gene expression analysis of the WT and mutant strains revealed upregulation of genes related to biofilm stress response and enhanced resistance in the luxS mutant strain, which may provide evidence for

  3. Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C.

    Science.gov (United States)

    Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth

    2016-04-16

    Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p<0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo

  4. Reprogramming of gene expression during compression wood formation in pine: Coordinated modulation of S-adenosylmethionine, lignin and lignan related genes

    Directory of Open Access Journals (Sweden)

    Villalobos David P

    2012-06-01

    Full Text Available Abstract Background Transcript profiling of differentiating secondary xylem has allowed us to draw a general picture of the genes involved in wood formation. However, our knowledge is still limited about the regulatory mechanisms that coordinate and modulate the different pathways providing substrates during xylogenesis. The development of compression wood in conifers constitutes an exceptional model for these studies. Although differential expression of a few genes in differentiating compression wood compared to normal or opposite wood has been reported, the broad range of features that distinguish this reaction wood suggest that the expression of a larger set of genes would be modified. Results By combining the construction of different cDNA libraries with microarray analyses we have identified a total of 496 genes in maritime pine (Pinus pinaster, Ait. that change in expression during differentiation of compression wood (331 up-regulated and 165 down-regulated compared to opposite wood. Samples from different provenances collected in different years and geographic locations were integrated into the analyses to mitigate the effects of multiple sources of variability. This strategy allowed us to define a group of genes that are consistently associated with compression wood formation. Correlating with the deposition of a thicker secondary cell wall that characterizes compression wood development, the expression of a number of genes involved in synthesis of cellulose, hemicellulose, lignin and lignans was up-regulated. Further analysis of a set of these genes involved in S-adenosylmethionine metabolism, ammonium recycling, and lignin and lignans biosynthesis showed changes in expression levels in parallel to the levels of lignin accumulation in cells undergoing xylogenesis in vivo and in vitro. Conclusions The comparative transcriptomic analysis reported here have revealed a broad spectrum of coordinated transcriptional modulation of genes

  5. Expression of ROS-responsive genes and transcription factors after metabolic formation of H2O2 in chloroplasts

    Directory of Open Access Journals (Sweden)

    Salma eBalazadeh

    2012-11-01

    Full Text Available Glycolate oxidase (GO catalyses the oxidation of glycolate to glyoxylate, thereby consuming O2 and producing H2O2. In this work, Arabidopsis thaliana plants expressing GO in the chloroplasts (GO plants were used to assess the expressional behaviour of reactive oxygen species (ROS-responsive genes and transcription factors (TFs after metabolic induction of H2O2 formation in chloroplasts. In this organelle, GO uses the glycolate derived from the oxygenase activity of RubisCO. Here, to identify genes responding to an abrupt production of H2O2 in chloroplasts we used quantitative real-time PCR (qRT-PCR to test the expression of 187 ROS-responsive genes and 1,880 TFs after transferring GO and wild-type plants grown at high CO2 levels to ambient CO2 concentration. Our data revealed coordinated expression changes of genes of specific functional networks 0.5 h after metabolic induction of H2O2 production in GO plants, including the induction of indole glucosinolate and camalexin biosynthesis genes. Comparative analysis using available microarray data suggests that signals for the induction of these genes through H2O2 may originate in the chloroplast. The TF profiling indicated an upregulation in GO plants of a group of genes involved in the regulation of proanthocyanidin and anthocyanin biosynthesis. Moreover, the upregulation of expression of TF and TF-interacting proteins affecting development (e.g., cell division, stem branching, flowering time, flower development would impact growth and reproductive capacity, resulting in altered development under conditions that promote the formation of H2O2.

  6. Complex Formation by the mrpABCDEFG Gene Products, Which Constitute a Principal Na+/H+ Antiporter in Bacillus subtilis▿

    OpenAIRE

    Kajiyama, Yusuke; Otagiri, Masato; Sekiguchi, Junichi; Kosono, Saori; Kudo, Toshiaki

    2007-01-01

    The Bacillus subtilis Mrp (also referred to as Sha) is a particularly unusual Na+/H+ antiporter encoded by mrpABCDEFG. Using His tagging of Mrp proteins, we showed complex formation by the mrpABCDEFG gene products by pull-down and blue native polyacrylamide gel electrophoresis analyses. This is the first molecular evidence that the Mrp is a multicomponent antiporter in the cation-proton antiporter 3 family.

  7. Evolutionary history of the recruitment of conserved developmental genes in association to the formation and diversification of a novel trait

    Directory of Open Access Journals (Sweden)

    Shirai Leila T

    2012-02-01

    Full Text Available Abstract Background The origin and modification of novel traits are important aspects of biological diversification. Studies combining concepts and approaches of developmental genetics and evolutionary biology have uncovered many examples of the recruitment, or co-option, of genes conserved across lineages for the formation of novel, lineage-restricted traits. However, little is known about the evolutionary history of the recruitment of those genes, and of the relationship between them -for example, whether the co-option involves whole or parts of existing networks, or whether it occurs by redeployment of individual genes with de novo rewiring. We use a model novel trait, color pattern elements on butterfly wings called eyespots, to explore these questions. Eyespots have greatly diversified under natural and sexual selection, and their formation involves genetic circuitries shared across insects. Results We investigated the evolutionary history of the recruitment and co-recruitment of four conserved transcription regulators to the larval wing disc region where circular pattern elements develop. The co-localization of Antennapedia, Notch, Distal-less, and Spalt with presumptive (eyespot organizers was examined in 13 butterfly species, providing the largest comparative dataset available for the system. We found variation between families, between subfamilies, and between tribes. Phylogenetic reconstructions by parsimony and maximum likelihood methods revealed an unambiguous evolutionary history only for Antennapedia, with a resolved single origin of eyespot-associated expression, and many homoplastic events for Notch, Distal-less, and Spalt. The flexibility in the (co-recruitment of the targeted genes includes cases where different gene combinations are associated with morphologically similar eyespots, as well as cases where identical protein combinations are associated with very different phenotypes. Conclusions The evolutionary history of gene

  8. Correlation between ability of biofilm formation with their responsible genes and MDR patterns in clinical and environmental Acinetobacter baumannii isolates.

    Science.gov (United States)

    Bardbari, Ali Mohammadi; Arabestani, Mohammad Reza; Karami, Manoochehr; Keramat, Fariba; Alikhani, Mohammad Yousef; Bagheri, Kamran Pooshang

    2017-07-01

    Acinetobacter baumannii potential to form biofilm and exhibit multiple antibiotic resistances may be responsible in its survival in hospital environment. Accordingly, our study was aimed to determine the correlation between ability of biofilm formation and the frequency of biofilm related genes with antibiotic resistance phenotypes, and also the categorization of their patterns in clinical and environmental isolates. A total of 75 clinical and 32 environmental strains of the A. baumannii were collected and identified via API 20NE. Antibiotic susceptibility was evaluated by disk diffusion and microdilution broth methods. Biofilm formation assay was performed by microtiter plate method. OXA types and biofilm related genes including Bla OXA-51 , Bla OXA-23 , Bla OXA-24 , Bla OXA-58 , bap, bla PER-1 , and ompA were amplified by PCR. The rate of MDR A. baumannii in clinical isolates (100%) was higher than environmental (81.2%) isolates (p baumannii isolates was associated with biofilm formation. There was a significant correlation between multiple drug resistance and biofilm formation. The clinical isolates had a higher ability to form strong biofilms compared to the environmental samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Identification of novel genes associated with renal tertiary lymphoid organ formation in aging mice

    NARCIS (Netherlands)

    Huang, Yuan; Caputo, Christina R.; Noordmans, Gerda A.; Yazdani, Saleh; Monteiro, Luiz Henrique; van den Born, Jaap; van Goor, Harry; Heeringa, Peter; Korstanje, Ron; Hillebrands, Jan-Luuk

    2014-01-01

    A hallmark of aging-related organ deterioration is a dysregulated immune response characterized by pathologic leukocyte infiltration of affected tissues. Mechanisms and genes involved are as yet unknown. To identify genes associated with aging-related renal infiltration, we analyzed kidneys from

  10. Enhanced gene transfection performance and biocompatibility of polyethylenimine through pseudopolyrotaxane formation with α-cyclodextrin

    Science.gov (United States)

    Hu, Li-Zhong; Wan, Ning; Ma, Xi-Xi; Jing, Zi-Wei; Zhang, Ya-Xuan; Li, Chen; Zhou, Si-Yuan; Zhang, Bang-Le

    2017-03-01

    Polyethylenimine (PEI), a commercially available gene transfection reagent, is a promising nonviral vector due to its inherent ability to efficiently condense genetic materials and its successful transfection performance in vitro. However, its low transfection efficiency in vivo, along with its high cytotoxicity, limit any further applications in gene therapy. To enhance the gene transfection performance and reduce the cytotoxicity of linear polyethylenimine, pseudopolyrotaxane PEI25k/CD and the polyrotaxanes PEI25k/CD-PA and PEI25k/CD-PB were prepared and their transfection efficiencies were then evaluated. The pseudopolyrotaxane PEI25k/CD exhibited better transfection efficiency and lower cytotoxicity than the transfection reagent linear PEI25k, even in the presence of serum. It also showed a remarkably higher cell viability, similar DNA protecting capability, and better DNA decondensation and release ability, and could be useful for the development of novel and safe nonviral gene delivery vectors for gene therapy.

  11. A Novel Testis-Specific Gene, Ccdc136, Is Required for Acrosome Formation and Fertilization in Mice.

    Science.gov (United States)

    Geng, Qiang; Ni, Liwei; Ouyang, Bin; Hu, Yanhua; Zhao, Yu; Guo, Jun

    2016-10-01

    Testis-specific genes are essential for the spermatogenesis in mammalian male reproduction. In this study, we have identified a novel testis-specific gene, Ccdc136 (coiled-coil domain containing 136), from the results of high-throughput gene expression profiling in the developmental stage of mouse testes. Ccdc136 was conserved across species in evolution. Quantitative real-time polymerase chain reaction and Western blot analyses showed that Ccdc136 messenger RNA and protein were extraordinarily expressed in mouse testes, which was first presented at postnatal 3 week and increased in an age-dependent manner before adulthood. Immunofluorescence staining revealed that CCDC136 protein was most abundantly located in the acrosome of round spermatids and elongating spermatids within seminiferous tubules of the adult mouse testes. To investigate the function of Ccdc136 in mouse testes, we generated the Ccdc136-knockout mice using Cas9/RNA-mediated gene targeting technology. Interestingly, we found Ccdc136(-/-) males were infertile, due to severe defect of disrupting acrosome formation. The expression levels of proteins (SPACA1 and PICK1) involved in acrosome formation were significantly downregulated in the testes of Ccdc136(-/-) mice than wide-type mice. Moreover, in vitro fertilization assay revealed that anti-CCDC136 antibody could remarkably inhibit fertilization, suggesting CCDC136 also plays an important role in fertilization. All of these demonstrated the essential role of CCDC136-mediated acrosome formation in spermatogenesis and fertilization, which might also provide new insight into the genetic causes of human infertility. © The Author(s) 2016.

  12. Cloning and expression patterns of two Smad genes during embryonic development and shell formation of the Pacific oyster Crassostrea gigas

    Science.gov (United States)

    Liu, Gang; Huan, Pin; Liu, Baozhong

    2014-11-01

    Increasing evidence indicates that transforming growth factor β (TGF-β) signaling pathways play many important roles in the early development of mollusks. However, limited information is known concerning their detailed mechanisms. Here, we describe the identification, cloning and characterization of two Smad genes, the key components of TGF-β signaling pathways, from the Pacific oyster Crassostrea gigas. Sequence analysis of the two genes, designated as cgi-smad1/ 5/ 8 and cgi-smad4, revealed conserved functional characteristics. The two genes were widely expressed in embryos and larvae, suggesting multiple roles in the early development of C. gigas. The mRNA of the two genes aggregated in the D quadrant and cgi-smad4 was highly expressed on the dorsal side of the gastrula, indicating that TGF-β signaling pathways may be involved in dorsoventral patterning in C. gigas. Furthermore, high expression levels of the two genes in the shell fields of embryos at different stages suggested important roles for TGF-β signaling pathways in particular phases of shell development, including the formation of the initial shell field and the biomineralization of larval shells. The results of this study provide fundamental support for elucidating how TGF-β signaling pathways participate in the early development of bivalve mollusks, and suggest that further work is warranted to this end.

  13. The Nf-actin gene is an important factor for food-cup formation and cytotoxicity of pathogenic Naegleria fowleri.

    Science.gov (United States)

    Sohn, Hae-Jin; Kim, Jong-Hyun; Shin, Myeong-Heon; Song, Kyoung-Ju; Shin, Ho-Joon

    2010-03-01

    Naegleria fowleri destroys target cells by trogocytosis, a phagocytosis mechanism, and a process of piecemeal ingestion of target cells by food-cups. Phagocytosis is an actin-dependent process that involves polymerization of monomeric G-actin into filamentous F-actin. However, despite the numerous studies concerning phagocytosis, its role in the N. fowleri food-cup formation related with trogocytosis has been poorly reported. In this study, we cloned and characterized an Nf-actin gene to elucidate the role of Nf-actin gene in N. fowleri pathogenesis. The Nf-actin gene is composed of 1,128-bp and produced a 54.1-kDa recombinant protein (Nf-actin). The sequence identity was 82% with nonpathogenic Naegleria gruberi but has no sequence identity with other mammals or human actin gene. Anti-Nf-actin polyclonal antibody was produced in BALB/c mice immunized with recombinant Nf-actin. The Nf-actin was localized on the cytoplasm, pseudopodia, and especially, food-cup structure (amoebastome) in N. fowleri trophozoites using immunofluorescence assay. When N. fowleri co-cultured with Chinese hamster ovary cells, Nf-actin was observed to localize around on phagocytic food-cups. We also observed that N. fowleri treated with cytochalasin D as actin polymerization inhibitor or transfected with antisense oligomer of Nf-actin gene had shown the reduced ability of food-cup formation and in vitro cytotoxicity. Finally, it suggests that Nf-actin plays an important role in phagocytic activity of pathogenic N. fowleri.

  14. Identifying Genes Controlling Ferulate Cross-Linking Formation in Grass Cell Walls

    Energy Technology Data Exchange (ETDEWEB)

    de O. Buanafina, Marcia Maria [Pennsylvania State Univ., University Park, PA (United States)

    2013-10-16

    This proposal focuses on cell wall feruloylation and our long term goal is to identify and isolate novel genes controlling feruloylation and to characterize the phenotype of mutants in this pathway, with a spotlight on cell wall properties.

  15. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  16. Evaluation of environmental and nutritional factors and sua gene on in vitro biofilm formation of Streptococcus uberis isolates.

    Science.gov (United States)

    Moliva, Melina Vanesa; Cerioli, Florencia; Reinoso, Elina Beatriz

    2017-06-01

    The pathogenesis of Streptococcus uberis is attributed to a combination of extracellular factors and properties such as adherence and biofilm formation. The aim of this work was to evaluate the influence of different factors, additives and bovine milk compounds on S. uberis biofilm formation, as the presence of the sua gene by PCR. Additionally, extracellular DNA and the effect of DNaseI were evaluated in the biofilms yielded. Optimal biofilm development was observed when the pH was adjusted to 7.0 and 37 °C. Additives as glucose and lactose reduced biofilm formation as bovine milk compounds tested. PCR assay showed that not all the isolates yielded sua gene. Extrachromosomal ADN was found in cell-free supernatants, suggesting that DNA released spontaneously to the medium. The results contribute to a better understanding of the factors involved in biofilm production of this important pathogen associated with mastitis in order to promote the design of new therapeutic approaches. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. The comER Gene Plays an Important Role in Biofilm Formation and Sporulation in both Bacillus subtilis and Bacillus cereus.

    Science.gov (United States)

    Yan, Fang; Yu, Yiyang; Wang, Luyao; Luo, Yuming; Guo, Jian-Hua; Chai, Yunrong

    2016-01-01

    Bacteria adopt alternative cell fates during development. In Bacillus subtilis, the transition from planktonic growth to biofilm formation and sporulation is controlled by a complex regulatory circuit, in which the most important event is activation of Spo0A, a transcription factor and a master regulator for genes involved in both biofilm formation and sporulation. In B. cereus, the regulatory pathway controlling biofilm formation and cell differentiation is much less clear. In this study, we show that a novel gene, comER, plays a significant role in biofilm formation as well as sporulation in both B. subtilis and B. cereus. Mutations in the comER gene result in defects in biofilm formation and a delay in spore formation in the two Bacillus species. Our evidence supports the idea that comER may be part of the regulatory circuit that controls Spo0A activation. comER likely acts upstream of sda, a gene encoding a small checkpoint protein for both sporulation and biofilm formation, by blocking the phosphor-relay and thereby Spo0A activation. In summary, our studies outlined a conserved, positive role for comER, a gene whose function was previously uncharacterized, in the regulation of biofilm formation and sporulation in the two Bacillus species.

  18. The comER Gene Plays an Important Role in Biofilm Formation and Sporulation in both Bacillus subtilis and Bacillus cereus

    Science.gov (United States)

    Yan, Fang; Yu, Yiyang; Wang, Luyao; Luo, Yuming; Guo, Jian-hua; Chai, Yunrong

    2016-01-01

    Bacteria adopt alternative cell fates during development. In Bacillus subtilis, the transition from planktonic growth to biofilm formation and sporulation is controlled by a complex regulatory circuit, in which the most important event is activation of Spo0A, a transcription factor and a master regulator for genes involved in both biofilm formation and sporulation. In B. cereus, the regulatory pathway controlling biofilm formation and cell differentiation is much less clear. In this study, we show that a novel gene, comER, plays a significant role in biofilm formation as well as sporulation in both B. subtilis and B. cereus. Mutations in the comER gene result in defects in biofilm formation and a delay in spore formation in the two Bacillus species. Our evidence supports the idea that comER may be part of the regulatory circuit that controls Spo0A activation. comER likely acts upstream of sda, a gene encoding a small checkpoint protein for both sporulation and biofilm formation, by blocking the phosphor-relay and thereby Spo0A activation. In summary, our studies outlined a conserved, positive role for comER, a gene whose function was previously uncharacterized, in the regulation of biofilm formation and sporulation in the two Bacillus species. PMID:27446060

  19. Regulation of Gene Expression in Shewanella oneidensis MR-1 during Electron Acceptor Limitation and Bacterial Nanowire Formation

    Science.gov (United States)

    Barchinger, Sarah E.; Pirbadian, Sahand; Baker, Carol S.; Leung, Kar Man; Burroughs, Nigel J.; El-Naggar, Mohamed Y.

    2016-01-01

    ABSTRACT In limiting oxygen as an electron acceptor, the dissimilatory metal-reducing bacterium Shewanella oneidensis MR-1 rapidly forms nanowires, extensions of its outer membrane containing the cytochromes MtrC and OmcA needed for extracellular electron transfer. RNA sequencing (RNA-Seq) analysis was employed to determine differential gene expression over time from triplicate chemostat cultures that were limited for oxygen. We identified 465 genes with decreased expression and 677 genes with increased expression. The coordinated increased expression of heme biosynthesis, cytochrome maturation, and transport pathways indicates that S. oneidensis MR-1 increases cytochrome production, including the transcription of genes encoding MtrA, MtrC, and OmcA, and transports these decaheme cytochromes across the cytoplasmic membrane during electron acceptor limitation and nanowire formation. In contrast, the expression of the mtrA and mtrC homologs mtrF and mtrD either remains unaffected or decreases under these conditions. The ompW gene, encoding a small outer membrane porin, has 40-fold higher expression during oxygen limitation, and it is proposed that OmpW plays a role in cation transport to maintain electrical neutrality during electron transfer. The genes encoding the anaerobic respiration regulator cyclic AMP receptor protein (CRP) and the extracytoplasmic function sigma factor RpoE are among the transcription factor genes with increased expression. RpoE might function by signaling the initial response to oxygen limitation. Our results show that RpoE activates transcription from promoters upstream of mtrC and omcA. The transcriptome and mutant analyses of S. oneidensis MR-1 nanowire production are consistent with independent regulatory mechanisms for extending the outer membrane into tubular structures and for ensuring the electron transfer function of the nanowires. IMPORTANCE Shewanella oneidensis MR-1 has the capacity to transfer electrons to its external surface

  20. Exploitation of a Very Small Peptide Nucleic Acid as a New Inhibitor of miR-509-3p Involved in the Regulation of Cystic Fibrosis Disease-Gene Expression

    Directory of Open Access Journals (Sweden)

    Felice Amato

    2014-01-01

    Full Text Available Computational techniques, and in particular molecular dynamics (MD simulations, have been successfully used as a complementary technique to predict and analyse the structural behaviour of nucleic acids, including peptide nucleic acid- (PNA- RNA hybrids. This study shows that a 7-base long PNA complementary to the seed region of miR-509-3p, one of the miRNAs involved in the posttranscriptional regulation of the CFTR disease-gene of Cystic Fibrosis, and bearing suitable functionalization at its N- and C-ends aimed at improving its resistance to nucleases and cellular uptake, is able to revert the expression of the luciferase gene containing the 3′UTR of the gene in A549 human lung cancer cells, in agreement with the MD results that pointed at the formation of a stable RNA/PNA heteroduplex notwithstanding the short sequence of the latter. The here reported results widen the interest towards the use of small PNAs as effective anti-miRNA agents.

  1. Novel genes participating in the formation of prismatic and nacreous layers in the pearl oyster as revealed by their tissue distribution and RNA interference knockdown.

    Directory of Open Access Journals (Sweden)

    Daisuke Funabara

    Full Text Available In our previous publication, we identified novel gene candidates involved in shell formation by EST analyses of the nacreous and prismatic layer-forming tissues in the pearl oyster Pinctada fucata. In the present study, 14 of those genes, including two known genes, were selected and further examined for their involvement in shell formation using the RNA interference. Molecular characterization based on the deduced amino acid sequences showed that seven of the novel genes encode secretory proteins. The tissue distribution of the transcripts of the genes, as analyzed by RT-PCR and in situ hybridization, was mostly consistent with those obtained by the EST analysis reported previously. Shells in the pearl oysters injected with dsRNAs targeting genes 000027, 000058, 000081, 000096, 000113 (nacrein, 000118, 000133 and 000411 (MSI60, which showed expression specific to the nacreous layer forming tissues, showed abnormal surface appearance in this layer. Individuals injected with dsRNAs targeting genes 000027, 000113 and 000133 also exhibited abnormal prismatic layers. Individuals injected with dsRNAs targeting genes 000031, 000066, 000098, 000145, 000194 and 000200, which showed expression specific to prismatic layer forming tissues, displayed an abnormal surface appearance in both the nacreous and prismatic layers. Taken together, the results suggest that the genes involved in prismatic layer formation might also be involved in the formation of the nacreous layers.

  2. Inactivation of Stigmatella aurantiaca CsgA gene impares rippling formation

    Directory of Open Access Journals (Sweden)

    Milosevic-Đeric Ana

    2015-01-01

    Full Text Available Stigmatella aurantiaca fruiting body development depends on cell-cell interactions. One type of the signaling molecule stigmolone isolated from S. aurantiaca cells acts to help cells to stay together in the aggregation phase. Another gene product involved in intercellular signaling in S. aurantiaca is the csgA homolog of Myxococcus xanthus. In close relative M. xanthus C signal the product of the csgA gene is required for rippling, aggregation and sporulation. Isolation of homologous gene in S. aurantiaca implicates a probable role of CsgA in intercellular communication. Inactivation of the gene by insertion mutagenesis caused alterations in S. aurantiaca fruiting. The motility behavior of the cells during development was changed as well as their ability to stay more closely together in the early stages of development. Inactivation of the csgA gene completely abolished rippling of the cells. This indicates the crucial role of the CsgA protein in regulating this rhythmic behavior.

  3. NTL8 Regulates Trichome Formation in Arabidopsis by Directly Activating R3 MYB Genes TRY and TCL1.

    Science.gov (United States)

    Tian, Hainan; Wang, Xianling; Guo, Hongyan; Cheng, Yuxin; Hou, Chunjiang; Chen, Jin-Gui; Wang, Shucai

    2017-08-01

    The NAM, ATAF1/2, and CUC (NAC) are plant-specific transcription factors that regulate multiple aspects of plant growth and development and plant response to environmental stimuli. We report here the identification of NTM1-LIKE8 (NTL8), a membrane-associated NAC transcription factor, as a novel regulator of trichome formation in Arabidopsis ( Arabidopsis thaliana ). From an activation-tagged Arabidopsis population, we identified a dominant, gain-of-function mutant with glabrous inflorescence stem. By using plasmid rescue and RT-PCR analyses, we found that NTL8 was tagged; thus, the mutant was named ntl8-1 Dominant ( ntl8-1D ). Recapitulation experiment further confirmed that the phenotype observed in the ntl8-1D mutant was caused by elevated expression of NTL8 Quantitative RT-PCR results showed that the expression level of the single-repeat R3 MYB genes TRIPTYCHON ( TRY ) and TRICHOMELESS1 ( TCL1 ) was elevated in the ntl8-1D mutant. Genetic analyses demonstrated that NTL8 acts upstream of TRY and TCL1 in the regulation of trichome formation. When recruited to the promoter region of the reporter gene Gal4:GUS by a fused GAL4 DNA-binding domain, NTL8 activated the expression of the reporter gene. Chromatin immunoprecipitation results indicated that TRY and TCL1 are direct targets of NTL8. However, NTL8 did not interact with SQUAMOSA PROMOTER BINDING PROTEIN LIKE9, another transcription factor that regulates the expression of TRY and TCL1 , in yeast and plant cells. Taken together, our results suggest that NTL8 negatively regulates trichome formation in Arabidopsis by directly activating the expression of TRY and TCL1 . © 2017 American Society of Plant Biologists. All Rights Reserved.

  4. Effects of Palm Vitamin E on Bone-Formation-Related Gene Expression in Nicotine-Treated Rats

    Directory of Open Access Journals (Sweden)

    Seham Salem Ahmed Abukhadir

    2012-01-01

    Full Text Available The study determines the effects of palm vitamin E on the gene expression of bone-formation-related genes in nicotine-treated rats. Male rats were divided into three groups: normal saline olive oil (NSO, nicotine olive oil (NO, and nicotine palm vitamin E (NE. The treatment was carried out in 2 phases. During the first 2 months, the NSO group received normal saline while the NO and NE groups received nicotine 7 mg/kg, 6 days a week, intraperitoneally. The following 2 months, normal saline and nicotine administration was stopped and was replaced with oral supplementation of olive oil for the NSO and NO groups and oral supplementation of palm vitamin E (60 mg/kg for the NE group. Both femurs were harvested to determine the gene expression of bone morphogenetic protein-2 (BMP-2, Osterix (OSX, and Runt-related transcription factor 2 (RUNX2. Nicotine significantly downregulated the gene expression. This effect was reversed by palm vitamin E treatment. In conclusion, palm vitamin E may play a role in osteoblast differentiation and can be considered as an anabolic agent to treat nicotine-induced osteoporosis.

  5. C. albicans Growth, Transition, Biofilm Formation, and Gene Expression Modulation by Antimicrobial Decapeptide KSL-W

    Science.gov (United States)

    2013-11-07

    penalty for failing to comply with a collection of information if it does not display a currently valid OMB control number. 1. REPORT DATE 01 NOV...microbial growth and plaque formation by surfactant drugs. J Periodontal Res 1978, 13:474–485. 36. Semlali A, Leung KP, Curt S, Rouabhia M

  6. Biofilm formation and presence of icaAD gene in clinical isolates of ...

    African Journals Online (AJOL)

    Two phenotypic methods were used for detection of biofilm production; qualitative Congo red agar (CRA) and quantitative Microtiter plate (MTP). PCR was used to determine the presence of icaAD gene. Biofilm production was detected in 23(46%) isolates by CRA and MTP, however, both methods correlated only in ...

  7. Carbapenem-resistant Pseudomonas aeruginosa: association with virulence genes and biofilm formation

    Directory of Open Access Journals (Sweden)

    Iara Rossi Gonçalves

    Full Text Available Abstract Pseudomonas aeruginosa is an opportunistic pathogen that causes frequently nosocomial infections, currently becoming more difficult to treat due to the various resistance mechanisms and different virulence factors. The purpose of this study was to determine the risk factors independently associated with the development of bacteremia by carbapenem-resistant P. aeruginosa, the frequency of virulence genes in metallo-β-lactamases producers and to evaluate their ability to produce biofilm. We conducted a case–control study in the Uberlândia Federal University – Hospital Clinic, Brazil. Polymerase Chain Reaction was performed for metallo-β-lactamases and virulence genes. Adhesion and biofilm assays were done by quantitative tests. Among the 157 strains analyzed, 73.9% were multidrug-resistant, 43.9% were resistant to carbapenems, 16.1% were phenotypically positive for metallo-β-lactamases, and of these, 10.7% were positive for blaSPM gene and 5.3% positive for blaVIM. The multivariable analysis showed that mechanical ventilation, enteral/nasogastric tubes, primary bacteremia with unknown focus, and inappropriate therapy were independent risk factors associated with bacteremia. All tested strains were characterized as strongly biofilm producers. A higher mortality was found among patients with bacteremia by carbapenem-resistant P. aeruginosa strains, associated independently with extrinsic risk factors, however it was not evident the association with the presence of virulence and metallo-β-lactamases genes.

  8. Distinct gene expression profile of Xanthomonas retroflexus engaged in synergistic multispecies biofilm formation

    DEFF Research Database (Denmark)

    Hansen, Lea Benedicte Skov; Ren, Dawei; Burmølle, Mette

    2017-01-01

    It is well known that bacteria often exist in naturally formed multispecies biofilms. Within these biofilms, interspecies interactions seem to have an important role in ecological processes. Little is known about the effects of interspecies interactions on gene expression in these multispecies...

  9. Differentially expressed genes linked to natural variation in long-term memory formation in Cotesia parasitic wasps

    Directory of Open Access Journals (Sweden)

    Joke J. F. A. Van Vugt

    2015-09-01

    Full Text Available Even though learning and memory are universal traits in the Animal Kingdom, closely related species reveal substantial variation in learning rate and memory dynamics. To determine the genetic background of this natural variation, we studied two congeneric parasitic wasp species, Cotesia glomerata and C. rubecula, which lay their eggs in caterpillars of the large and small cabbage white butterfly. A successful egg laying event serves as an unconditioned stimulus in a classical conditioning paradigm, where plant odors become associated to the encounter of a suitable host caterpillar. Depending on the host species, the number of conditioning trials and the parasitic wasp species, three different types of transcription-dependent long-term memory (LTM and one type of transcription-independent, anesthesia-resistant memory (ARM can be distinguished. To identify transcripts underlying these differences in memory formation, we isolated mRNA from parasitic wasp heads at three different time points between induction and consolidation of each of the four memory types, and for each sample three biological replicates, where after strand-specific paired-end 100 bp deep sequencing. Transcriptomes were assembled de novo and differential expression was determined for each memory type and time point after conditioning, compared to unconditioned wasps. Most differentially expressed (DE genes and antisense transcripts were only DE in one of the LTM types. Among the DE genes that were DE in two or more LTM types, were many protein kinases and phosphatases, small GTPases, receptors and ion channels. Some genes were DE in opposing directions between any of the LTM memory types and ARM, suggesting that ARM in Cotesia requires the transcription of genes inhibiting LTM or vice versa. We discuss our findings in the context of neuronal functioning, including RNA splicing and transport, epigenetic regulation, neurotransmitter/peptide synthesis and antisense transcription. In

  10. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. An IQGAP-related gene is activated during tentacle formation in the simple metazoan Hydra.

    Science.gov (United States)

    Venturelli, C R; Kuznetsov, S; Salgado, L M; Bosch, T C

    2000-09-01

    Differentiation of body column epithelial cells into tentacle epithelial cells in Hydra is accompanied by changes in both cell shape and cell-cell contact. The molecular mechanism by which epithelial cells acquire tentacle cell characteristics is unknown. Here we report that expression of a Hydra homologue of the mammalian IQGAP1 protein is strongly upregulated during tentacle formation. Like mammalian IQGAP, Hydra IQGAP1 contains an N-terminal calponin-homology domain, IQ repeats and a conserved C terminus. In adult polyps a high level of Hydra IQGAP1 mRNA is detected at the basis of tentacles. Consistent with a role in tentacle formation, IQGAP1 expression is activated during head regeneration and budding at a time when tentacles are emerging. The observations support the previous hypothesis that IQGAP proteins are involved in cytoskeletal as well as cell-cell contact rearrangements.

  12. Sprouty gene dosage influences temporal-spatial dynamics of primary enamel knot formation

    Czech Academy of Sciences Publication Activity Database

    Lochovská, Kateřina; Peterková, Renata; Pavlíková, Zuzana; Hovořáková, Mária

    2015-01-01

    Roč. 15, APR 22 (2015), s. 21 ISSN 1471-213X R&D Projects: GA ČR(CZ) GAP305/12/1766; GA ČR GB14-37368G Institutional support: RVO:68378041 Keywords : enamel knot * tooth development * mouse molar * sprouty genes * sonic hedgehog * cre -loxp system * supernumerary tooth Subject RIV: EA - Cell Biology Impact factor: 2.096, year: 2015

  13. Daf-2, Daf-16 and Daf-23: Genetically Interacting Genes Controlling Dauer Formation in Caenorhabditis Elegans

    OpenAIRE

    Gottlieb, S.; Ruvkun, G.

    1994-01-01

    Under conditions of high population density and low food, Caenorhabditis elegans forms an alternative third larval stage, called the dauer stage, which is resistant to desiccation and harsh environments. Genetic analysis of some dauer constitutive (Daf-c) and dauer defective (Daf-d) mutants has revealed a complex pathway that is likely to function in particular neurons and/or responding tissues. Here we analyze the genetic interactions between three genes which comprise a branch of the dauer ...

  14. Hap2, a novel gene in Babesia bigemina is expressed in tick stages, and specific antibodies block zygote formation

    Directory of Open Access Journals (Sweden)

    Minerva Camacho-Nuez

    2017-11-01

    Full Text Available Abstract Background Bovine babesiosis is a tick-borne disease caused by the protozoan parasites of the genus Babesia. In their host vector, Babesia spp. undergo sexual reproduction. Therefore, the development of sexual stages and the subsequent formation of the zygote are essential for the parasite to invade the intestinal cells of the vector tick and continue its life-cycle. HAP2/GCS1 is a protein identified in plants, protozoan parasites and other organisms that has an important role during membrane fusion in fertilization processes. The identification and characterization of HAP-2 protein in Babesia would be very significant to understand the biology of the parasite and to develop a transmission-blocking vaccine in the future. Results To isolate and sequence the hap2 gene DNA from an infected bovine with Babesia bigemina was purified. The hap2 gene was amplified, cloned and sequenced. The sequences of hap2 from four geographically different strains showed high conservation at the amino acid level, including the typical structure with a signal peptide and the HAP2/GSC domain. Antisera anti-HAP2 against the conserved extracellular region of the HAP2 amino acid sequence were obtained from rabbits. The expression of hap2 in the host and vector tissues was analyzed by using semi-quantitative RT-PCR, and the protein was examined by western blot and immunofluorescence. Based on the RT-PCR and WB results, HAP2 is expressed in both, sexual stages induced in vitro, and in infected ticks as well. We did not detect any expression in asexual erythrocytic stages of B. bigemina, relevantly anti-HAP2 specific antibodies were able to block zygotes formation in vitro. Conclusion Babesia bigemina HAP2 is expressed only in tick-infecting stages, and specific antibodies block zygote formation. Further studies regarding the function of HAP2 during tick infection may provide new insights into the molecular mechanisms of sexual reproduction of the parasite.

  15. Hap2, a novel gene in Babesia bigemina is expressed in tick stages, and specific antibodies block zygote formation.

    Science.gov (United States)

    Camacho-Nuez, Minerva; Hernández-Silva, Diego Josimar; Castañeda-Ortiz, Elizabeth Jacqueline; Paredes-Martínez, María Elena; Rocha-Martínez, Marisol Karina; Alvarez-Sánchez, María Elizbeth; Mercado-Curiel, Ricardo Francisco; Aguilar-Tipacamu, Gabriela; Mosqueda, Juan

    2017-11-13

    Bovine babesiosis is a tick-borne disease caused by the protozoan parasites of the genus Babesia. In their host vector, Babesia spp. undergo sexual reproduction. Therefore, the development of sexual stages and the subsequent formation of the zygote are essential for the parasite to invade the intestinal cells of the vector tick and continue its life-cycle. HAP2/GCS1 is a protein identified in plants, protozoan parasites and other organisms that has an important role during membrane fusion in fertilization processes. The identification and characterization of HAP-2 protein in Babesia would be very significant to understand the biology of the parasite and to develop a transmission-blocking vaccine in the future. To isolate and sequence the hap2 gene DNA from an infected bovine with Babesia bigemina was purified. The hap2 gene was amplified, cloned and sequenced. The sequences of hap2 from four geographically different strains showed high conservation at the amino acid level, including the typical structure with a signal peptide and the HAP2/GSC domain. Antisera anti-HAP2 against the conserved extracellular region of the HAP2 amino acid sequence were obtained from rabbits. The expression of hap2 in the host and vector tissues was analyzed by using semi-quantitative RT-PCR, and the protein was examined by western blot and immunofluorescence. Based on the RT-PCR and WB results, HAP2 is expressed in both, sexual stages induced in vitro, and in infected ticks as well. We did not detect any expression in asexual erythrocytic stages of B. bigemina, relevantly anti-HAP2 specific antibodies were able to block zygotes formation in vitro. Babesia bigemina HAP2 is expressed only in tick-infecting stages, and specific antibodies block zygote formation. Further studies regarding the function of HAP2 during tick infection may provide new insights into the molecular mechanisms of sexual reproduction of the parasite.

  16. Biocontrol of tomato wilt disease by Bacillus subtilis isolates from natural environments depends on conserved genes mediating biofilm formation

    Science.gov (United States)

    Liu, Hongxia; Kolter, Roberto; Losick, Richard; Guo, Jian-hua

    2014-01-01

    Summary Bacillus subtilis and other Bacilli have long been used as biological control agents against plant bacterial diseases but the mechanisms by which the bacteria confer protection are not well understood. Our goal in this study was to isolate strains of B. subtilis that exhibit high levels of biocontrol efficacy from natural environments and to investigate the mechanisms by which these strains confer plant protection. We screened a total of sixty isolates collected from various locations across China and obtained six strains that exhibited above 50% biocontrol efficacy on tomato plants against the plant pathogen Ralstonia solanacearum under greenhouse conditions. These wild strains were able to form robust biofilms both in defined medium and on tomato plant roots and exhibited strong antagonistic activities against various plant pathogens in plate assays. We show that plant protection by those strains depended on widely conserved genes required for biofilm formation, including regulatory genes and genes for matrix production. We provide evidence suggesting that matrix production is critical for bacterial colonization on plant root surfaces. Finally, we have established a model system for studies of B. subtilis-tomato plant interactions in protection against a plant pathogen. PMID:22934631

  17. PHOTOPERIOD RESPONSE 1 (PHOR1)-like genes regulate shoot/root growth, starch accumulation, and wood formation in Populus.

    Science.gov (United States)

    Zawaski, Christine; Ma, Cathleen; Strauss, Steven H; French, Darla; Meilan, Richard; Busov, Victor B

    2012-09-01

    This study describes functional characterization of two putative poplar PHOTOPERIOD RESPONSE 1 (PHOR1) orthologues. The expression and sequence analyses indicate that the two poplar genes diverged, at least partially, in function. PtPHOR1_1 is most highly expressed in roots and induced by short days, while PtPHOR1_2 is more uniformly expressed throughout plant tissues and is not responsive to short days. The two PHOR1 genes also had distinct effects on shoot and root growth when their expression was up- and downregulated transgenically. PtPHOR1_1 effects were restricted to roots while PtPHOR1_2 had similar effects on aerial and below-ground development. Nevertheless, both genes seemed to be upregulated in transgenic poplars that are gibberellin-deficient and gibberellin-insensitive, suggesting interplay with gibberellin signalling. PHOR1 suppression led to increased starch accumulation in both roots and stems. The effect of PHOR1 suppression on starch accumulation was coupled with growth-inhibiting effects in both roots and shoots, suggesting that PHOR1 is part of a mechanism that regulates the allocation of carbohydrate to growth or storage in poplar. PHOR1 downregulation led to significant reduction of xylem formation caused by smaller fibres and vessels suggesting that PHOR1 likely plays a role in the growth of xylem cells.

  18. BRD4 Promotes DNA Repair and Mediates the Formation of TMPRSS2-ERG Gene Rearrangements in Prostate Cancer.

    Science.gov (United States)

    Li, Xiangyi; Baek, GuemHee; Ramanand, Susmita G; Sharp, Adam; Gao, Yunpeng; Yuan, Wei; Welti, Jon; Rodrigues, Daniel N; Dolling, David; Figueiredo, Ines; Sumanasuriya, Semini; Crespo, Mateus; Aslam, Adam; Li, Rui; Yin, Yi; Mukherjee, Bipasha; Kanchwala, Mohammed; Hughes, Ashley M; Halsey, Wendy S; Chiang, Cheng-Ming; Xing, Chao; Raj, Ganesh V; Burma, Sandeep; de Bono, Johann; Mani, Ram S

    2018-01-16

    BRD4 belongs to the bromodomain and extraterminal (BET) family of chromatin reader proteins that bind acetylated histones and regulate gene expression. Pharmacological inhibition of BRD4 by BET inhibitors (BETi) has indicated antitumor activity against multiple cancer types. We show that BRD4 is essential for the repair of DNA double-strand breaks (DSBs) and mediates the formation of oncogenic gene rearrangements by engaging the non-homologous end joining (NHEJ) pathway. Mechanistically, genome-wide DNA breaks are associated with enhanced acetylation of histone H4, leading to BRD4 recruitment, and stable establishment of the DNA repair complex. In support of this, we also show that, in clinical tumor samples, BRD4 protein levels are negatively associated with outcome after prostate cancer (PCa) radiation therapy. Thus, in addition to regulating gene expression, BRD4 is also a central player in the repair of DNA DSBs, with significant implications for cancer therapy. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Inactivation of the Huntington's disease gene (Hdh impairs anterior streak formation and early patterning of the mouse embryo

    Directory of Open Access Journals (Sweden)

    Conlon Ronald A

    2005-08-01

    Full Text Available Abstract Background Huntingtin, the HD gene encoded protein mutated by polyglutamine expansion in Huntington's disease, is required in extraembryonic tissues for proper gastrulation, implicating its activities in nutrition or patterning of the developing embryo. To test these possibilities, we have used whole mount in situ hybridization to examine embryonic patterning and morphogenesis in homozygous Hdhex4/5 huntingtin deficient embryos. Results In the absence of huntingtin, expression of nutritive genes appears normal but E7.0–7.5 embryos exhibit a unique combination of patterning defects. Notable are a shortened primitive streak, absence of a proper node and diminished production of anterior streak derivatives. Reduced Wnt3a, Tbx6 and Dll1 expression signify decreased paraxial mesoderm and reduced Otx2 expression and lack of headfolds denote a failure of head development. In addition, genes initially broadly expressed are not properly restricted to the posterior, as evidenced by the ectopic expression of Nodal, Fgf8 and Gsc in the epiblast and T (Brachyury and Evx1 in proximal mesoderm derivatives. Despite impaired posterior restriction and anterior streak deficits, overall anterior/posterior polarity is established. A single primitive streak forms and marker expression shows that the anterior epiblast and anterior visceral endoderm (AVE are specified. Conclusion Huntingtin is essential in the early patterning of the embryo for formation of the anterior region of the primitive streak, and for down-regulation of a subset of dynamic growth and transcription factor genes. These findings provide fundamental starting points for identifying the novel cellular and molecular activities of huntingtin in the extraembryonic tissues that govern normal anterior streak development. This knowledge may prove to be important for understanding the mechanism by which the dominant polyglutamine expansion in huntingtin determines the loss of neurons in

  20. Norlichexanthone Reduces Virulence Gene Expression and Biofilm Formation in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Baldry, Mara; Nielsen, Anita; Bojer, Martin S.

    2016-01-01

    Staphylococcus aureus is a serious human pathogen and antibiotic resistant, community-associated strains, such as the methicillin resistant S. aureus (MRSA) strain USA300, continue to spread. To avoid resistance, anti-virulence therapy has been proposed where toxicity is targeted rather than...... viability. Previously we have shown that norlichexanthone, a small non-reduced tricyclic polyketide produced by fungi and lichens, reduces expression of hla encoding α-hemolysin as well as the regulatory RNAIII of the agr quorum sensing system in S. aureus 8325-4. The aim of the present study was to further...... characterise the mode of action of norlichexanthone and its effect on biofilm formation. We find that norlichexanthone reduces expression of both hla and RNAIII also in strain USA300. Structurally, norlichexanthone resembles ω-hydroxyemodin that recently was shown to bind the agr two component response...

  1. Mutations in Three Genes Encoding Proteins Involved in Hair Shaft Formation Cause Uncombable Hair Syndrome

    DEFF Research Database (Denmark)

    Ü Basmanav, F Buket; Cau, Laura; Tafazzoli, Aylar

    2016-01-01

    Uncombable hair syndrome (UHS), also known as "spun glass hair syndrome," "pili trianguli et canaliculi," or "cheveux incoiffables" is a rare anomaly of the hair shaft that occurs in children and improves with age. UHS is characterized by dry, frizzy, spangly, and often fair hair that is resistant...... in the majority of UHS case subjects. The two enzymes PADI3 and TGM3, responsible for posttranslational protein modifications, and their target structural protein TCHH are all involved in hair shaft formation. Elucidation of the molecular outcomes of the disease-causing mutations by cell culture experiments...... and tridimensional protein models demonstrated clear differences in the structural organization and activity of mutant and wild-type proteins. Scanning electron microscopy observations revealed morphological alterations in hair coat of Padi3 knockout mice. All together, these findings elucidate the molecular genetic...

  2. Requirement of the immediate early gene vesl-1S/homer-1a for fear memory formation

    Directory of Open Access Journals (Sweden)

    Inoue Naoko

    2009-03-01

    Full Text Available Abstract Background The formation of long-term memory (LTM and the late phase of long-term potentiation (L-LTP depend on macromolecule synthesis, translation, and transcription in neurons. vesl-1S (VASP/Ena-related gene upregulated during seizure and LTP, also known as homer-1a is an LTP-induced immediate early gene. The short form of Vesl (Vesl-1S is an alternatively spliced isoform of the vesl-1 gene, which also encodes the long form of the Vesl protein (Vesl-1L. Vesl-1L is a postsynaptic scaffolding protein that binds to and modulates the metabotropic glutamate receptor 1/5 (mGluR1/5, the IP3 receptor, and the ryanodine receptor. Vesl-1 null mutant mice show abnormal behavior, which includes anxiety- and depression-related behaviors, and an increase in cocaine-induced locomotion; however, the function of the short form of Vesl in behavior is poorly understood because of the lack of short-form-specific knockout mice. Results In this study, we generated short-form-specific gene targeting (KO mice by knocking in part of vesl-1L/homer-1c cDNA. Homozygous KO mice exhibited normal spine number and morphology. Using the contextual fear conditioning test, we demonstrated that memory acquisition and short-term memory were normal in homozygous KO mice. In contrast, these mice showed impairment in fear memory consolidation. Furthermore, the process from recent to remote memory was affected in homozygous KO mice. Interestingly, reactivation of previously consolidated fear memory attenuated the conditioning-induced freezing response in homozygous KO mice, which suggests that the short form plays a role in fear memory reconsolidation. General activity, emotional performance, and sensitivity to electrofootshock were normal in homozygous KO mice. Conclusion These results indicate that the short form of the Vesl family of proteins plays a role in multiple steps of long-term, but not short-term, fear memory formation.

  3. Nanosized hydroxyapatite and other calcium phosphates: chemistry of formation and application as drug and gene delivery agents.

    Science.gov (United States)

    Uskoković, Vuk; Uskoković, Dragan P

    2011-01-01

    The first part of this review looks at the fundamental properties of hydroxyapatite (HAP), the basic mineral constituent of mammalian hard tissues, including the physicochemical features that govern its formation by precipitation. A special emphasis is placed on the analysis of qualities of different methods of synthesis and of the phase transformations intrinsic to the formation of HAP following precipitation from aqueous solutions. This serves as an introduction to the second part and the main subject of this review, which relates to the discourse regarding the prospects of fabrication of ultrafine, nanosized particles based on calcium phosphate carriers with various therapeutic and/or diagnostic agents coated on and/or encapsulated within the particles. It is said that the particles could be either surface-functionalized with amphiphiles, peptides, proteins, or nucleic acids or injected with therapeutic agents, magnetic ions, or fluorescent molecules. Depending on the additive, they could be subsequently used for a variety of applications, including the controlled delivery and release of therapeutic agents (extracellularly or intracellularly), magnetic resonance imaging and hyperthermia therapy, cell separation, blood detoxification, peptide or oligonucleotide chromatography and ultrasensitive detection of biomolecules, and in vivo and in vitro gene transfection. Calcium phosphate nanoparticles as carriers of therapeutic agents that would enable a controlled drug release to treat a given bone infection and at the same be resorbed in the body so as to regenerate hard tissue lost to disease are emphasized hereby as one of the potentially attractive smart materials for the modern medicine. © 2010 Wiley Periodicals, Inc.

  4. Insights into Interspecific Hybridization Events in Allotetraploid Cotton Formation from Characterization of a Gene-Regulating Leaf Shape.

    Science.gov (United States)

    Chang, Lijing; Fang, Lei; Zhu, Yajuan; Wu, Huaitong; Zhang, Zhiyuan; Liu, Chunxiao; Li, Xinghe; Zhang, Tianzhen

    2016-10-01

    The morphology of cotton leaves varies considerably. Phenotypes, including okra, sea-island, super-okra, and broad leaf, are controlled by a multiple allele locus, L 2 Okra leaf (L 2 °) is an incomplete mutation that alters leaf shape by increasing the length of lobes with deeper sinuses. Using a map-based cloning strategy, we cloned the L 2 locus gene, which encodes a LATE MERISTEM IDENTITY 1 (LMI1)-like transcription factor (GhOKRA). Silencing GhOKRA leads to a change in phenotype from okra to broad leaf. Overexpression of GhOKRA in Arabidopsis thaliana greatly increases the degree of the leaf lobes and changes the leaf shape. Premature termination of translation in GhOKRA results in the production of broad leaves. The sequences of OKRA from diploid progenitor D-genome species, and wild races and domesticated allotetraploid cottons in Gossypium hirsutum show that a premature termination mutation occurred before and after the formation of tetraploid cotton, respectively. This study provides genomic insights into the two interspecific hybridization events: one produced the present broad leaf and another formed okra leaf phenotype with complete OKRA, that occurred during allotetraploid cotton formation. Copyright © 2016 by the Genetics Society of America.

  5. Genes that act downstream of sensory neurons to influence longevity, dauer formation, and pathogen responses in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Marta M Gaglia

    Full Text Available The sensory systems of multicellular organisms are designed to provide information about the environment and thus elicit appropriate changes in physiology and behavior. In the nematode Caenorhabditis elegans, sensory neurons affect the decision to arrest during development in a diapause state, the dauer larva, and modulate the lifespan of the animals in adulthood. However, the mechanisms underlying these effects are incompletely understood. Using whole-genome microarray analysis, we identified transcripts whose levels are altered by mutations in the intraflagellar transport protein daf-10, which result in impaired development and function of many sensory neurons in C. elegans. In agreement with existing genetic data, the expression of genes regulated by the transcription factor DAF-16/FOXO was affected by daf-10 mutations. In addition, we found altered expression of transcriptional targets of the DAF-12/nuclear hormone receptor in the daf-10 mutants and showed that this pathway influences specifically the dauer formation phenotype of these animals. Unexpectedly, pathogen-responsive genes were repressed in daf-10 mutant animals, and these sensory mutants exhibited altered susceptibility to and behavioral avoidance of bacterial pathogens. Moreover, we found that a solute transporter gene mct-1/2, which was induced by daf-10 mutations, was necessary and sufficient for longevity. Thus, sensory input seems to influence an extensive transcriptional network that modulates basic biological processes in C. elegans. This situation is reminiscent of the complex regulation of physiology by the mammalian hypothalamus, which also receives innervations from sensory systems, most notably the visual and olfactory systems.

  6. Gene expression profiling: cell cycle deregulation and aneuploidy do not cause breast cancer formation in WAP-SVT/t transgenic animals.

    Science.gov (United States)

    Klein, Andreas; Guhl, Eva; Zollinger, Raphael; Tzeng, Yin-Jeh; Wessel, Ralf; Hummel, Michael; Graessmann, Monika; Graessmann, Adolf

    2005-05-01

    Microarray studies revealed that as a first hit the SV40 T/t antigen causes deregulation of 462 genes in mammary gland cells (ME cells) of WAP-SVT/t transgenic animals. The majority of deregulated genes are cell proliferation specific and Rb-E2F dependent, causing ME cell proliferation and gland hyperplasia but not breast cancer formation. In the breast tumor cells a further 207 genes are differentially expressed, most of them belonging to the cell communication category. In tissue culture breast tumor cells frequently switch off WAP-SVT/t transgene expression and regain the morphology and growth characteristics of normal ME cells, although the tumor-revertant cells are aneuploid and only 114 genes regain the expression level of normal ME cells. The profile of retransformants shows that only 38 deregulated genes are tumor-specific, and that none of them is considered to be a typical breast cancer gene.

  7. Bovine mastitis: prevalence and antimicrobial susceptibility profile and detection of genes associated with biofilm formation in Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Valeska Paula Casanova

    2016-06-01

    Full Text Available Brazil currently ranks as one of the world leaders in food production and exportation. This scenario encourages the development of animal and plant health programs to ensure the production of safe food, helping the country to become an international provider of food for excellence. However, some health problems in dairy production, such as mastitis, have garnered increasing concern. This study aimed to estimate the prevalence of bovine mastitis in select properties located in the western Santa Catarina region, to assess the susceptibility profile to antimicrobial agents used for treatment and to check for the presence of genes (icaA and icaD associated with biofilm formation in Staphylococcus aureus. In 148 milk samples collected, 72.97% had bacterial growth (n = 108. Among the isolated microorganisms, 21.62% (n = 32 were classified as Staphylococcus aureus, 18.91% (n = 28 as Staphylococcus sp. coagulase negative, 7.43% (n = 11 as Corynebacterium sp., 6.76% (n = 10 as Staphylococcus sp. coagulase positive, 5.41% (n = 8 as Nocardia sp. and 12.83% (n = 19 classified in different bacterial genera. Among the isolates submitted for antimicrobial susceptibility testing, it was observed that 8.95% (n = 6/67 had resistance to amoxicillin, 8.04% (n = 7/87 to ampicillin, 5.88% (n = 5/85 to cephalothin, 3.40% (n = 3/88 to ceftiofur and enrofloxacin, 20.45% (n = 18/88 to streptomycin, 17.04% (n = 15/88 to gentamicin and lincomycin, 31.81% (n = 28/88 to neomycin, 14.94% (n = 13/87 to penicillin and 25% (n = 22/88 to tetracycline. Staphylococcus sp. coagulase negative isolates showed higher multidrug resistance when compared to those of S. aureus and Staphylococcus sp. coagulase positive. Thirty-one strains of S. aureus isolates were genotypically tested by polymerase chain reaction (PCR, yielding a positive result for the icaA gene in 83.87% of the samples, 80.64% positive for icaD and 74.19% of these showed both genes. The results reinforce the importance

  8. Estudio molecular mediante reacción en cadena de la polimerasa y análisis de heteroduplex para el gen de la resistencia a la Rifampicina en Micobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    P. Salcedo

    2001-07-01

    Full Text Available El Micobacterium tuberculosis, es un bacilo intracelular gramnegativo, facultativo, no esporulado, aerobio estricto, de crecimiento lento y que requiere medio de cultivo complejo para su aislamiento y caracterización. La tuberculosis es una infección que cursa con diversas manifestaciones clínicas teniendo como órgano blanco el pulmón y amplia distribució mundial. El bacilo muestra resistencia o multiresistencia a los tratamientos convencionales. El objetivo del presente trabajo, mediante PCR y el análisis de Heteroduplex de una región del gen rpoB de M. tuberculosis, es detectar las cepas resistentes a la rifampicina.

  9. Entropic effects in formation of chromosome territories: towards understanding of radiation-induced gene translocation frequency

    Science.gov (United States)

    Gudowska-Nowak, Ewa; Ritter, Sylvia; Durante, Marco; Deperas-Standylo, Joanna; Ciesla, Michal

    2012-07-01

    A detailed understanding of structural organization of biological target, such as geometry of an inter-phase chromosome, is an essential prerequisite for gaining deeper insight into relationship between radiation track structure and radiation-induced biological damage [1]. In particular, coupling of biophysical models aimed to describe architecture of chromosomes and their positioning in a cell nucleus [2-4] with models of local distribution of ionizations caused by passing projectiles, are expected to result in more accurate estimates of aberration induction caused by radiation. There is abundant experimental evidence indicating that arrangements of chromosomes in eukaryotic cell nucleus is non-random and has been evolutionary conserved in specific cell types. Moreover, the radial position of a given chromosome territory (CT) within the cell nucleus has been shown to correlate with its size and gene density. Usually it is assumed that chromosomal geometry and positioning result from the action of specific forces acting locally, such as hydrogen bonds, electrostatic, Van der Waals or hydrophobic interactions operating between nucleosomes and within their interiors. However, it is both desirable and instructive to learn to what extend organization of inter-phase chromosomes is affected by nonspecific entropic forces. In this study we report results of a coarse-grained analysis of a chromatin structure modeled by two distinct approaches. In the first method, we adhere to purely statistical analysis of chromatin packing within a chromosome territory. On the basis of the polymer theory, the chromatin fiber of diameter 30nm is approximated by a chain of spheres, each corresponding to about 30 kbp. Random positioning of the center of the domain is repeated for 1000 spherical nuclei. Configuration of the domain is determined by a random packing of a polymer (a string of identical beads) in estimated fraction of space occupied by a chromosome of a given length and mass

  10. Deep sequencing of ESTs from nacreous and prismatic layer producing tissues and a screen for novel shell formation-related genes in the pearl oyster.

    Directory of Open Access Journals (Sweden)

    Shigeharu Kinoshita

    Full Text Available BACKGROUND: Despite its economic importance, we have a limited understanding of the molecular mechanisms underlying shell formation in pearl oysters, wherein the calcium carbonate crystals, nacre and prism, are formed in a highly controlled manner. We constructed comprehensive expressed gene profiles in the shell-forming tissues of the pearl oyster Pinctada fucata and identified novel shell formation-related genes candidates. PRINCIPAL FINDINGS: We employed the GS FLX 454 system and constructed transcriptome data sets from pallial mantle and pearl sac, which form the nacreous layer, and from the mantle edge, which forms the prismatic layer in P. fucata. We sequenced 260477 reads and obtained 29682 unique sequences. We also screened novel nacreous and prismatic gene candidates by a combined analysis of sequence and expression data sets, and identified various genes encoding lectin, protease, protease inhibitors, lysine-rich matrix protein, and secreting calcium-binding proteins. We also examined the expression of known nacreous and prismatic genes in our EST library and identified novel isoforms with tissue-specific expressions. CONCLUSIONS: We constructed EST data sets from the nacre- and prism-producing tissues in P. fucata and found 29682 unique sequences containing novel gene candidates for nacreous and prismatic layer formation. This is the first report of deep sequencing of ESTs in the shell-forming tissues of P. fucata and our data provide a powerful tool for a comprehensive understanding of the molecular mechanisms of molluscan biomineralization.

  11. Molecular cloning of the human gene SUVCC3 associated with the formation of DNA-protein crosslinks following exposure to solar UV radiation

    International Nuclear Information System (INIS)

    Rosenstein, B.S.; Vaslet, C.A.

    1995-01-01

    DRP 153 cells, which are hypersensitive to solar UV and deficient in the formation of DNA-protein crosslinks (DPC) following irradiation, were transfected with human DNA and a secondary transformant obtained in which a normal DPC response and solar UV sensitivity reestablished. DNA from this secondary transformant was used to construct a genomic DNA library from which a recombinant phage was isolated containing the human gene capable of restoring a normal DPC response and solar UV sensitivity to DRP 153. This gene has been designated SUVCC3 to denote solar UV cross-complementing gene number 3. 27 refs., 5 figs., 2 tabs

  12. Frequency of bap and cpaA virulence genes in drug resistant clinical isolates of Acinetobacter baumannii and their role in biofilm formation

    Directory of Open Access Journals (Sweden)

    Arezoo Fallah

    2017-08-01

    Full Text Available Objective(s: Acinetobacter baumannii has a high propensity to form biofilm and frequently causes medical device-related infections with multiple-drug-resistance in hospitals. The aim of this work is to study antimicrobial resistance and the role of bap and cpaA genes in biofilm formation by A. baumannii to understand how this pathogen persists in the hospital environment. Materials and Methods: Theantibiotic resistance profile and in vitro biofilm-forming ability of one hundred clinical isolates of A. baumannii was evaluated by disc diffusion and crystal-violet staining methods, respectively. Isolates were tested for the presence of bap and cpaA genes. Results: The isolates were highly resistant to cefepime, third-generation cephalosporins, ciprofloxacin, cotrimoxazole, aminoglycosides and carbapenems. Moreover, four isolates were resistant to colistin. Quantification of biofilm showed that 43% of the isolates were strong biofilm-producer. Furthermore, 32% of the isolates exhibited moderate biofilm-formation and showed initial binding activity. Frequency of bap and cpaA were determined 92% and 36%, respectively. Conclusion: There was strong association between the presence of bap gene and biofilm formation by A. baumannii isolates (P=0.003. In addition, multidrug resistant isolates produced stronger biofilm than other isolates (P=0.0001. These results indicate importance of biofilm in resistance of isolates and effect of presence of bap gene in biofilm formation by A. baumannii strains.

  13. Distinct gene subsets in pterygia formation and recurrence: dissecting complex biological phenomenon using genome wide expression data

    Directory of Open Access Journals (Sweden)

    Ang Leonard PK

    2009-03-01

    Full Text Available Abstract Background Pterygium is a common ocular surface disease characterized by fibrovascular invasion of the cornea and is sight-threatening due to astigmatism, tear film disturbance, or occlusion of the visual axis. However, the mechanisms for formation and post-surgical recurrence of pterygium are not understood, and a valid animal model does not exist. Here, we investigated the possible mechanisms of pterygium pathogenesis and recurrence. Methods First we performed a genome wide expression analysis (human Affymetrix Genechip, >22000 genes with principal component analysis and clustering techniques, and validated expression of key molecules with PCR. The controls for this study were the un-involved conjunctival tissue of the same eye obtained during the surgical resection of the lesions. Interesting molecules were further investigated with immunohistochemistry, Western blots, and comparison with tear proteins from pterygium patients. Results Principal component analysis in pterygium indicated a signature of matrix-related structural proteins, including fibronectin-1 (both splice-forms, collagen-1A2, keratin-12 and small proline rich protein-1. Immunofluorescence showed strong expression of keratin-6A in all layers, especially the superficial layers, of pterygium epithelium, but absent in the control, with up-regulation and nuclear accumulation of the cell adhesion molecule CD24 in the pterygium epithelium. Western blot shows increased protein expression of beta-microseminoprotein, a protein up-regulated in human cutaneous squamous cell carcinoma. Gene products of 22 up-regulated genes in pterygium have also been found by us in human tears using nano-electrospray-liquid chromatography/mass spectrometry after pterygium surgery. Recurrent disease was associated with up-regulation of sialophorin, a negative regulator of cell adhesion, and never in mitosis a-5, known to be involved in cell motility. Conclusion Aberrant wound healing is therefore

  14. Motility, biofilm formation, apoptotic effect and virulence gene expression of atypical Salmonella Typhimurium outside and inside Caco-2 cells.

    Science.gov (United States)

    Chakroun, Ibtissem; Mahdhi, Abdelkarim; Morcillo, Patricia; Cordero, Hector; Cuesta, Alberto; Bakhrouf, Amina; Mahdouani, Kacem; Esteban, Maria Ángeles

    2018-01-01

    Disease outbreaks related to waterborne pathogen contamination throughout the world as well as challenges that lie ahead for addressing persistent infection are of renewed interest. In this research, we studied the effects of prolonged exposure of Salmonella enterica serovar Typhimurium to the cues encountered in the extracellular environment particularly in seawater microcosm on bacterial virulence and subsequent infection in Caco-2 cells. Our data show a significant difference in biofilm formation, swimming and swarming motilities between normal and stressed cells of S. Typhimurium under differing NaCl conditions (P Caco-2 epithelial cells were determined during infection with normal and stressed Salmonella. Furthermore, we compared the expression of SPI-1 virulence genes (sopA, sopB, sopD, sopE2 and hilA) of normal and stressed S. Typhimurium in response to salt conditions encountered in the extracellular environment in LB broth and after epithelial cell exposure. The interest of the present study is due to the fact that to investigate the bacterial survival strategies during its movement from the natural surroundings to the host cell is fundamental to our understanding of the infection process during the host-pathogen interactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Natural plant products inhibits growth and alters the swarming motility, biofilm formation, and expression of virulence genes in enteroaggregative and enterohemorrhagic Escherichia coli.

    Science.gov (United States)

    García-Heredia, Alam; García, Santos; Merino-Mascorro, José Ángel; Feng, Peter; Heredia, Norma

    2016-10-01

    The purpose of this study was to determine the effects of plant products on the growth, swarming motility, biofilm formation and virulence gene expression in enterohemorrhagic Escherichia coli O157:H7 and enteroaggregative E. coli strain 042 and a strain of O104:H4 serotype. Extracts of Lippia graveolens and Haematoxylon brassiletto, and carvacrol, brazilin were tested by an antimicrobial microdilution method using citral and rifaximin as controls. All products showed bactericidal activity with minimal bactericidal concentrations ranging from 0.08 to 8.1 mg/ml. Swarming motility was determined in soft LB agar. Most compounds reduced swarming motility by 7%-100%; except carvacrol which promoted motility in two strains. Biofilm formation studies were done in microtiter plates. Rifaximin inhibited growth and reduced biofilm formation, but various concentrations of other compounds actually induced biofilm formation. Real time PCR showed that most compounds decreased stx2 expression. The expression of pic and rpoS in E. coli 042 were suppressed but in E. coli O104:H4 they varied depending on compounds. In conclusion, these extracts affect E. coli growth, swarming motility and virulence gene expression. Although these compounds were bactericidal for pathogenic E. coli, sublethal concentrations had varied effects on phenotypic and genotypic traits, and some increased virulence gene expression. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Effect of hypergravity on lignin formation and expression of lignin-related genes in inflorescence stems of an ethylene-insensitive Arabidopsis mutant ein3-1

    Science.gov (United States)

    Karahara, Ichirou; Kobayashi, Mai; Tamaoki, Daisuke; Kamisaka, Seiichiro

    Our previous studies have shown that hypergravity inhibits growth and promotes lignin forma-tion in inflorescence stems of Arabidopsis thaliana by up-regulation of genes involved in lignin biosynthesis (Tamaoki et al. 2006, 2009). In the present study, we have examined whether ethylene is involved in these responses using an ethylene-insensitive Arabidopsis mutant ein3-1. Our results revealed that hypergravity treatment at 300 G for 24 h significantly inhibited growth of inflorescence stems, promoted both deposition of acetyl bromide extractable lignin and gene expression involved in lignin formation in inflorescence stems of wild type plants. Growth inhibition of inflorescence stems was also observed in ein3-1. However, the effects of hypergravity on the promotion of the deposition of acetyl bromide lignin and the expression of genes involved in lignin formation were not observed in ein3-1, indicating that ethylene sig-naling is involved in the up-regulation of the expression of lignin-related genes as well as the promotion of deposition of lignin by hypergravity in Arabidopsis inflorescence stems.

  17. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  18. LPS injection reprograms the expression and the 3' UTR of a CAP gene by alternative polyadenylation and the formation of a GAIT element in Ciona intestinalis.

    Science.gov (United States)

    Vizzini, Aiti; Bonura, Angela; Longo, Valeria; Sanfratello, Maria Antonietta; Parrinello, Daniela; Cammarata, Matteo; Colombo, Paolo

    2016-09-01

    The diversification of cellular functions is one of the major characteristics of multicellular organisms which allow cells to modulate their gene expression, leading to the formation of transcripts and proteins with different functions and concentrations in response to different stimuli. CAP genes represent a widespread family of proteins belonging to the cysteine-rich secretory protein, antigen 5 and pathogenesis-related 1 superfamily which, it has been proposed, play key roles in the infection process and the modulation of immune responses in host animals. The ascidian Ciona intestinalis represents a group of proto-chordates with an exclusively innate immune system that has been widely studied in the field of comparative and developmental immunology. Using this biological system, we describe the identification of a novel APA mechanism by which an intronic polyadenylation signal is activated by LPS injection, leading to the formation of a shorter CAP mRNA capable of expressing the first CAP exon plus 19 amino acid residues whose sequence is contained within the first intron of the annotated gene. Furthermore, such an APA event causes the expression of a translational controlling cis-acting GAIT element which is not present in the previously isolated CAP isoform and identified in the 3'-UTR of other immune-related genes, suggesting an intriguing scenario in which both transcriptional and post-transcriptional control mechanisms are involved in the activation of the CAP gene during inflammatory response in C. intestinalis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Influenza NA and PB1 Gene Segments Interact during the Formation of Viral Progeny: Localization of the Binding Region within the PB1 Gene

    Directory of Open Access Journals (Sweden)

    Brad Gilbertson

    2016-08-01

    Full Text Available The influenza A virus genome comprises eight negative-sense viral RNAs (vRNAs that form individual ribonucleoprotein (RNP complexes. In order to incorporate a complete set of each of these vRNAs, the virus uses a selective packaging mechanism that facilitates co-packaging of specific gene segments but whose molecular basis is still not fully understood. Recently, we used a competitive transfection model where plasmids encoding the A/Puerto Rico/8/34 (PR8 and A/Udorn/307/72 (Udorn PB1 gene segments were competed to show that the Udorn PB1 gene segment is preferentially co-packaged into progeny virions with the Udorn NA gene segment. Here we created chimeric PB1 genes combining both Udorn and PR8 PB1 sequences to further define the location within the Udorn PB1 gene that drives co-segregation of these genes and show that nucleotides 1776–2070 of the PB1 gene are crucial for preferential selection. In vitro assays examining specific interactions between Udorn NA vRNA and purified vRNAs transcribed from chimeric PB1 genes also supported the importance of this region in the PB1-NA interaction. Hence, this work identifies an association between viral genes that are co-selected during packaging. It also reveals a region potentially important in the RNP-RNP interactions within the supramolecular complex that is predicted to form prior to budding to allow one of each segment to be packaged in the viral progeny. Our study lays the foundation to understand the co-selection of specific genes, which may be critical to the emergence of new viruses with pandemic potential.

  20. Biphasic Gene Expression Changes Elicited by Phakopsora pachyrhizi in Soybean Correlate with Fungal Penetration and Haustoria Formation1[W][OA

    Science.gov (United States)

    Schneider, Katherine T.; van de Mortel, Martijn; Bancroft, Timothy J.; Braun, Edward; Nettleton, Dan; Nelson, Rex T.; Frederick, Reid D.; Baum, Thomas J.; Graham, Michelle A.; Whitham, Steven A.

    2011-01-01

    Inoculation of soybean (Glycine max) plants with Phakopsora pachyrhizi, the causal organism of Asian soybean rust, elicits a biphasic response characterized by a burst of differential gene expression in the first 12 h. A quiescent period occurs from 24 to 48 h after inoculation, in which P. pachyrhizi continues to develop but does not elicit strong host responses, followed by a second phase of intense gene expression. To correlate soybean responses with P. pachyrhizi growth and development, we inoculated the soybean cultivar Ankur (accession PI462312), which carries the Rpp3 resistance gene, with avirulent and virulent isolates of P. pachyrhizi. The avirulent isolate Hawaii 94-1 elicits hypersensitive cell death that limits fungal growth on Ankur and results in an incompatible response, while the virulent isolate Taiwan 80-2 grows extensively, sporulates profusely, and produces a compatible reaction. Inoculated leaves were collected over a 288-h time course for microarray analysis of soybean gene expression and microscopic analysis of P. pachyrhizi growth and development. The first burst in gene expression correlated with appressorium formation and penetration of epidermal cells, while the second burst of gene expression changes followed the onset of haustoria formation in both compatible and incompatible interactions. The proliferation of haustoria coincided with the inhibition of P. pachyrhizi growth in the incompatible interaction or the beginning of accelerated growth in the compatible interaction. The temporal relationships between P. pachyrhizi growth and host responses provide an important context in which to view interacting gene networks that mediate the outcomes of their interactions. PMID:21791600

  1. Analysis on Actinobacillus pleuropneumoniae LuxS regulated genes reveals pleiotropic roles of LuxS/AI-2 on biofilm formation, adhesion ability and iron metabolism.

    Science.gov (United States)

    Li, Lu; Xu, Zhuofei; Zhou, Yang; Li, Tingting; Sun, Lili; Chen, Huanchun; Zhou, Rui

    2011-06-01

    LuxS is an enzyme involved in the activated methyl cycle and the by-product autoinducer-2 (AI-2) was a quorum sensing signal in some species. In our previous study, the functional LuxS in AI-2 production was verified in the porcine respiratory pathogen Actinobacillus pleuropneumoniae. Enhanced biofilm formation and reduced virulence were observed in the luxS mutant. To comprehensively understand the luxS function, in this study, the transcriptional profiles were compared between the A. pleuropneumoniae luxS mutant and its parental strain in four different growth phases using microarray. Many genes associated with infection were differentially expressed. The biofilm formation genes pgaABC in the luxS mutant were up-regulated in early exponential phase, while 9 genes associated with adhesion were down-regulated in late exponential phase. A group of genes involved in iron acquisition and metabolism were regulated in four growth phases. Phenotypic investigations using luxS mutant and both genetic and chemical (AI-2) complementation on these virulence traits were performed. The results demonstrated that the luxS mutant showed enhanced biofilm formation and reduced adhesion ability and these effects were not due to lack of AI-2. But AI-2 could increase biofilm formation and adhesion of A. pleuropneumoniae independent of LuxS. Growth under iron restricted condition could be controlled by LuxS through AI-2 production. These results revealed pleiotropic roles of LuxS and AI-2 on A. pleuropneumoniae virulence traits. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Simultaneous gene transfer of bone morphogenetic protein (BMP -2 and BMP-7 by in vivo electroporation induces rapid bone formation and BMP-4 expression

    Directory of Open Access Journals (Sweden)

    Miyazaki Jun-ichi

    2006-08-01

    Full Text Available Abstract Background Transcutaneous in vivo electroporation is expected to be an effective gene-transfer method for promoting bone regeneration using the BMP-2 plasmid vector. To promote enhanced osteoinduction using this method, we simultaneously transferred cDNAs for BMP-2 and BMP-7, as inserts in the non-viral vector pCAGGS. Methods First, an in vitro study was carried out to confirm the expression of BMP-2 and BMP-7 following the double-gene transfer. Next, the individual BMP-2 and BMP-7 plasmids or both together were injected into rat calf muscles, and transcutaneous electroporation was applied 8 times at 100 V, 50 msec. Results In the culture system, the simultaneous transfer of the BMP-2 and BMP-7 genes led to a much higher ALP activity in C2C12 cells than did the transfer of either gene alone. In vivo, ten days after the treatment, soft X-ray analysis showed that muscles that received both pCAGGS-BMP-2 and pCAGGS-BMP-7 had better-defined opacities than those receiving a single gene. Histological examination showed advanced ossification in calf muscles that received the double-gene transfer. BMP-4 mRNA was also expressed, and RT-PCR showed that its level increased for 3 days in a time-dependent manner in the double-gene transfer group. Immunohistochemistry confirmed that BMP-4-expressing cells resided in the matrix between muscle fibers. Conclusion The simultaneous transfer of BMP-2 and BMP-7 genes using in vivo electroporation induces more rapid bone formation than the transfer of either gene alone, and the increased expression of endogenous BMP-4 suggests that the rapid ossification is related to the induction of BMP-4.

  3. Accumulation-associated Protein Gene and TGF-beta 1 Affects the Formation of Lung Cancer-related Biological Material Staphylococcus Epidermidis Biofilm

    Directory of Open Access Journals (Sweden)

    Ying CHEN

    2014-04-01

    Full Text Available Background and objective This study was conducted to evaluate the effects of the accumulation-associated protein (Aap gene and transform growth factor-beta 1 (TGF-β1 on the biofilm formation of lung cancer-related Staphylococcus epidermidis (SE. Methods Species identification was performed to isolate SE strains from clinically implanted materials in lung cancer patients. Stable genetic aggregated proteins, which are associated with negative and positive isolates, were obtained. The biofilm-formation ability of the SE Aap gene was determined by PCR. Density gradient method was used to extract peripheral blood mononuclear cells from patients with non-small cell lung cancer. After 30 h, these cells were co-cultured with A549 at different TGF-β1 concentrations. The supernatant was then combined with SE Aap+ and SE Aap- strains and co-cultured with a medical silicone rubber. A semi-quantitative adhesion test was performed for each bacterial biofilm formation. Scanning electron microscopy was also conducted to observe the microcosmic condition of this material on the bacterial biofilm surface. Results The Aap gene was closely related to SE biofilm formation. At 10 ng/mL, 20 ng/mL, and 40 ng/mL, SE Aap+ biofilm on the medical silicone rubber surface was thicker in the TGF-β1 group than in the control group. No significant differences were found between TGF-β1 groups. For the SE Aap- strains, no evident biofilm was formed in TGF-β1 and control groups. Conclusion In plant material-related infection of lung cancer patients, SE Aap+ strain easily forms biofilm. Furthermore, TGF-β1 was conducive for the biofilm formation of SE Aap+ strains.

  4. Identification of a Key Gene Involved in Branched-Chain Short Fatty Acids Formation in Natto by Transcriptional Analysis and Enzymatic Characterization in Bacillus subtilis.

    Science.gov (United States)

    Hong, Chenlu; Chen, Yangyang; Li, Lu; Chen, Shouwen; Wei, Xuetuan

    2017-03-01

    Natto as a fermented soybean product has many health benefits for human due to its rich nutritional and functional components. However, the unpleasant odor of natto, caused by the formation of branched-chain short fatty acids (BCFAs), prohibits the wide acceptance of natto products. This work is to identify the key gene of BCFAs formation and develop the guidance to reduce natto odor. Transcriptional analysis of BCFAs synthesis pathway genes was conducted in two Bacillus subtilis strains with obvious different BCFAs synthesis abilities. The transcriptional levels of bcd, bkdAA, and ptb in B. subtilis H-9 were 2.7-fold, 0.7-fold, and 8.9-fold higher than that of B. subtilis H-4, respectively. Therefore, the ptb gene with the highest transcriptional change was considered as the key gene in BCFAs synthesis. The ptb encoded enzyme Ptb was further characterized by inducible expression in Escherichia coli. The recombinant Ptb protein (about 32 kDa) was verified by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis analysis. The catalysis functions of Ptb were confirmed on substrates of isovaleryl-CoA and isobutyryl-CoA, and the higher catalysis efficiency of Ptb on isovaleryl-CoA explained the higher level of isovaleric acid in natto. The optimal activities of Ptb were observed at 50 °C and pH 8.0, and the enzymatic activity was inhibited by Ca 2+ , Zn 2+ , Ba 2+ , Mn 2+ , Cu 2+ , SDS, and EDTA. Collectively, this study reports a key gene responsible for BCFAs formation in natto fermentation and provides potential strategies to solve the odor problem.

  5. Staphylococcus epidermidis and Staphylococcus haemolyticus: detection of biofilm genes and biofilm formation in blood culture isolates from patients in a Brazilian teaching hospital.

    Science.gov (United States)

    Pinheiro, Luiza; Brito, Carla Ivo; Oliveira, Adilson de; Pereira, Valéria Cataneli; Cunha, Maria de Lourdes Ribeiro de Souza da

    2016-09-01

    Infections with coagulase-negative staphylococci are often related to biofilm formation. This study aimed to detect biofilm formation and biofilm-associated genes in blood culture isolates of Staphylococcus epidermidis and S. haemolyticus. Half (50.6%) of the 85 S. epidermidis isolates carried the icaAD genes and 15.3% the bhp gene, while these numbers were 42.9% and 0 for S. haemolyticus, respectively. According to the plate test, 30 S. epidermidis isolates were biofilm producers and 40% of them were strongly adherent, while only one (6%) of the 17 S. haemolyticus biofilm-producing isolates exhibited a strongly adherent biofilm. The concomitant presence of icaA and icaD was significantly associated with the plate and tube test results (P ≤ 0.0004). The higher frequency of icaA in S. epidermidis and of icaD in S. haemolyticus is correlated with the higher biofilm-producing capacity of the former since, in contrast to IcaD, IcaA activity is sufficient to produce small amounts of polysaccharide. Although this study emphasizes the importance of icaAD and bhp for biofilm formation in S. epidermidis, other mechanisms seem to be involved in S. haemolyticus. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Investigation of the roles of T6SS genes in motility, biofilm formation, and extracellular protease Asp production in Vibrio alginolyticus with modified Gateway-compatible plasmids.

    Science.gov (United States)

    Liu, H; Gu, D; Sheng, L; Wang, Q; Zhang, Y

    2012-07-01

    The aims of this study were to create and evaluate the Gateway-compatible plasmids for investigating the function of genes in Vibrio alginolyticus and other Gram-negative bacteria. In this study, Gateway-compatible plasmids were successfully constructed for rapid and comprehensive function analysis of genes. Taking advantage of these plasmids, the in-frame deletion mutant strains and their complemented strains of five T6SS genes, including dotU1, VEPGS_0008, VEPGS_0011, hcp2 and ppkA2, were obtained. The results illustrated that all the mutant strains showed no significant effects on extracellular protease production, expression of Hcp1, and biofilm formation when compared to the wild-type strain, but in-frame deletion of VEPGS_0008 resulted in obvious biofilm reduction and the complemented strain restored to the level of the wild-type strain. Besides, in-frame deletion of dotU1, VEPGS_0008 and ppkA2 abolished the swarming ability. A set of Gateway-compatible vectors for internal insertion, in-frame deletion and complementation of the target genes is constructed to facilitate the general and rapid function analysis of genes involved in T6SS in Vibrio alginolyticus. The modified Gateway-compatible plasmids greatly facilitate the high-throughput and convenient function analysis of the unidentified genes. No claim to Chinese Government works. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  7. The CUP-SHAPED COTYLEDON3 gene is required for boundary and shoot meristem formation in Arabidopsis

    DEFF Research Database (Denmark)

    Vroemen, Casper W; Mordhorst, Andreas P; Albrecht, Cathy

    2003-01-01

    From an enhancer trap screen for genes expressed in Arabidopsis embryos, we identified a gene expressed from the octant stage onward in the boundary between the two presumptive cotyledons and in a variety of postembryonic organ and meristem boundaries. This gene, CUP-SHAPED COTYLEDON3 (CUC3...... revealing an even higher degree of redundancy in this class of genes than was thought previously. The CUC3 expression pattern, the cuc3 phenotypes, and CUC3 expression in a series of shoot meristem mutants and transgenes suggest a primary role for CUC3 in the establishment of boundaries that contain cells...

  8. The fruitless gene is required for the proper formation of axonal tracts in the embryonic central nervous system of Drosophila

    NARCIS (Netherlands)

    Song, Ho-Juhn; Billeter, Jean-Christophe; Reynaud, Enrique; Carlo, Troy; Spana, Eric P; Perrimon, Norbert; Goodwin, Stephen F; Baker, Bruce S; Taylor, Barbara J

    2002-01-01

    The fruitless (fru) gene in Drosophila melanogaster is a multifunctional gene that has sex-specific functions in the regulation of male sexual behavior and sex-nonspecific functions affecting adult viability and external morphology. While much attention has focused on fru's sex-specific roles, less

  9. Poly(Vinylidene Fluoride-Trifluorethylene)/barium titanate membrane promotes de novo bone formation and may modulate gene expression in osteoporotic rat model.

    Science.gov (United States)

    Scalize, Priscilla Hakime; Bombonato-Prado, Karina F; de Sousa, Luiz Gustavo; Rosa, Adalberto Luiz; Beloti, Marcio Mateus; Semprini, Marisa; Gimenes, Rossano; de Almeida, Adriana L G; de Oliveira, Fabíola Singaretti; Hallak Regalo, Simone Cecilio; Siessere, Selma

    2016-12-01

    Osteoporosis is a chronic disease that impairs proper bone remodeling. Guided bone regeneration is a surgical technique that improves bone defect in a particular region through new bone formation, using barrier materials (e.g. membranes) to protect the space adjacent to the bone defect. The polytetrafluorethylene membrane is widely used in guided bone regeneration, however, new membranes are being investigated. The purpose of this study was to evaluate the effect of P(VDFTrFE)/BT [poly(vinylidene fluoride-trifluoroethylene)/barium titanate] membrane on in vivo bone formation. Twenty-three Wistar rats were submitted to bilateral ovariectomy. Five animals were subjected to sham surgery. After 150 days, bone defects were created and filled with P(VDF-TrFE)/BT membrane or PTFE membrane (except for the sham and OVX groups). After 4 weeks, the animals were euthanized and calvaria samples were subjected to histomorphometric and computed microtomography analysis (microCT), besides real time polymerase chain reaction (real time PCR) to evaluate gene expression. The histomorphometric analysis showed that the animals that received the P(VDF-TrFE)/BT membrane presented morphometric parameters similar or even better compared to the animals that received the PTFE membrane. The comparison between groups showed that gene expression of RUNX2, BSP, OPN, OSX and RANKL were lower on P(VDF-TrFE)/BT membrane; the gene expression of ALP, OC, RANK and CTSK were similar and the gene expression of OPG, CALCR and MMP9 were higher when compared to PTFE. The results showed that the P(VDF-TrFE)/BT membrane favors bone formation, and therefore, may be considered a promising biomaterial to support bone repair in a situation of osteoporosis.

  10. Effect of Emdogain enamel matrix derivative and BMP-2 on the gene expression and mineralized nodule formation of alveolar bone proper-derived stem/progenitor cells.

    Science.gov (United States)

    Fawzy El-Sayed, Karim M; Dörfer, Christof; Ungefroren, Hendrick; Kassem, Neemat; Wiltfang, Jörg; Paris, Sebastian

    2014-07-01

    The objective of this study was to evaluate the effect of Emdogain (Enamel Matrix Derivative, EMD) and Bone Morphogenetic Protein-2 (BMP-2), either solely or in combination, on the gene expression and mineralized nodule formation of alveolar bone proper-derived stem/progenitor cells. Stem/progenitor cells were isolated from human alveolar bone proper, magnetically sorted using STRO-1 antibodies, characterized flowcytometrically for their surface markers' expression, and examined for colony formation and multilineage differentiation potential. Subsequently, cells were treated over three weeks with 100 μg/ml Emdogain (EMD-Group), or 100 ng/ml BMP-2 (BMP-Group), or a combination of 100 ng/ml BMP-2 and 100 μg/ml Emdogain (BMP/EMD-Group). Unstimulated stem/progenitor cells (MACS(+)-Group) and osteoblasts (OB-Group) served as controls. Osteogenic gene expression was analyzed using RTq-PCR after 1, 2 and 3 weeks (N = 3/group). Mineralized nodule formation was evaluated by Alizarin-Red staining. BMP and EMD up-regulated the osteogenic gene expression. The BMP Group showed significantly higher expression of Collagen-I, III, and V, Alkaline phosphatase and Osteonectin compared to MACS(+)- and OB-Group (p Emdogain and BMP-2 up-regulate the osteogenic gene expression of stem/progenitor cells. The combination of BMP-2 and Emdogain showed no additive effect and would not be recommended for a combined clinical stimulation. Copyright © 2013 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  11. Gene editing using a zinc-finger nuclease mimicking the CCR5Δ32 mutation induces resistance to CCR5-using HIV-1.

    Science.gov (United States)

    Badia, Roger; Riveira-Muñoz, Eva; Clotet, Bonaventura; Esté, José A; Ballana, Ester

    2014-07-01

    To characterize a new zinc-finger nuclease (ZFN) that targets close to the sequence of the 32 bp deletion polymorphism in the CCR5 gene, and to generate cells resistant to HIV-1 strains that use CCR5. CCR5Δ32 is a naturally occurring deletion that provides genetic resistance to R5-tropic HIV-1. The specificity and efficacy of a newly identified target for CCR5 gene editing, near the CCR5Δ32 sequence (ZFNCCR5Δ32), was assessed as well as its ability to generate cells resistant to HIV infection with reduced off-target effects. ZFNCCR5Δ32 activity was evaluated by heteroduplex formation in human K562 cells. Assessment of ZFNCCR5Δ32 specificity was analysed in silico. The yield of ZFNCCR5Δ32 in cell culture was improved by fluorescence-activated cell sorting, and the anti-HIV potency of ZFNCCR5Δ32 was measured in vitro in TZM-bl cells against HIV-1 strains. ZFNCCR5Δ32 effectively recognized the CCR5Δ32 region, inducing a frameshift of the CCR5 coding region that resulted in the complete absence of CCR5 expression of mRNA and of protein at the cell surface. CCR5 knockout cells were refractory to HIV-1 infection by the R5-using strain BaL. Unlike previous CCR5 ZFN studies, the new ZFN has no detectable off-target activity. ZFNCCR5Δ32 is a specific and efficient tool for the generation of CCR5 knockouts. Its ability to mimic the natural CCR5Δ32 phenotype in the absence of relevant off-site cutting events suggests that ZFNCCR5Δ32 might be safe in clinical research. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Efficiently engineered cell sheet using a complex of polyethylenimine–alginate nanocomposites plus bone morphogenetic protein 2 gene to promote new bone formation

    Science.gov (United States)

    Jin, Han; Zhang, Kai; Qiao, Chunyan; Yuan, Anliang; Li, Daowei; Zhao, Liang; Shi, Ce; Xu, Xiaowei; Ni, Shilei; Zheng, Changyu; Liu, Xiaohua; Yang, Bai; Sun, Hongchen

    2014-01-01

    Regeneration of large bone defects is a common clinical problem. Recently, stem cell sheet has been an emerging strategy in bone tissue engineering. To enhance the osteogenic potential of stem cell sheet, we fabricated bone morphogenetic protein 2 (BMP-2) gene-engineered cell sheet using a complex of polyethylenimine–alginate (PEI–al) nanocomposites plus human BMP-2 complementary(c)DNA plasmid, and studied its osteogenesis in vitro and in vivo. PEI–al nanocomposites carrying BMP-2 gene could efficiently transfect bone marrow mesenchymal stem cells. The cell sheet was made by culturing the cells in medium containing vitamin C for 10 days. Assays on the cell culture showed that the genetically engineered cells released the BMP-2 for at least 14 days. The expression of osteogenesis-related gene was increased, which demonstrated that released BMP-2 could effectively induce the cell sheet osteogenic differentiation in vitro. To further test the osteogenic potential of the cell sheet in vivo, enhanced green fluorescent protein or BMP-2-producing cell sheets were treated on the cranial bone defects. The results indicated that the BMP-2-producing cell sheet group was more efficient than other groups in promoting bone formation in the defect area. Our results suggested that PEI–al nanocomposites efficiently deliver the BMP-2 gene to bone marrow mesenchymal stem cells and that BMP-2 gene-engineered cell sheet is an effective way for promoting bone regeneration. PMID:24855355

  13. The insulator factor CTCF controls MHC class II gene expression and is required for the formation of long-distance chromatin interactions

    Science.gov (United States)

    Majumder, Parimal; Gomez, Jorge A.; Chadwick, Brian P.; Boss, Jeremy M.

    2008-01-01

    Knockdown of the insulator factor CCCTC binding factor (CTCF), which binds XL9, an intergenic element located between HLA-DRB1 and HLA-DQA1, was found to diminish expression of these genes. The mechanism involved interactions between CTCF and class II transactivator (CIITA), the master regulator of major histocompatibility complex class II (MHC-II) gene expression, and the formation of long-distance chromatin loops between XL9 and the proximal promoter regions of these MHC-II genes. The interactions were inducible and dependent on the activity of CIITA, regulatory factor X, and CTCF. RNA fluorescence in situ hybridizations show that both genes can be expressed simultaneously from the same chromosome. Collectively, the results suggest a model whereby both HLA-DRB1 and HLA-DQA1 loci can interact simultaneously with XL9, and describe a new regulatory mechanism for these MHC-II genes involving the alteration of the general chromatin conformation of the region and their regulation by CTCF. PMID:18347100

  14. Evaluation of a PCR-Based Universal Heteroduplex Generator Assay as a Tool for Rapid Detection of Multidrug-Resistant Mycobacterium tuberculosis in Peru

    Science.gov (United States)

    Mayta, Holger; Gilman, Robert H.; Arenas, Fanny; Valencia, Teresa; Caviedes, Luz; Montenegro, Sonia H.; Ticona, Eduardo; Ortiz, Jaime; Chumpitaz, Rosa; Evans, Carlton A.; Williams, Diana L.

    2003-01-01

    Multidrug-resistant tuberculosis is an increasing health problem worldwide, especially in developing countries. The PCR-UHG-Rif assay, which detects mutations within the rpoB gene associated with rifampin resistance, was evaluated for its ability and reliability to detect and identify drug-resistant Mycobacterium tuberculosis in a developing country where tuberculosis is highly endemic. PMID:14662980

  15. Comparison of Biofilm Formation Capacities of Two Clinical Isolates of Staphylococcus Epidermidis with and without icaA and icaD Genes on Intraocular Lenses

    Directory of Open Access Journals (Sweden)

    Sertaç Argun Kıvanç

    2017-03-01

    Full Text Available Objectives: To compare biofilm formations of two Staphylococcus epidermidis (S. epidermidis isolates with known biofilm formation capacities on four different intraocular lenses (IOL that have not been studied before. Materials and Methods: Two isolates obtained from ocular surfaces and identified in previous studies and stored at -86 °C in 15% glycerol in the microbiology laboratory of the Anadolu University Department of Biology were purified and used in the study. The isolates were S. epidermidis KA 15.8 (ICA+, a known biofilm producer isolate positive for icaA, icaD and bap genes, and S. epidermidis KA 14.5 (ICA-, known as a non-biofilm producer isolate negative for icaA, icaD and bap genes. The biofilm formation capacities of the 2 isolates on 4 different IOLs were compared. Two of the IOLs were acrylic (UD613 [IOL A], Turkey; SA60AT [IOL B], USA, and the other two were polymethyl methacrylate (PMMA (B60130C [IOL C], India; B55125C [IOL D], India. Bacterial enumeration and optical density measurements were done from biofilms that formed on the IOLs. Biofilms were imaged using scanning electron microscopy. Results: Mean bacterial counts on the IOLs were 7.1±0.4 log10 CFU/mL with the ICA+ isolate, and 6.7±0.8 log10 CFU/mL with the ICA- isolate; there were no statistically significant differences. Biofilm formation was lower with acrylic lenses than PMMA lenses with both isolates (p=0.009 and p=0.013. The highest biofilm production was obtained on IOL C (PMMA (p<0.001 and the lowest was obtained on IOL A (hydrophilic acrylic (p<0.001. Conclusion: Bacterial counts after biofilm formation were lower on acrylic lenses, especially hydrophilic acrylic with hydrophobic properties. Further animal and in vivo studies are required to support the findings of this study.

  16. IKAP deficiency in an FD mouse model and in oligodendrocyte precursor cells results in downregulation of genes involved in oligodendrocyte differentiation and myelin formation.

    Science.gov (United States)

    Cheishvili, David; Dietrich, Paula; Maayan, Channa; Even, Aviel; Weil, Miguel; Dragatsis, Ioannis; Razin, Aharon

    2014-01-01

    The splice site mutation in the IKBKAP gene coding for IKAP protein leads to the tissue-specific skipping of exon 20, with concomitant reduction in IKAP protein production. This causes the neurodevelopmental, autosomal-recessive genetic disorder - Familial Dysautonomia (FD). The molecular hallmark of FD is the severe reduction of IKAP protein in the nervous system that is believed to be the main reason for the devastating symptoms of this disease. Our recent studies showed that in the brain of two FD patients, genes linked to oligodendrocyte differentiation and/or myelin formation are significantly downregulated, implicating IKAP in the process of myelination. However, due to the scarcity of FD patient tissues, these results awaited further validation in other models. Recently, two FD mouse models that faithfully recapitulate FD were generated, with two types of mutations resulting in severely low levels of IKAP expression. Here we demonstrate that IKAP deficiency in these FD mouse models affects a similar set of genes as in FD patients' brains. In addition, we identified two new IKAP target genes involved in oligodendrocyte cells differentiation and myelination, further underscoring the essential role of IKAP in this process. We also provide proof that IKAP expression is needed cell-autonomously for the regulation of expression of genes involved in myelin formation since knockdown of IKAP in the Oli-neu oligodendrocyte precursor cell line results in similar deficiencies. Further analyses of these two experimental models will compensate for the lack of human postmortem tissues and will advance our understanding of the role of IKAP in myelination and the disease pathology.

  17. Overexpression of Differentially Expressed Genes Identified in Non-pathogenic and Pathogenic Entamoeba histolytica Clones Allow Identification of New Pathogenicity Factors Involved in Amoebic Liver Abscess Formation.

    Directory of Open Access Journals (Sweden)

    Martin Meyer

    2016-08-01

    Full Text Available We here compared pathogenic (p and non-pathogenic (np isolates of Entamoeba histolytica to identify molecules involved in the ability of this parasite to induce amoebic liver abscess (ALA-like lesions in two rodent models for the disease. We performed a comprehensive analysis of 12 clones (A1-A12 derived from a non-pathogenic isolate HM-1:IMSS-A and 12 clones (B1-B12 derived from a pathogenic isolate HM-1:IMSS-B. "Non-pathogenicity" included the induction of small and quickly resolved lesions while "pathogenicity" comprised larger abscess development that overstayed day 7 post infection. All A-clones were designated as non-pathogenic, whereas 4 out of 12 B-clones lost their ability to induce ALAs in gerbils. No correlation between ALA formation and cysteine peptidase (CP activity, haemolytic activity, erythrophagocytosis, motility or cytopathic activity was found. To identify the molecular framework underlying different pathogenic phenotypes, three clones were selected for in-depth transcriptome analyses. Comparison of a non-pathogenic clone A1np with pathogenic clone B2p revealed 76 differentially expressed genes, whereas comparison of a non-pathogenic clone B8np with B2p revealed only 19 differentially expressed genes. Only six genes were found to be similarly regulated in the two non-pathogenic clones A1np and B8np in comparison with the pathogenic clone B2p. Based on these analyses, we chose 20 candidate genes and evaluated their roles in ALA formation using the respective gene-overexpressing transfectants. We conclude that different mechanisms lead to loss of pathogenicity. In total, we identified eight proteins, comprising a metallopeptidase, C2 domain proteins, alcohol dehydrogenases and hypothetical proteins, that affect the pathogenicity of E. histolytica.

  18. IKAP Deficiency in an FD Mouse Model and in Oligodendrocyte Precursor Cells Results in Downregulation of Genes Involved in Oligodendrocyte Differentiation and Myelin Formation

    Science.gov (United States)

    Cheishvili, David; Dietrich, Paula; Maayan, Channa; Even, Aviel; Weil, Miguel; Dragatsis, Ioannis; Razin, Aharon

    2014-01-01

    The splice site mutation in the IKBKAP gene coding for IKAP protein leads to the tissue-specific skipping of exon 20, with concomitant reduction in IKAP protein production. This causes the neurodevelopmental, autosomal-recessive genetic disorder - Familial Dysautonomia (FD). The molecular hallmark of FD is the severe reduction of IKAP protein in the nervous system that is believed to be the main reason for the devastating symptoms of this disease. Our recent studies showed that in the brain of two FD patients, genes linked to oligodendrocyte differentiation and/or myelin formation are significantly downregulated, implicating IKAP in the process of myelination. However, due to the scarcity of FD patient tissues, these results awaited further validation in other models. Recently, two FD mouse models that faithfully recapitulate FD were generated, with two types of mutations resulting in severely low levels of IKAP expression. Here we demonstrate that IKAP deficiency in these FD mouse models affects a similar set of genes as in FD patients' brains. In addition, we identified two new IKAP target genes involved in oligodendrocyte cells differentiation and myelination, further underscoring the essential role of IKAP in this process. We also provide proof that IKAP expression is needed cell-autonomously for the regulation of expression of genes involved in myelin formation since knockdown of IKAP in the Oli-neu oligodendrocyte precursor cell line results in similar deficiencies. Further analyses of these two experimental models will compensate for the lack of human postmortem tissues and will advance our understanding of the role of IKAP in myelination and the disease pathology. PMID:24760006

  19. IKAP deficiency in an FD mouse model and in oligodendrocyte precursor cells results in downregulation of genes involved in oligodendrocyte differentiation and myelin formation.

    Directory of Open Access Journals (Sweden)

    David Cheishvili

    Full Text Available The splice site mutation in the IKBKAP gene coding for IKAP protein leads to the tissue-specific skipping of exon 20, with concomitant reduction in IKAP protein production. This causes the neurodevelopmental, autosomal-recessive genetic disorder - Familial Dysautonomia (FD. The molecular hallmark of FD is the severe reduction of IKAP protein in the nervous system that is believed to be the main reason for the devastating symptoms of this disease. Our recent studies showed that in the brain of two FD patients, genes linked to oligodendrocyte differentiation and/or myelin formation are significantly downregulated, implicating IKAP in the process of myelination. However, due to the scarcity of FD patient tissues, these results awaited further validation in other models. Recently, two FD mouse models that faithfully recapitulate FD were generated, with two types of mutations resulting in severely low levels of IKAP expression. Here we demonstrate that IKAP deficiency in these FD mouse models affects a similar set of genes as in FD patients' brains. In addition, we identified two new IKAP target genes involved in oligodendrocyte cells differentiation and myelination, further underscoring the essential role of IKAP in this process. We also provide proof that IKAP expression is needed cell-autonomously for the regulation of expression of genes involved in myelin formation since knockdown of IKAP in the Oli-neu oligodendrocyte precursor cell line results in similar deficiencies. Further analyses of these two experimental models will compensate for the lack of human postmortem tissues and will advance our understanding of the role of IKAP in myelination and the disease pathology.

  20. Liver tumor formation by a mutant retinoblastoma protein in the transgenic mice is caused by an upregulation of c-Myc target genes

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Bo; Hikosaka, Keisuke; Sultana, Nishat; Sharkar, Mohammad Tofael Kabir [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Noritake, Hidenao [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Department of Internal Medicine, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Kimura, Wataru; Wu, Yi-Xin [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Kobayashi, Yoshimasa [Department of Internal Medicine, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Uezato, Tadayoshi [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan); Miura, Naoyuki, E-mail: nmiura@hama-med.ac.jp [Department of Biochemistry, Hamamatsu University School of Medicine, 1-20-1 Handa-yama, Higashi-ku, Hamamatsu 431-3192 (Japan)

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Fifty percent of the mutant Rb transgenic mice produced liver tumors. Black-Right-Pointing-Pointer In the tumor, Foxm1, Skp2, Bmi1 and AP-1 mRNAs were up-regulated. Black-Right-Pointing-Pointer No increase in expression of the Myc-target genes was observed in the non-tumorous liver. Black-Right-Pointing-Pointer Tumor formation depends on up-regulation of the Myc-target genes. -- Abstract: The retinoblastoma (Rb) tumor suppressor encodes a nuclear phosphoprotein that regulates cellular proliferation, apoptosis and differentiation. In order to adapt itself to these biological functions, Rb is subjected to modification cycle, phosphorylation and dephosphorylation. To directly determine the effect of phosphorylation-resistant Rb on liver development and function, we generated transgenic mice expressing phosphorylation-resistant human mutant Rb (mt-Rb) under the control of the rat hepatocyte nuclear factor-1 gene promoter/enhancer. Expression of mt-Rb in the liver resulted in macroscopic neoplastic nodules (adenomas) with {approx}50% incidence within 15 months old. Interestingly, quantitative reverse transcriptase-PCR analysis showed that c-Myc was up-regulated in the liver of mt-Rb transgenic mice irrespective of having tumor tissues or no tumor. In tumor tissues, several c-Myc target genes, Foxm1, c-Jun, c-Fos, Bmi1 and Skp2, were also up-regulated dramatically. We determined whether mt-Rb activated the Myc promoter in the HTP9 cells and demonstrated that mt-Rb acted as an inhibitor of wild-type Rb-induced repression on the Myc promoter. Our results suggest that continued upregulation of c-Myc target genes promotes the liver tumor formation after about 1 year of age.

  1. Overexpression of Differentially Expressed Genes Identified in Non-pathogenic and Pathogenic Entamoeba histolytica Clones Allow Identification of New Pathogenicity Factors Involved in Amoebic Liver Abscess Formation.

    Science.gov (United States)

    Meyer, Martin; Fehling, Helena; Matthiesen, Jenny; Lorenzen, Stephan; Schuldt, Kathrin; Bernin, Hannah; Zaruba, Mareen; Lender, Corinna; Ernst, Thomas; Ittrich, Harald; Roeder, Thomas; Tannich, Egbert; Lotter, Hannelore; Bruchhaus, Iris

    2016-08-01

    We here compared pathogenic (p) and non-pathogenic (np) isolates of Entamoeba histolytica to identify molecules involved in the ability of this parasite to induce amoebic liver abscess (ALA)-like lesions in two rodent models for the disease. We performed a comprehensive analysis of 12 clones (A1-A12) derived from a non-pathogenic isolate HM-1:IMSS-A and 12 clones (B1-B12) derived from a pathogenic isolate HM-1:IMSS-B. "Non-pathogenicity" included the induction of small and quickly resolved lesions while "pathogenicity" comprised larger abscess development that overstayed day 7 post infection. All A-clones were designated as non-pathogenic, whereas 4 out of 12 B-clones lost their ability to induce ALAs in gerbils. No correlation between ALA formation and cysteine peptidase (CP) activity, haemolytic activity, erythrophagocytosis, motility or cytopathic activity was found. To identify the molecular framework underlying different pathogenic phenotypes, three clones were selected for in-depth transcriptome analyses. Comparison of a non-pathogenic clone A1np with pathogenic clone B2p revealed 76 differentially expressed genes, whereas comparison of a non-pathogenic clone B8np with B2p revealed only 19 differentially expressed genes. Only six genes were found to be similarly regulated in the two non-pathogenic clones A1np and B8np in comparison with the pathogenic clone B2p. Based on these analyses, we chose 20 candidate genes and evaluated their roles in ALA formation using the respective gene-overexpressing transfectants. We conclude that different mechanisms lead to loss of pathogenicity. In total, we identified eight proteins, comprising a metallopeptidase, C2 domain proteins, alcohol dehydrogenases and hypothetical proteins, that affect the pathogenicity of E. histolytica.

  2. Liver tumor formation by a mutant retinoblastoma protein in the transgenic mice is caused by an upregulation of c-Myc target genes

    International Nuclear Information System (INIS)

    Wang, Bo; Hikosaka, Keisuke; Sultana, Nishat; Sharkar, Mohammad Tofael Kabir; Noritake, Hidenao; Kimura, Wataru; Wu, Yi-Xin; Kobayashi, Yoshimasa; Uezato, Tadayoshi; Miura, Naoyuki

    2012-01-01

    Highlights: ► Fifty percent of the mutant Rb transgenic mice produced liver tumors. ► In the tumor, Foxm1, Skp2, Bmi1 and AP-1 mRNAs were up-regulated. ► No increase in expression of the Myc-target genes was observed in the non-tumorous liver. ► Tumor formation depends on up-regulation of the Myc-target genes. -- Abstract: The retinoblastoma (Rb) tumor suppressor encodes a nuclear phosphoprotein that regulates cellular proliferation, apoptosis and differentiation. In order to adapt itself to these biological functions, Rb is subjected to modification cycle, phosphorylation and dephosphorylation. To directly determine the effect of phosphorylation-resistant Rb on liver development and function, we generated transgenic mice expressing phosphorylation-resistant human mutant Rb (mt-Rb) under the control of the rat hepatocyte nuclear factor-1 gene promoter/enhancer. Expression of mt-Rb in the liver resulted in macroscopic neoplastic nodules (adenomas) with ∼50% incidence within 15 months old. Interestingly, quantitative reverse transcriptase-PCR analysis showed that c-Myc was up-regulated in the liver of mt-Rb transgenic mice irrespective of having tumor tissues or no tumor. In tumor tissues, several c-Myc target genes, Foxm1, c-Jun, c-Fos, Bmi1 and Skp2, were also up-regulated dramatically. We determined whether mt-Rb activated the Myc promoter in the HTP9 cells and demonstrated that mt-Rb acted as an inhibitor of wild-type Rb-induced repression on the Myc promoter. Our results suggest that continued upregulation of c-Myc target genes promotes the liver tumor formation after about 1 year of age.

  3. A resource for characterizing genome-wide binding and putative target genes of transcription factors expressed during secondary growth and wood formation in Populus.

    Science.gov (United States)

    Liu, Lijun; Ramsay, Trevor; Zinkgraf, Matthew; Sundell, David; Street, Nathaniel Robert; Filkov, Vladimir; Groover, Andrew

    2015-06-01

    Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors expressed during secondary growth and wood formation. Software code (programs and scripts) for processing the Populus ChIP-seq data are provided within a publically available iPlant image, including tools for ChIP-seq data quality control and evaluation adapted from the human Encyclopedia of DNA Elements (ENCODE) project. Basic information for each transcription factor (including members of Class I KNOX, Class III HD ZIP, BEL1-like families) binding are summarized, including the number and location of binding regions, distribution of binding regions relative to gene features, associated putative target genes, and enriched functional categories of putative target genes. These ChIP-seq data have been integrated within the Populus Genome Integrative Explorer (PopGenIE) where they can be analyzed using a variety of web-based tools. We present an example analysis that shows preferential binding of transcription factor ARBORKNOX1 to the nearest neighbor genes in a pre-calculated co-expression network module, and enrichment for meristem-related genes within this module including multiple orthologs of Arabidopsis KNOTTED-like Arabidopsis 2/6. © 2015 Society for Experimental Biology and John Wiley & Sons Ltd This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  4. Differential Gene Expression from Microarray Analysis Distinguishes Woven and Lamellar Bone Formation in the Rat Ulna following Mechanical Loading

    OpenAIRE

    McKenzie, Jennifer A.; Bixby, Elise C.; Silva, Matthew J.

    2011-01-01

    Formation of woven and lamellar bone in the adult skeleton can be induced through mechanical loading. Although much is known about the morphological appearance and structural properties of the newly formed bone, the molecular responses to loading are still not well understood. The objective of our study was to use a microarray to distinguish the molecular responses between woven and lamellar bone formation induced through mechanical loading. Rat forelimb loading was completed in a single bout...

  5. Formation and subdivision of the head field in the centipede Strigamia maritima, as revealed by the expression of head gap gene orthologues and hedgehog dynamics

    Directory of Open Access Journals (Sweden)

    Vera S. Hunnekuhl

    2017-10-01

    Full Text Available Abstract Background There have been few studies of head patterning in non-insect arthropods, and even in the insects, much is not yet understood. In the fly Drosophila three head gap genes, orthodenticle (otd, buttonhead (btd and empty spiracles (ems are essential for patterning the head. However, they do not act through the same pair-rule genes that pattern the trunk from the mandibular segment backwards. Instead they act through the downstream factors collier (col and cap‘n’collar (cnc, and presumably other unknown factors. In the beetle Tribolium, these same gap and downstream genes are also expressed during early head development, but in more restricted domains, and some of them have been shown to be of minor functional importance. In the spider Parasteatoda tepidariorum, hedgehog (hh and otd have been shown to play an important role in head segmentation. Results We have investigated the expression dynamics of otx (otd, SP5/btd, ems, and the downstream factors col, cnc and hh during early head development of the centipede Strigamia maritima. Our results reveal the process of head condensation and show that the anteroposterior sequence of specific gene expression is conserved with that in insects. SP5/btd and otx genes are expressed prior to and during head field formation, whereas ems is not expressed until after the initial formation of the head field, in an emerging gap between SP5/btd and otx expression. Furthermore, we observe an early domain of Strigamia hh expression in the head field that splits to produce segmental stripes in the ocular, antennal and intercalary segments. Conclusions The dynamics of early gene expression in the centipede show considerable similarity with that in the beetle, both showing more localised expression of head gap genes than occurs in the fly. This suggests that the broad overlapping domains of head gap genes observed in Drosophila are derived in this lineage. We also suggest that the splitting of the

  6. Formation and subdivision of the head field in the centipede Strigamia maritima, as revealed by the expression of head gap gene orthologues and hedgehog dynamics.

    Science.gov (United States)

    Hunnekuhl, Vera S; Akam, Michael

    2017-01-01

    There have been few studies of head patterning in non-insect arthropods, and even in the insects, much is not yet understood. In the fly Drosophila three head gap genes, orthodenticle ( otd ), buttonhead ( btd ) and empty spiracles ( ems ) are essential for patterning the head. However, they do not act through the same pair-rule genes that pattern the trunk from the mandibular segment backwards. Instead they act through the downstream factors collier ( col ) and cap ' n ' collar ( cnc ), and presumably other unknown factors. In the beetle Tribolium , these same gap and downstream genes are also expressed during early head development, but in more restricted domains, and some of them have been shown to be of minor functional importance. In the spider Parasteatoda tepidariorum , hedgehog ( hh ) and otd have been shown to play an important role in head segmentation. We have investigated the expression dynamics of otx ( otd ), SP5 / btd , ems , and the downstream factors col , cnc and hh during early head development of the centipede Strigamia maritima . Our results reveal the process of head condensation and show that the anteroposterior sequence of specific gene expression is conserved with that in insects. SP5 / btd and otx genes are expressed prior to and during head field formation, whereas ems is not expressed until after the initial formation of the head field, in an emerging gap between SP5 / btd and otx expression. Furthermore, we observe an early domain of Strigamia hh expression in the head field that splits to produce segmental stripes in the ocular, antennal and intercalary segments. The dynamics of early gene expression in the centipede show considerable similarity with that in the beetle, both showing more localised expression of head gap genes than occurs in the fly. This suggests that the broad overlapping domains of head gap genes observed in Drosophila are derived in this lineage. We also suggest that the splitting of the early hh segmental stripes

  7. Identification of lignin genes and regulatory sequences involved in secondary cell wall formation in Acacia auriculiformis and Acacia mangium via de novo transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Cannon Charles H

    2011-07-01

    Full Text Available Abstract Background Acacia auriculiformis × Acacia mangium hybrids are commercially important trees for the timber and pulp industry in Southeast Asia. Increasing pulp yield while reducing pulping costs are major objectives of tree breeding programs. The general monolignol biosynthesis and secondary cell wall formation pathways are well-characterized but genes in these pathways are poorly characterized in Acacia hybrids. RNA-seq on short-read platforms is a rapid approach for obtaining comprehensive transcriptomic data and to discover informative sequence variants. Results We sequenced transcriptomes of A. auriculiformis and A. mangium from non-normalized cDNA libraries synthesized from pooled young stem and inner bark tissues using paired-end libraries and a single lane of an Illumina GAII machine. De novo assembly produced a total of 42,217 and 35,759 contigs with an average length of 496 bp and 498 bp for A. auriculiformis and A. mangium respectively. The assemblies of A. auriculiformis and A. mangium had a total length of 21,022,649 bp and 17,838,260 bp, respectively, with the largest contig 15,262 bp long. We detected all ten monolignol biosynthetic genes using Blastx and further analysis revealed 18 lignin isoforms for each species. We also identified five contigs homologous to R2R3-MYB proteins in other plant species that are involved in transcriptional regulation of secondary cell wall formation and lignin deposition. We searched the contigs against public microRNA database and predicted the stem-loop structures of six highly conserved microRNA families (miR319, miR396, miR160, miR172, miR162 and miR168 and one legume-specific family (miR2086. Three microRNA target genes were predicted to be involved in wood formation and flavonoid biosynthesis. By using the assemblies as a reference, we discovered 16,648 and 9,335 high quality putative Single Nucleotide Polymorphisms (SNPs in the transcriptomes of A. auriculiformis and A. mangium

  8. Research paper effects of 13-HPODE on expression of genes involved in thyroid hormone synthesis, iodide uptake and formation of hydrogen peroxide in porcine thyrocytes.

    Science.gov (United States)

    Luci, Sebastian; Bettzieche, Anja; Brandsch, Corinna; Eder, Klaus

    2006-11-01

    It has been shown that dietary oxidized fats influence thyroid function in rats and pigs. Mechanism underlying this phenomenon are unknown. This study was performed to investigate whether 13-hydroperoxy-9,11 -octadecadienic acid (13-HPODE), a primary oxidation product of linoleic acid, affects expression of gene involved in thyroid hormone synthesis and formation of hydrogen peroxide in primary porcine thyrocytes. Thyrocytes were treated with 13-HPODE in concentrations between 20 and 100 microM. Cells treated with vehicle alone ("control cells") or with equivalent concentrations of linoleic acid were considered as controls. Treatment of cells with 13-HPODE did not affect cell viability but increased the activities of the antioxidant enzymes superoxide dismutase and glutathione peroxidase (p < 0.05) compared to control cells or cells treated with linoleic acid. Relative mRNA concentrations of genes involved in thyroid hormone synthesis like sodium iodide symporter, thyrotropin receptor, and thyroid peroxidase, as well as iodide uptake, did not differ between cells treated with 13-HPODE and control cells or cells treated with linoleic acid. Treatment of cells with 13-HPODE, however, reduced the relative mRNA concentrations of dual oxidase-2 and the formation of hydrogen peroxide compared to control cells or cells treated with linoleic acid (p < 0.05). Because the production of hydrogen peroxide is rate-limiting for the synthesis of thyroid hormones, it is suggested that 13-HPODE could have an impact on the formation of thyroid hormones in the thyroid gland.

  9. Vascular endothelial growth factor and hypoxia-inducible factor-1α gene polymorphisms and coronary collateral formation in patients with coronary chronic total occlusions

    Directory of Open Access Journals (Sweden)

    Vincent Amoah

    2016-06-01

    Full Text Available Introduction: We evaluated the association between two single nucleotide polymorphisms of the vascular endothelial growth factor gene and one of the hypoxia-inducible factor-1α gene and the degree of coronary collateral formation in patients with a coronary chronic total occlusion. Methods: Totally, 98 patients with symptomatic coronary artery disease and a chronic total occlusion observed during coronary angiography were recruited. Genotyping of two vascular endothelial growth factor promoter single nucleotide polymorphisms (−152G>A and −165C>T and the C1772T single nucleotide polymorphism of hypoxia-inducible factor-1α were performed using polymerase chain reaction and restriction fragment length polymorphism analysis. The presence and extent of collateral vessel filling was scored by blinded observers using the Rentrop grade. Results: We found no association between the vascular endothelial growth factor −152G>A, −165C>T and hypoxia-inducible factor-1α −1772C>T with the presence and filling of coronary collateral vessels. A history of percutaneous coronary intervention and transient ischaemic attack/cerebrovascular accident were associated with the presence of enhanced collateral vessel formation following binary logistic regression analysis. Conclusion: The study findings suggest that coronary collateral formation is not associated with the tested polymorphic variants of vascular endothelial growth factor and hypoxia-inducible factor-1α in patients with symptomatic coronary artery disease and the presence of a chronic total occlusion.

  10. A mutation in the COX5 gene of the yeast Scheffersomyces stipitis alters utilization of amino acids as carbon source, ethanol formation and activity of cyanide insensitive respiration.

    Science.gov (United States)

    Freese, Stefan; Passoth, Volkmar; Klinner, Ulrich

    2011-04-01

    Scheffersomyces stipitis PJH was mutagenized by random integrative mutagenesis and the integrants were screened for lacking the ability to grow with glutamate as sole carbon source. One of the two isolated mutants was damaged in the COX5 gene, which encodes a subunit of the cytochrome c oxidase. BLAST searches in the genome of Sc. stipitis revealed that only one singular COX5 gene exists in Sc. stipitis, in contrast to Saccharomyces cerevisiae, where two homologous genes are present. Mutant cells had lost the ability to grow with the amino acids glutamate, proline or aspartate and other non-fermentable carbon sources, such as acetic acid and ethanol, as sole carbon sources. Biomass formation of the mutant cells in medium containing glucose or xylose as carbon source was lower compared with the wild-type cells. However, yields and specific ethanol formation of the mutant were much higher, especially under conditions of higher aeration. The mutant cells lacked both cytochrome c oxidase activity and cyanide-sensitive respiration, whereas ADH and PDC activities were distinctly enhanced. SHAM-sensitive respiration was obviously essential for the fermentative metabolism, because SHAM completely abolished growth of the mutant cells with both glucose or xylose as carbon source. Copyright © 2011 John Wiley & Sons, Ltd.

  11. Effect of Negative Pressure on Proliferation, Virulence Factor Secretion, Biofilm Formation, and Virulence-Regulated Gene Expression of Pseudomonas aeruginosa In Vitro

    Directory of Open Access Journals (Sweden)

    Guo-Qi Wang

    2016-01-01

    Full Text Available Objective. To investigate the effect of negative pressure conditions induced by NPWT on P. aeruginosa. Methods. P. aeruginosa was cultured in a Luria–Bertani medium at negative pressure of −125 mmHg for 24 h in the experimental group and at atmospheric pressure in the control group. The diameters of the colonies of P. aeruginosa were measured after 24 h. ELISA kit, orcinol method, and elastin-Congo red assay were used to quantify the virulence factors. Biofilm formation was observed by staining with Alexa Fluor® 647 conjugate of concanavalin A (Con A. Virulence-regulated genes were determined by quantitative RT-PCR. Results. As compared with the control group, growth of P. aeruginosa was inhibited by negative pressure. The colony size under negative pressure was significantly smaller in the experimental group than that in the controls (p<0.01. Besides, reductions in the total amount of virulence factors were observed in the negative pressure group, including exotoxin A, rhamnolipid, and elastase. RT-PCR results revealed a significant inhibition in the expression level of virulence-regulated genes. Conclusion. Negative pressure could significantly inhibit the growth of P. aeruginosa. It led to a decrease in the virulence factor secretion, biofilm formation, and a reduction in the expression level of virulence-regulated genes.

  12. Amino acid transporter genes are essential for FLO11-dependent and FLO11-independent biofilm formation and invasive growth in Saccharomyces cerevisiae.

    Science.gov (United States)

    Torbensen, Rasmus; Møller, Henrik Devitt; Gresham, David; Alizadeh, Sefa; Ochmann, Doreen; Boles, Eckhard; Regenberg, Birgitte

    2012-01-01

    Amino acids can induce yeast cell adhesion but how amino acids are sensed and signal the modulation of the FLO adhesion genes is not clear. We discovered that the budding yeast Saccharomyces cerevisiae CEN.PK evolved invasive growth ability under prolonged nitrogen limitation. Such invasive mutants were used to identify amino acid transporters as regulators of FLO11 and invasive growth. One invasive mutant had elevated levels of FLO11 mRNA and a Q320STOP mutation in the SFL1 gene that encodes a protein kinase A pathway regulated repressor of FLO11. Glutamine-transporter genes DIP5 and GNP1 were essential for FLO11 expression, invasive growth and biofilm formation in this mutant. Invasive growth relied on known regulators of FLO11 and the Ssy1-Ptr3-Ssy5 complex that controls DIP5 and GNP1, suggesting that Dip5 and Gnp1 operates downstream of the Ssy1-Ptr3-Ssy5 complex for regulation of FLO11 expression in a protein kinase A dependent manner. The role of Dip5 and Gnp1 appears to be conserved in the S. cerevisiae strain ∑1278b since the dip5 gnp1 ∑1278b mutant showed no invasive phenotype. Secondly, the amino acid transporter gene GAP1 was found to influence invasive growth through FLO11 as well as other FLO genes. Cells carrying a dominant loss-of-function PTR3(647::CWNKNPLSSIN) allele had increased transcription of the adhesion genes FLO1, 5, 9, 10, 11 and the amino acid transporter gene GAP1. Deletion of GAP1 caused loss of FLO11 expression and invasive growth. However, deletions of FLO11 and genes encoding components of the mitogen-activated protein kinase pathway or the protein kinase A pathway were not sufficient to abolish invasive growth, suggesting involvement of other FLO genes and alternative pathways. Increased intracellular amino acid pools in the PTR3(647::CWNKNPLSSIN)-containing strain opens the possibility that Gap1 regulates the FLO genes through alteration of the amino acid pool sizes.

  13. Bistable expression of virulence genes in salmonella leads to the formation of an antibiotic-tolerant subpopulation.

    Directory of Open Access Journals (Sweden)

    Markus Arnoldini

    2014-08-01

    Full Text Available Phenotypic heterogeneity can confer clonal groups of organisms with new functionality. A paradigmatic example is the bistable expression of virulence genes in Salmonella typhimurium, which leads to phenotypically virulent and phenotypically avirulent subpopulations. The two subpopulations have been shown to divide labor during S. typhimurium infections. Here, we show that heterogeneous virulence gene expression in this organism also promotes survival against exposure to antibiotics through a bet-hedging mechanism. Using microfluidic devices in combination with fluorescence time-lapse microscopy and quantitative image analysis, we analyzed the expression of virulence genes at the single cell level and related it to survival when exposed to antibiotics. We found that, across different types of antibiotics and under concentrations that are clinically relevant, the subpopulation of bacterial cells that express virulence genes shows increased survival after exposure to antibiotics. Intriguingly, there is an interplay between the two consequences of phenotypic heterogeneity. The bet-hedging effect that arises through heterogeneity in virulence gene expression can protect clonal populations against avirulent mutants that exploit and subvert the division of labor within these populations. We conclude that bet-hedging and the division of labor can arise through variation in a single trait and interact with each other. This reveals a new degree of functional complexity of phenotypic heterogeneity. In addition, our results suggest a general principle of how pathogens can evade antibiotics: Expression of virulence factors often entails metabolic costs and the resulting growth retardation could generally increase tolerance against antibiotics and thus compromise treatment.

  14. Protein translation and cell death: the role of rare tRNAs in biofilm formation and in activating dormant phage killer genes.

    Directory of Open Access Journals (Sweden)

    Rodolfo García-Contreras

    2008-06-01

    Full Text Available We discovered previously that the small Escherichia coli proteins Hha (hemolysin expression modulating protein and the adjacent, poorly-characterized YbaJ are important for biofilm formation; however, their roles have been nebulous. Biofilms are intricate communities in which cell signaling often converts single cells into primitive tissues. Here we show that Hha decreases biofilm formation dramatically by repressing the transcription of rare codon tRNAs which serves to inhibit fimbriae production and by repressing to some extent transcription of fimbrial genes fimA and ihfA. In vivo binding studies show Hha binds to the rare codon tRNAs argU, ileX, ileY, and proL and to two prophage clusters D1P12 and CP4-57. Real-time PCR corroborated that Hha represses argU and proL, and Hha type I fimbriae repression is abolished by the addition of extra copies of argU, ileY, and proL. The repression of transcription of rare codon tRNAs by Hha also leads to cell lysis and biofilm dispersal due to activation of prophage lytic genes rzpD, yfjZ, appY, and alpA and due to induction of ClpP/ClpX proteases which activate toxins by degrading antitoxins. YbaJ serves to mediate the toxicity of Hha. Hence, we have identified that a single protein (Hha can control biofilm formation by limiting fimbriae production as well as by controlling cell death. The mechanism used by Hha is the control of translation via the availability of rare codon tRNAs which reduces fimbriae production and activates prophage lytic genes. Therefore, Hha acts as a toxin in conjunction with co-transcribed YbaJ (TomB that attenuates Hha toxicity.

  15. Regulation of Pattern Formation and Gene Amplification During Drosophila Oogenesis by the miR-318 microRNA

    DEFF Research Database (Denmark)

    Ge, Wanzhong; Deng, Qiannan; Guo, Ting

    2015-01-01

    signaling pathway activates expression of miR-318 and that miR-318 cooperates with Tramtrack69 (Ttk69) to control the switch from endocycling to chorion gene amplification during differentiation of the follicular epithelium. The multiple functions of miR-318 in oogenesis illustrate the importance of mi...

  16. Root development in mice lacking functional tissue non-specific alkaline phosphatase gene: inhibition of acellular cementum formation

    NARCIS (Netherlands)

    Beertsen, W.; vandenBos, T.; Everts, V.

    1999-01-01

    Tissue non-specific alkaline phosphatase (TNAP) is richly present in developing teeth including the cells of the periodontal ligament. Here, we investigated tooth and root development in mice lacking the TNAP gene. Heterozygous mutants were obtained from The Jackson Laboratory, Animal Resources (Bar

  17. Biofilm formation, antimicrobial susceptibility, serogroups and virulence genes of uropathogenic E. coli isolated from clinical samples in Iran

    Directory of Open Access Journals (Sweden)

    Elahe Tajbakhsh

    2016-04-01

    Full Text Available Abstract Background Uropathogenic Escherichia coli O- Serogroups with their virulence factors are the most prevalent causes of UTIs. The present research performed to track common uropathogenic E.coli serogroups, antibiotic resistance pattern of strains and prevalence of virulence genes in isolations having the ability to constitute biofilm. Methods In this research 130 E.coli isolation from patients having UTI symptoms were collected and antimicrobial resistance pattern was performed by Kirby-Bauer method. Polymerase chain reaction was done using primer pairs to identify common serogroups of uropathogenic E.coli and studying virulence genes in isolations creating biofilm. Results Among 130 E.coli isolates, 80 (61.53 % were able to make biofilm that 15 isolates (18.75 % indicated strong reaction, 20 (25 % of medium and 45 (56.25 % of weak biofilm reaction. Among isolations creating biofilm, the highest resistance reported to Ampicillin (87.5 % and the lowest to Nitrofurantoin (3.75 %. The frequency of fimH, pap, sfa and afa genes in isolations having the ability to create strong biofilm reported 93.33 %, 86.66 %, 86.66 % and 66.66 %, respectively. Conclusions The findings indicated the importance of virulence genes in serogroups producing uropathogenic E.coli biofilm. It is recommended that strains producing biofilm before antibiotic use should be studied.

  18. The phosphotransferase system gene ptsI in the endophytic bacterium Bacillus cereus is required for biofilm formation, colonization, and biocontrol against wheat sharp eyespot.

    Science.gov (United States)

    Xu, Yu-Bin; Chen, Mai; Zhang, Ying; Wang, Miao; Wang, Ying; Huang, Qiu-bin; Wang, Xue; Wang, Gang

    2014-05-01

    Natural resistance of wheat plants to wheat sharp eyespot is inadequate, and new strategies for controlling the disease are required. Biological control is an alternative and attractive way of reducing the use of chemicals in agriculture. In this study, we investigated the biocontrol properties of endophytic bacterium Bacillus cereus strain 0-9, which was isolated from the root systems of healthy wheat varieties. The phosphotransferase system is a major regulator of carbohydrate metabolism in bacteria. Enzyme I is one of the protein components of this system. Specific disruption and complementation of the enzyme I-coding gene ptsI from B. cereus was achieved through homologous recombination. Disruption of ptsI in B. cereus caused a 70% reduction in biofilm formation, a 30.4% decrease in biocontrol efficacy, and a 1000-fold reduction in colonization. The growth of ΔptsI mutant strain on G-tris synthetic medium containing glucose as the exclusive carbon source was also reduced. Wild-type properties could be restored to the ΔptsI mutant strain by ptsI complementation. These results suggested that ptsI may be one of the key genes involved in biofilm formation, colonization, and biocontrol of B. cereus and that B. cereus wild-type strain 0-9 may be an ideal biocontrol agent for controlling wheat sharp eyespot. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  19. GTSE1: a novel TEAD4-E2F1 target gene involved in cell protrusions formation in triple-negative breast cancer cell models

    Science.gov (United States)

    Stelitano, Debora; Leticia, Yamila Peche; Dalla, Emiliano; Monte, Martin; Piazza, Silvano; Schneider, Claudio

    2017-01-01

    GTSE1 over-expression has been reported as a potential marker for metastasis in various types of malignancies, including breast cancer. Despite this, the transcriptional regulation of this protein and the causes of its misregulation in tumors remain largely unknown. The aims of this work were to elucidate how GTSE1 is regulated at the transcriptional level and to clarify the mechanism underlying GTSE1-dependent cell functions in triple-negative breast cancer (TNBC). Here, we identified GTSE1 as a novel target gene of the TEAD4 transcription factor, highlighting a role for the YAP and TAZ coactivators in the transcriptional regulation of GTSE1. Moreover, we found that TEAD4 controls the formation of cell protrusions required for cell migration through GTSE1, unveiling a relevant effector role for this protein in the TEAD-dependent cellular functions and confirming TEAD4 role in promoting invasion and metastasis in breast cancer. Finally, we highlighted a role for the pRb-E2F1 pathway in the control of GTSE1 transcription and observed that treatment with drugs targeting the pRb-E2F1 or YAP/TAZ-TEAD pathways dramatically downregulated the expression levels of GTSE1 and of other genes involved in the formation of metastasis, suggesting their potential use in the treatment of TNBC. PMID:28978043

  20. Direct activation of EXPANSIN14 by LBD18 in the gene regulatory network of lateral root formation in Arabidopsis

    OpenAIRE

    Kim, Jungmook; Lee, Han Woo

    2013-01-01

    Root system architecture is important for plants to adapt to a changing environment. The major determinant of the root system is lateral roots originating from the primary root. The developmental process of lateral root formation can be divided into priming, initiation, primordium development and the emergence of lateral roots, and is well characterized in Arabidopsis. The hormone auxin plays a critical role in lateral root development, and several auxin response modules involving AUXIN RESPO...

  1. Apolipoprotein E deficiency increases remnant lipoproteins and accelerates progressive atherosclerosis, but not xanthoma formation, in gene modified minipigs

    DEFF Research Database (Denmark)

    Shim, Jeong; Poulsen, Christian Bo; Hagensen, Mette K.

    2017-01-01

    Summary: Deficiency of apolipoprotein E (APOE) causes familial dysbetalipoproteinemia in humans resulting in a higher risk of atherosclerotic disease. In mice, APOE deficiency results in a severe atherosclerosis phenotype, but it is unknown to what extent this is unique to mice. In this study, APOE...... progressive atherosclerosis but not xanthoma formation. This indicates that remnant lipoproteinemia does not induce early lesions but is atherogenic in pre-existing atherosclerosis....

  2. Targeted Gene Deletion Demonstrates that Cell Adhesion MoleculeICAM-4 is Critical for Erythroblastic Island Formation

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Gloria; Lo, Annie; Short, Sarah A.; Mankelow, Tosti J.; Spring, Frances; Parsons, Stephen F.; Mohandas, Narla; Anstee, David J.; Chasis, Joel Anne

    2006-02-15

    Erythroid progenitors differentiate in erythroblastic islands, bone marrow niches composed of erythroblasts surrounding a central macrophage. Evidence suggests that within islands adhesive interactions regulate erythropoiesis and apoptosis. We are exploring whether erythroid intercellular adhesion molecule-4 (ICAM-4), animmunoglobulin superfamily member, participates in island formation. Earlier, we identified alpha V integrins as ICAM-4 counter receptors. Since macrophages express alpha V, ICAM-4 potentially mediates island attachments. To test this, we generated ICAM-4 knockout mice and developed quantitative, live cell techniques for harvesting intact islands and for reforming islands in vitro. We observed a 47 percent decrease in islands reconstituted from ICAM-4 null marrow compared to wild type. We also found a striking decrease in islands formed in vivo in knockout mice. Further, peptides that block ICAM-4 alpha V adhesion produced a 53-57 percent decrease in reconstituted islands, strongly suggesting that ICAM-4 binding to macrophage alpha V functions in island integrity. Importantly, we documented that alpha V integrin is expressed in macrophages isolated from erythro blastic islands. Collectively, these data provide convincing evidence that ICAM-4 is critical in erythroblastic island formation via ICAM-4/alpha V adhesion and also demonstrate that the novel experimental strategies we developed will be valuable in exploring molecular mechanisms of erythroblastic island formation and their functional role in regulating erythropoiesis.

  3. Correlation between GDF-15 gene polymorphism and the formation of collateral circulation in acute ST-elevation myocardial infarction.

    Science.gov (United States)

    Chen, Xiao-Ping; Shang, Xiao-Sen; Wang, Yan-Bin; Fu, Zhi-Hua; Gao, Yu; Feng, Tao

    2017-12-01

    To explore the correlation between growth differentiation factor 15 (GDF-15) -3148C/G polymorphism and the formation of collateral circulation in acute ST-elevation myocardial infarction (STEMI) in Han population of Taiyuan area. The present study included 92 STEMI patients and 56 normal controls based on coronary angiography; STEMI group was divided into collateral group and non-collateral group according to Rentrop's grading method. Polymerase chain reaction (PCR) and DNA sequencing methods were used to detect and analyze the GDF-15 -3148C/G polymorphism in all participants. There was significant difference in GDF-15 -3148C/G CC and GC distribution between STEMI group and control group (p=0.009); the allele frequencies between these two groups were also significant different (p=0.016); and the risk genotype for STEMI was CC with increased OR=2.660. For STEMI group, GDF-15 -3148C/G CC and GC distribution was also significantly different between patients with and without collateral (p=0.048), and CC genotype significantly promote the formation of collateral circulation. However, there were no significant differences in allele frequencies between these two subgroups of STEMI. There was correlation between GDF-15-3148C/G polymorphism and the formation of collateral circulation in patients with acute STEMI.

  4. Correlation between GDF-15 gene polymorphism and the formation of collateral circulation in acute ST-elevation myocardial infarction

    Directory of Open Access Journals (Sweden)

    Xiao-ping Chen

    Full Text Available Summary Objective: To explore the correlation between growth differentiation factor 15 (GDF-15 -3148C/G polymorphism and the formation of collateral circulation in acute ST-elevation myocardial infarction (STEMI in Han population of Taiyuan area. Method: The present study included 92 STEMI patients and 56 normal controls based on coronary angiography; STEMI group was divided into collateral group and non-collateral group according to Rentrop's grading method. Polymerase chain reaction (PCR and DNA sequencing methods were used to detect and analyze the GDF-15 -3148C/G polymorphism in all participants. Results: There was significant difference in GDF-15 -3148C/G CC and GC distribution between STEMI group and control group (p=0.009; the allele frequencies between these two groups were also significant different (p=0.016; and the risk genotype for STEMI was CC with increased OR=2.660. For STEMI group, GDF-15 -3148C/G CC and GC distribution was also significantly different between patients with and without collateral (p=0.048, and CC genotype significantly promote the formation of collateral circulation. However, there were no significant differences in allele frequencies between these two subgroups of STEMI. Conclusion: There was correlation between GDF-15-3148C/G polymorphism and the formation of collateral circulation in patients with acute STEMI.

  5. A Novel Function for the nm23-Hl Gene: Overexpression in Human Breast Carcinoma Cells Leads to the Formation of Basement Membrane and Growth Arrest

    Energy Technology Data Exchange (ETDEWEB)

    Howlett, Anthony R; Petersen, Ole W; Steeg, Patricia S; Bissell, Mina J

    1994-01-01

    We have developed a culture system using reconstituted basement membrane components in which normal human mammary epithelial cells exhibit several aspects of the development and differentiation process, including formation of acinar-like structures, production and basal deposition of basement membrane components, and production and apical secretion of sialomucins. Cell lines and cultures from human breast carcinomas failed to recapitulate this process. The data indicate the importance of cellular interactions with the basement membrane in the regulation of normal breast differentiation and, potentially, its loss in neoplasia. Our purpose was to use this assay to investigate the role of the putative metastasis suppressor gene nm23-H1 in mammary development and differentiation. The metastatic human breast carcinoma cell line MDA-MB-435, clones transfected with a control pCMVBamneo vector, and clones transfected with pCMVBamneo vector containing nm23-H1 complementary DNA (the latter of which exhibited a substantial reduction in spontaneous metastatic potential in vivo) were cultured within a reconstituted basement membrane. Clones were examined for formation of acinus-like spheres, deposition of basement membrane components, production of sialomucin, polarization, and growth arrest. In contrast to the parental cell line and control transfectants, MDA-MB-435 breast carcinoma cells overexpressing Nm23-H1 protein regained several aspects of the normal phenotype within reconstituted basement membrane. Nm23-H1 protein-positive cells formed organized acinus-like spheres, deposited the basement membrane components type IV collagen and, to some extent, laminin to the outside of the spheres, expressed sialomucin, and growth arrested. Growth arrest of Nm23-H1 protein-positive cells was preceded by and correlated with formation of a basement membrane, suggesting a causal relationship. The data indicate a previously unidentified cause-and-effect relationship between nm23-H1 gene

  6. Genes for selenium dependent and independent formate dehydrogenase in the gut microbial communities of three lower, wood-feeding termites and a wood-feeding roach.

    Science.gov (United States)

    Zhang, Xinning; Matson, Eric G; Leadbetter, Jared R

    2011-02-01

    The bacterial Wood-Ljungdahl pathway for CO(2)-reductive acetogenesis is important for the nutritional mutualism occurring between wood-feeding insects and their hindgut microbiota. A key step in this pathway is the reduction of CO(2) to formate, catalysed by the enzyme formate dehydrogenase (FDH). Putative selenocysteine- (Sec) and cysteine- (Cys) containing paralogues of hydrogenase-linked FDH (FDH(H)) have been identified in the termite gut acetogenic spirochete, Treponema primitia, but knowledge of their relevance in the termite gut environment remains limited. In this study, we designed degenerate PCR primers for FDH(H) genes (fdhF) and assessed fdhF diversity in insect gut bacterial isolates and the gut microbial communities of termites and cockroaches. The insects examined herein represent three wood-feeding termite families, Termopsidae, Kalotermitidae and Rhinotermitidae (phylogenetically 'lower' termite taxa); the wood-feeding roach family Cryptocercidae (the sister taxon to termites); and the omnivorous roach family Blattidae. Sec and Cys FDH(H) variants were identified in every wood-feeding insect but not the omnivorous roach. Of 68 novel alleles obtained from inventories, 66 affiliated phylogenetically with enzymes from T. primitia. These formed two subclades (37 and 29 phylotypes) almost completely comprised of Sec-containing and Cys-containing enzymes respectively. A gut cDNA inventory showed transcription of both variants in the termite Zootermopsis nevadensis (family Termopsidae). The gene patterns suggest that FDH(H) enzymes are important for the CO(2)-reductive metabolism of uncultured acetogenic treponemes and imply that the availability of selenium, a trace element, shaped microbial gene content in the last common ancestor of dictyopteran, wood-feeding insects, and continues to shape it to this day.

  7. Immediate Early Genes Anchor a Biological Pathway of Proteins Required for Memory Formation, Long-Term Depression and Risk for Schizophrenia

    Science.gov (United States)

    Marballi, Ketan K.; Gallitano, Amelia L.

    2018-01-01

    While the causes of myriad medical and infectious illnesses have been identified, the etiologies of neuropsychiatric illnesses remain elusive. This is due to two major obstacles. First, the risk for neuropsychiatric disorders, such as schizophrenia, is determined by both genetic and environmental factors. Second, numerous genes influence susceptibility for these illnesses. Genome-wide association studies have identified at least 108 genomic loci for schizophrenia, and more are expected to be published shortly. In addition, numerous biological processes contribute to the neuropathology underlying schizophrenia. These include immune dysfunction, synaptic and myelination deficits, vascular abnormalities, growth factor disruption, and N-methyl-D-aspartate receptor (NMDAR) hypofunction. However, the field of psychiatric genetics lacks a unifying model to explain how environment may interact with numerous genes to influence these various biological processes and cause schizophrenia. Here we describe a biological cascade of proteins that are activated in response to environmental stimuli such as stress, a schizophrenia risk factor. The central proteins in this pathway are critical mediators of memory formation and a particular form of hippocampal synaptic plasticity, long-term depression (LTD). Each of these proteins is also implicated in schizophrenia risk. In fact, the pathway includes four genes that map to the 108 loci associated with schizophrenia: GRIN2A, nuclear factor of activated T-cells (NFATc3), early growth response 1 (EGR1) and NGFI-A Binding Protein 2 (NAB2); each of which contains the “Index single nucleotide polymorphism (SNP)” (most SNP) at its respective locus. Environmental stimuli activate this biological pathway in neurons, resulting in induction of EGR immediate early genes: EGR1, EGR3 and NAB2. We hypothesize that dysfunction in any of the genes in this pathway disrupts the normal activation of Egrs in response to stress. This may result in

  8. Immediate Early Genes Anchor a Biological Pathway of Proteins Required for Memory Formation, Long-Term Depression and Risk for Schizophrenia

    Directory of Open Access Journals (Sweden)

    Ketan K. Marballi

    2018-02-01

    Full Text Available While the causes of myriad medical and infectious illnesses have been identified, the etiologies of neuropsychiatric illnesses remain elusive. This is due to two major obstacles. First, the risk for neuropsychiatric disorders, such as schizophrenia, is determined by both genetic and environmental factors. Second, numerous genes influence susceptibility for these illnesses. Genome-wide association studies have identified at least 108 genomic loci for schizophrenia, and more are expected to be published shortly. In addition, numerous biological processes contribute to the neuropathology underlying schizophrenia. These include immune dysfunction, synaptic and myelination deficits, vascular abnormalities, growth factor disruption, and N-methyl-D-aspartate receptor (NMDAR hypofunction. However, the field of psychiatric genetics lacks a unifying model to explain how environment may interact with numerous genes to influence these various biological processes and cause schizophrenia. Here we describe a biological cascade of proteins that are activated in response to environmental stimuli such as stress, a schizophrenia risk factor. The central proteins in this pathway are critical mediators of memory formation and a particular form of hippocampal synaptic plasticity, long-term depression (LTD. Each of these proteins is also implicated in schizophrenia risk. In fact, the pathway includes four genes that map to the 108 loci associated with schizophrenia: GRIN2A, nuclear factor of activated T-cells (NFATc3, early growth response 1 (EGR1 and NGFI-A Binding Protein 2 (NAB2; each of which contains the “Index single nucleotide polymorphism (SNP” (most SNP at its respective locus. Environmental stimuli activate this biological pathway in neurons, resulting in induction of EGR immediate early genes: EGR1, EGR3 and NAB2. We hypothesize that dysfunction in any of the genes in this pathway disrupts the normal activation of Egrs in response to stress. This may

  9. EBNA2 Drives Formation of New Chromosome Binding Sites and Target Genes for B-Cell Master Regulatory Transcription Factors RBP-jκ and EBF1.

    Science.gov (United States)

    Lu, Fang; Chen, Horng-Shen; Kossenkov, Andrew V; DeWispeleare, Karen; Won, Kyoung-Jae; Lieberman, Paul M

    2016-01-01

    Epstein-Barr Virus (EBV) transforms resting B-lymphocytes into proliferating lymphoblasts to establish latent infections that can give rise to malignancies. We show here that EBV-encoded transcriptional regulator EBNA2 drives the cooperative and combinatorial genome-wide binding of two master regulators of B-cell fate, namely EBF1 and RBP-jκ. Previous studies suggest that these B-cell factors are statically bound to target gene promoters. In contrast, we found that EBNA2 induces the formation of new binding for both RBP-jκ and EBF1, many of which are in close physical proximity in the cellular and viral genome. These newly induced binding sites co-occupied by EBNA2-EBF1-RBP-jκ correlate strongly with transcriptional activation of linked genes that are important for B-lymphoblast function. Conditional expression or repression of EBNA2 leads to a rapid alteration in RBP-jκ and EBF1 binding. Biochemical and shRNA depletion studies provide evidence for cooperative assembly at co-occupied sites. These findings reveal that EBNA2 facilitate combinatorial interactions to induce new patterns of transcription factor occupancy and gene programming necessary to drive B-lymphoblast growth and survival.

  10. EBNA2 Drives Formation of New Chromosome Binding Sites and Target Genes for B-Cell Master Regulatory Transcription Factors RBP-jκ and EBF1.

    Directory of Open Access Journals (Sweden)

    Fang Lu

    2016-01-01

    Full Text Available Epstein-Barr Virus (EBV transforms resting B-lymphocytes into proliferating lymphoblasts to establish latent infections that can give rise to malignancies. We show here that EBV-encoded transcriptional regulator EBNA2 drives the cooperative and combinatorial genome-wide binding of two master regulators of B-cell fate, namely EBF1 and RBP-jκ. Previous studies suggest that these B-cell factors are statically bound to target gene promoters. In contrast, we found that EBNA2 induces the formation of new binding for both RBP-jκ and EBF1, many of which are in close physical proximity in the cellular and viral genome. These newly induced binding sites co-occupied by EBNA2-EBF1-RBP-jκ correlate strongly with transcriptional activation of linked genes that are important for B-lymphoblast function. Conditional expression or repression of EBNA2 leads to a rapid alteration in RBP-jκ and EBF1 binding. Biochemical and shRNA depletion studies provide evidence for cooperative assembly at co-occupied sites. These findings reveal that EBNA2 facilitate combinatorial interactions to induce new patterns of transcription factor occupancy and gene programming necessary to drive B-lymphoblast growth and survival.

  11. Gene targeting implicates Cdc42 GTPase in GPVI and non-GPVI mediated platelet filopodia formation, secretion and aggregation.

    Directory of Open Access Journals (Sweden)

    Huzoor Akbar

    Full Text Available Cdc42 and Rac1, members of the Rho family of small GTPases, play critical roles in actin cytoskeleton regulation. We have shown previously that Rac1 is involved in regulation of platelet secretion and aggregation. However, the role of Cdc42 in platelet activation remains controversial. This study was undertaken to better understand the role of Cdc42 in platelet activation.We utilized the Mx-cre;Cdc42(lox/lox inducible mice with transient Cdc42 deletion to investigate the involvement of Cdc42 in platelet function. The Cdc42-deficient mice exhibited a significantly reduced platelet count than the matching Cdc42(+/+ mice. Platelets isolated from Cdc42(-/-, as compared to Cdc42(+/+, mice exhibited (a diminished phosphorylation of PAK1/2, an effector molecule of Cdc42, (b inhibition of filopodia formation on immobilized CRP or fibrinogen, (c inhibition of CRP- or thrombin-induced secretion of ATP and release of P-selectin, (d inhibition of CRP, collagen or thrombin induced platelet aggregation, and (e minimal phosphorylation of Akt upon stimulation with CRP or thrombin. The bleeding times were significantly prolonged in Cdc42(-/- mice compared with Cdc42(+/+ mice.Our data demonstrate that Cdc42 is required for platelet filopodia formation, secretion and aggregation and therefore plays a critical role in platelet mediated hemostasis and thrombosis.

  12. Comprehensive genome-wide analysis of the Aux/IAA gene family in Eucalyptus: evidence for the role of EgrIAA4 in wood formation.

    Science.gov (United States)

    Yu, Hong; Soler, Marçal; San Clemente, Hélène; Mila, Isabelle; Paiva, Jorge A P; Myburg, Alexander A; Bouzayen, Mondher; Grima-Pettenati, Jacqueline; Cassan-Wang, Hua

    2015-04-01

    Auxin plays a pivotal role in various plant growth and development processes, including vascular differentiation. The modulation of auxin responsiveness through the auxin perception and signaling machinery is believed to be a major regulatory mechanism controlling cambium activity and wood formation. To gain more insights into the roles of key Aux/IAA gene regulators of the auxin response in these processes, we identified and characterized members of the Aux/IAA family in the genome of Eucalyptus grandis, a tree of worldwide economic importance. We found that the gene family in Eucalyptus is slightly smaller than that in Populus and Arabidopsis, but all phylogenetic groups are represented. High-throughput expression profiling of different organs and tissues highlighted several Aux/IAA genes expressed in vascular cambium and/or developing xylem, some showing differential expression in response to developmental (juvenile vs. mature) and/or to environmental (tension stress) cues. Based on the expression profiles, we selected a promising candidate gene, EgrIAA4, for functional characterization. We showed that EgrIAA4 protein is localized in the nucleus and functions as an auxin-responsive repressor. Overexpressing a stabilized version of EgrIAA4 in Arabidopsis dramatically impeded plant growth and fertility and induced auxin-insensitive phenotypes such as inhibition of primary root elongation, lateral root emergence and agravitropism. Interestingly, the lignified secondary walls of the interfascicular fibers appeared very late, whereas those of the xylary fibers were virtually undetectable, suggesting that EgrIAA4 may play crucial roles in fiber development and secondary cell wall deposition. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  13. The gene for a lectin-like protein is transcriptionally activated during sexual development, but is not essential for fruiting body formation in the filamentous fungus Sordaria macrospora

    Directory of Open Access Journals (Sweden)

    Cebula Patricia

    2005-11-01

    Full Text Available Abstract Background The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies called perithecia that protect the developing ascospores and ensure their proper discharge. In previous microarray analyses, several genes have been identified that are downregulated in sterile mutants compared to the wild type. Among these genes was tap1 (transcript associated with perithecial development, a gene encoding a putative lectin homolog. Results Analysis of tap1 transcript levels in the wild type under conditions allowing only vegetative growth compared to conditions that lead to fruiting body development showed that tap1 is not only downregulated in developmental mutants but is also upregulated in the wild type during fruiting body development. We have cloned and sequenced a 3.2 kb fragment of genomic DNA containing the tap1 open reading frame and adjoining sequences. The genomic region comprising tap1 is syntenic to its homologous region in the closely related filamentous fungus Neurospora crassa. To determine whether tap1 is involved in fruiting body development in S. macrospora, a knockout construct was generated in which the tap1 open reading frame was replaced by the hygromycin B resistance gene hph under the control of fungal regulatory regions. Transformation of the S. macrospora wild type with this construct resulted in a tap1 deletion strain where tap1 had been replaced by the hph cassette. The knockout strain displayed no phenotypic differences under conditions of vegetative growth and sexual development when compared to the wild type. Double mutants carrying the Δtap1 allele in several developmental mutant backgrounds were phenotypically similar to the corresponding developmental mutant strains. Conclusion The tap1 transcript is strongly upregulated during sexual development in S. macrospora; however, analysis of a tap1 knockout strain shows that tap1 is not essential for fruiting body formation in S. macrospora.

  14. Low-magnitude high-frequency vibration enhances gene expression related to callus formation, mineralization and remodeling during osteoporotic fracture healing in rats.

    Science.gov (United States)

    Chung, Shu-Lu; Leung, Kwok-Sui; Cheung, Wing-Hoi

    2014-12-01

    Low magnitude high frequency vibration (LMHFV) has been shown to improve anabolic and osteogenic responses in osteoporotic intact bones and during osteoporotic fracture healing; however, the molecular response of LMHFV during osteoporotic fracture healing has not been investigated. It was hypothesized that LMHFV could enhance osteoporotic fracture healing by regulating the expression of genes related to chondrogenesis (Col-2), osteogenesis (Col-1) and remodeling (receptor activator for nuclear factor- κ B ligand (RANKL) and osteoproteger (OPG)). In this study, the effects of LMHFV on both osteoporotic and normal bone fracture healing were assessed by endpoint gene expressions, weekly radiographs, and histomorphometry at weeks 2, 4 and 8 post-treatment. LMHFV enhanced osteoporotic fracture healing by up-regulating the expression of chondrogenesis-, osteogenesis- and remodeling-related genes (Col-2 at week 4 (p=0.008), Col-1 at week 2 and 8 (p<0.001 and p=0.008) and RANKL/OPG at week 8 (p=0.045)). Osteoporotic bone had a higher response to LMHFV than normal bone and showed significantly better results as reflected by increased expression of Col-2 and Col-1 at week 2 (p<0.001 for all), larger callus width at week 2 (p=0.001), callus area at week 1 and 5(p<0.05 for all) and greater relative area of osseous tissue (p=0.002) at week 8. This study helps to understand how LMHFV regulates gene expression of callus formation, mineralization and remodeling during osteoporotic fracture healing. © 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  15. The Biosynthesis of Capuramycin-type Antibiotics: IDENTIFICATION OF THE A-102395 BIOSYNTHETIC GENE CLUSTER, MECHANISM OF SELF-RESISTANCE, AND FORMATION OF URIDINE-5'-CARBOXAMIDE.

    Science.gov (United States)

    Cai, Wenlong; Goswami, Anwesha; Yang, Zhaoyong; Liu, Xiaodong; Green, Keith D; Barnard-Britson, Sandra; Baba, Satoshi; Funabashi, Masanori; Nonaka, Koichi; Sunkara, Manjula; Morris, Andrew J; Spork, Anatol P; Ducho, Christian; Garneau-Tsodikova, Sylvie; Thorson, Jon S; Van Lanen, Steven G

    2015-05-29

    A-500359s, A-503083s, and A-102395 are capuramycin-type nucleoside antibiotics that were discovered using a screen to identify inhibitors of bacterial translocase I, an essential enzyme in peptidoglycan cell wall biosynthesis. Like the parent capuramycin, A-500359s and A-503083s consist of three structural components: a uridine-5'-carboxamide (CarU), a rare unsaturated hexuronic acid, and an aminocaprolactam, the last of which is substituted by an unusual arylamine-containing polyamide in A-102395. The biosynthetic gene clusters for A-500359s and A-503083s have been reported, and two genes encoding a putative non-heme Fe(II)-dependent α-ketoglutarate:UMP dioxygenase and an l-Thr:uridine-5'-aldehyde transaldolase were uncovered, suggesting that C-C bond formation during assembly of the high carbon (C6) sugar backbone of CarU proceeds from the precursors UMP and l-Thr to form 5'-C-glycyluridine (C7) as a biosynthetic intermediate. Here, isotopic enrichment studies with the producer of A-503083s were used to indeed establish l-Thr as the direct source of the carboxamide of CarU. With this knowledge, the A-102395 gene cluster was subsequently cloned and characterized. A genetic system in the A-102395-producing strain was developed, permitting the inactivation of several genes, including those encoding the dioxygenase (cpr19) and transaldolase (cpr25), which abolished the production of A-102395, thus confirming their role in biosynthesis. Heterologous production of recombinant Cpr19 and CapK, the transaldolase homolog involved in A-503083 biosynthesis, confirmed their expected function. Finally, a phosphotransferase (Cpr17) conferring self-resistance was functionally characterized. The results provide the opportunity to use comparative genomics along with in vivo and in vitro approaches to probe the biosynthetic mechanism of these intriguing structures. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Association study of genes related to bone formation and resorption and the extent of radiographic change in ankylosing spondylitis.

    Science.gov (United States)

    Cortes, A; Maksymowych, W P; Wordsworth, B P; Inman, R D; Danoy, P; Rahman, P; Stone, M A; Corr, M; Gensler, Lianne S; Gladman, D; Morgan, A; Marzo-Ortega, H; Ward, M M; Learch, T J; Reveille, J D; Brown, M A; Weisman, M H

    2015-07-01

    To identify genetic associations with severity of radiographic damage in ankylosing spondylitis (AS). We studied 1537 AS cases of European descent; all fulfilled the modified New York Criteria. Radiographic severity was assessed from digitised lateral radiographs of the cervical and lumbar spine using the modified Stoke Ankylosing Spondylitis Spinal Score (mSASSS). A two-phase genotyping design was used. In phase 1, 498 single nucleotide polymorphisms (SNPs) were genotyped in 688 cases; these were selected to capture >90% of the common haplotypic variation in the exons, exon-intron boundaries, and 5 kb flanking DNA in the 5' and 3' UTR of 74 genes involved in anabolic or catabolic bone pathways. In phase 2, 15 SNPs exhibiting ppathways in the osteoproliferative changes in AS. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  17. Meiotic gene conversion mutants in Saccharomyces cerevisiae. I. Isolation and characterization of PMS1-1 and PMS1-2

    International Nuclear Information System (INIS)

    Williamson, M.S.; Game, J.C.; Fogel, S.

    1985-01-01

    The PMS1 mutants, isolated on the basis of sharply elevated meiotic prototroph frequencies for two closely linked HIS4 alleles, display pleiotropic phenotypes in meiotic and mitotic cells. Two isolates carrying recessive mutations in PMS1 were characterized. They identify a function required to maintain low postmeiotic segregation (PMS) frequencies at many heterozygous sites. In addition, they are mitotic mutators. In mutant diploids, spore viability is reduced, and among survivors, gene conversion and postmeiotic segregation frequencies are increased, but reciprocal exchange frequencies are not affected. The conversion event pattern is also dramatically changed in multiply marked regions in PMS1 homozygotes. The PMS1 locus maps near MET4 on chromosome XIV. The PMS1 gene may identify an excision-resynthesis long patch mismatch correction function or a function that facilitates correction tract elongation. The PMS1 gene product may also play an important role in spontaneous mitotic mutation avoidance and correction of mismatches in heteroduplex DNA formed during spontaneous and UV-induced mitotic recombination. Based on meiotic recombination models emphasizing mismatch correction in heteroduplex DNA intermediates, this interpretation is favored, but alternative interpretations involving longer recombination intermediates in the mutants are also considered

  18. Nutrient depletion as a key factor for manipulating gene expression and product formation in different branches of the flavonoid pathway.

    Science.gov (United States)

    Lillo, Cathrine; Lea, Unni S; Ruoff, Peter

    2008-05-01

    The content of flavonoids increases in response to nitrogen and phosphorus depletion in plants. Manipulation of these macronutrients may therefore be used to control the levels of desirable compounds and improve plant quality. Key enzymes in the shikimate pathway, which feeds precursors into the flavonoid pathway, are regulated post-translationally by feedback from aromatic amino acids, and possibly by redox control through photosynthesis. Use of microarrays for global transcript analysis in Arabidopsis has revealed that transcript levels are less influenced by mineral nutrients in the shikimate pathway compared with the flavonoid pathway. The responses in the shikimate pathway appear complex, whereas in the flavonoid pathway, a single gene often responds similarly to mineral depletion, high light intensity and sucrose. MYB [production of anthocyanin pigment 1 (PAP1)/production of anthocyanin pigment 2 (PAP2)] and bHLH [GLABRA3 (GL3)] transcription factors are important for the nutrient depletion response. PAP1/2 stimulate gross activation of the flavonoid pathway, and different investigations support merging signal transduction chains for various abiotic treatments on PAP1/2. Flavonol synthase is not part of the PAP1/2 regulon, and expression is mainly enhanced by high light intensity and sucrose, not mineral depletion. Nevertheless, both cyanidin and flavonol derivatives increase in response to nitrogen depletion. Kaempferols are the dominating flavonols in Arabidopsis leaves under normal cultivation conditions, but quercetin accumulation can be triggered by nitrogen depletion in combination with other abiotic factors.

  19. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

    Science.gov (United States)

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

    1998-01-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  20. Interactions between BMP-7 and USAG-1 (uterine sensitization-associated gene-1 regulate supernumerary organ formations.

    Directory of Open Access Journals (Sweden)

    Honoka Kiso

    Full Text Available Bone morphogenetic proteins (BMPs are highly conserved signaling molecules that are part of the transforming growth factor (TGF-beta superfamily, and function in the patterning and morphogenesis of many organs including development of the dentition. The functions of the BMPs are controlled by certain classes of molecules that are recognized as BMP antagonists that inhibit BMP binding to their cognate receptors. In this study we tested the hypothesis that USAG-1 (uterine sensitization-associated gene-1 suppresses deciduous incisors by inhibition of BMP-7 function. We learned that USAG-1 and BMP-7 were expressed within odontogenic epithelium as well as mesenchyme during the late bud and early cap stages of tooth development. USAG-1 is a BMP antagonist, and also modulates Wnt signaling. USAG-1 abrogation rescued apoptotic elimination of odontogenic mesenchymal cells. BMP signaling in the rudimentary maxillary incisor, assessed by expressions of Msx1 and Dlx2 and the phosphorylation of Smad protein, was significantly enhanced. Using explant culture and subsequent subrenal capsule transplantation of E15 USAG-1 mutant maxillary incisor tooth primordia supplemented with BMP-7 demonstrated in USAG-1+/- as well as USAG-1-/- rescue and supernumerary tooth development. Based upon these results, we conclude that USAG-1 functions as an antagonist of BMP-7 in this model system. These results further suggest that the phenotypes of USAG-1 and BMP-7 mutant mice reported provide opportunities for regenerative medicine and dentistry.

  1. Formation of Highly Twisted Ribbons in a Carboxymethylcellulase Gene-Disrupted Strain of a Cellulose-Producing Bacterium

    Science.gov (United States)

    Sugano, Yasushi; Shoda, Makoto; Sakakibara, Hitoshi; Oiwa, Kazuhiro; Tuzi, Satoru; Imai, Tomoya; Sugiyama, Junji; Takeuchi, Miyuki; Yamauchi, Daisuke

    2013-01-01

    Cellulases are enzymes that normally digest cellulose; however, some are known to play essential roles in cellulose biosynthesis. Although some endogenous cellulases of plants and cellulose-producing bacteria are reportedly involved in cellulose production, their functions in cellulose production are unknown. In this study, we demonstrated that disruption of the cellulase (carboxymethylcellulase) gene causes irregular packing of de novo-synthesized fibrils in Gluconacetobacter xylinus, a cellulose-producing bacterium. Cellulose production was remarkably reduced and small amounts of particulate material were accumulated in the culture of a cmcax-disrupted G. xylinus strain (F2-2). The particulate material was shown to contain cellulose by both solid-state 13C nuclear magnetic resonance analysis and Fourier transform infrared spectroscopy analysis. Electron microscopy revealed that the cellulose fibrils produced by the F2-2 cells were highly twisted compared with those produced by control cells. This hypertwisting of the fibrils may reduce cellulose synthesis in the F2-2 strains. PMID:23243308

  2. Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children.

    Science.gov (United States)

    Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał

    2017-09-01

    It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p caries occurrence in Polish children.

  3. Efficiently engineered cell sheet using a complex of polyethylenimine–alginate nanocomposites plus bone morphogenetic protein 2 gene to promote new bone formation

    Directory of Open Access Journals (Sweden)

    Jin H

    2014-05-01

    Full Text Available Han Jin,1 Kai Zhang,2 Chunyan Qiao,1 Anliang Yuan,1 Daowei Li,1 Liang Zhao,1 Ce Shi,1 Xiaowei Xu,1 Shilei Ni,1 Changyu Zheng,3 Xiaohua Liu,4 Bai Yang,2 Hongchen Sun11Department of Pathology, School of Stomatology, Jilin University, Changchun, People’s Republic of China; 2State Key Laboratory of Supramolecular Structure and Materials, College of Chemistry, Jilin University, Changchun, People’s Republic of China; 3Molecular Physiology and Therapeutics Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD, USA; 4Department of Biomedical Sciences, Texas A&M University Baylor College of Dentistry, Dallas, TX, USAAbstract: Regeneration of large bone defects is a common clinical problem. Recently, stem cell sheet has been an emerging strategy in bone tissue engineering. To enhance the osteogenic potential of stem cell sheet, we fabricated bone morphogenetic protein 2 (BMP-2 gene-engineered cell sheet using a complex of polyethylenimine–alginate (PEI–al nanocomposites plus human BMP-2 complementary(cDNA plasmid, and studied its osteogenesis in vitro and in vivo. PEI–al nanocomposites carrying BMP-2 gene could efficiently transfect bone marrow mesenchymal stem cells. The cell sheet was made by culturing the cells in medium containing vitamin C for 10 days. Assays on the cell culture showed that the genetically engineered cells released the BMP-2 for at least 14 days. The expression of osteogenesis-related gene was increased, which demonstrated that released BMP-2 could effectively induce the cell sheet osteogenic differentiation in vitro. To further test the osteogenic potential of the cell sheet in vivo, enhanced green fluorescent protein or BMP-2-producing cell sheets were treated on the cranial bone defects. The results indicated that the BMP-2-producing cell sheet group was more efficient than other groups in promoting bone formation in the defect area. Our results suggested that PEI

  4. Identification of genes influencing formation of the Type III Brush Hair in Yangtze River Delta white goats by differential display of mRNA.

    Science.gov (United States)

    Li, Yongjun; Li, Wenting; Zhang, Jiahui; Ji, Dejun; Zhang, Guangjing; Yang, Bo

    2013-09-10

    Yangtze River Delta white goat is an exclusive indigenous Chinese goat breeds that can produce Brush Hair specialized in making valuable writing brush. The high-grade (Type III) Brush Hair is conical coarse hair but with a tip, which only grows in the cervical carina and back regions of Yangtze River Delta white goats. Screening of genes influencing the formation of Type III Brush Hair was conducted using differential display of mRNA technique in skin including the hair follicles of different goat groups and the differential bands were identified using reverse Northern dot blot, and the positive bands were subsequently cloned and sequenced. The results showed that 20 differentially displayed bands were obtained, seven of which were identified positive as expressed in skin. Three of these seven cDNAs were homologous to certain sequences from GenBank and the other four were respectively homologous to CKLF-like MARVEL transmembrane domain containing 3 (CMTM3), S100 calcium binding protein A4 (S100A4), protein kinase inhibitor gamma (PKIG) and fibulin 1-D. The study would provide a new view to elucidate their roles in hair growth and hair follicle cycle and increase our understanding of the formation of Type III Brush Hair. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. One gene, two proteins: coordinated production of a copper chaperone by differential transcript formation and translational frameshifting in Escherichia coli.

    Science.gov (United States)

    Drees, Steffen L; Klinkert, Birgit; Helling, Stefan; Beyer, Dominik F; Marcus, Katrin; Narberhaus, Franz; Lübben, Mathias

    2017-11-01

    Programmed ribosomal frameshifting (PRF) is a translational anomaly causing the ribosome to shift into an alternative reading frame. PRFs are common in viral genomes, using a single nucleotide sequence to code for two proteins in overlapping frames. In bacteria and eukaryota, PRFs are less frequent. We report on a PRF in the copper detoxification system of Escherichia coli where a metallochaperone is generated out of the first 69 amino acids and a C-terminal out-of-frame glycine of the gene copA. copA besides codes for the P 1B -ATPase CopA, a membrane-integral protein and principal interaction target of the chaperone. To enhance the production of the frameshift-generated cytosolic copper binding protein a truncated transcript is produced from the monocistronic copA gene. This shorter transcript is essential for producing sufficient amounts of the chaperone to support the membrane pump. The findings close the gap in our understanding of the molecular physiology of cytoplasmic copper transport in E. coli, revealing that a chaperone-like entity is required for full functionality of the P 1B -ATPase copper pump. We, moreover, demonstrate that the primary transcriptional response to copper results in formation of the small transcript and concurrently, the metallochaperone plays a key role in resistance against copper shock. © 2017 John Wiley & Sons Ltd.

  6. Analysis of the formation of flower shapes in wild species and cultivars of tree peony using the MADS-box subfamily gene.

    Science.gov (United States)

    Shu, Qingyan; Wang, Liangsheng; Wu, Jie; Du, Hui; Liu, Zheng'an; Ren, Hongxu; Zhang, Jingjing

    2012-02-01

    Tree peony (Paeonia suffricotisa) cultivars have a unique character compared with wild species; the stamen petalody results in increased whorls of petals and generates different flower forms, which are one of the most important traits for cultivar classification. In order to investigate how petaloid stamens are formed, we obtained the coding sequence (666 bp) and genomic DNA sequence of the PsTM6 genes (belongs to B subfamily of MADS-box gene family) from 23 tree peony samples, Five introns and six exons consisted of the genomic DNA sequence. The analysis of cis-acting regulatory elements in the third and fourth intron indicated that they were highly conserved in all samples. Partial putative amino acids were analyzed and the results suggested that functional differentiation of PsTM6 paralogs apparently affected stamen petalody and flower shape formation due to due to amino acid substitution caused by differences in polarity and electronic charge. Sliding window analysis indicated that the different regions of PsTM6 were subjected to different selection forces, especially in the K domain. This is the first attempt to investigate genetic control of the stamen petalody based on the PsTM6 sequence. This will provide a basis for understanding the evolution of PsTM6 and its the function of in determining stamen morphology of tree peony. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  7. Multi-Stepped Optogenetics: A Novel Strategy to Analyze Neural Network Formation and Animal Behaviors by Photo-Regulation of Local Gene Expression, Fluorescent Color and Neural Excitation

    Science.gov (United States)

    Hatta, Kohei; Nakajima, Yohei; Isoda, Erika; Itoh, Mariko; Yamamoto, Tamami

    The brain is one of the most complicated structures in nature. Zebrafish is a useful model to study development of vertebrate brain, because it is transparent at early embryonic stage and it develops rapidly outside of the body. We made a series of transgenic zebrafish expressing green-fluorescent protein related molecules, for example, Kaede and KikGR, whose green fluorescence can be irreversibly converted to red upon irradiation with ultra-violet (UV) or violet light, and Dronpa, whose green fluorescence is eliminated with strong blue light but can be reactivated upon irradiation with UV or violet-light. We have recently shown that infrared laser evoked gene operator (IR-LEGO) which causes a focused heat shock could locally induce these fluorescent proteins and the other genes. Neural cell migration and axonal pattern formation in living brain could be visualized by this technique. We also can express channel rhodopsine 2 (ChR2), a photoactivatable cation channel, or Natronomonas pharaonis halorhodopsin (NpHR), a photoactivatable chloride ion pump, locally in the nervous system by IR. Then, behaviors of these animals can be controlled by activating or silencing the local neurons by light. This novel strategy is useful in discovering neurons and circuits responsible for a wide variety of animal behaviors. We proposed to call this method ‘multi-stepped optogenetics’.

  8. Portulaca oleracea extract can inhibit nodule formation of colon cancer stem cells by regulating gene expression of the Notch signal transduction pathway.

    Science.gov (United States)

    Jin, Heiying; Chen, Li; Wang, Shuiming; Chao, Deng

    2017-07-01

    To investigate whether Portulaca oleracea extract affects tumor formation in colon cancer stem cells and its chemotherapy sensitivity. In addition, to analyze associated genetic changes within the Notch signal transduction pathway. Serum-free cultures of colon cancer cells (HT-29) and HT-29 cancer stem cells were treated with the chemotherapeutic drug 5-fluorouracil to assess sensitivity. Injections of the stem cells were also given to BALB/c mice to confirm tumor growth and note its characteristics. In addition, the effect of different concentrations of P. oleracea extract was tested on the growth of HT-29 colon cancer cells and HT-29 cancer stem cells, as determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide method. The effects of P. oleracea extract on the expression of β-catenin, Notch1, and Notch2 in the HT-29 cells were studied using reverse transcription polymerase chain reaction and Western blotting. The tumor volume of the HT29 cells was two times larger than that of HT29 cancer stem cells. Treatment with P. oleracea extract inhibited the proliferation of both HT-29 cancer cells and HT-29 cancer stem cells at doses from 0.07 to 2.25 µg/mL. Apoptosis of HT-29 cancer cells and HT-29 cancer stem cells was assessed by flow cytometry; it was enhanced by the addition of P. oleracea extract. Finally, treatment with P. oleracea extract significantly downregulated the expression of the Notch1 and β-catenin genes in both cell types. The results of this study show that P. oleracea extract inhibits the growth of colon cancer stem cells in a dose-dependent manner. Furthermore, it inhibits the expression of the Notch1 and β-catenin genes. Taken together, this suggests that it may elicit its effects through regulatory and target genes that mediate the Notch signal transduction pathway.

  9. Formation of multinucleated giant cells and microglial degeneration in rats expressing a mutant Cu/Zn superoxide dismutase gene

    Directory of Open Access Journals (Sweden)

    Streit Wolfgang J

    2007-02-01

    Full Text Available Abstract Background Microglial neuroinflammation is thought to play a role in the pathogenesis of amyotrophic lateral sclerosis (ALS. The purpose of this study was to provide a histopathological evaluation of the microglial neuroinflammatory response in a rodent model of ALS, the SOD1G93A transgenic rat. Methods Multiple levels of the CNS from spinal cord to cerebral cortex were studied in SOD1G93A transgenic rats during three stages of natural disease progression, including presymptomatic, early symptomatic (onset, and late symptomatic (end stage, using immuno- and lectin histochemical markers for microglia, such as OX-42, OX-6, and Griffonia simplicifolia isolectin B4. Results Our studies revealed abnormal aggregates of microglia forming in the spinal cord as early as the presymptomatic stage. During the symptomatic stages there was prominent formation of multinucleated giant cells through fusion of microglial cells in the spinal cord, brainstem, and red nucleus of the midbrain. Other brain regions, including substantia nigra, cranial nerve nuclei, hippocampus and cortex showed normal appearing microglia. In animals during end stage disease at 4–5 months of age virtually all microglia in the spinal cord gray matter showed extensive fragmentation of their cytoplasm (cytorrhexis, indicative of widespread microglial degeneration. Few microglia exhibiting nuclear fragmentation (karyorrhexis indicative of apoptosis were identified at any stage. Conclusion The current findings demonstrate the occurrence of severe abnormalities in microglia, such as cell fusions and cytorrhexis, which may be the result of expression of mutant SOD1 in these cells. The microglial changes observed are different from those that accompany normal microglial activation, and they demonstrate that aberrant activation and degeneration of microglia is part of the pathogenesis of motor neuron disease.

  10. Osteogenesis Imperfecta due to Mutations in Non-Collagenous Genes-Lessons in the Biology of Bone Formation

    Science.gov (United States)

    Marini, Joan C.; Reich, Adi; Smith, Simone M.

    2014-01-01

    Purpose of Review Osteogenesis imperfecta (OI), or “brittle bone disease”, has mainly been considered a bone disorder caused by collagen mutations. Within the last decade, however, a surge of genetic discoveries has created a new paradigm for OI as a collagen-related disorder, where autosomal dominant type I collagen defects cause most cases, while rare, mostly recessive forms are due to defects in genes whose protein products interact with collagen protein. This review is both timely and relevant in outlining the genesis, development and future of this paradigm shift in the understanding of OI. Recent Findings BRIL and PEDF defects cause types V and VI OI via defective bone mineralization, while defects in CRTAP, P3H1 and CyPB cause types VII-IX via defective collagen post-translational modification. Hsp47 and FKBP65 defects cause types X and XI OI via aberrant collagen crosslinking, folding and chaperoning, while defects in SP7, WNT1, TRIC-B and OASIS disrupt osteoblast development. Finally, absence of the type I collagen C-propeptidase BMP1 causes type XII OI due to altered collagen maturation/processing. Summary Identification of these multiple causative defects has provided crucial information for accurate genetic counseling, inspired a recently proposed functional grouping of OI types by shared mechanism to simplify current nosology, and should prod investigations into common pathways in OI. Such investigations could yield critical information on cellular and bone tissue mechanisms and translate to new mechanistic insight into clinical therapies for patients. PMID:25007323

  11. Osteogenesis imperfecta due to mutations in non-collagenous genes: lessons in the biology of bone formation.

    Science.gov (United States)

    Marini, Joan C; Reich, Adi; Smith, Simone M

    2014-08-01

    Osteogenesis imperfecta or 'brittle bone disease' has mainly been considered a bone disorder caused by collagen mutations. Within the last decade, however, a surge of genetic discoveries has created a new paradigm for osteogenesis imperfecta as a collagen-related disorder, where most cases are due to autosomal dominant type I collagen defects, while rare, mostly recessive, forms are due to defects in genes whose protein products interact with collagen protein. This review is both timely and relevant in outlining the genesis, development, and future of this paradigm shift in the understanding of osteogenesis imperfecta. Bone-restricted interferon-induced transmembrane (IFITM)-like protein (BRIL) and pigment epithelium-derived factor (PEDF) defects cause types V and VI osteogenesis imperfecta via defective bone mineralization, while defects in cartilage-associated protein (CRTAP), prolyl 3-hydroxylase 1 (P3H1), and cyclophilin B (CYPB) cause types VII-IX osteogenesis imperfecta via defective collagen post-translational modification. Heat shock protein 47 (HSP47) and FK506-binding protein-65 (FKBP65) defects cause types X and XI osteogenesis imperfecta via aberrant collagen crosslinking, folding, and chaperoning, while defects in SP7 transcription factor, wingless-type MMTV integration site family member 1 (WNT1), trimeric intracellular cation channel type b (TRIC-B), and old astrocyte specifically induced substance (OASIS) disrupt osteoblast development. Finally, absence of the type I collagen C-propeptidase bone morphogenetic protein 1 (BMP1) causes type XII osteogenesis imperfecta due to altered collagen maturation/processing. Identification of these multiple causative defects has provided crucial information for accurate genetic counseling, inspired a recently proposed functional grouping of osteogenesis imperfecta types by shared mechanism to simplify current nosology, and has prodded investigations into common pathways in osteogenesis imperfecta. Such

  12. Mutational analysis of the myelin protein zero (MPZ) gene associated with Charcot-Marie-Tooth neuropathy type 1B

    Energy Technology Data Exchange (ETDEWEB)

    Roa, B.B.; Warner, L.E.; Lupski, J.R. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    The MPZ gene that maps to chromosome 1q22q23 encodes myelin protein zero, which is the most abundant peripheral nerve myelin protein that functions as a homophilic adhesion molecule in myelin compaction. Association of the MPZ gene with the dysmyelinating peripheral neuropathies Charcot-Marie-Tooth disease type 1B (CMT1B) and the more severe Dejerine-Sottas syndrome (DSS) was previously demonstrated by MPZ mutations identified in CMT1B and in rare DSS patients. In this study, the coding region of the MPZ gene was screened for mutations in a cohort of 74 unrelated patients with either CMT type 1 or DSS who do not carry the most common CMT1-associated molecular lesion of a 1.5 Mb DNA duplication on 17p11.2-p12. Heteroduplex analysis detected base mismatches in ten patients that were distributed over three exons of MPZ. Direct sequencing of PCR-amplified genomic DNA identified a de novo MPZ mutation associated with CMT1B that predicts an Ile(135)Thr substitution. This finding further confirms the role of MPZ in the CMT1B disease process. In addition, two polymorphisms were identified within the Gly(200) and Ser(228) codons that do not alter the respective amino acid residues. A fourth base mismatch in MPZ exon 3 detected by heteroduplex analysis is currently being characterized by direct sequence determination. Previously, four unrelated patients in this same cohort were found to have unique point mutations in the coding region of the PMP22 gene. The collective findings on CMT1 point mutations could suggest that regulatory region mutations, and possibly mutations in CMT gene(s) apart from the MPZ, PMP22 and Cx32 genes identified thus far, may prove to be significant for a number of CMT1 cases that do not involve DNA duplication.

  13. Disruption of rcsB by a duplicated sequence in a curli-producing Escherichia coli O157:H7 results in differential gene expression in relation to biofilm formation, stress responses and metabolism.

    Science.gov (United States)

    Sharma, V K; Bayles, D O; Alt, D P; Looft, T; Brunelle, B W; Stasko, J A

    2017-03-08

    Escherichia coli O157:H7 (O157) strain 86-24, linked to a 1986 disease outbreak, displays curli- and biofilm-negative phenotypes that are correlated with the lack of Congo red (CR) binding and formation of white colonies (CR - ) on a CR-containing medium. However, on a CR medium this strain produces red isolates (CR + ) capable of producing curli fimbriae and biofilms. To identify genes controlling differential expression of curli fimbriae and biofilm formation, the RNA-Seq profile of a CR + isolate was compared to the CR - parental isolate. Of the 242 genes expressed differentially in the CR + isolate, 201 genes encoded proteins of known functions while the remaining 41 encoded hypothetical proteins. Among the genes with known functions, 149 were down- and 52 were up-regulated. Some of the upregulated genes were linked to biofilm formation through biosynthesis of curli fimbriae and flagella. The genes encoding transcriptional regulators, such as CsgD, QseB, YkgK, YdeH, Bdm, CspD, BssR and FlhDC, which modulate biofilm formation, were significantly altered in their expression. Several genes of the envelope stress (cpxP), heat shock (rpoH, htpX, degP), oxidative stress (ahpC, katE), nutrient limitation stress (phoB-phoR and pst) response pathways, and amino acid metabolism were downregulated in the CR + isolate. Many genes mediating acid resistance and colanic acid biosynthesis, which influence biofilm formation directly or indirectly, were also down-regulated. Comparative genomics of CR + and CR - isolates revealed the presence of a short duplicated sequence in the rcsB gene of the CR + isolate. The alignment of the amino acid sequences of RcsB of the two isolates showed truncation of RcsB in the CR + isolate at the insertion site of the duplicated sequence. Complementation of CR + isolate with rcsB of the CR - parent restored parental phenotypes to the CR + isolate. The results of this study indicate that RcsB is a global regulator affecting bacterial survival in

  14. Effect of heparin and heparan sulphate on open promoter complex formation for a simple tandem gene model using ex situ atomic force microscopy.

    Science.gov (United States)

    Chammas, Oliver; Bonass, William A; Thomson, Neil H

    2017-05-01

    The influence of heparin and heparan sulphate (HepS) on the appearance and analysis of open promoter complex (RP o ) formation by E. coli RNA polymerase (RNAP) holoenzyme (σ 70 RNAP) on linear DNA using ex situ imaging by atomic force microscopy (AFM) has been investigated. Introducing heparin or HepS into the reaction mix significantly reduces non-specific interactions of the σ 70 RNAP and RNAP after RP o formation allowing for better interpretation of complexes shown within AFM images, particularly on DNA templates containing more than one promoter. Previous expectation was that negatively charged polysaccharides, often used as competitive inhibitors of σRNAP binding and RP o formation, would also inhibit binding of the DNA template to the mica support surface and thereby lower the imaging yield of active RNAP-DNA complexes. We found that the reverse of this was true, and that the yield of RP o formation detected by AFM, for a simple tandem gene model containing two λ PR promoters, increased. Moreover and unexpectedly, HepS was more efficient than heparin, with both of them having a dispersive effect on the sample, minimising unwanted RNAP-RNAP interactions as well as non-specific interactions between the RNAP and DNA template. The success of this method relied on the observation that E. coli RNAP has the highest affinity for the mica surface of all the molecular components. For our system, the affinity of the three constituent biopolymers to muscovite mica was RNAP>Heparin or HepS>DNA. While we observed that heparin and HepS can inhibit DNA binding to the mica, the presence of E. coli RNAP overcomes this effect allowing a greater yield of RP o s for AFM analysis. This method can be extended to other DNA binding proteins and enzymes, which have an affinity to mica higher than DNA, to improve sample preparation for AFM studies. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Prevalence, pathogenic capability, virulence genes, biofilm formation, and antibiotic resistance of Listeria in goat and sheep milk confirms need of hygienic milking conditions.

    Science.gov (United States)

    Osman, Kamelia M; Zolnikov, Tara Rava; Samir, Ahmed; Orabi, Ahmed

    2014-01-01

    Goat and sheep milk is consumed by human populations throughout the world; as a result, it has been proposed as an alternative, nutrient-rich milk to feed infants allergic to cow's milk. Unfortunately, potentially harmful bacteria have not been thoroughly tested in goat or sheep milk. Listeria monocytogenes is a harmful bacterium that causes adverse health effects if ingested by humans. The purpose of this study was to estimate the prevalence and characterize the phenotype, genotype, virulence factors, biofilm formation, and antibiopotential of Listeria isolated from the milk of goat and sheep. Udder milk samples were collected from 107 goats and 102 sheep and screened for mastitis using the California mastitis test (CMT). Samples were then examined for the presence of pathogenic Listeria spp; if detected, the isolation of pathogenic Listeria (L. monocytogenes and Listeria ivanovii) was completed using isolation and identification techniques recommended by the International Organization for Standards (ISO 11290-1, 1996), in addition to serological, in vitro and in vivo pathogenicity tests. The isolates were subjected to PCR assay for virulence associated genes (hlyA, plcA, actA, and iap). Pathogenic Listeria spp. were isolated from 5·6% of goat and 3·9% sheep milk samples, with 33·3 and 25% of these selected samples respectively containing L. monocytogenes. The results of this study provide evidence of the low-likelihood of contamination leading to the presence of L. monocytogenes in raw goat and sheep milk; however, this study also confirmed a strong in vitro ability for biofilm formation and pathogenic capability of L. monocytogenes if discovered in the milk. L. monocytogenes may be present in goat and sheep milk and in order to reduce the exposure, hygienic milking conditions must be employed for the milk to be considered a safe alternative for human consumption.

  16. Effects of gene-augmentation on the formation, characteristics and microbial community of 2,4-dichlorophenoxyacetic acid degrading aerobic microbial granules

    Energy Technology Data Exchange (ETDEWEB)

    Quan, Xiang-chun, E-mail: xchquan@yahoo.com.cn [Key Laboratory of Water and Sediment Sciences of Ministry of Education/State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Ma, Jing-yun; Xiong, Wei-cong; Yang, Zhi-feng [Key Laboratory of Water and Sediment Sciences of Ministry of Education/State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China)

    2011-11-30

    Highlights: Black-Right-Pointing-Pointer The first study to cultivate aerobic granules capable of utilizing 2,4-D as the sole carbon source. Black-Right-Pointing-Pointer Granules cultivated through gene-augmentation were first compared systematically with the control on granule formation, degradation kinetics, morphology, and microbial community. Black-Right-Pointing-Pointer The first report on the fate of transconjugats in the granules during long term operation after bioaugmentation. Black-Right-Pointing-Pointer The first study to isolate in dominant bacteria in 2,4-D degrading microbial granules. - Abstract: Development of 2,4-dichlorophenoxyacetic acid (2,4-D) degrading aerobic granular sludge was conducted in two sequencing batch reactors (SBR) with one bioaugmented with a plasmid pJP4 donor strain Pseudomonas putida SM1443 and the other as a control. Half-matured aerobic granules pre-grown on glucose were used as the starting seeds and a two-stage operation strategy was applied. Granules capable of utilizing 2,4-D (about 500 mg/L) as the sole carbon source was successfully cultivated in both reactors. Gene-augmentation resulted in the enhancement of 2,4-D degradation rates by the percentage of 65-135% for the granules on Day 18, and 6-24% for the granules on Day 105. Transconjugants receiving plasmid pJP4 were established in the granule microbial community after bioaugmentation and persisted till the end of operation. Compared with the control granules, the granules in the bioaugmented reactor demonstrated a better settling ability, larger size, more abundant microbial diversity and stronger tolerance to 2,4-D. The finally obtained granules in the bioaugmented and control reactor had a granule size of around 600 {mu}m and 500 {mu}m, a Shannon-Weaver diversity index (H) of 0.96 and 0.55, respectively. A shift in microbial community was found during the granulation process.

  17. The exopolysaccharide gene cluster Bcam1330-Bcam1341 is involved in Burkholderia cenocepacia biofilm formation, and its expression is regulated by c-di-GMP and Bcam1349

    DEFF Research Database (Denmark)

    Fazli, Mustafa; McCarthy, Yvonne; Givskov, Michael

    2013-01-01

    In Burkholderia cenocepacia, the second messenger cyclic diguanosine monophosphate (c-di-GMP) has previously been shown to positively regulate biofilm formation and the expression of cellulose and type-I fimbriae genes through binding to the transcriptional regulator Bcam1349. Here, we provide ev...

  18. Molecular cloning, phylogenetic analysis, and expression patterns of LATERAL SUPPRESSOR-LIKE and REGULATOR OF AXILLARY MERISTEM FORMATION-LIKE genes in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Fambrini, Marco; Salvini, Mariangela; Pugliesi, Claudio

    2017-03-01

    The wild sunflower (Helianthus annuus) plants develop a highly branched form with numerous small flowering heads. The origin of a no branched sunflower, producing a single large head, has been a key event in the domestication process of this species. The interaction between hormonal factors and several genes organizes the initiation and outgrowth of axillary meristems (AMs). From sunflower, we have isolated two genes putatively involved in this process, LATERAL SUPPRESSOR (LS)-LIKE (Ha-LSL) and REGULATOR OF AXILLARY MERISTEM FORMATION (ROX)-LIKE (Ha-ROXL), encoding for a GRAS and a bHLH transcription factor (TF), respectively. Typical amino acid residues and phylogenetic analyses suggest that Ha-LSL and Ha-ROXL are the orthologs of the branching regulator LS and ROX/LAX1, involved in the growth habit of both dicot and monocot species. qRT-PCR analyses revealed a high accumulation of Ha-LSL transcripts in roots, vegetative shoots, and inflorescence shoots. By contrast, in internodal stems and young leaves, a lower amount of Ha-LSL transcripts was observed. A comparison of transcription patterns between Ha-LSL and Ha-ROXL revealed some analogies but also remarkable differences; in fact, the gene Ha-ROXL displayed a low expression level in all organs analyzed. In situ hybridization (ISH) analysis showed that Ha-ROXL transcription was strongly restricted to a small domain within the boundary zone separating the shoot apical meristem (SAM) and the leaf primordia and in restricted regions of the inflorescence meristem, beforehand the separation of floral bracts from disc flower primordia. These results suggested that Ha-ROXL may be involved to establish a cell niche for the initiation of AMs as well as flower primordia. The accumulation of Ha-LSL transcripts was not restricted to the boundary zones in vegetative and inflorescence shoots, but the mRNA activity was expanded in other cellular domains of primary shoot apical meristem as well as AMs. In addition, Ha

  19. Influence of over-expression of the Flowering Promoting Factor 1 gene (FPF1) from Arabidopsis on wood formation in hybrid poplar (Populus tremula L. × P. tremuloides Michx.).

    Science.gov (United States)

    Hoenicka, Hans; Lautner, Silke; Klingberg, Andreas; Koch, Gerald; El-Sherif, Fadia; Lehnhardt, Denise; Zhang, Bo; Burgert, Ingo; Odermatt, Jürgen; Melzer, Siegbert; Fromm, Jörg; Fladung, Matthias

    2012-02-01

    Constitutive expression of the FPF1 gene in hybrid aspen (Populus tremula L. × P. tremuloides Michx.) showed a strong effect on wood formation but no effect on flowering time. Gene expression studies showed that activity of flowering time genes PtFT1, PtCO2, and PtFUL was not increased in FPF1 transgenic plants. However, the SOC1/TM3 class gene PTM5, which has been related to wood formation and flowering time, showed a strong activity in stems of all transgenic lines studied. Wood density was lower in transgenic plants, despite significantly reduced vessel frequency which was overcompensated by thinner fibre cell walls. Chemical screening of the wood by pyrolysis GC/MS showed that FPF1 transgenics have higher fractions of cellulose and glucomannan products as well as lower lignin content. The latter observation was confirmed by UV microspectrophotometry on a cellular level. Topochemical lignin distribution revealed a slower increase of lignin incorporation in the developing xylem of the transgenics when compared with the wild-type plants. In line with the reduced wood density, micromechanical wood properties such as stiffness and ultimate stress were also significantly reduced in all transgenic lines. Thus, we provide evidence that FPF1 class genes may play a regulatory role in both wood formation and flowering in poplar.

  20. Genome Wide Identification and Expression Profiling of SWEET Genes Family Reveals Its Role During Plasmodiophora brassicae-Induced Formation of Clubroot in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Hong Li

    2018-02-01

    Full Text Available Plasmodiophora brassicae is a soil borne pathogen and the causal agent of clubroot, a devastating disease of Brassica crops. The pathogen lives inside roots, and hijacks nutrients from the host plants. It is suggested that clubroot galls created an additional nutrient sink in infected roots. However, the molecular mechanism underlying P. brassicae infection and sugar transport is unclear. Here, we analyzed sugar contents in leaves and roots before and after P. brassicae infection using a pair of Chinese cabbage near-isogenic lines (NILs, carrying either a clubroot resistant (CR or susceptible (CS allele at the CRb locus. P. brassicae infection caused significant increase of glucose and fructose contents in the root of CS-NIL compared to CR-NIL, suggesting that sugar translocation and P. brassicae growth are closely related. Among 32 B. rapa SWEET homologs, several BrSWEETs belonging to Clade I and III were significantly up-regulated, especially in CS-NIL upon P. brassicae infection. Moreover, Arabidopsis sweet11 mutant exhibited slower gall formation compared to the wild-type plants. Our studies suggest that P. brassicae infection probably triggers active sugar translocation between the sugar producing tissues and the clubbed tissues, and the SWEET family genes are involved in this process.

  1. Analysis of cuticular wax constituents and genes that contribute to the formation of 'glossy Newhall', a spontaneous bud mutant from the wild-type 'Newhall' navel orange.

    Science.gov (United States)

    Liu, Dechun; Yang, Li; Zheng, Qiong; Wang, Yuechen; Wang, Minli; Zhuang, Xia; Wu, Qi; Liu, Chuanfu; Liu, Shanbei; Liu, Yong

    2015-08-01

    Navel orange (Citrus sinensis [L.] Osbeck) fruit surfaces contain substantial quantities of cuticular waxes, which have important eco-physiological roles, such as water retention and pathogen defense. The wax constituents of ripe navel orange have been studied in various reports, while the wax changes occurring during fruit development and the molecular mechanism underlying their biosynthesis/export have not been investigated. Recently, we reported a spontaneous bud mutant from the wild-type (WT) 'Newhall' Navel orange. This mutant displayed unusual glossy fruit peels and was named 'glossy Newhall' (MT). In this study, we compared the developmental profiles of the epicuticular and intracuticular waxes on the WT and MT fruit surfaces. The formation of epicuticular wax crystals on the navel orange surface was shown to be dependent on the accumulation of high amounts of aliphatic wax components with trace amounts of terpenoids. In sharp contrast, the underlying intracuticular wax layers have relatively low concentrations of aliphatic wax components but high concentrations of cyclic wax compounds, especially terpenoids at the late fruit developmental stages. Our work also showed that many genes that are involved in wax biosynthesis and export pathways were down-regulated in MT fruit peels, leading to a decrease in aliphatic wax component amounts and the loss of epicuticular wax crystals, ultimately causing the glossy phenotype of MT fruits.

  2. Heterologous co-expression in E. coli of isoamylase genes from cassava Manihot esculenta Crantz 'KU50' achieves enzyme-active heteromeric complex formation.

    Science.gov (United States)

    Panpetch, Pawinee; Field, Robert A; Limpaseni, Tipaporn

    2018-01-29

    Cloning of two isoamylase genes, MeISA1 and MeISA2, from cassava (Manihot esculenta Crantz) tubers, accompanied by their co-expression in E. coli demonstrates a requirement for heteromeric complex formation to achieve debranching activity. Starch debranching enzyme (DBE) or isoamylase (ISA) (EC.3.2.1.68), an important enzyme in starch metabolism, catalyses the hydrolysis of α-1,6 glycosidic linkages of amylopectin. Isoforms of ISAs have been reported in higher plants and algae (Fujita et al. in Planta 208:283-293, 1999; Hussain et al. in Plant Cell 15:133-149, 2003; Ishizaki et al. in Agric Biol Chem 47:771-779, 1983; Mouille et al. in Plant Cell 8:1353-1366, 1996). In the current work, cassava ISA genes were isolated from cDNA generated from total RNA from tubers of Manihot esculanta Crantz cultivar KU50. MeISA1 and MeISA2 were successfully amplified and cloned into a pETDuet1 vector. The putative MeISA1 and MeISA2 proteins comprised 763 and 882 amino acids, with substantial similarity to StISA1 and StISA2 from potato (84.4% and 68.9%, respectively). Recombinant MeISA1 and MeISA2 were co-expressed in Escherichia coli SoluBL21 (DE3). Histrap TM -Purified rMeISA1 and rMeISA2 showed approximate molecular weights of 87 and 99 kDa, respectively, by SDS-PAGE. Debranching activity was only detectable in the column fractions where both recombinant ISA isoforms were present. The heteromeric DBE from crude extracts of 4-5 h induced cultures analysed by gel filtration chromatography and western blot showed combinations of rMeISA1 and rMeISA2 at ratios of 1:1 to 4:1. Pooled fractions with DBE activity were used for enzyme characterisation, which showed that the enzyme was specific for amylopectin, with optimum activity at 37 °C and pH 7.0. Enzyme activity was enhanced by Co 2+ , Mg 2+ and Ca 2+ , but was strongly inhibited by Cu 2+ . Debranched amylopectin products showed chain length distributions typical of plant DBE.

  3. Quadruplex DNA formation in a region of the tRNA gene supE associated with hydrogen peroxide mediated mutations

    Energy Technology Data Exchange (ETDEWEB)

    Akman, S.A.; Lingeman, R.G.; Doroshow, J.H.; Smith, S.S. (City of Hope National Medical Center and Beckman Research Inst., Duarte, CA (United States))

    1991-09-03

    A hot spot for H{sub 2}O{sub 2}/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189. To further characterize this hot spot, the authors synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50C into major forms, one of which migrates more slowly than does d(pT){sub 33} on nondenaturing 12% polyacrylamide gels. They propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quarters involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following: (1) pZ33 migrates as a single form that comigrates with d(pT){sub 33} on denaturing 20% acrylamide-8 M urea gels; (2) annealing an equimolar mixture of 5{prime}-{sup 32}P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5{prime}-{sup 32}P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels; (3) an oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating for; (4) dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H{sub 2}O{sub 2}/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsten bonded.

  4. The Determination and Correlation of Various Virulence Genes, ESBL, Serum Bactericidal Effect and Biofilm Formation of Clinical Isolated Classical Klebsiella pneumoniae and Hypervirulent Klebsiella pneumoniae from Respiratory Tract Infected Patients.

    Science.gov (United States)

    Shah, Rambha K; Ni, Zhao H; Sun, Xiao Y; Wang, Guo Q; Li, Fan

    2017-12-04

    Klebsiella pneumoniae strains that are commonly recognized by clinicians and microbiologists are termed as classical K. pneumoniae (cKP). A strain with capsule-associated mucopolysaccharide web is known as hypervirulent K. pneumoniae (hvKP) as it enhances the serum resistant and biofilm production. Aim is to determine and correlate various virulence genes, ESBL, serum bactericidal effect and biofilm formation of clinical isolated cKP and hvKP from respiratory tract infected patients. A total of 96 K. pneumoniae strains were isolated from sputum of respiratory tract infected patients. The isolates were performed string test, AST, ESBL virulence gene, serum bactericidal and biofilm assays. Out of 96 isolates, 39 isolates (40.6%) were identified with hypervirulent phenotypes. The number of cKP exhibiting resistance to the tested antimicrobials and ESBLs were significantly higher than that of the hvKP strains. The virulence genes of K. pneumoniae such as K1, K2, rmpA, uge, kfu and aerobactin were strongly associated with hvKP than cKP. However, no significant difference was found in FIM-1 and MrKD3 genes. ESBL producing cKP and hvKP were significantly associated with strong biofilm formation (both P < 0.05) and highly associated with bactericidal effect of serum (both P < 0.05) than cKP strains. However, neither biofilm formation nor bactericidal effect of serum was found with significant difference in between ESBL producing cKP and ESBL producing hvKP strains (both P > 0.05). Although the hvKP possess more virulence gene, but they didn't show any significant difference between biofilm formation and bactericidal effect of serum compared with ESBL producing cKP strains.

  5. Localization and physical mapping of a plasmid-borne 23-kb nif gene cluster from Enterobacter agglomerans showing homology to the entire nif gene cluster of Klebsiella pneumoniae M5a1.

    Science.gov (United States)

    Singh, M; Kreutzer, R; Acker, G; Klingmüller, W

    1988-01-01

    A physical and genetical map of the plasmid pEA3 indigenous to Enterobacter agglomerans is presented. pEA3 is a 111-kb large plasmid containing a 23-kb large cluster of nif genes which shows extensive homology (Southern hybridization and heteroduplex analysis) to the entire nif gene cluster of Klebsiella pneumoniae (Kp) M5a1. All the nif genes on pEA3 are organized in the same manner as in K. pneumoniae, except nifJ, which is located on the left end of pEA3 nif gene cluster (near nifQB). A BamHI restriction map of pEA3 and a detailed restriction map of the 23-kb nif region on pEA3 is also presented. The nif genes of pEA3 showed a low level of acetylene reduction in Escherichia coli, demonstrating that these genes are functional and contain the whole genetic information required to fix nitrogen. The origin of vegetative replication (OriV) of pEA3 was localized about 5.5 kb from the right end of the nif gene cluster. In addition to pEA3, large plasmids from four other strains of E. agglomerans showed homology to all the Kp nif genes tested, indicating that in diazotrophic strains of E. agglomerans nif genes are usually located on plasmids. In contrast, in most of the free-living, nitrogen-fixing bacteria the nif genes are on chromosome.

  6. Translocation t(6;9) in acute non-lymphocytic leukaemia results in the formation of a DEK-CAN fusion gene

    NARCIS (Netherlands)

    von Lindern, M.; Fornerod, M.; Soekarman, N.; van Baal, S.; Jaegle, M.; Hagemeijer, A.; Bootsma, D.; Grosveld, G.

    1992-01-01

    The t(6;9) that characterizes a specific subtype of ANLL fuses the 3' part of a gene located on chromosome 9q34, CAN, to the 5' part of a gene located on chromosome 6p23, DEK. On the 6p- chromosome, the resulting DEK-CAN fusion gene is transcribed into a leukaemia-specific 5.5 kb chimaeric mRNA that

  7. Dual Delivery of rhPDGF-BB and Bone Marrow Mesenchymal Stromal Cells Expressing the BMP2 Gene Enhance Bone Formation in a Critical-Sized Defect Model

    Science.gov (United States)

    Park, Shin-Young; Kim, Kyoung-Hwa; Shin, Seung-Yun; Koo, Ki-Tae; Lee, Yong-Moo

    2013-01-01

    Bone tissue healing is a dynamic, orchestrated process that relies on multiple growth factors and cell types. Platelet-derived growth factor-BB (PDGF-BB) is released from platelets at wound sites and induces cellular migration and proliferation necessary for bone regeneration in the early healing process. Bone morphogenetic protein-2 (BMP-2), the most potent osteogenic differentiation inducer, directs new bone formation at the sites of bone defects. This study evaluated a combinatorial treatment protocol of PDGF-BB and BMP-2 on bone healing in a critical-sized defect model. To mimic the bone tissue healing process, a dual delivery approach was designed to deliver the rhPDGF-BB protein transiently during the early healing phase, whereas BMP-2 was supplied by rat bone marrow stromal cells (BMSCs) transfected with an adenoviral vector containing the BMP2 gene (AdBMP2) for prolonged release throughout the healing process. In in vitro experiments, the dual delivery of rhPDGF-BB and BMP2 significantly enhanced cell proliferation. However, the osteogenic differentiation of BMSCs was significantly suppressed even though the amount of BMP-2 secreted by the AdBMP2-transfected BMSCs was not significantly affected by the rhPDGF-BB treatment. In addition, dual delivery inhibited the mRNA expression of BMP receptor type II and Noggin in BMSCs. In in vivo experiments, critical-sized calvarial defects in rats showed enhanced bone regeneration by dual delivery of autologous AdBMP2-transfected BMSCs and rhPDGF-BB in both the amount of new bone formed and the bone mineral density. These enhancements in bone regeneration were greater than those observed in the group treated with AdBMP2-transfected BMSCs alone. In conclusion, the dual delivery of rhPDGF-BB and AdBMP2-transfected BMSCs improved the quality of the regenerated bone, possibly due to the modulation of PDGF-BB on BMP-2-induced osteogenesis. PMID:23901900

  8. High-resolution melting (HRM of the cytochrome B gene: a powerful approach to identify blood-meal sources in Chagas disease Vectors.

    Directory of Open Access Journals (Sweden)

    Victor H Peña

    Full Text Available Methods to determine blood-meal sources of hematophagous Triatominae bugs (Chagas disease vectors are serological or based on PCR employing species-specific primers or heteroduplex analysis, but these are expensive, inaccurate, or problematic when the insect has fed on more than one species. To solve those problems, we developed a technique based on HRM analysis of the mitochondrial gene cytochrome B (Cyt b. This technique recognized 14 species involved in several ecoepidemiological cycles of the transmission of Trypanosoma cruzi and it was suitable with DNA extracted from intestinal content and feces 30 days after feeding, revealing a resolution power that can display mixed feedings. Field samples were analyzed showing blood meal sources corresponding to domestic, peridomiciliary and sylvatic cycles. The technique only requires a single pair of primers that amplify the Cyt b gene in vertebrates and no other standardization, making it quick, easy, relatively inexpensive, and highly accurate.

  9. High-Resolution Melting (HRM) of the Cytochrome B Gene: A Powerful Approach to Identify Blood-Meal Sources in Chagas Disease Vectors

    Science.gov (United States)

    Peña, Victor H.; Fernández, Geysson J.; Gómez-Palacio, Andrés M.; Mejía-Jaramillo, Ana M.; Cantillo, Omar; Triana-Chávez, Omar

    2012-01-01

    Methods to determine blood-meal sources of hematophagous Triatominae bugs (Chagas disease vectors) are serological or based on PCR employing species-specific primers or heteroduplex analysis, but these are expensive, inaccurate, or problematic when the insect has fed on more than one species. To solve those problems, we developed a technique based on HRM analysis of the mitochondrial gene cytochrome B (Cyt b). This technique recognized 14 species involved in several ecoepidemiological cycles of the transmission of Trypanosoma cruzi and it was suitable with DNA extracted from intestinal content and feces 30 days after feeding, revealing a resolution power that can display mixed feedings. Field samples were analyzed showing blood meal sources corresponding to domestic, peridomiciliary and sylvatic cycles. The technique only requires a single pair of primers that amplify the Cyt b gene in vertebrates and no other standardization, making it quick, easy, relatively inexpensive, and highly accurate. PMID:22389739

  10. A resource for characterizing genome-wide binding and putative target genes of transcription factors expressed during secondary growth and wood formation in Populus

    Science.gov (United States)

    Lijun Liu; Trevor Ramsay; Matthew S. Zinkgraf; David Sundell; Nathaniel Robert Street; Vladimir Filkov; Andrew Groover

    2015-01-01

    Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors...

  11. Analysis of genes for 5S rRNA from the cricket, Acheta domesticus: two classes of repeating units.

    Science.gov (United States)

    Benes, H; Ware, J; Cave, M D

    1985-01-01

    To examine the modulation of 5S rRNA gene activity during development in the cricket, Acheta domesticus, 5S X DNA was isolated from a lambda Charon 4 genomic library and characterized. Southern blot analysis of cloned A. domesticus genomic DNA revealed that restriction fragments of 3.0 and 2.1 kb represent two size classes of 5S X DNA repeating units; over 90% of the repeats measure 3.0 kb. Restriction analysis of two 5S X DNA clones suggests that the 2.1-kb repeats are not randomly interspersed within clusters of the larger 3.0-kb repeating units. Heteroduplex and restriction mapping of several clones indicate that the spacers of both repeating units account for their unusual length. The major difference between the two classes of repeats may lie in 0.9-kb spacer sequences to the 3.0-kb repeats.

  12. The MADS Box Genes ABS, SHP1, and SHP2 Are Essential for the Coordination of Cell Divisions in Ovule and Seed Coat Development and for Endosperm Formation in Arabidopsis thaliana.

    Science.gov (United States)

    Ehlers, Katrin; Bhide, Amey S; Tekleyohans, Dawit G; Wittkop, Benjamin; Snowdon, Rod J; Becker, Annette

    2016-01-01

    Seed formation is a pivotal process in plant reproduction and dispersal. It begins with megagametophyte development in the ovule, followed by fertilization and subsequently coordinated development of embryo, endosperm, and maternal seed coat. Two closely related MADS-box genes, SHATTERPROOF 1 and 2 (SHP1 and SHP2) are involved in specifying ovule integument identity in Arabidopsis thaliana. The MADS box gene ARABIDOPSIS BSISTER (ABS or TT16) is required, together with SEEDSTICK (STK) for the formation of endothelium, part of the seed coat and innermost tissue layer formed by the maternal plant. Little is known about the genetic interaction of SHP1 and SHP2 with ABS and the coordination of endosperm and seed coat development. In this work, mutant and expression analysis shed light on this aspect of concerted development. Triple tt16 shp1 shp2 mutants produce malformed seedlings, seed coat formation defects, fewer seeds, and mucilage reduction. While shp1 shp2 mutants fail to coordinate the timely development of ovules, tt16 mutants show less peripheral endosperm after fertilization. Failure in coordinated division of the innermost integument layer in early ovule stages leads to inner seed coat defects in tt16 and tt16 shp1 shp2 triple mutant seeds. An antagonistic action of ABS and SHP1/SHP2 is observed in inner seed coat layer formation. Expression analysis also indicates that ABS represses SHP1, SHP2, and FRUITFUL expression. Our work shows that the evolutionary conserved Bsister genes are required not only for endothelium but also for endosperm development and genetically interact with SHP1 and SHP2 in a partially antagonistic manner.

  13. Expression atlas and comparative coexpression network analyses reveal important genes involved in the formation of lignified cell wall in Brachypodium distachyon.

    Science.gov (United States)

    Sibout, Richard; Proost, Sebastian; Hansen, Bjoern Oest; Vaid, Neha; Giorgi, Federico M; Ho-Yue-Kuang, Severine; Legée, Frédéric; Cézart, Laurent; Bouchabké-Coussa, Oumaya; Soulhat, Camille; Provart, Nicholas; Pasha, Asher; Le Bris, Philippe; Roujol, David; Hofte, Herman; Jamet, Elisabeth; Lapierre, Catherine; Persson, Staffan; Mutwil, Marek

    2017-08-01

    While Brachypodium distachyon (Brachypodium) is an emerging model for grasses, no expression atlas or gene coexpression network is available. Such tools are of high importance to provide insights into the function of Brachypodium genes. We present a detailed Brachypodium expression atlas, capturing gene expression in its major organs at different developmental stages. The data were integrated into a large-scale coexpression database ( www.gene2function.de), enabling identification of duplicated pathways and conserved processes across 10 plant species, thus allowing genome-wide inference of gene function. We highlight the importance of the atlas and the platform through the identification of duplicated cell wall modules, and show that a lignin biosynthesis module is conserved across angiosperms. We identified and functionally characterised a putative ferulate 5-hydroxylase gene through overexpression of it in Brachypodium, which resulted in an increase in lignin syringyl units and reduced lignin content of mature stems, and led to improved saccharification of the stem biomass. Our Brachypodium expression atlas thus provides a powerful resource to reveal functionally related genes, which may advance our understanding of important biological processes in grasses. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  14. Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

    Science.gov (United States)

    Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

    2015-10-23

    The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

  15. Molecular basis of isozyme formation of beta-galactosidases in Bacillus stearothermophilus: isolation of two beta-galactosidase genes, bgaA and bgaB.

    Science.gov (United States)

    Hirata, H; Negoro, S; Okada, H

    1984-01-01

    Bacillus stearothermophilus IAM11001 produced three beta-galactosidases, beta-galactosidase I, II, and III (beta-gal I, II, and III), which are detectable by polyacrylamide (nondenatured) gel electrophoresis. By connecting restriction fragments of the chromosomal DNA to plasmid vectors, followed by transformation of Escherichia coli, two beta-galactosidase genes (bgaA and bgaB) located close to each other on the chromosome were isolated. Identification of the gene products and Southern hybridization analyses with a 2.7-kilobase-pair EcoRI fragment containing the bgaA gene as probe revealed that a single bgaA gene exists on the genome and that beta-gal II and beta-gal III consist of a common subunit (the bgaA gene product; molecular weight, 120,000), but differ in their assembly (beta-gal II is a dimer, and beta-gal III is a tetramer). The bgaB gene product (molecular weight, 70,000) in Bacillus subtilis harboring pHG5 (a hybrid plasmid consisting of pUB110 and a 2.9-kilobase-pair EcoRI fragment) was estimated to be the beta-gal I protein from its heat stability. Southern hybridization and immunological testing indicated that the two genes have no homology. Images PMID:6434528

  16. The Aux/IAA gene rum1 involved in seminal and lateral root formation controls vascular patterning in maize (Zea mays L.) primary roots.

    Science.gov (United States)

    Zhang, Yanxiang; Paschold, Anja; Marcon, Caroline; Liu, Sanzhen; Tai, Huanhuan; Nestler, Josefine; Yeh, Cheng-Ting; Opitz, Nina; Lanz, Christa; Schnable, Patrick S; Hochholdinger, Frank

    2014-09-01

    The maize (Zea mays L.) Aux/IAA protein RUM1 (ROOTLESS WITH UNDETECTABLE MERISTEMS 1) controls seminal and lateral root initiation. To identify RUM1-dependent gene expression patterns, RNA-Seq of the differentiation zone of primary roots of rum1 mutants and the wild type was performed in four biological replicates. In total, 2 801 high-confidence maize genes displayed differential gene expression with Fc ≥2 and FDR ≤1%. The auxin signalling-related genes rum1, like-auxin1 (lax1), lax2, (nam ataf cuc 1 nac1), the plethora genes plt1 (plethora 1), bbm1 (baby boom 1), and hscf1 (heat shock complementing factor 1) and the auxin response factors arf8 and arf37 were down-regulated in the mutant rum1. All of these genes except nac1 were auxin-inducible. The maize arf8 and arf37 genes are orthologues of Arabidopsis MP/ARF5 (MONOPTEROS/ARF5), which controls the differentiation of vascular cells. Histological analyses of mutant rum1 roots revealed defects in xylem organization and the differentiation of pith cells around the xylem. Moreover, histochemical staining of enlarged pith cells surrounding late metaxylem elements demonstrated that their thickened cell walls displayed excessive lignin deposition. In line with this phenotype, rum1-dependent mis-expression of several lignin biosynthesis genes was observed. In summary, RNA-Seq of RUM1-dependent gene expression in maize primary roots, in combination with histological and histochemical analyses, revealed the specific regulation of auxin signal transduction components by RUM1 and novel functions of RUM1 in vascular development. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  17. Continuous cultivations of a Penicillium chrysogenum strain expressing the expandase gene from Streptomyces clavuligerus: Kinetics of adipoyl-7-aminodeacetoxycephalosporanic acid and byproduct formations

    DEFF Research Database (Denmark)

    Robin, Jarno Jacky Christian; Bruheim, P.; Nielsen, M.L.

    2003-01-01

    The production kinetics of a transformed strain of Penicillium chrysogenum expressing the expandase gene from Streptomyces clavuligerus was investigated in chemostat cultivations. The recombinant strain produces adipoyl-7-aminodeacetoxycephalosporanic acid (ad-7-ADCA) as the major product; howeve...

  18. Genes for selenium dependent and independent formate dehydrogenase in the gut microbial communities of three lower, wood-feeding termites and a wood-feeding roach

    OpenAIRE

    Zhang, Xinning; Matson, Eric G.; Leadbetter, Jared R.

    2011-01-01

    The bacterial Wood-Ljungdahl pathway for CO_2-reductive acetogenesis is important for the nutritional mutualism occurring between wood-feeding insects and their hindgut microbiota. A key step in this pathway is the reduction of CO_2 to formate, catalysed by the enzyme formate dehydrogenase (FDH). Putative selenocysteine- (Sec) and cysteine- (Cys) containing paralogues of hydrogenase-linked FDH (FDH_H) have been identified in the termite gut acetogenic spirochet...

  19. Hen uterine gene expression profiling during eggshell formation reveals putative proteins involved in the supply of minerals or in the shell mineralization process

    Science.gov (United States)

    2014-01-01

    Background The chicken eggshell is a natural mechanical barrier to protect egg components from physical damage and microbial penetration. Its integrity and strength is critical for the development of the embryo or to ensure for consumers a table egg free of pathogens. This study compared global gene expression in laying hen uterus in the presence or absence of shell calcification in order to characterize gene products involved in the supply of minerals and / or the shell biomineralization process. Results Microarrays were used to identify a repertoire of 302 over-expressed genes during shell calcification. GO terms enrichment was performed to provide a global interpretation of the functions of the over-expressed genes, and revealed that the most over-represented proteins are related to reproductive functions. Our analysis identified 16 gene products encoding proteins involved in mineral supply, and allowed updating of the general model describing uterine ion transporters during eggshell calcification. A list of 57 proteins potentially secreted into the uterine fluid to be active in the mineralization process was also established. They were classified according to their potential functions (biomineralization, proteoglycans, molecular chaperone, antimicrobials and proteases/antiproteases). Conclusions Our study provides detailed descriptions of genes and corresponding proteins over-expressed when the shell is mineralizing. Some of these proteins involved in the supply of minerals and influencing the shell fabric to protect the egg contents are potentially useful biological markers for the genetic improvement of eggshell quality. PMID:24649854

  20. Frequent interchromosomal template switches during gene conversion in S. cerevisiae

    Science.gov (United States)

    Tsaponina, Olga; Haber, James E.

    2014-01-01

    Summary Although repair of double-strand breaks (DSBs) by gene conversion is the most accurate way to repair such lesions, in budding yeast there is a thousand-fold increase in accompanying mutations, including interchromosomal template switches (ICTS) involving highly mismatched (homeologous) ectopic sequences. Although such events are rare and appear at a rate of 2×10−7 when template jumps occur between 71% identical sequences, they are surprisingly frequent (0.3% of all repair events) when the second template is identical to the first, revealing the remarkable instability of repair DNA synthesis. With homeologous donors, ICTS uses microhomologies as small as 2 bp. Cells lacking mismatch repair proteins Msh6 and Mlh1 form chimeric recombinants with two distinct patches of microhomology, implying that these proteins are crucial for strand discrimination of heteroduplex DNA formed during ICTS. We identify the chromatin remodeler Rdh54 as the first protein required for template switching that does not affect simple gene conversion. PMID:25066232

  1. Flavonoid supplementation affects the expression of genes involved in cell wall formation and lignification metabolism and increases sugar content and saccharification in the fast-growing eucalyptus hybrid E. urophylla x E. grandis.

    Science.gov (United States)

    Lepikson-Neto, Jorge; Nascimento, Leandro C; Salazar, Marcela M; Camargo, Eduardo L O; Cairo, João P F; Teixeira, Paulo J; Marques, Wesley L; Squina, Fabio M; Mieczkowski, Piotr; Deckmann, Ana C; Pereira, Gonçalo A G

    2014-11-19

    Eucalyptus species are the most widely planted hardwood species in the world and are renowned for their rapid growth and adaptability. In Brazil, one of the most widely grown Eucalyptus cultivars is the fast-growing Eucalyptus urophylla x Eucalyptus grandis hybrid. In a previous study, we described a chemical characterization of these hybrids when subjected to flavonoid supplementation on 2 distinct timetables, and our results revealed marked differences between the wood composition of the treated and untreated trees. In this work, we report the transcriptional responses occurring in these trees that may be related to the observed chemical differences. Gene expression was analysed through mRNA-sequencing, and notably, compared to control trees, the treated trees display differential down-regulation of cell wall formation pathways such as phenylpropanoid metabolism as well as differential expression of genes involved in sucrose, starch and minor CHO metabolism and genes that play a role in several stress and environmental responses. We also performed enzymatic hydrolysis of wood samples from the different treatments, and the results indicated higher sugar contents and glucose yields in the flavonoid-treated plants. Our results further illustrate the potential use of flavonoids as a nutritional complement for modifying Eucalyptus wood, since, supplementation with flavonoids alters its chemical composition, gene expression and increases saccharification probably as part of a stress response.

  2. Role of bolA and rpoS genes in biofilm formation and adherence pattern by Escherichia coli K-12 MG1655 on polypropylene, stainless steel, and silicone surfaces.

    Science.gov (United States)

    Adnan, Mohd; Sousa, Ana Margarida; Machado, Idalina; Pereira, Maria Olivia; Khan, Saif; Morton, Glyn; Hadi, Sibte

    2017-06-01

    Escherichia coli has developed sophisticated means to sense, respond, and adapt in stressed environment. It has served as a model organism for studies in molecular genetics and physiology since the 1960s. Stress response genes are induced whenever a cell needs to adapt and survive under unfavorable growth conditions. Two of the possible important genes are rpoS and bolA. The rpoS gene has been known as the alternative sigma (σ) factor, which controls the expression of a large number of genes, which are involved in responses to various stress factors as well as transition to stationary phase from exponential form of growth. Morphogene bolA response to stressed environment leads to round morphology of E. coli cells, but little is known about its involvement in biofilms and its development or maintenance. This study has been undertaken to address the adherence pattern and formation of biofilms by E. coli on stainless steel, polypropylene, and silicone surfaces after 24 h of growth at 37 °C. Scanning electron microscopy was used for direct examination of the cell attachment and biofilm formation on various surfaces and it was found that, in the presence of bolA, E. coli cells were able to attach to the stainless steel and silicone very well. By contrast, polypropylene surface was not found to be attractive for E. coli cells. This indicates that bolA responded and can play a major role in the presence and absence of rpoS in cell attachment.

  3. Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C

    DEFF Research Database (Denmark)

    Piercey, Marta J.; Hingston, Patricia A.; Hansen, Lisbeth Truelstrup

    2016-01-01

    biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants...

  4. The MAP kinase-encoding gene MgFus3 of the non-appressorium phytopathogen Mycosphaerella graminicola is required for penetration and in vitro pycnidia formation

    NARCIS (Netherlands)

    Cousin, A.; Mehrabi, R.; Guilleroux, M.; Dufresne, M.; Lee, van der T.A.J.; Waalwijk, C.; Langin, T.; Kema, G.H.J.

    2006-01-01

    In eukaryotes, a family of serine/threonine protein kinases known as mitogen-activated protein kinases (MAPKs) is involved in the transduction of a variety of extracellular signals and in the regulation of growth and development. We identified a MAPK-encoding gene in Mycosphaerella graminicola

  5. Relationship of biofilm formation and gelE gene expression in Enterococcus faecalis recovered from root canals in patients requiring endodontic retreatment.

    Science.gov (United States)

    Wang, Lina; Dong, Ming; Zheng, Jinbo; Song, Qiyi; Yin, Wei; Li, Jiyao; Niu, Weidong

    2011-05-01

    Enterococcus faecalis is known to be the most frequently detected species in root canals with failed endodontic treatment. Many studies are available on biofilm formation and the expression of virulence factors such as gelatinase (gelE) in E. faecalis. However, the relationship of biofilm formation and the expression of gelE in E. faecalis recovered from root canals undergoing orthograde retreatment is not well understood. E. faecalis was isolated from clinical samples of root canal retreatment, and the expression of gelE in E. faecalis was assessed. Automatic microplate reader and scanning electron microscopy were used to investigate the biofilm formation ability of E. faecalis isolates. Real-time quantitative polymerase chain reaction was used for detecting the expression of gelE in biofilm-positive and biofilm-negative E. faecalis isolates. The detection rate of E. faecalis in the root canal retreatment cases was 39.26%. An automatic microplate reader showed that most isolates were able to form biofilms, and the biofilm formation ability of strains isolated from the teeth without a sinus tract was better than that with a sinus tract (P < .05). The expression of gelE was stronger in the cases of apical radiolucency than in those without the symptom (P < .05). The expression of gelE was higher in the biofilm-positive than in biofilm-negative strains (P < .05). Biofilm formation in E. faecalis was facilitated in the cases without a sinus tract. In the cases of apical radiolucency and in the biofilm-positive strains, the expression of gelE was higher. Copyright © 2011 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  6. The novel allele of the LhMYB12 gene is involved in splatter-type spot formation on the flower tepals of Asiatic hybrid lilies (Lilium spp.).

    Science.gov (United States)

    Yamagishi, Masumi; Toda, Shinya; Tasaki, Keisuke

    2014-02-01

    Many angiosperm families develop spatially regulated anthocyanin spots on their flowers. The Asiatic hybrid lily (Lilium spp.) cv 'Latvia' develops splatter-type spots on its tepals. The splatters arise simply from the deposition of anthocyanin pigments in the tepal epidermis. To determine how splatter development was regulated, we analysed the transcription of anthocyanin biosynthesis genes, and isolated and characterized an R2R3-MYB gene specific to splatter pigmentation. All anthocyanin biosynthesis genes were expressed in splatter-containing regions of tepals, but not in other regions, indicating that splatter pigmentation is caused by the transcriptional regulation of biosynthesis genes. Previously characterized LhMYB12 regulators were not involved in splatter pigmentation, but, instead, a new allele of the LhMYB12 gene, LhMYB12-Lat, isolated in this study, contributed to splatter development. In 'Latvia' and other lily plants expressing splatters, LhMYB12-Lat was preferentially transcribed in the splatter-containing region of tepals. Progeny segregation analysis showed that LhMYB12-Lat genotype and splatter phenotype were co-segregated among the F1 population, indicating that LhMYB12-Lat determines the presence or absence of splatters. LhMYB12-Lat contributes to splatter development, but not to full-tepal pigmentation and raised spot pigmentation. As a result of its unique sequences and different transcription profiles, this new allele of LhMYB12 should be a novel R2R3-MYB specifically associating with splatter spot development. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  7. GA3 stimulates the formation and germination of somatic embryos and the expression of a KNOTTED-like homeobox gene of Cocos nucifera (L.).

    Science.gov (United States)

    Montero-Córtes, M; Sáenz, Luis; Córdova, I; Quiroz, A; Verdeil, J-L; Oropeza, C

    2010-09-01

    The micropropagation of coconut palm has progressed rapidly; yet, there are constraints with regard to the number of somatic embryos formed and their germination. To overcome these, we tested the effect of gibberellic acid and characterized genes of the KNOX family. Gibberellic acid at 0.5 muM increased 1.5-fold the number of calli forming somatic embryos and twofold the number of somatic embryos per callus, calli with germinating embryos and the number of germinating somatic embryos per callus. With regard to the study of KNOX family genes, the complete sequences of two KNOX-like genes were obtained for CnKNOX1 and CnKNOX2. The deduced amino acid sequence of both showed highly conserved domains characteristic of KNOX genes. CnKNOX1 showed high homology with KNOX class I proteins. CnKNOX1 expression was detected throughout the embryogenesis process except in somatic embryos at the pro-globular stage, and was highest in somatic embryos at the coleoptilar stage. No detection of CnKNOX1 expression occurred in calli with aberrant embryos. The addition of gibberellic acid stimulated the expression of CnKNOX1 earlier and the relative expression at all stages was higher. CnKNOX2 expression occurred at all stages peaking at the globular stage, but gibberellic acid treatment decreased the expression. Gene expression was also analyzed in tissues of different organs of adult palms. With CnKNOX1, high level of expression was found in tissues of organs with, but not in those without, meristem, whereas CnKNOX2 expression was detected in tissues with and also in those without meristem.

  8. Introduction of the human pro. cap alpha. 1(I) collagen gene into pro. cap alpha. 1(I)-deficient Mov-13 mouse cells leads to formation of functional mouse-human hybrid type I collagen

    Energy Technology Data Exchange (ETDEWEB)

    Schnieke, A.; Dziadek, M.; Bateman, J.; Mascara, T.; Harbers, K.; Gelinas, R.; Jaenisch, R.

    1987-02-01

    The Mov-13 mouse strain carries a retroviral insertion in the pro..cap alpha..1(I) collagen gene that prevents transcription of the gene. Cell lines derived from homozygous embryos do not express type I collagen although normal amounts of pro..cap alpha..2 mRNA are synthesized. The authors have introduced genomic clones of either the human or mouse pro..cap alpha..1(I) collagen gene into homozygous cell lines to assess whether the human or mouse pro..cap alpha..1(I) chains can associate with the endogenous mouse pro..cap alpha..2(I) chain to form stable type I collagen. The human gene under control of the simian virus 40 promoter was efficiently transcribed in the transfected cells. Protein analyses revealed that stable heterotrimers consisting of two human ..cap alpha..1 chains and one mouse ..cap alpha..2 chain were formed and that type I collagen was secreted by the transfected cells at normal rates. However, the electrophoretic migration of both ..cap alpha..1(I) and ..cap alpha..2(I) chains in the human-mouse hybrid molecules were retarded, compared to the ..cap alpha..(I) chains in control mouse cells. Inhibition of the posttranslational hydroxylation of lysine and proline resulted in comigration of human and mouse ..cap alpha..1 and ..cap alpha..2 chains, suggesting that increased posttranslational modification caused the altered electrophoretic migration in the human-mouse hybrid molecules. Amino acid sequence differences between the mouse and human ..cap alpha.. chains may interfere with the normal rate of helix formation and increase the degree of posttranslational modifications similar to those observed in patients with lethal perinatal osteogenesis imperfecta. The Mov-13 mouse system should allow the authors to study the effect specific mutations introduced in transfected pro..cap alpha..1(I) genes have on the synthesis, assembly, and function of collagen I.

  9. Effect of heat stress on the gene expression of ion transporters/channels in the uterus of laying hens during eggshell formation.

    Science.gov (United States)

    Bahadoran, Shahab; Dehghani Samani, Amir; Hassanpour, Hossein

    2018-01-01

    Heat stress is a problem in laying hens as it decreases egg quality by decreasing eggshell mineralization. Heat stress alters gene expression, hence our aim was to investigate effects of heat stress on gene expression of ion transport elements involving in uterine mineralization (TRPV6, CALB1, ITPR3, SCNN1G, SLC4A4, KCNJ15, SLC4A9, and CLCN2) by real time quantitative PCR. Forty 23-week-old White Leghorn laying hens were housed in two rooms. The control group (n = 20) was maintained at 21-23 °C, and the heat stress group (n = 20) was exposed to 36-38 °C for 8 weeks. All parameters of egg quality including egg weight, surface area, volume, and eggshell weight, thickness, ash weight, and calcium content were decreased in the heat stress group compared to the control group (by 26.9%, 32.7%, 44.1%, 38.4%, 31.7%, 39.4%, and 11.1%, respectively). Total plasma calcium was decreased by 13.4%. Levels of ITPR3, SLC4A4, and SLC4A9 transcripts in the uterine lining were decreased in the heat stress group compared to the control group (by 61.4%, 66.1%, and 66.1%, respectively). CALB1 transcript level was increased (by 34.2 fold) in the heat stress group of hens compared to controls. TRPV6, SCNN1G, KCNJ15, and CLCN2 transcript levels did not significantly differ between control and heat stress groups of laying hens. It is concluded that the down-expression of ITPR3, SLC4A4, and SLC4A9 genes may impair transportation of Cl - , HCO 3 - , and Na + in eggshell mineralization during heat stress. Increased CALB1 gene expression may increase resistance of uterine cells to detrimental effects of heat stress.

  10. Candida albicans Lacking the Gene Encoding the Regulatory Subunit of Protein Kinase A Displays a Defect in Hyphal Formation and an Altered Localization of the Catalytic Subunit

    Science.gov (United States)

    Cassola, Alejandro; Parrot, Marc; Silberstein, Susana; Magee, Beatrice B.; Passeron, Susana; Giasson, Luc; Cantore, María L.

    2004-01-01

    The fungal pathogen Candida albicans switches from a yeast-like to a filamentous mode of growth in response to a variety of environmental conditions. We examined the morphogenetic behavior of C. albicans yeast cells lacking the BCY1 gene, which encodes the regulatory subunit of protein kinase A. We cloned the BCY1 gene and generated a bcy1 tpk2 double mutant strain because a homozygous bcy1 mutant in a wild-type genetic background could not be obtained. In the bcy1 tpk2 mutant, protein kinase A activity (due to the presence of the TPK1 gene) was cyclic AMP independent, indicating that the cells harbored an unregulated phosphotransferase activity. This mutant has constitutive protein kinase A activity and displayed a defective germinative phenotype in N-acetylglucosamine and in serum-containing medium. The subcellular localization of a Tpk1-green fluorescent protein (GFP) fusion protein was examined in wild-type, tpk2 null, and bcy1 tpk2 double mutant strains. The fusion protein was observed to be predominantly nuclear in wild-type and tpk2 strains. This was not the case in the bcy1 tpk2 double mutant, where it appeared dispersed throughout the cell. Coimmunoprecipitation of Bcy1p with the Tpk1-GFP fusion protein demonstrated the interaction of these proteins inside the cell. These results suggest that one of the roles of Bcy1p is to tether the protein kinase A catalytic subunit to the nucleus. PMID:14871949

  11. Stellar formation

    CERN Document Server

    Reddish, V C

    1978-01-01

    Stellar Formation brings together knowledge about the formation of stars. In seeking to determine the conditions necessary for star formation, this book examines questions such as how, where, and why stars form, and at what rate and with what properties. This text also considers whether the formation of a star is an accident or an integral part of the physical properties of matter. This book consists of 13 chapters divided into two sections and begins with an overview of theories that explain star formation as well as the state of knowledge of star formation in comparison to stellar structure

  12. An AU-rich element in the 3{prime} untranslated region of the spinach chloroplast petD gene participates in sequence-specific RNA-protein complex formation

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qiuyun; Adams, C.C.; Usack, L. [Cornell Univ., Ithaca, NY (United States)] [and others

    1995-04-01

    In chloroplasts, the 3{prime} untranslated regions of most mRNAs contain a stem-loop-forming inverted repeat (IR) sequence that is required for mRNA stability and correct 3{prime}-end formation. The IR regions of several mRNAs are also known to bind chloroplast proteins, as judged from in vitro gel mobility shift and UV cross-linking assays, and these RNA-protein interactions may be involved in the regulation of chloroplast mRNA processing and/or stability. Here we describe in detail the RNA and protein components that are involved in 3{prime} IR-containing RNA (3{prime} IR-RNA)-protein complex formation for the spinach chloroplast petD gene, which encodes subunit IV of the cytochrome b{sub 6}/f complex. We show that the complex contains 55-, 41-, and 29-kDa RNA-binding proteins (ribonucleoproteins [RNPs]). These proteins together protect a 90-nucleotide segment of RNA from RNase T{sub 1} digestion; this RNA contains the IR and downstream flanking sequences. Competition experiments using 3{prime} IR-RNAs from the psbA or rbcL gene demonstrate that the RNPs have a strong specificity for the petD sequence. Site-directed mutagenesis was carried out to define the RNA sequence elements required for complex formation. These studies identified an 8-nucleotide AU-rich sequence downstream of the IR; mutations within this sequence had moderate to severe effects on RNA-protein complex formation. Although other similar sequences are present in the petD 3{prime} untranslated region, only a single copy, which we have termed box II, appears to be essential for in vivo protein binding. In addition, the IR itself is necessary for optimal complex formation. These two sequence elements together with an RNP complex may direct correct 3{prime}-end processing and/or influence the stability of petD mRNA in chloroplasts. 48 refs., 9 figs., 2 tabs.

  13. Competencia digital y literacidad: nuevos formatos narrativos en el videojuego «Dragon Age: Orígenes» Digital Competence and Literacy: Developing New Narrative Formats. The «Dragon Age: Origins» Videogame

    Directory of Open Access Journals (Sweden)

    Amando López Valero

    2011-03-01

    Full Text Available Este artículo tiene como ejes conceptuales la competencia digital, la literacidad y los nuevos formatos narrativos. El aprendizaje permanente incluye las mismas como claves de la formación de la persona y sobre todo, como elemento que va a contribuir a su inserción en una sociedad dinámica y cambiante. Tras analizar dichas dimensiones, las mismas serán reflejadas en el videojuego denominado «Dragon Age: Orígenes», galardonado con el premio juego de rol del año en el año 2009. El desarrollo de la competencia digital conlleva una nueva alfabetización y en la misma es preciso hallar recursos motivadores para que dicha adquisición sea a la vez una cuestión lúdica y formativa. Otro aspecto relevante que será tratado en el texto tiene que ver con la multimodalidad textual (Kress & Van Leeuwen, 2001, sobre todo con los nuevos formatos narrativos. Este hecho supone un importante avance social ya que las formas de lectura varían apareciendo formas distintas más motivadoras para el usuario pero no por ello poseen menor calidad. Éste es el caso de «Dragon Age: Orígenes», un juego de rol basado en la fantasía heroica ubicado en un mundo novedoso. Dicho juego se convierte en una excelente historia para ser leída y experimentada.The approach of this article is centered on the concepts of digital competence and new narrative formats. We aim to apply these dimensions to the videogame «Dragon Age Origins», winner of the 2009 videogame of the year award. Its features - plot, characters and interactivity – make it ideal reading material in other formats and are highly motivational for young people. The development of digital competence signifies new literacy, and it is necessary to find new stimulating resources that combine the fun and formative dimensions. Equally relevant are multimodal texts (Kress & Van Leeuwen, 2001, especially new narrative formats that imply social progress, as the ways of reading are different. The texts have

  14. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  15. Homozygous deletion of ATC1 and NTC1 genes in Candida parapsilosis abolishes trehalase activity and affects cell growth, sugar metabolism, stress resistance, infectivity and biofilm formation.

    Science.gov (United States)

    Sánchez-Fresneda, Ruth; Guirao-Abad, José P; Martinez-Esparza, María; Maicas, Sergi; Valentín, Eulogio; Argüelles, Juan-Carlos

    2015-12-01

    A double homozygous atc1Δ/atc1Δ/ntc1Δ/ntc1Δ mutant (atc1Δ/ntc1Δ KO) was constructed in the pathogen opportunistic yeast Candida parapsilosis by disruption of the two chromosomal alleles coding for NTC1 gene (encoding a neutral trehalase) in a Cpatc1Δ/atc1Δ background (atc1Δ KO strain, deficient in acid trehalase). The Cpatc1Δ/ntc1Δ KO mutant failed to counteract the inability of Cpatc1Δ cells to metabolize exogenous trehalose and showed a similar growth pattern on several monosaccharides and disaccharides. However, upon prolonged incubation in either rich medium (YPD) or nutrient-starved medium the viability of Cpatc1Δ cells exhibited a sensitive phenotype, which was augmented by further CpNTC1/NTC1 disruption. Furthermore, Cpatc1Δ/ntc1Δ KO cells had difficulty in resuming active growth in fresh YPD. This homozygous mutant also lacked any in vitro measurable trehalase activity, whether acid or neutral, suggesting that a single gene codes for each enzyme. By contrast, in Cpatc1Δ/ntc1Δ KO strain the resistance to oxidative and heat stress displayed by atc1Δ mutant was suppressed. Cpatc1Δ/ntc1Δ KO cells showed a significant decrease in virulence as well as in the capacity to form biofilms. These results point to a major role for acid trehalase (Atc1p) in the pathobiology of C. parapsilosis, whereas the activity of neutral trehalase can only partially counteract Atc1p deficiency. They also support the use of ATC1 and NTC1 genes as interesting antifungal targets. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Soil formation.

    NARCIS (Netherlands)

    Breemen, van N.; Buurman, P.

    1998-01-01

    Soil Formation deals with qualitative and quantitative aspects of soil formation (or pedogenesis) and the underlying chemical, biological, and physical processes. The starting point of the text is the process - and not soil classification. Effects of weathering and new formation of minerals,

  17. Metabolic pathway for poly(3-hydroxybutyrate-co-3-hydroxyvalerate) formation in Nocardia corallina: inactivation of mutB by chromosomal integration of a kanamycin resistance gene.

    Science.gov (United States)

    Valentin, H F; Dennis, D

    1996-02-01

    The gene encoding the large subunit of the methylmalonyl-coenzyme A (CoA) mutase in Nocardia corallina (mutBNc) was cloned. A 4.3-kbp BamHI fragment containing almost the entire mutBNc was identified by Southern hybridization experiments employing a digoxigenin-labeled probe deduced from mutB of Streptomyces cinnamonensis, mutBNc was interrupted by insertion of a kanamycin resistance gene block (mutB::kan or mutB::neo) and introduced into N. corallina to obtain mutB-negative strains by homologous recombination. Four of sixteen kanamycin-resistant clones occurred via double-crossover events and harbored only the interrupted mutBNc. These exhibited no growth on odd-chain fatty acids in the presence of kanamycin but exhibited wild-type growth on even-chain fatty acids, glucose, and succinate. Whereas the wild type of N. corallina accumulates a copolyester of 3-hydroxybutyrate (3HB) and 3-hydroxyvalerate (3HV) containing more than 60 mol% 3HV from most carbon sources, mutB-negative strains accumulated poly(3HB-co-3HV) containing only 2 to 6 mol% 3HV. Methylmalonyl-CoA mutase activity was not found in these clones. Therefore, this study provides strong evidence that the majority of 3HV units in poly(3HB-co-3HV) accumulated by N. corallina are synthesized via the methylmalonyl-CoA pathway.

  18. Decaffeinated Green Tea and Voluntary Exercise Induce Gene Changes Related to Beige Adipocyte Formation in High Fat-Fed Obese Mice.

    Science.gov (United States)

    Sae-Tan, Sudathip; Rogers, Connie J; Lambert, Joshua D

    2015-04-01

    We have previously reported that decaffeinated green tea extract (GTE) in combination with voluntary exercise (Ex) reduces metabolic syndrome in high fat-fed C57BL/6J mice. Here, we examined for the first time the effect of treatment with 77 mg/g GTE, Ex, or both (GTE + Ex) on genes related to the conversion of white adipose tissue (WAT) to brown fat-like adipose tissue (BLAT) in this model. GTE+Ex induced genes related to lipolysis (hormone sensitive lipase [3.0-fold] and patatin-like phospholipase domain-containing protein 2 [2-fold]), mitochondrial β-oxidation (NADH dehydrogenase 5 [2.3-fold], cytochrome B [2.0-fold], and cytochrome C oxidase III [1.9-fold increase]), and adipose tissue browning (peroxisome proliferator-activated receptor-γ coactivator-1α [1.8-fold], bone morphogenetic protein 4 [2.6-fold], and phosphatase and tensin homolog [2.6-fold]) in visceral WAT compared to HF-fed mice. These results suggest that GTE+Ex function in part by inducing the conversion of WAT to BLAT and provides novel mechanistic insight into this combination.

  19. Decaffeinated Green Tea and Voluntary Exercise Induce Gene Changes Related to Beige Adipocyte Formation in High Fat-Fed Obese Mice*

    Science.gov (United States)

    Sae-tan, Sudathip; Rogers, Connie J.; Lambert, Joshua D.

    2015-01-01

    We have previously reported that decaffeinated green tea extract (GTE) in combination with voluntary exercise (Ex) reduces metabolic syndrome in high fat-fed C57BL/6J mice. Here, we examined for the first time the effect of treatment with 77 mg/g GTE, Ex, or both (GTE + Ex) on genes related to the conversion of white adipose tissue (WAT) to brown fat-like adipose tissue (BLAT) in this model. GTE+Ex induced genes related to lipolysis (hormone sensitive lipase [3.0-fold] and patatin-like phospholipase domain-containing protein 2 [2-fold]), mitochondrial β-oxidation (NADH dehydrogenase 5 [2.3-fold], cytochrome B [2.0-fold], and cytochrome C oxidase III [1.9-fold increase]), and adipose tissue browning (peroxisome proliferator-activated receptor-γ coactivator-1α [1.8-fold], bone morphogenetic protein 4 [2.6-fold], and phosphatase and tensin homolog [2.6-fold]) in visceral WAT compared to HF-fed mice. These results suggest that GTE+Ex function in part by inducing the conversion of WAT to BLAT and provides novel mechanistic insight into this combination. PMID:25844091

  20. Role of the plant-specific endoplasmic reticulum stress-inducible gene TIN1 in the formation of pollen surface structure in Arabidopsis thaliana

    KAUST Repository

    Iwata, Yuji

    2012-01-01

    Accumulation of unfolded proteins in the endoplasmic reticulum (ER) of eukaryotic cells triggers the transcriptional activation of ER-resident molecular chaperones and folding enzymes to maintain cellular homeostasis. This process is known as the ER stress response or the unfolded protein response. We have identified tunicamycin induced 1 (TIN1), a plant-specific ER stress-inducible Arabidopsis thaliana gene. The TIN1 protein is localized in the ER; however, its molecular function has yet to be clarified. In this study, we performed functional analysis of TIN1 in planta. RT-PCR analysis showed that TIN1 is highly expressed in pollen. Analysis using the β-glucuronidase reporter gene demonstrated that the TIN1 promoter is active throughout pollen development, peaking at the time of flowering and in an ovule of an open flower. Although a T-DNA insertion mutant of TIN1 grows normally under ambient laboratory conditions, abnormal pollen surface morphology was observed under a scanning electron microscope. Based on the current and previous observations, a possible physiological function of TIN1 during pollen development is discussed. © 2012 The Japanese Society for Plant Cell and Molecular Biology.

  1. Mucoid Pseudomonas aeruginosa isolates maintain the biofilm formation capacity and the gene expression profiles during the chronic lung infection of CF patients

    DEFF Research Database (Denmark)

    Lee, Bao le ri; Schjerling, Charlotte K.; Kirkby, Nikolai

    2011-01-01

    Phenotypic and genotypic diversifications of Pseudomonas aeruginosa in the airways of patients with cystic fibrosis (CF) promote long-term survival of bacteria during chronic lung infection. Twelve clonally related, sequential mucoid and non-mucoid paired P. aeruginosa isolates obtained from three...... and measurements of the alginate production and the detection of the QS signal molecules were performed. Comparisons of mucoid and non-mucoid isolates from early and late stages of the infection showed that the mucoid phenotype maintained over a decade the capacity to form in vitro biofilm and showed an unaltered...... transcriptional profile, whereas substantial alterations in the transcriptional profiles and loss of the capacity to form in vitro biofilms were observed in corresponding isolates of the non-mucoid phenotype. The conserved gene expression pattern in the mucoid isolates vs the diversity of changes in non...

  2. Molecular cloning and characterization of the genes encoding an auxin efflux carrier and the auxin influx carriers associated with the adventitious root formation in mango (Mangifera indica L.) cotyledon segments.

    Science.gov (United States)

    Li, Yun-He; Zou, Ming-Hong; Feng, Bi-Hong; Huang, Xia; Zhang, Zhi; Sun, Guang-Ming

    2012-06-01

    Polar auxin transport (PAT) plays an important role in the adventitious root formation of mango cotyledon segments, but the molecular mechanism remains unclear. In this study, we cloned a gene encoding an auxin efflux carrier (designated as MiPIN1), and we cloned four genes encoding auxin influx carriers (designated as MiAUX1, MiAUX2, MiAUX3 and MiAUX4). The results of a phylogenetic tree analysis indicated that MiPIN1 and the MiAUXs belong to plant PIN and AUXs/LAXs groups. Quantitative real-time PCR indicated that the expression of MiPIN1 and the MiAUXs was lowest at 0 days but sharply increased on and after day 4. During the root formation in the mango cotyledon segments, the MiPIN1 expression in the distal cut surface (DCS) was always higher than the expression in the proximal cut surface (PCS) whereas the expression of the MiAUXs in the PCS was usually higher than in the DCS. This expression pattern might be result in the PAT from the DCS to the PCS, which is essential for the adventitious root formation in the PCS. Our previous study indicated that a pre-treatment of embryos with indole-3-butyric acid (IBA) significantly promoted adventitious rooting in PCS whereas a pre-treatment with 2,3,5-triiodobenzoic acid (TIBA) completely inhibited this rooting. In this study, however, IBA and TIBA pre-treatments slightly changed the expression of MiPIN1. In contrast, while the MiAUX3 and MiAUX4 expression levels were significantly up-regulated by the IBA pre-treatment, the expression levels were down-regulated by the TIBA pre-treatment. These findings imply that MiAUX3 and MiAUX4 are more sensitive to the IBA and TIBA treatments and that they might play important roles during adventitious root formation in mango cotyledon segments. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  3. Adaptive sequence evolution in a color gene involved in the formation of the characteristic egg-dummies of male haplochromine cichlid fishes

    Directory of Open Access Journals (Sweden)

    Braasch Ingo

    2007-11-01

    Full Text Available Abstract Background The exceptionally diverse species flocks of cichlid fishes in East Africa are prime examples of parallel adaptive radiations. About 80% of East Africa's more than 1 800 endemic cichlid species, and all species of the flocks of Lakes Victoria and Malawi, belong to a particularly rapidly evolving lineage, the haplochromines. One characteristic feature of the haplochromines is their possession of egg-dummies on the males' anal fins. These egg-spots mimic real eggs and play an important role in the mating system of these maternal mouthbrooding fish. Results Here, we show that the egg-spots of haplochromines are made up of yellow pigment cells, xanthophores, and that a gene coding for a type III receptor tyrosine kinase, colony-stimulating factor 1 receptor a (csf1ra, is expressed in egg-spot tissue. Molecular evolutionary analyses reveal that the extracellular ligand-binding and receptor-interacting domain of csf1ra underwent adaptive sequence evolution in the ancestral lineage of the haplochromines, coinciding with the emergence of egg-dummies. We also find that csf1ra is expressed in the egg-dummies of a distantly related cichlid species, the ectodine cichlid Ophthalmotilapia ventralis, in which markings with similar functions evolved on the pelvic fin in convergence to those of the haplochromines. Conclusion We conclude that modifications of existing signal transduction mechanisms might have evolved in the haplochromine lineage in association with the origination of anal fin egg-dummies. That positive selection has acted during the evolution of a color gene that seems to be involved in the morphogenesis of a sexually selected trait, the egg-dummies, highlights the importance of further investigations of the comparative genomic basis of the phenotypic diversification of cichlid fishes.

  4. Silencing heme oxygenase-1 gene expression in retinal pigment epithelial cells inhibits proliferation, migration and tube formation of cocultured endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wenjie [Ophthalmology Hospital, The First Affiliated Hospital of Harbin Medical University, 23 Youzheng Street, Harbin 150001 (China); Zhang, Xiaomei, E-mail: zhangxm667@163.com [Ophthalmology Hospital, The First Affiliated Hospital of Harbin Medical University, 23 Youzheng Street, Harbin 150001 (China); Lu, Hong [Ophthalmology Hospital, The First Affiliated Hospital of Harbin Medical University, 23 Youzheng Street, Harbin 150001 (China); Matsukura, Makoto [Laboratory of Clinical Pharmacology and Therapeutics, Faculty of Pharmaceutical Sciences, Sojo University, 4-22-1 Ikeda, Kumamoto 860-0082 (Japan); Zhao, Jien; Shinohara, Makoto [Ashikita Institution for Developmental Disabilities, 2813 Oaza Ashikita, Ashikita-machi, Ashikita, Kumamoto 869-5461 (Japan)

    2013-05-10

    Highlights: •HO-1 is highly induced in RPE cells by hypoxia. •Inhibition of HO-1 activity and knockdown of HO-1 expression inhibit VEGF expression in RPE cells under hypoxia. •Knockdown of HO-1 in RPE cells inhibits angiogenesis of endothelial cells in vitro. -- Abstract: Heme oxygenase-1 (HO-1) plays an important role in the vasculature and in the angiogenesis of tumors, wounds and other environments. Retinal pigment epithelial (RPE) cells and choroidal endothelial cells (CECs) are the main cells involved in choroidal neovascularization (CNV), a process in which hypoxia plays an important role. Our aim was to evaluate the role of human RPE-cell HO-1 in the angiogenic activities of cocultured endothelial cells under hypoxia. Small interfering RNA (siRNA) for HO-1 was transfected into human RPE cell line ARPE-19, and zinc protoporphyrin (ZnPP) was used to inhibit HO-1 activity. Knockdown of HO-1 expression and inhibition of HO-1 activity resulted in potent reduction of the expression of vascular endothelial growth factor (VEGF) under hypoxia. Furthermore, knockdown of HO-1 suppressed the proliferation, migration and tube formation of cocultured endothelial cells. These findings indicated that HO-1 might have an angiogenic effect in CNV through modulation of VEGF expression and might be a potential target for treating CNV.

  5. Effects of gene-augmentation on the formation, characteristics and microbial community of 2,4-dichlorophenoxyacetic acid degrading aerobic microbial granules.

    Science.gov (United States)

    Quan, Xiang-chun; Ma, Jing-yun; Xiong, Wei-cong; Yang, Zhi-feng

    2011-11-30

    Development of 2,4-dichlorophenoxyacetic acid (2,4-D) degrading aerobic granular sludge was conducted in two sequencing batch reactors (SBR) with one bioaugmented with a plasmid pJP4 donor strain Pseudomonas putida SM1443 and the other as a control. Half-matured aerobic granules pre-grown on glucose were used as the starting seeds and a two-stage operation strategy was applied. Granules capable of utilizing 2,4-D (about 500 mg/L) as the sole carbon source was successfully cultivated in both reactors. Gene-augmentation resulted in the enhancement of 2,4-D degradation rates by the percentage of 65-135% for the granules on Day 18, and 6-24% for the granules on Day 105. Transconjugants receiving plasmid pJP4 were established in the granule microbial community after bioaugmentation and persisted till the end of operation. Compared with the control granules, the granules in the bioaugmented reactor demonstrated a better settling ability, larger size, more abundant microbial diversity and stronger tolerance to 2,4-D. The finally obtained granules in the bioaugmented and control reactor had a granule size of around 600 μm and 500 μm, a Shannon-Weaver diversity index (H) of 0.96 and 0.55, respectively. A shift in microbial community was found during the granulation process. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Upregulation of genes related to bone formation by γ-amino butyric acid and γ-oryzanol in germinated brown rice is via the activation of GABAB-receptors and reduction of serum IL-6 in rats.

    Science.gov (United States)

    Muhammad, Sani Ismaila; Maznah, Ismail; Mahmud, Rozi; Zuki, Abu Bakar Zakaria; Imam, Mustapha Umar

    2013-01-01

    GBR stimulates osteoblastogenesis by upregulation of bone formation genes, possibly via the activation of GABAB receptors and by inhibiting the activity of inflammatory cytokines and reactive oxygen species. Therefore, it could be used effectively in the management of osteoporosis.

  7. Changes of exoskeleton surface roughness and expression of crucial participation genes for chitin formation and digestion in the mud crab (Macrophthalmus japonicus) following the antifouling biocide irgarol.

    Science.gov (United States)

    Park, Kiyun; Nikapitiya, Chamilani; Kim, Won-Seok; Kwak, Tae-Soo; Kwak, Ihn-Sil

    2016-10-01

    Irgarol is a common antifoulant present in coastal sediment. The mud crab Macrophthalmus japonicus is one of the most abundant of the macrobenthos in the costal environment, and its exoskeleton has a protective function against various environmental threats. We evaluated the effects of irgarol toxicity on the exoskeleton of M. japonicus, which is the outer layer facing the environment. We analyzed transcriptional expression of exoskeleton, molting, and proteolysis-related genes in the gill and hepatopancreas of these exposed M. japonicus. In addition, changes in survival and exoskeleton surface characteristics were investigated. In the hepatopancreas, mRNA expression of chitinase 1 (Mj-chi1), chitinase 4 (Mj-chi4), and chitinase 5 (Mj-chi5) increased in M. japonicus exposed to all concentrations of irgarol. Mj-chi1 and Mj-chi4 expressions from 1 to 10μgL(-1) were dose- and time-dependent. Ecdysteroid receptor (Mj-EcR), trypsin (Mj-Tryp), and serine proteinase (Mj-SP) in the hepatopancreas were upregulated in response to different exposure levels of irgarol at day 1, 4, or 7. In contrast, gill Mj-chi5, Mj-Tryp, and Mj-SP exhibited late upregulated responses to 10μgL(-1) irgarol compared to the control at day 7. Mj-chi1 showed early upregulation upon exposure to 10μgL(-1) irgarol and Mj-chi4 showed no changes in transcription in the gill. Gill Mj-EcR presented generally downregulated expression patterns. In addition, decreased survival and change of exoskeleton surface roughness were observed in M. japonicus exposed to the three concentrations of irgarol. These results suggest that exposure to irgarol induces changes in the exoskeleton, molting, and proteolysis metabolism of M. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Curcuma oil attenuates accelerated atherosclerosis and macrophage foam-cell formation by modulating genes involved in plaque stability, lipid homeostasis and inflammation.

    Science.gov (United States)

    Singh, Vishal; Rana, Minakshi; Jain, Manish; Singh, Niharika; Naqvi, Arshi; Malasoni, Richa; Dwivedi, Anil Kumar; Dikshit, Madhu; Barthwal, Manoj Kumar

    2015-01-14

    In the present study, the anti-atherosclerotic effect and the underlying mechanism of curcuma oil (C. oil), a lipophilic fraction from turmeric (Curcuma longa L.), was evaluated in a hamster model of accelerated atherosclerosis and in THP-1 macrophages. Male golden Syrian hamsters were subjected to partial carotid ligation (PCL) or FeCl3-induced arterial oxidative injury (Ox-injury) after 1 week of treatment with a high-cholesterol (HC) diet or HC diet plus C. oil (100 and 300 mg/kg, orally). Hamsters fed with the HC diet were analysed at 1, 3 and 5 weeks following carotid injury. The HC diet plus C. oil-fed group was analysed at 5 weeks. In hyperlipidaemic hamsters with PCL or Ox-injury, C. oil (300 mg/kg) reduced elevated plasma and aortic lipid levels, arterial macrophage accumulation, and stenosis when compared with those subjected to arterial injury alone. Similarly, elevated mRNA transcripts of matrix metalloproteinase-2 (MMP-2), MMP-9, cluster of differentiation 45 (CD45), TNF-α, interferon-γ (IFN-γ), IL-1β and IL-6 were reduced in atherosclerotic arteries, while those of transforming growth factor-β (TGF-β) and IL-10 were increased after the C. oil treatment (300 mg/kg). The treatment with C. oil prevented HC diet- and oxidised LDL (OxLDL)-induced lipid accumulation, decreased the mRNA expression of CD68 and CD36, and increased the mRNA expression of PPARα, LXRα, ABCA1 and ABCG1 in both hyperlipidaemic hamster-derived peritoneal and THP-1 macrophages. The administration of C. oil suppressed the mRNA expression of TNF-α, IL-1β, IL-6 and IFN-γ and increased the expression of TGF-β in peritoneal macrophages. In THP-1 macrophages, C. oil supplementation prevented OxLDL-induced production of TNF-α and IL-1β and increased the levels of TGF-β. The present study shows that C. oil attenuates arterial injury-induced accelerated atherosclerosis, inflammation and macrophage foam-cell formation.

  9. Carboxylesterase 1 genes

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk

    2018-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase that metabolizes commonly used drugs. The CES1-related pseudogene, carboxylesterase 1 pseudogene 1 (CES1P1), has been implicated in gene exchange with CES1 and in the formation of hybrid genes including the carboxylesterase 1A2 gene (CES1A2...... region was revealed. In conclusion, many procedures for CES1, CES1A2 and CES1P1 genotyping appear to lack specificity. Knowledge about the segmental duplications may improve the typing of these genes....

  10. Upregulation of genes related to bone formation by γ-amino butyric acid and γ-oryzanol in germinated brown rice is via the activation of GABAB-receptors and reduction of serum IL-6 in rats

    Directory of Open Access Journals (Sweden)

    Muhammad SI

    2013-09-01

    bone tissue was determined using the Genetic Analysis System (Beckman Coulter Inc, Brea, CA, USA. Results: The results indicate that groups treated with GABA (100 and 200 mg/kg showed significant upregulation of SPARC, calcitonin receptor, and BMP-2 genes (P < 0.05, while the ORZ-treated group (100 and 200 mg/kg revealed significant (P < 0.05 upregulation of Osx, Postn, RUNX-2, and Col1&2. Similarly, IL-6 concentration decreased, while osteocalcin levels increased significantly (P < 0.05 in the treated groups as compared to ovariectomized non-treated groups. Conclusion: GABA and ORZ from GBR stimulates osteoblastogenesis by upregulation of bone formation genes, possibly via the activation of GABAB receptors and by inhibiting the activity of inflammatory cytokines and reactive oxygen species. Therefore, it could be used effectively in the management of osteoporosis. Keywords: gene expression, GBR-bioactive compounds, osteocalcin, ovariectomized rats

  11. Expression of a gymnosperm PIN homologous gene correlates with auxin immunolocalization pattern at cotyledon formation and in demarcation of the procambium during Picea abies somatic embryo development and in seedling tissues.

    Science.gov (United States)

    Palovaara, Joakim; Hallberg, Henrik; Stasolla, Claudio; Luit, Bert; Hakman, Inger

    2010-04-01

    In seed plants, the body organization is established during embryogenesis and is uniform across gymnosperms and angiosperms, despite differences during early embryogeny. Evidence from angiosperms implicates the plant hormone auxin and its polar transport, mainly established by the PIN family of auxin efflux transporters, in the patterning of embryos. Here, PaPIN1 from Norway spruce (Picea abies [L.] Karst.), a gene widely expressed in conifer tissues and organs, was characterized and its expression and localization patterns were determined with reverse transcription polymerase chain reaction and in situ hybridization during somatic embryo development and in seedlings. PaPIN1 shares the predicted structure of other PIN proteins, but its central hydrophilic loop is longer than most PINs. In phylogenetic analyses, PaPIN1 clusters with Arabidopsis thaliana (L.) Heynh. PIN3, PIN4 and PIN7, but its expression pattern also suggests similarity to PIN1. The PaPIN1 expression signal was high in the protoderm of pre-cotyledonary embryos, but not if embryos were pre-treated with the auxin transport inhibitor N-1-naphthylphthalamic acid (NPA). This, together with a high auxin immunolocalization signal in this cell layer, suggests a role of PaPIN1 during cotyledon formation. At later stages, high PaPIN1 expression was observed in differentiating procambium, running from the tip of incipient cotyledons down through the embryo axis and to the root apical meristem (RAM), although the mode of RAM specification in conifer embryos differs from that of most angiosperms. Also, the PaPIN1 in situ signal was high in seedling root tips including root cap columella cells. The results thus suggest that PaPIN1 provides an ancient function associated with auxin transport and embryo pattern formation prior to the separation of angiosperms and gymnosperms, in spite of some morphological differences.

  12. Clinical follow up of Mexican women with early onset of breast cancer and mutations in the BRCA1 and BRCA2 genes Estudio de seguimiento clínico de mujeres mexicanas con cáncer de mama de inicio temprano y mutaciones en los genes BRCA1 y BRCA2

    Directory of Open Access Journals (Sweden)

    Ana Laura Calderón-Garcidueñas

    2005-04-01

    Full Text Available OBJECTIVE: This study describes the presence of mutations in BRCA1 and BRCA2 genes in a group of Mexican women and the clinical evolution of early onset breast cancer (EOBC. MATERIAL AND METHODS: A prospective hospital-based study was performed in a sample of 22 women with EOBC (7 in clinical stage IIA, 8 in IIB, and 7 in IIIA. The patients attended a tertiary care hospital in northeastern Mexico in 1997 and were followed up over a 5-year period. Molecular analysis included: 1 a mutation screening by heteroduplex analysis (HA of BRCA1 and BRCA2 genes and 2 a sequence analysis. RESULTS: Of 22 patients, 14 (63.6% showed a variant band detected by heteroduplex analysis of the BRCA1 and BRCA2 genes: 8 polymorphisms, 4 mutations of uncertain significance, and 2 novel truncated protein mutations, one in BRCA1 (exon 11, 3587delT and the other in the BRCA2 gene (exon 11, 2664InsA. CONCLUSIONS: These findings support future studies to determine the significance and impact of the genetic factor in this Mexican women population.OBJETIVO: Describir la presencia de mutaciones en los genes BRCA1 y BRCA2 y la evolución clínica de un grupo de mujeres con carcinoma mamario de inicio temprano (CMIT. MATERIAL Y MÉTODOS: Se realizó un estudio hospitalario, prospectivo, en una muestra de 22 pacientes con CMIT (siete en etapa clínica IIA, ocho en la IIB y siete en etapa IIIA. Las pacientes fueron atendidas en un hospital del noreste de México en 1997 y se realizó un seguimiento clínico durante cinco años. El análisis molecular incluyó: 1 análisis heterodúplex (AH para detectar bandas variantes en la secuencia de ADN de los genes BRCA1 y BRCA2, y 2 análisis de secuenciación. RESULTADOS: De 22 pacientes, 14 (63.6% mostraron banda variante por AH en los genes BRCA1 y BRCA2: ocho polimorfismos, cuatro mutaciones de significado incierto y dos mutaciones noveles con proteína truncada, una en BRCA1 (exón 11, 3587delT y otra en BRCA2 (exón 11, 2664Ins

  13. An investigation of the association of the prothrombin G20210A gene mutation and inflammatory bowel disease: Factor II and IBD.

    Science.gov (United States)

    Haslam, N; Standen, G R; Probert, C S

    2001-05-01

    A thrombotic etiology for inflammatory bowel disease (IBD) has been proposed as a result of its association with thromboembolic complications, smoking, the oral contraceptive pill, and the response of ulcerative colitis (UC) patients to heparin. We have previously demonstrated an increased prevalence of the Factor V Leiden mutation in UC and wished to investigate the frequency of the recently discovered prothrombin G20210A gene mutation in IBD. The aim of the study was to investigate the hypothesis that the prothrombic state associated with the prothrombin G20210A gene mutation is involved in the etiology of IBD. A prospective cohort study of patients attending the Bristol Royal Infirmary and Gloucestershire Royal Hospital's IBD clinics was performed. Thirty-nine patients with IBD (24 with Crohn's disease and 15 with UC) and 100 historical controls were screened for the presence of the prothrombin gene mutation using a heteroduplex-based polymerase chain reaction technique. None of the patients with IBD had a personal history of thromboembolism, while three of them had a family history. No IBD patients had the prothrombin gene mutation compared with four (4%) controls (allelic frequency 2%). There does not appear to be an association of the prothrombin gene mutation with IBD and therefore it is unlikely to be involved in the etiology of IBD.

  14. Diagnostic value of immunoglobulin κ light chain gene rearrangement analysis in B-cell lymphomas.

    Science.gov (United States)

    Kokovic, Ira; Jezersek Novakovic, Barbara; Novakovic, Srdjan

    2015-03-01

    Analysis of the immunoglobulin κ light chain (IGK) gene is an alternative method for B-cell clonality assessment in the diagnosis of mature B-cell proliferations in which the detection of clonal immunoglobulin heavy chain (IGH) gene rearrangements fails. The aim of the present study was to evaluate the added value of standardized BIOMED-2 assay for the detection of clonal IGK gene rearrangements in the diagnostic setting of suspected B-cell lymphomas. With this purpose, 92 specimens from 80 patients with the final diagnosis of mature B-cell lymphoma (37 specimens), mature T-cell lymphoma (26 specimens) and reactive lymphoid proliferation (29 specimens) were analyzed for B-cell clonality. B-cell clonality analysis was performed using the BIOMED-2 IGH and IGK gene clonality assays. The determined sensitivity of the IGK assay was 67.6%, while the determined sensitivity of the IGH assay was 75.7%. The sensitivity of combined IGH+IGK assay was 81.1%. The determined specificity of the IGK assay was 96.2% in the group of T-cell lymphomas and 96.6% in the group of reactive lesions. The determined specificity of the IGH assay was 84.6% in the group of lymphomas and 86.2% in the group of reactive lesions. The comparison of GeneScan (GS) and heteroduplex pretreatment-polyacrylamide gel electrophoresis (HD-PAGE) methods for the analysis of IGK gene rearrangements showed a higher efficacy of GS analysis in a series of 27 B-cell lymphomas analyzed by both methods. In the present study, we demonstrated that by applying the combined IGH+IGK clonality assay the overall detection rate of B-cell clonality was increased by 5.4%. Thus, we confirmed the added value of the standardized BIOMED-2 IGK assay for assessment of B-cell clonality in suspected B-cell lymphomas with inconclusive clinical and cyto/histological diagnosis.

  15. Star formation

    International Nuclear Information System (INIS)

    Woodward, P.R.

    1978-01-01

    Theoretical models of star formation are discussed beginning with the earliest stages and ending in the formation of rotating, self-gravitating disks or rings. First a model of the implosion of very diffuse gas clouds is presented which relies upon a shock at the edge of a galactic spiral arm to drive the implosion. Second, models are presented for the formation of a second generation of massive stars in such a cloud once a first generation has formed. These models rely on the ionizing radiation from massive stars or on the supernova shocks produced when these stars explode. Finally, calculations of the gravitational collapse of rotating clouds are discussed with special focus on the question of whether rotating disks or rings are the result of such a collapse. 65 references

  16. Galaxy Formation

    DEFF Research Database (Denmark)

    Sparre, Martin

    Galaxy formation is an enormously complex discipline due to the many physical processes that play a role in shaping galaxies. The objective of this thesis is to study galaxy formation with two different approaches: First, numerical simulations are used to study the structure of dark matter and how...... galaxies form stars throughout the history of the Universe, and secondly it is shown that observations of gamma-ray bursts (GRBs) can be used to probe galaxies with active star formation in the early Universe. A conclusion from the hydrodynamical simulations is that the galaxies from the stateof...... is important, since it helps constraining chemical evolution models at high redshift. A new project studying how the population of galaxies hosting GRBs relate to other galaxy population is outlined in the conclusion of this thesis. The core of this project will be to quantify how the stellar mass function...

  17. Star formation

    Energy Technology Data Exchange (ETDEWEB)

    Woodward, P.R.

    1978-09-27

    Theoretical models of star formation are discussed beginning with the earliest stages and ending in the formation of rotating, self-gravitating disks or rings. First a model of the implosion of very diffuse gas clouds is presented which relies upon a shock at the edge of a galactic spiral arm to drive the implosion. Second, models are presented for the formation of a second generation of massive stars in such a cloud once a first generation has formed. These models rely on the ionizing radiation from massive stars or on the supernova shocks produced when these stars explode. Finally, calculations of the gravitational collapse of rotating clouds are discussed with special focus on the question of whether rotating disks or rings are the result of such a collapse. 65 references.

  18. The Association of Plasminogen Activator Inhibitor Type 1 (PAI-1) Level and PAI-1 4G/5G Gene Polymorphism with the Formation and the Grade of Endometrial Cancer.

    Science.gov (United States)

    Yıldırım, Malik Ejder; Karakuş, Savas; Kurtulgan, Hande Küçük; Kılıçgün, Hasan; Erşan, Serpil; Bakır, Sevtap

    2017-08-01

    Plasminogen activator inhibitor type 1 (PAI-1) is a serine protease inhibitor (Serpine 1), and it inhibits both tissue plasminogen activator and urokinase plasminogen activator which are important in fibrinolysis. We aimed to find whether there is a possible association between PAI-1 level, PAI-1 4G/5G polymorphism, and endometrial cancer. PAI-1 levels in peripheral blood were determined in 82 patients with endometrial carcinoma and 76 female healthy controls using an enzyme-linked immunoassay (ELISA). Then, the genomic DNA was extracted and screened by reverse hybridization procedure (Strip assay) to detect PAI 1 4G/5G polymorphism. The levels of PAI-1 in the patients were higher statistically in comparison to controls (P 5G polymorphism was quite different between patients and controls (P = 0.008), and 4G allelic frequency was significantly higher in the patients of endometrial cancer than in controls (P = 0.026). We found significant difference between Grade 1 and Grade 2+3 patients in terms of the PAI-1 levels (P = 0.047). There was no association between PAI-1 4G/5G polymorphism and the grades of endometrial cancer (P = 0.993). Our data suggest that the level of PAI-1 and PAI-1 4G/5G gene polymorphism are effective in the formation of endometrial cancer. PAI-1 levels are also associated with the grades of endometrial cancer.

  19. Gene probes: principles and protocols

    National Research Council Canada - National Science Library

    Aquino de Muro, Marilena; Rapley, Ralph

    2002-01-01

    ... of labeled DNA has allowed genes to be mapped to single chromosomes and in many cases to a single chromosome band, promoting significant advance in human genome mapping. Gene Probes: Principles and Protocols presents the principles for gene probe design, labeling, detection, target format, and hybridization conditions together with detailed protocols, accom...

  20. Mutations in BRCA1 and BRCA2 in breast cancer families: Are there more breast cancer-susceptibility genes?

    Energy Technology Data Exchange (ETDEWEB)

    Serova, O.M.; Mazoyer, S.; Putet, N. [CNRS, Lyon (France)] [and others

    1997-03-01

    To estimate the proportion of breast cancer families due to BRCA1 or BRCA2, we performed mutation screening of the entire coding regions of both genes supplemented with linkage analysis of 31 families, 8 containing male breast cancers and 23 site-specific female breast cancer. A combination of protein-truncation test and SSCP or heteroduplex analyses was used for mutation screening complemented, where possible, by the analysis of expression level of BRCA1 and BRCA2 alleles. Six of the eight families with male breast cancer revealed frameshift mutations, two in BRCA1 and four in BRCA2. Although most families with female site-specific breast cancers were thought to be due to mutations in either BRCA1 or BRCA2, we identified only eight mutations in our series of 23 site-specific female breast cancer families (34%), four in BRCA1 and four in BRCA2. According to the posterior probabilities calculated for mutation-negative families, based on linkage data and mutation screening results, we would expect 8-10 site-specific female breast cancer families of our series to be due to neither BRCA1 nor BRCA2. Thus, our results suggest the existence of at least one more major breast cancer-susceptibility gene. 24 refs., 1 fig., 3 tabs.

  1. Molecular characterization of 21 X-ALD Portuguese families: identification of eight novel mutations in the ABCD1 gene.

    Science.gov (United States)

    Guimarães, Carla P; Lemos, Manuela; Sá-Miranda, Clara; Azevedo, Jorge E

    2002-05-01

    X-linked adrenoleukodystrophy (X-ALD) is the most common inherited peroxisomal disorder. The gene associated with X-ALD, ABCD1, encodes a peroxisomal ATP-binding cassette half-transporter. In this study, we describe the molecular characterization of 21 affected Portuguese families. The complete coding region of the ABCD1 gene was amplified by reverse transcription polymerase chain reaction (RT-PCR) or genomic PCR. After conformation-sensitive gel electrophoresis analysis, fragments with a conformational heteroduplex pattern were sequenced. Using this strategy, we have identified 14 missense mutations, two nonsense mutations, two splicing site defects, and three small deletions, two of them resulting in frameshifts. Eight of the genetic alterations characterized in this study are novel. The levels of the ABCD1 transcript as well as the levels of ALDP in cultured skin fibroblasts of male probands were also determined in most cases. The levels of the ABCD1 transcript in one patient (corresponding to a nonsense mutation) were below the detection limit of Northern-blotting analysis. ALDP was found at normal levels in only three patients, absent in five (corresponding to a double missense, two nonsense, and two frameshift mutations), and decreased in all the others.

  2. Cement Formation

    DEFF Research Database (Denmark)

    Telschow, Samira; Jappe Frandsen, Flemming; Theisen, Kirsten

    2012-01-01

    Cement production has been subject to several technological changes, each of which requires detailed knowledge about the high multiplicity of processes, especially the high temperature process involved in the rotary kiln. This article gives an introduction to the topic of cement, including...... an overview of cement production, selected cement properties, and clinker phase relations. An extended summary of laboratory-scale investigations on clinkerization reactions, the most important reactions in cement production, is provided. Clinker formations by solid state reactions, solid−liquid and liquid...

  3. Digtets formater

    DEFF Research Database (Denmark)

    Schmidt, Michael Kallesøe; Rasmussen, Krista Stinne Greve; Skriver, Svend

    2017-01-01

    definition of text and work can be supplemented by a hermeneutical dimension, thus taking various versions of works and the influence of their respective media (blog, book etc.) on the percipient into account. In connection with the theoretical considerations, a handful of recent works by Lea Marie...... Løppenthin, Olga Ravn, Mikkel Thykier, Caspar Eric, and Simon Grotrian are discussed. By using the format as a point of departure rather than applying a more conventional practice of close reading, the authors argue for a broad-spectred approach to literary analysis which focuses on aspects of the conception...

  4. Mutation in a gene for type I procollagen (COL1A2) in a woman with postmenopausal osteoporosis: Evidence for phenotypic and genotypic overlap with mild osteogenesis imperfecta

    Energy Technology Data Exchange (ETDEWEB)

    Spotila, L.D.; Constantinou, C.D.; Sereda, L.; Ganguly, A.; Prockop, D.J. (Jefferson Medical College, Philadelphia, PA (United States)); Riggs, B.L. (Mayo Clinic, Rochester, MN (United States))

    1991-06-15

    Mutations in the two genes for type I collagen (COL1A1 or COL1A2) cause osteogenesis imperfecta (OI), a heritable disease characterized by moderate to extreme brittleness of bone early in life. Here, the authors show that a 52-year-old post menopausal woman with severe osteopenia and a compression fracture of a thoracic vertebra had a mutation in the gene for the {alpha}2(I) chain of type I collagen (COL1A2) similar to mutations that cause OI. cDNA was prepared from the woman's skin fibroblast RNA and assayed for the presence of a mutation by treating DNA heteroduplexes with carbodiimide. The results indicated a sequence variation in the region encoding amino acid residues 660-667 of the {alpha}2(I) chain. Further analysis demonstrated a single-base mutation that caused a serine-for-glycine substitution at position 661 of the {alpha}2(I) triple-helical domain. The substitution produced posttranslational overmodification of the collagen triple helix, as is seen with most glycine substitutions that cause OI. The patient had a history of five previous fractures, slightly blue sclerae, and slight hearing loss. Therefore, the results suggest that there may be phenotypic and genotypic overlap between mild osteogenesis imperfecta and postmenopausal osteoporosis, and that a subset of women with postmenopausal osteoporosis may have mutations in the genes for type I procollagen.

  5. Studying Genes

    Science.gov (United States)

    ... NIGMS NIGMS Home > Science Education > Studying Genes Studying Genes Tagline (Optional) Middle/Main Content Area PDF Version (382 KB) Other Fact Sheets What are genes? Genes are segments of DNA that contain instructions ...

  6. Galaxy Formation

    CERN Document Server

    Longair, Malcolm S

    2008-01-01

    This second edition of Galaxy Formation is an up-to-date text on astrophysical cosmology, expounding the structure of the classical cosmological models from a contemporary viewpoint. This forms the background to a detailed study of the origin of structure and galaxies in the Universe. The derivations of many of the most important results are derived by simple physical arguments which illuminate the results of more advanced treatments. A very wide range of observational data is brought to bear upon these problems, including the most recent results from WMAP, the Hubble Space Telescope, galaxy surveys like the Sloan Digital Sky Survey and the 2dF Galaxy Redshift Survey, studies of Type 1a supernovae, and many other observations.

  7. Gene Therapy

    Science.gov (United States)

    Gene therapy Overview Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease. Genes contain your ... that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds a new ...

  8. A Mutation in a Saccharomyces Cerevisiae Gene (Rad3) Required for Nucleotide Excision Repair and Transcription Increases the Efficiency of Mismatch Correction

    OpenAIRE

    Yang, Y.; Johnson, A. L.; Johnston, L. H.; Siede, W.; Friedberg, E. C.; Ramachandran, K.; Kunz, B. A.

    1996-01-01

    RAD3 functions in DNA repair and transcription in Saccharomyces cerevisiae and particular rad3 alleles confer a mutator phenotype, possibly as a consequence of defective mismatch correction. We assessed the potential involvement of the Rad3 protein in mismatch correction by comparing heteroduplex repair in isogenic rad3-1 and wild-type strains. The rad3-1 allele increased the spontaneous mutation rate but did not prevent heteroduplex repair or bias its directionality. Instead, the efficiency ...

  9. Type I oculocutaneous albinism (OCA1) associated with a large deletion of the tyrosinase (TYR) gene

    Energy Technology Data Exchange (ETDEWEB)

    Spritz, R.A.; Wick, P.A.; Holmes, S.A.; Schnur, R.E. [Univ. of Wisconsin, Madison, WI (United States)]|[Children`s Hospital of Philadelphia, PA (United States)

    1994-09-01

    OCA1 is an autosomal recessive disorder in which the biosynthesis of melanin is reduced or absent in skin, hair, and eyes, due to deficient enzymatic activity of tyrosinase. TYR consists of 5 exons spanning over 65 kb at 11q14-q21. Analyses of TYR in >400 unrelated patients with OCA1 have identified more than 50 different point mutations; however, no large deletions have been detected. Here we report a large deletion of TYR in a Caucasian boy with OCA1B. Simultaneous SSCP/heteroduplex screening and DNA sequence analysis indicated that the patient was apparently homozygous for a previously described TYR mutation, adjacent to the 3` splice site of IVS2 (-7, t{r_arrow}a). To distinguish between possible gene deletion vs. maternal uniparental isodisomy, we characterized several chromosome 11 polymorphisms. Maternal uniparental isodisomy was excluded by the patient`s heterozygosity for alleles at D11S35 (11q21-122) and HBG2 (11p15.5). In addition, the patient failed to inherit paternal alleles at an MboI RFLP in exon 1 of TYR and at a TaqI RFLP in the promoter region of the gene. To detect a possible submicroscopic deletion, we performed quantitative Southern blot hybridization using a full length TYR cDNA. Compared with controls, both the patient and his father appeared deleted for two or three TYR-derived PstI fragments; the two TYRL-derived fragments appeared normal. These data indicate that the patient and his father have a partial TYR deletion, including at least exons 1, 2, and IVS2. Based on the organization of the gene, this deletion is at least 50 kb in size. The patient is thus hemizygous for the maternally-inherited mutation in IVS2, accounting for his OCA1B phenotype.

  10. HLA-DQA1 and DQB1 gene polymorphisms in type I diabetic patients from central Italy and their use for risk prediction.

    Science.gov (United States)

    Buzzetti, R; Nisticò, L; Osborn, J F; Giovannini, C; Chersi, A; Sorrentino, R

    1993-08-01

    Susceptibility to type I diabetes has been shown to be highly correlated with the presence of an amino acid other than Asp at position 57 of the DQ beta-chain (non-Asp57) and also with the presence of an Arg at position 52 of the DQ alpha-chain (Arg52). In this study we analyzed the DQA1 and DQB1 gene polymorphisms in 65 patients from central Italy and 93 randomly selected control subjects. Polymerase chain reaction amplification of DNA encoding the first polymorphic domain of the DQB1 and DQA1 chains was performed, and DQB1 gene polymorphism was evaluated by dot blot analysis using 11 sequence-specific oligonucleotide probes. For DQA1 typing, a new simple procedure based on allele-specific amplification and analysis of heteroduplex DNA molecules formed by the annealing of mismatched allelic strands was used. This technique allows the discrimination of Arg52 and non-Arg52 DQA1 alleles. We then calculated by logistic regression the contribution of these genetic markers to the development of diabetes. Frequencies and odds ratios relative to the amino acid in position 57 of the DQ beta-chain and the amino acid in position 52 of the DQ alpha-chain showed that the highest odds ratio (odds ratio = 161; 95% confidence interval 19-1386) was that of the homozygous combination of the two susceptibility markers (non-Asp57 and Arg52).(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Evolution of the paralogous hap and iga genes in Haemophilus influenzae: evidence for a conserved hap pseudogene associated with microcolony formation in the recently diverged Haemophilus aegyptius and H. influenzae biogroup aegyptius

    DEFF Research Database (Denmark)

    Kilian, Mogens; Poulsen, Knud; Lomholt, Hans Bredsted

    2002-01-01

    Certain non-capsulate strains belonging to the Haemophilus influenzae/Haemophilus aegyptius complex show unusually high pathogenicity, but the evolutionary origin of these virulent phenotypes, termed H. influenzae biogroup aegyptius, is as yet unknown. The aim of the present study was to elucidate...... the mechanisms of evolution of two paralogous genes, hap and iga, which encode the adhesion and penetration Hap protein and the IgA1 protease respectively. Partial sequencing of hap and iga genes in a comprehensive collection of strains belonging to the H. influenzae/H. aegyptius complex revealed considerable...... genetic polymorphism and pronounced mosaic-like patterns in both genes, but no evidence of intrastrain recombination between the two genes. A conserved hap pseudogene was present in all strains of H. aegyptius and H. influenzae biogroup aegyptius, each of which constituted distinct subpopulations...

  12. gene structure, gene expression

    Indian Academy of Sciences (India)

    and seedling leaves were sampled at 6 h after the treatment. For cold stress, the seedlings were transferred to 4◦C growth chamber for 30 min. Control seedlings were exposed to none of these treatments. To examine the expression patterns of these predicted genes in Poplar and to further confirm their stress responsive-.

  13. A Comparison Between Denaturing Gradient Gel Electrophoresis and Denaturing High Performance Liquid Chromatography in Detecting Mutations in Genes Associated with Hereditary Non-Polyposis Colorectal Cancer (HNPCC and the Identification of 9 New Mutations Previously Unidentified by DGGE

    Directory of Open Access Journals (Sweden)

    Meldrum Cliff J

    2003-12-01

    Full Text Available Abstract Denaturing high performance liquid chromatography is a relatively new method by which heteroduplex structures formed during the PCR amplification of heterozygote samples can be rapidly identified. The use of this technology for mutation detection in hereditary non-polyposis colorectal cancer (HNPCC has the potential to appreciably shorten the time it takes to analyze genes associated with this disorder. Prior to acceptance of this method for screening genes associated with HNPCC, assessment of the reliability of this method should be performed. In this report we have compared mutation and polymorphism detection by denaturing gradient gel electrophoresis (DGGE with denaturing high performance liquid chromatography (DHPLC in a set of 130 families. All mutations/polymorphisms representing base substitutions, deletions, insertions and a 23 base pair inversion were detected by DHPLC whereas DGGE failed to identify four single base substitutions and a single base pair deletion. In addition, we show that DHPLC has been used for the identification of 5 different mutations in exon 7 of hMSH2 that could not be detected by DGGE. From this study we conclude that DHPLC is a more effective and rapid alternative to the detection of mutations in hMSH2 and hMLH1 with the same or better accuracy than DGGE. Furthermore, this technique offers opportunities for automation, which have not been realised for the majority of other methods of gene analysis.

  14. Heat-transfer-based detection of SNPs in the PAH gene of PKU patients

    Directory of Open Access Journals (Sweden)

    Vanden Bon N

    2014-03-01

    Full Text Available Natalie Vanden Bon,1 Bart van Grinsven,2 Mohammed Sharif Murib,2 Weng Siang Yeap,2 Ken Haenen,2,3 Ward De Ceuninck,2,3 Patrick Wagner,2,3 Marcel Ameloot,1 Veronique Vermeeren,1 Luc Michiels11Biomedical Research Institute, Hasselt University, Diepenbeek, Belgium; 2Institute for Materials Research, Hasselt University, Diepenbeek, Belgium; 3IMOMEC, Diepenbeek, BelgiumAbstract: Conventional neonatal diagnosis of phenylketonuria is based on the presence of abnormal levels of phenylalanine in the blood. However, for carrier detection and prenatal diagnosis, direct detection of disease-correlated mutations is needed. To speed up and simplify mutation screening in genes, new technologies are developed. In this study, a heat-transfer method is evaluated as a mutation-detection technology in entire exons of the phenylalanine hydroxylase (PAH gene. This method is based on the change in heat-transfer resistance (Rth upon thermal denaturation of dsDNA (double-stranded DNA on nanocrystalline diamond. First, ssDNA (single-stranded DNA fragments that span the size range of the PAH exons were successfully immobilized on nanocrystalline diamond. Next, it was studied whether an Rth change could be observed during the thermal denaturation of these DNA fragments after hybridization to their complementary counterpart. A clear Rth shift during the denaturation of exon 5, exon 9, and exon 12 dsDNA was observed, corresponding to lengths of up to 123 bp. Finally, Rth was shown to detect prevalent single-nucleotide polymorphisms, c.473G>A (R158Q, c.932T>C (p.L311P, and c.1222C>T (R408W, correlated with phenylketonuria, displaying an effect related to the different melting temperatures of homoduplexes and heteroduplexes.Keywords: mutation detection, heat-transfer resistance, melting temperature, nanocrystalline diamond, persistence length

  15. Summary of the IADR Cariology Research, Craniofacial Biology, and Mineralized Tissue Groups Symposium, Iguaçu Falls, Brazil, June 2012: Gene-environment Interactions and Epigenetics in Oral Diseases: Enamel Formation and its Clinical Impact on Tooth Defects, Caries, and Erosion

    Directory of Open Access Journals (Sweden)

    Adriana Modesto

    2013-12-01

    Full Text Available Characteristics of enamel may influence or modulate individual susceptibility to caries and erosion. These characteristics are defined during development, which is under strict genetic control, but can easily be modified in many ways by environmental factors. In the symposium, translational aspects of embryology, biochemistry, and genetics of amelogenesis were presented. The symposium provided unique insight into how basic sciences integrate with clinically relevant problems. The need for improved understanding of risks at the individual level, taking into consideration both environmental exposures and genetic background, was presented. The symposium was divided into four stepwise and interconnected topics as follows:  1 The Many Faces of Enamel Development; 2 Enamel Pathogenesis: Biochemistry Lessons; 3 Environmental Factors on Enamel Formation; and, 4 Genetic Variation in Enamel Formation Genes.

  16. Detection of monoclonal immunoglobulin heavy chain gene rearrangement (FR3 in Thai malignant lymphoma by High Resolution Melting curve analysis

    Directory of Open Access Journals (Sweden)

    Pongpruttipan Tawatchai

    2010-05-01

    Full Text Available Abstract Malignant lymphoma, especially non-Hodgkin lymphoma, is one of the most common hematologic malignancies in Thailand. The diagnosis of malignant lymphoma is often problematic, especially in early stages of the disease. Detection of antigen receptor gene rearrangement including T cell receptor (TCR and immunoglobulin heavy chain (IgH by polymerase chain reaction followed by heteroduplex has currently become standard whereas fluorescent fragment analysis (GeneScan has been used for confirmation test. In this study, three techniques had been compared: thermocycler polymerase chain reaction (PCR followed by heteroduplex and polyacrylamide gel electrophoresis, GeneScan analysis, and real time PCR with High Resolution Melting curve analysis (HRM. The comparison was carried out with DNA extracted from paraffin embedded tissues diagnosed as B- cell non-Hodgkin lymphoma. Specific PCR primers sequences for IgH gene variable region 3, including fluorescence labeled IgH primers were used and results were compared with HRM. In conclusion, the detection IgH gene rearrangement by HRM in the LightCycler System showed potential for distinguishing monoclonality from polyclonality in B-cell non-Hodgkin lymphoma. Introduction Malignant lymphoma, especially non-Hodgkin lymphoma, is one of the most common hematologic malignancies in Thailand. The incidence rate as reported by Ministry of Public Health is 3.1 per 100,000 population in female whereas the rate in male is 4.5 per 100,000 population 1. At Siriraj Hospital, the new cases diagnosed as malignant lymphoma were 214.6 cases/year 2. The diagnosis of malignant lymphoma is often problematic, especially in early stages of the disease. Therefore, detection of antigen receptor gene rearrangement including T cell receptor (TCR and immunoglobulin heavy chain (IgH by polymerase chain reaction (PCR assay has recently become a standard laboratory test for discrimination of reactive from malignant clonal

  17. Disruption of rcsB by a duplicated sequence in a curli-producing Escherichia coli O157:H7 results in differential gene expression in relation to biofilm formation, stress responses, and metabolism

    Science.gov (United States)

    Background: Escherichia coli O157:H7 (O157) strain 86-24, linked to a 1986 disease outbreak, displays biofilm- and curli-negative phenotypes that are correlated with the lack of Congo red (CR) binding and formation of white colonies (CR negative) on a CR negative containing medium. However, on a CR ...

  18. BcMF26a and BcMF26b Are Duplicated Polygalacturonase Genes with Divergent Expression Patterns and Functions in Pollen Development and Pollen Tube Formation in Brassica campestris.

    Directory of Open Access Journals (Sweden)

    Meiling Lyu

    Full Text Available Polygalacturonase (PG is one of the cell wall hydrolytic enzymes involving in pectin degradation. A comparison of two highly conserved duplicated PG genes, namely, Brassica campestris Male Fertility 26a (BcMF26a and BcMF26b, revealed the different features of their expression patterns and functions. We found that these two genes were orthologous genes of At4g33440, and they originated from a chromosomal segmental duplication. Although structurally similar, their regulatory and intron sequences largely diverged. QRT-PCR analysis showed that the expression level of BcMF26b was higher than that of BcMF26a in almost all the tested organs and tissues in Brassica campestris. Promoter activity analysis showed that, at reproductive development stages, BcMF26b promoter was active in tapetum, pollen grains, and pistils, whereas BcMF26a promoter was only active in pistils. In the subcellular localization experiment, BcMF26a and BcMF26b proteins could be localized to the cell wall. When the two genes were co-inhibited, pollen intine was formed abnormally and pollen tubes could not grow or stretch. Moreover, the knockout mutants of At4g33440 delayed the growth of pollen tubes. Therefore, BcMF26a/b can participate in the construction of pollen wall by modulating intine information and BcMF26b may play a major role in co-inhibiting transformed plants.

  19. Gene Expression of Pneumocystis murina after Treatment with Anidulafungin Results in Strong Signals for Sexual Reproduction, Cell Wall Integrity, and Cell Cycle Arrest, Indicating a Requirement for Asci Formation for Proliferation.

    Science.gov (United States)

    Cushion, Melanie T; Ashbaugh, Alan; Hendrix, Keeley; Linke, Michael J; Tisdale, Nikeya; Sayson, Steven G; Porollo, Aleksey

    2018-02-20

    The echinocandins are a class of anti-fungal agents that target β-1,3-D-glucan (BG) biosynthesis. In the ascigerous Pneumocystis species, treatment with these drugs deplete the asci life cycle stage which contain BG, but large numbers of forms which do not express BG remain in the infected lungs. In the present study, the gene expression profiles of Pneumocystis murina were compared between infected untreated mice and those treated with anidulafungin for 2 weeks to understand the metabolism of the persisting forms. Almost 80 genes were significantly up- or down-regulated. Like other fungi exposed to echinocandins, genes associated with sexual replication, cell wall integrity, cell cycle arrest and stress comprised the strongest up-regulated signals in P. murina from the treated mice. The up-regulation of the P. murina β-1,3-D-glucan endohydrolase and endo-1,3-glucanase was notable and may explain the disappearance of the existing asci in the lungs of treated mice since both enzymes can degrade BG. The biochemical measurement of BG in the lungs of treated mice and fluorescent microscopy with an anti-BG antibody supported the loss of BG. Down-regulated signals included genes involved in cell replication, genome stability, ribosomal biogenesis and function, and the Pneumocystis -specific genes encoding the major surface glycoproteins (Msg). These studies suggest that P. murina attempted to undergo sexual replication in response to a stressed environment and were halted in any type of proliferative cycle, likely due to a lack of BG. Asci appear to be a required part of the life cycle stage of Pneumocystis and BG may be needed to facilitate progression through the life cycle via sexual replication. Copyright © 2018 Cushion et al.

  20. Gene amplification in carcinogenesis

    Directory of Open Access Journals (Sweden)

    Lucimari Bizari

    2006-01-01

    Full Text Available Gene amplification increases the number of genes in a genome and can give rise to karyotype abnormalities called double minutes (DM and homogeneously staining regions (HSR, both of which have been widely observed in human tumors but are also known to play a major role during embryonic development due to the fact that they are responsible for the programmed increase of gene expression. The etiology of gene amplification during carcinogenesis is not yet completely understood but can be considered a result of genetic instability. Gene amplification leads to an increase in protein expression and provides a selective advantage during cell growth. Oncogenes such as CCND1, c-MET, c-MYC, ERBB2, EGFR and MDM2 are amplified in human tumors and can be associated with increased expression of their respective proteins or not. In general, gene amplification is associated with more aggressive tumors, metastases, resistance to chemotherapy and a decrease in the period during which the patient stays free of the disease. This review discusses the major role of gene amplification in the progression of carcinomas, formation of genetic markers and as possible therapeutic targets for the development of drugs for the treatment of some types of tumors.

  1. Close Formation Flight Control

    National Research Council Canada - National Science Library

    Proud, Andrew

    1999-01-01

    ... in the formation's drag is achieved. A controller, i.e., a formation-hold autopilot for the wing aircraft, is designed such that the formation's geometry is maintained in the face of lead aircraft maneuvers...

  2. Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

    Directory of Open Access Journals (Sweden)

    Hashishe Mervat M

    2010-06-01

    Full Text Available Abstract Background Breast cancer is one of the most common diseases affecting women. Inherited susceptibility genes, BRCA1 and BRCA2, are considered in breast, ovarian and other common cancers etiology. BRCA1 and BRCA2 genes have been identified that confer a high degree of breast cancer risk. Objective Our study was performed to identify germline mutations in some exons of BRCA1 and BRCA2 genes for the early detection of presymptomatic breast cancer in females. Methods This study was applied on Egyptian healthy females who first degree relatives to those, with or without a family history, infected with breast cancer. Sixty breast cancer patients, derived from 60 families, were selected for molecular genetic testing of BRCA1 and BRCA2 genes. The study also included 120 healthy first degree female relatives of the patients, either sisters and/or daughters, for early detection of presymptomatic breast cancer mutation carriers. Genomic DNA was extracted from peripheral blood lymphocytes of all the studied subjects. Universal primers were used to amplify four regions of the BRCA1 gene (exons 2,8,13 and 22 and one region (exon 9 of BRCA2 gene using specific PCR. The polymerase chain reaction was carried out. Single strand conformation polymorphism assay and heteroduplex analysis were used to screen for mutations in the studied exons. In addition, DNA sequencing of the normal and mutated exons were performed. Results Mutations in both BRCA1 and BRCA2 genes were detected in 86.7% of the families. Current study indicates that 60% of these families were attributable to BRCA1 mutations, while 26.7% of them were attributable to BRCA2 mutations. Results showed that four mutations were detected in the BRCA1 gene, while one mutation was detected in the BRCA2 gene. Asymptomatic relatives, 80(67% out of total 120, were mutation carriers. Conclusions BRCA1 and BRCA2 genes mutations are responsible for a significant proportion of breast cancer. BRCA mutations

  3. DNA methylation, nucleosome formation and positioning.

    Science.gov (United States)

    Pennings, Sari; Allan, James; Davey, Colin S

    2005-02-01

    Recent mapping of nucleosome positioning on several long gene regions subject to DNA methylation has identified instances of nucleosome repositioning by this base modification. The evidence for an effect of CpG methylation on nucleosome formation and positioning in chromatin is reviewed here in the context of the complex sequence-structure requirements of DNA wrapping around the histone octamer and the role of this epigenetic mark in gene repression.

  4. [Changes in Cell Surface Properties and Biofilm Formation Efficiency in Azospirillum brasilense Sp245 Mutants in the Putative Genes of Lipid Metabolism mmsB1 and fabG1].

    Science.gov (United States)

    Shumilova, E; Shelud'ko, A V; Filip'echeva, Yu A; Evstigneeva, S S; Ponomareva, E G; Petrova, L P; Katsy, E I

    2016-01-01

    The previously obtained insertion mutants ofAzospirillum brasilense Sp245 in the genes mmsBl and fabG1 (strains SK039 and Sp245.1610, respectively) were characterized by impaired flagellation and motility. The putative products of expression of these genes are 3-hydroxyisobutyrate dehydrogenase and 3-oxoacyl-[acyl-carrier protein] reductase, respectively. In the present work, A. brasilense- Sp245 strains SK039 and Sp245.1610 were found to have differences in the content of 3-hydroxyhexadecanoic, hexadecanoic, 3-hydroxytetradecanoic, hexadecenoic, octadecenoic, and nonadecanoic acids in their lipopolysaccharide prepa- rations, as well as in cell hydrophobicity and hemagglutination activity and dynamics of cell aggregation, in biomass amount, and in the relative content of lipopolysaccharide antigens in mature biofilms formed on hydrophilic or hydrophobic surfaces.

  5. An N-terminal glycine to cysteine mutation in the collagen COL1A1 gene produces moderately severe osteogenesis imperfecta

    Energy Technology Data Exchange (ETDEWEB)

    Wilcox, W.; Scott, L.; Cohn, D. [Cedars-Sinai Medical Center, Los Angeles, CA (United States)

    1994-09-01

    Osteogenesis imperfecta (OI) is usually due to mutations in the type I procollagen genes COL1A1 and COL1A2. Point mutations close to the N-terminus are generally milder than those near the C-terminus of the molecule (the gradient hypothesis of collagen mutations). We describe a patient with moderately severe OI due to a mutation in the N-terminal portion of the triple helical domain of the {alpha}1(I) chain. Electrophoretic analysis of collagen isolated from fibroblast cultures suggested the abnormal presence of a cysteine in the N-terminal portion of the {alpha}1(I) chain. Five overlapping DNA fragments amplified from fibroblast RNA were screened for mutations using single strand conformational polymorphism (SSCP) and heteroduplex analyses. Direct DNA sequence analysis of the single positive fragment demonstrated a G to T transversion, corresponding to a glycine to cysteine substitution at position 226 of the triple helical domain of the {alpha}1(I) chain. The mutation was confirmed by restriction enzyme analysis of amplified genomic DNA. The mutation was not present in fibroblasts from either phenotypically normal parent. Combining this mutation with other reported mutations, glycine to cysteine substitutions at positions 205, 211, 223, and 226 produce a moderately severe phenotype whereas flanking mutations at positions 175 and 382 produce a mild phenotype. This data supports a regional rather than a gradient model of the relationship between the nature and location of type I collagen mutations and OI phenotype.

  6. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  7. Bioinformatic analysis of an unusual gene-enzyme relationship in the arginine biosynthetic pathway among marine gamma proteobacteria: implications concerning the formation of N-acetylated intermediates in prokaryotes

    Directory of Open Access Journals (Sweden)

    Labedan Bernard

    2006-01-01

    Full Text Available Abstract Background The N-acetylation of L-glutamate is regarded as a universal metabolic strategy to commit glutamate towards arginine biosynthesis. Until recently, this reaction was thought to be catalyzed by either of two enzymes: (i the classical N-acetylglutamate synthase (NAGS, gene argA first characterized in Escherichia coli and Pseudomonas aeruginosa several decades ago and also present in vertebrates, or (ii the bifunctional version of ornithine acetyltransferase (OAT, gene argJ present in Bacteria, Archaea and many Eukaryotes. This paper focuses on a new and surprising aspect of glutamate acetylation. We recently showed that in Moritella abyssi and M. profunda, two marine gamma proteobacteria, the gene for the last enzyme in arginine biosynthesis (argH is fused to a short sequence that corresponds to the C-terminal, N-acetyltransferase-encoding domain of NAGS and is able to complement an argA mutant of E. coli. Very recently, other authors identified in Mycobacterium tuberculosis an independent gene corresponding to this short C-terminal domain and coding for a new type of NAGS. We have investigated the two prokaryotic Domains for patterns of gene-enzyme relationships in the first committed step of arginine biosynthesis. Results The argH-A fusion, designated argH(A, and discovered in Moritella was found to be present in (and confined to marine gamma proteobacteria of the Alteromonas- and Vibrio-like group. Most of them have a classical NAGS with the exception of Idiomarina loihiensis and Pseudoalteromonas haloplanktis which nevertheless can grow in the absence of arginine and therefore appear to rely on the arg(A sequence for arginine biosynthesis. Screening prokaryotic genomes for virtual argH-X 'fusions' where X stands for a homologue of arg(A, we retrieved a large number of Bacteria and several Archaea, all of them devoid of a classical NAGS. In the case of Thermus thermophilus and Deinococcus radiodurans, the arg(A-like sequence

  8. Mismatch Repair during Homologous and Homeologous Recombination

    Science.gov (United States)

    Spies, Maria; Fishel, Richard

    2015-01-01

    Homologous recombination (HR) and mismatch repair (MMR) are inextricably linked. HR pairs homologous chromosomes before meiosis I and is ultimately responsible for generating genetic diversity during sexual reproduction. HR is initiated in meiosis by numerous programmed DNA double-strand breaks (DSBs; several hundred in mammals). A characteristic feature of HR is the exchange of DNA strands, which results in the formation of heteroduplex DNA. Mismatched nucleotides arise in heteroduplex DNA because the participating parental chromosomes contain nonidentical sequences. These mismatched nucleotides may be processed by MMR, resulting in nonreciprocal exchange of genetic information (gene conversion). MMR and HR also play prominent roles in mitotic cells during genome duplication; MMR rectifies polymerase misincorporation errors, whereas HR contributes to replication fork maintenance, as well as the repair of spontaneous DSBs and genotoxic lesions that affect both DNA strands. MMR suppresses HR when the heteroduplex DNA contains excessive mismatched nucleotides, termed homeologous recombination. The regulation of homeologous recombination by MMR ensures the accuracy of DSB repair and significantly contributes to species barriers during sexual reproduction. This review discusses the history, genetics, biochemistry, biophysics, and the current state of studies on the role of MMR in homologous and homeologous recombination from bacteria to humans. PMID:25731766

  9. Rates of star formation

    International Nuclear Information System (INIS)

    Larson, R.B.

    1977-01-01

    It is illustrated that a theoretical understanding of the formation and evolution of galaxies depends on an understanding of star formation, and especially of the factors influencing the rate of star formation. Some of the theoretical problems of star formation in galaxies, some approaches that have been considered in models of galaxy evolution, and some possible observational tests that may help to clarify which processes or models are most relevant are reviewed. The material is presented under the following headings: power-law models for star formation, star formation processes (conditions required, ways of achieving these conditions), observational indications and tests, and measures of star formation rates in galaxies. 49 references

  10. Formate Formation and Formate Conversion in Biological Fuels Production

    Directory of Open Access Journals (Sweden)

    Bryan R. Crable

    2011-01-01

    Full Text Available Biomethanation is a mature technology for fuel production. Fourth generation biofuels research will focus on sequestering CO2 and providing carbon-neutral or carbon-negative strategies to cope with dwindling fossil fuel supplies and environmental impact. Formate is an important intermediate in the methanogenic breakdown of complex organic material and serves as an important precursor for biological fuels production in the form of methane, hydrogen, and potentially methanol. Formate is produced by either CoA-dependent cleavage of pyruvate or enzymatic reduction of CO2 in an NADH- or ferredoxin-dependent manner. Formate is consumed through oxidation to CO2 and H2 or can be further reduced via the Wood-Ljungdahl pathway for carbon fixation or industrially for the production of methanol. Here, we review the enzymes involved in the interconversion of formate and discuss potential applications for biofuels production.

  11. Formate Formation and Formate Conversion in Biological Fuels Production

    OpenAIRE

    Crable, Bryan R.; Plugge, Caroline M.; McInerney, Michael J.; Stams, Alfons J. M.

    2011-01-01

    Biomethanation is a mature technology for fuel production. Fourth generation biofuels research will focus on sequestering CO2 and providing carbon-neutral or carbon-negative strategies to cope with dwindling fossil fuel supplies and environmental impact. Formate is an important intermediate in the methanogenic breakdown of complex organic material and serves as an important precursor for biological fuels production in the form of methane, hydrogen, and potentially methanol. Formate is...

  12. Gene expression

    International Nuclear Information System (INIS)

    Hildebrand, C.E.; Crawford, B.D.; Walters, R.A.; Enger, M.D.

    1983-01-01

    We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn 2+ or Cd 2+ . We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully

  13. The Format Dilemma.

    Science.gov (United States)

    Oder, Norman

    2002-01-01

    Reports results of a survey of public libraries that investigated trends in audiovisual materials. Highlights include format issues; audiobooks; media budgets for various formats; video collections; DVDs; circulation; collection sizes; music CDs; and future possibilities. (LRW)

  14. Gene circuit analysis of the terminal gap gene huckebein.

    Directory of Open Access Journals (Sweden)

    Maksat Ashyraliyev

    2009-10-01

    Full Text Available The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network.

  15. Single gene deletions of mrpA to mrpG and mrpE point mutations affect activity of the Mrp Na+/H+ antiporter of alkaliphilic Bacillus and formation of hetero-oligomeric Mrp complexes.

    Science.gov (United States)

    Morino, Masato; Natsui, Shinsuke; Swartz, Talia H; Krulwich, Terry A; Ito, Masahiro

    2008-06-01

    Mrp antiporters catalyze secondary Na(+)(Li(+))/H(+) antiport and/or K(+)/H(+) antiport that is physiologically important in diverse bacteria. An additional capacity for anion flux has been observed for a few systems. Mrp is unique among antiporters in that it requires all six or seven hydrophobic gene products (MrpA to MrpG) of the mrp operon for full antiporter activity, but MrpE has been reported to be dispensable. Here, the membrane complexes formed by Mrp proteins were examined using a cloned mrp operon from alkaliphilic Bacillus pseudofirmus OF4. The operon was engineered so that the seven Mrp proteins could be detected in single samples. Membrane extracts of an antiporter-deficient Escherichia coli strain expressing this construct were analyzed by blue native-sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Mrp complexes of two sizes were identified containing all seven Mrp proteins. Studies of the single nonpolar mrp gene deletions in the construct showed that a subcomplex of MrpA, MrpB, MrpC, and MrpD was formed in the absence of MrpE, MrpF, or MrpG. By contrast, MrpE, MrpF, and MrpG were not observed in membranes lacking MrpA, MrpB, MrpC, or MrpD. Although MrpA and MrpD have been hypothesized to be the antiporter proteins, the MrpA-to-D complex was inactive. Every Mrp protein was required for an activity level near that of the wild-type Na(+)/H(+) antiporter, but a very low activity level was observed in the absence of MrpE. The introduction of an MrpE(P114G) mutation into the full Mrp complex led to antiport activity with a greatly increased apparent K(m) value for Na(+). The results suggested that interactions among the proteins of heterooligomeric Mrp complexes strongly impact antiporter properties.

  16. Formate Formation and Formate Conversion in Biological Fuels Production

    NARCIS (Netherlands)

    Crable, B.R.; Plugge, C.M.; McInerney, M.J.; Stams, A.J.M.

    2011-01-01

    Biomethanation is a mature technology for fuel production. Fourth generation biofuels research will focus on sequestering CO2 and providing carbon-neutral or carbon-negative strategies to cope with dwindling fossil fuel supplies and environmental impact. Formate is an important intermediate in the

  17. Trichoderma genes

    Science.gov (United States)

    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  18. Imaging after vascular gene therapy

    International Nuclear Information System (INIS)

    Manninen, Hannu I.; Yang, Xiaoming

    2005-01-01

    Targets for cardiovascular gene therapy currently include limiting restenosis after balloon angioplasty and stent placement, inhibiting vein bypass graft intimal hyperplasia/stenosis, therapeutic angiogenesis for cardiac and lower-limb ischemia, and prevention of thrombus formation. While catheter angiography is still standard method to follow-up vascular gene transfer, other modern imaging techniques, especially intravascular ultrasound (IVUS), magnetic resonance (MR), and positron emission tomography (PET) imaging provide complementary information about the therapeutic effect of vascular gene transfer in humans. Although molecular imaging of therapeutic gene expression in the vasculatures is still in its technical development phase, it has already offered basic medical science an extremely useful in vivo evaluation tool for non- or minimally invasive imaging of vascular gene therapy

  19. CytR Homolog of Pectobacterium carotovorum subsp. carotovorum Controls Air-Liquid Biofilm Formation by Regulating Multiple Genes Involved in Cellulose Production, c-di-GMP Signaling, Motility, and Type III Secretion System in Response to Nutritional and Environmental Signals.

    Science.gov (United States)

    Haque, M M; Oliver, M M H; Nahar, Kamrun; Alam, Mohammad Z; Hirata, Hisae; Tsuyumu, Shinji

    2017-01-01

    Pectobacterium carotovorum subsp. carotovorum [Pcc (formerly Erwinia carotovora subsp. carotovora )] PC1 causes soft-rot disease in a wide variety of plant species by secreting multiple pathogenicity-related traits. In this study, regulatory mechanism of a ir- l iquid (AL) biofilm formation was studied using a cytR homolog gene deletion mutant (Δ cytR ) of Pcc PC1. Compared to the wild type (Pcc PC1), the Δ cytR mutant produced fragile and significantly ( P < 0.001) lower amounts of AL biofilm on s alt- o ptimized b roth plus 2% g lycerol (SOBG), yeast peptone dextrose adenine, and also on King's B at 27°C after 72 h incubation in static condition. The wild type also produced significantly higher quantities of AL biofilm on SOBGMg - (magnesium deprived) containing Cupper (Cu 2+ ), Zinc (Zn 2+ ), Manganese (Mn 2+ ), Magnesium (Mg 2+ ), and Calcium (Ca 2+ ) compared to the Δ cytR mutant. Moreover, the wild type was produced higher amounts of biofilms compared to the mutant while responding to pH and osmotic stresses. The Δ fliC (encoding flagellin), flhD ::Tn5 (encoding a master regulator) and Δ motA (a membrane protein essential for flagellar rotation) mutants produced a lighter and more fragile AL biofilm on SOBG compared to their wild counterpart. All these mutants resulted in having weak bonds with the cellulose specific dye (Calcofluor) producing lower quantities of cellulose compared to the wild type. Gene expression analysis using mRNA collected from the AL biofilms showed that Δ cytR mutant significantly ( P < 0.001) reduced the expressions of multiple genes responsible for cellulose production ( bcsA, bcsE , and adrA ), motility ( flhD, fliA, fliC , and motA ) and type III secretion system ( hrpX, hrpL, hrpA , and hrpN ) compared to the wild type. The CytR homolog was therefore, argued to be able to regulate the AL biofilm formation by controlling cellulose production, motility and T3SS in Pcc PC1. In addition, all the mutants exhibited poorer

  20. CytR Homolog of Pectobacterium carotovorum subsp. carotovorum Controls Air-Liquid Biofilm Formation by Regulating Multiple Genes Involved in Cellulose Production, c-di-GMP Signaling, Motility, and Type III Secretion System in Response to Nutritional and Environmental Signals

    Directory of Open Access Journals (Sweden)

    M. M. Haque

    2017-05-01

    Full Text Available Pectobacterium carotovorum subsp. carotovorum [Pcc (formerly Erwinia carotovora subsp. carotovora] PC1 causes soft-rot disease in a wide variety of plant species by secreting multiple pathogenicity-related traits. In this study, regulatory mechanism of air-liquid (AL biofilm formation was studied using a cytR homolog gene deletion mutant (ΔcytR of Pcc PC1. Compared to the wild type (Pcc PC1, the ΔcytR mutant produced fragile and significantly (P < 0.001 lower amounts of AL biofilm on salt-optimized broth plus 2% glycerol (SOBG, yeast peptone dextrose adenine, and also on King’s B at 27°C after 72 h incubation in static condition. The wild type also produced significantly higher quantities of AL biofilm on SOBGMg– (magnesium deprived containing Cupper (Cu2+, Zinc (Zn2+, Manganese (Mn2+, Magnesium (Mg2+, and Calcium (Ca2+ compared to the ΔcytR mutant. Moreover, the wild type was produced higher amounts of biofilms compared to the mutant while responding to pH and osmotic stresses. The ΔfliC (encoding flagellin, flhD::Tn5 (encoding a master regulator and ΔmotA (a membrane protein essential for flagellar rotation mutants produced a lighter and more fragile AL biofilm on SOBG compared to their wild counterpart. All these mutants resulted in having weak bonds with the cellulose specific dye (Calcofluor producing lower quantities of cellulose compared to the wild type. Gene expression analysis using mRNA collected from the AL biofilms showed that ΔcytR mutant significantly (P < 0.001 reduced the expressions of multiple genes responsible for cellulose production (bcsA, bcsE, and adrA, motility (flhD, fliA, fliC, and motA and type III secretion system (hrpX, hrpL, hrpA, and hrpN compared to the wild type. The CytR homolog was therefore, argued to be able to regulate the AL biofilm formation by controlling cellulose production, motility and T3SS in Pcc PC1. In addition, all the mutants exhibited poorer attachment to radish sprouts and AL

  1. Studies of the variability of the hepatocyte nuclear factor-1beta (HNF-1beta / TCF2) and the dimerization cofactor of HNF-1 (DcoH / PCBD) genes in relation to type 2 diabetes mellitus and beta-cell function

    DEFF Research Database (Denmark)

    Ek, J; Grarup, N; Urhammer, S A

    2001-01-01

    , and 46 type 2 diabetic patients with an impaired beta-cell function by combined single-strand conformation polymorphism (SSCP) and heteroduplex analysis. Analysis of the promoter and nine exons including intron-exon boundaries of the HNF-1beta gene revealed one novel silent polymorphism and three...... previously reported intronic variants. The silent polymorphism (I91I) was found in one patient with late-onset type 2 diabetes. One of the intronic variant (IVS6+26T-->C) was examined further. Among 584 type 2 diabetic patients the allelic frequency was 13.1% (11.2-15.0%) compared to 11.6% (8.6-14.5%) in 229......Mutations in the homeodomain-containing transcription factor hepatocyte nuclear factor-1beta (HNF-1beta) are known to cause a rare subtype of maturity-onset diabetes of the young (MODY5), which is associated with early-onset progressive non-diabetic renal dysfunction. To investigate whether...

  2. Methylated genes as new cancer biomarkers.

    NARCIS (Netherlands)

    Duffy, M.J.; Napieralski, R.; Martens, J.W.; Span, P.N.; Spyratos, F.; Sweep, C.G.J.; Brunner, N.; Foekens, J.A.; Schmitt, M.

    2009-01-01

    Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested that

  3. Molecular marker genes for ectomycorrhizal symbiosis

    Science.gov (United States)

    Shiv Hiremath; Carolyn McQuattie; Gopi Podila; Jenise. Bauman

    2013-01-01

    Mycorrhizal symbiosis is a mutually beneficial association very commonly found among most vascular plants. Formation of mycorrhiza happens only between compatible partners and predicting this is often accomplished through a trial and error process. We investigated the possibility of using expression of symbiosis specific genes as markers to predict the formation of...

  4. Formation Flying Concept Issues

    Directory of Open Access Journals (Sweden)

    M. V. Palkin

    2015-01-01

    Full Text Available The term “formation flying” implies coordinated movement of at least two satellites on coplanar and non-coplanar orbits with a maximum distance between them being much less than the length of the orbit. Peculiarities of formation flying concept also include:- automatic coordination of satellites;- sub-group specialization of formation flying satellites;- equipment and data exchange technology unification in each specialized group or subgroup.Formation flying satellites can be classified according to the configuration stability level (order (array, cluster («swarm», intergroup specialization rules («central satellite», «leader», «slave», manoeuvrability («active» and «passive» satellites.Tasks of formation flying include:- experiments with payload, distributed in formation flying satellites;- various near-earth space and earth-surface research;- super-sized aperture antenna development;- land-based telescope calibration;- «space advertisement» (earth-surface observable satellite compositions of a logotype, word, etc.;- orbital satellite maintenance, etc.Main issues of formation flying satellite system design are:- development of an autonomous satellite group manoeuvring technology;- providing a sufficient characteristic velocity of formation flying satellites;- ballistic and navigation maintenance for satellite formation flying;- technical and economic assessment of formation flying orbital delivery and deployment;- standardization, unification, miniaturization and integration of equipment;- intergroup and intersatellite function redistribution.

  5. From Sermon Formation to Preacher Formation

    DEFF Research Database (Denmark)

    Gaarden, Marianne

    2016-01-01

    today is less about exercising the authority of an office and more about embodying authenticity. I argue that traditional homiletic education can benefit from implementing a learner-centered approach to teaching moving from sermon formation towards preacher formation, in order to develop and train...... judged, evaluated, or critiqued. In this paper, I explain how a learner-centered approach to education works in practice and show how pastors experience the teaching method and the congregations’ positive response to their improvements. I shall present the results of a focus-group interview with pastors...

  6. Immunoglobulin genes

    National Research Council Canada - National Science Library

    Honjo, T; Alt, F. W; Rabbitts, T. H

    1989-01-01

    ... Cataloguing in Publication Data Immunoglobulin genes 1. Vertebrates. Immunoglobulins 1. Honjo, T. II. Alt, F.W. III. Rabbitts, T.H. 612'. 118223 ISBN 0-12-354865-9 This book is printed on acid-free paper ( T...

  7. Ageing genes

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2018-01-01

    The idea of gerontogenes is in line with the evolutionary explanation of ageing as being an emergent phenomenon as a result of the imperfect maintenance and repair systems. Although evolutionary processes did not select for any specific ageing genes that restrict and determine the lifespan...... of an individual, the term ‘gerontogenes’ primarily refers to any genes that may seem to influence ageing and longevity, without being specifically selected for that role. Such genes can also be called ‘virtual gerontogenes’ by virtue of their indirect influence on the rate and process of ageing. More than 1000...... virtual gerontogenes have been associated with ageing and longevity in model organisms and humans. The ‘real’ genes, which do influence the essential lifespan of a species, and have been selected for in accordance with the evolutionary life history of the species, are known as the longevity assurance...

  8. Stages of ores formation

    International Nuclear Information System (INIS)

    Khasanov, A.Kh.

    1988-01-01

    Deposit formation (especially endogenous) is the complicated, multi-stage and long process. Establishment of deposit formation succession, age-specific correlations of minerals and aggregates have a high importance at solving genetic questions. Studying of minerals correlations and mineral aggregates, succession of their crystallization and other observations let restore the history of deposit formation, pick up in it different on duration and physical and chemical conditions stages

  9. Understanding Alliance Formation Patterns

    Science.gov (United States)

    2015-12-01

    might take a different trend in different eras, in which it is either positive, leading to a bigger chance of alliance formation , or negative, leading...of war and peace with regard to systemic analysis. Therefore, it is reasonable that there is a deviation in the trends of alliance formation during...ALLIANCE FORMATION PATTERNS by Wael Abbas Zoltan Schneider December 2015 Thesis Advisor: William P. Fox Second Reader: Heather S. Gregg

  10. Exploring Opponent Formats

    DEFF Research Database (Denmark)

    Jensen, Mads Møller; Rasmussen, Majken; Grønbæk, Kaj

    2013-01-01

    of how the opponent format and relationships impact a game are almost absent in current research. Thus, this paper aims to elucidate how the perception of a competition differs, depending on the opponent format, by presenting a game mechanic framework. The paper furthermore presents an interactive...... football-training platform, as well as games designed to explore the different opponent formats. The games are qualitatively evaluated to illuminate the qualities of and distinctions between different types of opponent formats, proposed by the framework terminology....

  11. ENDF/B format

    International Nuclear Information System (INIS)

    Khalil, M.A.; Lemmel, H.D.

    1986-09-01

    This document is a brief user's description of the format of ENDF/B. This format, originally designed for the US Evaluated Nuclear Data File, is recommended for international use. This summary is an aid to customers of the IAEA Nuclear Data Section when receiving data retrievals in ENDF/B format. For more detailed information the report BNL-NCS-50496 (ENDF 102) should be consulted. An Appendix to the present document gives a summary of the format differences between ENDF/B-4 and ENDF/B-5. (author)

  12. Data format translation routines

    International Nuclear Information System (INIS)

    Burris, R.D.

    1981-02-01

    To enable the effective connection of several dissimilar computers into a network, modification of the data being passed from one computer to another may become necessary. This document describes a package of routines which permit the translation of data in PDP-8 formats to PDP-11 or DECsystem-10 formats or from PDP-11 format to DECsystem-10 format. Additional routines are described which permit the effective use of the translation routines in the environment of the Fusion Energy Division (FED) network and the Elmo Bumpy Torus (EBT) data base

  13. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.

    Directory of Open Access Journals (Sweden)

    Xiuchun Ge

    Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.

  14. Determining Semantically Related Significant Genes.

    Science.gov (United States)

    Taha, Kamal

    2014-01-01

    GO relation embodies some aspects of existence dependency. If GO term xis existence-dependent on GO term y, the presence of y implies the presence of x. Therefore, the genes annotated with the function of the GO term y are usually functionally and semantically related to the genes annotated with the function of the GO term x. A large number of gene set enrichment analysis methods have been developed in recent years for analyzing gene sets enrichment. However, most of these methods overlook the structural dependencies between GO terms in GO graph by not considering the concept of existence dependency. We propose in this paper a biological search engine called RSGSearch that identifies enriched sets of genes annotated with different functions using the concept of existence dependency. We observe that GO term xcannot be existence-dependent on GO term y, if x- and y- have the same specificity (biological characteristics). After encoding into a numeric format the contributions of GO terms annotating target genes to the semantics of their lowest common ancestors (LCAs), RSGSearch uses microarray experiment to identify the most significant LCA that annotates the result genes. We evaluated RSGSearch experimentally and compared it with five gene set enrichment systems. Results showed marked improvement.

  15. ENDF/B Format

    International Nuclear Information System (INIS)

    Khalil, M.A.

    1975-01-01

    This document is a brief user's description of the format of ENDF/B, the evaluated neutron nuclear data library of the US National Nuclear Data Center. This summary is an aid to customers of the IAEA Nuclear Data Section when receiving data retrievals in ENDF/B format. For more detailed information the report BNL-50274 (ENDF-102) should be consulted. (author)

  16. Diminutive formations in Xitsonga

    African Journals Online (AJOL)

    Kate H

    Introduction. In Xitsonga diminutive formation, the juncture between the root and the suffix undergoes various phonological processes: glide formation, velarisation and vowel deletion. We argue that these seemingly disjointed processes are results of repair strategies that apply in order to avoid a sequence of labial sounds.

  17. Divisions-ST Formation

    CERN Document Server

    Henny, L

    2001-01-01

    Au CERN la formation est une partie intégrante des activités de l'Organisation. Mentionnée dans le Statut du Personnel depuis l'origine, elle figure au Règlement depuis 1981 et est largement explicitée dans la Circulaire Administrative N° 16. L'organe réglementaire est constitué par la Commission Paritaire de Formation (Joint Training Board dont le sigle est JTB) qui a pour but de conseiller le Directeur Général en matière de formation, de définir la politique de formation et d'en faire l'évaluation. Des organes spécifiques ont été mis en place pour organiser les différents programmes : le Groupe Formation et Développement, le Comité exécutif de formation (sigle TEC), le Comité d'enseignement académique. Des délégués divisionnaires à la formation (sigle DTO) servent de courroie de transmission entre ces organes, le personnel et le Service de l'Enseignement (Div. HR). La Division ST dont les activités présentent une grande variété se doit de poursuivre une politique de formation s...

  18. A Systems-Level Approach for Investigating Pseudomonas aeruginosa Biofilm Formation

    Science.gov (United States)

    Xu, Zhaobin; Fang, Xin; Wood, Thomas K.; Huang, Zuyi Jacky

    2013-01-01

    Prevention of the initiation of biofilm formation is the most important step for combating biofilm-associated pathogens, as the ability of pathogens to resist antibiotics is enhanced 10 to 1000 times once biofilms are formed. Genes essential to bacterial growth in the planktonic state are potential targets to treat biofilm-associated pathogens. However, the biofilm formation capability of strains with mutations in these essential genes must be evaluated, since the pathogen might form a biofilm before it is eliminated. In order to address this issue, this work proposes a systems-level approach to quantifying the biofilm formation capability of mutants to determine target genes that are essential for bacterial metabolism in the planktonic state but do not induce biofilm formation in their mutants. The changes of fluxes through the reactions associated with the genes positively related to biofilm formation are used as soft sensors in the flux balance analysis to quantify the trend of biofilm formation upon the mutation of an essential gene. The essential genes whose mutants are predicted not to induce biofilm formation are regarded as gene targets. The proposed approach was applied to identify target genes to treat Pseudomonas aeruginosa infections. It is interesting to find that most essential gene mutants exhibit high potential to induce the biofilm formation while most non-essential gene mutants do not. Critically, we identified four essential genes, lysC, cysH, adk, and galU, that constitute gene targets to treat P. aeruginosa. They have been suggested by existing experimental data as potential drug targets for their crucial role in the survival or virulence of P. aeruginosa. It is also interesting to find that P. aeruginosa tends to survive the essential-gene mutation treatment by mainly enhancing fluxes through 8 metabolic reactions that regulate acetate metabolism, arginine metabolism, and glutamate metabolism. PMID:23451140

  19. Histological and Transcriptomic Analysis during Bulbil Formation in Lilium lancifolium

    Directory of Open Access Journals (Sweden)

    Panpan Yang

    2017-08-01

    Full Text Available Aerial bulbils are an important propagative organ, playing an important role in population expansion. However, the detailed gene regulatory patterns and molecular mechanism underlying bulbil formation remain unclear. Triploid Lilium lancifolium, which develops many aerial bulbils on the leaf axils of middle-upper stem, is a useful species for investigating bulbil formation. To investigate the mechanism of bulbil formation in triploid L. lancifolium, we performed histological and transcriptomic analyses using samples of leaf axils located in the upper and lower stem of triploid L. lancifolium during bulbil formation. Histological results indicated that the bulbils of triploid L. lancifolium are derived from axillary meristems that initiate de novo from cells on the adaxial side of the petiole base. Transcriptomic analysis generated ~650 million high-quality reads and 11,871 differentially expressed genes (DEGs. Functional analysis showed that the DEGs were significantly enriched in starch and sucrose metabolism and plant hormone signal transduction. Starch synthesis and accumulation likely promoted the initiation of upper bulbils in triploid L. lancifolium. Hormone-associated pathways exhibited distinct patterns of change in each sample. Auxin likely promoted the initiation of bulbils and then inhibited further bulbil formation. High biosynthesis and low degradation of cytokinin might have led to bulbil formation in the upper leaf axil. The present study achieved a global transcriptomic analysis focused on gene expression changes and pathways' enrichment during upper bulbil formation in triploid L. lancifolium, laying a solid foundation for future molecular studies on bulbil formation.

  20. Industrial scale gene synthesis.

    Science.gov (United States)

    Notka, Frank; Liss, Michael; Wagner, Ralf

    2011-01-01

    The most recent developments in the area of deep DNA sequencing and downstream quantitative and functional analysis are rapidly adding a new dimension to understanding biochemical pathways and metabolic interdependencies. These increasing insights pave the way to designing new strategies that address public needs, including environmental applications and therapeutic inventions, or novel cell factories for sustainable and reconcilable energy or chemicals sources. Adding yet another level is building upon nonnaturally occurring networks and pathways. Recent developments in synthetic biology have created economic and reliable options for designing and synthesizing genes, operons, and eventually complete genomes. Meanwhile, high-throughput design and synthesis of extremely comprehensive DNA sequences have evolved into an enabling technology already indispensable in various life science sectors today. Here, we describe the industrial perspective of modern gene synthesis and its relationship with synthetic biology. Gene synthesis contributed significantly to the emergence of synthetic biology by not only providing the genetic material in high quality and quantity but also enabling its assembly, according to engineering design principles, in a standardized format. Synthetic biology on the other hand, added the need for assembling complex circuits and large complexes, thus fostering the development of appropriate methods and expanding the scope of applications. Synthetic biology has also stimulated interdisciplinary collaboration as well as integration of the broader public by addressing socioeconomic, philosophical, ethical, political, and legal opportunities and concerns. The demand-driven technological achievements of gene synthesis and the implemented processes are exemplified by an industrial setting of large-scale gene synthesis, describing production from order to delivery. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Comparative Studies on Callose Formation in Powdery Mildew Compatible and Incompatible Barley

    DEFF Research Database (Denmark)

    Skou, Jens-Peder; Jørgensen, Jørgen Helms; Lilholt, Ulla

    1984-01-01

    penetration Ml-(La) resistant varieties and near-isogenic lines in 'Manchuria' with resistance genes in 5 other loci showed only a tendency to a larger callose formation than their susceptible counterparts after inoculation with avirulent as well as virulent powdery mildew. The callose formation in ml......Callose formation in barley mutants, lines and varieties with different genes for resistance to powdery mildew in seven different loci was compared. Only barley with resistance genes in the ml-o locus showed so early a callose formation passing off at such a high rate that it prevented fungal...

  2. Evidence for Parallel Processing of Sensory Information Controlling Dauer Formation in Caenorhabditis Elegans

    OpenAIRE

    Thomas, J. H.; Birnby, D. A.; Vowels, J. J.

    1993-01-01

    Dauer formation in Caenorhabditis elegans is induced by chemosensation of high levels of a constitutively secreted pheromone. Seven genes defined by mutations that confer a dauer-formation constitutive phenotype (Daf-c) can be congruently divided into two groups by any of three criteria. Group 1 genes (daf-11 and daf-21) are (1) strongly synergistic with group 2 genes for their Daf-c phenotype, (2) incompletely suppressed by dauer-formation defective (Daf-d) mutations in the genes daf-3 and d...

  3. Gene Locater

    DEFF Research Database (Denmark)

    Anwar, Muhammad Zohaib; Sehar, Anoosha; Rehman, Inayat-Ur

    2012-01-01

    software's for calculating recombination frequency is mostly limited to the range and flexibility of this type of analysis. GENE LOCATER is a fully customizable program for calculating recombination frequency, written in JAVA. Through an easy-to-use interface, GENE LOCATOR allows users a high degree...... of flexibility in calculating genetic linkage and displaying linkage group. Among other features, this software enables user to identify linkage groups with output visualized graphically. The program calculates interference and coefficient of coincidence with elevated accuracy in sample datasets. AVAILABILITY......: The database is available for free at http://www.moperandib.com....

  4. Functional and evolutionary studies of type I MADS box genes in Petunia hybrida and arabidopsis thaliana

    NARCIS (Netherlands)

    Bemer, Marian

    2008-01-01

    MADS-box genes are very important for plant development and especially for the formation of the flower. The MADS box family of transcription factors in plants can be subdivided into two classes: the MIKC-type genes, which play essential roles in flower formation, and the type I genes, which are

  5. Manuel UNIMARC format bibliographique

    CERN Document Server

    2007-01-01

    This manual is the French translation of the second edition of UNIMARC Manual: bibliographic format published in English in 1994 and completed by 5 updates published from 1996 to 2005. This 5th French edition is composite. It reproduces identically a part of the 4th edition published in 2002 and, for the fields of the format modified in the Update 5, it offers a new more structured presentation. This is a handbook dedicated to French-speaking users of the UNIMARC format for bibliographic descriptions.

  6. Messenger RNA 3' end formation in plants.

    Science.gov (United States)

    Hunt, A G

    2008-01-01

    Messenger RNA 3' end formation is an integral step in the process that gives rise to mature, translated messenger RNAs in eukaryotes. With this step, a pre-messenger RNA is processed and polyadenylated, giving rise to a mature mRNA bearing the characteristic poly(A) tract. The poly(A) tract is a fundamental feature of mRNAs, participating in the process of translation initiation and being the focus of control mechanisms that define the lifetime of mRNAs. Thus messenger RNA 3' end formation impacts two steps in mRNA biogenesis and function. Moreover, mRNA 3' end formation is something of a bridge that integrates numerous other steps in mRNA biogenesis and function. While the process is essential for the expression of most genes, it is also one that is subject to various forms of regulation, such that both quantitative and qualitative aspects of gene expression may be modulated via the polyadenylation complex. In this review, the current status of understanding of mRNA 3' end formation in plants is discussed. In particular, the nature of mRNA 3' ends in plants is reviewed, as are recent studies that are beginning to yield insight into the functioning and regulation of plant polyadenylation factor subunits.

  7. Epigenetic mechanisms in experience-driven memory formation and behavior

    Science.gov (United States)

    Puckett, Rosemary E; Lubin, Farah D

    2011-01-01

    Epigenetic mechanisms have long been associated with the regulation of gene-expression changes accompanying normal neuronal development and cellular differentiation; however, until recently these mechanisms were believed to be statically quiet in the adult brain. Behavioral neuroscientists have now begun to investigate these epigenetic mechanisms as potential regulators of gene-transcription changes in the CNS subserving synaptic plasticity and long-term memory (LTM) formation. Experimental evidence from learning and memory animal models has demonstrated that active chromatin remodeling occurs in terminally differentiated postmitotic neurons, suggesting that these molecular processes are indeed intimately involved in several stages of LTM formation, including consolidation, reconsolidation and extinction. Such chromatin modifications include the phosphorylation, acetylation and methylation of histone proteins and the methylation of associated DNA to subsequently affect transcriptional gene readout triggered by learning. The present article examines how such learning-induced epigenetic changes contribute to LTM formation and influence behavior. In particular, this article is a survey of the specific epigenetic mechanisms that have been demonstrated to regulate gene expression for both transcription factors and growth factors in the CNS, which are critical for LTM formation and storage, as well as how aberrant epigenetic processing can contribute to psychological states such as schizophrenia and drug addiction. Together, the findings highlighted in this article support a novel role for epigenetic mechanisms in the adult CNS serving as potential key molecular regulators of gene-transcription changes necessary for LTM formation and adult behavior. PMID:22126252

  8. Epigenetic mechanisms in experience-driven memory formation and behavior.

    Science.gov (United States)

    Puckett, Rosemary E; Lubin, Farah D

    2011-10-01

    Epigenetic mechanisms have long been associated with the regulation of gene-expression changes accompanying normal neuronal development and cellular differentiation; however, until recently these mechanisms were believed to be statically quiet in the adult brain. Behavioral neuroscientists have now begun to investigate these epigenetic mechanisms as potential regulators of gene-transcription changes in the CNS subserving synaptic plasticity and long-term memory (LTM) formation. Experimental evidence from learning and memory animal models has demonstrated that active chromatin remodeling occurs in terminally differentiated postmitotic neurons, suggesting that these molecular processes are indeed intimately involved in several stages of LTM formation, including consolidation, reconsolidation and extinction. Such chromatin modifications include the phosphorylation, acetylation and methylation of histone proteins and the methylation of associated DNA to subsequently affect transcriptional gene readout triggered by learning. The present article examines how such learning-induced epigenetic changes contribute to LTM formation and influence behavior. In particular, this article is a survey of the specific epigenetic mechanisms that have been demonstrated to regulate gene expression for both transcription factors and growth factors in the CNS, which are critical for LTM formation and storage, as well as how aberrant epigenetic processing can contribute to psychological states such as schizophrenia and drug addiction. Together, the findings highlighted in this article support a novel role for epigenetic mechanisms in the adult CNS serving as potential key molecular regulators of gene-transcription changes necessary for LTM formation and adult behavior.

  9. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  10. Cosmology and galaxy formation

    International Nuclear Information System (INIS)

    Rees, M.J.

    1977-01-01

    Implications of the massive halos and ''missing mass'' for galaxy formation are addressed; it is suggested that this mass consists of ''Population III'' stars that formed before the galaxies did. 19 references

  11. PCF File Format.

    Energy Technology Data Exchange (ETDEWEB)

    Thoreson, Gregory G [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-08-01

    PCF files are binary files designed to contain gamma spectra and neutron count rates from radiation sensors. It is the native format for the GAmma Detector Response and Analysis Software (GADRAS) package [1]. It can contain multiple spectra and information about each spectrum such as energy calibration. This document outlines the format of the file that would allow one to write a computer program to parse and write such files.

  12. Kaffir lime leaves extract inhibits biofilm formation by Streptococcus mutans.

    Science.gov (United States)

    Kooltheat, Nateelak; Kamuthachad, Ludthawun; Anthapanya, Methinee; Samakchan, Natthapon; Sranujit, Rungnapa Pankla; Potup, Pachuen; Ferrante, Antonio; Usuwanthim, Kanchana

    2016-04-01

    Although kaffir lime has been reported to exhibit antioxidant and antileukemic activity, little is known about the antimicrobial effect of kaffir lime extract. Because Streptococcus mutans has been known to cause biofilm formation, it has been considered the most important causative pathogen of dental caries. Thus, the effective control of its effects on the oral biofilm is the key to the prevention of dental caries. The aims of the present study were to investigate the effect of kaffir lime leaves extract on biofilm formation and its antibacterial activity on S. mutans. We examined the effect of kaffir lime leaves extract on growth and biofilm formation of S. mutans. For the investigation we used a kaffir lime extract with high phenolic content. The minimum inhibitory concentration of the extract was determined by broth microdilution assay. The inhibitory effect of the test substances on biofilm formation was also investigated by biofilm formation assay and qRT-PCR of biofilm formation-associated genes. Kaffir lime leaves extract inhibits the growth of S. mutans, corresponding to the activity of an antibiotic, ampicillin. Formation of biofilm by S. mutans was also inhibited by the extract. These results were confirmed by the down-regulation of genes associated with the biofilm formation. The findings highlight the ability of kaffir lime leaves extract to inhibit S. mutans activity, which may be beneficial in the prevention of biofilm formation on dental surface, reducing dental plaque and decreasing the chance of dental carries. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Autonomous Formation Flight

    Science.gov (United States)

    Schkolnik, Gerard S.; Cobleigh, Brent

    2004-01-01

    NASA's Strategic Plan for the Aerospace Technology Enterprise includes ambitious objectives focused on affordable air travel, reduced emissions, and expanded aviation-system capacity. NASA Dryden Flight Research Center, in cooperation with NASA Ames Research Center, the Boeing Company, and the University of California, Los Angeles, has embarked on an autonomous-formation-flight project that promises to make significant strides towards these goals. For millions of years, birds have taken advantage of the aerodynamic benefit of flying in formation. The traditional "V" formation flown by many species of birds (including gulls, pelicans, and geese) enables each of the trailing birds to fly in the upwash flow field that exists just outboard of the bird immediately ahead in the formation. The result for each trailing bird is a decrease in induced drag and thus a reduction in the energy needed to maintain a given speed. Hence, for migratory birds, formation flight extends the range of the system of birds over the range of birds flying solo. The Autonomous Formation Flight (AFF) Project is seeking to extend this symbiotic relationship to aircraft.

  14. Novel CFTR missense mutations in Brazilian patients with congenital absence of vas deferens: counseling issues Mutações novas no gene CFTR de pacientes brasileiros portadores de agenesia dos vasos deferentes: dificuldades no aconselhamento

    Directory of Open Access Journals (Sweden)

    Patricia de Campos Pieri

    2007-01-01

    Full Text Available PURPOSE: Screening for mutations in the entire Cystic Fibrosis gene (CFTR of Brazilian infertile men with congenital absence of vas deferens, in order to prevent transmission of CFTR mutations to offspring with the use of assisted reproductive technologies. METHOD: Specific polymerase chain reaction (PCR primers were designed to each of the 27 exons and splicing sites of interest followed by single strand conformational polymorphism and Heteroduplex Analysis (SSCP-HA in precast 12.5% polyacrylamide gels at 7ºC and 20ºC. Fragments with abnormal SSCP migration pattern were sequenced. RESULTS: Two novel missense mutations (S753R and G149W were found in three patients (two brothers together with the IVS8-5T allele in hetrozygosis. CONCLUSION: The available screenings for CF mutations do not include the atypical mutations associated to absence of vas deferens and thus, when these tests fail to find mutations, there is still a genetic risk of affected children with the help of assisted reproduction. We recommend the screening of the whole CFTR gene for these infertile couples, as part of the work-up before assisted reproduction.OBJETIVO: Pesquisar mutações em toda a extensão do gene que causa a Fibrose Cística (CFTR de homens brasileiros inférteis por agenesia congênita dos vasos deferentes, com a finalidade de prevenir a transmissão de mutações em CFTR à prole com o uso das tecnologias de reprodução assistida. MÉTODOS: Foram desenhados oligonucleotídeos específicos para realização de reação de polimerização em cadeia (PCR para cada um dos 27 exons e sítios de processamento de interesse no gene CFTR. O PCR foi seguido pela técnica de SSCP-HA (polimorfismos de conformação no DNA de fita simples e na formação de heteroduplexes em géis pré-fabricados de poliacrilamida a 12,5% em duas temperaturas, 7ºC e 20ºC. Os fragmentos com padrão alterado na migração do SSCP foram submetidos a seqüenciamento automatizado

  15. An Undergraduate Study of Two Transcription Factors that Promote Lateral Root Formation

    Science.gov (United States)

    Bargmann, Bastiaan O. R.; Birnbaum, Kenneth D.; Brenner, Eric D.

    2014-01-01

    We present a lab that enables students to test the role of genes involved in the regulation of lateral roots growth in the model plant "Arabidopsis thaliana." Here, students design an experiment that follows the effects of the hormone auxin on the stimulation of genes involved in the formation of lateral root initials. These genes, known…

  16. New gene functions in megakaryopoiesis and platelet formation

    NARCIS (Netherlands)

    Gieger, Christian; Radhakrishnan, Aparna; Cvejic, Ana; Tang, Weihong; Porcu, Eleonora; Pistis, Giorgio; Serbanovic-Canic, Jovana; Elling, Ulrich; Goodall, Alison H.; Labrune, Yann; Lopez, Lorna M.; Maegi, Reedik; Meacham, Stuart; Okada, Yukinori; Pirastu, Nicola; Sorice, Rossella; Teumer, Alexander; Voss, Katrin; Zhang, Weihua; Ramirez-Solis, Ramiro; Bis, Joshua C.; Ellinghaus, David; Goegele, Martin; Hottenga, Jouke-Jan; Langenberg, Claudia; Kovacs, Peter; O'Reilly, Paul F.; Shin, So-Youn; Esko, Toenu; Hartiala, Jaana; Kanoni, Stavroula; Murgia, Federico; Parsa, Afshin; Stephens, Jonathan; van der Harst, Pim; van der Schoot, C. Ellen; Allayee, Hooman; Attwood, Antony; Balkau, Beverley; Bastardot, Francois; Basu, Saonli; Baumeister, Sebastian E.; Biino, Ginevra; Bomba, Lorenzo; Bonnefond, Amelie; Cambien, Francois; Chambers, John C.; Cucca, Francesco; D'Adamo, Pio; Davies, Gail; de Boer, Rudolf A.; de Geus, Eco J. C.; Doering, Angela; Elliott, Paul; Erdmann, Jeanette; Evans, David M.; Falchi, Mario; Feng, Wei; Folsom, Aaron R.; Frazer, Ian H.; Gibson, Quince D.; Glazer, Nicole L.; Hammond, Chris; Hartikainen, Anna-Liisa; Heckbert, Susan R.; Hengstenberg, Christian; Hersch, Micha; Illig, Thomas; Loos, Ruth J. F.; Jolley, Jennifer; Khaw, Kay Tee; Kuehnel, Brigitte; Kyrtsonis, Marie-Christine; Lagou, Vasiliki; Lloyd-Jones, Heather; Lumley, Thomas; Mangino, Massimo; Maschio, Andrea; Mateo Leach, Irene; McKnight, Barbara; Memari, Yasin; Mitchell, Braxton D.; Montgomery, Grant W.; Nakamura, Yusuke; Nauck, Matthias; Navis, Gerjan; Noethlings, Ute; Nolte, Ilja M.; Porteous, David J.; Pouta, Anneli; Pramstaller, Peter P.; Pullat, Janne; Ring, Susan M.; Rotter, Jerome I.; Ruggiero, Daniela; Ruokonen, Aimo; Sala, Cinzia; Samani, Nilesh J.; Sambrook, Jennifer; Schlessinger, David; Schreiber, Stefan; Schunkert, Heribert; Scott, James; Smith, Nicholas L.; Snieder, Harold; Starr, John M.; Stumvoll, Michael; Takahashi, Atsushi; Tang, W. H. Wilson; Taylor, Kent; Tenesa, Albert; Thein, Swee Lay; Toenjes, Anke; Uda, Manuela; Ulivi, Sheila; van Veldhuisen, Dirk J.; Visscher, Peter M.; Voelker, Uwe; Wichmann, H-Erich; Wiggins, Kerri L.; Willemsen, Gonneke; Yang, Tsun-Po; Zhao, Jing Hua; Zitting, Paavo; Bradley, John R.; Dedoussis, George V.; Gasparini, Paolo; Hazen, Stanley L.; Metspalu, Andres; Pirastu, Mario; Shuldiner, Alan R.; van Pelt, L. Joost; Zwaginga, Jaap-Jan; Boomsma, Dorret I.; Deary, Ian J.; Franke, Andre; Froguel, Philippe; Ganesh, Santhi K.; Jarvelin, Marjo-Riitta; Martin, Nicholas G.; Meisinger, Christa; Psaty, Bruce M.; Spector, Timothy D.; Wareham, Nicholas J.; Akkerman, Jan-Willem N.; Ciullo, Marina; Deloukas, Panos; Greinacher, Andreas; Jupe, Steve; Kamatani, Naoyuki; Khadake, Jyoti; Kooner, Jaspal S.; Penninger, Josef; Prokopenko, Inga; Stemple, Derek; Toniolo, Daniela; Wernisch, Lorenz; Sanna, Serena; Hicks, Andrew A.; Rendon, Augusto; Ferreira, Manuel A.; Ouwehand, Willem H.; Soranzo, Nicole

    2011-01-01

    Platelets are the second most abundant cell type in blood and are essential for maintaining haemostasis. Their count and volume are tightly controlled within narrow physiological ranges, but there is only limited understanding of the molecular processes controlling both traits. Here we carried out a

  17. Densities and Kinematic Viscosities for the Systems Benzene + Methyl Formate, Benzene + Ethyl Formate, Benzene + Propyl Formate, and Benzene + Butyl Formate

    DEFF Research Database (Denmark)

    Emmerling, Uwe; Rasmussen, Peter

    1998-01-01

    Densities and kinematic viscosities have been measured for the system benzene + methyl formate at 20°C and for the systems benzene + ethyl formate, benzene + propyl formate, and benzene + butyl formate from 20°C to 50°C. The results for the system benzene + methyl formate have been correlated usi...

  18. Galaxy formation and evolution

    CERN Document Server

    Mo, Houjun; White, Simon

    2010-01-01

    The rapidly expanding field of galaxy formation lies at the interface between astronomy, particle physics, and cosmology. Covering diverse topics from these disciplines, all of which are needed to understand how galaxies form and evolve, this book is ideal for researchers entering the field. Individual chapters explore the evolution of the Universe as a whole and its particle and radiation content; linear and nonlinear growth of cosmic structure; processes affecting the gaseous and dark matter components of galaxies and their stellar populations; the formation of spiral and elliptical galaxies; central supermassive black holes and the activity associated with them; galaxy interactions; and the intergalactic medium. Emphasizing both observational and theoretical aspects, this book provides a coherent introduction for astronomers, cosmologists, and astroparticle physicists to the broad range of science underlying the formation and evolution of galaxies.

  19. Forces in strategy formation

    DEFF Research Database (Denmark)

    Steensen, Elmer Fly; Sanchez, Ron

    2008-01-01

    This chapter proposes that organizational strategy formation should be characterized theoretically as a process that is subject to several interacting forces, rather than represented by separate discrete decisionmodels or theoretic perspectives, as is commonly done in the strategic management...... literature. Based on an extensive review of relevant theory and empirical work in strategic decision-making, organizational change theory, cognitive and social psychology, and strategy processes, seven kinds of ''forces'' - rational, imposed, teleological, learning, political, heuristic, and social...... - are identified as interacting in and having significant influence on the strategy formation process. It is further argued that by applying a holistic ''forces-view'' of the significant and interacting influences on strategy formation, we can better understand the dynamics and challenges in managing the process...

  20. Formation of ball lightning

    Energy Technology Data Exchange (ETDEWEB)

    Silberg, P.A. (2833 Lawton Drive, Amarillo, Texas (USA))

    A plasma continuum model for the formation of ball lightning is developed based on a substantial number of reports that the ball is often in the discharge column of a previous lightning stroke. The usual method of setting up the plasma equation for a one-component electron plasma is used. An approximate equation for the plasma is derived from the describing equation which is then solved exactly in terms of the Jacobi elliptic functions. The formation of the ball is based on a nonlinearity of the plasma equation which under certain circumstances permits the field to collapse into a small region. This collapse is interpreted to be ball lightning. The approximate equation derived for the plasma has the same form as a previous equation used to describe the formation of the fireball plasma.

  1. Tritiated ammonia formation

    International Nuclear Information System (INIS)

    Heung, L.K.

    1995-01-01

    When nitrogen was selected as the glovebox atmosphere for the Replacement Tritium Facility (RTF) at the Savannah River Site (SRS), a concern was raised as to the possibility of tritiated ammonia formation in the gloveboxes. Experimental data were produced to study the tritiated ammonia formation rate in a tritium and nitrogen mixture. A rate equation that closely simulates the experimental data was developed. This rate equation can be used to calculate the formation of tritiated ammonia from different concentrations of tritium and nitrogen. The reaction of T 2 and N 2 to form NT 3 is a slow process, particularly when the tritium concentration is low. The reaction requires weeks or months to reach radiochemical equilibrium dependent on the concentrations of the reactants. 4 refs., 6 figs., 1 tab

  2. Principles of star formation

    CERN Document Server

    Bodenheimer, Peter H

    2011-01-01

    Understanding star formation is one of the key fields in present-day astrophysics. This book treats a wide variety of the physical processes involved, as well as the main observational discoveries, with key points being discussed in detail. The current star formation in our galaxy is emphasized, because the most detailed observations are available for this case. The book presents a comparison of the various scenarios for star formation, discusses the basic physics underlying each one, and follows in detail the history of a star from its initial state in the interstellar gas to its becoming a condensed object in equilibrium. Both theoretical and observational evidence to support the validity of the general evolutionary path are presented, and methods for comparing the two are emphasized. The author is a recognized expert in calculations of the evolution of protostars, the structure and evolution of disks, and stellar evolution in general. This book will be of value to graduate students in astronomy and astroph...

  3. Double layer formation

    International Nuclear Information System (INIS)

    Singh, N.

    1982-01-01

    Results from several numerical simulations of the formation of double layers in plasmas with a constant potential drop across them are presented. Here the emphasis is mainly on plasma processes during the formation of double layers. The recurring formation of double layers, their propagation and associated current interruptions are observed when the electron current injected into the simulation region from the low potential side exceeds the electron thermal current. This recurring process is stopped (or delayed) when the electron current recuperation is inhibited by a small magnetic force on the electrons. The motion of double layers is examined and it is found that the motion is caused by the interruption of the ion current from the high potential side. The subsequent recovery of this current renders the double layer stationary. (author)

  4. Planetesimals and Planet Formation

    Science.gov (United States)

    Chambers, John

    The first step in the standard model for planet formation is the growth of gravitationally bound bodies called ``planetesimals'' from dust grains in a protoplanetary disk. Currently, we do not know how planetesimals form, how long they take to form, or what their sizes and mechanical properties are. The goal of this proposal is to assess how these uncertainties affect subsequent stages of planetary growth and the kind of planetary systems that form. The work will address three particular questions: (i) Can the properties of small body populations in the modern Solar System constrain the properties of planetesimals? (ii) How do the properties of planetesimals affect the formation of giant planets? (iii) How does the presence of a water ice condensation front (the ``snow line'') in a disk affect planetesimal formation and the later stages of planetary growth? These questions will be examined with computer simulations of planet formation using new computer codes to be developed as part of the proposal. The first question will be addressed using a statistical model for planetesimal coagulation and fragmentation. This code will be merged with the proposer's Mercury N-body integrator code to model the dynamics of large protoplanets in order to address the second question. Finally, a self- consistent model of disk evolution and the radial transport of water ice and vapour will be added to examine the third question. A theoretical understanding of how planets form is one of the key goals of NASA and the Origins of Solar Systems programme. Researchers have carried out many studies designed to address this goal, but the questions of how planetesimals form and how their properties affect planet formation have received relatively little attention. The proposed work will help address these unsolved questions, and place other research in context by assessing the importance of planetesimal origins and properties for planet formation.

  5. Minimal residual disease (MRD detection with translocations and T-cell receptor and immunoglobulin gene rearrangements in adult acute lymphoblastic leukemia patients: a pilot study

    Directory of Open Access Journals (Sweden)

    Muge Sayitoglu

    2008-09-01

    Full Text Available Objective: Monitoring minimal residual disease has become increasingly important in clinical practice of ALL management. Break-point fusion regions of leukaemia related chromosomal aberrations and rearranged immunoglobulin (Ig and T cell-receptor (TCR genes are used as leukaemia specific markers in genetic studies of MRD.Material and Methods: A total of 31 consecutive patients with newly diagnosed ALL were screened for eligibility criteria. Of those 26 were included in the study. One patient with partial response following induction therapy and four patients who were lost to follow-up after induction were excluded from the study; thus 21 patients were evaluated for MRD by using polymerase chain reaction (PCR, heteroduplex analysis, sequencing and quantitative real time PCR techniques. Results: Chromosomal aberrations were detected in 5 (24% of the patients and were used for MRD monitoring. Three patients had t(9;22 translocation, the other 2 had t(4;11 and t(1;19. MRD-based risk stratification of the16 patients analysed for Ig/TCR rearrangements revealed 3 low-risk, 11 intermediate-risk and 2 high-risk patients.Conclusion: MRD monitoring is progressively getting to be a more important predictive factor in adult ALL patients. As reported by others confirmed by our limited data there is a good correlation between MRD status and clinical outcome in patients receiving chemotherapy. The pilot-study presented here is the first that systematically and consecutively performs a molecular MRD monitoring of ALL patients in Turkey.

  6. Densities and Kinematic Viscosities for the Systems Benzene + Methyl Formate, Benzene + Ethyl Formate, Benzene + Propyl Formate, and Benzene + Butyl Formate

    DEFF Research Database (Denmark)

    Emmerling, Uwe; Rasmussen, Peter

    1998-01-01

    Densities and kinematic viscosities have been measured for the system benzene + methyl formate at 20°C and for the systems benzene + ethyl formate, benzene + propyl formate, and benzene + butyl formate from 20°C to 50°C. The results for the system benzene + methyl formate have been correlated using...... a Redlich-Kister type of expression with temperature-independent parameters and the data for the systems benzene + ethyl formate, benzene + propyl formate, and benzene + butyl formate with temperature-dependent parameters. The viscosities have furthermore been compared to values predicted by means of the GC...

  7. The formation of stars

    CERN Document Server

    Stahler, Steven W

    2008-01-01

    This book is a comprehensive treatment of star formation, one of the most active fields of modern astronomy. The reader is guided through the subject in a logically compelling manner. Starting from a general description of stars and interstellar clouds, the authors delineate the earliest phases of stellar evolution. They discuss formation activity not only in the Milky Way, but also in other galaxies, both now and in the remote past. Theory and observation are thoroughly integrated, with the aid of numerous figures and images. In summary, this volume is an invaluable resource, both as a text f

  8. Situated Formative Feedback

    DEFF Research Database (Denmark)

    Lukassen, Niels Bech; Wahl, Christian; Sorensen, Elsebeth Korsgaard

    This study addresses the conceptual challenge of providing students with good quality feedback to enhance student learning in an online community of practice (COP). The aim of the study is to identify feedback mechanisms in a virtual learning environment (VLE) and to create a full formative...... refer to this type of feedback as, Situated Formative Feedback (SFF). As a basis for exploring, identifying and discussing relevant aspects of SFF the paper analyses qualitative data from a Moodle dialogue. Data are embedded in the qualitative analytic program Nvivo and are analysed with a system...

  9. Tea aroma formation

    Directory of Open Access Journals (Sweden)

    Chi-Tang Ho

    2015-03-01

    Full Text Available Besides water, tea is one of the most popular beverages around the world. The chemical ingredients and biological activities of tea have been summarized recently. The current review summarizes tea aroma compounds and their formation in green, black, and oolong tea. The flavor of tea can be divided into two categories: taste (non-volatile compounds and aroma (volatile compounds. All of these aroma molecules are generated from carotenoids, lipids, glycosides, etc. precursors, and also from Maillard reaction. In the current review, we focus on the formation mechanism of main aromas during the tea manufacturing process.

  10. Genome-wide annotation of mutations in a phenotyped mutant library provides an efficient platform for discovery of casual gene mutations

    Science.gov (United States)

    Ethyl methanesulfonate (EMS) efficiently generates high-density mutations in genomes. Conventionally, these mutations are identified by techniques that can detect single-nucleotide mismatches in heteroduplexes of individual PCR amplicons. We applied whole-genome sequencing to 256-phenotyped mutant l...

  11. Tools to Minimize Inter-Laboratory Variability in Vitellogenin Gene Expression Monitoring Programs

    Data.gov (United States)

    U.S. Environmental Protection Agency — All data files are in excel format. Files with names CSU are different mesocosms qPCR data results for vitellogen gene and 18s a house keeping gene. Data files...

  12. Methylated genes as new cancer biomarkers.

    LENUS (Irish Health Repository)

    Duffy, M J

    2012-02-01

    Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested that measurement of the methylation status of the promoter regions of specific genes can aid early detection of cancer, determine prognosis and predict therapy responses. Promising DNA methylation biomarkers include the use of methylated GSTP1 for aiding the early diagnosis of prostate cancer, methylated PITX2 for predicting outcome in lymph node-negative breast cancer patients and methylated MGMT in predicting benefit from alkylating agents in patients with glioblastomas. However, prior to clinical utilisation, these findings require validation in prospective clinical studies. Furthermore, assays for measuring gene methylation need to be standardised, simplified and evaluated in external quality assurance programmes. It is concluded that methylated genes have the potential to provide a new generation of cancer biomarkers.

  13. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    Science.gov (United States)

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  14. Genes and Hearing Loss

    Science.gov (United States)

    ... ENTCareers Marketplace Find an ENT Doctor Near You Genes and Hearing Loss Genes and Hearing Loss Patient ... mutation may only have dystopia canthorum. How Do Genes Work? Genes are a road map for the ...

  15. Regulators of autophagosome formation in Drosophila muscles.

    Directory of Open Access Journals (Sweden)

    Jonathan Zirin

    2015-02-01

    Full Text Available Given the diversity of autophagy targets and regulation, it is important to characterize autophagy in various cell types and conditions. We used a primary myocyte cell culture system to assay the role of putative autophagy regulators in the specific context of skeletal muscle. By treating the cultures with rapamycin (Rap and chloroquine (CQ we induced an autophagic response, fully suppressible by knockdown of core ATG genes. We screened D. melanogaster orthologs of a previously reported mammalian autophagy protein-protein interaction network, identifying several proteins required for autophagosome formation in muscle cells, including orthologs of the Rab regulators RabGap1 and Rab3Gap1. The screen also highlighted the critical roles of the proteasome and glycogen metabolism in regulating autophagy. Specifically, sustained proteasome inhibition inhibited autophagosome formation both in primary culture and larval skeletal muscle, even though autophagy normally acts to suppress ubiquitin aggregate formation in these tissues. In addition, analyses of glycogen metabolic genes in both primary cultured and larval muscles indicated that glycogen storage enhances the autophagic response to starvation, an important insight given the link between glycogen storage disorders, autophagy, and muscle function.

  16. Temperature controlled 'void' formation

    International Nuclear Information System (INIS)

    Dasgupta, P.; Sharma, B.D.

    1975-01-01

    The nucleation and growth of voids in structural materials during high temperature deformation or irradiation is essentially dependent upon the existence of 'vacancy supersaturation'. The role of temperature dependent diffusion processes in 'void' formation under varying conditions, and the mechanical property changes associated with this microstructure are briefly reviewed. (author)

  17. Formatting Design Dialogues

    DEFF Research Database (Denmark)

    Brandt, Eva; Binder, Thomas; Messeter, Jörn

    2008-01-01

    This article discusses design games as a particular genre for formatting design dialogues. In the first part of the article we review the participatory design literature for game-oriented framings of co-design. We look at what constitutes game and play, we discuss other authors’ use of games...

  18. Triggered star formation

    Czech Academy of Sciences Publication Activity Database

    Palouš, Jan; Ehlerová, Soňa

    2002-01-01

    Roč. 12, - (2002), s. 35-36 ISSN 1405-2059 R&D Projects: GA AV ČR IAA3003705; GA AV ČR KSK1048102 Institutional research plan: CEZ:AV0Z1003909 Keywords : interstellar medium * star formation * HI shells Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  19. PAHs and star formation

    NARCIS (Netherlands)

    Tielens, AGGM; Peeters, E; Bakes, ELO; Spoon, HWW; Hony, S; Johnstone, D; Adams, FC; Lin, DNC; Neufeld, DA; Ostriker, EC

    2004-01-01

    Strong IR emission features at 3.3, 6.2, 7.7, 8.6, and 11.2 mum are a common characteristic of regions of massive star formation. These features are carried by large (similar to 50 C-atom) Polycyclic Aromatic Hydrocarbon molecules which are pumped by the strong FUV photon flux from these stars.

  20. FORMATION CONSTANTS AND THERMODYNAMIC ...

    African Journals Online (AJOL)

    , Ni(II), Cu(II) and Zn(II) ions has been ... A good deal of work has been reported on the preparation and structural investigation of. Schiff base ... Formation constants and thermodynamic parameters of Co, Ni, Cu and Zn complexes. Bull. Chem.

  1. COMPETENCYTHE FORMATION FOR LIFE

    Directory of Open Access Journals (Sweden)

    Milagros Mederos-Piñeiro

    2016-07-01

    Full Text Available The formation of life competences is the result of a quality education that prepares students to meet the challenges of a fast moving world where equality and equal opportunities should constitute premises of education; training them is a challenge teachers to assume new generations contribute actively to a better world. In Cuba are important research on the formation of communication competences and self-regulated learning in primary school. The paper shows the result of an investigation that provides a methodology for the formation of life competences in primary school education, used as an essential pathway research activity. The methodological approach of research has a quantitative approach and an explanatory scope to establish and make sense of understanding the causal relationship between the direction of research activity and training of life competences. Theoretical, empirical and mathematical-statistical, for characterizing the initial state, processing of results and analysis: research methods are used. The application of the methodology for the formation of life competences makes teachers lead the teaching-learning process with a research and transforming teaching concept, where the school is the protagonist of their learning and causes changes in their performances, which are evident in the formed competences related to effective and affective communication; the solution of problems related to life; the use of means in obtaining the knowledge and the expression of a behavior consistent with school and social demands. The effectiveness of the methodology confirms that there is a causal relationship between the direction of research activity by teachers and the formation of life competences in school.

  2. Translation efficiency in yeasts correlates with nucleosome formation in promoters.

    Science.gov (United States)

    Matushkin, Yu G; Levitsky, V G; Orlov, Yu L; Likhoshvai, V A; Kolchanov, N A

    2013-01-01

    Elongation efficiency index (EEI) was suggested earlier to estimate gene expression efficiency by nucleotide context of coding sequence in unicellular organisms. We have analyzed association between EEI and nucleosome formation potential (NFP) in 5' regulatory regions upstream translation initiation site (TIS) from two yeast species. Theoretical estimations of NFP based on DNA sequence were obtained by Recon method. Experimental estimation of nucleosome occupancy was obtained by high-throughput sequencing data of nucleosomal DNA in Saccharomyces cerevisiae . For the sample of all genes correlation coefficient was calculated between two vectors: vector of NFP values for fixed position relative to TIS and vector of EEI values. Profiles of correlation coefficients of NFP and EEI were counted in (-600; +600) regions relative to TIS for gene sequences extracted from GenBank. We found regions of strong negative dependence between NFP and EEI for all genes as well as for 10% highly expressed genes in Schizosaccharomyces pombe (10% of EEI-highest genes). At the same time, we found positive dependence between NFP and EEI for all genes and for low expressed genes in S. cerevisiae (10% of EEI-lowest genes). The association between NFP and EEI could be explained by evolutionary selection of context characteristics of nucleotide sequences for gene expression optimization.

  3. Gene expression and gene therapy imaging

    International Nuclear Information System (INIS)

    Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.

    2007-01-01

    The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)

  4. Imaging reporter gene for monitoring gene therapy

    International Nuclear Information System (INIS)

    Beco, V. de; Baillet, G.; Tamgac, F.; Tofighi, M.; Weinmann, P.; Vergote, J.; Moretti, J.L.; Tamgac, G.

    2002-01-01

    Scintigraphic images can be obtained to document gene function at cellular level. This approach is presented here and the use of a reporter gene to monitor gene therapy is described. Two main ways are presented: either the use of a reporter gene coding for an enzyme the action of which will be monitored by radiolabeled pro-drug, or a cellular receptor gene, the action of which is documented by a radio labeled cognate receptor ligand. (author)

  5. Distribution, formation and regulation of gas vesicles.

    Science.gov (United States)

    Pfeifer, Felicitas

    2012-10-01

    A range of bacteria and archaea produce intracellular gas-filled proteinaceous structures that function as flotation devices in order to maintain a suitable depth in the aqueous environment. The wall of these gas vesicles is freely permeable to gas molecules and is composed of a small hydrophobic protein, GvpA, which forms a single-layer wall. In addition, several minor structural, accessory or regulatory proteins are required for gas vesicle formation. In different organisms, 8-14 genes encoding gas vesicle proteins have been identified, and their expression has been shown to be regulated by environmental factors. In this Review, I describe the basic properties of gas vesicles, the genes that encode them and how their production is regulated. I also discuss the function of these vesicles and the initial attempts to exploit them for biotechnological purposes.

  6. Plasma formation in TBR

    International Nuclear Information System (INIS)

    Del Bosco, E.

    1981-01-01

    In this work are presented and discussed results of the formation and equilibrium of the plasma current in TBR, a small tokamak, designed and contructed at the Instituto de Fisica of Universidade de Sao Paulo. The measured breakdown curves for H 2 , A and He are compared with the predictions of a simple model with reasonable agreement. The influence of stray magnetic fields in the plasma formation is investigated and conditions are chosen to facilitate the breakdown. The time profile of loop voltage and plasma current for shots with plasma equilibrium are shown. A comparison is made between experimental results and analytical-numerical model for tokamaks discharges with ohmic heating. Reasonable agreement is obtained when Z, effective atomic number, is assumed as a parameter. (Author) [pt

  7. Molecular Genetics of Supernumerary Tooth Formation

    Science.gov (United States)

    Wang, Xiu-Ping; Fan, Jiabing

    2011-01-01

    Summary Despite advances in the knowledge of tooth morphogenesis and differentiation, relatively little is known about the aetiology and molecular mechanisms underlying supernumerary tooth formation. A small number of supernumerary teeth may be a common developmental dental anomaly, while multiple supernumerary teeth usually have a genetic component and they are sometimes thought to represent a partial third dentition in humans. Mice, which are commonly used for studying tooth development, only exhibit one dentition, with very few mouse models exhibiting supernumerary teeth similar to those in humans. Inactivation of Apc or forced activation of Wnt/β(catenin signalling results in multiple supernumerary tooth formation in both humans and in mice, but the key genes in these pathways are not very clear. Analysis of other model systems with continuous tooth replacement or secondary tooth formation, such as fish, snake, lizard, and ferret, is providing insights into the molecular and cellular mechanisms underlying succesional tooth development, and will assist in the studies on supernumerary tooth formation in humans. This information, together with the advances in stem cell biology and tissue engineering, will pave ways for the tooth regeneration and tooth bioengineering. PMID:21309064

  8. Mars’ peculiar formation

    Science.gov (United States)

    Woo, Man Yin; Brasser, Ramon; Mojzsis, Stephen; Matsumura, Soko; Ida, Shigeru

    2017-10-01

    The formation of the terrestrial planets is a long standing problem. Mars probably holds the key to solving this mystery because of the substantial amount of data gathered from space missions, martian meteorites and its obvious differences when compared to Earth. Recent elemental and isotopic abundances suggest that Mars’ composition is significantly different from that of Earth. Therefore, Mars should have accreted most of its mass in a region different from Earth’s, most likely further from the Sun. These compositional differences should be explained with planet formation models. We tested the probability of producing a Mars analogue that is compositionally different from Earth in two popular planet formation models: the Grand Tack model with tack locations of 1.5 or 2 AU for Jupiter; and the Classical model in which all the terrestrial planets formed near their current locations. We performed a high number of N-body simulations with initial conditions that are either equal-mass planetary embryos or a semi-analytical approach to oligarch growth. Our results show that the probability of producing a Mars analogue which matches the current mass and orbit of Mars is at most 9% but reduces to mostly about 1% when it mainly accretes its mass further than Mars’ current position of 1.5 AU. Strangely enough, in the Grand Tack model the number of Mars analogues produced is independent of the initial number of planet embryos. Hence, we conclude that both planet formation models have difficulties to explain the observed compositional differences between Earth and Mars.

  9. Alkali metal hydride formation

    International Nuclear Information System (INIS)

    1976-01-01

    The present invention relates to a method of producing alkali metal hydrides by absorbing hydrogen gas under pressure into a mixture of lower alkyl mono amines and alkali metal alkyl amides selected from sodium and potassium amides formed from said amines. The present invention also includes purification of a mixture of the amines and amides which contain impurities, such as is used as a catalytic exchange liquid in the enrichment of deuterium, involving the formation of the alkali metal hydride

  10. Isothermal Martensite Formation

    DEFF Research Database (Denmark)

    Villa, Matteo

    are chosen to investigate time dependent martensite formation. Among them, a Fe-11wt%Ni-0.6wt%C model alloy and Fe-1.6wt%Cr-1wt%C (AISI 52100), Fe-17wt%Cr-7wt%Ni (AISI 631) and Fe-16wt%Cr-5wt%Ni (AISI 630) commercial steels. The investigation was performed with in situ magnetometry, dilatometry, synchrotron...

  11. Symbol Formation Reconsidered

    DEFF Research Database (Denmark)

    Wagoner, Brady

    2013-01-01

    begins with a brief outline and contextualization of the book as well as of the articles that this special issue comprises. The first two articles were written by contributors who were part of the Werner era at Clark University. They explore the key concepts of the organismic and development, and situate...... the organismic-developmental approach to fields only touched in Symbol formation, such as magical practices, social structures, pictures and gesture....

  12. Formation of TRAPPIST-1

    Science.gov (United States)

    Ormel, C. W.; Liu, B.; Schoonenberg, D.

    2017-09-01

    We present a model for the formation of the recently-discovered TRAPPIST-1 planetary system. In our scenario planets form in the interior regions, by accretion of mm to cm-size particles (pebbles) that drifted from the outer disk. This scenario has several advantages: it connects to the observation that disks are made up of pebbles, it is efficient, it explains why the TRAPPIST-1 planets are ˜Earth mass, and it provides a rationale for the system's architecture.

  13. Methemoglobin formation by paraquat.

    OpenAIRE

    Watanabe, Shinsaku; Ogata, Masana

    1982-01-01

    Paraquat is a broad spectrum herbicide known to be highly lethal to man and animals. Its toxicity is characterized by acute lung injury. Paraquat produces such toxic effects through the generation of the superoxide anion according to one proposed mechanism. The present experiment, methemoglobin formation was demonstrated after incubation of oxyhemoglobin with paraquat. The generation of the superoxide anion through the interaction of oxyhemoglobin with paraquat was suggested by chemiluminesce...

  14. Formate-assisted pyrolysis

    Science.gov (United States)

    DeSisto, William Joseph; Wheeler, Marshall Clayton; van Heiningen, Adriaan R. P.

    2015-03-17

    The present invention provides, among other thing, methods for creating significantly deoxygenated bio-oils form biomass including the steps of providing a feedstock, associating the feedstock with an alkali formate to form a treated feedstock, dewatering the treated feedstock, heating the dewatered treated feedstock to form a vapor product, and condensing the vapor product to form a pyrolysis oil, wherein the pyrolysis oil contains less than 30% oxygen by weight.

  15. THE ALLIANCE FORMATION PROCESS

    OpenAIRE

    Whipple, Judith M.; Frankel, Robert

    1998-01-01

    While interest in developing strategic alliances within the food system continues to increase, there remains considerable risk when firms adopt such a cooperative strategy. The risk is due in part to the lack of concrete guidelines that illustrate the steps or stages of alliance development and the important strategic and operational decisions required at each stage. The existence of such guidelines would facilitate alliance formation and enable managers and researchers to better understand a...

  16. Complexity and formative experiences

    Directory of Open Access Journals (Sweden)

    Roque Strieder

    2017-12-01

    Full Text Available The contemporaneity is characterized by instability and diversity calling into question certainties and truths proposed in modernity. We recognize that the reality of things and phenomena become effective as a set of events, interactions, retroactions and chances. This different frame extends the need for revision of the epistemological foundations that sustain educational practices and give them sense. The complex thinking is an alternative option for acting as a counterpoint to classical science and its reductionist logic and knowledge compartmentalization, as well as to answer to contemporary epistemological and educational challenges. It aims to associate different areas and forms of knowledge, without, however merge them, distinguishing without separating the several disciplines and instances of the realities. This study, in theoretical references, highlights the relevance of complex approaches to support formative experiences because also able to produce complexities in reflections about educational issues. We conclude that formative possibilities from complexity potentialize the resignification of human’s conception and the understanding of its singularity in interdependence; The understanding that pedagogical and educational activities is a constant interrogation about the possibilities of knowing the knowledge and reframe learning, far beyond knowing its functions and utilitarian purposes; and, as a formative possibility, places us on the trail of responsibility, not as something eventual, but present and indicative of freedom to choose to stay or go beyond.

  17. Terrestrial planet formation.

    Science.gov (United States)

    Righter, K; O'Brien, D P

    2011-11-29

    Advances in our understanding of terrestrial planet formation have come from a multidisciplinary approach. Studies of the ages and compositions of primitive meteorites with compositions similar to the Sun have helped to constrain the nature of the building blocks of planets. This information helps to guide numerical models for the three stages of planet formation from dust to planetesimals (~10(6) y), followed by planetesimals to embryos (lunar to Mars-sized objects; few 10(6) y), and finally embryos to planets (10(7)-10(8) y). Defining the role of turbulence in the early nebula is a key to understanding the growth of solids larger than meter size. The initiation of runaway growth of embryos from planetesimals ultimately leads to the growth of large terrestrial planets via large impacts. Dynamical models can produce inner Solar System configurations that closely resemble our Solar System, especially when the orbital effects of large planets (Jupiter and Saturn) and damping mechanisms, such as gas drag, are included. Experimental studies of terrestrial planet interiors provide additional constraints on the conditions of differentiation and, therefore, origin. A more complete understanding of terrestrial planet formation might be possible via a combination of chemical and physical modeling, as well as obtaining samples and new geophysical data from other planets (Venus, Mars, or Mercury) and asteroids.

  18. An event-driven approach for studying gene block evolution in bacteria.

    Science.gov (United States)

    Ream, David C; Bankapur, Asma R; Friedberg, Iddo

    2015-07-01

    Gene blocks are genes co-located on the chromosome. In many cases, gene blocks are conserved between bacterial species, sometimes as operons, when genes are co-transcribed. The conservation is rarely absolute: gene loss, gain, duplication, block splitting and block fusion are frequently observed. An open question in bacterial molecular evolution is that of the formation and breakup of gene blocks, for which several models have been proposed. These models, however, are not generally applicable to all types of gene blocks, and consequently cannot be used to broadly compare and study gene block evolution. To address this problem, we introduce an event-based method for tracking gene block evolution in bacteria. We show here that the evolution of gene blocks in proteobacteria can be described by a small set of events. Those include the insertion of genes into, or the splitting of genes out of a gene block, gene loss, and gene duplication. We show how the event-based method of gene block evolution allows us to determine the evolutionary rateand may be used to trace the ancestral states of their formation. We conclude that the event-based method can be used to help us understand the formation of these important bacterial genomic structures. The software is available under GPLv3 license on http://github.com/reamdc1/gene_block_evolution.git. Supplementary online material: http://iddo-friedberg.net/operon-evolution © The Author 2015. Published by Oxford University Press.

  19. Global gene expression in Escherichia coli biofilms

    DEFF Research Database (Denmark)

    Schembri, Mark; Kjærgaard, K.; Klemm, Per

    2003-01-01

    It is now apparent that microorganisms undergo significant changes during the transition from planktonic to biofilm growth. These changes result in phenotypic adaptations that allow the formation of highly organized and structured sessile communities, which possess enhanced resistance...... to antimicrobial treatments and host immune defence responses. Escherichia coli has been used as a model organism to study the mechanisms of growth within adhered communities. In this study, we use DNA microarray technology to examine the global gene expression profile of E. coli during sessile growth compared...... the transition to biofilm growth, and these included genes expressed under oxygen-limiting conditions, genes encoding (putative) transport proteins, putative oxidoreductases and genes associated with enhanced heavy metal resistance. Of particular interest was the observation that many of the genes altered...

  20. Climate and growth influences on wood formation and utilisation ...

    African Journals Online (AJOL)

    Combining this with temporal, high-resolution measurements of stem growth, weather, gene expression, cambial structure, and canopy or root phenology enables us to better understand wood formation and the causes of variability in wood properties. CSIRO has, over recent years and in partnership with industry and other ...

  1. Biofilm formation-defective mutants in Pseudomonas putida.

    Science.gov (United States)

    López-Sánchez, Aroa; Leal-Morales, Antonio; Jiménez-Díaz, Lorena; Platero, Ana I; Bardallo-Pérez, Juan; Díaz-Romero, Alberto; Acemel, Rafael D; Illán, Juan M; Jiménez-López, Julia; Govantes, Fernando

    2016-07-01

    Out of 8000 candidates from a genetic screening for Pseudomonas putida KT2442 mutants showing defects in biofilm formation, 40 independent mutants with diminished levels of biofilm were analyzed. Most of these mutants carried insertions in genes of the lap cluster, whose products are responsible for synthesis, export and degradation of the adhesin LapA. All mutants in this class were strongly defective in biofilm formation. Mutants in the flagellar regulatory genes fleQ and flhF showed similar defects to that of the lap mutants. On the contrary, transposon insertions in the flagellar structural genes fliP and flgG, that also impair flagellar motility, had a modest defect in biofilm formation. A mutation in gacS, encoding the sensor element of the GacS/GacA two-component system, also had a moderate effect on biofilm formation. Additional insertions targeted genes involved in cell envelope function: PP3222, encoding the permease element of an ABC-type transporter and tolB, encoding the periplasmic component of the Tol-OprL system required for outer membrane stability. Our results underscore the central role of LapA, suggest cross-regulation between motility and adhesion functions and provide insights on the role of cell envelope trafficking and maintenance for biofilm development in P. putida. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Effects of H2 and formate on growth yield and regulation of methanogenesis in Methanococcus maripaludis.

    Science.gov (United States)

    Costa, Kyle C; Yoon, Sung Ho; Pan, Min; Burn, June A; Baliga, Nitin S; Leigh, John A

    2013-04-01

    Hydrogenotrophic methanogenic Archaea are defined by an H2 requirement for growth. Despite this requirement, many hydrogenotrophs are also capable of growth with formate as an electron donor for methanogenesis. While certain responses of these organisms to hydrogen availability have been characterized, responses to formate starvation have not been reported. Here we report that during continuous culture of Methanococcus maripaludis under defined nutrient conditions, growth yields relative to methane production decreased markedly with either H2 excess or formate excess. Analysis of the growth yields of several mutants suggests that this phenomenon occurs independently of the storage of intracellular carbon or a transcriptional response to methanogenesis. Using microarray analysis, we found that the expression of genes encoding coenzyme F420-dependent steps of methanogenesis, including one of two formate dehydrogenases, increased with H2 starvation but with formate occurred at high levels regardless of limitation or excess. One gene, encoding H2-dependent methylene-tetrahydromethanopterin dehydrogenase, decreased in expression with either H2 limitation or formate limitation. Expression of genes for the second formate dehydrogenase, molybdenum-dependent formylmethanofuran dehydrogenase, and molybdenum transport increased specifically with formate limitation. Of the two formate dehydrogenases, only the first could support growth on formate in batch culture where formate was in excess.

  3. Methylated genes as new cancer biomarkers

    DEFF Research Database (Denmark)

    Brunner, Nils; Duffy, M.J; Napieralski, R.

    2009-01-01

    Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested that meas......Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested...... that measurement of the methylation status of the promoter regions of specific genes can aid early detection of cancer, determine prognosis and predict therapy responses. Promising DNA methylation biomarkers include the use of methylated GSTP1 for aiding the early diagnosis of prostate cancer, methylated PITX2...... for predicting outcome in lymph node-negative breast cancer patients and methylated MGMT in predicting benefit from alkylating agents in patients with glioblastomas. However, prior to clinical utilisation, these findings require validation in prospective clinical studies. Furthermore, assays for measuring gene...

  4. GOseek: a gene ontology search engine using enhanced keywords.

    Science.gov (United States)

    Taha, Kamal

    2013-01-01

    We propose in this paper a biological search engine called GOseek, which overcomes the limitation of current gene similarity tools. Given a set of genes, GOseek returns the most significant genes that are semantically related to the given genes. These returned genes are usually annotated to one of the Lowest Common Ancestors (LCA) of the Gene Ontology (GO) terms annotating the given genes. Most genes have several annotation GO terms. Therefore, there may be more than one LCA for the GO terms annotating the given genes. The LCA annotating the genes that are most semantically related to the given gene is the one that receives the most aggregate semantic contribution from the GO terms annotating the given genes. To identify this LCA, GOseek quantifies the contribution of the GO terms annotating the given genes to the semantics of their LCAs. That is, it encodes the semantic contribution into a numeric format. GOseek uses microarray experiment data to rank result genes based on their significance. We evaluated GOseek experimentally and compared it with a comparable gene prediction tool. Results showed marked improvement over the tool.

  5. How Genes Evolve

    Indian Academy of Sciences (India)

    which they are found e.g. the evolution of the gene coding for the protein cytochrome-C which is part ofthe respiratory apparatus. On the contrary, paralogous genes are descendants of a duplicated gene. Paralogous genes therefore evolve within the same species as well as in different species e.g. genes coding for alpha ...

  6. Liposome formation in microgravity

    Science.gov (United States)

    Claassen, D. E.; Spooner, B. S.

    Liposomes are artificial vesicles with a phospholipid bilayer membrane. The formation of liposomes is a self-assembly process that is driven by the amphipathic nature of phospholipid molecules and can be observed during the removal of detergent from phospholipids dissolved in detergent micelles. As detergent concentration in the mixed micelles decreases, the non-polar tail regions of phospholipids produce a hydrophobic effect that drives the micelles to fuse and form planar bilayers in which phospholipids orient with tail regions to the center of the bilayer and polar head regions to the external surface. Remaining detergent molecules shield exposed edges of the bilayer sheet from the aqueous environment. Further removal of detergent leads to intramembrane folding and membrane vesiculation, forming liposomes. We have observed that the formation of liposomes is altered in microgravity. Liposomes that were formed at 1-g did not exceed 150 nm in diameter, whereas liposomes that were formed during spaceflight exhibited diameters up to 2000 nm. Using detergent-stabilized planar bilayers, we determined that the stage of liposome formation most influenced by gravity is membrane vesiculation. In addition, we found that small, equipment-induced fluid disturbances increased vesiculation and negated the size-enhancing effects of microgravity. However, these small disturbances had no effect on liposome size at 1-g, likely due to the presence of gravity-induced buoyancy-driven fluid flows (e.g., convection currents). Our results indicate that fluid disturbances, induced by gravity, influence the vesiculation of membranes and limit the diameter of forming liposomes.

  7. Formation control of AAUSHIP

    DEFF Research Database (Denmark)

    Østergaard, Nick; Dam, Jeppe; Larsen, Jesper Abildgaard

    2015-01-01

    Many maritime mapping tasks are today carried out by large research ships, which are very costly to operate. As a way to overcome this, a number of small surveying vessels have been developed called AAUSHIP. In order to efficiently map the an area with such smaller vessels, it is important that s...... that several vessels are able to corporate on the task at hand. In this paper, the developed formation control strategy for the AAUSHIP series of vessels is presented, along with simulation results, which confirms, that the algorithm works as intended....

  8. Bouyei word formation

    Directory of Open Access Journals (Sweden)

    Attasith Boonsawasd

    2012-12-01

    Full Text Available The Bouyei language is divided into three vernaculars, the southern vernacular, the central vernacular and the southwestern vernacular. This paper aims to describe the lexicology of the southern vernacular of the Bouyei language focusing on word formation process. Bouyei words are formed by affixing, compounding and reduplicating. First, the affixation consists of prefixing and suffixing. Infixing is not found in this language. Second, the compound is divided into the semantic and syntactic compound. Finally, the reduplication is divided into the simple and complex reduplication. The simple reduplication is normally used to emphasize the meaning of the root or to indicate plurality.

  9. Democracy and formation

    DEFF Research Database (Denmark)

    Huggler, Jørgen

    to nature, Schlegel appeals to culture and political experience and political formation, in order to make the world more peaceful. He opposes with heavy arguments the Kantian distinction between republicanism and democracy. Instead he gives quite good reasons for a more important distinction between...... of the structure of political autonomy in a political social contract (Ingeborg Mauss). Against Kant, the thinker of political continuity, Schlegel presents historically well informed reflections on the beginning and the end of political legitimacy. Dictatorship can be legitimate, states of emergency are found...

  10. Modeling Chondrule Formation

    Science.gov (United States)

    Eisenhour, D. D.; Buseck, P. R.

    1995-09-01

    Over the last several decades considerable data on chondrule sizes, compositions, and textures has been collected [1]; experimental studies have greatly improved our understanding of the conditions required to produce chondrule compositions and textures [2]; and models of energetic nebular processes have provided insight into mechanisms by which chondrules may have formed [3]. While much work remains in each of these areas, the information presently available is sufficient to allow the construction of simple numerical models of chondrule formation. We have constructed a computer algorithm to investigate the consequences of forming chondrules under a variety of conditions. Variables that are considered include: 1) the mechanism of heating (e.g., EM radiation, aerodynamic drag, collisions with energetic particles), 2) peak chondrule temperature, 3) heat-source geometry, 4) pre-chondrule dust aggregate size distributions, 5) dust aggregate compositional distributions, 6) chondrule solidus and liquidus temperatures, 7) kinetic barriers to melting, and 8) the duration of heating. Output includes the size distributions and relative abundances of PO, PP, POP, BO, and NP chondrules. Given the uncertainties in the input variables, the primary purpose of the code is not to construct a single (and necessarily somewhat arbitrary) model of chondrule formation, but rather to elucidate the differences in chondrule properties associated with various sets of formation conditions. Results from a number of simulations using a variety of input parameters illustrate the importance of both composition and peak temperature on the proportion of porphyritic to non-porphyritic chondrules produced. Also apparent is the influence of the mechanism of heating on the relative size distributions of chondrule textural types. Results indicate that specific heating mechanisms require unique sets of associated conditions to account for the observed properties of chondrules. These unique sets of

  11. Sensing mispaired thymines in DNA heteroduplexes using an electroactive osmium marker: towards electrochemical SNP probing

    Czech Academy of Sciences Publication Activity Database

    Kostečka, Pavel; Havran, Luděk; Bittová, M.; Pivoňková, Hana; Fojta, Miroslav

    2011-01-01

    Roč. 400, č. 1 (2011), s. 197-204 ISSN 1618-2642 R&D Projects: GA ČR GP203/08/P598; GA AV ČR IAA400040903; GA MŠk LC06035; GA ČR(CZ) GAP206/11/1638 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : single-base mismatch * osmium tetroxide * electrochemistry Subject RIV: BO - Biophysics Impact factor: 3.778, year: 2011

  12. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  13. Identification of two genes potentially associated in iron-heme ...

    Indian Academy of Sciences (India)

    Classic characteristics are poor predictors of the risk of thromboembolism. Thus, better markers for the carotid atheroma plaque formation and symptom causing are needed. Our objective was to study by microarray analysis gene expression of genes involved in homeostasis of iron and heme in carotid atheroma plaque ...

  14. The Planet Formation Imager

    Science.gov (United States)

    Kraus, S.; Buscher, D. F.; Monnier, J. D.; PFI Science, the; Technical Working Group

    2014-04-01

    Among the most fascinating and hotly-debated areas in contemporary astrophysics are the means by which planetary systems are assembled from the large rotating disks of gas and dust which attend a stellar birth. Although important work is being done both in theory and observation, a full understanding of the physics of planet formation can only be achieved by opening observational windows able to directly witness the process in action. The key requirement is then to probe planet-forming systems at the natural spatial scales over which material is being assembled. By definition, this is the so-called Hill Sphere which delineates the region of influence of a gravitating body within its surrounding environment. The Planet Formation Imager project has crystallized around this challenging goal: to deliver resolved images of Hill-Sphere-sized structures within candidate planet-hosting disks in the nearest star-forming regions. In this contribution we outline the primary science case of PFI and discuss how PFI could significantly advance our understanding of the architecture and potential habitability of planetary systems. We present radiation-hydrodynamics simulations from which we derive preliminary specifications that guide the design of the facility. Finally, we give an overview about the interferometric and non-interferometric technologies that we are investigating in order to meet the specifications.

  15. Urbanization and slum formation.

    Science.gov (United States)

    Ooi, Giok Ling; Phua, Kai Hong

    2007-05-01

    The formation of slums need not be inevitable with rapid urbanization. Such an argument appears to be contradicted by evidence of large slum populations in a large number of developing countries and particularly in rapidly urbanizing regions like Asia. The evidence discussed suggests that city authorities faced with rapid urban development lack the capacity to cope with the diverse demands for infrastructural provision to meet economic and social needs. Not only are strategic planning and intervention major issues in agenda to manage rapid urbanization, but city governments are not effectively linking the economic development trajectory to implications for urban growth and, hence, housing needs. In the following discussion, a case study is presented in support of the argument that city governments have to first recognize and then act to establish the link that is crucial between economic development, urban growth, and housing. This is the agendum that has been largely neglected by city and national governments that have been narrowly focused on economic growth with the consequent proliferation of slum formation as a housing solution.

  16. A bacterial volatile signal for biofilm formation

    Directory of Open Access Journals (Sweden)

    Yun Chen

    2015-09-01

    Full Text Available Bacteria constantly monitor the environment they reside in and respond to potential changes in the environment through a variety of signal sensing and transduction mechanisms in a timely fashion. Those signaling mechanisms often involve application of small, diffusible chemical molecules. Volatiles are a group of small air-transmittable chemicals that are produced universally by all kingdoms of organisms. Past studies have shown that volatiles can function as cell-cell communication signals not only within species, but also cross-species. However, little is known about how the volatile-mediated signaling mechanism works. In our recent study (Chen, et al. mBio (2015, 6: e00392-15, we demonstrated that the soil bacterium Bacillus subtilis uses acetic acid as a volatile signal to coordinate the timing of biofilm formation within physically separated cells in the community. We also showed that the bacterium possesses an intertwined gene network to produce, secrete, sense, and respond to acetic acid, in stimulating biofilm formation. Interestingly, many of those genes are highly conserved in other bacterial species, raising the possibility that acetic acid may act as a volatile signal for cross-species communication.

  17. Generation of a gene cassette for genetically engineered Salmonella Enteritidis in the specific region of the sipC gene

    Directory of Open Access Journals (Sweden)

    M Ghasemi

    2017-05-01

    Full Text Available Introduction: Salmonellosis is an infection caused by eating contaminated food with Salmonella, and it can occur in humans and other animals. Salmonella has acquired the ability to create the infection due to the presence of several virulence genes. One of the virulence genes of salmonella is sipC gene that coding the SipC protein. The aim of this study was creating the gene cassette to genetically engineered Salmonella enteritidis in the specific region of the sipC gene. Methods: In this study, after DNA extraction from Salmonella, the upstream and downstream regions of the sipC gene was amplified based on PCR method. The PCR products were cloned with T/A cloning method and they were inserted into the pGEM vector. In order to generate the final gene cassette, each of the upstream and downstream regions of the sipC gene was subcloned into the pET32 vector, and cloning accuracy was assessed by PCR and enzyme digestion methods. Results: Amplification of the 320 bp upstream and 206 bp downstream of sipC gene was successful by PCR method. T/A cloning of these fragments were caused the formation of two pGEM-up and pGEM-down recombinant vectors. Results that were confirmed the sub-cloning accuracy indicate the formation of the final pET32-up-down gene cassette. Conclusion: The generated gene cassette in this study was considered as a multi-purpose cassette that is able to specific gene manipulation of Salmonella sipC gene by homologous recombination matched. This gene cassette has the necessary potential for sipC gene deletion or insertion of any useful gene instead of sipC gene.

  18. Role of bacterial efflux pumps in biofilm formation.

    Science.gov (United States)

    Alav, Ilyas; Sutton, J Mark; Rahman, Khondaker Miraz

    2018-02-28

    Efflux pumps are widely implicated in antibiotic resistance because they can extrude the majority of clinically relevant antibiotics from within cells to the extracellular environment. However, there is increasing evidence from many studies to suggest that the pumps also play a role in biofilm formation. These studies have involved investigating the effects of efflux pump gene mutagenesis and efflux pump inhibitors on biofilm formation, and measuring the levels of efflux pump gene expression in biofilms. In particular, several key pathogenic species associated with increasing multidrug resistance, such as Acinetobacter baumannii, Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus, have been investigated, whilst other studies have focused on Salmonella enterica serovar Typhimurium as a model organism and problematic pathogen. Studies have shown that efflux pumps, including AcrAB-TolC of E. coli, MexAB-OprM of P. aeruginosa, AdeFGH of A. baumannii and AcrD of S. enterica, play important roles in biofilm formation. The substrates for such pumps, and whether changes in their efflux activity affect biofilm formation directly or indirectly, remain to be determined. By understanding the roles that efflux pumps play in biofilm formation, novel therapeutic strategies can be developed to inhibit their function, to help disrupt biofilms and improve the treatment of infections. This review will discuss and evaluate the evidence for the roles of efflux pumps in biofilm formation and the potential approaches to overcome the increasing problem of biofilm-based infections.

  19. The multifaceted planetesimal formation process

    DEFF Research Database (Denmark)

    Johansen, Anders; Blum, Jürgen; Tanaka, Hidekazu

    2013-01-01

    -Neptunian objects and comets provide a unique record of the physical conditions in the solar nebula. Debris from planetesimal collisions around other stars signposts that the planetesimal formation process, and hence planet formation, is ubiquitous in the Galaxy. The planetesimal formation stage extends from...

  20. Designing for informed group formation

    DEFF Research Database (Denmark)

    Nicolajsen, Hanne Westh; Juel Jacobsen, Alice; Riis, Marianne

    2012-01-01

    A new design ―project preparation‖ preparing for the group formation in problem based project work is proposed and investigated. The main problem is to overcome group formation based on existing relations. The hypothesis is that theme development and group formation are somewhat counterproductive...

  1. Restoring formation after leaching process

    International Nuclear Information System (INIS)

    Barrett, R.B.

    1983-01-01

    A method of restoring a formation which had uranium and other mineral values extracted by an alkaline lixiviant comprises introducing a source of phosphate in an amount sufficient to lower the level of soluble uranium compounds below that previously existing in the formation by the formation of insoluble uranium phosphate compounds

  2. Imaging gene expression in gene therapy

    International Nuclear Information System (INIS)

    Wiebe, Leonard I.

    1997-01-01

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented

  3. Recipes for planet formation

    Science.gov (United States)

    Meyer, Michael R.

    2009-11-01

    Anyone who has ever used baking soda instead of baking powder when trying to make a cake knows a simple truth: ingredients matter. The same is true for planet formation. Planets are made from the materials that coalesce in a rotating disk around young stars - essentially the "leftovers" from when the stars themselves formed through the gravitational collapse of rotating clouds of gas and dust. The planet-making disk should therefore initially have the same gas-to-dust ratio as the interstellar medium: about 100 to 1, by mass. Similarly, it seems logical that the elemental composition of the disk should match that of the star, reflecting the initial conditions at that particular spot in the galaxy.

  4. Determinants for gallstone formation

    DEFF Research Database (Denmark)

    Shabanzadeh, Daniel Monsted; Sorensen, Lars Tue; Jørgensen, Torben

    2016-01-01

    associations were found for blood pressure, smoking, alcohol consumption, HDL cholesterol, or triglycerides in meta-analyses. Conclusions: Age, female sex, BMI, non-HDL cholesterol, and polyps are independent determinants for gallstone formation. Incident gallstones and the metabolic syndrome share common risk...... on a prospective protocol, a systematic review of the literature was performed identifying all articles dealing with determinants of incident gallstones. Meta-analyses of comparable determinants were performed through fixed effect models. Results: Participants with no gallstones at baseline and with at least one...... re-examination were followed-up completely (mean 11.6 years, N = 2848). The overall cumulative incidence of gallstones was 0.60% per year. Independent positive determinants for incident gallstones were age, female sex, non-high density lipoprotein (non-HDL) cholesterol, and gallbladder polyps...

  5. Formation fracturing with foam

    Energy Technology Data Exchange (ETDEWEB)

    Blauer, R.E.; Kohlhaas, C.A.

    1974-01-01

    Over 60 wells have been treated with hydraulic fracturing techniques, with foam as the fracturing fluid. These foams contained as much as 95% gaseous phase; most treatments used foams with gas contents in the 65% to 85% range. Foam has several desirable properties for use as a fracturing fluid: high sand-carrying and sand-suspending capability, low fluid loss, low hydrostatic head, low pressure drops due to friction, quick fluid recovery, low formation damage, and no reduction of fracture conductivity due to fluid ingredients. Most applications of foam as a fracturing fluid have been in low permeability gas reservoirs. However, several oil reservoirs also have been successfully treated. Cost of the treatment is approx. the same or slightly less than a treatment with conventional fluids of comparable volume and rate. (25 refs.)

  6. Standardizing exchange formats

    International Nuclear Information System (INIS)

    Lemmel, H.D.; Schmidt, J.J.

    1992-01-01

    An international network of co-operating data centres is described who maintain identical data bases which are simultaneously updated by an agreed data exchange procedure. The agreement covers ''data exchange formats'' which are compatible to the centres' internal data storage and retrieval systems which remain different, optimized at each centre to the available computer facilities and to the needs of the data users. Essential condition for the data exchange is an agreement on common procedures for the data exchange is an agreement on common procedures for the data compilation, including critical data analysis and validation. The systems described (''EXFOR'', ''ENDF'', ''CINDA'') are used for ''nuclear reaction data'', but the principles used for data compilation and exchange should be valid also for other data types. (author). 24 refs, 4 figs

  7. Global impact of mature biofilm lifestyle on Escherichia coli K-12 gene expression

    DEFF Research Database (Denmark)

    Beloin, C.; Valle, J.; Latour-Lambert, P.

    2004-01-01

    The formation of biofilm results in a major lifestyle switch that is thought to affect the expression of multiple genes and operons. We used DNA arrays to study the global effect of biofilm formation on gene expression in mature Escherichia coli K-12 biofilm. We show that, when biofilm is compared...... that 20 of these genes are required for the formation of mature biofilm. This group includes 11 genes of previously unknown function. These results constitute a comprehensive analysis of the global transcriptional response triggered in mature E. coli biofilms and provide insights into its physiological...

  8. The mechanism of cerebral aneurysmal formation

    International Nuclear Information System (INIS)

    Yokoi, Toshihiro; Nozaki, Kazuhiko

    2010-01-01

    Cerebral aneurysm is a disease of poor prognosis and MR- and CT-angiographies are used for its diagnosis and in the preventive therapy of its rupture. Here discussed are formation and growth leading to rupture of the lesion for its advanced diagnosis and prevention of rupturing. Beginning from findings in animal experimentation in mice, rats and monkeys, discussed are pathology of the aneurysm, genes related with its formation, molecular biological approaches concerning apoptosis and NF-kB/TNF-α related inflammatory reactions, participation of sex hormone, clinical hemodynamic analyses based on 3D data from CT and MRI findings, and clinical studies. Authors consider that local hemodynamic stress loading is possibly related to cerebral aneurysm formation as it is yielded at the loading part of the vessel in human and in animal models. The aneurysm is possibly a result of remodeling disturbance by the load and subsequent excessive involution of the artery. In the process, probably included are the inflammation, apoptosis, degradation of extracellular matrix and functional impairment of endotherial cells. Future elucidation of molecular mechanisms underlying the aneurismal growth and rupture will bring about the improved treatment to prevent the disease by stabilizing the aneurismal wall. (T.T.)

  9. Lbx2 regulates formation of myofibrils

    Directory of Open Access Journals (Sweden)

    Westerfield Monte

    2009-02-01

    Full Text Available Abstract Background Skeletal muscle differentiation requires assembly of contractile proteins into organized myofibrils. The Drosophila ladybird homeobox gene (lad functions in founder cells of the segmental border muscle to promote myoblast fusion and muscle shaping. Tetrapods have two homologous genes (Lbx. Lbx1 functions in migration and/or proliferation of hypaxial myoblasts, whereas the function of Lbx2 is poorly understood. Results To elucidate the role of Lbx in vertebrate myogenesis, we examined Lbx function in zebrafish. Zebrafish lbx2 transcripts appear in newly formed paraxial mesoderm and become restricted to adaxial cells, precursors of slow muscle. Slow muscles lose lbx2 expression as they differentiate, while a subset of differentiating fast muscle cells transiently expresses lbx2. Fin and hyoid muscle express lbx2 later. In contrast, lbx1b expression first appears lateral to the somites at late segmentation stages and is later restricted to fin muscle. Morpholino knockdown of Lbx1b and Lbx2 suppresses hypaxial muscle development. Moreover, knockdown of Lbx2 results in malformation of muscle fibers and reduced fusion of fast precursors, although no obvious effects on induction or specification are observed. Expression of myofilament genes, including actin and myosin, requires the engrailed repressor domain of Lbx2. Conclusion Our results elucidate a new function of Lbx2 as a regulator of myofibril formation.

  10. DAVID Knowledgebase: a gene-centered database integrating heterogeneous gene annotation resources to facilitate high-throughput gene functional analysis

    Directory of Open Access Journals (Sweden)

    Baseler Michael W

    2007-11-01

    Full Text Available Abstract Background Due to the complex and distributed nature of biological research, our current biological knowledge is spread over many redundant annotation databases maintained by many independent groups. Analysts usually need to visit many of these bioinformatics databases in order to integrate comprehensive annotation information for their genes, which becomes one of the bottlenecks, particularly for the analytic task associated with a large gene list. Thus, a highly centralized and ready-to-use gene-annotation knowledgebase is in demand for high throughput gene functional analysis. Description The DAVID Knowledgebase is built around the DAVID Gene Concept, a single-linkage method to agglomerate tens of millions of gene/protein identifiers from a variety of public genomic resources into DAVID gene clusters. The grouping of such identifiers improves the cross-reference capability, particularly across NCBI and UniProt systems, enabling more than 40 publicly available functional annotation sources to be comprehensively integrated and centralized by the DAVID gene clusters. The simple, pair-wise, text format files which make up the DAVID Knowledgebase are freely downloadable for various data analysis uses. In addition, a well organized web interface allows users to query different types of heterogeneous annotations in a high-throughput manner. Conclusion The DAVID Knowledgebase is designed to facilitate high throughput gene functional analysis. For a given gene list, it not only provides the quick accessibility to a wide range of heterogeneous annotation data in a centralized location, but also enriches the level of biological information for an individual gene. Moreover, the entire DAVID Knowledgebase is freely downloadable or searchable at http://david.abcc.ncifcrf.gov/knowledgebase/.

  11. The transcriptional regulator c2h2 accelerates mushroom formation in Agaricus bisporus

    NARCIS (Netherlands)

    Pelkmans, J.F.; Vos, A.M.; Scholtmeijer, K; Hendrix, Eddy; Baars, Johan J; Gehrmann, Thies; Reinders, Marcel J; Lugones, L.G.; Wösten, HAB

    The Cys2His2 zinc finger protein gene c2h2 of Schizophyllum commune is involved in mushroom formation. Its inactivation results in a strain that is arrested at the stage of aggregate formation. In this study, the c2h2 orthologue of Agaricus bisporus was over-expressed in this white button mushroom

  12. The transcriptional regulator c2h2 acceleratesmushroom formation in Agaricus bisporus

    NARCIS (Netherlands)

    Pelkmans, Jordi F.; Vos, A.M.; Scholtmeijer, Karin; Hendrix, Ed; Baars, Johan J.P.; Gehrmann, T.; Reinders, M.J.T.; Lugones, Luis G.; Wösten, Han A.B.

    2016-01-01

    The Cys2His2 zinc finger protein gene c2h2 of Schizophyllum commune is involved in mushroom formation. Its inactivation results in a strain that is arrested at the stage of aggregate formation. In this study, the c2h2 orthologue of Agaricus bisporus was over-expressed in this white button mushroom

  13. The transcriptional regulator c2h2 accelerates mushroom formation in Agaricus bisporus

    NARCIS (Netherlands)

    Pelkmans, Jordi F.; Vos, Aurin M.; Scholtmeijer, Karin; Hendrix, Ed; Baars, Johan J.P.; Gehrmann, Thies; Reinders, Marcel J.T.; Lugones, Luis G.; Wösten, Han A.B.

    2016-01-01

    The Cys2His2 zinc finger protein gene c2h2 of Schizophyllum commune is involved in mushroom formation. Its inactivation results in a strain that is arrested at the stage of aggregate formation. In this study, the c2h2 orthologue of Agaricus bisporus was over-expressed in this white button

  14. Analysis of nodule meristem persistence and ENOD40 functioning in Medicago truncatula nodule formation

    NARCIS (Netherlands)

    Wan Xi,

    2007-01-01

    Medicago root nodules are formed as a result of the interaction of the plant with the soil-borne bacterium Sinorhizobium meliloti. Several plant genes are induced during nodule formation and MtENOD40 is one of the earliest genes activated. The precise function as well as the molecule

  15. Analysis of nodule meristem persistence and ENOD40 functioning in Medicago truncatula nodule formation

    NARCIS (Netherlands)

    Wan Xi,

    2007-01-01

    Medicago root nodules are formed as a result of the interaction of the plant with the soil-borne bacterium Sinorhizobium meliloti. Several plant genes are induced during nodule formation and MtENOD40 is one of the earliest genes activated. The precise function as well as the molecule harboring the

  16. Granulomatous response to Coxiella burnetii, the agent of Q fever: the lessons from gene expression analysis

    Directory of Open Access Journals (Sweden)

    delphine efaugaret

    2014-12-01

    Full Text Available The formation of granulomas is associated with the resolution of Q fever, a zoonosis due to Coxiella burnetii; however the molecular mechanisms of granuloma formation remain poorly understood. We generated human granulomas with peripheral blood mononuclear cells and beads coated with C. burnetii, using BCG extracts as controls. A microarray analysis showed dramatic changes in gene expression in granuloma cells of which more than 50% were commonly modulated genes in response to C. burnetii and BCG. They included M1-related genes and genes related to chemotaxis. The inhibition of the chemokines, CCL2 and CCL5, directly interfered with granuloma formation. C. burnetii granulomas also expressed a specific transcriptional profile that was essentially enriched in genes associated with type I interferon response. Our results showed that granuloma formation is associated with a core of transcriptional response based on inflammatory genes. The specific granulomatous response to C. burnetii is characterized by the activation of type I interferon pathway.

  17. Evaluation of genetic variations in miRNA-binding sites of BRCA1 and BRCA2 genes as risk factors for the development of early-onset and/or familial breast cancer.

    Science.gov (United States)

    Erturk, Elif; Cecener, Gulsah; Polatkan, Volkan; Gokgoz, Sehsuvar; Egeli, Unal; Tunca, Berrin; Tezcan, Gulcin; Demirdogen, Elif; Ak, Secil; Tasdelen, Ismet

    2014-01-01

    Although genetic markers identifying women at an increased risk of developing breast cancer exist, the majority of inherited risk factors remain elusive. Mutations in the BRCA1/BRCA2 gene confer a substantial increase in breast cancer risk, yet routine clinical genetic screening is limited to the coding regions and intron- exon boundaries, precluding the identification of mutations in noncoding and untranslated regions. Because 3' untranslated region (3'UTR) polymorphisms disrupting microRNA (miRNA) binding can be functional and can act as genetic markers of cancer risk, we aimed to determine genetic variation in the 3'UTR of BRCA1/BRCA2 in familial and early-onset breast cancer patients with and without mutations in the coding regions of BRCA1/ BRCA2 and to identify specific 3'UTR variants that may be risk factors for cancer development. The 3'UTRs of the BRCA1 and BRCA2 genes were screened by heteroduplex analysis and DNA sequencing in 100 patients from 46 BRCA1/2 families, 54 non-BRCA1/2 families, and 47 geographically matched controls. Two polymorphisms were identified. SNPs c.*1287C>T (rs12516) (BRCA1) and c.*105A>C (rs15869) (BRCA2) were identified in 27% and 24% of patients, respectively. These 2 variants were also identified in controls with no family history of cancer (23.4% and 23.4%, respectively). In comparison to variations in the 3'UTR region of the BRCA1/2 genes and the BRCA1/2 mutational status in patients, there was a statistically significant relationship between the BRCA1 gene polymorphism c.*1287C>T (rs12516) and BRCA1 mutations (p=0.035) by Fisher's Exact Test. SNP c.*1287C>T (rs12516) of the BRCA1 gene may have potential use as a genetic marker of an increased risk of developing breast cancer and likely represents a non-coding sequence variation in BRCA1 that impacts BRCA1 function and leads to increased early-onset and/or familial breast cancer risk in the Turkish population.

  18. Expression of conjoined genes: another mechanism for gene regulation in eukaryotes.

    Directory of Open Access Journals (Sweden)

    Tulika Prakash

    Full Text Available From the ENCODE project, it is realized that almost every base of the entire human genome is transcribed. One class of transcripts resulting from this arises from the conjoined gene, which is formed by combining the exons of two or more distinct (parent genes lying on the same strand of a chromosome. Only a very limited number of such genes are known, and the definition and terminologies used for them are highly variable in the public databases. In this work, we have computationally identified and manually curated 751 conjoined genes (CGs in the human genome that are supported by at least one mRNA or EST sequence available in the NCBI database. 353 representative CGs, of which 291 (82% could be confirmed, were subjected to experimental validation using RT-PCR and sequencing methods. We speculate that these genes are arising out of novel functional requirements and are not merely artifacts of transcription, since more than 70% of them are conserved in other vertebrate genomes. The unique splicing patterns exhibited by CGs reveal their possible roles in protein evolution or gene regulation. Novel CGs, for which no transcript is available, could be identified in 80% of randomly selected potential CG forming regions, indicating that their formation is a routine process. Formation of CGs is not only limited to human, as we have also identified 270 CGs in mouse and 227 in drosophila using our approach. Additionally, we propose a novel mechanism for the formation of CGs. Finally, we developed a database, ConjoinG, which contains detailed information about all the CGs (800 in total identified in the human genome. In summary, our findings reveal new insights about the functionality of CGs in terms of another possible mechanism for gene regulation and genomic evolution and the mechanism leading to their formation.

  19. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We pre