High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

Science.gov (United States)

Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

2017-08-01

Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

BRCA2 Hypomorphic Missense Variants Confer Moderate Risks of Breast Cancer.

OpenAIRE

Shimelis, Hermela; Mesman, Romy LS; Von, Nicolai Catharina; Ehlen, Asa; Guidugli, Lucia; Martin, Charlotte; Calléja, Fabienne MGR; Meeks, Huong; Hallberg, Emily; Hinton, Jamie; Lilyquist, Jenna; Hu, Chunling; Aalfs, Cora M; Aittomäki, Kristiina; Andrulis, Irene

2017-01-01

Breast cancer risks conferred by many germline missense variants in the $\\textit{BRCA1}$ and $\\textit{BRCA2}$ genes, often referred to as variants of uncertain significance (VUS), have not been established. In this study, associations between 19 BRCA1 and 33 BRCA2 missense substitution variants and breast cancer risk were investigated through a breast cancer case-control study using genotyping data from 38 studies of predominantly European ancestry (41,890 cases and 41,607 controls) and nine ...

A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

Science.gov (United States)

Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

2018-05-15

Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

SpxB is a suicide gene of Streptococcus pneumoniae and confers a selective advantage in an in vivo competitive colonization model.

Science.gov (United States)

Regev-Yochay, Gili; Trzcinski, Krzysztof; Thompson, Claudette M; Lipsitch, Marc; Malley, Richard

2007-09-01

The human bacterial pathogen Streptococcus pneumoniae dies spontaneously upon reaching stationary phase. The extent of S. pneumoniae death at stationary phase is unusual in bacteria and has been conventionally attributed to autolysis by the LytA amidase. In this study, we show that spontaneous pneumococcal death is due to hydrogen peroxide (H(2)O(2)), not LytA, and that the gene responsible for H(2)O(2) production (spxB) also confers a survival advantage in colonization. Survival of S. pneumoniae in stationary phase was significantly prolonged by eliminating H(2)O(2) in any of three ways: chemically by supplementing the media with catalase, metabolically by growing the bacteria under anaerobic conditions, or genetically by constructing DeltaspxB mutants that do not produce H(2)O(2). Likewise, addition of H(2)O(2) to exponentially growing S. pneumoniae resulted in a death rate similar to that of cells in stationary phase. While DeltalytA mutants did not lyse at stationary phase, they died at a rate similar to that of the wild-type strain. Furthermore, we show that the death process induced by H(2)O(2) has features of apoptosis, as evidenced by increased annexin V staining, decreased DNA content, and appearance as assessed by transmission electron microscopy. Finally, in an in vivo rat model of competitive colonization, the presence of spxB conferred a selective advantage over the DeltaspxB mutant, suggesting an explanation for the persistence of this gene. We conclude that a suicide gene of pneumococcus is spxB, which induces an apoptosis-like death in pneumococci and confers a selective advantage in nasopharyngeal cocolonization.

Overexpression of LOV KELCH protein 2 confers dehydration tolerance and is associated with enhanced expression of dehydration-inducible genes in Arabidopsis thaliana.

Science.gov (United States)

Miyazaki, Yuji; Abe, Hiroshi; Takase, Tomoyuki; Kobayashi, Masatomo; Kiyosue, Tomohiro

2015-05-01

The overexpression of LKP2 confers dehydration tolerance in Arabidopsis thaliana ; this is likely due to enhanced expression of dehydration-inducible genes and reduced stomatal opening. LOV KELCH protein 2 (LKP2) modulates the circadian rhythm and flowering time in plants. In this study, we observed that LKP2 overexpression enhanced dehydration tolerance in Arabidopsis. Microarray analysis demonstrated that expression of water deprivation-responsive genes was higher in the absence of dehydration stress in transgenic Arabidopsis plants expressing green fluorescent protein-tagged LKP2 (GFP-LKP2) than in control transgenic plants expressing GFP. After dehydration followed by rehydration, GFP-LKP2 plants developed more leaves and roots and exhibited higher survival rates than control plants. In the absence of dehydration stress, four dehydration-inducible genes, namely DREB1A, DREB1B, DREB1C, and RD29A, were expressed in GFP-LKP2 plants, whereas they were not expressed or were expressed at low levels in control plants. Under dehydration stress, the expression of DREB2B and RD29A peaked faster in the GFP-LKP2 plants than in control plants. The stomatal aperture of GFP-LKP2 plants was smaller than that of control plants. These results suggest that the dehydration tolerance of GFP-LKP2 plants is caused by upregulation of DREB1A-C/CBF1-3 and their downstream targets; restricted stomatal opening in the absence of dehydration stress also appears to contribute to the phenotype. The rapid and high expression of DREB2B and its downstream target genes also likely accounts for some features of the GFP-LKP2 phenotype. Our results suggest that LKP2 can be used for biotechnological applications not only to adjust the flowering time control but also to enhance dehydration tolerance.

BRCA2 hypomorphic missense variants confer moderate risks of breast cancer

OpenAIRE

Shimelis, Hermela; Mesman, Romy L.s.; Von Nicolai, Catharina; Ehlen, Asa; Guidugli, Lucia; Martin, Charlotte; Calleja, Fabienne Mgr; Meeks, Huong; Hallberg, Emily; Hinton, Jamie; Lilyquist, Jenna; Hu, Chunling; Aalfs, Cora M; Aittomaki, Kristiina; Andrulis, Irene L.

2017-01-01

Breast cancer risks conferred by many germline missense variants in the BRCA1 and BRCA2 genes, often referred to as variants of uncertain significance (VUS), have not been established. In this study, associations between 19 BRCA1 and 33 BRCA2 missense substitution variants and breast cancer risk were investigated through a breast cancer case–control study using genotyping data from 38 studies of predominantly European ancestry (41,890 cases and 41,607 controls) and nine studies of Asian ances...

A dominant control region from the human β-globin locus conferring integration site-independent gene expression.

NARCIS (Netherlands)

D. Talbot; P. Collis; M. Antoniou (Michael); M. Vidal; F.G. Grosveld (Frank); D.R. Greaves (David)

1989-01-01

textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell

Loss-of-function of neuroplasticity-related genes confers risk for human neurodevelopmental disorders.

Science.gov (United States)

Smith, Milo R; Glicksberg, Benjamin S; Li, Li; Chen, Rong; Morishita, Hirofumi; Dudley, Joel T

2018-01-01

High and increasing prevalence of neurodevelopmental disorders place enormous personal and economic burdens on society. Given the growing realization that the roots of neurodevelopmental disorders often lie in early childhood, there is an urgent need to identify childhood risk factors. Neurodevelopment is marked by periods of heightened experience-dependent neuroplasticity wherein neural circuitry is optimized by the environment. If these critical periods are disrupted, development of normal brain function can be permanently altered, leading to neurodevelopmental disorders. Here, we aim to systematically identify human variants in neuroplasticity-related genes that confer risk for neurodevelopmental disorders. Historically, this knowledge has been limited by a lack of techniques to identify genes related to neurodevelopmental plasticity in a high-throughput manner and a lack of methods to systematically identify mutations in these genes that confer risk for neurodevelopmental disorders. Using an integrative genomics approach, we determined loss-of-function (LOF) variants in putative plasticity genes, identified from transcriptional profiles of brain from mice with elevated plasticity, that were associated with neurodevelopmental disorders. From five shared differentially expressed genes found in two mouse models of juvenile-like elevated plasticity (juvenile wild-type or adult Lynx1-/- relative to adult wild-type) that were also genotyped in the Mount Sinai BioMe Biobank we identified multiple associations between LOF genes and increased risk for neurodevelopmental disorders across 10,510 patients linked to the Mount Sinai Electronic Medical Records (EMR), including epilepsy and schizophrenia. This work demonstrates a novel approach to identify neurodevelopmental risk genes and points toward a promising avenue to discover new drug targets to address the unmet therapeutic needs of neurodevelopmental disease.

Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea.

Science.gov (United States)

Nakahara, Yoshiki; Sawabe, Shogo; Kainuma, Kenta; Katsuhara, Maki; Shibasaka, Mineo; Suzuki, Masanori; Yamamoto, Kosuke; Oguri, Suguru; Sakamoto, Hikaru

2015-01-01

Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1) a novel protein highly homologous to thaumatin-like proteins, (2) a novel coiled-coil protein of unknown function, and (3) a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea

Directory of Open Access Journals (Sweden)

Yoshiki eNakahara

2015-10-01

Full Text Available Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1 a novel protein highly homologous to thaumatin-like proteins, (2 a novel coiled-coil protein of unknown function, and (3 a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

Genomic Evidence of Chemotrophic Metabolisms in Deep-Dwelling Chloroflexi Conferred by Ancient Horizontal Gene Transfer Events

Science.gov (United States)

Momper, L. M.; Magnabosco, C.; Amend, J.; Osburn, M. R.; Fournier, G. P.

2017-12-01

The marine and terrestrial subsurface biospheres represent quite likely the largest reservoirs for life on Earth, directly impacting surface processes and global cycles throughout Earth's history. In the deep subsurface biosphere (DSB) organic carbon and energy are often extremely scarce. However, archaea and bacteria are able to persist in the DSB to at least 3.5 km below surface [1]. Understanding how they persist, and by what metabolisms they subsist, are key questions in this biosphere. To address these questions we investigated 5 global DSB environments: one legacy mine in South Dakota, USA, 3 mines in South Africa and marine fluids circulating beneath the Juan de Fuca Ridge. Boreholes within these mines provided access to fluids buried beneath the earth's surface and sampled depths down to 3.1 km. Geochemical data were collected concomitantly with DNA for metagenomic sequencing. We examined genomes of the ancient and deeply branching Chloroflexi for metabolic capabilities and interrogated the geochemical drivers behind those metabolisms with in situ thermodynamic modeling of reaction energetics. In total, 23 Chloroflexi genomes were identified and analyzed from the 5 subsurface sites. Genes for nitrate reduction (nar) and sulfite reduction (dsr) were found in many of the South Africa Chloroflexi but were absent from genomes collected in South Dakota. Indeed, nitrate reduction was among the most energetically favorable reactions in South African fluids (10-14 kJ cell-1 sec -1 per mol of reactant) and sulfur reduction with Fe2+ or H2 was also exergonic [2]. Conversely, genes for nitrite and nitrous oxide reduction (nrf, nir and nos) were found in genomes collected in South Dakota and Juan de Fuca, but not South Africa. We examined the origin of genes conferring these metabolisms in the Chloroflexi genomes. We discovered evidence for horizontal gene transfer (HGT) for all of these putative metabolisms. Retention of these genes in Chloroflexi lineages indicates

Computational Biology Support: RECOMB Conference Series (Conference Support)

Energy Technology Data Exchange (ETDEWEB)

Michael Waterman

2006-06-15

This funding was support for student and postdoctoral attendance at the Annual Recomb Conference from 2001 to 2005. The RECOMB Conference series was founded in 1997 to provide a scientific forum for theoretical advances in computational biology and their applications in molecular biology and medicine. The conference series aims at attracting research contributions in all areas of computational molecular biology. Typical, but not exclusive, the topics of interest are: Genomics, Molecular sequence analysis, Recognition of genes and regulatory elements, Molecular evolution, Protein structure, Structural genomics, Gene Expression, Gene Networks, Drug Design, Combinatorial libraries, Computational proteomics, and Structural and functional genomics. The origins of the conference came from the mathematical and computational side of the field, and there remains to be a certain focus on computational advances. However, the effective use of computational techniques to biological innovation is also an important aspect of the conference. The conference had a growing number of attendees, topping 300 in recent years and often exceeding 500. The conference program includes between 30 and 40 contributed papers, that are selected by a international program committee with around 30 experts during a rigorous review process rivaling the editorial procedure for top-rate scientific journals. In previous years papers selection has been made from up to 130--200 submissions from well over a dozen countries. 10-page extended abstracts of the contributed papers are collected in a volume published by ACM Press and Springer, and are available at the conference. Full versions of a selection of the papers are published annually in a special issue of the Journal of Computational Biology devoted to the RECOMB Conference. A further point in the program is a lively poster session. From 120-300 posters have been presented each year at RECOMB 2000. One of the highlights of each RECOMB conference is a

A dominant control region from the human β-globin locus conferring integration site-independent gene expression.

OpenAIRE

Talbot, D.; Collis, P.; Antoniou, Michael; Vidal, M.; Grosveld, Frank; Greaves, David

1989-01-01

textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell lines and transgenic animals has turned out to be at a low level relative to that of endogenous genes, and influenced by the chromosomal site of insertion of the exogenous construct. We have previo...

2. National scientific conference on process engineering in environment protection. Conference materials

International Nuclear Information System (INIS)

1994-01-01

The national conference on 'Process engineering in environment protection' Jachranka 1994 has been divided into three sessions. Section 1 has been devoted to flue gas purification and collects 13 papers. Section 2 on liquid purification gathered 8 presentation. Section 3 - the poster session with 12 posters on related topics. During the conference 2 lectures and 3 posters have been devoted to the application of nuclear techniques to the solution different problems connected with environment protection

Agrobacterium mediated transformation of brassica juncea (l.) czern with chitinase gene conferring resistance against fungal infections

International Nuclear Information System (INIS)

Ahmad, B.; Ambreen, S.; Khan, I.

2015-01-01

Brassica juncea (Czern and Coss., L.) is an important oilseed crop. Since it is attacked by several bacterial and fungal diseases, therefore, we developed an easy and simple protocol for the regeneration and transformation of B. juncea variety RAYA ANMOL to give rise to transgenic plants conferring resistance against various fungal diseases. The transformation was carried out using Agrobacterium with Chitinase gene. This gene was isolated from Streptomyces griseus HUT6037. We used two types of explants for transformation i.e. hypocotyls and cotyledons. Only hypocotyls explants showed good results regarding callus initiation. Different hormonal concentrations were applied i.e. BAP 2, 4 and 6 mgL-1 and NAA 0.1, 0.2 and 0.3 mgL-1. However, high transformation efficiency was observed by supplementing the medium with combination of 2 mgL-1 BAP and 0.2 mgL-1 for initiation of callus. Similarly 10 mgL-1 kanamycin and 200 mgL-1 cefotaxime also proved successful for the selection of transformed callus. In order to confirm the presence of transgenic callus Polymerase chain reaction was performed using specific primers for Chitinase gene. (author)

Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

Science.gov (United States)

Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

2012-12-01

Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

Cereal cyst nematode resistance conferred by the Cre7 gene from Aegilops triuncialis and its relationship with Cre genes from Australian wheat cultivars

OpenAIRE

Montes, Maria Jesus; Andrés, María Fe; Sin, E.; Lopez Braña, Isidoro; Martín-Sánchez, J.A.; Romero, M.D.; Delibes Castro, Angeles

2008-01-01

Cereal cyst nematode (CCN; Heterodera avenae Woll.) is a root pathogen of cereal crops that can cause severe yield losses in wheat (Triticum aestivum). Differential host–nematode interactions occur in wheat cultivars carrying different CCN resistance (Cre) genes. The objective of this study was to determine the CCN resistance conferred by the Cre7 gene from Aegilops triuncialis in a 42-chromosome introgression line and to assess the effects of the Cre1, Cre3, Cre4, and Cre8 genes present in A...

BRCA2 Hypomorphic Missense Variants Confer Moderate Risks of Breast Cancer

DEFF Research Database (Denmark)

Shimelis, Hermela; Mesman, Romy L S; Von Nicolai, Catharina

2017-01-01

Breast cancer risks conferred by many germline missense variants in the BRCA1 and BRCA2 genes, often referred to as variants of uncertain significance (VUS), have not been established. In this study, associations between 19 BRCA1 and 33 BRCA2 missense substitution variants and breast cancer risk ......, moderately increased risks of breast cancer, with potential implications for risk management guidelines in women with these specific variants. Cancer Res; 77(11); 2789-99. ©2017 AACR....... were investigated through a breast cancer case-control study using genotyping data from 38 studies of predominantly European ancestry (41,890 cases and 41,607 controls) and nine studies of Asian ancestry (6,269 cases and 6,624 controls). The BRCA2 c.9104A>C, p.Tyr3035Ser (OR = 2.52; P = 0.04), and BRCA...... of breast cancer among Asians. Functional characterization of the BRCA2 variants using four quantitative assays showed reduced BRCA2 activity for p.Tyr3035Ser compared with wild-type. Overall, our results show how BRCA2 missense variants that influence protein function can confer clinically relevant...

Error-prone PCR mutation of Ls-EPSPS gene from Liriope spicata conferring to its enhanced glyphosate-resistance.

Science.gov (United States)

Mao, Chanjuan; Xie, Hongjie; Chen, Shiguo; Valverde, Bernal E; Qiang, Sheng

2017-09-01

Liriope spicata (Thunb.) Lour has a unique LsEPSPS structure contributing to the highest-ever-recognized natural glyphosate tolerance. The transformed LsEPSPS confers increased glyphosate resistance to E. coli and A. thaliana. However, the increased glyphosate-resistance level is not high enough to be of commercial value. Therefore, LsEPSPS was subjected to error-prone PCR to screen mutant EPSPS genes capable of endowing higher resistance levels. A mutant designated as ELs-EPSPS having five mutated amino acids (37Val, 67Asn, 277Ser, 351Gly and 422Gly) was selected for its ability to confer improved resistance to glyphosate. Expression of ELs-EPSPS in recombinant E. coli BL21 (DE3) strains enhanced resistance to glyphosate in comparison to both the LsEPSPS-transformed and -untransformed controls. Furthermore, transgenic ELs-EPSPS A. thaliana was about 5.4 fold and 2-fold resistance to glyphosate compared with the wild-type and the Ls-EPSPS-transgenic plants, respectively. Therefore, the mutated ELs-EPSPS gene has potential value for has potential for the development of glyphosate-resistant crops. Copyright © 2016 Elsevier Inc. All rights reserved.

2nd International Arctic Ungulate Conference

Directory of Open Access Journals (Sweden)

A. Anonymous

1996-01-01

Full Text Available The 2nd International Arctic Ungulate Conference was held 13-17 August 1995 on the University of Alaska Fairbanks campus. The Institute of Arctic Biology and the Alaska Cooperative Fish and Wildlife Research Unit were responsible for organizing the conference with assistance from biologists with state and federal agencies and commercial organizations. David R. Klein was chair of the conference organizing committee. Over 200 people attended the conference, coming from 10 different countries. The United States, Canada, and Norway had the largest representation. The conference included invited lectures; panel discussions, and about 125 contributed papers. There were five technical sessions on Physiology and Body Condition; Habitat Relationships; Population Dynamics and Management; Behavior, Genetics and Evolution; and Reindeer and Muskox Husbandry. Three panel sessions discussed Comparative caribou management strategies; Management of introduced, reestablished, and expanding muskox populations; and Health risks in translocation of arctic ungulates. Invited lectures focused on the physiology and population dynamics of arctic ungulates; contaminants in food chains of arctic ungulates and lessons learned from the Chernobyl accident; and ecosystem level relationships of the Porcupine Caribou Herd.

Saussurea involucrata SiDhn2 gene confers tolerance to drought stress in upland cotton

International Nuclear Information System (INIS)

Liu, B.; Zhu, J.; Mu, J.; Zhu, J.; Liang, Z.; Zhang, L.

2017-01-01

Severe water shortage has long been acknowledged as one major limiting factor for global cotton production, and cultivation of cotton varieties with strong drought resistance is of important economic and social significances. In this study, the Xinjiang upland cotton variety Xinluzao 42 was transformed with the SiDhn2 gene by optimized agrobacterium transformation system. The integration of SiDhn2 gene into cotton genome was confirmed by PCR and Southern blot hybridization, and the drought resistance of transgenic and corresponding receptor cotton plants and their physiological indexes under drought stress were detailedly analyzed. Multiple physiological and biochemical indexes including soluble sugar content, free proline content, chlorophyll content, relative water content, net photosynthetic rate, transpiration rate, intercellular CO/sub 2/ concentration in transgenic cotton expressing SiDhn2 gene under drought stress were significantly higher than those of receptor cotton. More importantly, the transgenic cotton plants exhibited remarkably decreased boll abscission rate and highly increased seed yield, indicating the significant role of SiDhn2 gene in cotton drought resistance and its great application potential in agricultural production. (author)

Two variants on chromosome 17 confer prostate cancer risk, and the one in TCF2 protects against type 2 diabetes

DEFF Research Database (Denmark)

Gudmundsson, Julius; Sulem, Patrick; Steinthorsdottir, Valgerdur

2007-01-01

attributable risk is substantial. One of the variants is in TCF2 (HNF1beta), a gene known to be mutated in individuals with maturity-onset diabetes of the young type 5. Results from eight case-control groups, including one West African and one Chinese, demonstrate that this variant confers protection against...... 17 with the disease. These two variants, 33 Mb apart, fall within a region previously implicated by family-based linkage studies on prostate cancer. The risks conferred by these variants are moderate individually (allele odds ratio of about 1.20), but because they are common, their joint population......We performed a genome-wide association scan to search for sequence variants conferring risk of prostate cancer using 1,501 Icelandic men with prostate cancer and 11,290 controls. Follow-up studies involving three additional case-control groups replicated an association of two variants on chromosome...

2nd Tourism Postdisciplinarity Conference

DEFF Research Database (Denmark)

Following the noted success of the 1st international conference on postdisciplinary approaches to tourism studies (held in Neuchatel, Switzerland, 19-22 June, 2013), we are happy to welcome you to the 2nd Tourism Postdisciplinarity Conference. Postdisciplinarity surpasses the boundaries...... of study less embedded in that system of thought. Postdisciplinarity is an epistemological endeavour that speaks of knowledge production and the ways in which the world of physical and social phenomena can be known. It is also an ontological discourse as it concerns what we call ‘tourism...

Common variants of inflammatory cytokine genes are associated with risk of nephropathy in type 2 diabetes among Asian Indians

DEFF Research Database (Denmark)

Ahluwalia, Tarun Veer Singh; Khullar, Madhu; Ahuja, Monica

2009-01-01

Inflammatory cytokine genes have been proposed as good candidate genes for conferring susceptibility to diabetic nephropathy. In the present study, we examined the combined effect of multiple alleles of pro inflammatory cytokine genes for determining the risk of nephropathy in type 2 diabetic...

2nd Bozeman Conference

CERN Document Server

Lund, John

1991-01-01

This volume contains a collection of papers delivered by the partici­ pants at the second Conference on Computation and Control held at Mon­ tana State University in Bozeman, Montana from August 1-7, 1990. The conference, as well as this proceedings, attests to the vitality and cohesion between the control theorist and the numerical analyst that was adver­ tised by the first Conference on Computation and Control in 1988. The proceedings of that initial conference was published by Birkhiiuser Boston as the first volume of this same series entitled Computation and Control, Proceedings of the Bozeman Conference, Bozeman, Montana, 1988. Control theory and numerical analysis are both, by their very nature, interdisciplinary subjects as evidenced by their interaction with other fields of mathematics and engineering. While it is clear that new control or es­ timation algorithms and new feedback design methodologies will need to be implemented computationally, it is likewise clear that new problems in computation...

Overexpression of Rice Auxilin-Like Protein, XB21, Induces Necrotic Lesions, up-Regulates Endocytosis-Related Genes, and Confers Enhanced Resistance to Xanthomonas oryzae pv. oryzae.

Science.gov (United States)

Park, Chang-Jin; Wei, Tong; Sharma, Rita; Ronald, Pamela C

2017-12-01

The rice immune receptor XA21 confers resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo). To elucidate the mechanism of XA21-mediated immunity, we previously performed a yeast two-hybrid screening for XA21 interactors and identified XA21 binding protein 21 (XB21). Here, we report that XB21 is an auxilin-like protein predicted to function in clathrin-mediated endocytosis. We demonstrate an XA21/XB21 in vivo interaction using co-immunoprecipitation in rice. Overexpression of XB21 in rice variety Kitaake and a Kitaake transgenic line expressing XA21 confers a necrotic lesion phenotype and enhances resistance to Xoo. RNA sequencing reveals that XB21 overexpression results in the differential expression of 8735 genes (4939 genes up- and 3846 genes down-regulated) (≥2-folds, FDR ≤0.01). The up-regulated genes include those predicted to be involved in 'cell death' and 'vesicle-mediated transport'. These results indicate that XB21 plays a role in the plant immune response and in regulation of cell death. The up-regulation of genes controlling 'vesicle-mediated transport' in XB21 overexpression lines is consistent with a functional role for XB21 as an auxilin.

GhCAX3 gene, a novel Ca(2+/H(+ exchanger from cotton, confers regulation of cold response and ABA induced signal transduction.

Directory of Open Access Journals (Sweden)

Lian Xu

Full Text Available As a second messenger, Ca(2+ plays a major role in cold induced transduction via stimulus-specific increases in [Ca(2+]cyt, which is called calcium signature. During this process, CAXs (Ca(2+/H(+ exchangers play critical role. For the first time, a putative Ca(2+/H(+ exchanger GhCAX3 gene from upland cotton (Gossypium hirsutum cv. 'YZ-1' was isolated and characterized. It was highly expressed in all tissues of cotton except roots and fibers. This gene may act as a regulator in cotton's response to abiotic stresses as it could be up-regulated by Ca(2+, NaCl, ABA and cold stress. Similar to other CAXs, it was proved that GhCAX3 also had Ca(2+ transport activity and the N-terminal regulatory region (NRR through yeast complementation assay. Over-expression of GhCAX3 in tobacco showed less sensitivity to ABA during seed germination and seedling stages, and the phenotypic difference between wild type (WT and transgenic plants was more significant when the NRR was truncated. Furthermore, GhCAX3 conferred cold tolerance in yeast as well as in tobacco seedlings based on physiological and molecular studies. However, transgenic plant seeds showed more sensitivity to cold stress compared to WT during seed germination, especially when expressed in N-terminal truncated version. Finally, the extent of sensitivity in transgenic lines was more severe than that in WT line under sodium tungstate treatment (an ABA repressor, indicating that ABA could alleviate cold sensitivity of GhCAX3 seeds, especially in short of its NRR. Meanwhile, we also found that overexpression of GhCAX3 could enhance some cold and ABA responsive marker genes. Taken together, these results suggested that GhCAX3 plays important roles in the cross-talk of ABA and cold signal transduction, and compared to full-length of GhCAX3, the absence of NRR could enhance the tolerance or sensitivity to cold stress, depending on seedling's developmental stages.

The NB-LRR gene Pm60 confers powdery mildew resistance in wheat.

Science.gov (United States)

Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong

2018-04-01

Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Genome-wide screening for genes whose deletions confer sensitivity to mutagenic purine base analogs in yeast

Directory of Open Access Journals (Sweden)

Kozmin Stanislav G

2005-06-01

Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.

Metagenomes of complex microbial consortia derived from different soils as sources for novel genes conferring formation of carbonyls from short-chain polyols on Escherichia coli.

Science.gov (United States)

Knietsch, Anja; Waschkowitz, Tanja; Bowien, Susanne; Henne, Anke; Daniel, Rolf

2003-01-01

Metagenomic DNA libraries from three different soil samples (meadow, sugar beet field, cropland) were constructed. The three unamplified libraries comprised approximately 1267000 independent clones and harbored approximately 4.05 Gbp of environmental DNA. Approximately 300000 recombinant Escherichia coli strains of each library per test substrate were screened for the production of carbonyls from short-chain (C2 to C4) polyols such as 1,2-ethanediol, 2,3-butanediol, and a mixture of glycerol and 1,2-propanediol on indicator agar. Twenty-four positive E. COLI clones were obtained during the initial screen. Fifteen of them contained recombinant plasmids, designated pAK201-215, which conferred a stable carbonyl-forming phenotype on E. coli Sequencing revealed that the inserts of pAK201-215 encoded 26 complete and 14 incomplete predicted protein-encoding genes. Most of these genes were similar to genes with unknown functions from other microorganisms or unrelated to any other known gene. The further analysis was focused on the 7 plasmids (pAK204, pAK206, pAK208, and pAK210-213) recovered from the positive clones, which exhibited an NAD(H)-dependent alcohol oxidoreductase activity with polyols or the correlating carbonyls as substrates in crude extracts. Three genes (ORF6, ORF24, and ORF25) conferring this activity were identified during subcloning of the inserts of pAK204, pAK211, and pAK212. The sequences of the three deduced gene products revealed no significant similarities to known alcohol oxidoreductases, but contained putative glycine-rich regions, which are characteristic for binding of nicotinamide cofactors. Copyright 2003 S. Karger AG, Basel

Influences of the disease resistance conferred by the individual ...

African Journals Online (AJOL)

To research possible influences of the disease resistance conferred by different trans-resistance genes on the transgenic rice plants in their yields and grain quality, three transgenic rice lines, including two with the resistance genes Pi-d2 and Pi-d3, respectively, for rice blast, and one with the resistance gene Xa21 for rice ...

Introgression and pyramiding into common bean market class fabada of genes conferring resistance to anthracnose and potyvirus.

Science.gov (United States)

Ferreira, Juan José; Campa, Ana; Pérez-Vega, Elena; Rodríguez-Suárez, Cristina; Giraldez, Ramón

2012-03-01

Anthracnose and bean common mosaic (BCM) are considered major diseases in common bean crop causing severe yield losses worldwide. This work describes the introgression and pyramiding of genes conferring genetic resistance to BCM and anthracnose local races into line A25, a bean genotype classified as market class fabada. Resistant plants were selected using resistance tests or combining resistance tests and marker-assisted selection. Lines A252, A321, A493, Sanilac BC6-Are, and BRB130 were used as resistance sources. Resistance genes to anthracnose (Co-2 ( C ), Co-2 ( A252 ) and Co-3/9) and/or BCM (I and bc-3) were introgressed in line A25 through six parallel backcrossing programs, and six breeding lines showing a fabada seed phenotype were obtained after six backcross generations: line A1258 from A252; A1231 from A321; A1220 from A493; A1183 and A1878 from Sanilac BC6-Are; and line A2418 from BRB130. Pyramiding of different genes were developed using the pedigree method from a single cross between lines obtained in the introgression step: line A1699 (derived from cross A1258 × A1220), A2438 (A1220 × A1183), A2806 (A1878 × A2418), and A3308 (A1699 × A2806). A characterization based on eight morpho-agronomic traits revealed a limited differentiation among the obtained breeding lines and the recurrent line A25. However, using a set of seven molecular markers linked to the loci used in the breeding programs it was possible to differentiate the 11 fabada lines. Considering the genetic control of the resistance in resistant donor lines, the observed segregations in the last backcrossing generation, the reaction against the pathogens, and the expression of the molecular markers it was also possible to infer the genotype conferring resistance in the ten fabada breeding lines obtained. As a result of these breeding programs, genetic resistance to three anthracnose races controlled by genes included in clusters Co-2 and Co-3/9, and genetic resistance to BCM controlled

Hamburg Accelerator Conference (2)

Energy Technology Data Exchange (ETDEWEB)

Wilson, Edmund J.N. [CERN Accelerator School (Switzerland)

1992-11-15

From 20-24 July, Hamburg welcomed the Fifteenth International Conference on High Energy Accelerators (HEACC). The HEACC Conference traditionally reviews the status of all major accelerator projects whether they are already running like clockwork, still in the construction phase, or waiting impatiently for financial approval.

Hamburg Accelerator Conference (2)

International Nuclear Information System (INIS)

Wilson, Edmund J.N.

1992-01-01

From 20-24 July, Hamburg welcomed the Fifteenth International Conference on High Energy Accelerators (HEACC). The HEACC Conference traditionally reviews the status of all major accelerator projects whether they are already running like clockwork, still in the construction phase, or waiting impatiently for financial approval

Common variants in the TPH2 promoter confer susceptibility to paranoid schizophrenia.

Science.gov (United States)

Yi, Zhenghui; Zhang, Chen; Lu, Weihong; Song, Lisheng; Liu, Dentang; Xu, Yifeng; Fang, Yiru

2012-07-01

Serotonergic system-related genes may be good candidates in investigating the genetic basis of schizophrenia. Our previous study suggested that promoter region of tryptophan hydroxylase 2 gene (TPH2) may confer the susceptibility to paranoid schizophrenia. In this study, we investigated whether common variants within TPH2 promoter may predispose to paranoid schizophrenia in Han Chinese. A total of 509 patients who met DSM-IV criteria for paranoid schizophrenia and 510 matched healthy controls were recruited for this study. Five polymorphisms within TPH2 promoter region were tested. No statistically significant differences were found in allele or genotype frequencies between schizophrenic patients and healthy controls. The frequency of the rs4448731T-rs6582071A-rs7963803A-rs4570625T-rs11178997A haplotype was significantly higher in cases compared to the controls (P = 0.003; OR = 1.49; 95% CI, 1.15-1.95). Our results suggest that the common variants within TPH2 promoter are associated with paranoid schizophrenia in Han Chinese. Further studies in larger samples are warranted to elucidate the role of TPH2 in the etiology of paranoid schizophrenia.

Association of TGFβ1, TNFα, CCR2 and CCR5 gene polymorphisms in type-2 diabetes and renal insufficiency among Asian Indians

Directory of Open Access Journals (Sweden)

Gupta Arvind

2007-04-01

Full Text Available Abstract Background Cytokines play an important role in the development of diabetic chronic renal insufficiency (CRI. Transforming growth factor β1 (TGF β1 induces renal hypertrophy and fibrosis, and cytokines like tumor necrosis factor-alpha (TNFα, chemoattractant protein-1 (MCP-1, and regulated upon activation and normal T cell expressed and secreted (RANTES mediate macrophage infiltration into kidney. Over expression of these chemokines leads to glomerulosclerosis and interstitial fibrosis. The effect of MCP-1 and RANTES on kidney is conferred by their receptors i.e., chemokine receptor (CCR-2 and CCR-5 respectively. We tested association of nine single nucleotide polymorphisms (SNPs from TGFβ1, TNFα, CCR2 and CCR5 genes among individuals with type-2 diabetes with and without renal insufficiency. Methods Type-2 diabetes subjects with chronic renal insufficiency (serum creatinine ≥ 3.0 mg/dl constituted the cases, and matched individuals with diabetes of duration ≥ 10 years and normoalbuminuria were evaluated as controls from four centres in India. Allelic and genotypic contributions of nine SNPs from TGFβ1, TNFα, CCR2 and CCR5 genes to diabetic CRI were tested by computing odds ratio (OR and 95% confidence intervals (CI. Sub-analysis of CRI cases diabetic retinopathy status as dependent variable and SNP genotypes as independent variable in a univariate logistic regression was also performed. Results SNPs Tyr81His and Thr263Ile in TGF β1 gene were monomorphic, and Arg25Pro in TGF β1 gene and Δ32 polymorphism in CCR5 gene were minor variants (minor allele frequency A SNP of CCR5 gene has been observed and the allele 59029A seems to confer predisposition to development of diabetic CRI (OR 1.39; CI 1.04–1.84. In CRI subjects a compound group of genotypes "GA and AA" of SNP G>A -800 was found to confer predisposition for proliferative retinopathy (OR 3.03; CI 1.08–8.50, p = 0.035. Conclusion Of the various cytokine gene

Arabidopsis genes, AtNPR1, AtTGA2 and AtPR-5, confer partial resistance to soybean cyst nematode (Heterodera glycines) when overexpressed in transgenic soybean roots

Science.gov (United States)

2014-01-01

Background Extensive studies using the model system Arabidopsis thaliana to elucidate plant defense signaling and pathway networks indicate that salicylic acid (SA) is the key hormone triggering the plant defense response against biotrophic and hemi-biotrophic pathogens, while jasmonic acid (JA) and derivatives are critical to the defense response against necrotrophic pathogens. Several reports demonstrate that SA limits nematode reproduction. Results Here we translate knowledge gained from studies using Arabidopsis to soybean. The ability of thirty-one Arabidopsis genes encoding important components of SA and JA synthesis and signaling in conferring resistance to soybean cyst nematode (SCN: Heterodera glycines) are investigated. We demonstrate that overexpression of three of thirty-one Arabidoposis genes in transgenic soybean roots of composite plants decreased the number of cysts formed by SCN to less than 50% of those found on control roots, namely AtNPR1(33%), AtTGA2 (38%), and AtPR-5 (38%). Three additional Arabidopsis genes decreased the number of SCN cysts by 40% or more: AtACBP3 (53% of the control value), AtACD2 (55%), and AtCM-3 (57%). Other genes having less or no effect included AtEDS5 (77%), AtNDR1 (82%), AtEDS1 (107%), and AtPR-1 (80%), as compared to control. Overexpression of AtDND1 greatly increased susceptibility as indicated by a large increase in the number of SCN cysts (175% of control). Conclusions Knowledge of the pathogen defense system gained from studies of the model system, Arabidopsis, can be directly translated to soybean through direct overexpression of Arabidopsis genes. When the genes, AtNPR1, AtGA2, and AtPR-5, encoding specific components involved in SA regulation, synthesis, and signaling, are overexpressed in soybean roots, resistance to SCN is enhanced. This demonstrates functional compatibility of some Arabidopsis genes with soybean and identifies genes that may be used to engineer resistance to nematodes. PMID:24739302

Arabidopsis genes, AtNPR1, AtTGA2 and AtPR-5, confer partial resistance to soybean cyst nematode (Heterodera glycines) when overexpressed in transgenic soybean roots.

Science.gov (United States)

Matthews, Benjamin F; Beard, Hunter; Brewer, Eric; Kabir, Sara; MacDonald, Margaret H; Youssef, Reham M

2014-04-16

Extensive studies using the model system Arabidopsis thaliana to elucidate plant defense signaling and pathway networks indicate that salicylic acid (SA) is the key hormone triggering the plant defense response against biotrophic and hemi-biotrophic pathogens, while jasmonic acid (JA) and derivatives are critical to the defense response against necrotrophic pathogens. Several reports demonstrate that SA limits nematode reproduction. Here we translate knowledge gained from studies using Arabidopsis to soybean. The ability of thirty-one Arabidopsis genes encoding important components of SA and JA synthesis and signaling in conferring resistance to soybean cyst nematode (SCN: Heterodera glycines) are investigated. We demonstrate that overexpression of three of thirty-one Arabidoposis genes in transgenic soybean roots of composite plants decreased the number of cysts formed by SCN to less than 50% of those found on control roots, namely AtNPR1(33%), AtTGA2 (38%), and AtPR-5 (38%). Three additional Arabidopsis genes decreased the number of SCN cysts by 40% or more: AtACBP3 (53% of the control value), AtACD2 (55%), and AtCM-3 (57%). Other genes having less or no effect included AtEDS5 (77%), AtNDR1 (82%), AtEDS1 (107%), and AtPR-1 (80%), as compared to control. Overexpression of AtDND1 greatly increased susceptibility as indicated by a large increase in the number of SCN cysts (175% of control). Knowledge of the pathogen defense system gained from studies of the model system, Arabidopsis, can be directly translated to soybean through direct overexpression of Arabidopsis genes. When the genes, AtNPR1, AtGA2, and AtPR-5, encoding specific components involved in SA regulation, synthesis, and signaling, are overexpressed in soybean roots, resistance to SCN is enhanced. This demonstrates functional compatibility of some Arabidopsis genes with soybean and identifies genes that may be used to engineer resistance to nematodes.

An improved method for transformation of lettuce by Agrobacterium tumefaciens with a gene that confers freezing resistance

Directory of Open Access Journals (Sweden)

Pileggi Marcos

2001-01-01

Full Text Available An efficient method for constructing transgenic lettuce cultivars by Agrobacterium tumefaciens was described by Torres et al., 1993. In the present work, an improvement of the above procedure is described and applied to transform the cultivar Grand Rapids with a mutated P5CS gene. The major modifications were concerned with turning more practical the transformation and regeneration protocols. Also we tried to improve transformation steps by increasing injured area in explants and prolonging co-cultivation with Agrobacteria (in larger concentration. A more significant selective pressure was used against non-transformed plants and bacteria. In these work we were concerned to obtain T1 and T2 seeds. The P5CS gene codes for a delta¹-pyrroline-5-carboxylate synthetase, a bifunctional enzyme that catalyzes two steps of proline biosynthesis in plants (Zhang et al., 1995; Peng et al., 1996, while the mutated gene is insensitive to feedback inhibition by proline. The potential benefit of this gene is to confer water stress resistance (drought, salt, cold due to increased intracellular levels of proline that works like an osmoprotectant. In this work could obtain and characterize transgenic lettuce lineages which are resistant to freezing temperature.

Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

Directory of Open Access Journals (Sweden)

Jacobs Jeanne ME

2011-10-01

Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

2nd UNet conference

CERN Document Server

Menasche, Daniel; Sabir, Essaïd; Pellegrini, Francesco; Benjillali, Mustapha

2017-01-01

This volume offers the proceedings of the 2nd UNet conference, held in Casablanca May 30 - June 1, 2016. It presents new trends and findings in hot topics related to ubiquitous computing/networking, covered in three tracks and three special sessions: Main Track 1: Context-Awareness and Autonomy Paradigms Track Main Track 2: Mobile Edge Networking and Virtualization Track Main Track 3: Enablers, Challenges and Applications Special Session 1: Smart Cities and Urban Informatics for Sustainable Development Special Session 2: Unmanned Aerial Vehicles From Theory to Applications Special Session 3: From Data to Knowledge: Big Data applications and solutions.

Expression of TaWRKY44, a wheat WRKY gene, in transgenic tobacco confers multiple abiotic stress tolerances

Directory of Open Access Journals (Sweden)

Xiatian eWang

2015-08-01

Full Text Available The WRKY transcription factors have been reported to be involved in various plant physiological and biochemical processes. In this study, we successfully assembled ten unigenes from expressed sequence tags (ESTs of wheat and designated them as TaWRKY44–TaWRKY53, respectively. Among these genes, a subgroup I gene, TaWRKY44, was found to be upregulated by treatments with PEG6000, NaCl, 4°C, abscisic acid (ABA, H2O2 and gibberellin (GA. The TaWRKY44-GFP fusion protein was localized to the nucleus of onion epidermal cells, and TaWRKY44 was able to bind to the core DNA sequences of TTGACC and TTAACC in yeast. The N-terminal of TaWRKY44 showed transcriptional activation activity. Expression of TaWRKY44 in tobacco plants conferred drought and salt tolerance and transgenic tobacco exhibited a higher survival rate, relative water content (RWC, soluble sugar, proline and superoxide dismutase (SOD content, as well as higher activities of catalase (CAT and peroxidase (POD, but less ion leakage (IL, lower contents of malondialdehyde (MDA, and H2O2. In addition, expression of TaWRKY44 also increased the seed germination rate in the transgenic lines under osmotic stress conditions while exhibiting a lower H2O2 content and higher SOD, CAT and POD activities. Expression of TaWRKY44 upregulated the expression of some reactive oxygen species (ROS-related genes and stress-responsive genes in tobacco under osmotic stresses. These data demonstrate that TaWRKY44 may act as a positive regulator in drought/salt/osmotic stress responses by either efficient ROS elimination through direct or indirect activation of the cellular antioxidant systems or activation of stress-associated gene expression.

In silico design and functional assessment of semisynthetic genes that confer tolerance to phosphinothricin

Directory of Open Access Journals (Sweden)

Jenny Paola Jiménez

2016-07-01

Full Text Available Herbicide tolerance is one of the features most used in GM crops, which has shown positive results for farmers and the environment. The starting point is the development of expression cassettes that express the characteristic of interest, they are initially constructed by standard molecular biology techniques. Currently, by bioinformatics and synthetic biology tools, it is possible to design and test the construct in silico, and then hire their synthesis. This approach allows optimizing expression by modifying the codon usage. In this work there were designed and evaluated semi-synthetic versions of genes in Nicotiana benthamiana, these genes confer tolerance to the herbicide phosphinothricin. It was made an analysis of freedom to operate in order to ensure that the designed constructs not violate intellectual property in Colombia. There were obtained two expression cassettes with freedom to operate, which express versions of the bar gene.

Design of chimeric expression elements that confer high-level gene activity in chromoplasts.

Science.gov (United States)

Caroca, Rodrigo; Howell, Katharine A; Hasse, Claudia; Ruf, Stephanie; Bock, Ralph

2013-02-01

Non-green plastids, such as chromoplasts, generally have much lower activity of gene expression than chloroplasts in photosynthetically active tissues. Suppression of plastid genes in non-green tissues occurs through a complex interplay of transcriptional and translational control, with the contribution of regulation of transcript abundance versus translational activity being highly variable between genes. Here, we have investigated whether the low expression of the plastid genome in chromoplasts results from inherent limitations in gene expression capacity, or can be overcome by designing appropriate combinations of promoters and translation initiation signals in the 5' untranslated region (5'-UTR). We constructed chimeric expression elements that combine promoters and 5'-UTRs from plastid genes, which are suppressed during chloroplast-to-chromoplast conversion in Solanum lycopersicum (tomato) fruit ripening, either just at the translational level or just at the level of mRNA accumulation. These chimeric expression elements were introduced into the tomato plastid genome by stable chloroplast transformation. We report the identification of promoter-UTR combinations that confer high-level gene expression in chromoplasts of ripe tomato fruits, resulting in the accumulation of reporter protein GFP to up to 1% of total cellular protein. Our work demonstrates that non-green plastids are capable of expressing genes to high levels. Moreover, the chimeric cis-elements for chromoplasts developed here are widely applicable in basic and applied research using transplastomic methods. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.

Identification and characterization of Sr13, a tetraploid wheat gene that confers resistance to the Ug99 stem rust race group

Science.gov (United States)

The Puccinia graminis f. sp. tritici (Pgt) Ug99 race group is virulent to most stem rust resistance genes currently deployed in wheat and poses a serious threat to global wheat production. The durum wheat (Triticum turgidum ssp. durum) gene Sr13 confers resistance to Ug99 in addition to virulent rac...

Microgravity Materials Science Conference 2000. Volume 2

Science.gov (United States)

Ramachandran, Narayanan (Editor); Bennett, Nancy (Editor); McCauley, Dannah (Editor); Murphy, Karen (Editor); Poindexter, Samantha (Editor)

2001-01-01

This is Volume 2 of 3 of the 2000 Microgravity Materials Science Conference that was held June 6-8 at the Von Braun Center, Huntsville, Alabama. It was organized by the Microgravity Materials Science Discipline Working Group, sponsored by the Microgravity Research Division (MRD) at NASA Headquarters, and hosted by NASA Marshall Space Flight Center and the Alliance for Microgravity Materials Science and Applications (AMMSA). It was the fourth NASA conference of this type in the Microgravity materials science discipline. The microgravity science program sponsored approx. 200 investigators, all of whom made oral or poster presentations at this conference- In addition, posters and exhibits covering NASA microgravity facilities, advanced technology development projects sponsored by the NASA Microgravity Research Division at NASA Headquarters, and commercial interests were exhibited. The purpose of the conference %%,its to inform the materials science community of research opportunities in reduced gravity and to highlight the Spring 2001 release of the NASA Research Announcement (NRA) to solicit proposals for future investigations. It also served to review the current research and activities in material,, science, to discuss the envisioned long-term goals. and to highlight new crosscutting research areas of particular interest to MRD. The conference was aimed at materials science researchers from academia, industry, and government. A workshop on in situ resource utilization (ISRU) was held in conjunction with the conference with the goal of evaluating and prioritizing processing issues in Lunar and Martian type environments. The workshop participation included invited speakers and investigators currently funded in the material science program under the Human Exploration and Development of Space (HEDS) initiative. The conference featured a plenary session every day with an invited speaker that was followed by three parallel breakout sessions in subdisciplines. Attendance

Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.

Science.gov (United States)

Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian

2018-06-01

Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.

10. international mouse genome conference

Energy Technology Data Exchange (ETDEWEB)

Meisler, M.H.

1996-12-31

Ten years after hosting the First International Mammalian Genome Conference in Paris in 1986, Dr. Jean-Louis Guenet presided over the Tenth Conference at the Pasteur Institute, October 7--10, 1996. The 1986 conference was a satellite to the Human Gene Mapping Workshop and had approximately 50 attendees. The 1996 meeting was attended by 300 scientists from around the world. In the interim, the number of mapped loci in the mouse increased from 1,000 to over 20,000. This report contains a listing of the program and its participants, and two articles that review the meeting and the role of the laboratory mouse in the Human Genome project. More than 200 papers were presented at the conference covering the following topics: International mouse chromosome committee meetings; Mutant generation and identification; Physical and genetic maps; New technology and resources; Chromatin structure and gene regulation; Rate and hamster genetic maps; Informatics and databases; and Quantitative trait analysis.

Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

Science.gov (United States)

Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

2017-01-01

A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

2nd SUMO Conference

CERN Document Server

Weber, Melanie

2015-01-01

This contributed volume contains the conference proceedings of the Simulation of Urban Mobility (SUMO) conference 2014, Berlin. The included research papers cover a wide range of topics in traffic planning and simulation, including open data, vehicular communication, e-mobility, urban mobility, multimodal traffic as well as usage approaches. The target audience primarily comprises researchers and experts in the field, but the book may also be beneficial for graduate students.  

Stable gene transfer of CCR5 and CXCR4 siRNAs by sleeping beauty transposon system to confer HIV-1 resistance

Directory of Open Access Journals (Sweden)

Akkina Ramesh

2008-07-01

Full Text Available Abstract Background Thus far gene therapy strategies for HIV/AIDS have used either conventional retroviral vectors or lentiviral vectors for gene transfer. Although highly efficient, their use poses a certain degree of risk in terms of viral mediated oncogenesis. Sleeping Beauty (SB transposon system offers a non-viral method of gene transfer to avoid this possible risk. With respect to conferring HIV resistance, stable knock down of HIV-1 coreceptors CCR5 and CXCR4 by the use of lentiviral vector delivered siRNAs has proved to be a promising strategy to protect cells from HIV-1 infection. In the current studies our aim is to evaluate the utility of SB system for stable gene transfer of CCR5 and CXCR4 siRNA genes to derive HIV resistant cells as a first step towards using this system for gene therapy. Results Two well characterized siRNAs against the HIV-1 coreceptors CCR5 and CXCR4 were chosen based on their previous efficacy for the SB transposon gene delivery. The siRNA transgenes were incorporated individually into a modified SB transfer plasmid containing a FACS sortable red fluorescence protein (RFP reporter and a drug selectable neomycin resistance gene. Gene transfer was achieved by co-delivery with a construct expressing a hyperactive transposase (HSB5 into the GHOST-R3/X4/R5 cell line, which expresses the major HIV receptor CD4 and and the co-receptors CCR5 and CXCR4. SB constructs expressing CCR5 or CXCR4 siRNAs were also transfected into MAGI-CCR5 or MAGI-CXCR4 cell lines, respectively. Near complete downregulation of CCR5 and CXCR4 surface expression was observed in transfected cells. During viral challenge with X4-tropic (NL4.3 or R5-tropic (BaL HIV-1 strains, the respective transposed cells showed marked viral resistance. Conclusion SB transposon system can be used to deliver siRNA genes for stable gene transfer. The siRNA genes against HIV-1 coreceptors CCR5 and CXCR4 are able to downregulate the respective cell surface proteins

NRF2 Mutation Confers Malignant Potential and Resistance to Chemoradiation Therapy in Advanced Esophageal Squamous Cancer

Directory of Open Access Journals (Sweden)

Tatsuhiro Shibata

2011-09-01

Full Text Available Esophageal squamous cancer (ESC is one of the most aggressive tumors of the gastrointestinal tract. A combination of chemotherapy and radiation therapy (CRT has improved the clinical outcome, but the molecular background determining the effectiveness of therapy remains unknown. NRF2 is a master transcriptional regulator of stress adaptation, and gain of-function mutation of NRF2 in cancer confers resistance to stressors including anticancer therapy. Direct resequencing analysis revealed that Nrf2 gain-of-function mutation occurred recurrently (18/82, 22% in advanced ESC tumors and ESC cell lines (3/10. The presence of Nrf2 mutation was associated with tumor recurrence and poor prognosis. Short hairpin RNA-mediated down-regulation of NRF2 in ESC cells that harbor only mutated Nrf2 allele revealed that themutant NRF2 conferred increased cell proliferation, attachment-independent survival, and resistance to 5-fluorouracil and γ-irradiation. Based on the Nrf2 mutation status, gene expression signatures associated with NRF2 mutation were extracted from ESC cell lines, and their potential utility for monitoring and prognosis was examined in a cohort of 33 pre-CRT cases of ESC. The molecular signatures of NRF2 mutation were significantly predictive and prognostic for CRT response. In conclusion, recurrent NRF2 mutation confers malignant potential and resistance to therapy in advanced ESC, resulting in a poorer outcome. Molecular signatures of NRF2 mutation can be applied as predictive markers of response to CRT, and efficient inhibition of aberrant NRF2 activation could be a promising approach in combination with CRT.

2nd International Conference on NeuroRehabilitation

CERN Document Server

Andersen, Ole; Akay, Metin

2014-01-01

The book is the proceedings of the 2nd International Conference on NeuroRehabilitation (ICNR 2014), held 24th-26th June 2014 in Aalborg, Denmark. The conference featured the latest highlights in the emerging and interdisciplinary field of neural rehabilitation engineering and identified important healthcare challenges the scientific community will be faced with in the coming years. Edited and written by leading experts in the field, the book includes keynote papers, regular conference papers, and contributions to special and innovation sessions, covering the following main topics: neuro-rehabilitation applications and solutions for restoring impaired neurological functions; cutting-edge technologies and methods in neuro-rehabilitation; and translational challenges in neuro-rehabilitation. Thanks to its highly interdisciplinary approach, the book will not only be a  highly relevant reference guide for academic researchers, engineers, neurophysiologists, neuroscientists, physicians and physiotherapists workin...

2. International conference on non-proliferation problems. Abstracts of reports

Energy Technology Data Exchange (ETDEWEB)

Koltysheva, G I; Perepelkin, I G [eds.

1999-12-31

On 14-17 September 1998, in Kurchatov (Kazakstan), II. International Conference on Non-proliferation Problems was held. Representatives from different international organizations (IAEA, UNO, CTBT Organization Preparatory Committee, Austria), from organizations of Kazakstan, Russia, USA, Japan took part in the Conference. At the conference there were 220 participants. Different issues relating to non-proliferation were discussed at the conference sections. The Conference included Plenary Session `History and Current State of Non-proliferation Problem` and three sections: (1) Practical measures to support non-proliferation regime and Control for Nuclear Tests`; (2) Problems on Eliminating Nuclear tests Consequences and Conversion of Nuclear and Industrial Complex`; (3) Medical and ecological problems of Nuclear Tests Consequences`

2. International conference on non-proliferation problems. Abstracts of reports

International Nuclear Information System (INIS)

Koltysheva, G.I.; Perepelkin, I.G.

1998-01-01

On 14-17 September 1998, in Kurchatov (Kazakstan), II. International Conference on Non-proliferation Problems was held. Representatives from different international organizations (IAEA, UNO, CTBT Organization Preparatory Committee, Austria), from organizations of Kazakstan, Russia, USA, Japan took part in the Conference. At the conference there were 220 participants. Different issues relating to non-proliferation were discussed at the conference sections. The Conference included Plenary Session 'History and Current State of Non-proliferation Problem' and three sections: 1) Practical measures to support non-proliferation regime and Control for Nuclear Tests'; 2) Problems on Eliminating Nuclear tests Consequences and Conversion of Nuclear and Industrial Complex'; 3) Medical and ecological problems of Nuclear Tests Consequences'

Candidate gene analysis and identification of TRAP and SSR markers linked to the Or5 gene, which confers sunflower resistance to race E of broomrape (Orobanche cumana Wallr.)

Science.gov (United States)

Sunflower broomrape (Orobanche cumana Wallr.) is a root holoparasitic angiosperm considered as being one of the major constraints for sunflower production in Mediterranean areas. Breeding for resistance has been crucial for protecting sunflowers from broomrape damage. The Or5 gene, which confers re...

Functional variants in the LRRK2 gene confer shared effects on risk for Crohn's disease and Parkinson's disease.

Science.gov (United States)

Hui, Ken Y; Fernandez-Hernandez, Heriberto; Hu, Jianzhong; Schaffner, Adam; Pankratz, Nathan; Hsu, Nai-Yun; Chuang, Ling-Shiang; Carmi, Shai; Villaverde, Nicole; Li, Xianting; Rivas, Manual; Levine, Adam P; Bao, Xiuliang; Labrias, Philippe R; Haritunians, Talin; Ruane, Darren; Gettler, Kyle; Chen, Ernie; Li, Dalin; Schiff, Elena R; Pontikos, Nikolas; Barzilai, Nir; Brant, Steven R; Bressman, Susan; Cheifetz, Adam S; Clark, Lorraine N; Daly, Mark J; Desnick, Robert J; Duerr, Richard H; Katz, Seymour; Lencz, Todd; Myers, Richard H; Ostrer, Harry; Ozelius, Laurie; Payami, Haydeh; Peter, Yakov; Rioux, John D; Segal, Anthony W; Scott, William K; Silverberg, Mark S; Vance, Jeffery M; Ubarretxena-Belandia, Iban; Foroud, Tatiana; Atzmon, Gil; Pe'er, Itsik; Ioannou, Yiannis; McGovern, Dermot P B; Yue, Zhenyu; Schadt, Eric E; Cho, Judy H; Peter, Inga

2018-01-10

Crohn's disease (CD), a form of inflammatory bowel disease, has a higher prevalence in Ashkenazi Jewish than in non-Jewish European populations. To define the role of nonsynonymous mutations, we performed exome sequencing of Ashkenazi Jewish patients with CD, followed by array-based genotyping and association analysis in 2066 CD cases and 3633 healthy controls. We detected association signals in the LRRK2 gene that conferred risk for CD (N2081D variant, P = 9.5 × 10 -10 ) or protection from CD (N551K variant, tagging R1398H-associated haplotype, P = 3.3 × 10 -8 ). These variants affected CD age of onset, disease location, LRRK2 activity, and autophagy. Bayesian network analysis of CD patient intestinal tissue further implicated LRRK2 in CD pathogenesis. Analysis of the extended LRRK2 locus in 24,570 CD cases, patients with Parkinson's disease (PD), and healthy controls revealed extensive pleiotropy, with shared genetic effects between CD and PD in both Ashkenazi Jewish and non-Jewish cohorts. The LRRK2 N2081D CD risk allele is located in the same kinase domain as G2019S, a mutation that is the major genetic cause of familial and sporadic PD. Like the G2019S mutation, the N2081D variant was associated with increased kinase activity, whereas neither N551K nor R1398H variants on the protective haplotype altered kinase activity. We also confirmed that R1398H, but not N551K, increased guanosine triphosphate binding and hydrolyzing enzyme (GTPase) activity, thereby deactivating LRRK2. The presence of shared LRRK2 alleles in CD and PD provides refined insight into disease mechanisms and may have major implications for the treatment of these two seemingly unrelated diseases. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Mapping 22q11.2 Gene Dosage Effects on Brain Morphometry.

Science.gov (United States)

Lin, Amy; Ching, Christopher R K; Vajdi, Ariana; Sun, Daqiang; Jonas, Rachel K; Jalbrzikowski, Maria; Kushan-Wells, Leila; Pacheco Hansen, Laura; Krikorian, Emma; Gutman, Boris; Dokoru, Deepika; Helleman, Gerhard; Thompson, Paul M; Bearden, Carrie E

2017-06-28

Reciprocal chromosomal rearrangements at the 22q11.2 locus are associated with elevated risk of neurodevelopmental disorders. The 22q11.2 deletion confers the highest known genetic risk for schizophrenia, but a duplication in the same region is strongly associated with autism and is less common in schizophrenia cases than in the general population. Here we conducted the first study of 22q11.2 gene dosage effects on brain structure in a sample of 143 human subjects: 66 with 22q11.2 deletions (22q-del; 32 males), 21 with 22q11.2 duplications (22q-dup; 14 males), and 56 age- and sex-matched controls (31 males). 22q11.2 gene dosage varied positively with intracranial volume, gray and white matter volume, and cortical surface area (deletion control > duplication). Widespread differences were observed for cortical surface area with more localized effects on cortical thickness. These diametric patterns extended into subcortical regions: 22q-dup carriers had a significantly larger right hippocampus, on average, but lower right caudate and corpus callosum volume, relative to 22q-del carriers. Novel subcortical shape analysis revealed greater radial distance (thickness) of the right amygdala and left thalamus, and localized increases and decreases in subregions of the caudate, putamen, and hippocampus in 22q-dup relative to 22q-del carriers. This study provides the first evidence that 22q11.2 is a genomic region associated with gene-dose-dependent brain phenotypes. Pervasive effects on cortical surface area imply that this copy number variant affects brain structure early in the course of development. SIGNIFICANCE STATEMENT Probing naturally occurring reciprocal copy number variation in the genome may help us understand mechanisms underlying deviations from typical brain and cognitive development. The 22q11.2 genomic region is particularly susceptible to chromosomal rearrangements and contains many genes crucial for neuronal development and migration. Not surprisingly

2nd International Conference on Nuclear Physics in Astrophysics

CERN Document Server

Fülöp, Zsolt; Somorjai, Endre; The European Physical Journal A : Volume 27, Supplement 1, 2006

2006-01-01

Launched in 2004, "Nuclear Physics in Astrophysics" has established itself in a successful topical conference series addressing the forefront of research in the field. This volume contains the selected and refereed papers of the 2nd conference, held in Debrecen in 2005 and reprinted from "The European Physical Journal A - Hadrons and Nuclei".

2. National scientific conference on process engineering in environment protection. Conference materials; 2. Ogolnopolska konferencja naukowa ``inzynieria procesowa w ochronie srodowiska``. Materialy konferencyjne

Energy Technology Data Exchange (ETDEWEB)

NONE

1994-12-31

The national conference on `Process engineering in environment protection` Jachranka 1994 has been divided into three sessions. Section 1 has been devoted to flue gas purification and collects 13 papers. Section 2 on liquid purification gathered 8 presentation. Section 3 - the poster session with 12 posters on related topics. During the conference 2 lectures and 3 posters have been devoted to the application of nuclear techniques to the solution different problems connected with environment protection.

Common Variants in CLDN2 and MORC4 Genes Confer Disease Susceptibility in Patients with Chronic Pancreatitis.

Directory of Open Access Journals (Sweden)

Anil K Giri

Full Text Available A recent genome-wide association study (GWAS identified association with variants in X-linked CLDN2 and MORC4, and PRSS1-PRSS2 loci with chronic pancreatitis (CP in North American patients of European ancestry. We selected 9 variants from the reported GWAS and replicated the association with CP in Indian patients by genotyping 1807 unrelated Indians of Indo-European ethnicity, including 519 patients with CP and 1288 controls. The etiology of CP was idiopathic in 83.62% and alcoholic in 16.38% of 519 patients. Our study confirmed a significant association of 2 variants in CLDN2 gene (rs4409525-OR 1.71, P = 1.38 x 10-09; rs12008279-OR 1.56, P = 1.53 x 10-04 and 2 variants in MORC4 gene (rs12688220-OR 1.72, P = 9.20 x 10-09; rs6622126-OR 1.75, P = 4.04x10-05 in Indian patients with CP. We also found significant association at PRSS1-PRSS2 locus (OR 0.60; P = 9.92 x 10-06 and SAMD12-TNFRSF11B (OR 0.49, 95% CI [0.31-0.78], P = 0.0027. A variant in the gene MORC4 (rs12688220 showed significant interaction with alcohol (OR for homozygous and heterozygous risk allele -14.62 and 1.51 respectively, P = 0.0068 suggesting gene-environment interaction. A combined analysis of the genes CLDN2 and MORC4 based on an effective risk allele score revealed a higher percentage of individuals homozygous for the risk allele in CP cases with 5.09 fold enhanced risk in individuals with 7 or more effective risk alleles compared with individuals with 3 or less risk alleles (P = 1.88 x 10-14. Genetic variants in CLDN2 and MORC4 genes were associated with CP in Indian patients.

Multiyear evaluation of the durability of the resistance conferred by Ma and RMia genes to Meloidogyne incognita in Prunus under controlled conditions.

Science.gov (United States)

Khallouk, Samira; Voisin, Roger; Portier, Ulysse; Polidori, Joël; Van Ghelder, Cyril; Esmenjaud, Daniel

2013-08-01

Root-knot nematodes (RKNs) (Meloidogyne spp.) are highly polyphagous pests that parasitize Prunus crops in Mediterranean climates. Breeding for RKN-resistant Prunus cultivars, as an alternative to the now-banned use of nematicides, is a real challenge, because the perennial nature of these trees increases the risk of resistance breakdown. The Ma plum resistance (R) gene, with a complete spectrum, and the RMia peach R gene, with a more restricted spectrum, both provide total control of Meloidogyne incognita, the model parthenogenetic species of the genus and the most important RKN in terms of economic losses. We investigated the durability of the resistance to this nematode conferred by these genes, comparing the results obtained with those for the tomato Mi-1 reference gene. In multiyear experiments, we applied a high and continuous nematode inoculum pressure by cultivating nematode-infested susceptible tomato plants with either Prunus accessions carrying Ma or RMia R genes, or with resistant tomato plants carrying the Mi-1 gene. Suitable conditions for Prunus development were achieved by carrying out the studies in a glasshouse, in controlled conditions allowing a short winter leaf fall and dormancy. We first assessed the plum accession 'P.2175', which is heterozygous for the Ma gene, in two successive 2-year evaluations, for resistance to two M. incognita isolates. Whatever the isolate used, no nematodes reproducing on P.2175 were detected, whereas galls and nematodes reproducing on tomato plants carrying Mi-1 were observed. In a second experiment with the most aggressive isolate, interspecific full-sib material (P.2175 × ['Garfi' almond × 'Nemared' peach]), carrying either Ma or RMia (from Nemared) or both (in the heterozygous state) or neither of these genes, was evaluated for 4 years. No virulent nematodes developed on Prunus spp. carrying R genes, whereas galling and virulent individuals were observed on Mi-1-resistant tomato plants. Thus, the resistance to

Cooperative interactions between CBP and TORC2 confer selectivity to CREB target gene expression

DEFF Research Database (Denmark)

Ravnskjær, Kim; Kester, Henri; Liu, Yi

2007-01-01

A number of hormones and growth factors stimulate gene expression by promoting the phosphorylation of CREB (P-CREB), thereby enhancing its association with the histone acetylase paralogs p300 and CBP (CBP/p300). Relative to cAMP, stress signals trigger comparable amounts of CREB phosphorylation...... to stress signals, however; and in its absence, P-CREB is unable to stimulate CRE-dependent transcription, due to a block in CBP recruitment. The effect of TORC2 on CBP/p300 promoter occupancy appears pivotal because a gain of function mutant CREB polypeptide with increased affinity for CBP restored CRE......-mediated transcription in cells exposed to stress signals. Taken together, these results indicate that TORC2 is one of the long sought after cofactors that mediates the differential effects of cAMP and stress pathways on CREB target gene expression....

2nd Applied Electromagnetic International Conference

CERN Document Server

Sulaiman, Hamzah; Othman, Mohd; Aziz, Mohamad; Malek, Mohd

2017-01-01

In this book, experts from academia and industry present the latest advances in scientific theory relating to applied electromagnetics and examine current and emerging applications particularly within the fields of electronics, communications, and computer technology. The book is based on presentations delivered at APPEIC 2015, the 2nd Applied Electromagnetic International Conference, held in Krabi, Thailand in December 2015. The conference provided an ideal platform for researchers and specialists to deliver both theoretically and practically oriented contributions on a wide range of topics relevant to the theme of nurturing applied electromagnetics for human technology. Many novel aspects were addressed, and the contributions selected for this book highlight the relevance of advances in applied electromagnetics to a variety of industrial engineering problems and identify exciting future directions for research.

The novel kasugamycin 2'-N-acetyltransferase gene aac(2')-IIa, carried by the IncP island, confers kasugamycin resistance to rice-pathogenic bacteria.

Science.gov (United States)

Yoshii, Atsushi; Moriyama, Hiromitsu; Fukuhara, Toshiyuki

2012-08-01

Kasugamycin (KSM), a unique aminoglycoside antibiotic, has been used in agriculture for many years to control not only rice blast caused by the fungus Magnaporthe grisea but also rice bacterial grain and seedling rot or rice bacterial brown stripe caused by Burkholderia glumae or Acidovorax avenae subsp. avenae, respectively. Since both bacterial pathogens are seed-borne and cause serious injury to rice seedlings, the emergence of KSM-resistant B. glumae and A. avenae isolates highlights the urgent need to understand the mechanism of resistance to KSM. Here, we identified a novel gene, aac(2')-IIa, encoding a KSM 2'-N-acetyltransferase from both KSM-resistant pathogens but not from KSM-sensitive bacteria. AAC(2')-IIa inactivates KSM, although it reveals no cross-resistance to other aminoglycosides. The aac(2')-IIa gene from B. glumae strain 5091 was identified within the IncP genomic island inserted into the bacterial chromosome, indicating the acquisition of this gene by horizontal gene transfer. Although excision activity of the IncP island and conjugational gene transfer was not detected under the conditions tested, circular intermediates containing the aac(2')-IIa gene were detected. These results indicate that the aac(2')-IIa gene had been integrated into the IncP island of a donor bacterial species. Molecular detection of the aac(2')-IIa gene could distinguish whether isolates are resistant or susceptible to KSM. This may contribute to the production of uninfected rice seeds and lead to the effective control of these pathogens by KSM.

Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.

Science.gov (United States)

Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin

2017-06-14

Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

The 2nd International Conference on Particle Physics and Astrophysics

CERN Document Server

Soldatov, Evgeny; ICPPA 2016

2016-01-01

The 2nd International Conference on Particle Physics and Astrophysics (ICPPA-2016) will be held in Moscow, Russia, (from the 10th to 14th of October). The conference is organized by the National Research Nuclear University “MEPhI”. The aim of the Conference is to promote contacts between scientists and to develop new ideas in fundamental research. Therefore we will bring together experts and young scientists working in experimental and theoretical aspects of nuclear physics, particle physics (including astroparticle physics), and cosmology. ICPPA-2016 aims to present the most recent results in astrophysics and collider physics from the main experiments actively taking data as well as any upgrades for the methods of experimental particle physics. Furthermore, one special workshop will be held within the framework of this conference: «SiPM development and application». The working language of the conference is English

A paralogue of the phosphomutase-like gene family in Candida glabrata, CgPmu2, gained broad-range phosphatase activity due to a small number of clustered substitutions.

Science.gov (United States)

Orlando, Kelly A; Iosue, Christine L; Leone, Sarah G; Davies, Danielle L; Wykoff, Dennis D

2015-10-15

Inorganic phosphate is required for a range of cellular processes, such as DNA/RNA synthesis and intracellular signalling. The phosphate starvation-inducible phosphatase activity of Candida glabrata is encoded by the gene CgPMU2 (C. glabrata phosphomutase-like protein). CgPMU2 is part of a three-gene family (∼75% identical) created through gene duplication in the C. glabrata clade; only CgPmu2 is a PHO-regulated broad range acid phosphatase. We identified amino acids that confer broad range phosphatase activity on CgPmu2 by creating fusions of sections of CgPMU2 with CgPMU1, a paralogue with little broad range phosphatase activity. We used site-directed mutagenesis on various fusions to sequentially convert CgPmu1 to CgPmu2. Based on molecular modelling of the Pmu proteins on to a histidine phosphatase crystal structure, clusters of amino acids were found in two distinct regions that were able to confer phosphatase activity. Substitutions in these two regions together conferred broad phosphatase activity on CgPmu1. Interestingly, one change is a histidine adjacent to the active site histidine of CgPmu2 and it exhibits a novel ability to partially replace the conserved active site histidine in CgPmu2. Additionally, a second amino acid change was able to confer nt phosphatase activity to CgPmu1, suggesting single amino acid changes neofunctionalize CgPmu2. © 2015 Authors; published by Portland Press Limited.

Interfacing microbiology and biotechnology. Conference abstracts

Energy Technology Data Exchange (ETDEWEB)

Maupin, Julia A.

2001-05-19

The Interfacing Microbiology and Biotechnology Conference was attended by over 100 faculty, post-docs, students, and research scientists from the US, Europe, and Latin America. The conference successfully stimulated communication and the dissemination of knowledge among scientists involved in basic and applied research. The focus of the conference was on microbial physiology and genetics and included sessions on C1 metabolism, archaeal metabolism, proteases and chaperones, gene arrays, and metabolic engineering. The meeting provided the setting for in-depth discussions between scientists who are internationally recognized for their research in these fields. The following objectives were met: (1) The promotion of interaction and future collaborative projects among scientists involved in basic and applied research which incorporates microbial physiology, genetics, and biochemistry; (2) the facilitation of communication of new research findings through seminars, posters, and abstracts; (3 ) the stimulation of enthusiasm and education among participants including graduate and undergraduate students.

Proceedings of the 2. international oil sands tailings conference

Energy Technology Data Exchange (ETDEWEB)

NONE

2010-07-01

The tailings produced by oil sands extraction processes pose significant threats to the surrounding environment in addition to releasing greenhouse gases (GHGs) into the atmosphere. Recent directives have been established to reduce the amount of tailings produced at oil sands operations, and to ensure that tailings ponds are reclaimed in the most effective manner. This conference provided a forum for researchers and industry experts to discuss issues related to the management and reclamation of oil sands tailings. New technologies for dewatering tailings ponds were presented, and methods of analyzing the chemical properties of tailings were reviewed. The conference was divided into the following 7 sessions: (1) tailings properties, (2) tailings dewatering, (3) new concepts, (4) water and chemistry, (5) soft tailings stabilization and reclamation, (6) water treatment, and (7) new concepts 2. The conference featured 44 presentations, all of which have been catalogued separately for inclusion in this database. tabs., figs.

9. international mouse genome conference

Energy Technology Data Exchange (ETDEWEB)

NONE

1995-12-31

This conference was held November 12--16, 1995 in Ann Arbor, Michigan. The purpose of this conference was to provide a multidisciplinary forum for exchange of state-of-the-art information on genetic mapping in mice. This report contains abstracts of presentations, focusing on the following areas: mutation identification; comparative mapping; informatics and complex traits; mutagenesis; gene identification and new technology; and genetic and physical mapping.

2nd International Afro-European Conference for Industrial Advancement

CERN Document Server

Wegrzyn-Wolska, Katarzyna; Hassanien, Aboul; Snasel, Vaclav; Alimi, Adel

2016-01-01

This volume contains papers presented at the 2nd International Afro-European Conference for Industrial Advancement -- AECIA 2015. The conference aimed at bringing together the foremost experts and excellent young researchers from Africa, Europe and the rest of the world to disseminate the latest results from various fields of engineering, information, and communication technologies. The topics, discussed at the conference, covered a broad range of domains spanning from ICT and engineering to prediction, modeling, and analysis of complex systems. The 2015 edition of AECIA featured a distinguished special track on prediction, modeling and analysis of complex systems -- Nostradamus, and special sessions on Advances in Image Processing and Colorization and Data Processing, Protocols, and Applications in Wireless Sensor Networks.

Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger.

Science.gov (United States)

Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling

2018-04-19

Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

The aux1 gene of the Ri plasmid is sufficient to confer auxin autotrophy in tobacco BY-2 cells.

Science.gov (United States)

Nemoto, Keiichirou; Hara, Masamitsu; Goto, Shingo; Kasai, Kouji; Seki, Hikaru; Suzuki, Masashi; Oka, Atsuhiro; Muranaka, Toshiya; Mano, Yoshihiro

2009-05-01

Tobacco (Nicotiana tabacum) Bright Yellow-2 (BY-2) cells are rapidly proliferating meristematic cells that require auxin for culture in vitro. We have established several transgenic BY-2 cell lines that carry the T-DNA of Agrobacterium rhizogenes 15834, which harbors an agropine-type root-inducing (Ri) plasmid. Two of these lines, BYHR-3 and BYHR-7, were used to test the role of auxin in the proliferation of plant cells. The lines grew rapidly in Linsmaier-Skoog (LS) medium lacking auxin and other phytohormones. The TR-DNA, containing the aux1 (tryptophan monooxygenase) and aux2 (indoleacetamide hydrolase) genes, was present in the genomes of both transgenic lines, whereas the TL-DNA, containing the rolA, B, C and D genes, was present in the genome of BYHR-7 but not BYHR-3. Since the introduction of the rolABCD genes alone did not affect the auxin requirement of BY-2 cells, the aux1 and aux2 genes, but not the rolABCD genes, appear to be relevant to the auxin autotrophy of these transgenic lines. Furthermore, the overexpression of aux1 allowed BY-2 cells to grow rapidly in the absence of auxin, suggesting the existence in plant cells of an unidentified gene whose product is functionally equivalent or similar to that of aux2 of the Ri plasmid.

Association Analysis Suggests SOD2 as a Newly Identified Candidate Gene Associated With Leprosy Susceptibility.

Science.gov (United States)

Ramos, Geovana Brotto; Salomão, Heloisa; Francio, Angela Schneider; Fava, Vinícius Medeiros; Werneck, Renata Iani; Mira, Marcelo Távora

2016-08-01

Genetic studies have identified several genes and genomic regions contributing to the control of host susceptibility to leprosy. Here, we test variants of the positional and functional candidate gene SOD2 for association with leprosy in 2 independent population samples. Family-based analysis revealed an association between leprosy and allele G of marker rs295340 (P = .042) and borderline evidence of an association between leprosy and alleles C and A of markers rs4880 (P = .077) and rs5746136 (P = .071), respectively. Findings were validated in an independent case-control sample for markers rs295340 (P = .049) and rs4880 (P = .038). These results suggest SOD2 as a newly identified gene conferring susceptibility to leprosy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

OpenAIRE

Guo, Bingfu; Guo, Yong; Hong, Huilong; Jin, Longguo; Zhang, Lijuan; Chang, Ru-Zhen; Lu, Wei; Lin, Min; Qiu, Li-Juan

2015-01-01

Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-...

PREFACE: 2nd International Conference on Innovative Materials, Structures and Technologies

Science.gov (United States)

Ručevskis, Sandris

2015-11-01

The 2nd International Conference on Innovative Materials, Structures and Technologies (IMST 2015) took place in Riga, Latvia from 30th September - 2nd October, 2015. The first event of the conference series, dedicated to the 150th anniversary of the Faculty of Civil Engineering of Riga Technical University, was held in 2013. Following the established tradition, the aim of the conference was to promote and discuss the latest results of industrial and academic research carried out in the following engineering fields: analysis and design of advanced structures and buildings; innovative, ecological and energy efficient building materials; maintenance, inspection and monitoring methods; construction technologies; structural management; sustainable and safe transport infrastructure; and geomatics and geotechnics. The conference provided an excellent opportunity for leading researchers, representatives of the industrial community, engineers, managers and students to share the latest achievements, discuss recent advances and highlight the current challenges. IMST 2015 attracted over 120 scientists from 24 countries. After rigorous reviewing, over 80 technical papers were accepted for publication in the conference proceedings. On behalf of the organizing committee I would like to thank all the speakers, authors, session chairs and reviewers for their efficient and timely effort. The 2nd International Conference on Innovative Materials, Structures and Technologies was organized by the Faculty of Civil Engineering of Riga Technical University with the support of the Latvia State Research Programme under the grant agreement "INNOVATIVE MATERIALS AND SMART TECHNOLOGIES FOR ENVIRONMENTAL SAFETY, IMATEH". I would like to express sincere gratitude to Juris Smirnovs, Dean of the Faculty of Civil Engineering, and Andris Chate, manager of the Latvia State Research Programme. Finally, I would like to thank all those who helped to make this event happen. Special thanks go to Diana

Identification of a rice gene (Bph 1) conferring resistance to brown planthopper (Nilaparvata lugens Stal) using STS markers.

Science.gov (United States)

Kim, Suk-Man; Sohn, Jae-Keun

2005-08-31

This study was carried out to identify a high-resolution marker for a gene conferring resistance to brown planthopper (BPH) biotype 1, using japonica type resistant lines. Bulked segregant analyses were conducted using 520 RAPD primers to identify RAPD fragments linked to the BPH resistance gene. Eleven RAPDs were shown to be polymorphic amplicons between resistant and susceptible progeny. One of these primers, OPE 18, which amplified a 923 bp band tightly linked to resistance, was converted into a sequence-tagged-site (STS) marker. The STS marker, BpE18-3, was easily detectable as a dominant band with tight linkage (3.9cM) to Bph1. It promises to be useful as a marker for assisted selection of resistant progeny in backcross breeding programs to introgress the resistance gene into elite japonica cultivars.

Phloem-specific expression of the lectin gene from Allium sativum confers resistance to the sap-sucker Nilaparvata lugens.

Science.gov (United States)

Chandrasekhar, Kottakota; Vijayalakshmi, Muvva; Vani, Kalasamudramu; Kaul, Tanushri; Reddy, Malireddy K

2014-05-01

Rice production is severely hampered by insect pests. Garlic lectin gene (ASAL) holds great promise in conferring protection against chewing (lepidopteran) and sap-sucking (homopteran) insect pests. We have developed transgenic rice lines resistant to sap-sucking brown hopper (Nilaparvata lugens) by ectopic expression of ASAL in their phloem tissues. Molecular analyses of T0 lines confirmed stable integration of transgene. T1 lines (NP 1-2, 4-3, 11-6 & 17-7) showed active transcription and translation of ASAL transgene. ELISA revealed ASAL expression was as high as 0.95% of total soluble protein. Insect bioassays on T2 homozygous lines (NP 18 & 32) revealed significant reduction (~74-83%) in survival rate, development and fecundity of brown hoppers in comparison to wild type. Transgenics exhibited enhanced resistance (1-2 score) against brown hoppers, minimal plant damage and no growth penalty or phenotypic abnormalities.

Proceedings of the 2. CDEN design conference

International Nuclear Information System (INIS)

Yellowley, I.; Gu, P.

2005-01-01

The Canadian Design Engineering Network (CDEN) promotes best practices in engineering design. This annual conference, which provided a forum to exchange ideas and experiences in engineering design, included 2 roundtable discussions on design and innovation in Canadian engineering schools, and design considerations in the accreditation of engineering programs. The conference also featured a student design competition. The main topics of the conference were design education, design for innovation and design practices. Within the topic of design education, the following themes were addressed: design curriculum; design projects and cases; emerging design education tools and techniques; evaluation metrics and techniques in design education; web-based education resources; and, multi-disciplinary design education. Within the topic of design for innovation, the following themes were addressed: technological innovation and creativity; product design; process design; adaptable design; platform and product architecture design; modular design; life cycle issues, reliability, serviceability and disposal/recycling; sustainable design and development; design for manufacturing, construction, services, and the environment; design for life, health and fitness; design methodologies, tools and techniques; distributed design activities and teams; and, web-based design and collaborative design and tools. Within the topic of design practice, the following themes were addressed: engineering, procurement and construction industry; design in auto manufacturing, aerospace industry and high-tech industry; engineering project management; design for sustainability and environmental practices; professional development in engineering design; and, current and future industrial practice trends. The conference featured 30 presentations, of which 5 have been catalogued separately for inclusion in this database. refs., tabs., figs

PREFACE: 2nd National Conference on Nanotechnology 'NANO 2008'

Science.gov (United States)

Czuba, P.; Kolodziej, J. J.; Konior, J.; Szymonski, M.

2009-03-01

This issue of Journal of Physics: Conference Series contains selected papers presented at the 2nd National Conference on Nanotechnology 'NANO2008', that was held in Kraków, Poland, 25-28 June 2008. It was organized jointly by the Polish Chemical Society, Polish Physical Society, Polish Vacuum Society, and the Centre for Nanometer-scale Science and Advanced Materials (NANOSAM) of the Jagiellonian University. The meeting presentations were categorized into the following topics: 1. Nanomechanics and nanotribology 2. Characterization and manipulation in nanoscale 3. Quantum effects in nanostructures 4. Nanostructures on surfaces 5. Applications of nanotechnology in biology and medicine 6. Nanotechnology in education 7. Industrial applications of nanotechnology, presentations of the companies 8. Nanoengineering and nanomaterials (international sessions shared with the fellows of Maria-Curie Host Fellowships within the 6th FP of the European Community Project 'Nano-Engineering for Expertise and Development, NEED') 9. Nanopowders 10. Carbon nanostructures and nanosystems 11. Nanoelectronics and nanophotonics 12. Nanomaterials in catalysis 13. Nanospintronics 14. Ethical, social, and environmental aspects of nanotechnology The Conference was attended by 334 participants. The presentations were delivered as 7 invited plenary lectures, 25 invited topical lectures, 78 oral and 108 poster contributions. Only 1/6 of the contributions presented during the Conference were submitted for publication in this Proceedings volume. From the submitted material, this volume of Journal of Physics: Conference Series contains 37 articles that were positively evaluated by independent referees. The Organizing Committee gratefully acknowledges all these contributions. We also thank all the referees of the papers submitted for the Proceedings for their timely and thorough work. We would like to thank all members of the National Program Committee for their work in the selection process of

The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

Science.gov (United States)

Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

2017-11-01

The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

Science.gov (United States)

Jain, Parul; Tar'an, Bunyamin

2014-11-01

Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

A horizontally gene transferred copper resistance locus confers hyper‐resistance to antibacterial copper toxicity and enables survival of community acquired methicillin resistant Staphylococcus aureus USA300 in macrophages

Science.gov (United States)

Purves, Joanne; Thomas, Jamie; Riboldi, Gustavo P.; Zapotoczna, Marta; Tarrant, Emma; Andrew, Peter W.; Londoño, Alejandra; Planet, Paul J.; Geoghegan, Joan A.; Waldron, Kevin J.

2018-01-01

Summary Excess copper is highly toxic and forms part of the host innate immune system's antibacterial arsenal, accumulating at sites of infection and acting within macrophages to kill engulfed pathogens. We show for the first time that a novel, horizontally gene transferred copper resistance locus (copXL), uniquely associated with the SCCmec elements of the highly virulent, epidemic, community acquired methicillin resistant Staphylococcus aureus (CA‐MRSA) USA300, confers copper hyper‐resistance. These genes are additional to existing core genome copper resistance mechanisms, and are not found in typical S. aureus lineages, but are increasingly identified in emerging pathogenic isolates. Our data show that CopX, a putative P1B‐3‐ATPase efflux transporter, and CopL, a novel lipoprotein, confer copper hyper‐resistance compared to typical S. aureus strains. The copXL genes form an operon that is tightly repressed in low copper environments by the copper regulator CsoR. Significantly, CopX and CopL are important for S. aureus USA300 intracellular survival within macrophages. Therefore, the emergence of new S. aureus clones with the copXL locus has significant implications for public health because these genes confer increased resistance to antibacterial copper toxicity, enhancing bacterial fitness by altering S. aureus interaction with innate immunity. PMID:29521441

CCTC 2009 : 2nd Climate Change Technology Conference

International Nuclear Information System (INIS)

2009-01-01

The 2nd Climate Change Technology Conference (CCTC2009) was held in Hamilton, Ontario, Canada on May 12-15, 2009. CCTC2009 is a Canadian/International forum for engineers, scientists, policy advisors, industry and other stakeholders to share new information and ideas for dealing with climate change and global warming. It also provided an opportunity for participants to keep abreast of emerging techniques and technologies for the mitigation of and adaptation to, the impacts of climate change. The conference theme: 'Climate Change ..... Deal with It!' emphasized the need to develop practical engineering and administrative responses to address the impacts of climate change and global warming.

The Metallothionein Gene, TaMT3, from Tamarix androssowii Confers Cd2+ Tolerance in Tobacco

Directory of Open Access Journals (Sweden)

Boru Zhou

2014-06-01

Full Text Available Cadmium (Cd is a nonessential microelement and low concentration Cd2+ has strong toxicity to plant growth. Plant metallothioneins, a class of low molecular, cystein(Cys-rich and heavy-metal binding proteins, play an important role in both metal chaperoning and scavenging of reactive oxygen species (ROS with their large number of cysteine residues and therefore, protect plants from oxidative damage. In this study, a metallothionein gene, TaMT3, isolated from Tamarix androssowii was transformed into tobacco (Nicotiana tobacum through Agrobacterium-mediated leaf disc method, and correctly expressed under the control of 35S promoter. Under Cd2+ stress, the transgenic tobacco showed significant increases of superoxide dismutase (SOD activity and chlorophyll concentration, but decreases of peroxidase (POD activity and malondialdehyde (MDA accumulation when compared to the non-transgenic tobacco. Vigorous growth of transgenic tobacco was observed at the early development stages, resulting in plant height and fresh weight were significantly larger than those of the non-transgenic tobacco under Cd2+ stress. These results demonstrated that the expression of the exogenous TaMT3 gene increased the ability of ROS cleaning-up, indicating a stronger tolerance to Cd2+ stress.

The metallothionein gene, TaMT3, from Tamarix androssowii confers Cd2+ tolerance in tobacco.

Science.gov (United States)

Zhou, Boru; Yao, Wenjing; Wang, Shengji; Wang, Xinwang; Jiang, Tingbo

2014-06-10

Cadmium (Cd) is a nonessential microelement and low concentration Cd2+ has strong toxicity to plant growth. Plant metallothioneins, a class of low molecular, cystein(Cys)-rich and heavy-metal binding proteins, play an important role in both metal chaperoning and scavenging of reactive oxygen species (ROS) with their large number of cysteine residues and therefore, protect plants from oxidative damage. In this study, a metallothionein gene, TaMT3, isolated from Tamarix androssowii was transformed into tobacco (Nicotiana tobacum) through Agrobacterium-mediated leaf disc method, and correctly expressed under the control of 35S promoter. Under Cd2+ stress, the transgenic tobacco showed significant increases of superoxide dismutase (SOD) activity and chlorophyll concentration, but decreases of peroxidase (POD) activity and malondialdehyde (MDA) accumulation when compared to the non-transgenic tobacco. Vigorous growth of transgenic tobacco was observed at the early development stages, resulting in plant height and fresh weight were significantly larger than those of the non-transgenic tobacco under Cd2+ stress. These results demonstrated that the expression of the exogenous TaMT3 gene increased the ability of ROS cleaning-up, indicating a stronger tolerance to Cd2+ stress.

Functional and structural analysis of the DNA sequence conferring glucocorticoid inducibility to the mouse mammary tumor virus gene

International Nuclear Information System (INIS)

Skroch, P.

1987-05-01

In the first part of my thesis I show that the DNA element conferring glucocorticoid inducibility to the Mouse Mammary Tumor Virus (HRE) has enhancer properties. It activates a heterologous promoter - that of the β-globin gene, independently of distance, position and orientation. These properties however have to be regarded in relation to the remaining regulatory elements of the activated gene as the recombinants between HRE and the TK gene have demonstrated. In the second part of my thesis I investigated the biological significance of certain sequence motifs of the HRE, which are remarkable by their interaction with transacting factors or sequence homologies with other regulatory DNA elements. I could confirm the generally postulated modular structure of enhancers for the HRE and bring the relevance of the single subdomains for the function of the element into relationship. (orig.) [de

2nd International Conference on Measurement Instrumentation and Electronics

International Nuclear Information System (INIS)

2017-01-01

Preface It is our great pleasure to welcome you to 2017 2nd International Conference on Measurement Instrumentation and Electronics which has been held in Prague, Czech Republic during June 9-11, 2017. ICMIE 2017 is dedicated to issues related to measurement instrumentation and electronics. The major goal and feature of the conference is to bring academic scientists, engineers, industry researchers together to exchange and share their experiences and research results, and discuss the practical challenges encountered and the solutions adopted. Professors from Czech Republic, Germany and Italy are invited to deliver keynote speeches regarding latest information in their respective expertise areas. It is a golden opportunity for the students, researchers and engineers to interact with the experts and specialists to get their advice or consultation on technical matters, teaching methods and strategies. These proceedings present a selection from papers submitted to the conference from universities, research institutes and industries. All of the papers were subjected to peer-review by conference committee members and international reviewers. The papers selected depended on their quality and their relevancy to the conference. The volume tends to present to the readers the recent advances in the field of computer and communication system, system design and measurement and control technology, power electronics and electrical engineering, materials science and engineering, power machinery and equipment maintenance, architectural design and project management, environmental analysis and detection etc. We would like to thank all the authors who have contributed to this volume and also to the organizing committee, reviewers, speakers, chairpersons, and all the conference participants for their support to ICMIE 2017. ICMIE 2017 Organizing Committee June 20th, 2017 (paper)

The Novel Kasugamycin 2′-N-Acetyltransferase Gene aac(2′)-IIa, Carried by the IncP Island, Confers Kasugamycin Resistance to Rice-Pathogenic Bacteria

Science.gov (United States)

Moriyama, Hiromitsu; Fukuhara, Toshiyuki

2012-01-01

Kasugamycin (KSM), a unique aminoglycoside antibiotic, has been used in agriculture for many years to control not only rice blast caused by the fungus Magnaporthe grisea but also rice bacterial grain and seedling rot or rice bacterial brown stripe caused by Burkholderia glumae or Acidovorax avenae subsp. avenae, respectively. Since both bacterial pathogens are seed-borne and cause serious injury to rice seedlings, the emergence of KSM-resistant B. glumae and A. avenae isolates highlights the urgent need to understand the mechanism of resistance to KSM. Here, we identified a novel gene, aac(2′)-IIa, encoding a KSM 2′-N-acetyltransferase from both KSM-resistant pathogens but not from KSM-sensitive bacteria. AAC(2′)-IIa inactivates KSM, although it reveals no cross-resistance to other aminoglycosides. The aac(2′)-IIa gene from B. glumae strain 5091 was identified within the IncP genomic island inserted into the bacterial chromosome, indicating the acquisition of this gene by horizontal gene transfer. Although excision activity of the IncP island and conjugational gene transfer was not detected under the conditions tested, circular intermediates containing the aac(2′)-IIa gene were detected. These results indicate that the aac(2′)-IIa gene had been integrated into the IncP island of a donor bacterial species. Molecular detection of the aac(2′)-IIa gene could distinguish whether isolates are resistant or susceptible to KSM. This may contribute to the production of uninfected rice seeds and lead to the effective control of these pathogens by KSM. PMID:22660700

Protein-protein association and cellular localization of four essential gene products encoded by tellurite resistance-conferring cluster "ter" from pathogenic Escherichia coli.

Science.gov (United States)

Valkovicova, Lenka; Vavrova, Silvia Minarikova; Mravec, Jozef; Grones, Jozef; Turna, Jan

2013-12-01

Gene cluster "ter" conferring high tellurite resistance has been identified in various pathogenic bacteria including Escherichia coli O157:H7. However, the precise mechanism as well as the molecular function of the respective gene products is unclear. Here we describe protein-protein association and localization analyses of four essential Ter proteins encoded by minimal resistance-conferring fragment (terBCDE) by means of recombinant expression. By using a two-plasmid complementation system we show that the overproduced single Ter proteins are not able to mediate tellurite resistance, but all Ter members play an irreplaceable role within the cluster. We identified several types of homotypic and heterotypic protein-protein associations among the Ter proteins by in vitro and in vivo pull-down assays and determined their cellular localization by cytosol/membrane fractionation. Our results strongly suggest that Ter proteins function involves their mutual association, which probably happens at the interface of the inner plasma membrane and the cytosol.

The 2nd International Conference on Particle Physics and Astrophysics

International Nuclear Information System (INIS)

Galper, A M; Petrukhin, A A; Rubin, S G; Selyuzhenkov, I V; Skorokhvatov, M D; Soldatov, E; Voronov, S A

2017-01-01

The 2nd International Conference on Particle Physics and Astrophysics (ICPPA-2016) was held in Moscow, Russia, from October 10 to 14, 2016. The conference is organized by the National Research Nuclear University “MEPhI”. The aim of the Conference is to promote contacts between scientists and to develop new ideas in fundamental research. We bring together experts and young scientists working on experimental and theoretical aspects of nuclear, particle and astroparticle physics and cosmology. The conference covers a wide range of topics such as accelerator physics, (astro) particle physics, cosmic rays, cosmology and methods of experimental physics: detectors and instruments. These directions are unified by development of the Standard Model which is evidently not complete. There are deviations from the Standard Model: neutrino oscillations, the dark matter existence. Together with strong interactions they are main subjects of the Conference. New results from leading high energy physics collaborations are discussed. Main LHC experiments (ATLAS, CMS, ALICE) presented their results and detector upgrade prospects on the conference. Various aspects of Standard Model testing and search for new phenomena are main subjects of the conference. Among them: flavor physics at B factories, precision multi-boson production measurements, dark matter searches. Electroweak interaction was discussed in the talks given by participants of neutrino physics experiments (Borexino, Neutrino-4, SOX, T2K and others). Enigmatic properties of neutrinos such as their tiny masses, oscillations between different neutrino types, cannot be explained in frame of the modern theory and require new approaches. Properties of neutrinos influenced the formation of the large-scale structure of the Universe and may be neutrinos are partially responsible for the excess of matter over anti-matter. Also our current challenge is the nature of the Dark matter. Many opportunities arise with the development of

TaCIPK29, a CBL-interacting protein kinase gene from wheat, confers salt stress tolerance in transgenic tobacco.

Directory of Open Access Journals (Sweden)

Xiaomin Deng

Full Text Available Calcineurin B-like protein-interacting protein kinases (CIPKs have been found to be responsive to abiotic stress. However, their precise functions and the related molecular mechanisms in abiotic stress tolerance are not completely understood, especially in wheat. In the present study, TaCIPK29 was identified as a new member of CIPK gene family in wheat. TaCIPK29 transcript increased after NaCl, cold, methyl viologen (MV, abscisic acid (ABA and ethylene treatments. Over-expression of TaCIPK29 in tobacco resulted in increased salt tolerance, which was demonstrated by higher germination rates, longer root lengths and better growth status of transgenic tobacco plants compared to controls when both were treated with salt stress. Physiological measurements indicated that transgenic tobacco seedlings retained high K(+/Na(+ ratios and Ca(2+ content by up-regulating some transporter genes expression and also possessed lower H2O2 levels and reduced membrane injury by increasing the expression and activities of catalase (CAT and peroxidase (POD under salt stress. Moreover, transgenic lines conferred tolerance to oxidative stress by increasing the activity and expression of CAT. Finally, TaCIPK29 was located throughout cells and it preferentially interacted with TaCBL2, TaCBL3, NtCBL2, NtCBL3 and NtCAT1. Taken together, our results showed that TaCIPK29 functions as a positive factor under salt stress and is involved in regulating cations and reactive oxygen species (ROS homeostasis.

Relocation of a rust resistance gene R 2 and its marker-assisted gene pyramiding in confection sunflower (Helianthus annuus L.).

Science.gov (United States)

Qi, L L; Ma, G J; Long, Y M; Hulke, B S; Gong, L; Markell, S G

2015-03-01

The rust resistance gene R 2 was reassigned to linkage group 14 of the sunflower genome. DNA markers linked to R 2 were identified and used for marker-assisted gene pyramiding in a confection type genetic background. Due to the frequent evolution of new pathogen races, sunflower rust is a recurring threat to sunflower production worldwide. The inbred line Morden Cross 29 (MC29) carries the rust resistance gene, R 2 , conferring resistance to numerous races of rust fungus in the US, Canada, and Australia, and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments and SSR marker analyses on the 117 F2 individuals derived from a cross of HA 89 with MC29 (USDA), R 2 was mapped to linkage group (LG) 14 of the sunflower, and not to the previously reported location on LG9. The closest SSR marker HT567 was located at 4.3 cM distal to R 2 . Furthermore, 36 selected SNP markers from LG14 were used to saturate the R 2 region. Two SNP markers, NSA_002316 and SFW01272, flanked R 2 at a genetic distance of 2.8 and 1.8 cM, respectively. Of the three closely linked markers, SFW00211 amplified an allele specific for the presence of R 2 in a marker validation set of 46 breeding lines, and SFW01272 was also shown to be diagnostic for R 2 . These newly developed markers, together with the previously identified markers linked to the gene R 13a , were used to screen 524 F2 individuals from a cross of a confection R 2 line and HA-R6 carrying R 13a . Eleven homozygous double-resistant F2 plants with the gene combination of R 2 and R 13a were obtained. This double-resistant line will be extremely useful in confection sunflower, where few rust R genes are available, risking evolution of new virulence phenotypes and further disease epidemics.

Association of aldose reductase gene Z+2 polymorphism with reduced susceptibility to diabetic nephropathy in Caucasian Type 1 diabetic patients

DEFF Research Database (Denmark)

Lajer, Mathilde; Tarnow, L; Fleckner, Jan

2004-01-01

AIMS: The Z-2 allele of the (AC)n polymorphism in the aldose reductase gene (ALR2) confers increased risk of microvascular diabetic complications, whereas the Z+2 allele has been proposed to be a marker of protection. However data are conflicting. Therefore, we investigated whether this polymorph......AIMS: The Z-2 allele of the (AC)n polymorphism in the aldose reductase gene (ALR2) confers increased risk of microvascular diabetic complications, whereas the Z+2 allele has been proposed to be a marker of protection. However data are conflicting. Therefore, we investigated whether...... this polymorphism is associated with diabetic nephropathy and retinopathy in Type 1 diabetes mellitus in a large case-control study and a family-based analysis. METHODS: A total of 431 Type 1 diabetic patients with diabetic nephropathy and 468 patients with longstanding Type 1 diabetes and persistent...... of the ALR2 promoter polymorphism is associated with a reduced susceptibility to diabetic nephropathy in Danish Type 1 diabetic patients, suggesting a minor role for the polyol pathway in the pathogenesis of diabetic kidney disease. No association of the ALR2 polymorphism with diabetic retinopathy was found....

International Conference on Biotechnology for Salinity and Drought Tolerance in Plants

International Nuclear Information System (INIS)

Malik, K.A.; Mahmood, K.

2005-01-01

International Conference on Biotechnology for Salinity and Drought Tolerance in Plants was held from 28-29 March, 2005 at Islamabad, Pakistan. Abstracts of this conference have been presented in this proceeding. There were six technical sessions like 1) Stress Physiology/Ion Transport, 2) Stress Sensing and Signaling, 3) Genomis, Metabolomics and Proteomics, 4) Genetic Engineering, 5) Gene Expression, 6) Field Studies and Management. This seminar was quite useful specially drought resistance and salinity in the soil. Researches exchange their views in the seminar. (A.B.)

The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na(+) loading in xylem and confers salt tolerance in transgenic tobacco.

Science.gov (United States)

Yadav, Narendra Singh; Shukla, Pushp Sheel; Jha, Anupama; Agarwal, Pradeep K; Jha, Bhavanath

2012-10-11

Soil salinity adversely affects plant growth and development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1) gene encodes a plasma membrane Na(+)/H(+) antiporter that plays an important role in imparting salt stress tolerance to plants. Here, we report the cloning and characterisation of the SbSOS1 gene from Salicornia brachiata, an extreme halophyte. The SbSOS1 gene is 3774 bp long and encodes a protein of 1159 amino acids. SbSOS1 exhibited a greater level of constitutive expression in roots than in shoots and was further increased by salt stress. Overexpressing the S. brachiata SbSOS1 gene in tobacco conferred high salt tolerance, promoted seed germination and increased root length, shoot length, leaf area, fresh weight, dry weight, relative water content (RWC), chlorophyll, K(+)/Na(+) ratio, membrane stability index, soluble sugar, proline and amino acid content relative to wild type (WT) plants. Transgenic plants exhibited reductions in electrolyte leakage, reactive oxygen species (ROS) and MDA content in response to salt stress, which probably occurred because of reduced cytosolic Na(+) content and oxidative damage. At higher salt stress, transgenic tobacco plants exhibited reduced Na(+) content in root and leaf and higher concentrations in stem and xylem sap relative to WT, which suggests a role of SbSOS1 in Na(+) loading to xylem from root and leaf tissues. Transgenic lines also showed increased K(+) and Ca(2+) content in root tissue compared to WT, which reflect that SbSOS1 indirectly affects the other transporters activity. Overexpression of SbSOS1 in tobacco conferred a high degree of salt tolerance, enhanced plant growth and altered physiological and biochemical parameters in response to salt stress. In addition to Na(+) efflux outside the plasma membrane, SbSOS1 also helps to maintain variable Na(+) content in different organs and also affect the other transporters activity indirectly. These

Risk-Conferring Glutamatergic Genes and Brain Glutamate Plus Glutamine in Schizophrenia

Directory of Open Access Journals (Sweden)

Juan R. Bustillo

2017-06-01

Full Text Available BackgroundThe proton magnetic resonance spectroscopy (1H-MRS signals from glutamate (or the combined glutamate and glutamine signal—Glx have been found to be greater in various brain regions in people with schizophrenia. Recently, the Psychiatric Genetics Consortium reported that several common single-nucleotide polymorphisms (SNPs in glutamate-related genes confer increased risk of schizophrenia. Here, we examined the relationship between presence of these risk polymorphisms and brain Glx levels in schizophrenia.Methods1H-MRS imaging data from an axial, supraventricular tissue slab were acquired in 56 schizophrenia patients and 67 healthy subjects. Glx was measured in gray matter (GM and white matter (WM regions. The genetic data included six polymorphisms genotyped across an Illumina 5M SNP array. Only three of six glutamate as well as calcium-related SNPs were available for examination. These included three glutamate-related polymorphisms (rs10520163 in CLCN3, rs12704290 in GRM3, and rs12325245 in SLC38A7, and three calcium signaling polymorphisms (rs1339227 in RIMS1, rs7893279 in CACNB2, and rs2007044 in CACNA1C. Summary risk scores for the three glutamate and the three calcium polymorphisms were calculated.ResultsGlx levels in GM positively correlated with glutamate-related genetic risk score but only in younger (≤36 years schizophrenia patients (p = 0.01. Glx levels did not correlate with calcium risk scores. Glx was higher in the schizophrenia group compared to levels in controls in GM and WM regardless of age (p < 0.001.ConclusionElevations in brain Glx are in part, related to common allelic variants of glutamate-related genes known to increase the risk for schizophrenia. Since the glutamate risk scores did not differ between groups, some other genetic or environmental factors likely interact with the variability in glutamate-related risk SNPs to contribute to an increase in brain Glx early in the illness.

1988 DOE model conference proceedings: Volume 2

International Nuclear Information System (INIS)

1988-01-01

These Proceedings of the October 3 - 7, 1988, DOE Model Conference are a compilation of the papers that were presented in the technical or poster sessions at the conference. Papers and posters not submitted for publication are not included in the proceedings. The Table of Contents lists the titles of papers as well as the names of the presenters. These individuals are not, in all cases, the primary authors of the papers published. The actual title pages, appearing later with the papers, show the primary author(s) and all co-authors. The papers in all three volumes of the Proceedings appear as they were originally submitted for publication and have not been edited or changed in any way. Volume 2 contains information on environmental restoration at federal facilities, waste disposal technology, quality assurance, contingency planning and emergency response, decontamination and decommissioning, environmental restoration, and public involvement in waste management

IMP2, a nuclear gene controlling the mitochondrial dependence of galactose, maltose and raffinose utilization in Saccharomyces cerevisiae.

Science.gov (United States)

Donnini, C; Lodi, T; Ferrero, I; Puglisi, P P

1992-02-01

The IMP2 gene of Saccharomyces cerevisiae is involved in the nucleo-mitochondrial control of maltose, galactose and raffinose utilization as shown by the inability of imp2 mutants to grow on these carbon sources in respiratory-deficient conditions or in the presence of ethidium bromide and erythromycin. The negative phenotype cannot be scored in the presence of inhibitors of respiration and oxidative phosphorylation, indicating that the role of the mitochondria in the utilization of the above-mentioned carbon sources in imp2 mutants is not at the energetical level. Mutations in the IMP2 gene also confer many phenotypic alterations in respiratory-sufficient conditions, e.g. leaky phenotype on oxidizable carbon sources, sensitivity to heat shock and sporulation deficiency. The IMP2 gene has been cloned, sequenced and disrupted. The phenotype of null imp2 mutants is indistinguishable from that of the originally isolated mutant.

Joint conference of iMEC 2015 (2nd International Manufacturing Engineering Conference & APCOMS 2015 (3rd Asia-Pacific Conference on Manufacturing Systems)

Science.gov (United States)

2016-02-01

Properties Synthesized through Top Down Approach”, which was warmly welcomed by an eager and highly motivated audience. The second keynote speaker was Prof. Ir. Dradjad Irianto (ITB, Indonesia) on “Collaborative Manufacturing for Small-medium Enterprises”. The organizers are very grateful to them for supporting the conference and sharing their latest research results with the conference participants. The conference organizers would like to express our sincere gratitude and thanks to the honorary chairman Prof. Dato, Dr. Daing Nasir Ibrahim and Prof. Dr. Wan Azhar Wan Yusoff and organizing committee members of iMEC2015, Assoc. Prof. Dr. A.K. Prasada Rao (chairman), Dr. Ing. Mohd Azmir Mohd Azhari (co-chairman), and all committee members Assoc. Prof. Dr. Ahmad Razlan Yusoff, Assoc. Prof. Dr. Ismed Iskandar, Dr Noraini Mohd Razali, Dr Muhammed Nafis Osman Zahid, Dr Noor Mazni Ismail, Dr Izwan Ismail, Dr Zamzuri Hamedon, Dr Faiz Mohd Turan, Ms Suraya Sulaiman and secretariat Miss Zuryaty, Mrs Wan Norshihah, Mr. Mohd Khairulnazri and Mr Rafilah and also a million thanks to the steering committee from APCOMS Prof. Dr. Kadarsyah Suryadi, Prof. Dr. Bermawi, P. Iskandar, Prof. Dr. Abdul Hakim Halim, Prof. Dr. Dradjad Irianto, Dr. TMA Ari Samadhi, Ir. I Made Dana Tangkas and APCOMS organizing committee Prof. Dr. Abdul Hakim Halim (chair), Dr. Rachmawati Wangsaputra (co-chair) and other committee members Dr. Iwan Inrawan Wiratmadja, Dr. Anas Ma'ruf, Dr. Sukoyo and Dr. Wisnu Aribowo. The editorial board are indebted to all of the reviewers who were willing to spend their precious time in reviewing the papers. Thanks also to all who contributed direct or indirectly in making this conference a success, especially Mr. Mohd Khairulnazri in helping the editors complete the proceedings. Dr. Zamzuri Hamedon Editor in-chief iMEC & APCOMS 2015 Associate Editors 1. Assoc. Prof. Dr. A.K. Prasada Rao 2. Assoc. Prof. Dr. Ahmad Razlan Yusoff 3. Dr. Ing. Mohd Azmir Mohd Azhari 4. Dr. Muhammed

Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

Science.gov (United States)

Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

2012-12-18

Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

41 CFR 301-74.2 - What costs should be considered when planning a conference?

Science.gov (United States)

2010-07-01

...-CONFERENCE PLANNING Agency Responsibilities § 301-74.2 What costs should be considered when planning a... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false What costs should be considered when planning a conference? 301-74.2 Section 301-74.2 Public Contracts and Property Management...

2nd International Conference on Intelligent Computing and Applications

CERN Document Server

Dash, Subhransu; Das, Swagatam; Panigrahi, Bijaya

2017-01-01

Second International Conference on Intelligent Computing and Applications was the annual research conference aimed to bring together researchers around the world to exchange research results and address open issues in all aspects of Intelligent Computing and Applications. The main objective of the second edition of the conference for the scientists, scholars, engineers and students from the academia and the industry is to present ongoing research activities and hence to foster research relations between the Universities and the Industry. The theme of the conference unified the picture of contemporary intelligent computing techniques as an integral concept that highlights the trends in computational intelligence and bridges theoretical research concepts with applications. The conference covered vital issues ranging from intelligent computing, soft computing, and communication to machine learning, industrial automation, process technology and robotics. This conference also provided variety of opportunities for ...

bHLH106 Integrates Functions of Multiple Genes through Their G-Box to Confer Salt Tolerance on Arabidopsis.

Science.gov (United States)

Ahmad, Aftab; Niwa, Yasuo; Goto, Shingo; Ogawa, Takeshi; Shimizu, Masanori; Suzuki, Akane; Kobayashi, Kyoko; Kobayashi, Hirokazu

2015-01-01

An activation-tagging methodology was applied to dedifferentiated calli of Arabidopsis to identify new genes involved in salt tolerance. This identified salt tolerant callus 8 (stc8) as a gene encoding the basic helix-loop-helix transcription factor bHLH106. bHLH106-knockout (KO) lines were more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. Back-transformation of the KO line rescued its phenotype, and over-expression (OX) of bHLH106 in differentiated plants exhibited tolerance to NaCl. Green fluorescent protein (GFP) fused with bHLH106 revealed that it was localized to the nucleus. Prepared bHLH106 protein was subjected to electrophoresis mobility shift assays against E-box sequences (5'-CANNTG-3'). The G-box sequence 5'-CACGTG-3' had the strongest interaction with bHLH106. bHLH106-OX lines were transcriptomically analyzed, and resultant up- and down-regulated genes selected on the criterion of presence of a G-box sequence. There were 198 genes positively regulated by bHLH106 and 36 genes negatively regulated; these genes possessed one or more G-box sequences in their promoter regions. Many of these genes are known to be involved in abiotic stress response. It is concluded that bHLH106 locates at a branching point in the abiotic stress response network by interacting directly to the G-box in genes conferring salt tolerance on plants.

The GSK3B gene confers risk for both major depressive disorder and schizophrenia in the Han Chinese population.

Science.gov (United States)

Chen, Jianhua; Wang, Meng; Waheed Khan, Raja Amjad; He, Kuanjun; Wang, Qingzhong; Li, Zhiqiang; Shen, Jiawei; Song, Zhijian; Li, Wenjin; Wen, Zujia; Jiang, Yiwen; Xu, Yifeng; Shi, Yongyong; Ji, Weidong

2015-10-01

Glycogen synthease kinase-3B is a key gene encoding a protein kinase which is abundant in brain, and is involved in signal transduction cascades of neuronal cell development and energy metabolism. Previous researches proposed GSK3B as a potential region for schizophrenia. To validate the susceptibility of GSK3B to major depressive disorder, and to investigate the overlapping risk conferred by GSK3B for mental disorders, we performed a large-scale case-control study, analyzed 6 tag single nucleotide polymorphisms using TaqMan® technology in 1,045 major depressive disorder patients, 1,235 schizophrenia patients and 1,235 normal controls of Han Chinese origin. We found rs334535 (Pallele=2.79E-03, Pgenotype=5.00E-03, OR=1.429) and rs2199503 (Pallele=0.020, Pgenotype= 0.040, OR=1.157) showed association with major depressive disorder before Bonferroni correction. rs6771023 (adjusted Pallele=1.64E-03, adjusted Pgenotype=6.00E-03, OR=0.701) and rs2199503 (adjusted Pallele=0.001, adjusted Pgenotype=0.002, OR=1.251) showed significant association with schizophrenia after Bonferroni correction. rs2199503 (adjusted Pallele=1.70E-03, adjusted Pgenotype=0.006, OR=1.208) remained to be significant in the combined cases of major depressive disorder and schizophrenia after Bonferroni correction. Further validations of our findings in samples with larger scale are suggested, and functional genomic study is needed to elucidate the role of GSK3B in signal pathway and psychiatric disorders. Our results provide evidence that the GSK3B gene could be a promising region which contains genetic risk for both major depressive disorder and schizophrenia in the Han Chinese population. The study on variants conferring overlapping risk for multiple psychiatric disorders could be tangible pathogenesis support and clinical or diagnostic references. Copyright © 2015. Published by Elsevier B.V.

2nd National Conference on Sensors

CERN Document Server

Baldini, Francesco; Natale, Corrado; Betta, Giovanni; Siciliano, Pietro

2015-01-01

This book contains a selection of papers presented at the Second National Conference on Sensors held in Rome 19-21 February 2014. The conference highlighted state-of-the-art results from both theoretical and applied research in the field of sensors and related technologies. This book presents material in an interdisciplinary approach, covering many aspects of the disciplines related to sensors, including physics, chemistry, materials science, biology and applications. ·         Provides a selection of the best papers from the Second Italian National Conference on Sensors; ·         Covers a broad range of topics relating to sensors and microsystems, including physics, chemistry, materials science, biology and applications; ·         Offers interdisciplinary coverage, aimed at defining a common ground for sensors beyond the specific differences among the different particular implementation of sensors.

2012 Gordon Research Conference, Mitochondria and Chloroplasts, July 29 - Aug 3 2012

Energy Technology Data Exchange (ETDEWEB)

Barkan, Alice [Univ. of Oregon, Eugene, OR (United States)

2012-08-03

The 2012 Gordon Research Conference on Mitochondria and Chloroplasts will assemble an international group of scientists investigating fundamental properties of these organelles, and their integration into broader physiological processes. The conference will emphasize the many commonalities between mitochondria and chloroplasts: their evolution from bacterial endosymbionts, their genomes and gene expression systems, their energy transducing membranes whose proteins derive from both nuclear and organellar genes, the challenge of maintaining organelle integrity in the presence of the reactive oxygen species that are generated during energy transduction, their incorporation into organismal signaling pathways, and more. The conference will bring together investigators working in animal, plant, fungal and protozoan systems who specialize in cell biology, genetics, biochemistry, physiology, proteomics, genomics, and structural biology. As such, this conference will provide a unique forum that engenders cross-disciplinary discussions concerning the biogenesis, dynamics, and regulation of these key cellular structures. By fostering interactions among mammalian, fungal and plant organellar biologists, this conference also provides a conduit for the transmission of mechanistic insights obtained in model organisms to applications in medicine and agriculture. The 2012 conference will highlight areas that are moving rapidly and emerging themes. These include new insights into the ultrastructure and organization of the energy transducing membranes, the coupling of organellar gene expression with the assembly of photosynthetic and respiratory complexes, the regulatory networks that couple organelle biogenesis with developmental and physiological signals, the signaling events through which organellar physiology influences nuclear gene expression, and the roles of organelles in disease and development.

Selected papers from the 2nd IEEEE Nordic Circuits and Systems Conference (NorCAS), 2016

DEFF Research Database (Denmark)

Sparsø, Jens

2018-01-01

This special issue includes selected papers from the 2nd IEEEE Nordic Circuits and Systems Conference (NorCAS), held in Linköping, Sweden, October 24-25, 2016. The IEEE NorCAS conference is the main circuits and systems event of the Nordic and Baltic countries representing both academia and the e......This special issue includes selected papers from the 2nd IEEEE Nordic Circuits and Systems Conference (NorCAS), held in Linköping, Sweden, October 24-25, 2016. The IEEE NorCAS conference is the main circuits and systems event of the Nordic and Baltic countries representing both academia...

Identification of regulated genes conferring resistance to high concentrations of glyphosate in a new strain of Enterobacter.

Science.gov (United States)

Fei, Yun-Yan; Gai, Jun-Yi; Zhao, Tuan-Jie

2013-12-01

Glyphosate is a widely used herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity. Most plants and microbes are sensitive to glyphosate. However, transgenic-resistant crops that contain a modified epsps obtained from the resistant microbes have been commercially successful and therefore, new resistance genes and their adaptive regulatory mechanisms are of great interest. In this study, a soil-borne, glyphosate-resistant bacterium was selected and identified as Enterobacter. The EPSPS in this strain was found to have been altered to a resistant one. A total of 42 differentially expressed genes (DEGs) in the glyphosate were screened using microarray techniques. Under treatment, argF, sdhA, ivbL, rrfA-H were downregulated, whereas the transcripts of speA, osmY, pflB, ahpC, fusA, deoA, uxaC, rpoD and a few ribosomal protein genes were upregulated. Data were verified by quantitative real-time PCR on selected genes. All transcriptional changes appeared to protect the bacteria from glyphosate and associated osmotic, acidic and oxidative stresses. Many DEGs may have the potential to confer resistance to glyphosate alone, and some may be closely related to the shikimate pathway, reflecting the complex gene interaction network for glyphosate resistance. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

An AP-2 element acts synergistically with the cyclic AMP- and Phorbol ester-inducible enhancer of the human proenkephalin gene

Energy Technology Data Exchange (ETDEWEB)

Hyman, S.E.; Comb, M.; Pearlberg, J.; Goodman, H.M.

1989-01-01

An enhancer with two DNA elements, one containing the sequence CGTCA, is required for cyclic AMP-and phorbol ester-inducible transcription of the human proenkephalin gene. The authors report that an AP-2 element located adjacent to the enhancer acts synergistically with it to confer maximal response to cyclic AMP and phorbol esters.

Joint conference of iMEC 2015 (2nd International Manufacturing Engineering Conference and APCOMS 2015 (3rd Asia-Pacific Conference on Manufacturing Systems)

International Nuclear Information System (INIS)

2016-01-01

;Nanomaterials with Exceptional Properties Synthesized through Top Down Approach”, which was warmly welcomed by an eager and highly motivated audience. The second keynote speaker was Prof. Ir. Dradjad Irianto (ITB, Indonesia) on “Collaborative Manufacturing for Small-medium Enterprises”. The organizers are very grateful to them for supporting the conference and sharing their latest research results with the conference participants. The conference organizers would like to express our sincere gratitude and thanks to the honorary chairman Prof. Dato, Dr. Daing Nasir Ibrahim and Prof. Dr. Wan Azhar Wan Yusoff and organizing committee members of iMEC2015, Assoc. Prof. Dr. A.K. Prasada Rao (chairman), Dr. Ing. Mohd Azmir Mohd Azhari (co-chairman), and all committee members Assoc. Prof. Dr. Ahmad Razlan Yusoff, Assoc. Prof. Dr. Ismed Iskandar, Dr Noraini Mohd Razali, Dr Muhammed Nafis Osman Zahid, Dr Noor Mazni Ismail, Dr Izwan Ismail, Dr Zamzuri Hamedon, Dr Faiz Mohd Turan, Ms Suraya Sulaiman and secretariat Miss Zuryaty, Mrs Wan Norshihah, Mr. Mohd Khairulnazri and Mr Rafilah and also a million thanks to the steering committee from APCOMS Prof. Dr. Kadarsyah Suryadi, Prof. Dr. Bermawi, P. Iskandar, Prof. Dr. Abdul Hakim Halim, Prof. Dr. Dradjad Irianto, Dr. TMA Ari Samadhi, Ir. I Made Dana Tangkas and APCOMS organizing committee Prof. Dr. Abdul Hakim Halim (chair), Dr. Rachmawati Wangsaputra (co-chair) and other committee members Dr. Iwan Inrawan Wiratmadja, Dr. Anas Ma'ruf, Dr. Sukoyo and Dr. Wisnu Aribowo. The editorial board are indebted to all of the reviewers who were willing to spend their precious time in reviewing the papers. Thanks also to all who contributed direct or indirectly in making this conference a success, especially Mr. Mohd Khairulnazri in helping the editors complete the proceedings. Dr. Zamzuri Hamedon Editor in-chief iMEC and APCOMS 2015 Associate Editors 1. Assoc. Prof. Dr. A.K. Prasada Rao 2. Assoc. Prof. Dr. Ahmad Razlan Yusoff 3. Dr. Ing. Mohd Azmir

First intron of nestin gene regulates its expression during C2C12 myoblast ifferentiation

Institute of Scientific and Technical Information of China (English)

Hua Zhong; Zhigang Jin; Yongfeng Chen; Ting Zhang; Wei Bian; Xing Cui; Naihe Jing

2008-01-01

Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China Nestin is an intermediate filament protein expressed in neural progenitor cells and in developing skeletal muscle. Nestin has been widely used as a neural progenitor cell marker. It is well established that the specific expression of the nestin gene in neural progenitor cells is conferred by the neural-specific enhancer located in the second intron of the nestin gene. However, the transcriptional mechanism of nestin expression in developing muscle is still unclear. In this study, we identified a muscle cell-specific enhancer in the first intron of mouse nestin gene in mouse myoblast C2C12 cells.We localized the core enhancer activity to the 291-661 region of the first intron, and showed that the two E-boxes in the core enhancer region were important for enhancer activity in differentiating C2C12 cells. We also showed that MyoD protein was involved in the regulation of nestin expression in the myogenic differentiation of C2C12 cells.

2nd International Conference on Rheology and Modeling of Materials (IC-RMM2)

International Nuclear Information System (INIS)

2017-01-01

Understanding the rheological properties of materials and their rheological behaviors during their manufacturing processes and in their applications in many cases can help to increase the efficiency and competitiveness not only of the finished goods and products but the organizations and societies also. The more scientific supported and prepared organizations develop more competitive products with better thermal, mechanical, physical, chemical and biological properties and the leading companies apply more competitive equipment and technology processes. The aims of the 2 nd International Conference on Rheology and Modeling of Materials (ic-rmm2) and the parallel organized symposiums of the 1 st International Symposium on Powder Injection Molding (is-pim1) and the 1 st International Symposium on Rheology and Fracture of Solids (is-rfs1) are the followings: Promote new methods and results of scientific research in the fields of modeling and measurements of rheological properties and behavior of materials under processing and applications; Change information between the theoretical and applied sciences as well as technical and technological implantations. Promote the communication and collaboration between the scientists, researchers and engineers of different disciplines, different nations, countries and continents. The international conference ic-rmm2 and symposiums of is-pim1 and is-rfs1 provide a platform among the leading international scientists, researchers, PhD students and engineers for discussing recent achievements in measurement, modeling and application of rheology in materials technology and materials science of liquids, melts, solids, crystals and amorphous structures. Among thr major fields of interest are the influence of materials structures, mechanical stresses, temperatures, deformation speeds and shear rates on rheological and physical properties, phase transformation of foams, foods, polymers, plastics and other competitive materials like ceramics

2nd International Conference on Rheology and Modeling of Materials (IC-RMM2)

Science.gov (United States)

2017-01-01

Understanding the rheological properties of materials and their rheological behaviors during their manufacturing processes and in their applications in many cases can help to increase the efficiency and competitiveness not only of the finished goods and products but the organizations and societies also. The more scientific supported and prepared organizations develop more competitive products with better thermal, mechanical, physical, chemical and biological properties and the leading companies apply more competitive equipment and technology processes. The aims of the 2nd International Conference on Rheology and Modeling of Materials (ic-rmm2) and the parallel organized symposiums of the 1st International Symposium on Powder Injection Molding (is-pim1) and the 1st International Symposium on Rheology and Fracture of Solids (is-rfs1) are the followings: Promote new methods and results of scientific research in the fields of modeling and measurements of rheological properties and behavior of materials under processing and applications; Change information between the theoretical and applied sciences as well as technical and technological implantations. Promote the communication and collaboration between the scientists, researchers and engineers of different disciplines, different nations, countries and continents. The international conference ic-rmm2 and symposiums of is-pim1 and is-rfs1 provide a platform among the leading international scientists, researchers, PhD students and engineers for discussing recent achievements in measurement, modeling and application of rheology in materials technology and materials science of liquids, melts, solids, crystals and amorphous structures. Among thr major fields of interest are the influence of materials structures, mechanical stresses, temperatures, deformation speeds and shear rates on rheological and physical properties, phase transformation of foams, foods, polymers, plastics and other competitive materials like ceramics

Proceedings of the 1. Arabic conference on chemical applications (Chemia 2). Vol. 2

International Nuclear Information System (INIS)

1997-11-01

The conference of chemical application was held on 1-5 Nov 1997 in Cairo, This vol.2 contains of chemical application on nuclear materials. Studies on these vol.This second volume covers papers presented on the subjects

A rare sugar, d-allose, confers resistance to rice bacterial blight with upregulation of defense-related genes in Oryza sativa.

Science.gov (United States)

Kano, Akihito; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Satoh, Masaru; Fukumoto, Takeshi; Ohtani, Kouhei; Tajima, Shigeyuki; Izumori, Ken; Tanaka, Keiji; Ishida, Yutaka; Tada, Yasuomi; Nishizawa, Yoko; Akimitsu, Kazuya

2010-01-01

We investigated responses of rice plant to three rare sugars, d-altrose, d-sorbose, and d-allose, due to establishment of mass production methods for these rare sugars. Root growth and shoot growth were significantly inhibited by d-allose but not by the other rare sugars. A large-scale gene expression analysis using a rice microarray revealed that d-allose treatment causes a high upregulation of many defense-related, pathogenesis-related (PR) protein genes in rice. The PR protein genes were not upregulated by other rare sugars. Furthermore, d-allose treatment of rice plants conferred limited resistance of the rice against the pathogen Xanthomonas oryzae pv. oryzae but the other tested sugars did not. These results indicate that d-allose has a growth inhibitory effect but might prove to be a candidate elicitor for reducing disease development in rice.

2nd Conference of the International Society for Nonparametric Statistics

CERN Document Server

Manteiga, Wenceslao; Romo, Juan

2016-01-01

This volume collects selected, peer-reviewed contributions from the 2nd Conference of the International Society for Nonparametric Statistics (ISNPS), held in Cádiz (Spain) between June 11–16 2014, and sponsored by the American Statistical Association, the Institute of Mathematical Statistics, the Bernoulli Society for Mathematical Statistics and Probability, the Journal of Nonparametric Statistics and Universidad Carlos III de Madrid. The 15 articles are a representative sample of the 336 contributed papers presented at the conference. They cover topics such as high-dimensional data modelling, inference for stochastic processes and for dependent data, nonparametric and goodness-of-fit testing, nonparametric curve estimation, object-oriented data analysis, and semiparametric inference. The aim of the ISNPS 2014 conference was to bring together recent advances and trends in several areas of nonparametric statistics in order to facilitate the exchange of research ideas, promote collaboration among researchers...

2nd International Conference on Dynamics of Disasters

CERN Document Server

Nagurney, Anna; Pardalos, Panos

2016-01-01

This volume results from the “Second International Conference on Dynamics of Disasters” held in Kalamata, Greece, June 29-July 2, 2015. The conference covered particular topics involved in natural and man-made disasters such as war, chemical spills, and wildfires. Papers in this volume examine the finer points of disasters through: · Critical infrastructure protection · Resiliency · Humanitarian logistic · Relief supply chains · Cooperative game theory · Dynamical systems · Decision making under risk and uncertainty · Spread of diseases · Contagion · Funding for disaster relief · Tools for emergency preparedness · Response, and risk mitigation Multi-disciplinary theories, tools, techniques and methodologies are linked with disasters from mitigation and preparedness to response and recovery. The interdisciplinary approach to problems in economics, optimization, government, management, business, humanities, engineering, medicine, mathematics, computer science, behavioral studies, emergency servi...

Genetic association between the phospholipase A2 gene and unipolar affective disorder: a multicentre case-control study.

Science.gov (United States)

Papadimitriou, George N; Dikeos, Dimitris G; Souery, Daniel; Del-Favero, Jurgen; Massat, Isabelle; Avramopoulos, Dimitrios; Blairy, Sylvie; Cichon, Sven; Ivezic, Sladjana; Kaneva, Radka; Karadima, Georgia; Lilli, Roberta; Milanova, Vihra; Nöthen, Markus; Oruc, Lilijana; Rietschel, Marcella; Serretti, Alessandro; Van Broeckhoven, Christine; Stefanis, Costas N; Mendlewicz, Julien

2003-12-01

The co-segregation in one pedigree of bipolar affective disorder with Darier's disease whose gene is on chromosome 12q23-q24.1, and findings from linkage and association studies with the neighbouring gene of phospholipase A2 (PLA2) indicate that PLA2 may be considered as a candidate gene for affective disorders. All relevant genetic association studies, however, were conducted on bipolar patients. In the present study, the possible association between the PLA2 gene and unipolar affective disorder was examined on 321 unipolar patients and 604 controls (all personally interviewed), recruited from six countries (Belgium, Bulgaria, Croatia, Germany, Greece, and Italy) participating in the European Collaborative Project on Affective Disorders. After controlling for population group and gender, one of the eight alleles of the investigated marker (allele 7) was found to be more frequent among unipolar patients with more than three major depressive episodes than among controls (P<0.01); genotypic association was also observed, under the dominant model of genetic transmission (P<0.02). In addition, presence of allele 7 was correlated with a higher frequency of depressive episodes (P<0.02). These findings suggest that structural variations at the PLA2 gene or the chromosomal region around it may confer susceptibility for unipolar affective disorder.

2nd world TRIGA users conference. Conference volume

International Nuclear Information System (INIS)

2004-01-01

This conference was organized by the Atomic Institute of the Austrian Universities (University of Technology Vienna), it was devoted to present results in the operation of TRIGA research reactors. The main general topics were: a) reactor operation experience, b)neutron and solid state physics, c) radiochemistry and activation analysis, d) medical applications (boron neutron capture therapy, labeled compounds), e) reactor related experiments and calculations, f) waste management and decommissioning of TRIGA reactors. (nevyjel)

2nd world TRIGA users conference. Conference volume

Energy Technology Data Exchange (ETDEWEB)

NONE

2004-07-01

This conference was organized by the Atomic Institute of the Austrian Universities (University of Technology Vienna), it was devoted to present results in the operation of TRIGA research reactors. The main general topics were: a) reactor operation experience, b)neutron and solid state physics, c) radiochemistry and activation analysis, d) medical applications (boron neutron capture therapy, labeled compounds), e) reactor related experiments and calculations, f) waste management and decommissioning of TRIGA reactors. (nevyjel)

The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na+ loading in xylem and confers salt tolerance in transgenic tobacco

Directory of Open Access Journals (Sweden)

Yadav Narendra

2012-10-01

Full Text Available Abstract Background Soil salinity adversely affects plant growth and development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1 gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in imparting salt stress tolerance to plants. Here, we report the cloning and characterisation of the SbSOS1 gene from Salicornia brachiata, an extreme halophyte. Results The SbSOS1 gene is 3774 bp long and encodes a protein of 1159 amino acids. SbSOS1 exhibited a greater level of constitutive expression in roots than in shoots and was further increased by salt stress. Overexpressing the S. brachiata SbSOS1 gene in tobacco conferred high salt tolerance, promoted seed germination and increased root length, shoot length, leaf area, fresh weight, dry weight, relative water content (RWC, chlorophyll, K+/Na+ ratio, membrane stability index, soluble sugar, proline and amino acid content relative to wild type (WT plants. Transgenic plants exhibited reductions in electrolyte leakage, reactive oxygen species (ROS and MDA content in response to salt stress, which probably occurred because of reduced cytosolic Na+ content and oxidative damage. At higher salt stress, transgenic tobacco plants exhibited reduced Na+ content in root and leaf and higher concentrations in stem and xylem sap relative to WT, which suggests a role of SbSOS1 in Na+ loading to xylem from root and leaf tissues. Transgenic lines also showed increased K+ and Ca2+ content in root tissue compared to WT, which reflect that SbSOS1 indirectly affects the other transporters activity. Conclusions Overexpression of SbSOS1 in tobacco conferred a high degree of salt tolerance, enhanced plant growth and altered physiological and biochemical parameters in response to salt stress. In addition to Na+ efflux outside the plasma membrane, SbSOS1 also helps to maintain variable Na+ content in different organs and also affect the other

The SbSOS1 gene from the extreme halophyte Salicornia brachiata enhances Na+ loading in xylem and confers salt tolerance in transgenic tobacco

Science.gov (United States)

2012-01-01

Background Soil salinity adversely affects plant growth and development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1) gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in imparting salt stress tolerance to plants. Here, we report the cloning and characterisation of the SbSOS1 gene from Salicornia brachiata, an extreme halophyte. Results The SbSOS1 gene is 3774 bp long and encodes a protein of 1159 amino acids. SbSOS1 exhibited a greater level of constitutive expression in roots than in shoots and was further increased by salt stress. Overexpressing the S. brachiata SbSOS1 gene in tobacco conferred high salt tolerance, promoted seed germination and increased root length, shoot length, leaf area, fresh weight, dry weight, relative water content (RWC), chlorophyll, K+/Na+ ratio, membrane stability index, soluble sugar, proline and amino acid content relative to wild type (WT) plants. Transgenic plants exhibited reductions in electrolyte leakage, reactive oxygen species (ROS) and MDA content in response to salt stress, which probably occurred because of reduced cytosolic Na+ content and oxidative damage. At higher salt stress, transgenic tobacco plants exhibited reduced Na+ content in root and leaf and higher concentrations in stem and xylem sap relative to WT, which suggests a role of SbSOS1 in Na+ loading to xylem from root and leaf tissues. Transgenic lines also showed increased K+ and Ca2+ content in root tissue compared to WT, which reflect that SbSOS1 indirectly affects the other transporters activity. Conclusions Overexpression of SbSOS1 in tobacco conferred a high degree of salt tolerance, enhanced plant growth and altered physiological and biochemical parameters in response to salt stress. In addition to Na+ efflux outside the plasma membrane, SbSOS1 also helps to maintain variable Na+ content in different organs and also affect the other transporters activity indirectly

Abstracts of 2. International conference on lasers and their applications

International Nuclear Information System (INIS)

1993-01-01

The following topics are presented at 2. international conference on lasers and their applications in Iran: laser principle and technology, laser applications in spectroscopy; nonlinear optics; industry; medicine; and laser related techniques

2nd International Conference on Advanced Intelligent Systems and Informatics

CERN Document Server

Shaalan, Khaled; Gaber, Tarek; Azar, Ahmad; Tolba, M

2017-01-01

This book gathers the proceedings of the 2nd International Conference on Advanced Intelligent Systems and Informatics (AISI2016), which took place in Cairo, Egypt during October 24–26, 2016. This international interdisciplinary conference, which highlighted essential research and developments in the field of informatics and intelligent systems, was organized by the Scientific Research Group in Egypt (SRGE) and sponsored by the IEEE Computational Intelligence Society (Egypt chapter) and the IEEE Robotics and Automation Society (Egypt Chapter). The book’s content is divided into four main sections: Intelligent Language Processing, Intelligent Systems, Intelligent Robotics Systems, and Informatics.

Genes2FANs: connecting genes through functional association networks

Science.gov (United States)

2012-01-01

Background Protein-protein, cell signaling, metabolic, and transcriptional interaction networks are useful for identifying connections between lists of experimentally identified genes/proteins. However, besides physical or co-expression interactions there are many ways in which pairs of genes, or their protein products, can be associated. By systematically incorporating knowledge on shared properties of genes from diverse sources to build functional association networks (FANs), researchers may be able to identify additional functional interactions between groups of genes that are not readily apparent. Results Genes2FANs is a web based tool and a database that utilizes 14 carefully constructed FANs and a large-scale protein-protein interaction (PPI) network to build subnetworks that connect lists of human and mouse genes. The FANs are created from mammalian gene set libraries where mouse genes are converted to their human orthologs. The tool takes as input a list of human or mouse Entrez gene symbols to produce a subnetwork and a ranked list of intermediate genes that are used to connect the query input list. In addition, users can enter any PubMed search term and then the system automatically converts the returned results to gene lists using GeneRIF. This gene list is then used as input to generate a subnetwork from the user’s PubMed query. As a case study, we applied Genes2FANs to connect disease genes from 90 well-studied disorders. We find an inverse correlation between the counts of links connecting disease genes through PPI and links connecting diseases genes through FANs, separating diseases into two categories. Conclusions Genes2FANs is a useful tool for interpreting the relationships between gene/protein lists in the context of their various functions and networks. Combining functional association interactions with physical PPIs can be useful for revealing new biology and help form hypotheses for further experimentation. Our finding that disease genes in

Introduction-2nd Fire Behavior and Fuels Conference: The fire environment-innovations, management, and policy

Science.gov (United States)

Wayne Cook; Bret W. Butler

2007-01-01

The 2nd Fire Behavior and Fuels Conference: Fire Environment -- Innovations, Management and Policy was held in Destin, FL, March 26-30, 2007. Following on the success of the 1st Fire Behavior and Fuels Conference, this conference was initiated in response to the needs of the National Wildfire Coordinating Group -- Fire Environment Working Team.

Dissection of two soybean QTL conferring partial resistance to Phytophthora sojae through sequence and gene expression analysis

Directory of Open Access Journals (Sweden)

Wang Hehe

2012-08-01

Full Text Available Abstract Background Phytophthora sojae is the primary pathogen of soybeans that are grown on poorly drained soils. Race-specific resistance to P. sojae in soybean is gene-for-gene, although in many areas of the US and worldwide there are populations that have adapted to the most commonly deployed resistance to P. sojae ( Rps genes. Hence, this system has received increased attention towards identifying mechanisms and molecular markers associated with partial resistance to this pathogen. Several quantitative trait loci (QTL have been identified in the soybean cultivar ‘Conrad’ that contributes to the expression of partial resistance to multiple P. sojae isolates. Results In this study, two of the Conrad QTL on chromosome 19 were dissected through sequence and expression analysis of genes in both resistant (Conrad and susceptible (‘Sloan’ genotypes. There were 1025 single nucleotide polymorphisms (SNPs in 87 of 153 genes sequenced from Conrad and Sloan. There were 304 SNPs in 54 genes sequenced from Conrad compared to those from both Sloan and Williams 82, of which 11 genes had SNPs unique to Conrad. Eleven of 19 genes in these regions analyzed with qRT-PCR had significant differences in fold change of transcript abundance in response to infection with P. sojae in lines with QTL haplotype from the resistant parent compared to those with the susceptible parent haplotype. From these, 8 of the 11 genes had SNPs in the upstream, untranslated region, exon, intron, and/or downstream region. These 11 candidate genes encode proteins potentially involved in signal transduction, hormone-mediated pathways, plant cell structural modification, ubiquitination, and basal resistance. Conclusions These findings may indicate a complex defense network with multiple mechanisms underlying these two soybean QTL conferring resistance to P. sojae. SNP markers derived from these candidate genes can contribute to fine mapping of QTL and marker assisted breeding for

Food irradiation - 2nd all-German conference. Proceedings

International Nuclear Information System (INIS)

Walz, E.; Ehlermann, D.A.E.

1993-01-01

The 2nd conference on 'Food Irradiation' in re-united Germany took place in Eggenstein-Leopoldshafen at the Karlsruhe Nuclear Research Centre, 9th to 10th December 1992. Participants came from government investigating agencies and research institutions of the German Federal Government and the Federal States. Abstracts focus on issues of food laws and certification of irradiation treatment. (UHE) [de

2nd International Conference on Photonics, Optics and Laser Technology

CERN Document Server

Raposo, Maria

2016-01-01

This collection of the selected papers presented to the Second International Conference on Photonics, Optics and laser technology PHOTOPTICS 2014 covers the three main conference scientific areas of “Optics”, “Photonics” and “Lasers”. The selected papers, in two classes full and short, result from a double blind review carried out by conference Program Committee members who are highly qualified experts in the conference topic areas.

Affinity Maturation of an Anti-V Antigen IgG Expressed In Situ Via Adenovirus Gene Delivery Confers Enhanced Protection Against Yersinia pestis Challenge

Science.gov (United States)

Van Blarcom, Thomas J.; Sofer-Podesta, Carolina; Ang, John; Boyer, Julie L.; Crystal, Ronald G.; Georgiou, George

2013-01-01

Genetic transfer of neutralizing antibodies has been shown to confer strong and persistent protection against bacterial and viral infectious agents. While it is well established that for many exogenous neutralizing antibodies increased antigen affinity correlates with protection, the effect of antigen affinity on antibodies produced in situ following adenoviral gene transfer has not been examined. The mouse IgG2b monoclonal antibody 2C12.4 recognizes the Yersinia pestis Type III secretion apparatus protein LcrV (V antigen) and confers protection in mice when administered as an IgG intraperitoneally or, following genetic immunization with engineered, replication-defective serotype 5 human adenovirus (Ad) 1. 2C12.4 was expressed as a scFv fragment in E. coli and was shown to display a KD=3.5 nM by surface plasmon resonance (SPR) analysis. The 2C12.4 scFv was subjected to random mutagenesis and variants with increased affinity were isolated by flow cytometry using the Anchored Periplasmic Expression (APEx) bacterial display system. After a single round of mutagenesis, variants displaying up to 35-fold lower KD values (H8, KD=100 pM) were isolated. The variable domains of the H8 scFv were used to replace those of the parental 2C12.4 IgG encoded in the Ad vector, AdαV giving rise to AdαV.H8. The two adenoviral vectors resulted in similar titers of anti-V antigen antibodies 3 days post-immunization with 109, 1010 or 1011 particle units. Following intranasal challenge with 363 LD50Y. pestis CO92, 54% of the mice immunized with 1010 pu of AdαV.H8 survived at the 14 day end point compared to only 15% survivors for the group immunized with AdαV expressing the lower affinity 2C12.4 (Pgenetic transfer may confer increased protection not only for Y. pestis challenge but possibly for other pathogens. PMID:20393511

Biothechnology conferences held in Cuba. Cuba no biotechnology gakkai ni sankashite

Energy Technology Data Exchange (ETDEWEB)

Murata, M. (Ajinomoto Co. Inc., Tokyo, (Japan))

1990-04-25

Three biotechnology conferences including Cuba International Interferon Conference were held at Havana in April 1989, and the author participated in them. The number of participants was about 3,000. Most of them were from the Middle and the Central America, but there were also those from Europe, the USSR and the USA. The three conferences were composed of 16 symposiums and they covered a wide range of field such as medical science, agriculture and industry. High leveled reports were read in the conferences: on the application of interferons to medical treatments, curing effects of infections caused by herpes virus and B type hepatitis virus, anti-tumor effects, and anti-virus effects against AIDS virus; on the production of protein and vaccini by gene engineering, large quantity production of interleukin and epithelium cell multiplication genes. Especially impressing were the efforts the whole nation of Cuba makes to promote biotechnology and its modern facilities. 3 figs.

Search of type 2 diabetes susceptibility gene on chromosome 20q

International Nuclear Information System (INIS)

Takeuchi, F.; Yanai, K.; Inomata, H.; Kuzuya, N.; Kajio, H.; Honjo, S.; Takeda, N.; Kaburagi, Y.; Yasuda, K.; Shirasawa, S.; Sasazuki, T.; Kato, N.

2007-01-01

Significant evidence of linkage to type 2 diabetes (T2D) has been shown in a relatively broad region on chromosome 20q, where the hepatocyte nuclear factor-4α (HNF4A) has been noted as a positional candidate. To systematically evaluate genetic susceptibility to T2D in the relevant region, we examined the disease association by using 1145 SNPs in two-step screening in the Japanese population. The marker screening enabled us to identify significant disease association in the lipopolysaccharide binding protein (LBP) but not in the HNF4A locus. In a 17.7-Mb interval screened, the strongest association was identified for a SNP, rs2232592, located in the intron of LBP, with an estimated odds ratio of 1.73 (95% CI 1.30-2.31) (P 0.0002) in the whole study panel involving 675 case and 474 control subjects. Our data suggest that the LBP gene may confer genetic susceptibility to T2D and this warrants further replication study

Allelic association of the D2 dopamine receptor gene with receptor-binding characteristics in alcoholism

International Nuclear Information System (INIS)

Noble, E.P.; Blum, K.; Ritchie, T.; Montgomery, A.; Sheridan, P.J.

1991-01-01

The allelic association of the human D2 dopamine receptor gene with the binding characteristics of the D2 dopamine receptor was determined in 66 brains of alcoholic and non-alcoholic subjects. In a blinded experiment, DNA from the cerebral cortex was treated with the restriction endonuclease Taql and probed with a 1.5-kilobase (kb) digest of a clone (lambda hD2G1) of the human D2 dopamine receptor gene. The binding characteristics (Kd [binding affinity] and Bmax [number of binding sites]) of the D2 dopamine receptor were determined in the caudate nuclei of these brains using tritiated spiperone as the ligand. The adjusted Kd was significantly lower in alcoholic than in nonalcoholic subjects. In subjects with the A1 allele, in whom a high association with alcoholism was found, the Bmax was significantly reduced compared with the Bmax of subjects with the A2 allele. Moreover, a progressively reduced Bmax was found in subjects with A2/A2, A1/A2, and A1/A1 alleles, with subjects with A2/A2 having the highest mean values, and subjects with A1/A1, the lowest. The polymorphic pattern of the D2 dopamine receptor gene and its differential expression of receptors suggests the involvement of the dopaminergic system in conferring susceptibility to at least one subtype of severe alcoholism

Eighth DOD/NASA/FAA Conference on Fibrous Composites in Structural Design, part 2

Energy Technology Data Exchange (ETDEWEB)

Starnes, J.H. Jr.; Bohon, H.L.; Garzon, S.B.

1990-09-01

Papers presented at the conference are compiled. The conference provided a forum for the scientific community to exchange composite structures design information and an opportunity to observe recent progress in composite structures design and technology. Part 2 contains papers related to the following subject areas: the application in design; methodology in design; and reliability in design.

Eighth DOD/NASA/FAA Conference on Fibrous Composites in Structural Design, Part 2

Science.gov (United States)

Starnes, James H., Jr. (Compiler); Bohon, Herman L. (Compiler); Garzon, Sherry B. (Compiler)

1990-01-01

Papers presented at the conference are compiled. The conference provided a forum for the scientific community to exchange composite structures design information and an opportunity to observe recent progress in composite structures design and technology. Part 2 contains papers related to the following subject areas: the application in design; methodology in design; and reliability in design.

Conference proceedings of the 4. international conference on CANDU fuel. V. 1,2

International Nuclear Information System (INIS)

1995-01-01

These proceedings contain the full texts of all 65 papers presented at the 4th International Conference on CANDU fuel. As such, they represent an update on the state-of-the-art in such important CANDU fuel topics as International Development Programs and Operating Experience with CANDU fuel, Performance Assessments and Fuel Behavior Modeling, Fuel Properties, Licensing and Accident Analyses for CANDU fuel, Design, Testing and Manufacturing, and Advanced Fuel Designs. The large number of papers required the use of parallel sessions for the first time at a CANDU Fuel Conference

Conference proceedings of the 4. international conference on CANDU fuel. V. 1,2

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-12-31

These proceedings contain the full texts of all 65 papers presented at the 4th International Conference on CANDU fuel. As such, they represent an update on the state-of-the-art in such important CANDU fuel topics as International Development Programs and Operating Experience with CANDU fuel, Performance Assessments and Fuel Behavior Modeling, Fuel Properties, Licensing and Accident Analyses for CANDU fuel, Design, Testing and Manufacturing, and Advanced Fuel Designs. The large number of papers required the use of parallel sessions for the first time at a CANDU Fuel Conference.

2nd international conference on advanced nanomaterials and nanotechnology

CERN Document Server

Goswami, D; Perumal, A

2013-01-01

Nanoscale science and technology have occupied centre stage globally in modern scientific research and discourses in the early twenty first century. The enabling nature of the technology makes it important in modern electronics, computing, materials, healthcare, energy and the environment. This volume contains selected articles presented (as Invited/Oral/Poster presentations) at the 2nd international conference on advanced materials and nanotechnology (ICANN-2011) held recently at the Indian Institute of Technology Guwahati, during Dec 8-10, 2011. The list of topics covered in this proceedings include: Synthesis and self assembly of nanomaterials Nanoscale characterisation Nanophotonics & Nanoelectronics Nanobiotechnology Nanocomposites  F   Nanomagnetism Nanomaterials for Enery Computational Nanotechnology Commercialization of Nanotechnology The conference was represented by around 400 participants from several countries including delegates invited from USA, Germany, Japan, UK, Taiwan, Italy, Singapor...

2nd International Conference on Green Communications and Networks 2012

CERN Document Server

Ma, Maode; GCN 2012

2013-01-01

The objective of the 2nd International Conference on Green Communications and Networks 2012 (GCN 2012) is to facilitate an exchange of information on best practices for the latest research advances in the area of communications, networks and intelligence applications. These mainly involve computer science and engineering, informatics, communications and control, electrical engineering, information computing, and business intelligence and management. Proceedings of the 2nd International Conference on Green Communications and Networks 2012 (GCN 2012) will focus on green information technology and applications, which will provide in-depth insights for engineers and scientists in academia, industry, and government. The book addresses the most innovative research developments including technical challenges, social and economic issues, and presents and discusses the authors’ ideas, experiences, findings, and current projects on all aspects of advanced green information technology and applications. Yuhang Yang is ...

Duplications of the Neuropeptide Receptor VIPR2 Confer Significant Risk for Schizophrenia

Science.gov (United States)

Vacic, Vladimir; McCarthy, Shane; Malhotra, Dheeraj; Murray, Fiona; Chou, Hsun-Hua; Peoples, Aine; Makarov, Vladimir; Yoon, Seungtai; Bhandari, Abhishek; Corominas, Roser; Iakoucheva, Lilia M.; Krastoshevsky, Olga; Krause, Verena; Larach-Walters, Verónica; Welsh, David K.; Craig, David; Kelsoe, John R.; Gershon, Elliot S.; Leal, Suzanne M.; Aquila, Marie Dell; Morris, Derek W.; Gill, Michael; Corvin, Aiden; Insel, Paul A.; McClellan, Jon; King, Mary-Claire; Karayiorgou, Maria; Levy, Deborah L.; DeLisi, Lynn E.; Sebat, Jonathan

2012-01-01

Rare copy number variants (CNVs) play a prominent role in the etiology of schizophrenia and other neuropsychiatric disorders1. Substantial risk for schizophrenia is conferred by large (>500 kb) CNVs at several loci, including microdeletions at 1q21.1 2, 3q29 3, 15q13.3 2 and 22q11.2 4 and microduplication at 16p11.2 5. However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia (P= 4.0×10-5, OR = 16.14 [3.06, ∞]). Microduplications with variable breakpoints occurred within a 362 kb region and were detected in 29 of 8,290 (0.35%) patients versus two of 7,431 (0.03%) controls in the combined sample (p-value= 5.7×10-7, odds ratio (OR) = 14.1 [3.5, 123.9]). All duplications overlapped or were located within 89 kb upstream of the vasoactive intestinal peptide receptor VIPR2. VIPR2 transcription and cyclic-AMP signaling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered VIP signaling in the pathogenesis of schizophrenia and suggest VIPR2 as a potential target for the development of novel antipsychotic drugs. PMID:21346763

2nd International Conference on Ultra-Wideband, Short-Pulse Electromagnetics

CERN Document Server

Felsen, Leopold

1995-01-01

The papers published in this volume were presented at the Second International Conference on Ultra-WidebandiShort-Pulse (UWB/SP) Electromagnetics, ApriIS-7, 1994. To place this second international conference in proper perspective with respect to the first conference held during October 8-10, 1992, at Polytechnic University, some background information is necessary. As we had hoped, the first conference struck a responsive cord, both in timeliness and relevance, among the electromagnetic community 1. Participants at the first conference already inquired whether and when a follow-up meeting was under consideration. The first concrete proposal in this direction was made a few months after the first conference by Prof. A. Terzuoli of the Air Force Institute of Technology (AFIT), Dayton, Ohio, who has been a strong advocate of time-domain methods and technologies. He initially proposed a follow-up time-domain workshop under AFIT auspices. Realizing that interest in this subject is lodged also at other Air Force i...

Insect Resistance to Bacillus thuringiensis Toxin Cry2Ab Is Conferred by Mutations in an ABC Transporter Subfamily A Protein.

Directory of Open Access Journals (Sweden)

Wee Tek Tay

2015-11-01

Full Text Available The use of conventional chemical insecticides and bacterial toxins to control lepidopteran pests of global agriculture has imposed significant selection pressure leading to the rapid evolution of insecticide resistance. Transgenic crops (e.g., cotton expressing the Bt Cry toxins are now used world wide to control these pests, including the highly polyphagous and invasive cotton bollworm Helicoverpa armigera. Since 2004, the Cry2Ab toxin has become widely used for controlling H. armigera, often used in combination with Cry1Ac to delay resistance evolution. Isolation of H. armigera and H. punctigera individuals heterozygous for Cry2Ab resistance in 2002 and 2004, respectively, allowed aspects of Cry2Ab resistance (level, fitness costs, genetic dominance, complementation tests to be characterised in both species. However, the gene identity and genetic changes conferring this resistance were unknown, as was the detailed Cry2Ab mode of action. No cross-resistance to Cry1Ac was observed in mutant lines. Biphasic linkage analysis of a Cry2Ab-resistant H. armigera family followed by exon-primed intron-crossing (EPIC marker mapping and candidate gene sequencing identified three independent resistance-associated INDEL mutations in an ATP-Binding Cassette (ABC transporter gene we named HaABCA2. A deletion mutation was also identified in the H. punctigera homolog from the resistant line. All mutations truncate the ABCA2 protein. Isolation of further Cry2Ab resistance alleles in the same gene from field H. armigera populations indicates unequal resistance allele frequencies and the potential for Bt resistance evolution. Identification of the gene involved in resistance as an ABC transporter of the A subfamily adds to the body of evidence on the crucial role this gene family plays in the mode of action of the Bt Cry toxins. The structural differences between the ABCA2, and that of the C subfamily required for Cry1Ac toxicity, indicate differences in the

Superfund 16: Conference and exhibition proceedings. Volume 2

International Nuclear Information System (INIS)

Anon.

1995-01-01

This conference was held November 6--8, 1995 in Washington, D.C. The purpose of the conference was to provide a multidisciplinary forum dealing with state-of-the-art methods and site characterization technologies for environmental monitoring and remedial action planning of hazardous wastes. Individual papers have been processed separately for inclusion in the appropriate data bases

Proceedings of the 2. world conference on Pellets

International Nuclear Information System (INIS)

2006-07-01

The conference and exhibition had over 1000 participants from 60 different countries. Subject areas covered by the conference were: Raw Materials For Densification; Pellet Production Technologies; Pellet Burning Technologies; Supply Chain Logistics; Environmental Issues; Marketing of Densified Fuels; Co-Generation of Heat and Electricity from Densified Fuels; 57 contributions have been separately indexed for the database

Heat-resistant materials 2. Conference proceedings of the 2. international conference on heat-resistant materials

International Nuclear Information System (INIS)

Natesan, K.; Ganesan, P.; Lai, G.Y.

1995-01-01

The Second International Conference on Heat-Resistant Materials was held in Gatlinburg, Tennessee, September 11--14, 1995 and focused on materials performance in cross-cutting technologies where heat resistant materials play a large and sometimes life-and performance-limiting roles in process schemes. The scope of materials for heat-resistant applications included structural iron- and nickel-base alloys, intermetallics, and ceramics. The conference focused on materials development, performance of materials in simulated laboratory and actual service environments on mechanical and structural integrity of components, and state-of-the-art techniques for processing and evaluating materials performance. The three keynote talks described the history of heat-resistant materials, relationship between microstructure and mechanical behavior, and applications of these materials in process schemes. The technical sessions included alloy metallurgy and properties, environmental effects and properties, deformation behavior and properties, relation between corrosion and mechanical properties, coatings, intermetallics, ceramics, and materials for waste incineration. Seventy one papers have been processed separately for inclusion on the data base

Expression of the Galanthus nivalis agglutinin (GNA) gene in transgenic potato plants confers resistance to aphids.

Science.gov (United States)

Mi, Xiaoxiao; Liu, Xue; Yan, Haolu; Liang, Lina; Zhou, Xiangyan; Yang, Jiangwei; Si, Huaijun; Zhang, Ning

2017-01-01

Aphids, the largest group of sap-sucking pests, cause significant yield losses in agricultural crops worldwide every year. The massive use of pesticides to combat this pest causes severe damage to the environment, putting in risk the human health. In this study, transgenic potato plants expressing Galanthus nivalis agglutinin (GNA) gene were developed using CaMV 35S and ST-LS1 promoters generating six transgenic lines (35S1-35S3 and ST1-ST3 corresponding to the first and second promoter, respectively). Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the GNA gene was expressed in leaves, stems and roots of transgenic plants under the control of the CaMV 35S promoter, while it was only expressed in leaves and stems under the control of the ST-LS1 promoter. The levels of aphid mortality after 5 days of the inoculation in the assessed transgenic lines ranged from 20 to 53.3%. The range of the aphid population in transgenic plants 15 days after inoculation was between 17.0±1.43 (ST2) and 36.6±0.99 (35S3) aphids per plant, which corresponds to 24.9-53.5% of the aphid population in non-transformed plants. The results of our study suggest that GNA expressed in transgenic potato plants confers a potential tolerance to aphid attack, which appears to be an alternative against the use of pesticides in the future. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Overexpression of the human BCL-2 gene product results in growth enhancement of Epstein-Barr virus-immortalized B cells

International Nuclear Information System (INIS)

Tsujimoto, Yoshihide

1989-01-01

The biological activity of the human BCL-2 gene product was analyzed in an Epstein-Barr virus (EBV)-infected human lymphoblastoid B-cell line transfected with BCL-2 sequences driven by the simian virus 40 promoter and enhancer. Overproduction of the BCL-2 protein conferred a selective growth advantage to the EBV-infected B cells as compared with control transfectants in low-serum medium and also after seeding at limiting dilution but did not render the cells tumorigenic in athymic nude mice. This growth enhancement was also seen in cells transfected with the BCL-2 gene with its own promoter juxtaposed to the immunoglobulin heavy chain gene enhancer, which represents the translocated form of the BCL-2 gene observed in follicular lymphomas with the t(14;18) translocation. The growth advantage of EBV-infected B cells overproducing the BCL-2 protein is neither due to the enhanced growth factor production nor due to an enhanced sensitivity of the BCL-2 transfectants to interleukins 1 or 6, although both lymphokines are known to stimulate proliferation of EBV-infected B-cell lines. The growth advantage of EBV-infected B-cell lines. The growth advantage of EBV-infected B cells by overproduction of the BCL-2 protein suggests the direct involvement of the BCL-2 gene product in the pathogenesis of follicular lymphoma

Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

Directory of Open Access Journals (Sweden)

Hashishe Mervat M

2010-06-01

Full Text Available Abstract Background Breast cancer is one of the most common diseases affecting women. Inherited susceptibility genes, BRCA1 and BRCA2, are considered in breast, ovarian and other common cancers etiology. BRCA1 and BRCA2 genes have been identified that confer a high degree of breast cancer risk. Objective Our study was performed to identify germline mutations in some exons of BRCA1 and BRCA2 genes for the early detection of presymptomatic breast cancer in females. Methods This study was applied on Egyptian healthy females who first degree relatives to those, with or without a family history, infected with breast cancer. Sixty breast cancer patients, derived from 60 families, were selected for molecular genetic testing of BRCA1 and BRCA2 genes. The study also included 120 healthy first degree female relatives of the patients, either sisters and/or daughters, for early detection of presymptomatic breast cancer mutation carriers. Genomic DNA was extracted from peripheral blood lymphocytes of all the studied subjects. Universal primers were used to amplify four regions of the BRCA1 gene (exons 2,8,13 and 22 and one region (exon 9 of BRCA2 gene using specific PCR. The polymerase chain reaction was carried out. Single strand conformation polymorphism assay and heteroduplex analysis were used to screen for mutations in the studied exons. In addition, DNA sequencing of the normal and mutated exons were performed. Results Mutations in both BRCA1 and BRCA2 genes were detected in 86.7% of the families. Current study indicates that 60% of these families were attributable to BRCA1 mutations, while 26.7% of them were attributable to BRCA2 mutations. Results showed that four mutations were detected in the BRCA1 gene, while one mutation was detected in the BRCA2 gene. Asymptomatic relatives, 80(67% out of total 120, were mutation carriers. Conclusions BRCA1 and BRCA2 genes mutations are responsible for a significant proportion of breast cancer. BRCA mutations

PREFACE: 2nd International Conference on Competitive Materials and Technological Processes (IC-CMTP2)

Science.gov (United States)

László, Gömze A.

2013-12-01

Competitiveness is one of the most important factors in our life and it plays a key role in the efficiency both of organizations and societies. The more scientifically supported and prepared organizations develop more competitive materials with better physical, chemical and biological properties and the leading companies apply more competitive equipment and technology processes. The aims of the 2nd International Conference on Competitive Materials and Technology Processes (ic-cmtp2) are the following: Promote new methods and results of scientific research in the fields of material, biological, environmental and technology sciences; Change information between the theoretical and applied sciences as well as technical and technological implantations. Promote the communication between the scientist of different nations, countries and continents. Among the major fields of interest are materials with extreme physical, chemical, biological, medical, thermal, mechanical properties and dynamic strength; including their crystalline and nano-structures, phase transformations as well as methods of their technological processes, tests and measurements. Multidisciplinary applications of materials science and technological problems encountered in sectors like ceramics, glasses, thin films, aerospace, automotive and marine industry, electronics, energy, construction materials, medicine, biosciences and environmental sciences are of particular interest. In accordance to the program of the conference ic-cmtp2, more than 250 inquiries and registrations from different organizations were received. Researchers from 36 countries in Asia, Europe, Africa, North and South America arrived at the venue of conference. Including co-authors, the research work of more than 500 scientists are presented in this volume. Professor Dr Gömze A László Chair, ic-cmtp2 The PDF also contains lists of the boards, session chairs and sponsors.

Transgenic strategies to confer resistance against viruses in rice plants

Directory of Open Access Journals (Sweden)

Takahide eSasaya

2014-01-01

Full Text Available Rice (Oryza sativa L. is cultivated in more than 100 countries and supports nearly half of the world’s population. Developing efficient methods to control rice viruses is thus an urgent necessity because viruses cause serious losses in rice yield. Most rice viruses are transmitted by insect vectors, notably planthoppers and leafhoppers. Viruliferous insect vectors can disperse their viruses over relatively long distances, and eradication of the viruses is very difficult once they become widespread. Exploitation of natural genetic sources of resistance is one of the most effective approaches to protect crops from virus infection; however, only a few naturally occurring rice genes confer resistance against rice viruses. In an effort to improve control, many investigators are using genetic engineering of rice plants as a potential strategy to control viral diseases. Using viral genes to confer pathogen-derived resistance against crops is a well-established procedure, and the expression of various viral gene products has proved to be effective in preventing or reducing infection by various plant viruses since the 1990s. RNA-interference (RNAi, also known as RNA silencing, is one of the most efficient methods to confer resistance against plant viruses on their respective crops. In this article, we review the recent progress, mainly conducted by our research group, in transgenic strategies to confer resistance against tenuiviruses and reoviruses in rice plants. Our findings also illustrate that not all RNAi constructs against viral RNAs are equally effective in preventing virus infection and that it is important to identify the viral Achilles’ heel gene to target for RNAi attack when engineering plants.

Molecular cloning of the potato Gro1-4 gene conferring resistance to pathotype Ro1 of the root cyst nematode Globodera rostochiensis, based on a candidate gene approach.

Science.gov (United States)

Paal, Jürgen; Henselewski, Heike; Muth, Jost; Meksem, Khalid; Menéndez, Cristina M; Salamini, Francesco; Ballvora, Agim; Gebhardt, Christiane

2004-04-01

The endoparasitic root cyst nematode Globodera rostochiensis causes considerable damage in potato cultivation. In the past, major genes for nematode resistance have been introgressed from related potato species into cultivars. Elucidating the molecular basis of resistance will contribute to the understanding of nematode-plant interactions and assist in breeding nematode-resistant cultivars. The Gro1 resistance locus to G. rostochiensis on potato chromosome VII co-localized with a resistance-gene-like (RGL) DNA marker. This marker was used to isolate from genomic libraries 15 members of a closely related candidate gene family. Analysis of inheritance, linkage mapping, and sequencing reduced the number of candidate genes to three. Complementation analysis by stable potato transformation showed that the gene Gro1-4 conferred resistance to G. rostochiensis pathotype Ro1. Gro1-4 encodes a protein of 1136 amino acids that contains Toll-interleukin 1 receptor (TIR), nucleotide-binding (NB), leucine-rich repeat (LRR) homology domains and a C-terminal domain with unknown function. The deduced Gro1-4 protein differed by 29 amino acid changes from susceptible members of the Gro1 gene family. Sequence characterization of 13 members of the Gro1 gene family revealed putative regulatory elements and a variable microsatellite in the promoter region, insertion of a retrotransposon-like element in the first intron, and a stop codon in the NB coding region of some genes. Sequence analysis of RT-PCR products showed that Gro1-4 is expressed, among other members of the family including putative pseudogenes, in non-infected roots of nematode-resistant plants. RT-PCR also demonstrated that members of the Gro1 gene family are expressed in most potato tissues.

The SbMT-2 gene from a halophyte confers abiotic stress tolerance and modulates ROS scavenging in transgenic tobacco.

Directory of Open Access Journals (Sweden)

Amit Kumar Chaturvedi

Full Text Available Heavy metals are common pollutants of the coastal saline area and Salicornia brachiata an extreme halophyte is frequently exposed to various abiotic stresses including heavy metals. The SbMT-2 gene was cloned and transformed to tobacco for the functional validation. Transgenic tobacco lines (L2, L4, L6 and L13 showed significantly enhanced salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ tolerance compared to WT plants. Transgenic lines did not show any morphological variation and had enhanced growth parameters viz. shoot length, root length, fresh weight and dry weight. High seed germination percentage, chlorophyll content, relative water content, electrolytic leakage and membrane stability index confirmed that transgenic lines performed better under salt (NaCl, osmotic (PEG and metals (Zn++, Cu++ and Cd++ stress conditions compared to WT plants. Proline, H2O2 and lipid peroxidation (MDA analyses suggested the role of SbMT-2 in cellular homeostasis and H2O2 detoxification. Furthermore in vivo localization of H2O2 and O2-; and elevated expression of key antioxidant enzyme encoding genes, SOD, POD and APX evident the possible role of SbMT-2 in ROS scavenging/detoxification mechanism. Transgenic lines showed accumulation of Cu++ and Cd++ in root while Zn++ in stem under stress condition. Under control (unstressed condition, Zn++ was accumulated more in root but accumulation of Zn++ in stem under stress condition suggested that SbMT-2 may involve in the selective translocation of Zn++ from root to stem. This observation was further supported by the up-regulation of zinc transporter encoding genes NtZIP1 and NtHMA-A under metal ion stress condition. The study suggested that SbMT-2 modulates ROS scavenging and is a potential candidate to be used for phytoremediation and imparting stress tolerance.

The SbMT-2 gene from a halophyte confers abiotic stress tolerance and modulates ROS scavenging in transgenic tobacco.

Science.gov (United States)

Chaturvedi, Amit Kumar; Patel, Manish Kumar; Mishra, Avinash; Tiwari, Vivekanand; Jha, Bhavanath

2014-01-01

Heavy metals are common pollutants of the coastal saline area and Salicornia brachiata an extreme halophyte is frequently exposed to various abiotic stresses including heavy metals. The SbMT-2 gene was cloned and transformed to tobacco for the functional validation. Transgenic tobacco lines (L2, L4, L6 and L13) showed significantly enhanced salt (NaCl), osmotic (PEG) and metals (Zn++, Cu++ and Cd++) tolerance compared to WT plants. Transgenic lines did not show any morphological variation and had enhanced growth parameters viz. shoot length, root length, fresh weight and dry weight. High seed germination percentage, chlorophyll content, relative water content, electrolytic leakage and membrane stability index confirmed that transgenic lines performed better under salt (NaCl), osmotic (PEG) and metals (Zn++, Cu++ and Cd++) stress conditions compared to WT plants. Proline, H2O2 and lipid peroxidation (MDA) analyses suggested the role of SbMT-2 in cellular homeostasis and H2O2 detoxification. Furthermore in vivo localization of H2O2 and O2-; and elevated expression of key antioxidant enzyme encoding genes, SOD, POD and APX evident the possible role of SbMT-2 in ROS scavenging/detoxification mechanism. Transgenic lines showed accumulation of Cu++ and Cd++ in root while Zn++ in stem under stress condition. Under control (unstressed) condition, Zn++ was accumulated more in root but accumulation of Zn++ in stem under stress condition suggested that SbMT-2 may involve in the selective translocation of Zn++ from root to stem. This observation was further supported by the up-regulation of zinc transporter encoding genes NtZIP1 and NtHMA-A under metal ion stress condition. The study suggested that SbMT-2 modulates ROS scavenging and is a potential candidate to be used for phytoremediation and imparting stress tolerance.

Association between NINJ2 gene polymorphisms and ischemic stroke: a family-based case-control study.

Science.gov (United States)

Zhu, Yanping; Liu, Kuo; Tang, Xun; Wang, Jinwei; Yu, Zhiping; Wu, Yiqun; Chen, Dafang; Wang, Xueyin; Fang, Kai; Li, Na; Huang, Shaoping; Hu, Yonghua

2014-11-01

Novel susceptibility genes related to ischemic stroke (IS) are proposed in recent literatures. Population-based replicate studies would cause false positive results due to population stratification. 229 recruit IS patients and their 229 non-IS siblings were used in this study to avoid population stratification. The family-based study was conducted in Beijing from June 2005 to June 2012. Association between SNPs and IS was found in the sibship discordant tests, and the conditional logistic regression was performed to identify effect size and explore gene-environment interactions. Significant allelic association was identified between NINJ2 gene rs11833579 (P = 0.008), protein kinase C η gene rs2230501 (P = 0.039) and IS. The AA genotype of rs11833579 increased 1.51-fold risk (95% CI 1.04-3.46; P = 0.043) of IS, and it conferred susceptibility to IS only in a dominant model (OR 2.69; 95% CI 1.06-6.78; P = 0.036]. Risk of IS was higher (HR 3.58; 95% CI 1.54-8.31; P = 0.003) especially when the carriers of rs11833579 AA genotype were smokers. The present study suggests A allele of rs11833579 may play a role in mediating susceptibility to IS and it may increase the risk of IS together with smoking.

A TagSNP in SIRT1 gene confers susceptibility to myocardial infarction in a Chinese Han population.

Directory of Open Access Journals (Sweden)

Jie Cheng

Full Text Available SIRT1 exerts protective effects against endothelial cells dysfunction, inflammation and atherosclerosis, indicating an important role on myocardial infarction (MI pathogenesis. Nonetheless, the effects of SIRT1 variants on MI risk remain poorly understood. Here we aimed to investigate the influence of SIRT1 polymorphisms on individual susceptibility to MI. Genotyping of three tagSNPs (rs7069102, rs3818292 and rs4746720 in SIRT1 gene was performed in a Chinese Han population, consisting of 287 MI cases and 654 control subjects. In a logistic regression analysis, we found that G allele of rs7069102 had increased MI risk with odds ratio (OR of 1.57 [95% confidence interval (CI = 1.15-2.16, Bonferroni corrected P (Pc = 0.015] after adjustment for conventional risk factors compared to C allele. Similarly, the combined CG/GG genotypes was associated with the increased MI risk (OR = 1.64, 95% CI = 1.14-2.35, Pc = 0.021 compared to the CC genotype. Further stratified analysis revealed a more significant association with MI risk among younger subjects (≤ 55 years old. Consistent with these results, the haplotype rs7069102G-rs3818292A-rs4746720T containing the rs7069102 G allele was also associated with the increased MI risk (OR = 1.41, 95% CI = 1.09-1.84, Pc = 0.040. However, we did not detect any association of rs3818292 and rs4746720 with MI risk. Our study provides the first evidence that the tagSNP rs7069102 and haplotype rs7069102G-rs3818292A-rs4746720T in SIRT1 gene confer susceptibility to MI in the Chinese Han population.

2nd National Conference on Theoretical Physics. Abstracts Book

International Nuclear Information System (INIS)

Grecu, Alexandru Tudor

2004-01-01

The 2nd National Conference on Theoretical Physics was held on 26-29 August 2004 in Constanta, Romania. The addressed physics fields within the INIS scope are as follows: classical and quantum mechanics, general physics, physics of elementary particles and fields, nuclear physics and radiation physics, classical and quantum mechanics, general physics, atomic and molecular physics, condensed matter physics

Stable integration and expression of a cry1Ia gene conferring resistance to fall armyworm and boll weevil in cotton plants.

Science.gov (United States)

Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C

2016-08-01

Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

2nd International Conference on Education and Educational Technology (EET 2011)

CERN Document Server

Education Management, Education Theory and Education Application

2012-01-01

This volume includes extended and revised versions of a set of selected papers from the 2011 2nd International Conference on Education and Educational Technology (EET 2011) held in Chengdu, China, October 1-2, 2011. The mission of EET 2011 Volume 2 is to provide a forum for researchers, educators, engineers, and government officials involved in the general areas of education management, education theory and education application to disseminate their latest research results and exchange views on the future research directions of these fields. 133 related topic papers were selected into this volume. All the papers were reviewed by 2 program committee members and selected by the volume editor Prof. Yuanzhi Wang, from Intelligent Information Technology Application Research Association, Hong Kong. The conference will bring together leading researchers, engineers and scientists in the domain of interest. We hope every participant can have a good opportunity to exchange their research ideas and results and to discus...

Conference papers of POWER-GEN '93: Book 2

International Nuclear Information System (INIS)

Anon.

1993-01-01

The 6th International Conference and Exhibition for the Power Generating Industries was held November 17--19, 1993 in Dallas, Texas. The conference provided a forum for exchange of state-of-the-art information on power generation. Major topics of discussion include the following: environmental issues and technologies; and Clean Air Act compliance. Individual papers have been processed separately for inclusion in the appropriate data bases

Second international conference on isotopes. Conference proceedings

International Nuclear Information System (INIS)

Hardy, C.J.

1997-10-01

The Second International Conference on Isotopes (2ICI) was hosted by the Australian Nuclear Association in Sydney, NSW, Australia. The Theme of the Second Conference: Isotopes for Industry, Health and a Better Environment recognizes that isotopes have been used in these fields successfully for many years and offer prospects for increasing use in the future. The worldwide interest in the use of research reactors and accelerators and in applications of stable and radioactive isotopes, isotopic techniques and radiation in industry, agriculture, medicine, environmental studies and research in general, was considered. Other radiation issues including radiation protection and safety were also addressed. International and national overviews and subject reviews invited from leading experts were included to introduce the program of technical sessions. The invited papers were supported by contributions accepted from participants for oral and poster presentation. A Technical Exhibition was held in association with the Conference. This volume contains the foreword, technical program, the author index and of the papers (1-60) presented at the conference

Second international conference on isotopes. Conference proceedings

Energy Technology Data Exchange (ETDEWEB)

Hardy, C J [ed.

1997-10-01

The Second International Conference on Isotopes (2ICI) was hosted by the Australian Nuclear Association in Sydney, NSW, Australia. The Theme of the Second Conference: Isotopes for Industry, Health and a Better Environment recognizes that isotopes have been used in these fields successfully for many years and offer prospects for increasing use in the future. The worldwide interest in the use of research reactors and accelerators and in applications of stable and radioactive isotopes, isotopic techniques and radiation in industry, agriculture, medicine, environmental studies and research in general, was considered. Other radiation issues including radiation protection and safety were also addressed. International and national overviews and subject reviews invited from leading experts were included to introduce the program of technical sessions. The invited papers were supported by contributions accepted from participants for oral and poster presentation. A Technical Exhibition was held in association with the Conference. This volume contains the foreword, technical program, the author index and of the papers (1-60) presented at the conference.

Heterologous expression of three Camellia sinensis small heat shock protein genes confers temperature stress tolerance in yeast and Arabidopsis thaliana.

Science.gov (United States)

Wang, Mingle; Zou, Zhongwei; Li, Qinghui; Xin, Huahong; Zhu, Xujun; Chen, Xuan; Li, Xinghui

2017-07-01

CsHSP17.7, CsHSP18.1, and CsHSP21.8 expressions are induced by heat and cold stresses, and CsHSP overexpression confers tolerance to heat and cold stresses in transgenic Pichia pastoris and Arabidopsis thaliana. Small heat shock proteins (sHSPs) are crucial for protecting plants against biotic and abiotic stresses, especially heat stress. However, knowledge concerning the functions of Camellia sinensis sHSP in heat and cold stresses remains poorly understood. In this study, three C. sinensis sHSP genes (i.e., CsHSP17.7, CsHSP18.1, and CsHSP21.8) were isolated and characterized using suppression subtractive hybridization (SSH) technology. The CsHSPs expression levels in C. sinensis leaves were significantly up-regulated by heat and cold stresses. Phylogenetic analyses revealed that CsHSP17.7, CsHSP18.1, and CsHSP21.8 belong to sHSP Classes I, II, and IV, respectively. Heterologous expression of the three CsHSP genes in Pichia pastoris cells enhanced heat and cold stress tolerance. When exposed to heat and cold treatments, transgenic Arabidopsis thaliana plants overexpressing CsHSP17.7, CsHSP18.1, and CsHSP21.8 had lower malondialdehyde contents, ion leakage, higher proline contents, and transcript levels of stress-related genes (e.g., AtPOD, AtAPX1, AtP5CS2, and AtProT1) compared with the control line. In addition, improved seed germination vigor was also observed in the CsHSP-overexpressing seeds under heat stress. Taken together, our results suggest that the three identified CsHSP genes play key roles in heat and cold tolerance.

The 2-nd Conference on Isotopic and Molecular Processes. Abstracts

International Nuclear Information System (INIS)

Bogdan, Mircea

2001-01-01

The proceedings of the 2-nd Conference on Isotopic and Molecular Processes held on September 27 - 29, 2001 in Cluj - Napoca, Romania, contains contributions presented as: 11 plenary lectures, 24 oral presentations and 103 posters in two sections, namely, isotopic processes and molecular processes. The main topics treated in this conference were isotope production, separation and enrichment as well as stable isotope applications. Also, studies on isotope effects in different fields are reported. Besides reports on isotope effects, exchange and separation, new methods of preparation and labelling compounds used particularly in nuclear medicine are presented. Environmental studies by means of stable isotope and radon monitoring are described. Applications of radiation effects and different nuclear methods in medicine are also addressed

Abstracts of 2. international conference C-BN and diamond crystallization under reduced pressure

International Nuclear Information System (INIS)

1995-01-01

The important problem and the last advanced one from the view point of electronic materials sciences is the new A III B V compounds creation and investigation of their properties. This domain was the main subject of the 2. International Conference on C-BN and diamond crystallization under reduced pressure. The conference has been divided into 8 sessions. They were: opening address, c-BN, new materials, posters, diamond, applications, posters

[2. European] TRIGA owners' conference. Papers and abstracts

International Nuclear Information System (INIS)

1972-01-01

The Second European TRIGA Owners' Conference was held in Pavia, Italy, September 1972. The meeting was organized by the University of Pavia Applied Nuclear Energy Laboratory (L.E.N.A.). Sixty-two attendees representing 12 TRIGA reactor centers in Europe, South America, and the United States were present at the Conference. The main areas of discussions were: Reactor operation and maintenance experience; Research programs and TRIGA technology development

[2. European] TRIGA owners' conference. Papers and abstracts

Energy Technology Data Exchange (ETDEWEB)

NONE

1972-07-01

The Second European TRIGA Owners' Conference was held in Pavia, Italy, September 1972. The meeting was organized by the University of Pavia Applied Nuclear Energy Laboratory (L.E.N.A.). Sixty-two attendees representing 12 TRIGA reactor centers in Europe, South America, and the United States were present at the Conference. The main areas of discussions were: Reactor operation and maintenance experience; Research programs and TRIGA technology development.

Genetic Variations in the Kir6.2 Subunit (KCNJ11 of Pancreatic ATP-Sensitive Potassium Channel Gene Are Associated with Insulin Response to Glucose Loading and Early Onset of Type 2 Diabetes in Childhood and Adolescence in Taiwan

Directory of Open Access Journals (Sweden)

Yi-Der Jiang

2014-01-01

Full Text Available To investigate the role of E23K polymorphism of the KCNJ11 gene on early onset of type 2 diabetes in school-aged children/adolescents in Taiwan, we recruited 38 subjects with type 2 diabetes (ages 18.6 ± 6.6 years; body mass index percentiles 83.3 ± 15.4 and 69 normal controls (ages 17.3 ± 3.8 years; body mass index percentiles 56.7 ± 29.0 from a national surveillance for childhood/adolescent diabetes in Taiwan. We searched for the E23K polymorphism of the KCNJ11 gene. We found that type 2 diabetic subjects had higher carrier rate of E23K polymorphism of KCNJ11 gene than control subjects (P = 0.044. After adjusting for age, gender, body mass index percentiles, and fasting plasma insulin, the E23K polymorphism contributed to an increased risk for type 2 diabetes (P = 0.047. K23-allele-containing genotypes conferring increased plasma insulin level during OGTT in normal subjects. However, the diabetic subjects with the K23-allele-containing genotypes had lower fasting plasma insulin levels after adjustment of age and BMI percentiles. In conclusion, the E23K variant of the KCNJ11 gene conferred higher susceptibility to type 2 diabetes in children/adolescents. Furthermore, in normal glucose-tolerant children/adolescents, K23 allele carriers had a higher insulin response to oral glucose loading.

Genetic variants of the MAVS, MITA and MFN2 genes are not associated with leprosy in Han Chinese from Southwest China.

Science.gov (United States)

Wang, Dong; Li, Guo-Dong; Zhang, Deng-Feng; Xu, Ling; Li, Xiao-An; Yu, Xiu-Feng; Long, Heng; Li, Yu-Ye; Yao, Yong-Gang

2016-11-01

Leprosy is a chronic infectious disease caused by Mycobacterium leprae (M. leprae), which has massive genomic decay and dependence on host metabolism. Accumulating evidence showed a crucial role of mitochondria in metabolism and innate immunity. We hypothesized that the mitochondrial-related antimicrobial/antiviral immune genes MAVS (mitochondrial antiviral signaling protein), MITA (mediator of IRF3 activation) and MFN2 (mitofusin 2) would confer a risk to leprosy. In this study, we performed a case-control study to analyze 11 tag and/or non-synonymous SNPs of the MAVS, MITA and MFN2 genes in 527 leprosy patients and 583 healthy individuals, and directly sequenced the three genes in 80 leprosy patients with a family history from Yunnan, Southwest China. We found no association between these SNPs and leprosy (including its subtypes) based on the frequencies of alleles, genotypes and haplotypes between the cases and controls. There was also no enrichment of potential pathogenic variants of the three genes in leprosy patients. Our results suggested that genetic variants of the MAVS, MITA and MFN2 genes might not affect the susceptibility to leprosy. Copyright © 2016 Elsevier B.V. All rights reserved.

Presence of fibronectin-binding protein gene prtF2 in invasive group A streptococci in tropical Australia is associated with increased internalisation efficiency.

Science.gov (United States)

Gorton, Davina; Norton, Robert; Layton, Ramon; Smith, Helen; Ketheesan, Natkunam

2005-03-01

The fibronectin-binding proteins (FnBPs) PrtF1 and PrtF2 are considered to be major group A streptococcal virulence factors, mediating adherence to and internalisation of host cells. The present study investigated an association between the presence of prtF1 and prtF2 genes and internalisation efficiency in group A streptococci (GAS) isolated from patients with invasive disease. Of the 80 isolates tested, 58 (73%) had prtF1 and 71 (89%) possessed prtF2. Three isolates (4%) had neither gene, seven (9%) had prtF1 only, 19 (24%) had prtF2 only and 51 isolates (64%) had both prtF1 and prtF2. prtF2-positive isolates internalised up to three times more efficiently than isolates that had prtF1 alone (Pinternalisation efficiency and presence of the prtF1 gene. Analysis of the fibronectin-binding repeat domain (FBRD) of prtF2 revealed that this gene can contain 2, 3, 4 or 5 repeat regions and that five repeat regions conferred very high internalisation efficiency in invasive GAS isolates.

qnrA6 genetic environment and quinolone resistance conferred on Proteus mirabilis.

Science.gov (United States)

Jayol, Aurélie; Janvier, Frédéric; Guillard, Thomas; Chau, Françoise; Mérens, Audrey; Robert, Jérôme; Fantin, Bruno; Berçot, Béatrice; Cambau, Emmanuelle

2016-04-01

To determine the genetic location and environment of the qnrA6 gene in Proteus mirabilis PS16 where it was first described and to characterize the quinolone resistance qnrA6 confers. Transformation experiments and Southern blotting were performed for plasmid and genomic DNA of P. mirabilis PS16 to determine the qnrA6 location. Combinatorial PCRs with primers in qnrA6 and genes usually surrounding qnrA genes were used to determine the genetic environment. The qnrA6 coding region, including or not the promoter region, was cloned into vectors pTOPO and pBR322 and the MICs of six quinolones were measured for transformants of Escherichia coli TOP10 and P. mirabilis ATCC 29906 Rif(R). qnrA6 was shown to be chromosomally encoded in P. mirabilis PS16 and its genetic environment was 81%-87% similar to that of qnrA2 in the Shewanella algae chromosome. The 5138 bp region up- and downstream of qnrA6 contained an IS10 sequence surrounded by two ISCR1. This resulted in qnrA6 being displaced 1.9 kb from its native promoter but supplied a promoter present in ISCR1. qnrA6 cloned into pTOPO and pBR322 conferred a 4-32-fold increase in fluoroquinolone MICs when expressed in E. coli but only 2-3-fold in P. mirabilis. When including the promoter region, a further increase in resistance was observed in both species, reaching MIC values above clinical breakpoints for only P. mirabilis. qnrA6 is the first chromosomally located qnrA gene described in Enterobacteriaceae. The quinolone resistance conferred by qnrA6 depends on the proximity of an efficient promoter and the host strain where it is expressed. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Induction of Xa10-like Genes in Rice Cultivar Nipponbare Confers Disease Resistance to Rice Bacterial Blight.

Science.gov (United States)

Wang, Jun; Tian, Dongsheng; Gu, Keyu; Yang, Xiaobei; Wang, Lanlan; Zeng, Xuan; Yin, Zhongchao

2017-06-01

Bacterial blight of rice, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive bacterial diseases throughout the major rice-growing regions in the world. The rice disease resistance (R) gene Xa10 confers race-specific disease resistance to X. oryzae pv. oryzae strains that deliver the corresponding transcription activator-like (TAL) effector AvrXa10. Upon bacterial infection, AvrXa10 binds specifically to the effector binding element in the promoter of the R gene and activates its expression. Xa10 encodes an executor R protein that triggers hypersensitive response and activates disease resistance. 'Nipponbare' rice carries two Xa10-like genes in its genome, of which one is the susceptible allele of the Xa23 gene, a Xa10-like TAL effector-dependent executor R gene isolated recently from 'CBB23' rice. However, the function of the two Xa10-like genes in disease resistance to X. oryzae pv. oryzae strains has not been investigated. Here, we designated the two Xa10-like genes as Xa10-Ni and Xa23-Ni and characterized their function for disease resistance to rice bacterial blight. Both Xa10-Ni and Xa23-Ni provided disease resistance to X. oryzae pv. oryzae strains that deliver the matching artificially designed TAL effectors (dTALE). Transgenic rice plants containing Xa10-Ni and Xa23-Ni under the Xa10 promoter provided specific disease resistance to X. oryzae pv. oryzae strains that deliver AvrXa10. Xa10-Ni and Xa23-Ni knock-out mutants abolished dTALE-dependent disease resistance to X. oryzae pv. oryzae. Heterologous expression of Xa10-Ni and Xa23-Ni in Nicotiana benthamiana triggered cell death. The 19-amino-acid residues at the N-terminal regions of XA10 or XA10-Ni are dispensable for their function in inducing cell death in N. benthamiana and the C-terminal regions of XA10, XA10-Ni, and XA23-Ni are interchangeable among each other without affecting their function. Like XA10, both XA10-Ni and XA23-Ni locate to the endoplasmic reticulum (ER) membrane

2nd International Conference on Education and Educational Technology (EET 2011)

CERN Document Server

Education and Educational Technology

2012-01-01

This volume includes extended and revised versions of a set of selected papers from the 2011 2nd International Conference on Education and Educational Technology (EET 2011) held in Chengdu, China, October 1-2, 2011. The mission of EET 2011 Volume 1 is to provide a forum for researchers, educators, engineers, and government officials involved in the general areas of education and educational technology to disseminate their latest research results and exchange views on the future research directions of these fields. 130 related topic papers were selected into this volume. All the papers were reviewed by 2 program committee members and selected by the volume editor Prof. Yuanzhi Wang, from Intelligent Information Technology Application Research Association, Hong Kong. The conference will bring together leading researchers, engineers and scientists in the domain of interest. We hope every participant can have a good opportunity to exchange their research ideas and results and to discuss the state of the art in th...

Role of Bmznf-2, a Bombyx mori CCCH zinc finger gene, in masculinisation and differential splicing of Bmtra-2.

Science.gov (United States)

Gopinath, Gajula; Arunkumar, Kallare P; Mita, Kazuei; Nagaraju, Javaregowda

2016-08-01

Deciphering the regulatory factors involved in Bombyx mori sex determination has been a puzzle, challenging researchers for nearly a century now. The pre-mRNA of B. mori doublesex (Bmdsx), a master regulator gene of sexual differentiation, is differentially spliced, producing Bmdsxm and Bmdsxf transcripts in males and females respectively. The putative proteins encoded by these differential transcripts orchestrate antagonistic functions, which lead to sexual differentiation. A recent study in B. mori illustrated the role of a W-derived fem piRNA in conferring femaleness. In females, the fem piRNA was shown to suppress the activity of a Z-linked CCCH type zinc finger (znf) gene, Masculiniser (masc), which indirectly promotes the Bmdsxm type of splicing. In this study, we report a novel autosomal (Chr 25) CCCH type znf motif encoding gene Bmznf-2 as one of the potential factors in the Bmdsx sex specific differential splicing, and we also provide insights into its role in the alternative splicing of Bmtra2 by using ovary derived BmN cells. Over-expression of Bmznf-2 induced Bmdsxm type of splicing (masculinisation) with a correspondingly reduced expression of Bmdsxf type isoform in BmN cells. Further, the site-directed mutational studies targeting the tandem CCCH znf motifs revealed their indispensability in the observed phenotype of masculinisation. Additionally, the dual luciferase assays in BmN cells using 5' UTR region of the Bmznf-2 strongly implied the existence of a translational repression over this gene. From these findings, we propose Bmznf-2 to be one of the potential factors of masculinisation similar to Masc. From the growing number of Bmdsx splicing regulators, we assume that the sex determination cascade of B. mori is quite intricate in nature; hence, it has to be further investigated for its comprehensive understanding. Copyright © 2016 Elsevier Ltd. All rights reserved.

Massive gene swamping among cheese-making Penicillium fungi

Directory of Open Access Journals (Sweden)

Jeanne Ropars

2015-03-01

Full Text Available Horizontal gene transfers (HGT, i.e., the transmission of genetic material between species not directly attributable to meiotic gene exchange, have long been acknowledged as a major driver of prokaryotic evolution and is increasingly recognized as an important source of adaptation in eukaryotes. In fungi in particular, many convincing examples of HGT have been reported to confer selective advantages on the recipient fungal host, either promoting fungal pathogenicity on plants or increasing their toxicity by the acquisition of secondary metabolic clusters, resulting in adaptation to new niches and in some cases eventually even in speciation. These horizontal gene transfers involve single genes, complete metabolic pathways or even entire chromosomes. A recent study has uncovered multiple recent horizontal transfers of a 575 kb genomic island in cheese Penicillium fungi, representing ca. 2% of the Penicillium roqueforti’s genome, that may confer selective advantage in the competing cheese environment where bacteria and fungi occur. Novel phylogenomic methods are being developed, revealing massive HGT among fungi. Altogether, these recent studies indicate that HGT is a crucial mechanism of rapid adaptation, even among eukaryotes.

2nd Historic Mortars Conference

CERN Document Server

Hughes, John; Groot, Caspar; Historic Mortars : Characterisation, Assessment and Repair

2012-01-01

This volume focuses on research and practical issues connected with mortars on historic structures. The book is divided into four sections: Characterisation of Historic Mortars, Repair Mortars and Design Issues, Experimental Research into Properties of Repair Mortars, and Assessment and Testing. The papers present the latest work of researchers in their field. The individual contributions were selected from the contributions to the 2nd Historic Mortars Conference, which took place in Prague, September, 22-24, 2010. All papers were reviewed and improved as necessary before publication. This peer review process by the editors resulted in the 34 individual contributions included in here. One extra paper reviewing and summarising State-of-the-Art knowledge covered by this publication was added as a starting and navigational point for the reader. The editors believe that having these papers in print is important and they hope that it will stimulate further research into historic mortars and related subjects. 

Gene expression profiling of loss of TET2 and/or JAK2V617F mutant hematopoietic stem cells from mouse models of myeloproliferative neoplasms

Directory of Open Access Journals (Sweden)

Takuro Kameda

2015-06-01

Full Text Available Myeloproliferative neoplasms (MPNs are clinically characterized by the chronic overproduction of differentiated peripheral blood cells and the gradual expansion of malignant intramedullary/extramedullary hematopoiesis. In MPNs mutations in JAK2 MPL or CALR are detected mutually exclusive in more than 90% of cases [1,2]. Mutations in them lead to the abnormal activation of JAK/STAT signaling and the autonomous growth of differentiated cells therefore they are considered as “driver” gene mutations. In addition to the above driver gene mutations mutations in epigenetic regulators such as TET2 DNMT3A ASXL1 EZH2 or IDH1/2 are detected in about 5%–30% of cases respectively [3]. Mutations in TET2 DNMT3A EZH2 or IDH1/2 commonly confer the increased self-renewal capacity on normal hematopoietic stem cells (HSCs but they do not lead to the autonomous growth of differentiated cells and only exhibit subtle clinical phenotypes [4,6–8,5]. It was unclear how mutations in such epigenetic regulators influenced abnormal HSCs with driver gene mutations how they influenced the disease phenotype or whether a single driver gene mutation was sufficient for the initiation of human MPNs. Therefore we focused on JAK2V617F and loss of TET2—the former as a representative of driver gene mutations and the latter as a representative of mutations in epigenetic regulators—and examined the influence of single or double mutations on HSCs (Lineage−Sca-1+c-Kit+ cells (LSKs by functional analyses and microarray whole-genome expression analyses [9]. Gene expression profiling showed that the HSC fingerprint genes [10] was statistically equally enriched in TET2-knockdown-LSKs but negatively enriched in JAK2V617F–LSKs compared to that in wild-type-LSKs. Double-mutant-LSKs showed the same tendency as JAK2V617F–LSKs in terms of their HSC fingerprint genes but the expression of individual genes differed between the two groups. Among 245 HSC fingerprint genes 100 were more

Mutation of Rv2887, a marR-like gene, confers Mycobacterium tuberculosis resistance to an imidazopyridine-based agent.

Science.gov (United States)

Winglee, Kathryn; Lun, Shichun; Pieroni, Marco; Kozikowski, Alan; Bishai, William

2015-11-01

Drug resistance is a major problem in Mycobacterium tuberculosis control, and it is critical to identify novel drug targets and new antimycobacterial compounds. We have previously identified an imidazo[1,2-a]pyridine-4-carbonitrile-based agent, MP-III-71, with strong activity against M. tuberculosis. In this study, we evaluated mechanisms of resistance to MP-III-71. We derived three independent M. tuberculosis mutants resistant to MP-III-71 and conducted whole-genome sequencing of these mutants. Loss-of-function mutations in Rv2887 were common to all three MP-III-71-resistant mutants, and we confirmed the role of Rv2887 as a gene required for MP-III-71 susceptibility using complementation. The Rv2887 protein was previously unannotated, but domain and homology analyses suggested it to be a transcriptional regulator in the MarR (multiple antibiotic resistance repressor) family, a group of proteins first identified in Escherichia coli to negatively regulate efflux pumps and other mechanisms of multidrug resistance. We found that two efflux pump inhibitors, verapamil and chlorpromazine, potentiate the action of MP-III-71 and that mutation of Rv2887 abrogates their activity. We also used transcriptome sequencing (RNA-seq) to identify genes which are differentially expressed in the presence and absence of a functional Rv2887 protein. We found that genes involved in benzoquinone and menaquinone biosynthesis were repressed by functional Rv2887. Thus, inactivating mutations of Rv2887, encoding a putative MarR-like transcriptional regulator, confer resistance to MP-III-71, an effective antimycobacterial compound that shows no cross-resistance to existing antituberculosis drugs. The mechanism of resistance of M. tuberculosis Rv2887 mutants may involve efflux pump upregulation and also drug methylation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

International conference on the role of the polar regions in global change: Proceedings. Volume 2

Energy Technology Data Exchange (ETDEWEB)

Weller, G.; Wilson, C.L.; Severin, B.A.B. [eds.

1991-12-01

The International Conference on the Role of the Polar Regions in Global Change took place on the campus of the University of Alaska Fairbanks on June 11--15, 1990. The goal of the conference was to define and summarize the state of knowledge on the role of the polar regions in global change, and to identify gaps in knowledge. To this purpose experts in a wide variety of relevant disciplines were invited to present papers and hold panel discussions. While there are numerous conferences on global change, this conference dealt specifically with the polar regions which occupy key positions in the global system. These two volumes of conference proceedings include papers on (1) detection and monitoring of change; (2) climate variability and climate forcing; (3) ocean, sea ice, and atmosphere interactions and processes; and (4) effects on biota and biological feedbacks; (5) ice sheet, glacier and permafrost responses and feedbacks, (6) paleoenvironmental studies; and, (7) aerosol and trace gases.

2nd International Conference on Multiscale Computational Methods for Solids and Fluids

CERN Document Server

2016-01-01

This volume contains the best papers presented at the 2nd ECCOMAS International Conference on Multiscale Computations for Solids and Fluids, held June 10-12, 2015. Topics dealt with include multiscale strategy for efficient development of scientific software for large-scale computations, coupled probability-nonlinear-mechanics problems and solution methods, and modern mathematical and computational setting for multi-phase flows and fluid-structure interaction. The papers consist of contributions by six experts who taught short courses prior to the conference, along with several selected articles from other participants dealing with complementary issues, covering both solid mechanics and applied mathematics. .

Applied and Environmental Microbiology Gordon Research Conference

Energy Technology Data Exchange (ETDEWEB)

Wall, Judy D.

2003-11-19

The main objective of the Gordon Research Conference on Applied and Environmental Microbiology was to present and discuss new, fundamental research findings on microorganisms, their activities in the environment, their ecosystem-level effects, and their environmental or commercial applications. To accomplish this goal, knowledge of microbial diversity, interactions and population dynamics was required. The genomic basis of microbial processes, the cycling of naturally occurring and hazardous substances, and methodologies to assess the functional relationships of microorganisms in their habitats were essential for understanding the ecological consequences of microbial activities and the formulation of generalizing principles. In the last decade, molecular technology has revealed that microbial diversity is far more extensive than the limited view obtained from culturing procedures. Great advances in environmental microbiology have resulted from the development and application of molecular approaches to ecology and molecular evolution. A further surprise resulting from the application of these new tools is the blurring of the distinction between pathogenic traits versus those considered non-pathogenic. This year's conference addressed the issues of biodiversity, its development, and the impact of stress on gene selection and expression. In addition microbial metabolic versatility with toxins such as heavy metals, antibiotics, and organic pollutants were discussed. The nine session topics were (1) biodiversity and the bacterial species, (2) mechanisms of biodiversification, (3) biofilms in health and environment, (4) a genomic view of microbial response to stress, (5) microbial use of toxic metals, (6) microbial mineral formation and dissolution, (7) power and limitations of antimicrobials, (8) biodegradation of organic pollutants, and (9) astrobiology. The Conference had an international profile: the Conference Vice-Chair, Dr. Gerard Muyzer, was from The Nether

The diversity of antimicrobial resistance genes among staphylococci of animal origin.

Science.gov (United States)

Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina

2013-08-01

Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

2nd CEAS Specialist Conference on Guidance, Navigation and Control

CERN Document Server

Mulder, Bob; Choukroun, Daniel; Kampen, Erik-Jan; Visser, Coen; Looye, Gertjan

2013-01-01

Following the successful 1st CEAS (Council of European Aerospace Societies) Specialist Conference on Guidance, Navigation and Control (CEAS EuroGNC) held in Munich, Germany in 2011, Delft University of Technology happily accepted the invitation of organizing the 2nd  CEAS EuroGNC in Delft, The Netherlands in 2013. The goal of the conference is to promote new advances in aerospace GNC theory and technologies for enhancing safety, survivability, efficiency, performance, autonomy and intelligence of aerospace systems using on-board sensing, computing and systems. A great push for new developments in GNC are the ever higher safety and sustainability requirements in aviation. Impressive progress was made in new research fields such as sensor and actuator fault detection and diagnosis, reconfigurable and fault tolerant flight control, online safe flight envelop prediction and protection, online global aerodynamic model identification, online global optimization and flight upset recovery. All of these challenges de...

Cloning of the Lycopene β-cyclase Gene in Nicotiana tabacum and Its Overexpression Confers Salt and Drought Tolerance

Directory of Open Access Journals (Sweden)

Yanmei Shi

2015-12-01

Full Text Available Carotenoids are important pigments in plants that play crucial roles in plant growth and in plant responses to environmental stress. Lycopene β cyclase (β-LCY functions at the branch point of the carotenoid biosynthesis pathway, catalyzing the cyclization of lycopene. Here, a β-LCY gene from Nicotiana tabacum, designated as Ntβ-LCY1, was cloned and functionally characterized. Robust expression of Ntβ-LCY1 was found in leaves, and Ntβ-LCY1 expression was obviously induced by salt, drought, and exogenous abscisic acid treatments. Strong accumulation of carotenoids and expression of carotenoid biosynthesis genes resulted from Ntβ-LCY1 overexpression. Additionally, compared to wild-type plants, transgenic plants with overexpression showed enhanced tolerance to salt and drought stress with higher abscisic acid levels and lower levels of malondialdehyde and reactive oxygen species. Conversely, transgenic RNA interference plants had a clear albino phenotype in leaves, and some plants did not survive beyond the early developmental stages. The suppression of Ntβ-LCY1 expression led to lower expression levels of genes in the carotenoid biosynthesis pathway and to reduced accumulation of carotenoids, chlorophyll, and abscisic acid. These results indicate that Ntβ-LCY1 is not only a likely cyclization enzyme involved in carotenoid accumulation but also confers salt and drought stress tolerance in Nicotiana tabacum.

Genetic variations of PIP4K2A confer vulnerability to poor antipsychotic response in severely ill schizophrenia patients.

Directory of Open Access Journals (Sweden)

Harpreet Kaur

incomplete responders with low severity (OR = 4.09, 95%-CI = 2.09-8.02. Our findings provide strong evidence that diplotype ATTGCT/ATTGCT of PIP4K2A gene conferred approximately three-times higher incomplete responsiveness towards antipsychotics in severely ill patients. These results are consistent with the known role of phosphatidyl-inositol-signaling elements in antipsychotic action and outcome. Findings have implication for future molecular genetic studies as well as personalized medicine. However more work is warranted to elucidate underlying causal biological pathway.

Identification of a locus control region for quadruplicated green-sensitive opsin genes in zebrafish

Science.gov (United States)

Tsujimura, Taro; Chinen, Akito; Kawamura, Shoji

2007-01-01

Duplication of opsin genes has a crucial role in the evolution of visual system. Zebrafish have four green-sensitive (RH2) opsin genes (RH2–1, RH2–2, RH2–3, and RH2–4) arrayed in tandem. They are expressed in the short member of the double cones (SDC) but differ in expression areas in the retina and absorption spectra of their encoding photopigments. The shortest and the second shortest wavelength subtypes, RH2–1 and RH2–2, are expressed in the central-to-dorsal retina. The longer wavelength subtype, RH2–3, is expressed circumscribing the RH2–1/RH2–2 area, and the longest subtype, RH2–4, is expressed further circumscribing the RH2–3 area and mainly occupying the ventral retina. The present report shows that a 0.5-kb region located 15 kb upstream of the RH2 gene array is an essential regulator for their expression. When the 0.5-kb region was deleted from a P1-artificial chromosome (PAC) clone encompassing the four RH2 genes and when one of these genes was replaced with a reporter GFP gene, the GFP expression in SDCs was abolished in the zebrafish to which a series of the modified PAC clones were introduced. Transgenic studies also showed that the 0.5-kb region conferred the SDC-specific expression for promoters of a non-SDC (UV opsin) and a nonretinal (keratin 8) gene. Changing the location of the 0.5-kb region in the PAC clone conferred the highest expression for its proximal gene. The 0.5-kb region was thus designated as RH2-LCR analogous to the locus control region of the L-M opsin genes of primates. PMID:17646658

Common variants conferring risk of schizophrenia

DEFF Research Database (Denmark)

Stefansson, Hreinn; Ophoff, Roel A; Steinberg, Stacy

2009-01-01

Schizophrenia is a complex disorder, caused by both genetic and environmental factors and their interactions. Research on pathogenesis has traditionally focused on neurotransmitter systems in the brain, particularly those involving dopamine. Schizophrenia has been considered a separate disease...... conform to classical nosological disease boundaries. Certain CNVs confer not only high relative risk of schizophrenia but also of other psychiatric disorders. The structural variations associated with schizophrenia can involve several genes and the phenotypic syndromes, or the 'genomic disorders', have.......2. Our findings implicating the MHC region are consistent with an immune component to schizophrenia risk, whereas the association with NRGN and TCF4 points to perturbation of pathways involved in brain development, memory and cognition....

Conference proceedings of the 2nd and 3rd Regional Innovation & Entrepreneurship Conference : at Saxion University of applied sciences

NARCIS (Netherlands)

Bazen, J.J. (Jacques); Hammer, M.H.M. (Matthijs)

2016-01-01

DOI:https://doi.org/10.14261/postit/F20ECDBA-3106-4133-9EE0714DBAA65B51 In 2015 and 2016, Saxion University of Applied Sciences organized the 2nd and 3rd edition of the Regional Innovation and Entrepreneurship Conference (RIEC). The book that is in front of you now is the result of these two

Overexpression of an AP2/ERF Type Transcription Factor OsEREBP1 Confers Biotic and Abiotic Stress Tolerance in Rice.

Directory of Open Access Journals (Sweden)

V Jisha

Full Text Available AP2/ERF-type transcription factors regulate important functions of plant growth and development as well as responses to environmental stimuli. A rice AP2/ERF transcription factor, OsEREBP1 is a downstream component of a signal transduction pathway in a specific interaction between rice (Oryza sativa and its bacterial pathogen, Xoo (Xanthomonas oryzae pv. oryzae. Constitutive expression of OsEREBP1 in rice driven by maize ubiquitin promoter did not affect normal plant growth. Microarray analysis revealed that over expression of OsEREBP1 caused increased expression of lipid metabolism related genes such as lipase and chloroplastic lipoxygenase as well as several genes related to jasmonate and abscisic acid biosynthesis. PR genes, transcription regulators and Aldhs (alcohol dehydrogenases implicated in abiotic stress and submergence tolerance were also upregulated in transgenic plants. Transgenic plants showed increase in endogenous levels of α-linolenate, several jasmonate derivatives and abscisic acid but not salicylic acid. Soluble modified GFP (SmGFP-tagged OsEREBP1 was localized to plastid nucleoids. Comparative analysis of non-transgenic and OsEREBP1 overexpressing genotypes revealed that OsEREBP1 attenuates disease caused by Xoo and confers drought and submergence tolerance in transgenic rice. Our results suggest that constitutive expression of OsEREBP1 activates the jasmonate and abscisic acid signalling pathways thereby priming the rice plants for enhanced survival under abiotic or biotic stress conditions. OsEREBP1 is thus, a good candidate gene for engineering plants for multiple stress tolerance.

75 FR 3471 - International Conference on Harmonisation; Guidance on M3(R2) Nonclinical Safety Studies for the...

Science.gov (United States)

2010-01-21

...] International Conference on Harmonisation; Guidance on M3(R2) Nonclinical Safety Studies for the Conduct of... the availability of a guidance entitled ``M3(R2) Nonclinical Safety Studies for the Conduct of Human... auspices of the International Conference on Harmonisation of Technical Requirements for Registration of...

Ectopic expression of ubiquitin-conjugating enzyme gene from wild rice, OgUBC1, confers resistance against UV-B radiation and Botrytis infection in Arabidopsis thaliana

International Nuclear Information System (INIS)

Jeon, En Hee; Pak, Jung Hun; Kim, Mi Jin; Kim, Hye Jeong; Shin, Sang Hyun; Lee, Jai Heon; Kim, Doh Hoon; Oh, Ju Sung; Oh, Boung-Jun; Jung, Ho Won; Chung, Young Soo

2012-01-01

Highlights: ► We isolated a novel E2 ubiquitin-conjugating enzyme from leaves of wild rice plants. ► The OgUBC1 was highly expressed in leaves treated with SA and UV-B radiation. ► The recombinant OgUBC1 has an enzymatic activity of E2 in vitro. ► The OgUBC1 could protect disruption of plant cells by UV-B radiation. ► OgUBC1 confers disease resistance and UV-B tolerance in transgenic Arabidopsis plants. -- Abstract: A previously unidentified gene encoding ubiquitin-conjugating enzyme was isolated from leaves of wild rice plant treated with wounding and microbe-associated molecular patterns. The OgUBC1 gene was composed of 148 amino acids and contained a typical active site and 21 ubiquitin thioester intermediate interaction residues and 4 E3 interaction residues. Both exogenous application of salicylic acid and UV-B irradiation triggered expression of OgUBC1 in leaves of wild rice. Recombinant OgUBC1 proteins bound to ubiquitins in vitro, proposing that the protein might act as E2 enzyme in planta. Heterologous expression of the OgUBC1 in Arabidopsis thaliana protected plants from cellular damage caused by an excess of UV-B radiation. A stable expression of chalcone synthase gene was detected in leaves of OgUBC1-expressing Arabidopsis, resulting in producing higher amounts of anthocyanin than those in wild-type Col-0 plants. Additionally, both pathogenesis-related gene1 and 5 were transcribed in the transgenic Arabidopsis in the absence of pathogen infection. The OgUBC1-expressing plants were resistant to the infection of Botrytis cinerea. Taken together, we suggested that the OgUBC1 is involved in ubiquitination process important for cellular response against biotic and abiotic stresses in plants.

Ectopic expression of ubiquitin-conjugating enzyme gene from wild rice, OgUBC1, confers resistance against UV-B radiation and Botrytis infection in Arabidopsis thaliana

Energy Technology Data Exchange (ETDEWEB)

Jeon, En Hee; Pak, Jung Hun; Kim, Mi Jin; Kim, Hye Jeong [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of); Shin, Sang Hyun [National Crop Experiment Station, Rural Development Administration, Suwon 441-100 (Korea, Republic of); Lee, Jai Heon; Kim, Doh Hoon; Oh, Ju Sung [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of); Oh, Boung-Jun [BioControl Center, Jeonnam 516-942 (Korea, Republic of); Jung, Ho Won, E-mail: hwjung@dau.ac.kr [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of); Chung, Young Soo, E-mail: chungys@dau.ac.kr [Department of Genetic Engineering, Dong-A University, Busan 604-714 (Korea, Republic of)

2012-10-19

Highlights: Black-Right-Pointing-Pointer We isolated a novel E2 ubiquitin-conjugating enzyme from leaves of wild rice plants. Black-Right-Pointing-Pointer The OgUBC1 was highly expressed in leaves treated with SA and UV-B radiation. Black-Right-Pointing-Pointer The recombinant OgUBC1 has an enzymatic activity of E2 in vitro. Black-Right-Pointing-Pointer The OgUBC1 could protect disruption of plant cells by UV-B radiation. Black-Right-Pointing-Pointer OgUBC1 confers disease resistance and UV-B tolerance in transgenic Arabidopsis plants. -- Abstract: A previously unidentified gene encoding ubiquitin-conjugating enzyme was isolated from leaves of wild rice plant treated with wounding and microbe-associated molecular patterns. The OgUBC1 gene was composed of 148 amino acids and contained a typical active site and 21 ubiquitin thioester intermediate interaction residues and 4 E3 interaction residues. Both exogenous application of salicylic acid and UV-B irradiation triggered expression of OgUBC1 in leaves of wild rice. Recombinant OgUBC1 proteins bound to ubiquitins in vitro, proposing that the protein might act as E2 enzyme in planta. Heterologous expression of the OgUBC1 in Arabidopsis thaliana protected plants from cellular damage caused by an excess of UV-B radiation. A stable expression of chalcone synthase gene was detected in leaves of OgUBC1-expressing Arabidopsis, resulting in producing higher amounts of anthocyanin than those in wild-type Col-0 plants. Additionally, both pathogenesis-related gene1 and 5 were transcribed in the transgenic Arabidopsis in the absence of pathogen infection. The OgUBC1-expressing plants were resistant to the infection of Botrytis cinerea. Taken together, we suggested that the OgUBC1 is involved in ubiquitination process important for cellular response against biotic and abiotic stresses in plants.

MsZEP, a novel zeaxanthin epoxidase gene from alfalfa (Medicago sativa), confers drought and salt tolerance in transgenic tobacco.

Science.gov (United States)

Zhang, Zhiqiang; Wang, Yafang; Chang, Leqin; Zhang, Tong; An, Jie; Liu, Yushi; Cao, Yuman; Zhao, Xia; Sha, Xuyang; Hu, Tianming; Yang, Peizhi

2016-02-01

The zeaxanthin epoxidase gene ( MsZEP ) was cloned and characterized from alfalfa and validated for its function of tolerance toward drought and salt stresses by heterologous expression in Nicotiana tabacum. Zeaxanthin epoxidase (ZEP) plays important roles in plant response to various environment stresses due to its functions in ABA biosynthetic and the xanthophyll cycle. To understand the expression characteristics and the biological functions of ZEP in alfalfa (Medicago sativa), a novel gene, designated as MsZEP (KM044311), was cloned, characterized and overexpressed in Nicotiana tabacum. The open reading frame of MsZEP contains 1992 bp nucleotides and encodes a 663-amino acid polypeptide. Amino acid sequence alignment indicated that deduced MsZEP protein was highly homologous to other plant ZEP sequences. Phylogenetic analysis showed that MsZEP was grouped into a branch with other legume plants. Real-time quantitative PCR revealed that MsZEP gene expression was clearly tissue-specific, and the expression levels were higher in green tissues (leaves and stems) than in roots. MsZEP expression decreased in shoots under drought, cold, heat and ABA treatment, while the expression levels in roots showed different trends. Besides, the results showed that nodules could up-regulate the MsZEP expression under non-stressful conditions and in the earlier stage of different abiotic stress. Heterologous expression of the MsZEP gene in N. tabacum could confer tolerance to drought and salt stress by affecting various physiological pathways, ABA levels and stress-responsive genes expression. Taken together, these results suggested that the MsZEP gene may be involved in alfalfa responses to different abiotic stresses and nodules, and could enhance drought and salt tolerance of transgenic tobacco by heterologous expression.

2nd conference on Continuous Media with Microstructure

CERN Document Server

Kuczma, Mieczysław

2016-01-01

This book presents research advances in the field of Continuous Media with Microstructure and considers the three complementary pillars of mechanical sciences: theory, research and computational simulation. It focuses on the following problems: thermodynamic and mathematical modeling of materials with extensions of classical constitutive laws, single and multicomponent media including modern multifunctional materials, wave propagation, multiscale and multiphysics processes, phase transformations, and porous, granular and composite materials. The book presents the proceedings of the 2nd Conference on Continuous Media with Microstructure, which was held in 2015 in Łagów, Poland, in memory of Prof. Krzysztof Wilmański. .

Multidisciplinary Rectal Cancer Management: 2nd European Rectal Cancer Consensus Conference (EURECA-CC2)

International Nuclear Information System (INIS)

Valentini, Vincenzo; Aristei, Cynthia; Glimelius, Bengt; Minsky, Bruce D.; Beets-Tan, Regina; Borras, Jose M.; Haustermans, Karin; Maingon, Philippe; Overgaard, Jens; Pahlman, Lars; Quirke, Phil; Schmoll, Hans-Joachim; Sebag-Montefiore, David; Taylor, Irving; Van Cutsem, Eric; Velde, Cornelius Van de; Cellini, Numa; Latini, Paolo

2009-01-01

Background and purpose: During the first decade of the 21st century a number of important European randomized studies were published. In order to help shape clinical practice based on best scientific evidence from the literature, the International Conference on 'Multidisciplinary Rectal Cancer Treatment: Looking for an European Consensus' (EURECA-CC2) was organized in Italy under the endorsement of European Society of Medical Oncology (ESMO), European Society of Surgical Oncology (ESSO), and European Society of Therapeutic Radiation Oncology (ESTRO). Methods: Consensus was achieved using the Delphi method. The document was available to all Committee members as a web-based document customized for the consensus process. Eight chapters were identified: epidemiology, diagnostics, pathology, surgery, radiotherapy and chemotherapy, treatment toxicity and quality of life, follow-up, and research questions. Each chapter was subdivided by a topic, and a series of statements were developed. Each member commented and voted, sentence by sentence thrice. Sentences upon which an agreement was not reached after voting round no. 2 were openly debated during a Consensus Conference in Perugia (Italy) from 11 December to 13 December 2008. A hand-held televoting system collected the opinions of both the Committee members and the audience after each debate. The Executive Committee scored percentage consensus based on three categories: 'large consensus', 'moderate consensus', and 'minimum consensus'. Results: The total number of the voted sentences was 207. Of the 207, 86% achieved large consensus, 13% achieved moderate consensus, and only 3 (1%) resulted in minimum consensus. No statement was disagreed by more than 50% of the members. All chapters were voted on by at least 75% of the members, and the majority was voted on by >85%. Conclusions: This Consensus Conference represents an expertise opinion process that may help shape future programs, investigational protocols, and guidelines

Selected Papers and Presentations Presented at MODSIM World 2010 Conference Expo. Part 2

Science.gov (United States)

Pinelli, Thomas E. (Editor)

2011-01-01

MODSIM World 2010 was held in Hampton, Virginia, October 13-15, 2010. The theme of the 2010 conference & expo was "21st Century Decision-Making: The Art of Modeling& Simulation". The conference program consisted of seven technical tracks - Defense, Engineering and Science, Health & Medicine, Homeland Security & First Responders, The Human Dimension, K-20 STEM Education, and Serious Games & Virtual Worlds. Selected papers and presentations from MODSIM World 2010 Conference & Expo are contained in this NASA Conference Publication (CP). Section 8.0 of this CP contains papers from MODSIM World 2009 Conference & Expo that were unavailable at the time of publication of NASA/CP-2010-216205 Selected Papers Presented at MODSIM World 2009 Conference and Expo, March 2010.

Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

Science.gov (United States)

Roten, C A; Brandt, C; Karamata, D

1991-04-01

Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

Second international conference on isotopes. Conference proceedings

Energy Technology Data Exchange (ETDEWEB)

Hardy, C J [ed.

1997-10-01

The Second International Conference on Isotopes (2ICI) was hosted by the Australian Nuclear Association in Sydney, NSW, Australia. The Theme of the Second Conference: Isotopes for Industry, Health and a Better Environment recognizes that isotopes have been used in these fields successfully for many years and offer prospects for increasing use in the future. The worldwide interest in the use of research reactors and accelerators and in applications of stable and radioactive isotopes, isotopic techniques and radiation in industry, agriculture, medicine, environmental studies and research in general, was considered. Other radiation issues including radiation protection and safety were also addressed. International and national overviews and subject reviews invited from leading experts were included to introduce the program of technical sessions. The invited papers were supported by contributions accepted from participants for oral and poster presentation. A Technical Exhibition was held in association with the Conference. This volume contains the full text or extended abstracts of papers number 61- to number 114

2nd European Conference on Data Analysis

CERN Document Server

Wilhelm, Adalbert FX

2016-01-01

This book offers a snapshot of the state-of-the-art in classification at the interface between statistics, computer science and application fields. The contributions span a broad spectrum, from theoretical developments to practical applications; they all share a strong computational component. The topics addressed are from the following fields: Statistics and Data Analysis; Machine Learning and Knowledge Discovery; Data Analysis in Marketing; Data Analysis in Finance and Economics; Data Analysis in Medicine and the Life Sciences; Data Analysis in the Social, Behavioural, and Health Care Sciences; Data Analysis in Interdisciplinary Domains; Classification and Subject Indexing in Library and Information Science. The book presents selected papers from the Second European Conference on Data Analysis, held at Jacobs University Bremen in July 2014. This conference unites diverse researchers in the pursuit of a common topic, creating truly unique synergies in the process.

Identification of candidate new cancer susceptibility genes using yeast genomics

International Nuclear Information System (INIS)

Brown, M.; Brown, J.A.; Game, J.C.

2003-01-01

A large proportion of cancer susceptibility syndromes are the result of mutations in genes in DNA repair or in cell-cycle checkpoints in response to DNA damage, such as ataxia telangiectasia (AT), Fanconi's anemia (FA), Bloom's syndrome (BS), Nijmegen breakage syndrome (NBS), and xeroderma pigmentosum (XP). Mutations in these genes often cause gross chromosomal instability leading to an increased mutation rate of all genes including those directly responsible for cancer. We have proposed that because the orthologs of these genes in budding yeast, S. cerevisiae, confer protection against killing by DNA damaging agents it should be possible to identify new cancer susceptibility genes by identifying yeast genes whose deletion causes sensitivity to DNA damage. We therefore screened the recently completed collection of individual gene deletion mutants to identify genes that affect sensitivity to DNA-damaging agents. Screening for sensitivity in this obtained up to now with the F98 glioma model othe fact that each deleted gene is replaced by a cassette containing two molecular 'barcodes', or 20-mers, that uniquely identify the strain when DNA from a pool of strains is hybridized to an oligonucleotide array containing the complementary sequences of the barcodes. We performed the screen with UV, IR, H 2 0 2 and other DNA damaging agents. In addition to identifying genes already known to confer resistance to DNA damaging agents we have identified, and individually confirmed, several genes not previously associated with resistance. Several of these are of unknown function. We have also examined the chromosomal stability of selected strains and found that IR sensitive strains often but not always exhibit genomic instability. We are presently constructing a yeast artificial chromosome to globally interrogate all the genes in the deletion pool for their involvement in genomic stability. This work shows that budding yeast is a valuable eukaryotic model organism to identify

Mechanisms Involved in Acquisition of blaNDM Genes by IncA/C2 and IncFIIY Plasmids.

Science.gov (United States)

Wailan, Alexander M; Sidjabat, Hanna E; Yam, Wan Keat; Alikhan, Nabil-Fareed; Petty, Nicola K; Sartor, Anna L; Williamson, Deborah A; Forde, Brian M; Schembri, Mark A; Beatson, Scott A; Paterson, David L; Walsh, Timothy R; Partridge, Sally R

2016-07-01

blaNDM genes confer carbapenem resistance and have been identified on transferable plasmids belonging to different incompatibility (Inc) groups. Here we present the complete sequences of four plasmids carrying a blaNDM gene, pKP1-NDM-1, pEC2-NDM-3, pECL3-NDM-1, and pEC4-NDM-6, from four clinical samples originating from four different patients. Different plasmids carry segments that align to different parts of the blaNDM region found on Acinetobacter plasmids. pKP1-NDM-1 and pEC2-NDM-3, from Klebsiella pneumoniae and Escherichia coli, respectively, were identified as type 1 IncA/C2 plasmids with almost identical backbones. Different regions carrying blaNDM are inserted in different locations in the antibiotic resistance island known as ARI-A, and ISCR1 may have been involved in the acquisition of blaNDM-3 by pEC2-NDM-3. pECL3-NDM-1 and pEC4-NDM-6, from Enterobacter cloacae and E. coli, respectively, have similar IncFIIY backbones, but different regions carrying blaNDM are found in different locations. Tn3-derived inverted-repeat transposable elements (TIME) appear to have been involved in the acquisition of blaNDM-6 by pEC4-NDM-6 and the rmtC 16S rRNA methylase gene by IncFIIY plasmids. Characterization of these plasmids further demonstrates that even very closely related plasmids may have acquired blaNDM genes by different mechanisms. These findings also illustrate the complex relationships between antimicrobial resistance genes, transposable elements, and plasmids and provide insights into the possible routes for transmission of blaNDM genes among species of the Enterobacteriaceae family. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

The learning conference

DEFF Research Database (Denmark)

Ravn, Ib

little support amongst serious students of learning. The professional conference as a forum for knowledge sharing is in dire need of a new learning theory and a more enlightened practice. The notion of human flourishing is offered as basis for theory, and four simple design principles for the so......The typical one-day conference attended by managers or professionals in search of inspiration is packed with PowerPoint presentations and offers little opportunity for involvement or knowledge sharing. Behind the conventional conference format lurks the transfer model of learning, which finds......-called “learning conference” are proposed: People go to conferences to 1. get concise input, 2. interpret it in the light of their ongoing concerns, 3. talk about their current projects and 4. meet the other attendees and be inspired by them. Six practical techniques that induce attendees to do these things...

fter the Dark Ages: When Galaxies Were Young (The Universe at 2Conference. Proceedings

International Nuclear Information System (INIS)

Holt, S.S.; Smith, E.P.

1999-01-01

These proceedings represent papers presented at the 9th Astrophysics Conference held in College Park, Maryland, USA, in October, 1998. The topic chosen for this conference was ''The Universe at 2< z<5: After the Dark Ages, When Galaxies Were Young.'' Various aspects of cosmology including the cosmic microwave background, quasars, galactic bulges, dark matter, primordial protostellar clouds, galaxy evolution and mergers were discussed. Gamma ray bursts formed a special topic of discussion at the Conference. There were 61 papers presented at the conference,out of which 3 have been abstracted for the Energy,Science and Technology database

2nd International Conference on Intelligent Technologies and Engineering Systems

CERN Document Server

Chen, Cheng-Yi; Yang, Cheng-Fu

2014-01-01

This book includes the original, peer reviewed research papers from the 2nd International Conference on Intelligent Technologies and Engineering Systems (ICITES2013), which took place on December 12-14, 2013 at Cheng Shiu University in Kaohsiung, Taiwan. Topics covered include: laser technology, wireless and mobile networking, lean and agile manufacturing, speech processing, microwave dielectrics, intelligent circuits and systems, 3D graphics, communications, and structure dynamics and control.

2nd Interdiciplinary Conference on Production, Logistics and Traffic 2015

CERN Document Server

Friedrich, Hanno; Thaller, Carina; Geiger, Christiane

2016-01-01

This contributed volume contains the selected and reviewed papers of the 2nd Interdisciplinary Conference on Production, Logistics and Traffic (ICPLT) 2015, Dortmund, Germany. The topical focus lies on economic, ecological and societal issues related to commercial transport. The authors are international experts and the paper collection presents the state-of-the-art in the field, thus making this book a valuable read for both practitioners and researchers.

Coordinated Regulation of Anthocyanin Biosynthesis Genes Confers Varied Phenotypic and Spatial-Temporal Anthocyanin Accumulation in Radish (Raphanus sativus L.

Directory of Open Access Journals (Sweden)

Everlyne M'mbone Muleke

2017-07-01

Full Text Available Anthocyanins are natural pigments that have important functions in plant growth and development. Radish taproots are rich in anthocyanins which confer different taproot colors and are potentially beneficial to human health. The crop differentially accumulates anthocyanin during various stages of growth, yet molecular mechanisms underlying this differential anthocyanin accumulation remains unknown. In the present study, transcriptome analysis was used to concisely identify putative genes involved in anthocyanin biosynthesis in radish. Spatial-temporal transcript expressions were then profiled in four color variant radish cultivars. From the total transcript sequences obtained through illumina sequencing, 102 assembled unigenes, and 20 candidate genes were identified to be involved in anthocyanin biosynthesis. Fifteen genomic sequences were isolated and sequenced from radish taproot. The length of these sequences was between 900 and 1,579 bp, and the unigene coverage to all of the corresponding cloned sequences was more than 93%. Gene structure analysis revealed that RsF3′H is intronless and anthocyanin biosynthesis genes (ABGs bear asymmetrical exons, except RsSAM. Anthocyanin accumulation showed a gradual increase in the leaf of the red radish and the taproot of colored cultivars during development, with a rapid increase at 30 days after sowing (DAS, and the highest content at maturity. Spatial-temporal transcriptional analysis of 14 genes revealed detectable expressions of 12 ABGs in various tissues at different growth levels. The investigation of anthocyanin accumulation and gene expression in four color variant radish cultivars, at different stages of development, indicated that total anthocyanin correlated with transcript levels of ABGs, particularly RsUFGT, RsF3H, RsANS, RsCHS3 and RsF3′H1. Our results suggest that these candidate genes play key roles in phenotypic and spatial-temporal anthocyanin accumulation in radish through

Technology 2003: The Fourth National Technology Transfer Conference and Exposition, volume 2

Science.gov (United States)

Hackett, Michael (Compiler)

1994-01-01

Proceedings from symposia of the Technology 2003 Conference and Exposition, Dec. 7-9, 1993, Anaheim, CA, are presented. Volume 2 features papers on artificial intelligence, CAD&E, computer hardware, computer software, information management, photonics, robotics, test and measurement, video and imaging, and virtual reality/simulation.

Proceedings of the 2. IASTED international conference on advanced technology in the environmental field

International Nuclear Information System (INIS)

Ubertini, L.

2006-01-01

This international conference provided a forum for representatives from academic institutions, government agencies, and industries to discuss emerging technologies in the environmental field. Recent developments in physico-chemical remediation technologies were reviewed, as well as strategies related to waste water treatment in urban and coastal regions. Advances in bio-plastics and bio-hydrogen production were also discussed along with various bioremediation techniques. Strategies related to urban drainage and wetland management were presented together with issues related to energy efficiency and ecological sustainability. The conference was divided into 6 sections: (1) wastewater treatment and reuse; (2) biotechnology, bioremediation and biomass; (3) integrated water resources management; (4) alternative energy systems; (5) decision support tools; and (6) groundwater and soil remediation. The conference featured 48 presentations, of which 9 have been catalogued separately for inclusion in this database. refs., tabs., figs

Proceedings of the 2. IASTED international conference on advanced technology in the environmental field

Energy Technology Data Exchange (ETDEWEB)

Ubertini, L. [IRPI National Research Council, Rome (Italy)] (ed.)

2006-07-01

This international conference provided a forum for representatives from academic institutions, government agencies, and industries to discuss emerging technologies in the environmental field. Recent developments in physico-chemical remediation technologies were reviewed, as well as strategies related to waste water treatment in urban and coastal regions. Advances in bio-plastics and bio-hydrogen production were also discussed along with various bioremediation techniques. Strategies related to urban drainage and wetland management were presented together with issues related to energy efficiency and ecological sustainability. The conference was divided into 6 sections: (1) wastewater treatment and reuse; (2) biotechnology, bioremediation and biomass; (3) integrated water resources management; (4) alternative energy systems; (5) decision support tools; and (6) groundwater and soil remediation. The conference featured 48 presentations, of which 9 have been catalogued separately for inclusion in this database. refs., tabs., figs.

Hunting for genes for hypertension: the Millennium Genome Project for Hypertension.

Science.gov (United States)

Tabara, Yasuharu; Kohara, Katsuhiko; Miki, Tetsuro

2012-06-01

The Millennium Genome Project for Hypertension was started in 2000 to identify genetic variants conferring susceptibility to hypertension, with the aim of furthering the understanding of the pathogenesis of this condition and realizing genome-based personalized medical care. Two different approaches were launched, genome-wide association analysis using single-nucleotide polymorphisms (SNPs) and microsatellite markers, and systematic candidate gene analysis, under the hypothesis that common variants have an important role in the etiology of common diseases. These multilateral approaches identified ATP2B1 as a gene responsible for hypertension in not only Japanese but also Caucasians. The high blood pressure susceptibility conferred by certain alleles of ATP2B1 has been widely replicated in various populations. Ex vivo mRNA expression analysis in umbilical artery smooth muscle cells indicated that reduced expression of this gene associated with the risk allele may be an underlying mechanism relating the ATP2B1 variant to hypertension. However, the effect size of a SNP was too small to clarify the entire picture of the genetic basis of hypertension. Further, dense genome analysis with accurate phenotype data may be required.

Expression of an insulin/interleukin-1 receptor antagonist hybrid gene in insulin-producing cell lines (HIT-T15 and NIT-1) confers resistance against interleukin-1-induced nitric oxide production.

Science.gov (United States)

Welsh, N; Bendtzen, K; Welsh, M

1995-01-01

A hybrid gene consisting of the insulin gene enhancer/promoter region, the signal sequence, the insulin B- and C-chains, and the human interleukin-1 receptor antagonist (IL-1ra) gene was constructed. This hybrid gene was transfected together with the pSV2-neo construct into the insulin-producing cell lines HIT-T15 and NIT-1. One of the geneticin-selected clones, HITra2, expressed a 1.4-kb mRNA, which hybridized both to insulin and IL-1ra-cDNA in Northern blot analysis. Three proteins, with the mol wt 23, 17, and 14 kD, were immunoprecipitated with anti-IL-1ra antibodies from [35S]methionine-labeled HITra2 cells. Both at a low and at a high glucose concentration, 4-5 ng of IL-1ra/10(6) cells (ELISA) was released from these cells. On the other hand, a high glucose concentration evoked a three-fold increase in the release of insulin, suggesting that IL-1ra was released constitutively. Measured by nitrite production, transfected HIT, and NIT-1 cells exhibited a more than 10-fold decrease in IL-1 beta sensitivity. Since the conditioned culture media from the HITra2 cells exhibited an anti-IL-1 beta activity of only 0.5 U/ml, and mixed culture of HITra2 cells and isolated rat islets prevented IL-1 beta induced inhibition of insulin release, it is likely that IL-1ra acts locally at the cell surface. It is concluded that expression of a hybrid insulin/IL-1ra gene confers resistance to IL-1 and that this technique may be used to elucidate the role of IL-1 in autoimmune disorders such as insulin-dependent diabetes mellitus. Images PMID:7706480

Properties of Cells Carrying the Herpes Simplex Virus Type 2 Thymidine Kinase Gene: Mechanisms of Reversion to a Thymidine Kinase-Negative Phenotype

Science.gov (United States)

Bastow, K. F.; Darby, G.; Wildy, P.; Minson, A. C.

1980-01-01

We have isolated cells with a thymidine kinase-negative (tk−) phenotype from cells which carry the herpes simplex virus type 2 tk gene by selection in 5-bromodeoxyuridine or 9-(2-hydroxyethoxymethyl)guanine. Both selection routines generated revertants with a frequency of 10−3 to 10−4, and resistance to either compound conferred simultaneous resistance to the other. tk− revertants fell into three classes: (i) cells that arose by deletion of all virus sequences, (ii) cells that had lost the virus tk gene but retained a nonselected virus-specific function and arose by deletion of part of the virus-specific sequence, and (iii) cells that retained the potential to express all of the virus-specific functions of the parental cells and retained all of the virus-specific DNA sequences. Images PMID:16789205

Molecular characterisation of the broad-spectrum resistance to powdery mildew conferred by the Stpk-V gene from the wild species Haynaldia villosa.

Science.gov (United States)

Qian, C; Cui, C; Wang, X; Zhou, C; Hu, P; Li, M; Li, R; Xiao, J; Wang, X; Chen, P; Xing, L; Cao, A

2017-11-01

A key member of the Pm21 resistance gene locus, Stpk-V, derived from Haynaldia villosa, was shown to confer broad-spectrum resistance to wheat powdery mildew. The present study was planned to investigate the resistance mechanism mediated by Stpk-V. Transcriptome analysis was performed in Stpk-V transgenic plants and recipient Yangmai158 upon Bgt infection, and detailed histochemical observations were conducted. Chromosome location of Stpk-V orthologous genes in Triticeae species was conducted for evolutionary study and over-expression of Stpk-V both in barley and Arabidopsis was performed for functional study. The transcriptome results indicate, at the early infection stage, the ROS pathway, JA pathway and some PR proteins associated with the SA pathway were activated in both the resistant Stpk-V transgenic plants and susceptible Yangmai158. However, at the later infection stage, the genes up-regulated at the early stage were continuously held only in the transgenic plants, and a large number of new genes were also activated in the transgenic plants but not in Yangmai158. Results indicate that sustained activation of the early response genes combined with later-activated genes mediated by Stpk-V is critical for resistance in Stpk-V transgenic plants. Stpk-V orthologous genes in the representative grass species are all located on homologous group six chromosomes, indicating that Stpk-V is an ancient gene in the grasses. Over-expression of Stpk-V enhanced host resistance to powdery mildew in barley but not in Arabidopsis. Our results enable a better understanding of the resistance mechanism mediated by Stpk-V, and establish a solid foundation for its use in cereal breeding as a gene resource. © 2017 German Society for Plant Sciences and The Royal Botanical Society of the Netherlands.

Mendel conference

CERN Document Server

2015-01-01

This book is a collection of selected accepted papers of Mendel conference that has been held in Brno, Czech Republic in June 2015. The book contents three chapters which represent recent advances in soft computing including intelligent image processing and bio-inspired robotics.: Chapter 1: Evolutionary Computing, and Swarm intelligence, Chapter 2: Neural Networks, Self-organization, and Machine Learning, and Chapter3: Intelligent Image Processing, and Bio-inspired Robotics. The Mendel conference was established in 1995, and it carries the name of the scientist and Augustinian priest Gregor J. Mendel who discovered the famous Laws of Heredity. In 2015 we are commemorating 150 years since Mendel's lectures, which he presented in Brno on February and March 1865. The main aim of the conference was to create a periodical possibility for students, academics and researchers to exchange their ideas and novel research methods.  .

PET/CT imaging of human somatostatin receptor 2 (hsstr2) as reporter gene for gene therapy

International Nuclear Information System (INIS)

Hofmann, M.; Gazdhar, A.; Weitzel, T.; Schmid, R.; Krause, T.

2006-01-01

Localized information on region-selective gene expression in small animals is widely obtained by use of reporter genes inducing light emission. Using these reporter genes for imaging deep inside the human body fluorescent probes are hindered by attenuation, scattering and possible fluorescence quenching. This can be overcome by use of radio-peptide receptors as reporter genes. Therefore, the feasibility of the somatostatin receptor 2 expression vector system for expression imaging was checked against a control vector containing luciferase gene. For in vivo transduction of vector DNA into the rat forelimb muscles the in vivo electroporation technique was chosen because of its high regio-selectivity. The gene expression was imaged by high-sensitive CCD camera (luciferase activity) and by PET/CT using a Ga-68-DOTATOC as radio peptide probe. The relative sstr2 expression was enhanced by gene transduction at maximum to a factor of 15. The PET/CT images could be fully quantified. The above demonstrated feasibility of radio-peptide PET/CT reporter gene imaging may serve in the future as a tool for full quantitative understanding of regional gene expression, especially in large animals and humans

PET/CT imaging of human somatostatin receptor 2 (hsstr2) as reporter gene for gene therapy

Energy Technology Data Exchange (ETDEWEB)

Hofmann, M. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland)]. E-mail: Michael.Hofmann@insel.ch; Gazdhar, A. [Division of Pulmonary Medicine, University Hospital Bern (Switzerland); Weitzel, T. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland); Schmid, R. [Division of Thoracic Surgery, University Hospital Bern (Switzerland); Krause, T. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland)

2006-12-20

Localized information on region-selective gene expression in small animals is widely obtained by use of reporter genes inducing light emission. Using these reporter genes for imaging deep inside the human body fluorescent probes are hindered by attenuation, scattering and possible fluorescence quenching. This can be overcome by use of radio-peptide receptors as reporter genes. Therefore, the feasibility of the somatostatin receptor 2 expression vector system for expression imaging was checked against a control vector containing luciferase gene. For in vivo transduction of vector DNA into the rat forelimb muscles the in vivo electroporation technique was chosen because of its high regio-selectivity. The gene expression was imaged by high-sensitive CCD camera (luciferase activity) and by PET/CT using a Ga-68-DOTATOC as radio peptide probe. The relative sstr2 expression was enhanced by gene transduction at maximum to a factor of 15. The PET/CT images could be fully quantified. The above demonstrated feasibility of radio-peptide PET/CT reporter gene imaging may serve in the future as a tool for full quantitative understanding of regional gene expression, especially in large animals and human000.

2nd International Conference on Mechatronics and Robotics Engineering

CERN Document Server

Wei, Bin

2017-01-01

Featuring selected contributions from the 2nd International Conference on Mechatronics and Robotics Engineering, held in Nice, France, February 18–19, 2016, this book introduces recent advances and state-of-the-art technologies in the field of advanced intelligent manufacturing. This systematic and carefully detailed collection provides a valuable reference source for mechanical engineering researchers who want to learn about the latest developments in advanced manufacturing and automation, readers from industry seeking potential solutions for their own applications, and those involved in the robotics and mechatronics industry.

Duplications of the Neuropeptide Receptor VIPR2 Confer Significant Risk for Schizophrenia

OpenAIRE

Vacic, Vladimir; McCarthy, Shane; Malhotra, Dheeraj; Murray, Fiona; Chou, Hsun-Hua; Peoples, Aine; Makarov, Vladimir; Yoon, Seungtai; Bhandari, Abhishek; Corominas, Roser; Iakoucheva, Lilia M.; Krastoshevsky, Olga; Krause, Verena; Larach-Walters, Verónica; Welsh, David K.

2011-01-01

PUBLISHED PMID:21346763 Rare copy number variants (CNVs) play a prominent role in the etiology of schizophrenia and other neuropsychiatric disorders 1 . Substantial risk for schizophrenia is conferred by large (>500 kb) CNVs at several loci, including microdeletions at 1q21.1 2 , 3q29 3 , 15q13.3 2 and 22q11.2 4 and microduplication at 16p11.2 5 . However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant ...

Proceedings of the environmental technology through industry partnership conference. Volume 2

Energy Technology Data Exchange (ETDEWEB)

Kothari, V.P.

1995-10-01

The overall objective of this conference was to review the latest environmental and waste management technologies being developed under the sponsorship of METC. The focus of this conference was also to address the accomplishments and barriers affecting private sector, and lay the groundwork for future technology development initiatives and opportunities. 26 presentations were presented in: Mixed waste characterization, treatment, and disposal; Contaminant plume containment and remediation; and Decontamination and decommissioning. In addition there were 10 Focus Area presentations, 31 Poster papers covering all Focus Areas, and two panel discussions on: Mixed waste characterization, treatment, and disposal issues; and the Application, evaluation, and acceptance of in-situ and ex-situ plume remediation technologies. Volume 2 contains 16 papers in a poster session and 8 papers in the contaminant plume containment and remediation and landfill stabilization Focus Areas. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database.

Proceedings of the fifth international conference on CANDU fuel. V.1,2

International Nuclear Information System (INIS)

Lau, J.H.

1997-01-01

The First International Conference on CANDU Fuel was held in Chalk River in 1986. The CANDU Fuel community has gathered every three years since. The papers presented include topics on international experience, CANFLEX fuel bundles, Fuel design, Fuel modelling, Manufacturing and Quality assurance, Fuel performance and Safety, Fuel cycles and Spent Fuel management. Volume One was published in advance of the conference and Volume Two was printed after the conference

Proceedings of the fifth international conference on CANDU fuel. V.1,2

Energy Technology Data Exchange (ETDEWEB)

Lau, J H [ed.

1997-07-01

The First International Conference on CANDU Fuel was held in Chalk River in 1986. The CANDU Fuel community has gathered every three years since. The papers presented include topics on international experience, CANFLEX fuel bundles, Fuel design, Fuel modelling, Manufacturing and Quality assurance, Fuel performance and Safety, Fuel cycles and Spent Fuel management. Volume One was published in advance of the conference and Volume Two was printed after the conference.

2012 Gordon Research Conference on Microbial Stress Response, Schedule and Speaker/Poster Program

Energy Technology Data Exchange (ETDEWEB)

Donohue, Timothy J. [Univ. of Wisconsin, Madison, WI (United States)

2012-07-20

The Gordon Research Conference on Microbial Stress Response was held at Mount Holyoke College, South Hadley, Massachusetts, July 15-20, 2012. The Conference was well-attended with 180 participants. The 2012 Microbial Stress Responses Gordon Research Conference will provide a forum for the open reporting of recent discoveries on the diverse mechanisms employed by microbes to respond to stress. Approaches range from analysis at the molecular level (how are signals perceived and transmitted to change gene expression or function) to cellular and microbial community responses. Attached is a copy of the formal schedule and speaker program and the poster program.

Preface: 2nd International Conference on Structural Nano Composites (NANOSTRUC2014)

International Nuclear Information System (INIS)

Njuguna, J; Verdejo, R

2014-01-01

The NANOSTRUC 2014 took place at CSIC, Madrid, Spain. The conference theme on 'Nanosciences and Nanotechnologies – Recent Advances towards Nanoproducts and Applications'. The conference aimed to promote activities in various areas of materials and structures by providing a forum for exchange of ideas, presentation of technical achievements and discussion of future directions. NANOSTRUC conferences brings together an international community of experts to discuss the state-of-the-art, new research results, perspectives of future developments, and innovative applications relevant to structural materials, engineering structures, nanocomposites, modelling and simulations, and their related application areas

2008 Co2 Assimilation in Plants: Genome to Biome Gordon Research Conference - August 17-22

Energy Technology Data Exchange (ETDEWEB)

James V. Maroney

2009-08-12

Formerly entitled 'CO2 Fixation and Metabolism in Green Plants', this long-standing Gordon Research Conference has been held on a triennial basis since 1976. In 1990 the participants decided to alternate between sites in the U.S. and outside the U.S. The 2005 conference was held in Europe at the Centre Paul Langevin in Aussois, France, so the 2008 conference returns to a U.S. site - the University of New England in Biddeford, Maine. The 2008 conference covers basic plant research related to photosynthesis and the subsequent regulation and engineering of carbon assimilation. Approaches that range from post-genomic technologies and systems biology, through to fundamental biochemistry, physiology and molecular biology are integrated within ecological and agronomic contexts. As such, the meeting provides the rare opportunity of a single venue for discussing all aspects of the 'carbon-side' of photosynthesis - from genome to biome. The 2008 conference will include an emphasis on the central role of carbon assimilation by plants for developing new sources of bioenergy and for achieving a carbon-neutral planet. A special characteristic of this conference is its 'intimacy' with approximately 110 conferees, ranging from beginning graduate students and postdoctoral associates to leading senior plant scientists, engaged in open and forward-thinking discussions in an informal, friendly setting. With extended time devoted to discussion, and the encouragement to challenge dogma, it is unlike other meetings in the U.S. or abroad. Another novel feature of the conference is a session devoted to the latest 'hot off the press' findings by both established and early career scientists, picked from the abstracts. Together with an expanded poster discussion in the evening sessions, this session provides an opportunity for early career scientists to present interesting new data and to 'test drive' hypotheses in a collegial atmosphere.

Bridging cancer biology with the clinic: relative expression of a GRHL2-mediated gene-set pair predicts breast cancer metastasis.

Directory of Open Access Journals (Sweden)

Xinan Yang

Full Text Available Identification and characterization of crucial gene target(s that will allow focused therapeutics development remains a challenge. We have interrogated the putative therapeutic targets associated with the transcription factor Grainy head-like 2 (GRHL2, a critical epithelial regulatory factor. We demonstrate the possibility to define the molecular functions of critical genes in terms of their personalized expression profiles, allowing appropriate functional conclusions to be derived. A novel methodology, relative expression analysis with gene-set pairs (RXA-GSP, is designed to explore the potential clinical utility of cancer-biology discovery. Observing that Grhl2-overexpression leads to increased metastatic potential in vitro, we established a model assuming Grhl2-induced or -inhibited genes confer poor or favorable prognosis respectively for cancer metastasis. Training on public gene expression profiles of 995 breast cancer patients, this method prioritized one gene-set pair (GRHL2, CDH2, FN1, CITED2, MKI67 versus CTNNB1 and CTNNA3 from all 2717 possible gene-set pairs (GSPs. The identified GSP significantly dichotomized 295 independent patients for metastasis-free survival (log-rank tested p = 0.002; severe empirical p = 0.035. It also showed evidence of clinical prognostication in another independent 388 patients collected from three studies (log-rank tested p = 3.3e-6. This GSP is independent of most traditional prognostic indicators, and is only significantly associated with the histological grade of breast cancer (p = 0.0017, a GRHL2-associated clinical character (p = 6.8e-6, Spearman correlation, suggesting that this GSP is reflective of GRHL2-mediated events. Furthermore, a literature review indicates the therapeutic potential of the identified genes. This research demonstrates a novel strategy to integrate both biological experiments and clinical gene expression profiles for extracting and elucidating the genomic

Additional mechanisms conferring genetic susceptibility to Alzheimer's disease

Directory of Open Access Journals (Sweden)

Miguel eCalero

2015-04-01

Full Text Available Familial Alzheimer's disease (AD, mostly associated with early onset, is caused by mutations in three genes (APP, PSEN1 and PSEN2 involved in the production of the amyloid  peptide. In contrast, the molecular mechanisms that trigger the most common late onset sporadic AD remain largely unknown. With the implementation of an increasing number of case-control studies and the upcoming of large-scale genome-wide association studies (GWAS there is a mounting list of genetic risk factors associated to common genetic variants that have been associated to sporadic AD. Besides APOE, that presents a strong association with the disease (OR~4, the rest of these genes have moderate or low degrees of association, with OR ranging from 0.88 to 1.23. Taking together, these genes may account only for a fraction of the attributable AD risk and therefore, rare variants and epistastic gene interactions should be taken into account in order to get the full picture of the genetic risks associated to AD. Here, we review recent whole-exome studies looking for rare variants, somatic brain mutations with a strong association to the disease, and several studies dealing with epistasis as additional mechanisms conferring genetic susceptibility to AD. Altogether, recent evidence underlines the importance of defining molecular and genetic pathways and networks rather than the contribution of specific genes.

2003 Plant Cell Walls Gordon Conference

Energy Technology Data Exchange (ETDEWEB)

Daniel J. Cosgrove

2004-09-21

This conference will address recent progress in many aspects of cell wall biology. Molecular, genetic, and genomic approaches are yielding major advances in our understanding of the composition, synthesis, and architecture of plant cell walls and their dynamics during growth, and are identifying the genes that encode the machinery needed to make their biogenesis possible. This meeting will bring together international scientists from academia, industry and government labs to share the latest breakthroughs and perspectives on polysaccharide biosynthesis, wood formation, wall modification, expansion and interaction with other organisms, and genomic & evolutionary analyses of wall-related genes, as well as to discuss recent ''nanotechnological'' advances that take wall analysis to the level of a single cell.

Expression of the grape VqSTS21 gene in Arabidopsis confers resistance to osmotic stress and biotrophic pathogens but not Botrytis cinerea

Directory of Open Access Journals (Sweden)

Li Huang

2016-09-01

Full Text Available Stilbene synthase (STS is a key gene in the biosynthesis of various stilbenoids, including resveratrol and its derivative glucosides (such as piceid, that has been shown to contribute to disease resistance in plants. However, the mechanism behind such a role has yet to be elucidated. Furthermore, the function of STS genes in osmotic stress tolerance remains unclear. As such, we sought to elucidate the role of STS genes in the defense against biotic and abiotic stress in the model plant Arabidopsis thaliana. Expression profiling of 31 VqSTS genes from Vitis quinquangularis revealed that VqSTS21 was up-regulated in response to powdery mildew (PM infection. To provide a deeper understanding of the function of this gene, we cloned the full-length coding sequence of VqSTS21 and overexpressed it in Arabidopsis thaliana via Agrobacterium-mediated transformation. The resulting VqSTS21 Arabidopsis lines produced trans-piceid rather than resveratrol as their main stilbenoid product and exhibited improved disease resistance to PM and Pseudomonas syringae pv. tomato DC3000, but displayed increased susceptibility to Botrytis cinerea. In addition, transgenic Arabidopsis lines were found to confer tolerance to salt and drought stress from seed germination through plant maturity. Intriguingly, qPCR assays of defense-related genes involved in salicylic acid, jasmonic acid, and abscisic acid-induced signaling pathways in these transgenic lines suggested that VqSTS21 plays a role in various phytohormone-related pathways, providing insight into the mechanism behind VqSTS21-mediated resistance to biotic and abiotic stress.

The identification of candidate rice genes that confer resistance to the brown planthopper (Nilaparvata lugens) through representational difference analysis.

Science.gov (United States)

Park, Dong-Soo; Lee, Sang-Kyu; Lee, Jong-Hee; Song, Min-Young; Song, Song-Yi; Kwak, Do-Yeon; Yeo, Un-Sang; Jeon, Nam-Soo; Park, Soo-Kwon; Yi, Gihwan; Song, You-Chun; Nam, Min-Hee; Ku, Yeon-Chung; Jeon, Jong-Seong

2007-08-01

The development of rice varieties (Oryza sativa L.) that are resistant to the brown planthopper (BPH; Nilaparvata lugens Stål) is an important objective in current breeding programs. In this study, we generated 132 BC(5)F(5) near-isogenic rice lines (NILs) by five backcrosses of Samgangbyeo, a BPH resistant indica variety carrying the Bph1 locus, with Nagdongbyeo, a BPH susceptible japonica variety. To identify genes that confer BPH resistance, we employed representational difference analysis (RDA) to detect transcripts that were exclusively expressed in one of our BPH resistant NIL, SNBC61, during insect feeding. The chromosomal mapping of the RDA clones that we subsequently isolated revealed that they are located in close proximity either to known quantitative trait loci or to an introgressed SSR marker from the BPH resistant donor parent Samgangbyeo. Genomic DNA gel-blot analysis further revealed that loci of all RDA clones in SNBC61 correspond to the alleles of Samgangbyeo. Most of the RDA clones were found to be exclusively expressed in SNBC61 and could be assigned to functional groups involved in plant defense. These RDA clones therefore represent candidate defense genes for BPH resistance.

NUCLEAR 2010 international conference on sustainable development through nuclear research and education.Part 2/2

International Nuclear Information System (INIS)

Turcu, Ilie

2010-01-01

The Proceedings of the 'NUCLEAR 2010 international conference on sustainable development through nuclear research and education' held at INR-Pitesti on May, 26 - 28 2010 contain communications published in two parts. The second part contains 34 talks adressing themes of nuclear energy, in the following three sections: Section 2.1 - Radioactive waste management (13 papers); Section 2.2 and 3 - Radioprotection and air, water and soil protection (12 papers); Section 3.1 - Strategies in energy (3 papers); Section 3.2 - Education, continuous formation, and knowledge transfer (1 paper); Section 3. - International Partnership for a sustainable development (2 papers); Section 3.4 - Research infrastructure (3 papers)

Two wheat glutathione peroxidase genes whose products are located in chloroplasts improve salt and H2O2 tolerances in Arabidopsis.

Directory of Open Access Journals (Sweden)

Chao-Zeng Zhai

Full Text Available Oxidative stress caused by accumulation of reactive oxygen species (ROS is capable of damaging effects on numerous cellular components. Glutathione peroxidases (GPXs, EC 1.11.1.9 are key enzymes of the antioxidant network in plants. In this study, W69 and W106, two putative GPX genes, were obtained by de novo transcriptome sequencing of salt-treated wheat (Triticum aestivum seedlings. The purified His-tag fusion proteins of W69 and W106 reduced H2O2 and t-butyl hydroperoxide (t-BHP using glutathione (GSH or thioredoxin (Trx as an electron donor in vitro, showing their peroxidase activity toward H2O2 and toxic organic hydroperoxide. GFP fluorescence assays revealed that W69 and W106 are localized in chloroplasts. Quantitative real-time PCR (Q-RT-PCR analysis showed that two GPXs were differentially responsive to salt, drought, H2O2, or ABA. Isolation of the W69 and W106 promoters revealed some cis-acting elements responding to abiotic stresses. Overexpression of W69 and W106 conferred strong tolerance to salt, H2O2, and ABA treatment in Arabidopsis. Moreover, the expression levels of key regulator genes (SOS1, RbohD and ABI1/ABI2 involved in salt, H2O2 and ABA signaling were altered in the transgenic plants. These findings suggest that W69 and W106 not only act as scavengers of H2O2 in controlling abiotic stress responses, but also play important roles in salt and ABA signaling.

76 FR 64083 - Reliability Technical Conference; Notice of Technical Conference

Science.gov (United States)

2011-10-17

... Technical Conference; Notice of Technical Conference Take notice that the Federal Energy Regulatory Commission will hold a Technical Conference on Tuesday, November 29, 2011, from 1 p.m. to 5 p.m. and... reliability that were identified in earlier Commission technical conferences. The conference also will discuss...

2nd International Conference on Electric and Electronics (EEIC 2012)

CERN Document Server

Advances in Electric and Electronics

2012-01-01

This volume contains 108 full length papers presented at the 2nd International Conference on Electric and Electronics (EEIC 2012), held on April 21-22 in Sanya, China, which brings together researchers working in many different areas of education and learning to foster international collaborations and exchange of new ideas. This volume can be divided into two sections on the basis of the classification of manuscripts considered: the first section deals with Electric and the second section with Electronics.

Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

Science.gov (United States)

Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

1988-01-01

We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

Science.gov (United States)

Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

1996-05-16

A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

Science.gov (United States)

Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

2007-07-10

Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

N-acetyltransferase Mpr1 confers ethanol tolerance on Saccharomyces cerevisiae by reducing reactive oxygen species

Energy Technology Data Exchange (ETDEWEB)

Du, Xiaoyi [Fukui Prefectural Univ., Fukui (Japan). Dept. of Bioscience; Takagi, Hiroshi [Nara Inst. of Science and Technology, Ikoma, Nara (Japan). Graduate School of Biological Sciences

2007-07-15

N-Acetyltransferase Mpr1 of Saccharomyces cerevisiae can reduce intracellular oxidation levels and protect yeast cells under oxidative stress, including H{sub 2}O{sub 2}, heat-shock, or freeze-thaw treatment. Unlike many antioxidant enzyme genes induced in response to oxidative stress, the MPR1 gene seems to be constitutively expressed in yeast cells. Based on a recent report that ethanol toxicity is correlated with the production of reactive oxygen species (ROS), we examined here the role of Mpr1 under ethanol stress conditions. The null mutant of the MPR1 and MPR2 genes showed hypersensitivity to ethanol stress, and the expression of the MPR1 gene conferred stress tolerance. We also found that yeast cells exhibited increased ROS levels during exposure to ethanol stress, and that Mpr1 protects yeast cells from ethanol stress by reducing intracellular ROS levels. When the MPR1 gene was overexpressed in antioxidant enzyme-deficient mutants, increased resistance to H{sub 2}O{sub 2} or heat shock was observed in cells lacking the CTA1, CTT1, or GPX1 gene encoding catalase A, catalase T, or glutathione peroxidase, respectively. These results suggest that Mpr1 might compensate the function of enzymes that detoxify H{sub 2}O{sub 2}. Hence, Mpr1 has promising potential for the breeding of novel ethanol-tolerant yeast strains. (orig.)

2nd International Conference on Natural Fibers

CERN Document Server

Rana, Sohel

2016-01-01

This book collects selected high quality articles submitted to the 2nd International Conference on Natural Fibers (ICNF2015). A wide range of topics is covered related to various aspects of natural fibres such as agriculture, extraction and processing, surface modification and functionalization, advanced structures, nano fibres, composites and nanocomposites, design and product development, applications, market potential, and environmental impact. Divided into separate sections on these various topics, the book presents the latest high quality research work addressing different approaches and techniques to improve processing, performance, functionalities and cost-effectiveness of natural fibre and natural based products, in order to promote their applications in various advanced technical sectors. This book is a useful source of information for materials scientists, teachers and students from various disciplines as well as for R& D staff in industries using natural fibre based materials. .

Sixteenth International Laser Radar Conference, Part 2

International Nuclear Information System (INIS)

Mccormick, M.P.

1992-07-01

Given here are extended abstracts of papers presented at the 16th International Laser Radar Conference, held in Cambridge, Massachusetts, July 20-24, 1992. Topics discussed include the Mt. Pinatubo volcanic dust laser observations, global change, ozone measurements, Earth mesospheric measurements, wind measurements, imaging, ranging, water vapor measurements, and laser devices and technology

2nd Rochester Conference on Superconductivity in D- and F- Band Metals

CERN Document Server

Superconductivity in d- and f- band metals

1976-01-01

The occurrence of superconductivity among the d- and f-band metals remains one of the unsolved problems of physics. The first Rochester conference on this subject in October 1971 brought together approximately 100 experimentalists and theorists, and that conference was considered successful; the published proceedings well-represented the current research at that time and has served as a "handbook" to many. In the four and one half years since the first conference, impressive progress has been made in many areas (although Berndt Matthias would be one of the first to point out that raising the m"aximum transition temperature by a significant amount was not one of them). For a variety of reasons, I decided that it was time for a Second Rochester Conference on Superconductivity in d- and f-Band Metals and it was held on April 30 and May 1, 1976. It would appear that this conference was even more successful judging from the quality of the talks and various comments made to me. I believe that this was due...

The Second Joint NASA/FAA/DoD Conference on Aging Aircraft. Part 2

Science.gov (United States)

Harris, Charles E. (Editor)

1999-01-01

The purpose of the Conference was to bring together world leaders in aviation safety research, aircraft design and manufacturing, fleet operation and aviation maintenance to disseminate information on current practices and advanced technologies that will assure the continued airworthiness of the aging aircraft in the military and commercial fleets. The Conference included reviews of current industry practices, assessments of future technology requirements, and status of aviation safety research. The Conference provided an opportunity for interactions among the key personnel in the research and technology development community, the original equipment manufacturers, commercial airline operators, military fleet operators, aviation maintenance, and aircraft certification and regulatory authorities. Conference participation was unrestricted and open to the international aviation community. Appendix B contains the name and addresses of the 623 participants in the Conference.

Quantitative genome re-sequencing defines multiple mutations conferring chloroquine resistance in rodent malaria

Science.gov (United States)

2012-01-01

Background Drug resistance in the malaria parasite Plasmodium falciparum severely compromises the treatment and control of malaria. A knowledge of the critical mutations conferring resistance to particular drugs is important in understanding modes of drug action and mechanisms of resistances. They are required to design better therapies and limit drug resistance. A mutation in the gene (pfcrt) encoding a membrane transporter has been identified as a principal determinant of chloroquine resistance in P. falciparum, but we lack a full account of higher level chloroquine resistance. Furthermore, the determinants of resistance in the other major human malaria parasite, P. vivax, are not known. To address these questions, we investigated the genetic basis of chloroquine resistance in an isogenic lineage of rodent malaria parasite P. chabaudi in which high level resistance to chloroquine has been progressively selected under laboratory conditions. Results Loci containing the critical genes were mapped by Linkage Group Selection, using a genetic cross between the high-level chloroquine-resistant mutant and a genetically distinct sensitive strain. A novel high-resolution quantitative whole-genome re-sequencing approach was used to reveal three regions of selection on chr11, chr03 and chr02 that appear progressively at increasing drug doses on three chromosomes. Whole-genome sequencing of the chloroquine-resistant parent identified just four point mutations in different genes on these chromosomes. Three mutations are located at the foci of the selection valleys and are therefore predicted to confer different levels of chloroquine resistance. The critical mutation conferring the first level of chloroquine resistance is found in aat1, a putative aminoacid transporter. Conclusions Quantitative trait loci conferring selectable phenotypes, such as drug resistance, can be mapped directly using progressive genome-wide linkage group selection. Quantitative genome-wide short

Conjugal transfer of aac(6')Ie-aph(2″)Ia gene from native species and mechanism of regulation and cross resistance in Enterococcus faecalis MCC3063 by real time-PCR.

Science.gov (United States)

Jaimee, G; Halami, P M

2017-09-01

High level aminoglycoside resistance (HLAR) in the lactic acid bacteria (LAB) derived from food animals is detrimental. The aim of this study was to investigate the localization and conjugal transfer of aminoglycoside resistance genes, aac(6')Ie-aph(2″)Ia and aph(3')IIIa in different Enterococcus species. The cross resistance patterns in Enterococcus faecalis MCC3063 to clinically important aminoglycosides by real time PCR were also studied. Southern hybridization experiments revealed the presence of aac(6')Ie-aph(2 ″ )Ia and aph(3')IIIa genes conferring HLAR in high molecular weight plasmids except in Lactobacillus plantarum. The plasmid encoded bifunctional aac(6')Ie-aph(2″)Ia gene was transferable from Enterococcus avium (n = 2), E. cecorum (n = 1), E. faecalis (n = 1) and Pediococcus lolii (n = 1) species into the recipient strain; E. faecalis JH2-2 by filter mating experiments thus indicating the possible risks of gene transfer into pathogenic strains. Molecular analysis of cross resistance patterns in native isolate of E. faecalis MCC3063 carrying aac(6')Ie-aph(2″)Ia and aph(3')IIIa gene was displayed by quantification of the mRNA levels in this study. For this, the culture was induced with increasing concentrations of gentamicin, kanamycin and streptomycin (2048, 4096, 8192, 16384 μg/mL) individually. The increasing concentrations of gentamicin and kanamycin induced the expression of the aac(6')Ie-aph(2″)Ia and aph(3')IIIa resistance genes, respectively. Interestingly, it was observed that induction with streptomycin triggered a significant fold increase in the expression of the aph(3')IIIa gene which otherwise was not known to modify the aminoglycoside. This is noteworthy as streptomycin was found to confer cross resistance to structurally unrelated kanamycin. Also, expression of the aph(3')IIIa gene when induced with streptomycin, revealed that bacteria harbouring this gene will be able to overcome streptomycin bactericidal action at

2nd Biennial Conference on Refrigeration for Cryogenic Sensors and Electronic Systems

CERN Document Server

1983-01-01

This proceedings documents the output of the Second Biennial Conference on Refrigeration for Cryogenic Sensors and Electronic Systems held at the National Aeronautics and Space Administration's Goddard Space Flight Center, Greenbelt, Maryland, on December 7-8, 1982. Building on the first open meeting hosted by the National Bureau of Standards in 1980, the focus of this second meeting was again on low-temperature, closed-cycle cooler technology. However, higher temperature coolers (77 K), with technology applicable to the low temperature coolers, were considered to be within the scope of this meeting. This second conference consisted of 30 papers presented by representatives of industry, government, and academia. The conference proceedings reproduced here was published by the NASA Goddard Space Flight Center in Greenbelt Maryland as NASA Conference Publication 2287.

Disruption of a Guard Cell–Expressed Protein Phosphatase 2A Regulatory Subunit, RCN1, Confers Abscisic Acid Insensitivity in Arabidopsis

Science.gov (United States)

Kwak, June M.; Moon, Ji-Hye; Murata, Yoshiyuki; Kuchitsu, Kazuyuki; Leonhardt, Nathalie; DeLong, Alison; Schroeder, Julian I.

2002-01-01

Pharmacological studies have led to a model in which the phytohormone abscisic acid (ABA) may be positively transduced via protein phosphatases of the type 1 (PP1) or type 2A (PP2A) families. However, pharmacological evidence also exists that PP1s or PP2As may function as negative regulators of ABA signaling. Furthermore, recessive disruption mutants in protein phosphatases that function in ABA signal transduction have not yet been identified. A guard cell–expressed PP2A gene, RCN1, which had been characterized previously as a molecular component affecting auxin transport and gravity response, was isolated. A T-DNA disruption mutation in RCN1 confers recessive ABA insensitivity to Arabidopsis. The rcn1 mutation impairs ABA-induced stomatal closing and ABA activation of slow anion channels. Calcium imaging analyses show a reduced sensitivity of ABA-induced cytosolic calcium increases in rcn1, whereas mechanisms downstream of cytosolic calcium increases show wild-type responses, suggesting that RCN1 functions in ABA signal transduction upstream of cytosolic Ca2+ increases. Furthermore, rcn1 shows ABA insensitivity in ABA inhibition of seed germination and ABA-induced gene expression. The PP1 and PP2A inhibitor okadaic acid phenocopies the rcn1 phenotype in wild-type plants both in ABA-induced cytosolic calcium increases and in seed germination, and the wild-type RCN1 genomic DNA complements rcn1 phenotypes. These data show that RCN1 functions as a general positive transducer of early ABA signaling. PMID:12417706

Gene therapy strategy for long-term myocardial protection using adeno-associated virus-mediated delivery of heme oxygenase gene.

Science.gov (United States)

Melo, Luis G; Agrawal, Reitu; Zhang, Lunan; Rezvani, Mojgan; Mangi, Abeel A; Ehsan, Afshin; Griese, Daniel P; Dell'Acqua, Giorgio; Mann, Michael J; Oyama, Junichi; Yet, Shaw-Fang; Layne, Matthew D; Perrella, Mark A; Dzau, Victor J

2002-02-05

Ischemia and oxidative stress are the leading mechanisms for tissue injury. An ideal strategy for preventive/protective therapy would be to develop an approach that could confer long-term transgene expression and, consequently, tissue protection from repeated ischemia/reperfusion injury with a single administration of a therapeutic gene. In the present study, we used recombinant adeno-associated virus (rAAV) as a vector for direct delivery of the cytoprotective gene heme oxygenase-1 (HO-1) into the rat myocardium, with the purpose of evaluating this strategy as a therapeutic approach for long-term protection from ischemia-induced myocardial injury. Human HO-1 gene (hHO-1) was delivered to normal rat hearts by intramyocardial injection. AAV-mediated transfer of the hHO-1 gene 8 weeks before acute coronary artery ligation and release led to a dramatic reduction (>75%) in left ventricular myocardial infarction. The reduction in infarct size was accompanied by decreases in myocardial lipid peroxidation and in proapoptotic Bax and proinflammatory interleukin-1beta protein abundance, concomitant with an increase in antiapoptotic Bcl-2 protein level. This suggested that the transgene exerts its cardioprotective effects in part by reducing oxidative stress and associated inflammation and apoptotic cell death. This study documents the beneficial therapeutic effect of rAAV-mediated transfer, before myocardial injury, of a cytoprotective gene that confers long-term myocardial protection from ischemia/reperfusion injury. Our data suggest that this novel "pre-event" gene transfer approach may provide sustained tissue protection from future repeated episodes of injury and may be beneficial as preventive therapy for patients with or at risk of developing coronary ischemic events.

Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

Science.gov (United States)

Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

2007-11-01

Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

Identification of dfrA14 in two distinct plasmids conferring trimethoprim resistance in Actinobacillus pleuropneumoniae.

Science.gov (United States)

Bossé, Janine T; Li, Yanwen; Walker, Stephanie; Atherton, Tom; Fernandez Crespo, Roberto; Williamson, Susanna M; Rogers, Jon; Chaudhuri, Roy R; Weinert, Lucy A; Oshota, Olusegun; Holden, Matt T G; Maskell, Duncan J; Tucker, Alexander W; Wren, Brendan W; Rycroft, Andrew N; Langford, Paul R

2015-08-01

The objective of this study was to determine the distribution and genetic basis of trimethoprim resistance in Actinobacillus pleuropneumoniae isolates from pigs in England. Clinical isolates collected between 1998 and 2011 were tested for resistance to trimethoprim and sulphonamide. The genetic basis of trimethoprim resistance was determined by shotgun WGS analysis and the subsequent isolation and sequencing of plasmids. A total of 16 (out of 106) A. pleuropneumoniae isolates were resistant to both trimethoprim (MIC >32 mg/L) and sulfisoxazole (MIC ≥256 mg/L), and a further 32 were resistant only to sulfisoxazole (MIC ≥256 mg/L). Genome sequence data for the trimethoprim-resistant isolates revealed the presence of the dfrA14 dihydrofolate reductase gene. The distribution of plasmid sequences in multiple contigs suggested the presence of two distinct dfrA14-containing plasmids in different isolates, which was confirmed by plasmid isolation and sequencing. Both plasmids encoded mobilization genes, the sulphonamide resistance gene sul2, as well as dfrA14 inserted into strA, a streptomycin-resistance-associated gene, although the gene order differed between the two plasmids. One of the plasmids further encoded the strB streptomycin-resistance-associated gene. This is the first description of mobilizable plasmids conferring trimethoprim resistance in A. pleuropneumoniae and, to our knowledge, the first report of dfrA14 in any member of the Pasteurellaceae. The identification of dfrA14 conferring trimethoprim resistance in A. pleuropneumoniae isolates will facilitate PCR screens for resistance to this important antimicrobial. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

Systematic study of association of four GABAergic genes: glutamic acid decarboxylase 1 gene, glutamic acid decarboxylase 2 gene, GABA(B) receptor 1 gene and GABA(A) receptor subunit beta2 gene, with schizophrenia using a universal DNA microarray.

Science.gov (United States)

Zhao, Xu; Qin, Shengying; Shi, Yongyong; Zhang, Aiping; Zhang, Jing; Bian, Li; Wan, Chunling; Feng, Guoyin; Gu, Niufan; Zhang, Guangqi; He, Guang; He, Lin

2007-07-01

Several studies have suggested the dysfunction of the GABAergic system as a risk factor in the pathogenesis of schizophrenia. In the present study, case-control association analysis was conducted in four GABAergic genes: two glutamic acid decarboxylase genes (GAD1 and GAD2), a GABA(A) receptor subunit beta2 gene (GABRB2) and a GABA(B) receptor 1 gene (GABBR1). Using a universal DNA microarray procedure we genotyped a total of 20 SNPs on the above four genes in a study involving 292 patients and 286 controls of Chinese descent. Statistically significant differences were observed in the allelic frequencies of the rs187269C/T polymorphism in the GABRB2 gene (P=0.0450, chi(2)=12.40, OR=1.65) and the -292A/C polymorphism in the GAD1 gene (P=0.0450, chi(2)=14.64 OR=1.77). In addition, using an electrophoretic mobility shift assay (EMSA), we discovered differences in the U251 nuclear protein binding to oligonucleotides representing the -292 SNP on the GAD1 gene, which suggests that the -292C allele has reduced transcription factor binding efficiency compared with the 292A allele. Using the multifactor-dimensionality reduction method (MDR), we found that the interactions among the rs187269C/T polymorphism in the GABRB2 gene, the -243A/G polymorphism in the GAD2 gene and the 27379C/T and 661C/T polymorphisms in the GAD1 gene revealed a significant association with schizophrenia (Pschizophrenia in the Chinese population.

Identification and functional analysis of a new glyphosate resistance gene from a fungus cDNA library.

Science.gov (United States)

Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan

2017-08-01

Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Aberrations of ERBB2 and TOP2A Genes in Breast Cancer

DEFF Research Database (Denmark)

Nielsen, Kirsten Vang; Müller, Sven; Møller, Susanne

2009-01-01

genes and the other by having amplification of ERBB2 and deletion of TOP2A. The characteristics are compared to findings on paired ERBB2 and TOP2A data from 649 patients with invasive breast cancer from a previously published biomarker study. The physical localization of FISH signals in metaphase...... spreads from cell lines showed that simultaneous amplification is not a simple co-amplification of a whole amplicon containing both genes. Most gene signals are translocated to abnormal marker chromosomes. ERBB2 genes but not TOP2A genes are present in tandem amplicons, leading to a higher ERBB2 ratio....... This observation was confirmed by patient FISH data: among 276 (43% of all patients) abnormal tumors, 67% had different ERBB2 and TOP2A status. ERBB2 amplification with normal TOP2A status was found in 36% of the abnormal tumors (15% of all patients). Simultaneous amplification of both genes was found in 28...

2. Conference on Radioactivity in the Environment. Proceedings

International Nuclear Information System (INIS)

Lucivjansky, L.

2000-01-01

In this conference took part more the 40 scientists from the Czech Republic; Poland and Slovakia and 31 lectures were presented. Presented works deals with radiation monitoring in the environment as well as near some nuclear power plants

The NVL gene confers risk for both major depressive disorder and schizophrenia in the Han Chinese population.

Science.gov (United States)

Wang, Meng; Chen, Jianhua; He, Kuanjun; Wang, Qingzhong; Li, Zhiqiang; Shen, Jiawei; Wen, Zujia; Song, Zhijian; Xu, Yifeng; Shi, Yongyong

2015-10-01

NVL (nuclear VCP (valosin containing protein)/p97-Like), a member of the AAA-ATPase (ATPases associated with various cellular activities) family, encodes a novel hTERT (human telomerase reverse transcriptase)-interacting protein NVL2 which is a telomerase component essential for holoenzyme assembly. Previous researches have reported the impacts of telomerase activity on mental illness and the potential association between NVL and major depressive disorder. To validate the susceptibility of NVL to major depressive disorder, and to investigate the overlapping risk conferred by NVL for both major depressive disorder and schizophrenia, we analyzed 9 tag single nucleotide polymorphisms (tag SNPs) using TaqMan® technology, in 1045 major depressive disorder patients, 1235 schizophrenia patients and 1235 normal controls of Han Chinese origin. We found that rs10916583 (P(allele) = 0.020, P(genotype) = 0.028, OR = 1.156) and rs16846649 (adjusted P(allele) = 0.014, P(genotype) = 0.007, OR = 0.718) were associated with major depressive disorder, while rs10916583 (adjusted P(allele) = 1.08E-02, OR = 1.213), rs16846649 (adjusted P(allele) = 7.40E-06, adjusted P(genotype) = 8.07E-05, OR = 0.598) and rs10799541 (adjusted P(allele) = 8.10E-03, adjusted P(genotype) = 0.049, OR= 0.826) showed statistically significant association with schizophrenia after Bonferroni correction. Furthermore, rs10916583 (adjusted P(allele) = 9.00E-03, adjusted P(genotype) = 3.15E-02, OR = 1.187) and rs16846649 (adjusted P(allele) = 8.92E-06, adjusted P(genotype) = 8.84E-05, OR = 0.653) remained strongly associated with the analysis of combined cases of major depressive disorder and schizophrenia after Bonferroni correction. Our results indicated that the NVL gene may contain overlapping common genetic risk factors for major depressive disorder and schizophrenia in the Han Chinese population. The roles of NVL in telomerase biogenesis were also highlighted in psychiatric pathogenesis. The study on

Eukaryotic translation initiation factor 2B-beta (eIF2Bβ), a new class of plant virus resistance gene.

Science.gov (United States)

Shopan, Jannat; Mou, Haipeng; Zhang, Lili; Zhang, Changtong; Ma, Weiwei; Walsh, John A; Hu, Zhongyuan; Yang, Jinghua; Zhang, Mingfang

2017-06-01

Recessive resistances to plant viruses in the Potyvirus genus have been found to be based on mutations in the plant eukaryotic translation initiation factors, eIF4E and eIF4G or their isoforms. Here we report that natural, monogenic recessive resistance to the Potyvirus Turnip mosaic virus (TuMV) has been found in a number of mustard (Brassica juncea) accessions. Bulked segregant analysis and sequencing of resistant and susceptible plant lines indicated the resistance is controlled by a single recessive gene, recessive TuMV resistance 03 (retr03), an allele of the eukaryotic translation initiation factor 2B-beta (eIF2Bβ). Silencing of eIF2Bβ in a TuMV-susceptible mustard plant line and expression of eIF2Bβ from a TuMV-susceptible line in a TuMV-resistant mustard plant line confirmed the new resistance mechanism. A functional copy of a specific allele of eIF2Bβ is required for efficient TuMV infection. eIF2Bβ represents a new class of virus resistance gene conferring resistance to any pathogen. eIF2B acts as a guanine nucleotide exchange factor (GEF) for its GTP-binding protein partner eIF2 via interaction with eIF2·GTP at an early step in translation initiation. Further genotyping indicated that a single non-synonymous substitution (A120G) in the N-terminal region of eIF2Bβ was responsible for the TuMV resistance. A reproducible marker has been developed, facilitating marker-assisted selection for TuMV resistance in B. juncea. Our findings provide a new target for seeking natural resistance to potyviruses and new opportunities for the control of potyviruses using genome editing techniques targeted on eIF2Bβ. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

2nd International Conference on Mathematics and Computing

CERN Document Server

Chowdhury, Dipanwita; Giri, Debasis

2015-01-01

This book discusses recent developments and contemporary research in mathematics, statistics and their applications in computing. All contributing authors are eminent academicians, scientists, researchers and scholars in their respective fields, hailing from around the world. This is the second conference on mathematics and computing organized at Haldia Institute of Technology, India. The conference has emerged as a powerful forum, offering researchers a venue to discuss, interact and collaborate, and stimulating the advancement of mathematics and its applications in computer science. The book will allow aspiring researchers to update their knowledge of cryptography, algebra, frame theory, optimizations, stochastic processes, compressive sensing, functional analysis, complex variables, etc. Educating future consumers, users, producers, developers and researchers in mathematics and computing is a challenging task and essential to the development of modern society. Hence, mathematics and its applications in com...

2nd Conference on Interdisciplinary Applications in Kinematics

CERN Document Server

Flores, Francisco

2015-01-01

This book collects a number of important contributions presented during the Second Conference on Interdisciplinary Applications of Kinematics (IAK 2013) held in Lima, Peru. The conference brought together scientists from several research fields, such as computational kinematics, multibody systems, industrial machines, robotics, biomechanics, mechatronics, computational chemistry, and vibration analysis, and embraced all key aspects of kinematics, namely, theoretical methods, modeling, optimization, experimental validation, industrial applications, and design. Kinematics is an exciting area of computational mechanics and plays  a central role in a great variety of fields and industrial applications nowadays. Apart from research in pure kinematics, the field deals with problems of practical relevance that need to be solved in an interdisciplinary manner in order for new technologies to develop. The results presented in this book should be of interest for practicing and research engineers as well as Ph.D. stud...

Characterization of the beta-carotene hydroxylase gene DSM2 conferring drought and oxidative stress resistance by increasing xanthophylls and abscisic acid synthesis in rice.

Science.gov (United States)

Du, Hao; Wang, Nili; Cui, Fei; Li, Xianghua; Xiao, Jinghua; Xiong, Lizhong

2010-11-01

Drought is a major limiting factor for crop production. To identify critical genes for drought resistance in rice (Oryza sativa), we screened T-DNA mutants and identified a drought-hypersensitive mutant, dsm2. The mutant phenotype was caused by a T-DNA insertion in a gene encoding a putative β-carotene hydroxylase (BCH). BCH is predicted for the biosynthesis of zeaxanthin, a carotenoid precursor of abscisic acid (ABA). The amounts of zeaxanthin and ABA were significantly reduced in two allelic dsm2 mutants after drought stress compared with the wild type. Under drought stress conditions, the mutant leaves lost water faster than the wild type and the photosynthesis rate, biomass, and grain yield were significantly reduced, whereas malondialdehyde level and stomata aperture were increased in the mutant. The mutant is also hypersensitive to oxidative stresses. The mutant had significantly lower maximal efficiency of photosystem II photochemistry and nonphotochemical quenching capacity than the wild type, indicating photoinhibition in photosystem II and decreased capacity for eliminating excess energy by thermal dissipation. Overexpression of DSM2 in rice resulted in significantly increased resistance to drought and oxidative stresses and increases of the xanthophylls and nonphotochemical quenching. Some stress-related ABA-responsive genes were up-regulated in the overexpression line. DSM2 is a chloroplast protein, and the response of DSM2 to environmental stimuli is distinctive from the other two BCH members in rice. We conclude that the DSM2 gene significantly contributes to control of the xanthophyll cycle and ABA synthesis, both of which play critical roles in the establishment of drought resistance in rice.

Clinical infection control in gene therapy : A multidisciplinary conference

NARCIS (Netherlands)

Evans, ME; Jordan, CT; Chang, SMW; Conrad, C; Gerberding, JL; Kaufman, HL; Mayhall, CG; Nolta, JA; Pilaro, AM; Sullivan, S; Weber, DJ; Wivel, NA

2000-01-01

Gene therapy is being studied for the treatment of a variety of acquired and inherited disorders. Retroviruses, adenoviruses, poxviruses, adeno-associated viruses, herpesviruses, and others are being engineered to transfer genes into humans. Treatment protocols using recombinant viruses are being

PREFACE: 10th International Conference on Materials and Mechanisms of Superconductivity (M2S-X)

Science.gov (United States)

Greene, L. H.; Zhu, J.-X.; Wang, H.; Meen, J.; Lorenz, B.; Dong, X. L.; dela Cruz, C. R.; Carlson, E.; Bud'ko, S. L.; Bauer, E.; Paglione, J.

2013-07-01

The 2012 Materials and Mechanisms of Superconductivity Conference (M2S 2012), which occurs every three years, brought together world experts and young scientists to discuss open questions in the fundamental physics and applications of superconductors, and to disseminate the latest theoretical and experimental research results in superconductors and related novel materials. This conference of 600 participants acted as a valuable training ground in this technologically important area. We focused on key unanswered questions in high-temperature cuprate superconductors, high-temperature iron-based superconductors, topological superconductors, organic superconductors, and heavy-electron superconductors. The discovery of new materials and novel technological applications for electronic devices and for energy transmission and storage was emphasized. There were special sessions on superconductivity and energy, and outreach sessions, and an evening public lecture. There were also junior researcher symposia interspersed within the conference, thus providing an ideal environment for advanced graduate students and postdoctoral researchers to explore the latest theoretical and experimental methods used to investigate challenging questions in the physics of materials as it relates to both fundamental science and technological applications. These proceedings are an archival testament to the excitement in the field and provide a valuable snapshot of the cutting-edge research of 2012. We hope this will be a valuable resource to active researchers in the field as well as an encouraging volume to excite new researchers to the ever-growing, multifaceted field of superconductivity. We thank Bernd Lorenz and his Publications Committee for their tremendously creative and diligent work in putting this volume together. This Conference would not have been possible without the tireless work of our Program Committee, Chaired by Rick Greene and Co-Chaired by Mike Norman. Becky McDuffee, our

A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae.

Science.gov (United States)

Das, Alok; Soubam, D; Singh, P K; Thakur, S; Singh, N K; Sharma, T R

2012-06-01

The dominant rice blast resistance gene, Pi54 confers resistance to Magnaporthe oryzae in different parts of India. In our effort to identify more effective forms of this gene, we isolated an orthologue of Pi54 named as Pi54rh from the blast-resistant wild species of rice, Oryza rhizomatis, using allele mining approach and validated by complementation. The Pi54rh belongs to CC-NBS-LRR family of disease resistance genes with a unique Zinc finger (C(3)H type) domain. The 1,447 bp Pi54rh transcript comprises of 101 bp 5'-UTR, 1,083 bp coding region and 263 bp 3'-UTR, driven by pathogen inducible promoter. We showed the extracellular localization of Pi54rh protein and the presence of glycosylation, myristoylation and phosphorylation sites which implicates its role in signal transduction process. This is in contrast to other blast resistance genes that are predicted to be intracellular NBS-LRR-type resistance proteins. The Pi54rh was found to express constitutively at basal level in the leaves, but upregulates 3.8-fold at 96 h post-inoculation with the pathogen. Functional validation of cloned Pi54rh gene using complementation test showed high degree of resistance to seven isolates of M. oryzae collected from different geographical locations of India. In this study, for the first time, we demonstrated that a rice blast resistance gene Pi54rh cloned from wild species of rice provides broad spectrum resistance to M. oryzae hence can be used in rice improvement breeding programme.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Conference report: formulating better medicines for children: 4th European Paediatric Formulation Initiative conference.

Science.gov (United States)

Walsh, Jennifer; Mills, Simon

2013-01-01

The fourth annual European Paediatric Formulation Initiative (EuPFI) conference on Formulating Better Medicines for Children was held on 19-20 September 2012 at the Institute of Molecular Genetics Congress Centre, Prague, Czech Republic. The 2-day conference concentrated on the latest advances, challenges and opportunities for developing medicinal products and administration devices for pediatric use, both from European and US perspectives. It was aimed specifically at providing exposure to emerging practical applications, and for illustrating remedies utilized by pediatric drug-development teams to overcome hurdles faced in developing medicines for pediatric patients. The conference format included plenary talks, focus sessions on each of the EuPFI work streams (extemporaneous preparations, excipients, pediatric administration devices, taste masking and taste assessment, age-appropriate formulations), case studies, soapbox sessions and a parallel poster display. This conference report summarizes the keynote lectures and also gives a flavor of other presentations and posters from the conference.

Common variants of the TCF7L2 gene are associated with increased risk of type 2 diabetes mellitus in a UK-resident South Asian population

Directory of Open Access Journals (Sweden)

Kumar Sudhesh

2008-02-01

Full Text Available Abstract Background Recent studies have implicated variants of the transcription factor 7-like 2 (TCF7L2 gene in genetic susceptibility to type 2 diabetes mellitus in several different populations. The aim of this study was to determine whether variants of this gene are also risk factors for type 2 diabetes development in a UK-resident South Asian cohort of Punjabi ancestry. Methods We genotyped four single nucleotide polymorphisms (SNPs of TCF7L2 (rs7901695, rs7903146, rs11196205 and rs12255372 in 831 subjects with diabetes and 437 control subjects. Results The minor allele of each variant was significantly associated with type 2 diabetes; the greatest risk of developing the disease was conferred by rs7903146, with an allelic odds ratio (OR of 1.31 (95% CI: 1.11 – 1.56, p = 1.96 × 10-3. For each variant, disease risk associated with homozygosity for the minor allele was greater than that for heterozygotes, with the exception of rs12255372. To determine the effect on the observed associations of including young control subjects in our data set, we reanalysed the data using subsets of the control group defined by different minimum age thresholds. Increasing the minimum age of our control subjects resulted in a corresponding increase in OR for all variants of the gene (p ≤ 1.04 × 10-7. Conclusion Our results support recent findings that TCF7L2 is an important genetic risk factor for the development of type 2 diabetes in multiple ethnic groups.

Proceedings of the 2. annual international greening rooftops for sustainable communities conference, awards and trade show

International Nuclear Information System (INIS)

2004-01-01

This conference provided a forum to discuss the many private and public benefits that can be derived from green roofs. The benefits of green roofs include energy savings, creation of green space, mitigation of the urban heat island effect, cleaner stormwater runoff, sound attenuation, aesthetic value, oxygen production, and mitigation of carbon dioxide emissions. The presentations at this conference addressed a broad range of issues, including strategies to improve the commercialization of green roof technology in North America. Federal policies and standards that support green roof applications were reviewed, along with initiatives that promote green roofs at the municipal level. Innovative research programs and demonstration programs were highlighted along with policy developments in countries where green roof technology has been widely implemented. Public outreach, training and education programs were also reviewed. The conference was divided into the following 3 sessions: (1) policy and program development, (2) case studies and design, and (3) research on technical performance and benefits. The conference featured 53 presentations, of which 43 have been catalogued separately for inclusion in this database. refs., tabs., figs

Expression of Aluminum-Induced Genes in Transgenic Arabidopsis Plants Can Ameliorate Aluminum Stress and/or Oxidative Stress1

Science.gov (United States)

Ezaki, Bunichi; Gardner, Richard C.; Ezaki, Yuka; Matsumoto, Hideaki

2000-01-01

To examine the biological role of Al-stress-induced genes, nine genes derived from Arabidopsis, tobacco (Nicotiana tabacum L.), wheat (Triticum aestivum L.), and yeast (Saccharomyces cerevisiae) were expressed in Arabidopsis ecotype Landsberg. Lines containing eight of these genes were phenotypically normal and were tested in root elongation assays for their sensitivity to Al, Cd, Cu, Na, Zn, and to oxidative stresses. An Arabidopsis blue-copper-binding protein gene (AtBCB), a tobacco glutathione S-transferase gene (parB), a tobacco peroxidase gene (NtPox), and a tobacco GDP-dissociation inhibitor gene (NtGDI1) conferred a degree of resistance to Al. Two of these genes, AtBCB and parB, and a peroxidase gene from Arabidopsis (AtPox) also showed increased resistance to oxidative stress induced by diamide, while parB conferred resistance to Cu and Na. Al content of Al-treated root tips was reduced in the four Al-resistant plant lines compared with wild-type Ler-0, as judged by morin staining. All four Al-resistant lines also showed reduced staining of roots with 2′,7′-dichloro fluorescein diacetate (H2DCFDA), an indicator of oxidative stress. We conclude that Al-induced genes can serve to protect against Al toxicity, and also provide genetic evidence for a link between Al stress and oxidative stress in plants. PMID:10712528

Identification of a novel vga(E) gene variant that confers resistance to pleuromutilins, lincosamides and streptogramin A antibiotics in staphylococci of porcine origin.

Science.gov (United States)

Li, Jun; Li, Beibei; Wendlandt, Sarah; Schwarz, Stefan; Wang, Yang; Wu, Congming; Ma, Zhiyong; Shen, Jianzhong

2014-04-01

To investigate the genetic basis of pleuromutilin resistance in coagulase-negative staphylococci of porcine origin that do not carry known pleuromutilin resistance genes and to determine the localization and genetic environment of the identified resistance gene. Plasmid DNA of two pleuromutilin-resistant Staphylococcus cohnii and Staphylococcus simulans isolates was transformed into Staphylococcus aureus RN4220. The identified resistance plasmids were sequenced completely. The candidate gene for pleuromutilin resistance was cloned into shuttle vector pAM401. S. aureus RN4220 transformants carrying this recombinant shuttle vector were tested for their MICs. S. cohnii isolate SA-7 and S. simulans isolate SSI1 carried the same plasmid of 5584 bp, designated pSA-7. A variant of the vga(E) gene was detected, which encodes a 524 amino acid ATP-binding cassette protein. The variant gene shared 85.7% nucleotide sequence identity and the variant protein 85.3% amino acid sequence identity with the original vga(E) gene and Vga(E) protein, respectively. The Vga(E) variant conferred cross-resistance to pleuromutilins, lincosamides and streptogramin A antibiotics. Plasmid pSA-7 showed an organization similar to that of the apmA-carrying plasmid pKKS49 from methicillin-resistant S. aureus and the dfrK-carrying plasmid pKKS966 from Staphylococcus hyicus. Sequence comparisons suggested that recombination events may have played a role in the acquisition of this vga(E) variant. A novel vga(E) gene variant was identified, which was located on a small plasmid and was not associated with the transposon Tn6133 [in contrast to the original vga(E) gene]. The plasmid location may enable its further dissemination to other staphylococci and possibly also to other bacteria.

2nd International Conference on Mechanical, Manufacturing and Process Plant Engineering

CERN Document Server

2017-01-01

This volume presents selected papers from the 2nd International Conference on Mechanical, Manufacturing and Process Plant Engineering (ICMMPE 2016) which was held from 23rd to 24th November, 2016 in Kuala Lumpur, Malaysia. The proceedings discuss genuine problems of joining technologies that are heart of manufacturing sectors. It discusses the findings of experimental and numerical works from soldering, arc welding to solid state joining technology that faced by current industry. .

Proceedings of the ninth national conference on undergraduate research, 1995. Volume 2

Energy Technology Data Exchange (ETDEWEB)

Yearout, R.D.

1995-07-01

The Ninth National Conference on Undergraduate Research (NCUR 95) was held at Union College in Schenectady, New York. This annual celebration of undergraduate scholarly activity continues to elicit strong nation-wide support and enthusiasm among both students and faculty. Attendance was nearly 1,650, which included 1,213 student oral and poster presenters. For the second year in a row, many student papers had to be rejected for presentation at NCUR due to conference size limitations. Thus, submitted papers for presentation at NCUR 95 were put through a careful review process before acceptance. Those students who have been selected to have their paper appear in these Proceedings have been through yet a second review process. As a consequence, their work has been judged to represent an impressive level of achievement at the undergraduate level. Volume 2 contains papers related to Engineering and Mathematics (41 papers) and Physical Science (18 papers).

Gene expression of the mismatch repair gene MSH2 in primary colorectal cancer

DEFF Research Database (Denmark)

Jensen, Lars Henrik; Kuramochi, Hidekazu; Crüger, Dorthe Gylling

2011-01-01

promoter was only detected in 14 samples and only at a low level with no correlation to gene expression. MSH2 gene expression was not a prognostic factor for overall survival in univariate or multivariate analysis. The gene expression of MSH2 is a potential quantitative marker ready for further clinical...

Proceedings of the 2. invitational conference on advancing energy literacy in Alberta

Energy Technology Data Exchange (ETDEWEB)

Martin, J. [Centre for Environment-Economy Learning Foundation, Edmonton, AB (Canada)

2010-07-01

This conference provided a forum to discuss and define necessary short-term actions to advance energy literacy in Alberta. The goals of the conference were to clearly define the conditions needed to move forward on energy literacy; provide input to the Strategic Framework for Advancing Energy Literacy in Alberta (AELA); and describe objectives for the next two years of cooperative work on advancing energy literacy in the province. Four sectors were recognized at the conference, notably government; electricity and other utilities; oil and gas industry; and community, which included educators, landowners, environmental and conservation group representatives, and private media. The 2010 conference intended to build on the interest of the energy community and focus on action. Alberta's Minister of Energy emphasized the need for Albertans to understand energy as it relates to the economic well being of the province. Participants were encouraged to find ways to work together, as a collective to develop and deliver education programs that help the public to understand that resources can be developed in an environmentally sustainable manner. Electronic polling of all conference participants produced a prioritized list of actions for launching an energy literacy program as well as an initial indication of commitment to those actions. tabs.

Changing times. Southwest Energy-Minerals Conference Proceedings, Volumes 1 and 2

Energy Technology Data Exchange (ETDEWEB)

None

1977-01-01

This conference was held at the Albuquerque Convention Center, Albuquerque, NM, Nov. 2 and 3, 1977. It was sponsored by the Bureau of Land Management, U.S. Dept. of the Interior. It contains articles on the leasing of coal deposits (changes and modifications of leasing policy, environmental impact statements, U.S. energy policy (NEP), prices of gas and oil), New Mexico's energy consumption (by the Governor), transport of energy (Santa Fe railroad's plans), the energy crisis and proposed solutions, energy supplies and environmental problems, energy problems of agriculture (fuels, fertilizers and water energy requirements are greater than the energy in the food produced; possibility of biomass conversion, photosynthetic efficiency of using sunlight in arid lands), energy project financing, a review of the recent Law of the Sea conferences (1967 to date) (mining projects), growth economy as no growth and relation to energy supplies and environmental problems, natural gas and petroleum industries (divestiture problems, reserves), raw materials stockpiles (national experience, changing targets), the mining industry and its reserves of metals, taxation, etc.). (LTN)

A coding polymorphism in NALP1 confers risk for autoimmune Addison's disease and type 1 diabetes

NARCIS (Netherlands)

Magitta, N. F.; Wolff, A. S. Boe; Johansson, S.; Skinningsrud, B.; Lie, B. A.; Myhr, K-M; Undlien, D. E.; Joner, G.; Njolstad, P. R.; Kvien, T. K.; Forre, O.; Knappskog, P. M.; Husebye, E. S.

Variants in the gene encoding NACHT leucine-rich-repeat protein 1 (NALP1), an important molecule in innate immunity, have recently been shown to confer risk for vitiligo and associated autoimmunity. We hypothesized that sequence variants in this gene may be involved in susceptibility to a wider

Activation of Pathogenesis-related Genes by the Rhizobacterium, Bacillus sp. JS, Which Induces Systemic Resistance in Tobacco Plants.

Science.gov (United States)

Kim, Ji-Seong; Lee, Jeongeun; Lee, Chan-Hui; Woo, Su Young; Kang, Hoduck; Seo, Sang-Gyu; Kim, Sun-Hyung

2015-06-01

Plant growth promoting rhizobacteria (PGPR) are known to confer disease resistance to plants. Bacillus sp. JS demonstrated antifungal activities against five fungal pathogens in in vitro assays. To verify whether the volatiles of Bacillus sp. JS confer disease resistance, tobacco leaves pre-treated with the volatiles were damaged by the fungal pathogen, Rhizoctonia solani and oomycete Phytophthora nicotianae. Pre-treated tobacco leaves had smaller lesion than the control plant leaves. In pathogenesis-related (PR) gene expression analysis, volatiles of Bacillus sp. JS caused the up-regulation of PR-2 encoding β-1,3-glucanase and acidic PR-3 encoding chitinase. Expression of acidic PR-4 encoding chitinase and acidic PR-9 encoding peroxidase increased gradually after exposure of the volatiles to Bacillus sp. JS. Basic PR-14 encoding lipid transfer protein was also increased. However, PR-1 genes, as markers of salicylic acid (SA) induced resistance, were not expressed. These results suggested that the volatiles of Bacillus sp. JS confer disease resistance against fungal and oomycete pathogens through PR genes expression.

Genes2Networks: connecting lists of gene symbols using mammalian protein interactions databases

Directory of Open Access Journals (Sweden)

Ma'ayan Avi

2007-10-01

Full Text Available Abstract Background In recent years, mammalian protein-protein interaction network databases have been developed. The interactions in these databases are either extracted manually from low-throughput experimental biomedical research literature, extracted automatically from literature using techniques such as natural language processing (NLP, generated experimentally using high-throughput methods such as yeast-2-hybrid screens, or interactions are predicted using an assortment of computational approaches. Genes or proteins identified as significantly changing in proteomic experiments, or identified as susceptibility disease genes in genomic studies, can be placed in the context of protein interaction networks in order to assign these genes and proteins to pathways and protein complexes. Results Genes2Networks is a software system that integrates the content of ten mammalian interaction network datasets. Filtering techniques to prune low-confidence interactions were implemented. Genes2Networks is delivered as a web-based service using AJAX. The system can be used to extract relevant subnetworks created from "seed" lists of human Entrez gene symbols. The output includes a dynamic linkable three color web-based network map, with a statistical analysis report that identifies significant intermediate nodes used to connect the seed list. Conclusion Genes2Networks is powerful web-based software that can help experimental biologists to interpret lists of genes and proteins such as those commonly produced through genomic and proteomic experiments, as well as lists of genes and proteins associated with disease processes. This system can be used to find relationships between genes and proteins from seed lists, and predict additional genes or proteins that may play key roles in common pathways or protein complexes.

DRS // CUMULUS Oslo 2013. The 2nd International Conference for Design Education Researchers

Directory of Open Access Journals (Sweden)

Liv Merete Nielsen

2012-08-01

Full Text Available This international conference is a springboard for sharing ideas and concepts about contemporary design education research. Contributors are invited to submit research that deals with different facets of contemporary approaches to design education research. All papers will be double-blind peer-reviewed. This conference is open to research in any aspect and discipline of design education. Conference theme:Design Learning for Tomorrow - Design Education from Kindergarten to PhD

2nd International Conference on Serviceology

CERN Document Server

Sawatani, Yuriko; Hara, Tatsunori

2016-01-01

This book provides a useful overall guide to the state of the art in theory and practice of services. It can also serve as a reference book for researchers in various fields, including engineering, marketing, economics, and other disciplines. Advanced works presented here were selected from the proceedings of the Second International Conference on Serviceology (ICServ2014), held September 14–16, 2014. This book helps readers to understand serviceology, which tackles with a broad range of services, the globalization of the economy and also enhances the quality of life of local residents.

The targeted inhibition of mitochondrial Hsp90 overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis

Energy Technology Data Exchange (ETDEWEB)

Yan, Chunlan [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of); Department of Physiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058 (China); Oh, Joon Seok; Yoo, Seung Hee; Lee, Jee Suk [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of); Yoon, Young Geol [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of); Department of Biomedical Science, Institute for Biomedical and Health Sciences, Jungwon University, Chungbuk, 367-805 (Korea, Republic of); Oh, Yoo Jin; Jang, Min Seok [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of); Lee, Sang Yeob [Department of Rheumatology, Dong-A University College of Medicine, Busan, 602-714 (Korea, Republic of); Yang, Jun [Department of Toxicology, Hangzhou Normal University School of Public Health, Hangzhou, Zhejiang, 310036 China (China); Lee, Sang Hwa [Department of Microbiology and, Dong-A University College of Medicine, Busan, 602-714 (Korea, Republic of); Kim, Hye Young [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of); Yoo, Young Hyun, E-mail: yhyoo@dau.ac.kr [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of)

2013-01-01

Previous studies have reported that a Gamitrinib variant containing triphenylphosphonium (G-TPP) binds to mitochondrial Hsp90 and rapidly inhibits its activity, thus inducing the apoptotic pathway in the cells. Accordingly, G-TPP shows a potential as a promising drug for the treatment of cancer. A cell can die from different types of cell death such as apoptosis, necrosis, necroptosis, and autophagic cell death. In this study, we further investigated the mechanisms and modes of cell death in the G-TPP-treated Hep3B and U937 cell lines. We discovered that G-TPP kills the U937 cells through the apoptotic pathway and the overexpression of Bcl-2 significantly inhibits U937 cell death to G-TPP. We further discovered that G-TPP kills the Hep3B cells by activating necroptosis in combination with the partial activation of caspase-dependent apoptosis. Importantly, G-TPP overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis. We also observed that G-TPP induces compensatory autophagy in the Hep3B cell line. We further found that whereas there is a Bcl-2-Beclin 1 interaction in response to G-TPP, silencing the beclin 1 gene failed to block LC3-II accumulation in the Hep3B cells, indicating that G-TPP triggers Beclin 1-independent protective autophagy in Hep3B cells. Taken together, these data reveal that G-TPP induces cell death through a combination of death pathways, including necroptosis and apoptosis, and overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis. These findings are important for the therapeutic exploitation of necroptosis as an alternative cell death program to bypass the resistance to apoptosis. Highlights: ► G-TPP binds to mitochondrial Hsp90. ► G-TPP induces apoptosis in U937 human leukemia cancer cells. ► G-TPP induces combination of death pathways in Hep3B cell. ► G-TPP overcomes the resistance conferred by Bcl-2 in Hep3B cells via necroptosis. ► G-TPP triggers Beclin 1-independent

An AFLP marker linked to the Pm-1 gene that confers resistance to Podosphaera xanthii race 1 in Cucumis melo

Directory of Open Access Journals (Sweden)

Ana Paula Matoso Teixeira

2008-01-01

Full Text Available Brazil produced 330,000 metric tons of melons in 2005, principally in the Northeast region where one of the most important melon pathogens is the powdery mildew fungus Podosphaera xanthii. The disease is controlled mainly by incorporating single dominant resistance genes into commercial hybrids. We report on linkage analysis of the Pm-1 resistance gene, introgressed from the AF125Pm-1 Cantalupensis Charentais-type breeding line into the yellow-fleshed melon (Group Inodorus breeding line AF426-S by backcrossing to produce the resistant line AF426-R, and the amplified fragment length polymorphism (AFLP marker M75/H35_155 reported to be polymorphic between AF426-S and AF426-R. Segregation analysis of M75/H35_155 using a backcross population of 143 plants derived from [AF426-R x AF426-S] x AF426-S and screened for resistance to P. xanthii race 1 produced a recombination frequency of 4.9%, indicating close linkage between M75/H35_155 and Pm-1. Using the same segregating population, the M75/H35_155 marker had previously been reported to be distantly linked to Prv¹, a gene conferring resistance to papaya ringspot virus-type W. Since M75/H35_155 is linked to Prv¹ at a distance of 40.9 cM it is possible that Pm-1 and Prv¹ are also linked.

An Alcohol Dehydrogenase Gene from Synechocystis sp. Confers Salt Tolerance in Transgenic Tobacco

Directory of Open Access Journals (Sweden)

So Young Yi

2017-11-01

Full Text Available Synechocystis salt-responsive gene 1 (sysr1 was engineered for expression in higher plants, and gene construction was stably incorporated into tobacco plants. We investigated the role of Sysr1 [a member of the alcohol dehydrogenase (ADH superfamily] by examining the salt tolerance of sysr1-overexpressing (sysr1-OX tobacco plants using quantitative real-time polymerase chain reactions, gas chromatography-mass spectrometry, and bioassays. The sysr1-OX plants exhibited considerably increased ADH activity and tolerance to salt stress conditions. Additionally, the expression levels of several stress-responsive genes were upregulated. Moreover, airborne signals from salt-stressed sysr1-OX plants triggered salinity tolerance in neighboring wild-type (WT plants. Therefore, Sysr1 enhanced the interconversion of aldehydes to alcohols, and this occurrence might affect the quality of green leaf volatiles (GLVs in sysr1-OX plants. Actually, the Z-3-hexenol level was approximately twofold higher in sysr1-OX plants than in WT plants within 1–2 h of wounding. Furthermore, analyses of WT plants treated with vaporized GLVs indicated that Z-3-hexenol was a stronger inducer of stress-related gene expression and salt tolerance than E-2-hexenal. The results of the study suggested that increased C6 alcohol (Z-3-hexenol induced the expression of resistance genes, thereby enhancing salt tolerance of transgenic plants. Our results revealed a role for ADH in salinity stress responses, and the results provided a genetic engineering strategy that could improve the salt tolerance of crops.

T helper-2 cytokine/regulatory T-cell gene polymorphisms and their relation with risk of psoriasis in a South Indian Tamil cohort.

Science.gov (United States)

Indhumathi, Sundar; Rajappa, Medha; Chandrashekar, Laxmisha; Ananthanarayanan, Palghat Hariharan; Thappa, Devinder Mohan; Negi, Vir Singh

2017-02-01

Psoriasis is known to be associated with an up-regulation of T-helper (Th)-1 & Th-17 cytokines and a relative down-regulation of Th-2 and T-regulatory (T-reg) cytokines. Certain allelic variants of these cytokine genes may alter Th1/Th17 and Th2/T-reg balance and may be associated with the risk of psoriasis. Hence we aimed to determine the association of IL-4 (rs2243250), IL-10 (rs1800871 and rs1800896) and FOXP3 (rs3761548) gene polymorphisms with risk of psoriasis in South Indian Tamils. A total of 360 cases of psoriasis and 360 healthy controls were recruited. The polymorphism in IL-4 (rs2243250) & IL-10 (rs1800871) were typed by ARMS-PCR and IL-10 (rs1800896) & FOXP3 (rs3761548) were typed by TaqMan 5'allele discrimination assay. We observed that IL-4 (rs2243250) had a reduced risk of psoriasis, while the IL-10 (rs1800871) conferred an increased susceptibility to psoriasis, as compared with controls. However, IL-10 (rs1800896) and FOXP3 (rs3761548) gene polymorphisms were not associated with psoriasis risk. The plasma IL-4 levels was not different between the cases and controls, however the heterozygous CT genotype demonstrated significant high IL-4 levels. Plasma IL-10 levels were significantly increased in cases compared to controls, however none of the genotypes were associated with the plasma IL-10 levels. Our results suggest that IL-4 (rs2243250) polymorphism is protective against psoriasis, while IL-10 (rs1800871) polymorphism confers increased risk of psoriasis in South Indian Tamils. Detection of these genetic variants as predictive risk factors may lead to the selection of patient-tailored therapy to maximize the effectiveness of therapy. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

OpenAIRE

Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

1994-01-01

The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

NIH Consensus Conference. Acupuncture.

Science.gov (United States)

1998-11-04

To provide clinicians, patients, and the general public with a responsible assessment of the use and effectiveness of acupuncture to treat a variety of conditions. A nonfederal, nonadvocate, 12-member panel representing the fields of acupuncture, pain, psychology, psychiatry, physical medicine and rehabilitation, drug abuse, family practice, internal medicine, health policy, epidemiology, statistics, physiology, biophysics, and the representatives of the public. In addition, 25 experts from these same fields presented data to the panel and a conference audience of 1200. Presentations and discussions were divided into 3 phases over 2 1/2 days: (1) presentations by investigators working in areas relevant to the consensus questions during a 2-day public session; (2) questions and statements from conference attendees during open discussion periods that were part of the public session; and (3) closed deliberations by the panel during the remainder of the second day and morning of the third. The conference was organized and supported by the Office of Alternative Medicine and the Office of Medical Applications of Research, National Institutes of Health, Bethesda, Md. The literature, produced from January 1970 to October 1997, was searched through MEDLINE, Allied and Alternative Medicine, EMBASE, and MANTIS, as well as through a hand search of 9 journals that were not indexed by the National Library of Medicine. An extensive bibliography of 2302 references was provided to the panel and the conference audience. Expert speakers prepared abstracts of their own conference presentations with relevant citations from the literature. Scientific evidence was given precedence over clinical anecdotal experience. The panel, answering predefined questions, developed their conclusions based on the scientific evidence presented in the open forum and scientific literature. The panel composed a draft statement, which was read in its entirety and circulated to the experts and the audience

Conference Scene: Personalized Medicine comes to Harvard.

Science.gov (United States)

Greenberg, Tarryn

2012-01-01

The Seventh Annual Harvard Personalized Medicine Conference was held at The Joseph B Martin Conference Center at the Harvard Medical School in Boston, MA, USA on the 9-10 November 2011. The 2-day conference program was designed to highlight the impact that personalized medicine is currently making clinically as it enters the healthcare delivery system. Going forward, policies, plans and actions of stakeholders including those from government, academia and the private sector need to be informed and guided by recent experience - all of which the conference program set out to explore. The conference attracted over 600 national and international thought leaders all involved in personalized healthcare.

PREFACE: Proceedings of the 2nd International Conference on Quantum Simulators and Design (Tokyo, Japan, 31 May-3 June 2008) Proceedings of the 2nd International Conference on Quantum Simulators and Design (Tokyo, Japan, 31 May-3 June 2008)

Science.gov (United States)

Akai, Hisazumi; Tsuneyuki, Shinji

2009-02-01

This special issue of Journal of Physics: Condensed Matter comprises selected papers from the proceedings of the 2nd International Conference on Quantum Simulators and Design (QSD2008) held in Tokyo, Japan, between 31 May and 3 June 2008. This conference was organized under the auspices of the Development of New Quantum Simulators and Quantum Design Grant-in-Aid for Scientific Research on Priority Areas, Ministry of Education, Culture, Sports, Science and Technology of Japan (MEXT). The conference focused on the development of first principles electronic structure calculations and their applications. The aim was to provide an opportunity for discussion on the progress in computational materials design and, in particular, the development of quantum simulators and quantum design. Computational materials design is a computational approach to the development of new materials. The essential ingredient is the use of quantum simulators to design a material that meets a given specification of properties and functionalities. For this to be successful, the quantum simulator should be very reliable and be applicable to systems of realistic size. During the conference, new methods of quantum simulation and quantum design were discussed including methods beyond the local density approximation of density functional theory, order-N methods, methods dealing with excitations and reactions, and the application of these methods to the design of novel materials, devices and systems. The conference provided an international forum for experimental and theoretical researchers to exchange ideas. A total of 220 delegates from eight countries participated in the conference. There were 13 invited talks, ten oral presentations and 120 posters. The 3rd International Conference on Quantum Simulators and Design will be held in Germany in the autumn of 2011.

20th Annual Systems Engineering Conference, Thursday, Volume 4

Science.gov (United States)

2017-10-26

20th Annual Systems Engineering Conference October 23-26, 2017 | Waterford at Springfield | Springfield, VA NDIA.org/systemsengineering...Conference Program SYSTEMS ENGINEERING CONFERENCE 2 Welcome to the NDIA Systems Engineering Conference On behalf of the National Defense Industrial...Association’s Systems Engineering Division, I would like to extend a very warm welcome to the 20th Annual Systems Engineering Conference. Yes, the 20th Annual

Hosting an eConference: Interactive video conference grand rounds between two institutions

Directory of Open Access Journals (Sweden)

Jeffrey Rixe

2018-01-01

Full Text Available Audience: The eConference is an interactive video conference grand rounds innovation to augment the didactic curriculum provided for medical students, interns, residents, fellows, and attending physicians. Introduction: Formal education during emergency medicine (EM training has historically emphasized aspects of humanism and constructivism; the former through self-directed reading in books and journals, the latter through the content and discussion during resident didactics.1 However, some studies suggest that the current generation of EM learners are increasingly using digital and internet technologies to connect with online peer networks, a phenomenon known as connectivism.2 As such, contemporary EM learners are increasingly utilizing social media and Free Open Access Medical Education (FOAM to supplement traditional learning resources. The eConference was developed to be an interactive, virtual grand rounds that marries the merits of constructivism with connectivism; a new format of EM didactics that goes beyond the “typical lecture” model to incorporate the changing landscape in technology and medical education by combining classroom teaching at multiple institutions alongside digital learning tools. This manuscript outlines how to plan and execute a joint video conference with another institution. Objectives: Our objectives were to create and implement a novel virtual conference format through the integration of social media tools which allows for interdisciplinary and multi-site participation to enhance EM resident education. We wish to outline the steps required to reproduce this innovative session and share lessons learned. Conclusion: We designed and executed a multi-centered, novel form of virtual conference into the EM residency curriculum at two participating institutions. The virtual conference took place during a routine conference day for both programs, an hour in duration. The format utilized a hybrid of live and virtual

Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

Science.gov (United States)

Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

2015-10-01

Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

4. International reservoir characterization technical conference

Energy Technology Data Exchange (ETDEWEB)

NONE

1997-04-01

This volume contains the Proceedings of the Fourth International Reservoir Characterization Technical Conference held March 2-4, 1997 in Houston, Texas. The theme for the conference was Advances in Reservoir Characterization for Effective Reservoir Management. On March 2, 1997, the DOE Class Workshop kicked off with tutorials by Dr. Steve Begg (BP Exploration) and Dr. Ganesh Thakur (Chevron). Tutorial presentations are not included in these Proceedings but may be available from the authors. The conference consisted of the following topics: data acquisition; reservoir modeling; scaling reservoir properties; and managing uncertainty. Selected papers have been processed separately for inclusion in the Energy Science and Technology database.

A variant in CDKAL1 influences insulin response and risk of type 2 diabetes

DEFF Research Database (Denmark)

Steinthorsdottir, Valgerdur; Thorleifsson, Gudmar; Reynisdottir, Inga

2007-01-01

We conducted a genome-wide association study for type 2 diabetes (T2D) in Icelandic cases and controls, and we found that a previously described variant in the transcription factor 7-like 2 gene (TCF7L2) gene conferred the most significant risk. In addition to confirming two recently identified...... risk variants, we identified a variant in the CDKAL1 gene that was associated with T2D in individuals of European ancestry (allele-specific odds ratio (OR) = 1.20 (95% confidence interval, 1.13-1.27), P = 7.7 x 10(-9)) and individuals from Hong Kong of Han Chinese ancestry (OR = 1.25 (1.11-1.40), P = 0...... was approximately 20% lower than for heterozygotes or noncarriers, suggesting that this variant confers risk of T2D through reduced insulin secretion....

AMA Conferences 2015. SENSOR 2015. 17th international conference on sensors and measurement technology. IRS2 2015. 14th international conference on infrared sensors and systems. Proceedings

International Nuclear Information System (INIS)

2015-01-01

This meeting paper contains presentations of two conferences: SENSOR 2015 and IRS 2 (= International conference on InfraRed Sensors and systems). The first part of SENSOR 2015 contains the following chapters: (A) SENSOR PRINCIPLES: A.1: Mechanical sensors; A.2: Optical sensors; A.3: Ultrasonic sensors; A.4: Microacoustic sensors; A.5: Magnetic sensors; A.6: Impedance sensors; A.7: Gas sensors; A.8: Flow sensors; A.9: Dimensional measurement; A.10: Temperature and humidity sensors; A.11: Chemosensors; A.12: Biosensors; A.13: Embedded sensors; A.14: Sensor-actuator systems; (B) SENSOR TECHNOLOGY: B.1: Sensor design; B.2: Numerical simulation of sensors; B.3: Sensor materials; B.4: MEMS technology; B.5: Micro-Nano-Integration; B.6: Packaging; B.7: Materials; B.8: Thin films; B.9: Sensor production; B.10: Sensor reliability; B.11: Calibration and testing; B.12: Optical fibre sensors. (C) SENSOR ELECTRONICS AND COMMUNICATION: C.1: Sensor electronics; C.2: Sensor networks; C.3: Wireless sensors; C.4: Sensor communication; C.5: Energy harvesting; C.6: Measuring systems; C.7: Embedded systems; C.8: Self-monitoring and diagnosis; (D) APPLICATIONS: D.1: Medical measuring technology; D.2: Ambient assisted living; D.3: Process measuring technology; D.4: Automotive; D.5: Sensors in energy technology; D.6: Production technology; D.7: Security technology; D.8: Smart home; D.9: Household technology. The second part with the contributions of the IRS 2 2015 is structured as follows: (E) INFRARED SENSORS: E.1: Photon detectors; E.2: Thermal detectors; E.3: Cooled detectors; E.4: Uncooled detectors; E.5: Sensor modules; E.6: Sensor packaging. (G) INFRARED SYSTEMS AND APPLICATIONS: G.1: Thermal imaging; G.2: Pyrometry / contactless temperature measurement; G.3: Gas analysis; G.4: Spectroscopy; G.5: Motion control and presence detection; G.6: Security and safety monitoring; G.7: Non-destructive testing; F: INFRARED SYSTEM COMPONENTS: F.1: Infrared optics; F.2: Optical modulators; F.3

Proceedings of the 16th International ECOS conference. Volume 1, 2, and 3

DEFF Research Database (Denmark)

Houbak, Niels; Elmegaard, Brian; Qvale, Einar Bjørn

The members of the Organizing and the Scientific Committees of ECOS 2003 are pleased to present these Proceedings of the Conference. This is the sixteenth in the series of international conferences that started in Rome in 1987. The slogan chosen for this years conference "Bridge to Our Energy...... in recent years. ECOS 2003 distinguishes itself through the quality and quantity of the papers submitted for presentation. Without the effort of dedicated researchers and authors from all over the world, this conference could not have taken place. We recognize and appreciate the creativity and work...... overall national planning to technological development, from government-initiated development of market forces to the completely liberalized market, from government-supported development to private investment opportunities, and from centralized generation of electricity from fossil fuels to distributed...

Association of TCF7L2 gene polymorphisms with T2DM in the population of Hyderabad, India.

Directory of Open Access Journals (Sweden)

Kommoju Uma Jyothi

Full Text Available We attempt to evaluate the nature of association of TCF7L2 gene variants with T2DM, for the first time in the population of Hyderabad, which is considered to be diabetic capital of India. It is a case-control study of the three SNPs of TCF7L2, rs7903146, rs12255372 and rs11196205, genotyped on Sequenom Massarray platform, in a sample of 758 patients and 621 controls. The risk allele frequency of the three SNPs was found to be significantly higher in the T2DM cases than controls, implicating susceptibility for diabetes (p<0.01. The greatest risk of developing the disease was conferred by rs7903146. Further, the logistic regression of genotypes of each SNP under log additive model, and the haplotypes constituted by at least one of the three risk alleles also show significantly greater risk of developing T2DM when compared to the wild type haplotype. Further, BMI and WHR emerge as significant covariates with confounding effects. The strong association of the TCF7L2 SNPs with T2DM is consistent with the findings among other Indian and Non-Indian populations, suggesting universal phenomena of its association across ethnic groups globally, both within and outside the Indian subcontinent, albeit the functional relevance of these SNPs needs yet to be established.

The 2nd international conference on CANDU maintenance. Proceedings

International Nuclear Information System (INIS)

1992-01-01

The conference mainly dealt with all aspects of the maintenance of CANDU power plants, but also included some papers on PWR plants, one on a coal-burning station, and one on robotics for fusion. Volume 1 includes sessions on the following topics: Plenary, Human performance, Maintenance planning and resourcing, Life cycle management, Maintenance cost evaluation and control, Use of special teams, Innovative maintenance techniques, Remote tooling, Reactivity maintenance, Reactor maintenance, Steam generator experience. Out of 34 papers listed under these sessions, one was published as an appendix to Vol. 2, two were published only as loose papers in a virtual supplement, and nine were not published in the proceedings at all. The individual papers have been abstracted separately

2nd International Conference on Communication and Computer Engineering

CERN Document Server

Othman, Mohd; Othman, Mohd; Rahim, Yahaya; Pee, Naim

2016-01-01

This book covers diverse aspects of advanced computer and communication engineering, focusing specifically on industrial and manufacturing theory and applications of electronics, communications, computing and information technology. Experts in research, industry, and academia present the latest developments in technology, describe applications involving cutting-edge communication and computer systems, and explore likely future trends. In addition, a wealth of new algorithms that assist in solving computer and communication engineering problems are presented. The book is based on presentations given at ICOCOE 2015, the 2nd International Conference on Communication and Computer Engineering. It will appeal to a wide range of professionals in the field, including telecommunication engineers, computer engineers and scientists, researchers, academics and students.

7. Eurasia Conference on Chemical Sciences (abstracts)

International Nuclear Information System (INIS)

Atta-ur-Rahman; Choudhary, M.I.

2002-01-01

The 7th Eurasia Conference on Chemical sciences (EuAs/sub 2/S-7) was held from 8-12 March, 2002 at Karachi, Pakistan. Scientists from thirty different countries had participated in this conference. Several topics from chemical world were highlighted in this conference including use of radioisotopes in different fields and specially environment which have been included here. (A.B)

Conference Report: The First ATLAS.ti User Conference

Directory of Open Access Journals (Sweden)

Jeanine C. Evers

2014-01-01

Full Text Available This report on the First ATLAS.ti User Conference shares our impressions and experiences as longstanding ATLAS.ti users and trainers about the First ATLAS.ti User Conference in Berlin 2013. The origins, conceptual principles and development of the program are outlined, the conference themes discussed and experiences shared. Finally, the future of the program is discussed. URN: http://nbn-resolving.de/urn:nbn:de:0114-fqs1401197

MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

Science.gov (United States)

Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.

2014-01-01

MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. We explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. Taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs. PMID:25330340

Using the 2A Protein Coexpression System: Multicistronic 2A Vectors Expressing Gene(s) of Interest and Reporter Proteins.

Science.gov (United States)

Luke, Garry A; Ryan, Martin D

2018-01-01

To date, a huge range of different proteins-many with cotranslational and posttranslational subcellular localization signals-have been coexpressed together with various reporter proteins in vitro and in vivo using 2A peptides. The pros and cons of 2A co-expression technology are considered below, followed by a simple example of a "how to" protocol to concatenate multiple genes of interest, together with a reporter gene, into a single gene linked via 2As for easy identification or selection of transduced cells.

Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

DEFF Research Database (Denmark)

Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

2005-01-01

Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

Proceedings of the Third international conference 'Interaction of radiation with solids'. Part 2

International Nuclear Information System (INIS)

Anishchik, V.M.; Zhukova, S.I.; Ponaryadov, V.V.; Popok, V.N.; Prikhod'ko, Zh.L.

1999-10-01

The 128 collected papers form the Proceedings of the International Conference 'Interaction of Radiation with Solids'. This Conference is the third forum biennially gathering in Minsk the specialists from different countries. The scope of the problems considered at the Conference is widening steadily from year to year including the recent results and most advanced leads in the field of radiation physics of condensed matter. In the second part of the proceedings consideration is being given to 'Properties modification of materials ' and 'Equipment and technologies'

A parasitic selfish gene that affects host promiscuity

OpenAIRE

Giraldo-Perez, Paulina; Goddard, Matthew R.

2013-01-01

Selfish genes demonstrate transmission bias and invade sexual populations despite conferring no benefit to their hosts. While the molecular genetics and evolutionary dynamics of selfish genes are reasonably well characterized, their effects on hosts are not. Homing endonuclease genes (HEGs) are one well-studied family of selfish genes that are assumed to be benign. However, we show that carrying HEGs is costly for Saccharomyces cerevisiae, demonstrating that these genetic elements are not nec...

Learning about the Earth as a System. International Conference on Geoscience Education Conference Proceedings (2nd, Hilo, HI, July 28-31, 1997).

Science.gov (United States)

Fortner, Rosanne W., Ed.; Mayer, Victor J., Ed.

Learning about the earth as a system was the focus of the 1997 International Conference on Geoscience Education. This proceedings contains details on the organization of the conference as well as five general sessions by various participants. The interactive poster sessions are organized according to three themes: (1) Earth Systems/Science…

The variant rs1867277 in FOXE1 gene confers thyroid cancer susceptibility through the recruitment of USF1/USF2 transcription factors.

Directory of Open Access Journals (Sweden)

Iñigo Landa

2009-09-01

Full Text Available In order to identify genetic factors related to thyroid cancer susceptibility, we adopted a candidate gene approach. We studied tag- and putative functional SNPs in genes involved in thyroid cell differentiation and proliferation, and in genes found to be differentially expressed in thyroid carcinoma. A total of 768 SNPs in 97 genes were genotyped in a Spanish series of 615 cases and 525 controls, the former comprising the largest collection of patients with this pathology from a single population studied to date. SNPs in an LD block spanning the entire FOXE1 gene showed the strongest evidence of association with papillary thyroid carcinoma susceptibility. This association was validated in a second stage of the study that included an independent Italian series of 482 patients and 532 controls. The strongest association results were observed for rs1867277 (OR[per-allele] = 1.49; 95%CI = 1.30-1.70; P = 5.9x10(-9. Functional assays of rs1867277 (NM_004473.3:c.-283G>A within the FOXE1 5' UTR suggested that this variant affects FOXE1 transcription. DNA-binding assays demonstrated that, exclusively, the sequence containing the A allele recruited the USF1/USF2 transcription factors, while both alleles formed a complex in which DREAM/CREB/alphaCREM participated. Transfection studies showed an allele-dependent transcriptional regulation of FOXE1. We propose a FOXE1 regulation model dependent on the rs1867277 genotype, indicating that this SNP is a causal variant in thyroid cancer susceptibility. Our results constitute the first functional explanation for an association identified by a GWAS and thereby elucidate a mechanism of thyroid cancer susceptibility. They also attest to the efficacy of candidate gene approaches in the GWAS era.

The Variant rs1867277 in FOXE1 Gene Confers Thyroid Cancer Susceptibility through the Recruitment of USF1/USF2 Transcription Factors

Science.gov (United States)

Montero-Conde, Cristina; Inglada-Pérez, Lucía; Schiavi, Francesca; Leskelä, Susanna; Pita, Guillermo; Milne, Roger; Maravall, Javier; Ramos, Ignacio; Andía, Víctor; Rodríguez-Poyo, Paloma; Jara-Albarrán, Antonino; Meoro, Amparo; del Peso, Cristina; Arribas, Luis; Iglesias, Pedro; Caballero, Javier; Serrano, Joaquín; Picó, Antonio; Pomares, Francisco; Giménez, Gabriel; López-Mondéjar, Pedro; Castello, Roberto; Merante-Boschin, Isabella; Pelizzo, Maria-Rosa; Mauricio, Didac; Opocher, Giuseppe; Rodríguez-Antona, Cristina; González-Neira, Anna; Matías-Guiu, Xavier; Santisteban, Pilar; Robledo, Mercedes

2009-01-01

In order to identify genetic factors related to thyroid cancer susceptibility, we adopted a candidate gene approach. We studied tag- and putative functional SNPs in genes involved in thyroid cell differentiation and proliferation, and in genes found to be differentially expressed in thyroid carcinoma. A total of 768 SNPs in 97 genes were genotyped in a Spanish series of 615 cases and 525 controls, the former comprising the largest collection of patients with this pathology from a single population studied to date. SNPs in an LD block spanning the entire FOXE1 gene showed the strongest evidence of association with papillary thyroid carcinoma susceptibility. This association was validated in a second stage of the study that included an independent Italian series of 482 patients and 532 controls. The strongest association results were observed for rs1867277 (OR[per-allele] = 1.49; 95%CI = 1.30–1.70; P = 5.9×10−9). Functional assays of rs1867277 (NM_004473.3:c.−283G>A) within the FOXE1 5′ UTR suggested that this variant affects FOXE1 transcription. DNA-binding assays demonstrated that, exclusively, the sequence containing the A allele recruited the USF1/USF2 transcription factors, while both alleles formed a complex in which DREAM/CREB/αCREM participated. Transfection studies showed an allele-dependent transcriptional regulation of FOXE1. We propose a FOXE1 regulation model dependent on the rs1867277 genotype, indicating that this SNP is a causal variant in thyroid cancer susceptibility. Our results constitute the first functional explanation for an association identified by a GWAS and thereby elucidate a mechanism of thyroid cancer susceptibility. They also attest to the efficacy of candidate gene approaches in the GWAS era. PMID:19730683

Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

Directory of Open Access Journals (Sweden)

Xi-Yin Wang

2011-01-01

Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

Proceedings of the 2nd Mediterranean Conference on Information Technology Applications (ITA '97)

International Nuclear Information System (INIS)

Spyrou, S.

1997-01-01

This is the proceedings of the 2nd Mediterranean Conference on Information Technology Applications, held in Nicosia, Cyprus, between 6-7 November, 1997. It contains 16 papers. Two of these fall within the scope of INIS and are dealing with Telemetry, Radiation Monitoring, Environment Monitoring, Radiation Accidents, Air Pollution Monitoring, Diagnosis, Computers, Radiology and Data Processing

Proceedings of the third international conference on containment design and operation. v.2

International Nuclear Information System (INIS)

1994-01-01

The third international conference on containment design and operation includes in volume 2 of the publication sessions on the following topics: structural analysis and response tests; passive safety systems; aerosol behaviour; containment reliability, integrity, and risk assessment; hydrogen deflagration and detonation. Due prominence was given to CANDU and other PHWR reactors. The individual papers have been abstracted separately

Proceedings of the third international conference on containment design and operation. v.2

Energy Technology Data Exchange (ETDEWEB)

NONE

1994-12-31

The third international conference on containment design and operation includes in volume 2 of the publication sessions on the following topics: structural analysis and response tests; passive safety systems; aerosol behaviour; containment reliability, integrity, and risk assessment; hydrogen deflagration and detonation. Due prominence was given to CANDU and other PHWR reactors. The individual papers have been abstracted separately.

Proceedings of the 2nd Mediterranean Conference on Information Technology Applications (ITA `97)

Energy Technology Data Exchange (ETDEWEB)

Spyrou, S [ed.

1998-12-31

This is the proceedings of the 2nd Mediterranean Conference on Information Technology Applications, held in Nicosia, Cyprus, between 6-7 November, 1997. It contains 16 papers. Two of these fall within the scope of INIS and are dealing with Telemetry, Radiation Monitoring, Environment Monitoring, Radiation Accidents, Air Pollution Monitoring, Diagnosis, Computers, Radiology and Data Processing.

Clinical conferences for physicians: Who sets the agenda?

Science.gov (United States)

Abakumova, T R; Safina, A F; Ziganshina, L E

2015-01-01

Clinical conferences are generally defined as scheduled events at which practicing physicians themselves present to their colleagues interesting clinical cases, share their new experiences and learn about the latest achievements of medical science and practice. The value of a clinical conference is thought to be in direct communication between physicians, in analysis of topical issues in a given specialty with the aim to improve the quality of care. Speakers based on their own observations and studies reveal the most urgent problems, analyze results and offer potential decisions to their colleagues interested in the same questions. The event format may be different: workshops, highly specialized sections, round tables and seminars with participation of the leading specialists in a given field. These conferences are generally organised by the Ministries and Departments of Health, by leading research and/or educational institutions in the field, by recognised medical centres and other institutions. Recently pharmaceutical companies got actively involved in medical events, acting as sponsors of various scientific conferences and congresses, however threatening the mission of these events [1]. This brings up some uneasy questions: who are the medical conferences for? Who is in charge of setting the conference agenda? Do they contribute to evidence-based medicine; do they contribute to better health? Unfortunately, there is a trend to duplication or multiplication of conferences: various agencies and departments deliver the same conferences, presentations at which are often pre-arranged by pharmaceutical companies and do not have clear scientific novelty, while the conferences themselves have largely transformed into advertising of new pharmaceuticals or new technologies [2]. Pharmaceutical corporations sponsor invited speakers paying for their trips and paying honoraria, organising cocktail parties as part of medical activities. With the help of leading experts with

11th International Conference of Radiation Research

Energy Technology Data Exchange (ETDEWEB)

NONE

1999-07-18

Topics discussed in the conference included the following: Radiation Physics, Radiation Chemistry and modelling--Radiation physics and dosimetry; Electron transfer in biological media; Radiation chemistry; Biophysical and biochemical modelling; Mechanisms of DNA damage; Assays of DNA damage; Energy deposition in micro volumes; Photo-effects; Special techniques and technologies; Oxidative damage. Molecular and cellular effects-- Photobiology; Cell cycle effects; DNA damage: Strand breaks; DNA damage: Bases; DNA damage Non-targeted; DNA damage: other; Chromosome aberrations: clonal; Chromosomal aberrations: non-clonal; Interactions: Heat/Radiation/Drugs; Biochemical effects; Protein expression; Gene induction; Co-operative effects; ``Bystander'' effects; Oxidative stress effects; Recovery from radiation damage. DNA damage and repair -- DNA repair genes; DNA repair deficient diseases; DNA repair enzymology; Epigenetic effects on repair; and Ataxia and ATM.

An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

Science.gov (United States)

Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

1999-03-01

The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

1st Complex Systems Digital Campus World E-Conference 2015

CERN Document Server

Bourgine, Paul; Collet, Pierre

2017-01-01

This book contains the proceedings as well as invited papers for the first annual conference of the UNESCO Unitwin Complex System Digital Campus (CSDC), which is an international initiative gathering 120 Universities on four continents, and structured in ten E-Departments. First Complex Systems Digital Campus World E-Conference 2015 features chapters from the latest research results on theoretical questions of complex systems and their experimental domains. The content contained bridges the gap between the individual and the collective within complex systems science and new integrative sciences on topics such as: genes to organisms to ecosystems, atoms to materials to products, and digital media to the Internet. The conference breaks new ground through a dedicated video-conferencing system – a concept at the heart of the international UNESCO UniTwin, embracing scientists from low-income and distant countries. This book promotes an integrated system of research, education, and training. It also aims at contr...

Mapping of Ppd-B1, a Major Candidate Gene for Late Heading on Wild Emmer Chromosome Arm 2BS and Assessment of Its Interactions with Early Heading QTLs on 3AL.

Science.gov (United States)

Zhou, Wei; Wu, Shasha; Ding, Mingquan; Li, Jingjuan; Shi, Zhaobin; Wei, Wei; Guo, Jialian; Zhang, Hua; Jiang, Yurong; Rong, Junkang

2016-01-01

Wheat heading date is an important agronomic trait determining maturation time and yield. A set of common wheat (Triticum aestivum var. Chinese Spring; CS)-wild emmer (T. turgidum L. subsp. dicoccoides (TDIC)) chromosome arm substitution lines (CASLs) was used to identify and allocate QTLs conferring late or early spike emergence by examining heading date. Genetic loci accelerating heading were found on TDIC chromosome arms 3AL and 7BS, while loci delaying heading were located on 4AL and 2BS. To map QTLs conferring late heading on 2BS, F2 populations derived from two cross combinations of CASL2BS × CS and CASL3AL × CASL2BS were developed and each planted at two times, constituting four F2 mapping populations. Heading date varied continuously among individuals of these four populations, suggesting quantitative characteristics. A genetic map of 2BS, consisting of 23 SSR and one single-stranded conformation polymorphism (SSCP) marker(s), was constructed using these F2 populations. This map spanned a genetic length of 53.2 cM with average marker density of 2.3 cM. The photoperiod-sensitivity gene Ppd-B1 was mapped to chromosome arm 2BS as a SSCP molecular marker, and was validated as tightly linked to a major QTL governing late heading of CASL2BS in all mapping populations. A significant dominance by additive effect of Ppd-B1 with the LUX gene located on 3AL was also detected. CS had more copies of Ppd-B1 than CASL2BS, implying that increased copy number could elevate the expression of Ppd-1 in CS, also increasing expression of LUX and FT genes and causing CS to have an earlier heading date than CASL2BS in long days.

Highlights of the 2nd session of the General Conference

Energy Technology Data Exchange (ETDEWEB)

NONE

1959-01-15

The debates of the Conference were based on the 'First Annual Report to the General Conference' (GC(n)/39) covering the period 23 October 1957 to 30 June 1958, the 'Programme and Budget for 1959' (GC(H)/36) both submitted by the Board of Governors and on the statement made by the Director General on 22 September 1958 (GC(II)OR. 14) which brought the survey of the Agency's activities up-to-date. Delegates appraised the first year's achievements and many speakers emphasized the importance of close international co-operation in the field of atomic energy and dealt with the role the IAEA was called upon to play. Referring to the offers of various and in particular fissionable materials several delegates supported the statement made by the Director General in his opening address that some preferential treatment must be given the Agency by the offering countries thereby providing some inducement for governments to utilize the channels of true international co-operation. Issues concerning safeguards and reactors were discussed. The Conference finally recommended that the Board of Governors should give earnest and early consideration to initiating action for a survey to be made of the needs of the less developed countries in the matter of nuclear power generation plants, and to the adoption of measures for continuing study regarding the development of technology and economics of small and medium scale nuclear power reactors best suited for less developed countries, and assisting them in planning and implementing their training programmes in that connection. The Conference, finally, voted in favour of the appropriations necessary for the setting up of laboratory facilities. Practically all delegates agreed, although with varying emphasis, on the importance of technical assistance and other activities of the IAEA which would soonest benefit the less advanced countries. The General Conference finally approved by 59 votes, none against and one abstention the Board of Governors

The restriction-modification genes of Escherichia coli K-12 may not be selfish: they do not resist loss and are readily replaced by alleles conferring different specificities.

Science.gov (United States)

O'Neill, M; Chen, A; Murray, N E

1997-12-23

Type II restriction and modification (R-M) genes have been described as selfish because they have been shown to impose selection for the maintenance of the plasmid that encodes them. In our experiments, the type I R-M system EcoKI does not behave in the same way. The genes specifying EcoKI are, however, normally residents of the chromosome and therefore our analyses were extended to monitor the deletion of chromosomal genes rather than loss of plasmid vector. If EcoKI were to behave in the same way as the plasmid-encoded type II R-M systems, the loss of the relevant chromosomal genes by mutation or recombination should lead to cell death because the cell would become deficient in modification enzyme and the bacterial chromosome would be vulnerable to the restriction endonuclease. Our data contradict this prediction; they reveal that functional type I R-M genes in the chromosome are readily replaced by mutant alleles and by alleles encoding a type I R-M system of different specificity. The acquisition of allelic genes conferring a new sequence specificity, but not the loss of the resident genes, is dependent on the product of an unlinked gene, one predicted [Prakash-Cheng, A., Chung, S. S. & Ryu, J. (1993) Mol. Gen. Genet. 241, 491-496] to be relevant to control of expression of the genes that encode EcoKI. Our evidence suggests that not all R-M systems are evolving as "selfish" units; rather, the diversity and distribution of the family of type I enzymes we have investigated require an alternative selective pressure.

Gene2Function: An Integrated Online Resource for Gene Function Discovery

Directory of Open Access Journals (Sweden)

Yanhui Hu

2017-08-01

Full Text Available One of the most powerful ways to develop hypotheses regarding the biological functions of conserved genes in a given species, such as humans, is to first look at what is known about their function in another species. Model organism databases and other resources are rich with functional information but difficult to mine. Gene2Function addresses a broad need by integrating information about conserved genes in a single online resource.

Tamoxifen and CYP2D6

DEFF Research Database (Denmark)

Cronin-Fenton, Deirdre P.; Damkier, Per

2018-01-01

Tamoxifen reduces the rate of breast cancer recurrence by about one-half. It is converted to more active metabolites by enzymes encoded by polymorphic genes, including cytochrome P450 2D6 (CYP2D6) and transported by ATP-binding cassette transporters. Genetic polymorphisms that confer reduced CYP2...

Indico CONFERENCE tutorial

CERN Multimedia

CERN. Geneva; Manzoni, Alex Marc

2017-01-01

This short tutorial explains how to create a CONFERENCE in indico and how to handle abstracts and registration forms, in detail: Timestamps: 1:01 - Programme  2:28 - Call for abstracts  11:50 - Abstract submission  13:41 - Abstract Review 15:41 - The Judge's Role 17:23 - Registration forms' creation 23:34 - Candidate participant's registration/application 25:54 - Customisation of Indico pages - Layout 28:08 - Customisation of Indico pages - Menus 29:47 - Configuring Event reminders and import into calendaring tools   See HERE a recent presentation by Pedro about the above steps in the life of an indico CONFERENCE event.

Partnering for functional genomics research conference: Abstracts of poster presentations

Energy Technology Data Exchange (ETDEWEB)

NONE

1998-06-01

This reports contains abstracts of poster presentations presented at the Functional Genomics Research Conference held April 16--17, 1998 in Oak Ridge, Tennessee. Attention is focused on the following areas: mouse mutagenesis and genomics; phenotype screening; gene expression analysis; DNA analysis technology development; bioinformatics; comparative analyses of mouse, human, and yeast sequences; and pilot projects to evaluate methodologies.

A Variation in the Cerebroside Sulfotransferase Gene Is Linked to Exercise-Modified Insulin Resistance and to Type 2 Diabetes

Directory of Open Access Journals (Sweden)

A. Roeske-Nielsen

2009-01-01

Full Text Available Aims. The glycosphingolipid β-galactosylceramide-3-O-sulfate (sulfatide is present in the secretory granules of the insulin producing β-cells and may act as a molecular chaperone of insulin. The final step in sulfatide synthesis is performed by cerebroside sulfotransferase (CST (EC 2.8.2.11. The aim of this study was to investigate whether two single nucleotide polymorphisms (SNP, rs2267161 located in an exon or rs42929 located in an intron, in the gene encoding CST are linked to type 2 diabetes (T2D. Methods. As a population survey, 265 male and female patients suffering from T2D and 291 gender matched controls were examined. Results. A higher proportion of T2D patients were heterozygous at SNP rs2267161 with both T (methionine and C (valine alleles present (49.8% versus 41.3%, P=.04. The calculated odd risk for T2D was 1.47 (1.01–2.15, P=.047. Among female controls, the homozygous CC individuals displayed lower insulin resistance measured by HOMA-IR (P=.05 than the C/T or TT persons; this was particularly prevalent in individuals who exercise (P=.03. Conclusion. Heterozygosity at SNP rs2267161 in the gene encoding the CST enzyme confers increased risk of T2D. Females with the CC allele showed lower insulin resistance.

CDX2 gene expression in acute lymphoblastic leukemia

International Nuclear Information System (INIS)

Arnaoaut, H.H.; Mokhtar, D.A.; Samy, R.M.; Omar, Sh.A.; Khames, S.A.

2014-01-01

CDX genes are classically known as regulators of axial elongation during early embryogenesis. An unsuspected role for CDX genes has been revealed during hematopoietic development. The CDX gene family member CDX2 belongs to the most frequent aberrantly expressed proto-oncogenes in human acute leukemias and is highly leukemogenic in experimental models. We used reversed transcriptase polymerase chain reaction (RT-PCR) to determine the expression level of CDX2 gene in 30 pediatric patients with acute lymphoblastic leukemia (ALL) at diagnosis and 30 healthy volunteers. ALL patients were followed up to detect minimal residual disease (MRD) on days 15 and 42 of induction. We found that CDX2 gene was expressed in 50% of patients and not expressed in controls. Associations between gene expression and different clinical and laboratory data of patients revealed no impact on different findings. With follow up, we could not confirm that CDX2 expression had a prognostic significance.

Veterans in Society Conference 2014: Humanizing the Discourse (Conference Program)

OpenAIRE

Virginia Tech. Department of English. Center for the Study of Rhetoric in Society; Virginia Tech. Veterans Studies Group

2014-01-01

This program lists the daily sessions, presentations, and events that took place during the 2014 Veterans in Society Conference, which was held from April 27-28, 2014 at the Hotel Roanoke in Roanoke, VA. This program also includes speaker and presenter bios, descriptions of unrecorded conference events, and a letter from conference co-chair Jim Dubinsky, the director of Virginia Tech's Center for the Study of Rhetoric in Society. The 2014 Veterans in Society Conference: Humanizing the Discour...

INTERCARTO CONFERENCES

Directory of Open Access Journals (Sweden)

Vladimir Tikunov

2010-01-01

Full Text Available The InterCarto conferences are thematically organized to target one of the most pressing problems of modern geography—creation and use of geographical information systems (GISs as effective tools for achieving sustainable development of territories. Over the years, from 1994 to 2009, 1872 participants from 51 countries and 156 cities, who made 1494 reports, attended the conferences. There were 1508 participants from 49 regions of Russia making 1340 presentations. The conferences hosted 31 different sections, most popular of which were Environmental GIS-Projects: Development and Experience, Sustainable Development and Innovative Projects, GIS: the Theory and Methodology, Projects for Russia and Regions, and GIS-Technologies and Digital Mapping. The next annual InterCarto-InterGIS conference will take place in December 2011. The Russian component of the conference will be held in the Altay Kray followed by another meeting on Bali, Indonesia

Fifth French-German Conference on Optimization

CERN Document Server

1989-01-01

The 2-yearly French-German Conferences on Optimization review the state-of-the-art and the trends in the field. The proceedings of the Fifth Conference include papers on projective methods in linear programming (special session at the conference), nonsmooth optimization, two-level optimization, multiobjective optimization, partial inverse method, variational convergence, Newton type algorithms and flows and on practical applications of optimization. A. Ioffe and J.-Ph. Vial have contributed survey papers on, respectively second order optimality conditions and projective methods in linear programming.

Regulation of radiation-induced apoptosis by early growth response-1 gene in solid tumors

International Nuclear Information System (INIS)

Ahmed, M.

2003-01-01

Ionizing radiation exposure is associated with activation of certain immediate-early genes that function as transcription factors. These include members of jun or fos and early growth response (EGR) gene families. In particular, the functional role of EGR-1 in radiation-induced signaling is pivotal since the promoter of EGR-1 contains radiation-inducible CArG DNA sequences. The Egr-1 gene belongs to a family of Egr genes that includes EGR-2, EGR-3, EGR-4, EGR-α and the tumor suppressor, Wilms' tumor gene product, WT1. The Egr-1 gene product, EGR-1, is a nuclear protein that contains three zinc fingers of the C 2 H 2 subtype. The EGR-1 GC-rich consensus target sequence, 5'-GCGT/GGGGCG-3' or 5'-TCCT/ACCTCCTCC-3', has been identified in the promoter regions of transcription factors, growth factors, receptors, cell cycle regulators and pro-apoptotic genes. The gene targets mediated by Egr-1 in response to ionizing radiation include TNF-α , p53, Rb and Bax, all these are effectors of apoptosis. Based on these targets, Egr-1 is a pivotal gene that initiates early signal transduction events in response to ionizing radiation leading to either growth arrest or cell death in tumor cells. There are two potential application of Egr-1 gene in therapy of cancer. First, the Egr-1 promoter contains information for appropriate spatial and temporal expression in-vivo that can be regulated by ionizing radiation to control transcription of genes that have pro-apoptotic and suicidal function. Secondly, EGR-1 protein can eliminate 'induced-radiation resistance' by inhibiting the functions of radiation-induced pro-survival genes (NFκB activity and bcl-2 expression) and activate pro-apoptotic genes (such as bax) to confer a significant radio-sensitizing effect. Together, the reported findings from my laboratory demonstrate clearly that EGR-1 is an early central gene that confers radiation sensitivity and its pro-apoptotic functions are synergized by abrogation of induced radiation

Internet conferences in glycobiology.

Science.gov (United States)

Hardy, B J; Doughty, S W; Parretti, M F; Tennison, J; Wilson, I

1997-09-01

In this article we describe recent activities in the use of electronic conferencing in glycobiology focusing on our experiences with the organization and development of the Second Electronic Glycoscience Conference (EGC-2), which was held on the Internet and World Wide Web in September 1996. EGC-2 involved the presentation and discussion of scientific research results in a virtual conferencing environment which incorporated virtual replicas of many activities usually observed at a physical conference in addition to features unique to the electronic medium. Highlights of the scientific program and technical developments in the design and use of these facilities are briefly described. EGC-3 will be held in October 1997.

AMA Conferences 2015. SENSOR 2015. 17th international conference on sensors and measurement technology. IRS{sup 2} 2015. 14th international conference on infrared sensors and systems. Proceedings

Energy Technology Data Exchange (ETDEWEB)

NONE

2015-07-01

This meeting paper contains presentations of two conferences: SENSOR 2015 and IRS{sup 2} (= International conference on InfraRed Sensors and systems). The first part of SENSOR 2015 contains the following chapters: (A) SENSOR PRINCIPLES: A.1: Mechanical sensors; A.2: Optical sensors; A.3: Ultrasonic sensors; A.4: Microacoustic sensors; A.5: Magnetic sensors; A.6: Impedance sensors; A.7: Gas sensors; A.8: Flow sensors; A.9: Dimensional measurement; A.10: Temperature and humidity sensors; A.11: Chemosensors; A.12: Biosensors; A.13: Embedded sensors; A.14: Sensor-actuator systems; (B) SENSOR TECHNOLOGY: B.1: Sensor design; B.2: Numerical simulation of sensors; B.3: Sensor materials; B.4: MEMS technology; B.5: Micro-Nano-Integration; B.6: Packaging; B.7: Materials; B.8: Thin films; B.9: Sensor production; B.10: Sensor reliability; B.11: Calibration and testing; B.12: Optical fibre sensors. (C) SENSOR ELECTRONICS AND COMMUNICATION: C.1: Sensor electronics; C.2: Sensor networks; C.3: Wireless sensors; C.4: Sensor communication; C.5: Energy harvesting; C.6: Measuring systems; C.7: Embedded systems; C.8: Self-monitoring and diagnosis; (D) APPLICATIONS: D.1: Medical measuring technology; D.2: Ambient assisted living; D.3: Process measuring technology; D.4: Automotive; D.5: Sensors in energy technology; D.6: Production technology; D.7: Security technology; D.8: Smart home; D.9: Household technology. The second part with the contributions of the IRS{sup 2} 2015 is structured as follows: (E) INFRARED SENSORS: E.1: Photon detectors; E.2: Thermal detectors; E.3: Cooled detectors; E.4: Uncooled detectors; E.5: Sensor modules; E.6: Sensor packaging. (G) INFRARED SYSTEMS AND APPLICATIONS: G.1: Thermal imaging; G.2: Pyrometry / contactless temperature measurement; G.3: Gas analysis; G.4: Spectroscopy; G.5: Motion control and presence detection; G.6: Security and safety monitoring; G.7: Non-destructive testing; F: INFRARED SYSTEM COMPONENTS: F.1: Infrared optics; F.2: Optical

Conference summaries. Canadian Nuclear Association 29. annual conference; Canadian Nuclear Society 10. annual conference

Energy Technology Data Exchange (ETDEWEB)

NONE

1990-12-31

Separate abstracts were prepared for 15 papers from the twenty-ninth Annual Conference of the Canadian Nuclear Association. Abstracts were also prepared for the 102 papers from the tenth Annual Conference of the Canadian Nuclear Society.

Conference summaries. Canadian Nuclear Association 29. annual conference; Canadian Nuclear Society 10. annual conference

International Nuclear Information System (INIS)

1989-01-01

Separate abstracts were prepared for 15 papers from the twenty-ninth Annual Conference of the Canadian Nuclear Association. Abstracts were also prepared for the 102 papers from the tenth Annual Conference of the Canadian Nuclear Society

2nd International Conference on Emerging Trends in Electrical, Communication and Information Technologies

CERN Document Server

Kumar, Amit; Sankar, V; Rao, N; Sarma, T

2017-01-01

This book includes the original, peer-reviewed research from the 2nd International Conference on Emerging Trends in Electrical, Communication and Information Technologies (ICECIT 2015), held in December, 2015 at Srinivasa Ramanujan Institute of Technology, Ananthapuramu, Andhra Pradesh, India. It covers the latest research trends or developments in areas of Electrical Engineering, Electronic and Communication Engineering, and Computer Science and Information.

20th IAEA fusion energy conference 2004. Conference proceedings

International Nuclear Information System (INIS)

2005-01-01

The 20th International Atomic Energy Agency (IAEA) Fusion Energy Conference (FEC) was held in Vilamoura, Portugal, from 1 to 6 November 2004. The Instituto Superior Tecnico through the Centro de Fusao Nuclear on behalf of the Portuguese Government and the Association EURATOM/IST hosted the conference. The IAEA wishes to express its gratitude to the host. More than 600 delegates representing 33 countries and three international organizations attended the Fusion Energy Conference 2004. The Programme Committee accepted a total of some 437 papers for presentation at the conference. The scientific experimental and theoretical papers have been grouped with respect to the following themes: Overview on magnetic and inertial fusion; Advanced Scenarios and Steady State; Edge Localized Modes; Fusion Technology; Transport Theory; Beta Limits; Hybrid Scenarios; H-mode and Transport; ITER; Alfven Modes and Wave Heating; Operational Limits and Momentum Transport; Energetic Particles and Stability; Neoclassical Tearing Modes; Transport and Turbulence; Inertial Fusion; Configuration Effects and Transport; and Plasma-wall Interaction. The conference adjourned with the announcement of the next IAEA Fusion Energy Conference, which will be held for the first time in the People's Republic of China, in the city of Chengdu, October 16-22, 2006

2008 Gordon Research Conference on Catalysis [Conference summary report

Energy Technology Data Exchange (ETDEWEB)

Soled, Stuart L.; Gray, Nancy Ryan

2009-01-01

The GRC on Catalysis is one of the most prestigious catalysis conferences as it brings together leading researchers from around the world to discuss their latest, most exciting work in catalysis. The 2008 conference will continue this tradition. The conference will cover a variety of themes including new catalytic materials, theoretical and experimental approaches to improve understanding of kinetics and transport phenomena, and state of the art nanoscale characterization probes to monitor active sites. The conference promotes interactions among established researchers and young scientists. It provides a venue for students to meet, talk to and learn from some of the world leading researchers in the area. It also gives them a platform for displaying their own work during the poster sessions. The informal nature of the meeting, excellent quality of the presentations and posters, and ability to meet many outstanding colleagues makes this an excellent conference.

Presentations of the 1. Eurasia Conference on Nuclear Science and Its Application. Vol.2

International Nuclear Information System (INIS)

2001-01-01

The primary objective of this conference was to enable scientists from the Eurasia region to exchange views in the field of nuclear science and its applications, for establishing collaboration among the respective countries, such carrying out joint projects, organizing conferences, seminars, training programs and related activities. The topics discussed at the conference were: Nuclear energy satatus and perspectives, Applications of nuclear techniques, Fundamental problems of nuclear science. Full texts of presentations published in two volumes

Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

DEFF Research Database (Denmark)

Huang, Laurence; Crothers, Kristina; Atzori, Chiara

2004-01-01

in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

The 2009 stock conference report: inflammation, obesity and metabolic disease.

Science.gov (United States)

Hevener, A L; Febbraio, M A

2010-09-01

Obesity is linked with many deleterious health consequences and is associated with increased risk of chronic disease including type 2 diabetes, atherosclerosis and certain forms of cancer. Recent work has highlighted the impact of obesity to activate inflammatory gene networks and suggests a causal function of inflammation in the pathogenesis of the metabolic syndrome. Since 2005, when Dr Gokhan Hotamisligil chaired the fourth Stock Conference in Istanbul, Turkey, entitled 'Obesity and Inflammation', there has been an explosion of studies investigating the relationship between obesity, inflammation and substrate metabolism. The exuberance surrounding this field of research is exemplified by the body of work that has been published in these past 4 years, including over 1400 publications. During this time, several novel mechanisms relating to cellular inflammation have been uncovered including the role of the hematopoietic system, toll-like receptor activation, endoplasmic reticulum stress and very recently T-cell activation in obesity-induced insulin resistance. These discoveries have led us to rethink cellular nutrient sensing and its role in inflammation and metabolic disease. Despite burgeoning investigation in this field, there still remain a number of unanswered questions. This review that evolved from the 2009 Stock Conference summarizes current research and identifies the deficiencies in our understanding of this topic. The overall goal of this Stock Conference was to bring together leading investigators in the field of inflammation and obesity research in the hope of fostering new ideas, thus advancing the pursuit of novel therapeutic strategies to reduce disease risk and or better treat chronic disease including type 2 diabetes, cardiovascular disease and cancer. © 2009 The Authors. obesity reviews © 2009 International Association for the Study of Obesity.

2nd International Conference on Harmony Search Algorithm

CERN Document Server

Geem, Zong

2016-01-01

The Harmony Search Algorithm (HSA) is one of the most well-known techniques in the field of soft computing, an important paradigm in the science and engineering community.  This volume, the proceedings of the 2nd International Conference on Harmony Search Algorithm 2015 (ICHSA 2015), brings together contributions describing the latest developments in the field of soft computing with a special focus on HSA techniques. It includes coverage of new methods that have potentially immense application in various fields. Contributed articles cover aspects of the following topics related to the Harmony Search Algorithm: analytical studies; improved, hybrid and multi-objective variants; parameter tuning; and large-scale applications.  The book also contains papers discussing recent advances on the following topics: genetic algorithms; evolutionary strategies; the firefly algorithm and cuckoo search; particle swarm optimization and ant colony optimization; simulated annealing; and local search techniques.   This book ...

20th Annual Systems Engineering Conference. Volume 1, Monday-Tuesday

Science.gov (United States)

2017-10-26

20th Annual Systems Engineering Conference October 23-26, 2017 | Waterford at Springfield | Springfield, VA NDIA.org/systemsengineering...Conference Program SYSTEMS ENGINEERING CONFERENCE 2 Welcome to the NDIA Systems Engineering Conference On behalf of the National Defense Industrial...Association’s Systems Engineering Division, I would like to extend a very warm welcome to the 20th Annual Systems Engineering Conference. Yes, the 20th Annual

Prediction of Possible Biomarkers and Novel Pathways Conferring Risk to Post-Traumatic Stress Disorder.

Science.gov (United States)

Chitrala, Kumaraswamy Naidu; Nagarkatti, Prakash; Nagarkatti, Mitzi

2016-01-01

Post-traumatic stress disorder is one of the common mental ailments that is triggered by exposure to traumatic events. Till date, the molecular factors conferring risk to the development of PTSD is not well understood. In this study, we have conducted a meta-analysis followed by hierarchical clustering and functional enrichment, to uncover the potential molecular networks and critical genes which play an important role in PTSD. Two datasets of expression profiles from Peripheral Blood Mononuclear Cells from 62 control samples and 63 PTSD samples were included in our study. In PTSD samples of GSE860 dataset, we identified 26 genes informative when compared with Post-deploy PTSD condition and 58 genes informative when compared with Pre-deploy and Post-deploy PTSD of GSE63878 dataset. We conducted the meta-analysis using Fisher, roP, Stouffer, AW, SR, PR and RP methods in MetaDE package. Results from the rOP method of MetaDE package showed that among these genes, the following showed significant changes including, OR2B6, SOX21, MOBP, IL15, PTPRK, PPBPP2 and SEC14L5. Gene ontology analysis revealed enrichment of these significant PTSD-related genes for cell proliferation, DNA damage and repair (p-value ≤ 0.05). Furthermore, interaction network analysis was performed on these 7 significant genes. This analysis revealed highly connected functional interaction networks with two candidate genes, IL15 and SEC14L5 highly enriched in networks. Overall, from these results, we concluded that these genes can be recommended as some of the potential targets for PTSD.

European Research Reactor Conference (RRFM) 2015: Conference Proceedings

International Nuclear Information System (INIS)

2015-01-01

In 2015 the European Research Reactor Conference, RRFM, took place in Bucharest, Romania. The conference programme resolved around a series of plenary sessions dedicated to the latest global developments with regards to research reactor technology and management. Parallel sessions focused on all areas of the fuel cycle of research reactors, their utilisation, operation and management as well as new research reactor projects and Innovative methods in reactor physics and thermo-hydraulics. The European Research Reactor Conference also gave special attention to safety and security of research reactors

European Research Reactor Conference (RRFM) 2016: Conference Proceedings

International Nuclear Information System (INIS)

2016-01-01

The 2016 European Research Reactor Conference, RRFM, took place in Berlin, Germany. The conference programme resolved around a series of plenary sessions dedicated to the latest global developments with regards to research reactor technology and management. Parallel sessions focused on all areas of the fuel cycle of research reactors, their utilisation, operation and management as well as new research reactor projects and Innovative methods in reactor physics and thermo-hydraulics. The European Research Reactor Conference also gave special attention to safety and security of research reactors.

Differential expression of cell adhesion genes

DEFF Research Database (Denmark)

Stein, Wilfred D; Litman, Thomas; Fojo, Tito

2005-01-01

that compare cells grown in suspension to similar cells grown attached to one another as aggregates have suggested that it is adhesion to the extracellular matrix of the basal membrane that confers resistance to apoptosis and, hence, resistance to cytotoxins. The genes whose expression correlates with poor...... in cell adhesion and the cytoskeleton. If the proteins involved in tethering cells to the extracellular matrix are important in conferring drug resistance, it may be possible to improve chemotherapy by designing drugs that target these proteins....

NRC regulatory information conference: Proceedings

International Nuclear Information System (INIS)

1989-09-01

This volume of the report provides the proceedings from the Nuclear Regulatory Commission (NRC) Regulatory Information Conference that was held at the Mayflower Hotel, Washington, DC, on April 18, 19, and 20, 1989. This conference was held by the NRC and chaired by Dr. Thomas E. Mosley, Director, Office of Nuclear Reactor Regulations (NRR) and coordinated by S. Singh Bajwa, Chief, Technical Assistance Management Section, NRR. There were approximately 550 participants from nine countries at the conference. The countries represented were Canada, England, Italy, Japan, Mexico, Spain, Taiwan, Yugoslavia, and the United States. The NRC staff discussed with nuclear industry its regulatory philosophy and approach and the bases on which they have been established. Furthermore, the NRC staff discussed several initiatives that have been implemented recently and their bases as well as NRC's expectations for new initiatives to further improve safety. The figures contained in Appendix A to the volume correspond to the slides that were shown during the presentations. Volume 2 of this report contains the formal papers that were distributed at the beginning of the Regulatory Information Conference and other information about the conference

Conference summaries

International Nuclear Information System (INIS)

1991-01-01

This volume contains conference summaries for the 31. annual conference of the Canadian Nuclear Association and the 12. annual conference of the Canadian Nuclear Society. Topics of discussion include: reactor physics; thermalhydraulics; industrial irradiation; computer applications; fuel channel analysis; small reactors; severe accidents; fuel behaviour under accident conditions; reactor components, safety related computer software; nuclear fuel management; fuel behaviour and performance; reactor safety; reactor engineering; nuclear waste management; and, uranium mining and processing

INTERCARTO CONFERENCES

OpenAIRE

Vladimir Tikunov

2010-01-01

The InterCarto conferences are thematically organized to target one of the most pressing problems of modern geography—creation and use of geographical information systems (GISs) as effective tools for achieving sustainable development of territories. Over the years, from 1994 to 2009, 1872 participants from 51 countries and 156 cities, who made 1494 reports, attended the conferences. There were 1508 participants from 49 regions of Russia making 1340 presentations. The conferences hosted 31 di...

Proceedings of the fourth international conference and exhibition: World Congress on superconductivity. Volume 2

Energy Technology Data Exchange (ETDEWEB)

Krishen, K.; Burnham, C. [eds.] [National Aeronautics and Space Administration, Houston, TX (United States). Lyndon B. Johnson Space Center

1994-12-31

This document contains papers presented at the 4th International Conference Exhibition: World Congress on Superconductivity held at the Marriott Orlando World Center, Orlando, Florida, June 27--July 1, 1994. This conference encompassed research, technology, applications, funding, political, and social aspects of superconductivity. Specifically, the areas of research, technology, and development covered during the conference included high-temperature materials, thin films, C-60 based superconductors, persistent magnetic fields and shielding, fabrication methodology, space applications, physical applications, performance characterization, device applications, weak link effects and flux motion, accelerator technology, superconductivity energy, storage, future research and development directions, medical applications, granular superconductors, wire fabrication technology, computer applications, technical and commercial challenges, and power and energy applications. The key objective of this conference was to provide a forum for the world community to share technological results of recent advances made in the field of superconductivity and to discuss translation of the research to technology which will benefit humanity. More than 150 presentations were made at this conference. Individual papers are indexed separately on the Energy Data Bases.

Proceedings of the fourth international conference and exhibition: World Congress on superconductivity. Volume 2

International Nuclear Information System (INIS)

Krishen, K.; Burnham, C.

1994-01-01

This document contains papers presented at the 4th International Conference Exhibition: World Congress on Superconductivity held at the Marriott Orlando World Center, Orlando, Florida, June 27--July 1, 1994. This conference encompassed research, technology, applications, funding, political, and social aspects of superconductivity. Specifically, the areas of research, technology, and development covered during the conference included high-temperature materials, thin films, C-60 based superconductors, persistent magnetic fields and shielding, fabrication methodology, space applications, physical applications, performance characterization, device applications, weak link effects and flux motion, accelerator technology, superconductivity energy, storage, future research and development directions, medical applications, granular superconductors, wire fabrication technology, computer applications, technical and commercial challenges, and power and energy applications. The key objective of this conference was to provide a forum for the world community to share technological results of recent advances made in the field of superconductivity and to discuss translation of the research to technology which will benefit humanity. More than 150 presentations were made at this conference. Individual papers are indexed separately on the Energy Data Bases

Metabolic engineering of the chloroplast genome reveals that the yeast ArDH gene confers enhanced tolerance to salinity and drought in plants

Directory of Open Access Journals (Sweden)

Muhammad Sarwar Khan

2015-09-01

Full Text Available Osmoprotectants stabilize proteins and membranes against the denaturing effect of high concentrations of salts and other harmful solutes. In yeast, arabitol dehydrogenase (ArDH reduces D-ribulose to D-arabitol where D-ribulose is derived by dephosphorylating D-ribulose-5-PO4 in the oxidized pentose pathway. Osmotolerance in plants could be developed through metabolic engineering of chloroplast genome by introducing genes encoding polyols. Here, we report that ArDH expression in chloroplasts confers tolerance to NaCl (up to 400 mM. Transgenic plants compared to wild type survived for four to five weeks on 400 mM NaCl. Nevertheless, plants remained green and grew normal on concentrations up to 350 mM NaCl. Further, a-week-old seedlings were also challenged with poly ethylene glycol (PEG, up to 6% in the liquid medium, considering that membranes and proteins are protected under stress conditions due to accumulation of arabitol in chloroplasts. Seedlings were tolerant to 6% PEG, suggesting that ARDH enzyme maintains integrity of membranes in chloroplasts under drought conditions via metabolic engineering. Hence, the gene could be expressed in agronomic plants to withstand abiotic stresses.

DRD2: Bridging the Genome and Ingestive Behavior.

Science.gov (United States)

Sun, Xue; Luquet, Serge; Small, Dana M

2017-05-01

Recent work highlights the importance of genetic variants that influence brain structure and function in conferring risk for polygenic obesity. The neurotransmitter dopamine (DA) has a pivotal role in energy balance by integrating metabolic signals with circuits supporting cognitive, perceptual, and appetitive functions that guide feeding. It has also been established that diet and obesity alter DA signaling, leading to compulsive-like feeding and neurocognitive impairments. This raises the possibility that genetic variants that influence DA signaling and adaptation confer risk for overeating and cognitive decline. Here, we consider the role of two common gene variants, FTO and TaqIA rs1800497 in driving gene × environment interactions promoting obesity, metabolic dysfunction, and cognitive change via their influence on DA receptor subtype 2 (DRD2) signaling. Copyright © 2017 Elsevier Ltd. All rights reserved.

A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death.

Science.gov (United States)

Ma, Hongming; Dang, Ying; Wu, Yonggan; Jia, Gengxiang; Anaya, Edgar; Zhang, Junli; Abraham, Sojan; Choi, Jang-Gi; Shi, Guojun; Qi, Ling; Manjunath, N; Wu, Haoquan

2015-07-28

West Nile virus (WNV) causes an acute neurological infection attended by massive neuronal cell death. However, the mechanism(s) behind the virus-induced cell death is poorly understood. Using a library containing 77,406 sgRNAs targeting 20,121 genes, we performed a genome-wide screen followed by a second screen with a sub-library. Among the genes identified, seven genes, EMC2, EMC3, SEL1L, DERL2, UBE2G2, UBE2J1, and HRD1, stood out as having the strongest phenotype, whose knockout conferred strong protection against WNV-induced cell death with two different WNV strains and in three cell lines. Interestingly, knockout of these genes did not block WNV replication. Thus, these appear to be essential genes that link WNV replication to downstream cell death pathway(s). In addition, the fact that all of these genes belong to the ER-associated protein degradation (ERAD) pathway suggests that this might be the primary driver of WNV-induced cell death. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Conference Support, 23rd Western Photosynthesis Conference 2014, Final Technical Report

Energy Technology Data Exchange (ETDEWEB)

Wachter, Rebekka [Arizona State Univ., Tempe, AZ (United States)

2015-01-12

The Western Photosynthesis Conference is a regional conference that is held on an annual basis to bring together researchers primarily from the Western United States to share their newest research advances on photosynthetic processes. The 23rd conference was focused on both fundamental and more applied research on the biological conversion of solar energy to various energy storage forms. Several particular areas of solar energy conversion were emphasized in this conference (see below). Some of these topics, such as carbon limitations on photosynthesis, biomimicry and phenotyping, have traditionally not been incorporated extensively in the Western Photosynthesis Conference. We found that these topics have substantially broadened of the scope of this meeting.

78 FR 27963 - Reliability Technical Conference; Notice of Technical Conference

Science.gov (United States)

2013-05-13

... Technical Conference; Notice of Technical Conference Take notice that the Federal Energy Regulatory Commission will hold a Technical Conference on Tuesday, July 9, 2013 from 9:00 a.m. to 5:00 p.m. This... technical support for webcasts and offers the option of listening to the meeting via phone-bridge for a fee...

Conference proceedings

African Journals Online (AJOL)

abp

2015-08-07

Aug 7, 2015 ... Conference was organized in June 2-6, 2014 at the Yaoundé Mont Febe Hotel, in Cameroon. Under the theme«Practice .... while the implementation of family planning in African HIV programs will favor safe contraception ... equipment. The WHO-stepwise approach for the global strategy for the prevention ...

Proceedings of ICTEA 2006, the 2. international conference on thermal engineering : theory and applications

International Nuclear Information System (INIS)

Haik, Y; Saghir, Z.

2006-01-01

This international conference provided a venue for the exchange of research and the discussion of ideas related to thermal engineering. Participants at the conference discussed emerging research trends in thermal energy and presented new technologies and advances in computerized simulations and thermodynamic analyses related to thermal energy. Recent developments in solar cell technology, waste heat utilization, and energy management were presented. New developments in biomass combustion technologies were also described. The conference was divided into 22 sessions that discussed materials and polymers; computational fluid dynamics; energy management; solar energy; natural convection; experimental fluid flow; experimental combustion; multi-phase; environment; solar renewables; computational fluid dynamics and combustion; porous media; and micro and nano media. The conference featured 118 presentations, of which 63 have been catalogued separately for inclusion in this database. refs., tabs., figs

miR-24-2 controls H2AFX expression regardless of gene copy number alteration and induces apoptosis by targeting antiapoptotic gene BCL-2: a potential for therapeutic intervention.

Science.gov (United States)

Srivastava, Niloo; Manvati, Siddharth; Srivastava, Archita; Pal, Ranjana; Kalaiarasan, Ponnusamy; Chattopadhyay, Shilpi; Gochhait, Sailesh; Dua, Raina; Bamezai, Rameshwar N K

2011-04-04

New levels of gene regulation with microRNA (miR) and gene copy number alterations (CNAs) have been identified as playing a role in various cancers. We have previously reported that sporadic breast cancer tissues exhibit significant alteration in H2AX gene copy number. However, how CNA affects gene expression and what is the role of miR, miR-24-2, known to regulate H2AX expression, in the background of the change in copy number, are not known. Further, many miRs, including miR-24-2, are implicated as playing a role in cell proliferation and apoptosis, but their specific target genes and the pathways contributing to them remain unexplored. Changes in gene copy number and mRNA/miR expression were estimated using real-time polymerase chain reaction assays in two mammalian cell lines, MCF-7 and HeLa, and in a set of sporadic breast cancer tissues. In silico analysis was performed to find the putative target for miR-24-2. MCF-7 cells were transfected with precursor miR-24-2 oligonucleotides, and the gene expression levels of BRCA1, BRCA2, ATM, MDM2, TP53, CHEK2, CYT-C, BCL-2, H2AFX and P21 were examined using TaqMan gene expression assays. Apoptosis was measured by flow cytometric detection using annexin V dye. A luciferase assay was performed to confirm BCL-2 as a valid cellular target of miR-24-2. It was observed that H2AX gene expression was negatively correlated with miR-24-2 expression and not in accordance with the gene copy number status, both in cell lines and in sporadic breast tumor tissues. Further, the cells overexpressing miR-24-2 were observed to be hypersensitive to DNA damaging drugs, undergoing apoptotic cell death, suggesting the potentiating effect of mir-24-2-mediated apoptotic induction in human cancer cell lines treated with anticancer drugs. BCL-2 was identified as a novel cellular target of miR-24-2. mir-24-2 is capable of inducing apoptosis by modulating different apoptotic pathways and targeting BCL-2, an antiapoptotic gene. The study suggests

Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

Energy Technology Data Exchange (ETDEWEB)

Somerville, Chris R.; Scieble, Wolf

2000-10-11

Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

Genome-wide analysis of the Hsp70 family genes in pepper (Capsicum annuum L.) and functional identification of CaHsp70-2 involvement in heat stress.

Science.gov (United States)

Guo, Meng; Liu, Jin-Hong; Ma, Xiao; Zhai, Yu-Fei; Gong, Zhen-Hui; Lu, Ming-Hui

2016-11-01

Hsp70s function as molecular chaperones and are encoded by a multi-gene family whose members play a crucial role in plant response to stress conditions, and in plant growth and development. Pepper (Capsicum annuum L.) is an important vegetable crop whose genome has been sequenced. Nonetheless, no overall analysis of the Hsp70 gene family is reported in this crop plant to date. To assess the functionality of Capsicum annuum Hsp70 (CaHsp70) genes, pepper genome database was analyzed in this research. A total of 21 CaHsp70 genes were identified and their characteristics were also described. The promoter and transcript expression analysis revealed that CaHsp70s were involved in pepper growth and development, and heat stress response. Ectopic expression of a cytosolic gene, CaHsp70-2, regulated expression of stress-related genes and conferred increased thermotolerance in transgenic Arabidopsis. Taken together, our results provide the basis for further studied to dissect CaHsp70s' function in response to heat stress as well as other environmental stresses. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Genotypes do not confer risk for delinquency but rather alter susceptibility to positive and negative environmental factors: gene-environmentinteractions of BDNF Val66Met, 5-HTTLPR, and MAOA-uVNTR [corrected].

Science.gov (United States)

Nilsson, Kent W; Comasco, Erika; Hodgins, Sheilagh; Oreland, Lars; Åslund, Cecilia

2014-12-10

Previous evidence of gene-by-environment interactions associated with emotional and behavioral disorders is contradictory. Differences in findings may result from variation in valence and dose of the environmental factor, and/or failure to take account of gene-by-gene interactions. The present study investigated interactions between the brain-derived neurotrophic factor gene (BDNF Val66Met), the serotonin transporter gene-linked polymorphic region (5-HTTLPR), the monoamine oxidase A (MAOA-uVNTR) polymorphisms, family conflict, sexual abuse, the quality of the child-parent relationship, and teenage delinquency. In 2006, as part of the Survey of Adolescent Life in Västmanland, Sweden, 1 337 high-school students, aged 17-18 years, anonymously completed questionnaires and provided saliva samples for DNA analyses. Teenage delinquency was associated with two-, three-, and four-way interactions of each of the genotypes and the three environmental factors. Significant four-way interactions were found for BDNF Val66Met × 5-HTTLPR×MAOA-uVNTR × family conflicts and for BDNF Val66Met × 5-HTTLPR×MAOA-uVNTR × sexual abuse. Further, the two genotype combinations that differed the most in expression levels (BDNF Val66Met Val, 5-HTTLPR LL, MAOA-uVNTR LL [girls] and L [boys] vs BDNF Val66Met Val/Met, 5-HTTLPR S/LS, MAOA-uVNTR S/SS/LS) in interaction with family conflict and sexual abuse were associated with the highest delinquency scores. The genetic variants previously shown to confer vulnerability for delinquency (BDNF Val66Met Val/Met × 5-HTTLPR S × MAOA-uVNTR S) were associated with the lowest delinquency scores in interaction with a positive child-parent relationship. Functional variants of the MAOA-uVNTR, 5-HTTLPR, and BDNF Val66Met, either alone or in interaction with each other, may be best conceptualized as modifying sensitivity to environmental factors that confer either risk or protection for teenage delinquency. © The Author 2015. Published by Oxford University

Genotypes Do Not Confer Risk For Delinquency ut Rather Alter Susceptibility to Positive and Negative Environmental Factors: Gene-Environment Interactions of BDNF Val66Met, 5-HTTLPR, and MAOA-uVNTR

Science.gov (United States)

Comasco, Erika; Hodgins, Sheilagh; Oreland, Lars; Åslund, Cecilia

2015-01-01

Background: Previous evidence of gene-by-environment interactions associated with emotional and behavioral disorders is contradictory. Differences in findings may result from variation in valence and dose of the environmental factor, and/or failure to take account of gene-by-gene interactions. The present study investigated interactions between the brain-derived neurotrophic factor gene (BDNF Val66Met), the serotonin transporter gene-linked polymorphic region (5-HTTLPR), the monoamine oxidase A (MAOA-uVNTR) polymorphisms, family conflict, sexual abuse, the quality of the child-parent relationship, and teenage delinquency. Methods: In 2006, as part of the Survey of Adolescent Life in Västmanland, Sweden, 1 337 high-school students, aged 17–18 years, anonymously completed questionnaires and provided saliva samples for DNA analyses. Results: Teenage delinquency was associated with two-, three-, and four-way interactions of each of the genotypes and the three environmental factors. Significant four-way interactions were found for BDNF Val66Met × 5-HTTLPR×MAOA-uVNTR × family conflicts and for BDNF Val66Met × 5-HTTLPR×MAOA-uVNTR × sexual abuse. Further, the two genotype combinations that differed the most in expression levels (BDNF Val66Met Val, 5-HTTLPR LL, MAOA-uVNTR LL [girls] and L [boys] vs BDNF Val66Met Val/Met, 5-HTTLPR S/LS, MAOA-uVNTR S/SS/LS) in interaction with family conflict and sexual abuse were associated with the highest delinquency scores. The genetic variants previously shown to confer vulnerability for delinquency (BDNF Val66Met Val/Met × 5-HTTLPR S × MAOA-uVNTR S) were associated with the lowest delinquency scores in interaction with a positive child-parent relationship. Conclusions: Functional variants of the MAOA-uVNTR, 5-HTTLPR, and BDNF Val66Met, either alone or in interaction with each other, may be best conceptualized as modifying sensitivity to environmental factors that confer either risk or protection for teenage delinquency. PMID

2nd International Conference on Construction and Building Research

CERN Document Server

Fernández-Plazaola, Igor; Hidalgo-Delgado, Francisco; Martínez-Valenzuela, María; Medina-Ramón, Francisco; Oliver-Faubel, Inmaculada; Rodríguez-Abad, Isabel; Salandin, Andrea; Sánchez-Grandia, Rafael; Tort-Ausina, Isabel; Construction and Building Research

2014-01-01

Many areas of knowledge converge in the building industry and therefore research in this field necessarily involves an interdisciplinary approach. Effective research requires strong relations between a broad variety of scientific and technological domains and more conventional construction or craft processes, while also considering advanced management processes, where all the main actors permanently interact. This publication takes an interdisciplinary approach grouping various studies on the building industry chosen from among the works presented for the 2nd International Conference on Construction and Building Research. The papers examine aspects of materials and building systems; construction technology; energy and sustainability; construction management; heritage, refurbishment and conservation. The information contained within these pages may be of interest to researchers and practitioners in construction and building activities from the academic sphere, as well as public and private sectors.

2nd International Conference on Intelligent Computing, Communication & Devices

CERN Document Server

Popentiu-Vladicescu, Florin

2017-01-01

The book presents high quality papers presented at 2nd International Conference on Intelligent Computing, Communication & Devices (ICCD 2016) organized by Interscience Institute of Management and Technology (IIMT), Bhubaneswar, Odisha, India, during 13 and 14 August, 2016. The book covers all dimensions of intelligent sciences in its three tracks, namely, intelligent computing, intelligent communication and intelligent devices. intelligent computing track covers areas such as intelligent and distributed computing, intelligent grid and cloud computing, internet of things, soft computing and engineering applications, data mining and knowledge discovery, semantic and web technology, hybrid systems, agent computing, bioinformatics, and recommendation systems. Intelligent communication covers communication and network technologies, including mobile broadband and all optical networks that are the key to groundbreaking inventions of intelligent communication technologies. This covers communication hardware, soft...

Differential expression of cytochrome P450 genes between bromadiolone-resistant and anticoagulant-susceptible Norway rats

DEFF Research Database (Denmark)

Markussen, Mette Drude Kjær; Heiberg, Ann-Charlotte; Fredholm, Merete

2008-01-01

Background: Anticoagulant resistance in Norway rats, Rattus norvegicus (Berk.), has been suggested to be conferred by mutations in the VKORC1 gene, encoding the target protein of anticoagulant rodenticides. Other factors, e.g. pharmacokinetics, may also contribute to resistance, however. To examine......, Cyp3a2 and Cyp3a3 genes. On exposure to bromadiolone, females had higher Cyp2e1 expression than males, which possibly explains why female rats are generally more tolerant to anticoagulants than male rats. Conclusion: results suggest that bromadiolone resistance in a Danish strain of Norway rats...

Effects of simulated microgravity on gene expression and biological phenotypes of a single generation Caenorhabditis elegans cultured on 2 different media.

Science.gov (United States)

Tee, Ling Fei; Neoh, Hui-Min; Then, Sue Mian; Murad, Nor Azian; Asillam, Mohd Fairos; Hashim, Mohd Helmy; Nathan, Sheila; Jamal, Rahman

2017-11-01

Studies of multigenerational Caenorhabditis elegans exposed to long-term spaceflight have revealed expression changes of genes involved in longevity, DNA repair, and locomotion. However, results from spaceflight experiments are difficult to reproduce as space missions are costly and opportunities are rather limited for researchers. In addition, multigenerational cultures of C. elegans used in previous studies contribute to mixture of gene expression profiles from both larvae and adult worms, which were recently reported to be different. Usage of different culture media during microgravity simulation experiments might also give rise to differences in the gene expression and biological phenotypes of the worms. In this study, we investigated the effects of simulated microgravity on the gene expression and biological phenotype profiles of a single generation of C. elegans worms cultured on 2 different culture media. A desktop Random Positioning Machine (RPM) was used to simulate microgravity on the worms for approximately 52 to 54 h. Gene expression profile was analysed using the Affymetrix GeneChip® C. elegans 1.0 ST Array. Only one gene (R01H2.2) was found to be downregulated in nematode growth medium (NGM)-cultured worms exposed to simulated microgravity. On the other hand, eight genes were differentially expressed for C. elegans Maintenance Medium (CeMM)-cultured worms in microgravity; six were upregulated, while two were downregulated. Five of the upregulated genes (C07E3.15, C34H3.21, C32D5.16, F35H8.9 and C34F11.17) encode non-coding RNAs. In terms of biological phenotype, we observed that microgravity-simulated worms experienced minimal changes in terms of lifespan, locomotion and reproductive capabilities in comparison with the ground controls. Taking it all together, simulated microgravity on a single generation of C. elegans did not confer major changes to their gene expression and biological phenotype. Nevertheless, exposure of the worms to microgravity

International conference, ICPRAM 2012

CERN Document Server

Sánchez, J; Fred, Ana; Pattern recognition : applications and methods : revised selected papers

2013-01-01

This edited book includes extended and revised versions of a set of selected papers from the First International Conference on Pattern Recognition (ICPRAM 2012), held in Vilamoura, Algarve, Portugal, from 6 to 8 February, 2012, sponsored by the Institute for Systems and Technologies of Information Control and Communication (INSTICC) and held in cooperation with the Association for the Advancement of Artificial Intelligence (AAAI) and Pattern Analysis, Statistical Modelling and Computational Learning (PASCAL2). The conference brought together researchers, engineers and practitioners interested on the areas of Pattern Recognition, both from theoretical and application perspectives.

COAL Conference Poster

OpenAIRE

Brown, Taylor Alexander; McGibbney, Lewis John

2017-01-01

COAL Conference Poster This archive contains the COAL conference poster for the AGU Fall Meeting 2017 by Taylor Alexander Brown. The Inkscape SVG source is available at https://github.com/capstone-coal/coal-conference-poster/ under the Creative Commons Attribution-ShareAlike 4.0 International license.

Abstracts of the Canadian Society for Civil Engineering annual conference including the general conference, the 1. international structural specialty conference, the 1. international construction specialty conference, and the 1. specialty conference on disaster mitigation : towards a sustainable future

International Nuclear Information System (INIS)

El-Badry, M.; Loov, R.E.; Ruwanpura, J.; El-Hacha, R.; Kroman, J.; Rankin, J.

2006-01-01

This conference provided a forum for national and international practicing engineers, researchers and technical experts to discuss sustainable solutions to infrastructure development. Discussions focused on recent developments in new technologies for building more economic and sustainable infrastructure, while improving the safety of buildings, bridges, roads, water supply and sewage treatment systems. The conference was held in conjunction with associated specialty conferences, including a first international structures specialty conference, a first international construction specialty conference, and a first specialty conference on disaster mitigation. This book of abstracts highlights all the specialty conferences and accompanies a CD-ROM that has the full text of all the papers. Manuscripts of the full papers submitted to the specialty conferences were peer-reviewed by international scientific committees. The general conference provided a forum to learn about new technologies and future directions in various areas of civil engineering. It included a special theme session on sustainable development and a special session on innovation and information technology. Other technical sessions focused on topics such as civil engineering history and education; infrastructure management and renewal; asset management; risk assessment and management; engineering materials and mechanics; environmental engineering and science; hydrotechnical engineering; cold region engineering; and, transportation engineering. The general conference featured 88 presentations, of which 15 have been catalogued separately for inclusion in this database

DRD2 and PPP1R1B (DARPP-32 polymorphisms independently confer increased risk for autism spectrum disorders and additively predict affected status in male-only affected sib-pair families

Directory of Open Access Journals (Sweden)

Hettinger Joe A

2012-05-01

Full Text Available Abstract Background The neurotransmitter dopamine (DA modulates executive functions, learning, and emotional processing, all of which are impaired in individuals with autism spectrum disorders (ASDs. Our previous findings suggest a role for dopamine-related genes in families with only affected males. Methods We examined two additional genes which affect DA function, the DRD2 and PPP1R1B (DARPP-32 genes, in a cohort of 112 male-only affected sib-pair families. Selected polymorphisms spanning these genes were genotyped and both family-based and population-based tests were carried out for association analysis. General discriminant analysis was used to examine the gene-gene interactions in predicting autism susceptibility. Results There was a significantly increased frequency of the DRD2 rs1800498TT genotype (P = 0.007 in affected males compared to the comparison group, apparently due to over-transmission of the T allele (P = 0.0003. The frequency of the PPP1R1B rs1495099CC genotype in affected males was also higher than that in the comparison group (P = 0.002 due to preferential transmission of the C allele from parents to affected children (P = 0.0009. Alleles rs1800498T and rs1495099C were associated with more severe problems in social interaction (P = 0.0002 and P = 0.0016, respectively and communication (P = 0.0004 and P = 0.0046, and increased stereotypic behaviours (P = 0.0021 and P = 0.00072. General discriminant analysis found that the DRD2 and PPP1R1B genes additively predicted ASDs (P = 0.00011; Canonical R = 0.26 and explain ~7% of the variance in our families. All findings remained significant following corrections for multiple testing. Conclusion Our findings support a role for the DRD2 and PPP1R1B genes in conferring risk for autism in families with only affected males and show an additive effect of these genes towards prediction of affected status in our families.

PREFACE: 2nd International Conference and Young Scientist School ''Magnetic resonance imaging in biomedical research''

Science.gov (United States)

Naumova, A. V.; Khodanovich, M. Y.; Yarnykh, V. L.

2016-02-01

The Second International Conference and Young Scientist School ''Magnetic resonance imaging in biomedical research'' was held on the campus of the National Research Tomsk State University (Tomsk, Russia) on September 7-9, 2015. The conference was focused on magnetic resonance imaging (MRI) applications for biomedical research. The main goal was to bring together basic scientists, clinical researchers and developers of new MRI techniques to bridge the gap between clinical/research needs and advanced technological solutions. The conference fostered research and development in basic and clinical MR science and its application to health care. It also had an educational purpose to promote understanding of cutting-edge MR developments. The conference provided an opportunity for researchers and clinicians to present their recent theoretical developments, practical applications, and to discuss unsolved problems. The program of the conference was divided into three main topics. First day of the conference was devoted to educational lectures on the fundamentals of MRI physics and image acquisition/reconstruction techniques, including recent developments in quantitative MRI. The second day was focused on developments and applications of new contrast agents. Multinuclear and spectroscopic acquisitions as well as functional MRI were presented during the third day of the conference. We would like to highlight the main developments presented at the conference and introduce the prominent speakers. The keynote speaker of the conference Dr. Vasily Yarnykh (University of Washington, Seattle, USA) presented a recently developed MRI method, macromolecular proton fraction (MPF) mapping, as a unique tool for modifying image contrast and a unique tool for quantification of the myelin content in neural tissues. Professor Yury Pirogov (Lomonosov Moscow State University) described development of new fluorocarbon compounds and applications for biomedicine. Drs. Julia Velikina and Alexey

2nd International Conference on Health Care Systems Engineering

CERN Document Server

Sahin, Evren; Li, Jingshan; Guinet, Alain; Vandaele, Nico

2016-01-01

In this volume, scientists and practitioners write about new methods and technologies for improving the operation of health care organizations. Statistical analyses play an important role in these methods with the implications of simulation and modeling applied to the future of health care. Papers are based on work presented at the Second International Conference on Health Care Systems Engineering (HCSE2015) in Lyon, France. The conference was a rare opportunity for scientists and practitioners to share work directly with each other. Each resulting paper received a double blind review. Paper topics include: hospital drug logistics, emergency care, simulation in patient care, and models for home care services. Discusses statistical analysis and operations management for health care delivery systems based on real case studies Papers in this volume received a double blind review Brings together the work of scientists, practitioners, and clinicians to unite research and practice in the future of these systems Top...

Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

Science.gov (United States)

Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

2016-10-13

PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

Mutation intolerant genes and targets of FMRP are enriched for nonsynonymous alleles in schizophrenia.

Science.gov (United States)

Leonenko, Ganna; Richards, Alexander L; Walters, James T; Pocklington, Andrew; Chambert, Kimberly; Al Eissa, Mariam M; Sharp, Sally I; O'Brien, Niamh L; Curtis, David; Bass, Nicholas J; McQuillin, Andrew; Hultman, Christina; Moran, Jennifer L; McCarroll, Steven A; Sklar, Pamela; Neale, Benjamin M; Holmans, Peter A; Owen, Michael J; Sullivan, Patrick F; O'Donovan, Michael C

2017-10-01

Risk of schizophrenia is conferred by alleles occurring across the full spectrum of frequencies from common SNPs of weak effect through to ultra rare alleles, some of which may be moderately to highly penetrant. Previous studies have suggested that some of the risk of schizophrenia is attributable to uncommon alleles represented on Illumina exome arrays. Here, we present the largest study of exomic variation in schizophrenia to date, using samples from the United Kingdom and Sweden (10,011 schizophrenia cases and 13,791 controls). Single variants, genes, and gene sets were analyzed for association with schizophrenia. No single variant or gene reached genome-wide significance. Among candidate gene sets, we found significant enrichment for rare alleles (minor allele frequency [MAF] schizophrenia by excluding a role for uncommon exomic variants (0.01 ≤ MAF ≥ 0.001) that confer a relatively large effect (odds ratio [OR] > 4). We also show risk alleles within this frequency range exist, but confer smaller effects and should be identified by larger studies. © 2017 Wiley Periodicals, Inc.

Pathways, Networks and Systems Medicine Conferences

Energy Technology Data Exchange (ETDEWEB)

Nadeau, Joseph H. [Pacific Northwest Research Institute

2013-11-25

The 6th Pathways, Networks and Systems Medicine Conference was held at the Minoa Palace Conference Center, Chania, Crete, Greece (16-21 June 2008). The Organizing Committee was composed of Joe Nadeau (CWRU, Cleveland), Rudi Balling (German Research Centre, Brauschweig), David Galas (Institute for Systems Biology, Seattle), Lee Hood (Institute for Systems Biology, Seattle), Diane Isonaka (Seattle), Fotis Kafatos (Imperial College, London), John Lambris (Univ. Pennsylvania, Philadelphia),Harris Lewin (Univ. of Indiana, Urbana-Champaign), Edison Liu (Genome Institute of Singapore, Singapore), and Shankar Subramaniam (Univ. California, San Diego). A total of 101 individuals from 21 countries participated in the conference: USA (48), Canada (5), France (5), Austria (4), Germany (3), Italy (3), UK (3), Greece (2), New Zealand (2), Singapore (2), Argentina (1), Australia (1), Cuba (1), Denmark (1), Japan (1), Mexico (1), Netherlands (1), Spain (1), Sweden (1), Switzerland (1). With respect to speakers, 29 were established faculty members and 13 were graduate students or postdoctoral fellows. With respect to gender representation, among speakers, 13 were female and 28 were male, and among all participants 43 were female and 58 were male. Program these included the following topics: Cancer Pathways and Networks (Day 1), Metabolic Disease Networks (Day 2), Day 3 ? Organs, Pathways and Stem Cells (Day 3), and Day 4 ? Inflammation, Immunity, Microbes and the Environment (Day 4). Proceedings of the Conference were not published.

National Physics Conference. Paper Abstracts

International Nuclear Information System (INIS)

Marinela Dumitriu, Editorial Coordination.

1995-01-01

This book contains the abstracts of the proceedings of the annual Romanian Physics Conference organized by Romanian Physics Society. The conference was held on November 30 to December 2, 1995 in the city of Baia Mare. It was organized in the following nine sections: 1 - Astrophysics, Particle Physics, Nuclear Physics, Molecular and Atomic Physics; 2 - Plasma Physics; 3 - Biophysics; 4 - Technical Physics; 5 - Theoretical Physics; 6 -The Physics of Energy; 7 - The Physics of Environment 8 - Solid State Physics; 9 - Optical and Quantum Electronics. The full texts can be obtained on request from the Romanian Physical Society or directly from authors

Identification of candidate genes for yeast engineering to improve bioethanol production in very high gravity and lignocellulosic biomass industrial fermentations

Directory of Open Access Journals (Sweden)

Pereira Francisco B

2011-12-01

Full Text Available Abstract Background The optimization of industrial bioethanol production will depend on the rational design and manipulation of industrial strains to improve their robustness against the many stress factors affecting their performance during very high gravity (VHG or lignocellulosic fermentations. In this study, a set of Saccharomyces cerevisiae genes found, through genome-wide screenings, to confer resistance to the simultaneous presence of different relevant stresses were identified as required for maximal fermentation performance under industrial conditions. Results Chemogenomics data were used to identify eight genes whose expression confers simultaneous resistance to high concentrations of glucose, acetic acid and ethanol, chemical stresses relevant for VHG fermentations; and eleven genes conferring simultaneous resistance to stresses relevant during lignocellulosic fermentations. These eleven genes were identified based on two different sets: one with five genes granting simultaneous resistance to ethanol, acetic acid and furfural, and the other with six genes providing simultaneous resistance to ethanol, acetic acid and vanillin. The expression of Bud31 and Hpr1 was found to lead to the increase of both ethanol yield and fermentation rate, while Pho85, Vrp1 and Ygl024w expression is required for maximal ethanol production in VHG fermentations. Five genes, Erg2, Prs3, Rav1, Rpb4 and Vma8, were found to contribute to the maintenance of cell viability in wheat straw hydrolysate and/or the maximal fermentation rate of this substrate. Conclusions The identified genes stand as preferential targets for genetic engineering manipulation in order to generate more robust industrial strains, able to cope with the most significant fermentation stresses and, thus, to increase ethanol production rate and final ethanol titers.

Proceedings of the third Radiation Physics Conference. Vol. 2

International Nuclear Information System (INIS)

Gomaa, M.A.; El-Behay, A.Z.; Hassib, G.M.; El-Naggar, A.M.

1996-01-01

The conference of radiation physics was held in 13-17 Nov. 1996 in cairo. The specialists of atomic energy authority and Al-Minia University discussed the biological radiation effects,radiation protection, applied radiation physics and material shielding studies were discussed at the meeting more than 400 page were presented

Proceedings of the third Radiation Physics Conference. Vol. 2

Energy Technology Data Exchange (ETDEWEB)

Gomaa, M A; El-Behay, A Z; Hassib, G M; El-Naggar, A M [eds.

1997-12-31

The conference of radiation physics was held in 13-17 Nov. 1996 in cairo. The specialists of atomic energy authority and Al-Minia University discussed the biological radiation effects,radiation protection, applied radiation physics and material shielding studies were discussed at the meeting more than 400 page were presented.

Complex epigenetic regulation of engrailed-2 (EN-2) homeobox gene in the autism cerebellum.

Science.gov (United States)

James, S J; Shpyleva, Svitlana; Melnyk, Stepan; Pavliv, Oleksandra; Pogribny, I P

2013-02-19

The elucidation of epigenetic alterations in the autism brain has potential to provide new insights into the molecular mechanisms underlying abnormal gene expression in this disorder. Given strong evidence that engrailed-2 (EN-2) is a developmentally expressed gene relevant to cerebellar abnormalities and autism, the epigenetic evaluation of this candidate gene was undertaken in 26 case and control post-mortem cerebellar samples. Assessments included global DNA methylation, EN-2 promoter methylation, EN-2 gene expression and EN-2 protein levels. Chromatin immunoprecipitation was used to evaluate trimethylation status of histone H3 lysine 27 (H3K27) associated with gene downregulation and histone H3 lysine 4 (H3K4) associated with gene activation. The results revealed an unusual pattern of global and EN-2 promoter region DNA hypermethylation accompanied by significant increases in EN-2 gene expression and protein levels. Consistent with EN-2 overexpression, histone H3K27 trimethylation mark in the EN-2 promoter was significantly decreased in the autism samples relative to matched controls. Supporting a link between reduced histone H3K27 trimethylation and increased EN-2 gene expression, the mean level of histone H3K4 trimethylation was elevated in the autism cerebellar samples. Together, these results suggest that the normal EN-2 downregulation that signals Purkinje cell maturation during late prenatal and early-postnatal development may not have occurred in some individuals with autism and that the postnatal persistence of EN-2 overexpression may contribute to autism cerebellar abnormalities.

A Single Dose of LSD Does Not Alter Gene Expression of the Serotonin 2A Receptor Gene (HTR2A) or Early Growth Response Genes (EGR1-3) in Healthy Subjects

Science.gov (United States)