WorldWideScience

Sample records for gene fusion events

  1. Fusion events

    International Nuclear Information System (INIS)

    Aboufirassi, M; Angelique, J.C.; Bizard, G.; Bougault, R.; Brou, R.; Buta, A.; Colin, J.; Cussol, D.; Durand, D.; Genoux-Lubain, A.; Horn, D.; Kerambrun, A.; Laville, J.L.; Le Brun, C.; Lecolley, J.F.; Lefebvres, F.; Lopez, O.; Louvel, M.; Meslin, C.; Metivier, V.; Nakagawa, T.; Peter, J.; Popescu, R.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E.; Wieloch, A.; Yuasa-Nakagawa, K.

    1998-01-01

    The fusion reactions between low energy heavy ions have a very high cross section. First measurements at energies around 30-40 MeV/nucleon indicated no residue of either complete or incomplete fusion, thus demonstrating the disappearance of this process. This is explained as being due to the high amount o energies transferred to the nucleus, what leads to its total dislocation in light fragments and particles. Exclusive analyses have permitted to mark clearly the presence of fusion processes in heavy systems at energies above 30-40 MeV/nucleon. Among the complete events of the Kr + Au reaction at 60 MeV/nucleon the majority correspond to binary collisions. Nevertheless, for the most considerable energy losses, a class of events do occur for which the detected fragments appears to be emitted from a unique source. These events correspond to an incomplete projectile-target fusion followed by a multifragmentation. Such events were singled out also in the reaction Xe + Sn at 50 MeV/nucleon. For the events in which the energy dissipation was maximal it was possible to isolate an isotropic group of events showing all the characteristics of fusion nuclei. The fusion is said to be incomplete as pre-equilibrium Z = 1 and Z = 2 particles are emitted. The cross section is of the order of 25 mb. Similar conclusions were drown for the systems 36 Ar + 27 Al and 64 Zn + nat Ti. A cross section value of ∼ 20 mb was determined at 55 MeV/nucleon in the first case, while the measurement of evaporation light residues in the last system gave an upper limit of 20-30 mb for the cross section at 50 MeV/nucleon

  2. Fusion and retrotransposition events in the evolution of the sea anemone Anemonia viridis neurotoxin genes.

    Science.gov (United States)

    Moran, Yehu; Weinberger, Hagar; Lazarus, Nimrod; Gur, Maya; Kahn, Roy; Gordon, Dalia; Gurevitz, Michael

    2009-08-01

    Sea anemones are sessile predators that use a variety of toxins to paralyze prey and foe. Among these toxins, Types I, II and III are short peptides that affect voltage-gated sodium channels. Anemonia viridis is the only sea anemone species that produces both Types I and III neurotoxin. Although the two toxin types are unrelated in sequence and three-dimensional structure, cloning and comparative analysis of their loci revealed a highly similar sequence at the 5' region, which encodes a signal peptide. This similarity was likely generated by gene fusion and could be advantageous in transcript stability and intracellular trafficking and secretion. In addition, these analyses identified the processed pseudogenes of the two gene families in the genome of A. viridis, probably resulting from retrotransposition events. As presence of processed pseudogenes in the genome requires transcription in germ-line cells, we analyzed oocyte-rich ovaries and found that indeed they contain Types I and III transcripts. This result raises questions regarding the role of toxin transcripts in these tissues. Overall, the retrotransposition and gene fusion events suggest that the genes of both Types I and III neurotoxins evolved in a similar fashion and share a partial common ancestry.

  3. Prevention of adverse events of interferon γ gene therapy by gene delivery of interferon γ-heparin-binding domain fusion protein in mice

    Directory of Open Access Journals (Sweden)

    Mitsuru Ando

    2014-01-01

    Full Text Available Sustained gene delivery of interferon (IFN γ can be an effective treatment, but our previous study showed high levels of IFNγ-induced adverse events, including the loss of body weight. These unwanted events could be reduced by target-specific delivery of IFNγ after in vivo gene transfer. To achieve this, we selected the heparin-binding domain (HBD of extracellular superoxide dismutase as a molecule to anchor IFNγ to the cell surface. We designed three IFNγ derivatives, IFNγ-HBD1, IFNγ-HBD2, and IFNγ-HBD3, each of which had 1, 2, or 3 HBDs, respectively. Each plasmid-encoding fusion proteins was delivered to the liver, a model target in this study, by hydrodynamic tail vein injection. The serum concentration of IFNγ-HBD2 and IFNγ-HBD3 after gene delivery was lower than that of IFNγ or IFNγ-HBD1. Gene delivery of IFNγ-HBD2, but not of IFNγ-HBD3, effectively increased the mRNA expression of IFNγ-inducible genes in the liver, suggesting liver-specific distribution of IFNγ-HBD2. Gene delivery of IFNγ-HBD2-suppressed tumor growth in the liver as efficiently as that of IFNγ with much less symptoms of adverse effects. These results indicate that the adverse events of IFNγ gene transfer can be prevented by gene delivery of IFNγ-HBD2, a fusion protein with high cell surface affinity.

  4. External events analysis for experimental fusion facilities

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    1990-01-01

    External events are those off-normal events that threaten facilities either from outside or inside the building. These events, such as floods, fires, and earthquakes, are among the leading risk contributors for fission power plants, and the nature of fusion facilities indicates that they may also lead fusion risk. This paper gives overviews of analysis methods, references good analysis guidance documents, and gives design tips for mitigating the effects of floods and fires, seismic events, and aircraft impacts. Implications for future fusion facility siting are also discussed. Sites similar to fission plant sites are recommended. 46 refs

  5. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with viral-vectored vaccines, various synergistic components may need to be incorporated into DNA vaccines. From the perspective of the future clinical use of DNA vaccines, it has been suggested that antigen presentation should be improved and cytokine coadministration attempted. However, even...

  6. Transcriptome sequencing in pediatric acute lymphoblastic leukemia identifies fusion genes associated with distinct DNA methylation profiles

    Directory of Open Access Journals (Sweden)

    Yanara Marincevic-Zuniga

    2017-08-01

    Full Text Available Abstract Background Structural chromosomal rearrangements that lead to expressed fusion genes are a hallmark of acute lymphoblastic leukemia (ALL. In this study, we performed transcriptome sequencing of 134 primary ALL patient samples to comprehensively detect fusion transcripts. Methods We combined fusion gene detection with genome-wide DNA methylation analysis, gene expression profiling, and targeted sequencing to determine molecular signatures of emerging ALL subtypes. Results We identified 64 unique fusion events distributed among 80 individual patients, of which over 50% have not previously been reported in ALL. Although the majority of the fusion genes were found only in a single patient, we identified several recurrent fusion gene families defined by promiscuous fusion gene partners, such as ETV6, RUNX1, PAX5, and ZNF384, or recurrent fusion genes, such as DUX4-IGH. Our data show that patients harboring these fusion genes displayed characteristic genome-wide DNA methylation and gene expression signatures in addition to distinct patterns in single nucleotide variants and recurrent copy number alterations. Conclusion Our study delineates the fusion gene landscape in pediatric ALL, including both known and novel fusion genes, and highlights fusion gene families with shared molecular etiologies, which may provide additional information for prognosis and therapeutic options in the future.

  7. InFusion: Advancing Discovery of Fusion Genes and Chimeric Transcripts from Deep RNA-Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Konstantin Okonechnikov

    Full Text Available Analysis of fusion transcripts has become increasingly important due to their link with cancer development. Since high-throughput sequencing approaches survey fusion events exhaustively, several computational methods for the detection of gene fusions from RNA-seq data have been developed. This kind of analysis, however, is complicated by native trans-splicing events, the splicing-induced complexity of the transcriptome and biases and artefacts introduced in experiments and data analysis. There are a number of tools available for the detection of fusions from RNA-seq data; however, certain differences in specificity and sensitivity between commonly used approaches have been found. The ability to detect gene fusions of different types, including isoform fusions and fusions involving non-coding regions, has not been thoroughly studied yet. Here, we propose a novel computational toolkit called InFusion for fusion gene detection from RNA-seq data. InFusion introduces several unique features, such as discovery of fusions involving intergenic regions, and detection of anti-sense transcription in chimeric RNAs based on strand-specificity. Our approach demonstrates superior detection accuracy on simulated data and several public RNA-seq datasets. This improved performance was also evident when evaluating data from RNA deep-sequencing of two well-established prostate cancer cell lines. InFusion identified 26 novel fusion events that were validated in vitro, including alternatively spliced gene fusion isoforms and chimeric transcripts that include intergenic regions. The toolkit is freely available to download from http:/bitbucket.org/kokonech/infusion.

  8. A Hierarchical Convolutional Neural Network for vesicle fusion event classification.

    Science.gov (United States)

    Li, Haohan; Mao, Yunxiang; Yin, Zhaozheng; Xu, Yingke

    2017-09-01

    Quantitative analysis of vesicle exocytosis and classification of different modes of vesicle fusion from the fluorescence microscopy are of primary importance for biomedical researches. In this paper, we propose a novel Hierarchical Convolutional Neural Network (HCNN) method to automatically identify vesicle fusion events in time-lapse Total Internal Reflection Fluorescence Microscopy (TIRFM) image sequences. Firstly, a detection and tracking method is developed to extract image patch sequences containing potential fusion events. Then, a Gaussian Mixture Model (GMM) is applied on each image patch of the patch sequence with outliers rejected for robust Gaussian fitting. By utilizing the high-level time-series intensity change features introduced by GMM and the visual appearance features embedded in some key moments of the fusion process, the proposed HCNN architecture is able to classify each candidate patch sequence into three classes: full fusion event, partial fusion event and non-fusion event. Finally, we validate the performance of our method on 9 challenging datasets that have been annotated by cell biologists, and our method achieves better performances when comparing with three previous methods. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Identification and selection of initiating events for experimental fusion facilities

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    1989-01-01

    This paper describes the current approaches used in probabilistic risk assessment (PRA) to identify and select accident initiating events for study in either probabilistic safety analysis or PRA. Current methods directly apply to fusion facilities as well as other types of industries, such as chemical processing and nuclear fission. These identification and selection methods include the Master Logic Diagram, historical document review, system level Failure Modes and Effects Analysis, and others. A combination of the historical document review, such as Safety Analysis Reports and fusion safety studies, and the Master Logic Diagram with appropriate quality assurance reviews, is suggested for standardizing US fusion PRA effects. A preliminary set of generalized initiating events applicable to fusion facilities derived from safety document review is presented as a framework to start from for the historical document review and Master Logic Diagram approach. Fusion designers should find this list useful for their design reviews. 29 refs., 2 tabs

  10. Identification and selection of initiating events for experimental fusion facilities

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    1989-01-01

    This paper describes the current approaches used in probabilistic risk assessment (PRA) to identify and select accident initiating events for study in either probabilistic safety analysis or PRA. Current methods directly apply to fusion facilities as well as other types of industries, such as chemical processing and nuclear fission. These identification and selection methods include the Master Logic Diagram, historical document review, system level Failure Modes and Effects Analysis, and others. A combination of the historical document review, such as Safety Analysis Reports and fusion safety studies, and the Master Logic Diagram with appropriate quality assurance reviews, is suggested for standardizing U.S. fusion PRA efforts. A preliminary set of generalized initiating events applicable to fusion facilities derived from safety document review is presented as a framework to start from for the historical document review and Master Logic Diagram approach. Fusion designers should find this list useful for their design reviews. 29 refs., 1 tab

  11. Protein functional links in Trypanosoma brucei, identified by gene fusion analysis

    Directory of Open Access Journals (Sweden)

    Trimpalis Philip

    2011-07-01

    Full Text Available Abstract Background Domain or gene fusion analysis is a bioinformatics method for detecting gene fusions in one organism by comparing its genome to that of other organisms. The occurrence of gene fusions suggests that the two original genes that participated in the fusion are functionally linked, i.e. their gene products interact either as part of a multi-subunit protein complex, or in a metabolic pathway. Gene fusion analysis has been used to identify protein functional links in prokaryotes as well as in eukaryotic model organisms, such as yeast and Drosophila. Results In this study we have extended this approach to include a number of recently sequenced protists, four of which are pathogenic, to identify fusion linked proteins in Trypanosoma brucei, the causative agent of African sleeping sickness. We have also examined the evolution of the gene fusion events identified, to determine whether they can be attributed to fusion or fission, by looking at the conservation of the fused genes and of the individual component genes across the major eukaryotic and prokaryotic lineages. We find relatively limited occurrence of gene fusions/fissions within the protist lineages examined. Our results point to two trypanosome-specific gene fissions, which have recently been experimentally confirmed, one fusion involving proteins involved in the same metabolic pathway, as well as two novel putative functional links between fusion-linked protein pairs. Conclusions This is the first study of protein functional links in T. brucei identified by gene fusion analysis. We have used strict thresholds and only discuss results which are highly likely to be genuine and which either have already been or can be experimentally verified. We discuss the possible impact of the identification of these novel putative protein-protein interactions, to the development of new trypanosome therapeutic drugs.

  12. Gene Fusion Markup Language: a prototype for exchanging gene fusion data.

    Science.gov (United States)

    Kalyana-Sundaram, Shanker; Shanmugam, Achiraman; Chinnaiyan, Arul M

    2012-10-16

    An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses.

  13. Semantic Context Detection Using Audio Event Fusion

    Directory of Open Access Journals (Sweden)

    Cheng Wen-Huang

    2006-01-01

    Full Text Available Semantic-level content analysis is a crucial issue in achieving efficient content retrieval and management. We propose a hierarchical approach that models audio events over a time series in order to accomplish semantic context detection. Two levels of modeling, audio event and semantic context modeling, are devised to bridge the gap between physical audio features and semantic concepts. In this work, hidden Markov models (HMMs are used to model four representative audio events, that is, gunshot, explosion, engine, and car braking, in action movies. At the semantic context level, generative (ergodic hidden Markov model and discriminative (support vector machine (SVM approaches are investigated to fuse the characteristics and correlations among audio events, which provide cues for detecting gunplay and car-chasing scenes. The experimental results demonstrate the effectiveness of the proposed approaches and provide a preliminary framework for information mining by using audio characteristics.

  14. FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events.

    Science.gov (United States)

    Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J P; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

    2015-01-01

    Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain-domain interactions, protein-protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist's mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop 'novel' therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE. © The Author(s) 2015. Published by Oxford University Press.

  15. Organotypic three-dimensional culture model of mesenchymal and epithelial cells to examine tissue fusion events.

    Science.gov (United States)

    Tissue fusion during early mammalian development requires coordination of multiple cell types, the extracellular matrix, and complex signaling pathways. Fusion events during processes including heart development, neural tube closure, and palatal fusion are dependent on signaling ...

  16. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Science.gov (United States)

    Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

    2012-01-01

    RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  17. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Directory of Open Access Journals (Sweden)

    Sara Kangaspeska

    Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  18. Fusion events lead to truncation of FOS in epithelioid hemangioma of bone

    DEFF Research Database (Denmark)

    van IJzendoorn, David G P; de Jong, Danielle; Romagosa, Cleofe

    2015-01-01

    in exon 4 of the FOS gene and the fusion event led to the introduction of a stop codon. In all instances, the truncation of the FOS gene would result in the loss of the transactivation domain (TAD). Using FISH probes we found a break in the FOS gene in two additional cases, in none of these cases...... differential diagnosis of vascular tumors of bone. Our data suggest that the translocation causes truncation of the FOS protein, with loss of the TAD, which is thereby a novel mechanism involved in tumorigenesis....

  19. Selection of Photon Gluon Fusion Events in DIS

    International Nuclear Information System (INIS)

    Kowalik, K.; Rondio, E.; Sulej, R.; Zaremba, K.

    2001-01-01

    A selection of the Photon Gluon Fusion (PGF) process with light quarks for deep inelastic scattering events is presented. This process is directly sensitive to gluon polarization and our goal is to find out the most effective selection on a sample of events simulated for the SMC experiment. We compare two general multi-class classification methods - Bayes method and neural network with a conventional selection procedure. The neural network algorithm presented here is a modification of method belonging to the family of directional minimization algorithms. This method is convenient and effective for photon gluon fusion selection and determination of gluon polarization. Finally we present the estimation for precision of gluon polarization for neural network method. (author)

  20. Can gene fusions serve for fingerprints of radiogenic cancers?

    International Nuclear Information System (INIS)

    Nakamura, Nori

    2016-01-01

    It has been recognized that malignancies in blood cells often bear specific chromosome translocations or gene fusions. In recent years, the presence of fusion genes became to be known also among solid cancers as driver mutations. However, representative solid cancers bearing specific gene fusions are limited to cancers of thyroid, prostate, and sarcomas among which only thyroid cancer risk is known to be related to radiation exposures. On the other hand, it is extremely rare to find recurrent reciprocal translocations among common cancers such as in the lung, stomach, breast, and colon, which form a major component of radiation risks. It is therefore unlikely that radiation increases the risk of cancer by inducing specific translocations (gene fusions) but more likely through induction of mutations (including deletions). Although gene fusions could play a role in radiation carcinogenesis, it does not seem good enough to serve for a radiation fingerprint. (author)

  1. Earth Science Data Fusion with Event Building Approach

    Science.gov (United States)

    Lukashin, C.; Bartle, Ar.; Callaway, E.; Gyurjyan, V.; Mancilla, S.; Oyarzun, R.; Vakhnin, A.

    2015-01-01

    Objectives of the NASA Information And Data System (NAIADS) project are to develop a prototype of a conceptually new middleware framework to modernize and significantly improve efficiency of the Earth Science data fusion, big data processing and analytics. The key components of the NAIADS include: Service Oriented Architecture (SOA) multi-lingual framework, multi-sensor coincident data Predictor, fast into-memory data Staging, multi-sensor data-Event Builder, complete data-Event streaming (a work flow with minimized IO), on-line data processing control and analytics services. The NAIADS project is leveraging CLARA framework, developed in Jefferson Lab, and integrated with the ZeroMQ messaging library. The science services are prototyped and incorporated into the system. Merging the SCIAMACHY Level-1 observations and MODIS/Terra Level-2 (Clouds and Aerosols) data products, and ECMWF re- analysis will be used for NAIADS demonstration and performance tests in compute Cloud and Cluster environments.

  2. Novel fusion genes and chimeric transcripts in ependymal tumors

    DEFF Research Database (Denmark)

    Olsen, Thale Kristin; Panagopoulos, Ioannis; Gorunova, Ludmila

    2016-01-01

    with subsequent Sanger sequencing was used to validate the potential fusions. Fluorescent in situ hybridization (FISH) using locus-specific probes was also performed. A total of 841 candidate chimeric transcripts were identified in the 12 tumors, with an average of 49 unique candidate fusions per tumor. After...... infratentorial anaplastic ependymoma. Our previously reported ALK rearrangements and the RELA and YAP1 fusions found in supratentorial ependymomas were until now the only known fusion genes present in ependymal tumors. The chimeric transcripts presented here are the first to be reported in infratentorial...

  3. Relevance of Fusion Genes in Pediatric Cancers: Toward Precision Medicine

    Directory of Open Access Journals (Sweden)

    Célia Dupain

    2017-03-01

    Full Text Available Pediatric cancers differ from adult tumors, especially by their very low mutational rate. Therefore, their etiology could be explained in part by other oncogenic mechanisms such as chromosomal rearrangements, supporting the possible implication of fusion genes in the development of pediatric cancers. Fusion genes result from chromosomal rearrangements leading to the juxtaposition of two genes. Consequently, an abnormal activation of one or both genes is observed. The detection of fusion genes has generated great interest in basic cancer research and in the clinical setting, since these genes can lead to better comprehension of the biological mechanisms of tumorigenesis and they can also be used as therapeutic targets and diagnostic or prognostic biomarkers. In this review, we discuss the molecular mechanisms of fusion genes and their particularities in pediatric cancers, as well as their relevance in murine models and in the clinical setting. We also point out the difficulties encountered in the discovery of fusion genes. Finally, we discuss future perspectives and priorities for finding new innovative therapies in childhood cancer.

  4. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  5. Computational challenges in modeling gene regulatory events.

    Science.gov (United States)

    Pataskar, Abhijeet; Tiwari, Vijay K

    2016-10-19

    Cellular transcriptional programs driven by genetic and epigenetic mechanisms could be better understood by integrating "omics" data and subsequently modeling the gene-regulatory events. Toward this end, computational biology should keep pace with evolving experimental procedures and data availability. This article gives an exemplified account of the current computational challenges in molecular biology.

  6. Gene fusion analysis in the battle against the African endemic sleeping sickness.

    Directory of Open Access Journals (Sweden)

    Philip Trimpalis

    Full Text Available The protozoan Trypanosoma brucei causes African Trypanosomiasis or sleeping sickness in humans, which can be lethal if untreated. Most available pharmacological treatments for the disease have severe side-effects. The purpose of this analysis was to detect novel protein-protein interactions (PPIs, vital for the parasite, which could lead to the development of drugs against this disease to block the specific interactions. In this work, the Domain Fusion Analysis (Rosetta Stone method was used to identify novel PPIs, by comparing T. brucei to 19 organisms covering all major lineages of the tree of life. Overall, 49 possible protein-protein interactions were detected, and classified based on (a statistical significance (BLAST e-value, domain length etc., (b their involvement in crucial metabolic pathways, and (c their evolutionary history, particularly focusing on whether a protein pair is split in T. brucei and fused in the human host. We also evaluated fusion events including hypothetical proteins, and suggest a possible molecular function or involvement in a certain biological process. This work has produced valuable results which could be further studied through structural biology or other experimental approaches so as to validate the protein-protein interactions proposed here. The evolutionary analysis of the proteins involved showed that, gene fusion or gene fission events can happen in all organisms, while some protein domains are more prone to fusion and fission events and present complex evolutionary patterns.

  7. Multimodality imaging of reporter gene expression using a novel fusion vector in living cells and animals

    Science.gov (United States)

    Gambhir, Sanjiv [Portola Valley, CA; Pritha, Ray [Mountain View, CA

    2011-06-07

    Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.

  8. A Screening Method for the ALK Fusion Gene in NSCLC

    International Nuclear Information System (INIS)

    Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

    2012-01-01

    Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

  9. Exploration of the gene fusion landscape of glioblastoma using transcriptome sequencing and copy number data.

    Science.gov (United States)

    Shah, Nameeta; Lankerovich, Michael; Lee, Hwahyung; Yoon, Jae-Geun; Schroeder, Brett; Foltz, Greg

    2013-11-22

    RNA-seq has spurred important gene fusion discoveries in a number of different cancers, including lung, prostate, breast, brain, thyroid and bladder carcinomas. Gene fusion discovery can potentially lead to the development of novel treatments that target the underlying genetic abnormalities. In this study, we provide comprehensive view of gene fusion landscape in 185 glioblastoma multiforme patients from two independent cohorts. Fusions occur in approximately 30-50% of GBM patient samples. In the Ivy Center cohort of 24 patients, 33% of samples harbored fusions that were validated by qPCR and Sanger sequencing. We were able to identify high-confidence gene fusions from RNA-seq data in 53% of the samples in a TCGA cohort of 161 patients. We identified 13 cases (8%) with fusions retaining a tyrosine kinase domain in the TCGA cohort and one case in the Ivy Center cohort. Ours is the first study to describe recurrent fusions involving non-coding genes. Genomic locations 7p11 and 12q14-15 harbor majority of the fusions. Fusions on 7p11 are formed in focally amplified EGFR locus whereas 12q14-15 fusions are formed by complex genomic rearrangements. All the fusions detected in this study can be further visualized and analyzed using our website: http://ivygap.swedish.org/fusions. Our study highlights the prevalence of gene fusions as one of the major genomic abnormalities in GBM. The majority of the fusions are private fusions, and a minority of these recur with low frequency. A small subset of patients with fusions of receptor tyrosine kinases can benefit from existing FDA approved drugs and drugs available in various clinical trials. Due to the low frequency and rarity of clinically relevant fusions, RNA-seq of GBM patient samples will be a vital tool for the identification of patient-specific fusions that can drive personalized therapy.

  10. Horizontal gene transfers with or without cell fusions in all categories of the living matter.

    Science.gov (United States)

    Sinkovics, Joseph G

    2011-01-01

    This article reviews the history of widespread exchanges of genetic segments initiated over 3 billion years ago, to be part of their life style, by sphero-protoplastic cells, the ancestors of archaea, prokaryota, and eukaryota. These primordial cells shared a hostile anaerobic and overheated environment and competed for survival. "Coexist with, or subdue and conquer, expropriate its most useful possessions, or symbiose with it, your competitor" remain cellular life's basic rules. This author emphasizes the role of viruses, both in mediating cell fusions, such as the formation of the first eukaryotic cell(s) from a united crenarchaeon and prokaryota, and the transfer of host cell genes integrated into viral (phages) genomes. After rising above the Darwinian threshold, rigid rules of speciation and vertical inheritance in the three domains of life were established, but horizontal gene transfers with or without cell fusions were never abolished. The author proves with extensive, yet highly selective documentation, that not only unicellular microorganisms, but the most complex multicellular entities of the highest ranks resort to, and practice, cell fusions, and donate and accept horizontally (laterally) transferred genes. Cell fusions and horizontally exchanged genetic materials remain the fundamental attributes and inherent characteristics of the living matter, whether occurring accidentally or sought after intentionally. These events occur to cells stagnating for some 3 milliard years at a lower yet amazingly sophisticated level of evolution, and to cells achieving the highest degree of differentiation, and thus functioning in dependence on the support of a most advanced multicellular host, like those of the human brain. No living cell is completely exempt from gene drains or gene insertions.

  11. Early and late HIV-1 membrane fusion events are impaired by sphinganine lipidated peptides that target the fusion site.

    Science.gov (United States)

    Klug, Yoel A; Ashkenazi, Avraham; Viard, Mathias; Porat, Ziv; Blumenthal, Robert; Shai, Yechiel

    2014-07-15

    Lipid-conjugated peptides have advanced the understanding of membrane protein functions and the roles of lipids in the membrane milieu. These lipopeptides modulate various biological systems such as viral fusion. A single function has been suggested for the lipid, binding to the membrane and thus elevating the local concentration of the peptide at the target site. In the present paper, we challenged this argument by exploring in-depth the antiviral mechanism of lipopeptides, which comprise sphinganine, the lipid backbone of DHSM (dihydrosphingomyelin), and an HIV-1 envelope-derived peptide. Surprisingly, we discovered a partnership between the lipid and the peptide that impaired early membrane fusion events by reducing CD4 receptor lateral diffusion and HIV-1 fusion peptide-mediated lipid mixing. Moreover, only the joint function of sphinganine and its conjugate peptide disrupted HIV-1 fusion protein assembly and folding at the later fusion steps. Via imaging techniques we revealed for the first time the direct localization of these lipopeptides to the virus-cell and cell-cell contact sites. Overall, the findings of the present study may suggest lipid-protein interactions in various biological systems and may help uncover a role for elevated DHSM in HIV-1 and its target cell membranes.

  12. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  13. Study on Fusion Protein and Its gene in Baculovirus Specificity

    International Nuclear Information System (INIS)

    Nemr, W.A.H.

    2012-01-01

    Baculoviruses are subdivided into two groups depending on the type of budded virus envelop fusion protein; group I utilized gp64 which include the most of nucleopolyhedroviruses (NPVs), group II utilized F protein which include the remnants of NPVs and all Granuloviruses (GVs). Recent studies reported the viral F protein coding gene as a host cellular sourced gene and may evolutionary acquired from the host genome referring to phylogeny analysis of fusion proteins. Thus, it was deduced that F protein coding gene is species- specific nucleotide sequence related to the type of the specific host and if virus could infect an unexpected host, the resulted virus may encode a vary F gene. In this regard, the present study utilized the mentioned properties of F gene in an attempt to produce a model of specific and more economic wider range granulovirus bio- pesticide able to infect both Spodoptera littoralis and Phthorimaea operculella larvae. Multiple sequence alignment and phylogeny analysis were performed on six members of group II baculovirus, novel universal PCR primers were manually designed from the conserved regions in the alignment graph, targeted to amplify species- specific sequence entire F gene open reading frame (ORF) which is useful in molecular identification of baculovirus in unknown samples. So, the PCR product of SpliGV used to prepare a specific probe for the F gene of this type of virus. Results reflected that it is possible to infect S. littoralis larvae by PhopGV if injected into larval haemocoel, the resulted virus of this infection showed by using DNA hybridization technique to be encode to F gene homologous with the F gene of Spli GV, which is revealed that the resulted virus acquired this F gene sequence from the host genome after infection. Consequently, these results may infer that if genetic aberrations occur in the host genome, this may affect in baculoviral infectivity. So, this study aimed to investigate the effect of gamma radiation at

  14. Scaffold filling, contig fusion and comparative gene order inference

    Directory of Open Access Journals (Sweden)

    Rounsley Steve

    2010-06-01

    Full Text Available Abstract Background There has been a trend in increasing the phylogenetic scope of genome sequencing without finishing the sequence of the genome. Increasing numbers of genomes are being published in scaffold or contig form. Rearrangement algorithms, however, including gene order-based phylogenetic tools, require whole genome data on gene order or syntenic block order. How then can we use rearrangement algorithms to compare genomes available in scaffold form only? Can the comparative evidence predict the location of unsequenced genes? Results Our method involves optimally filling in genes missing from the scaffolds, while incorporating the augmented scaffolds directly into the rearrangement algorithms as if they were chromosomes. This is accomplished by an exact, polynomial-time algorithm. We then correct for the number of extra fusion/fission operations required to make scaffolds comparable to full assemblies. We model the relationship between the ratio of missing genes actually absent from the genome versus merely unsequenced ones, on one hand, and the increase of genomic distance after scaffold filling, on the other. We estimate the parameters of this model through simulations and by comparing the angiosperm genomes Ricinus communis and Vitis vinifera. Conclusions The algorithm solves the comparison of genomes with 18,300 genes, including 4500 missing from one genome, in less than a minute on a MacBook, putting virtually all genomes within range of the method.

  15. Scaffold filling, contig fusion and comparative gene order inference.

    Science.gov (United States)

    Muñoz, Adriana; Zheng, Chunfang; Zhu, Qian; Albert, Victor A; Rounsley, Steve; Sankoff, David

    2010-06-04

    There has been a trend in increasing the phylogenetic scope of genome sequencing without finishing the sequence of the genome. Increasing numbers of genomes are being published in scaffold or contig form. Rearrangement algorithms, however, including gene order-based phylogenetic tools, require whole genome data on gene order or syntenic block order. How then can we use rearrangement algorithms to compare genomes available in scaffold form only? Can the comparative evidence predict the location of unsequenced genes? Our method involves optimally filling in genes missing from the scaffolds, while incorporating the augmented scaffolds directly into the rearrangement algorithms as if they were chromosomes. This is accomplished by an exact, polynomial-time algorithm. We then correct for the number of extra fusion/fission operations required to make scaffolds comparable to full assemblies. We model the relationship between the ratio of missing genes actually absent from the genome versus merely unsequenced ones, on one hand, and the increase of genomic distance after scaffold filling, on the other. We estimate the parameters of this model through simulations and by comparing the angiosperm genomes Ricinus communis and Vitis vinifera. The algorithm solves the comparison of genomes with 18,300 genes, including 4500 missing from one genome, in less than a minute on a MacBook, putting virtually all genomes within range of the method.

  16. A Cluster-Based Fuzzy Fusion Algorithm for Event Detection in Heterogeneous Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    ZiQi Hao

    2015-01-01

    Full Text Available As limited energy is one of the tough challenges in wireless sensor networks (WSN, energy saving becomes important in increasing the lifecycle of the network. Data fusion enables combining information from several sources thus to provide a unified scenario, which can significantly save sensor energy and enhance sensing data accuracy. In this paper, we propose a cluster-based data fusion algorithm for event detection. We use k-means algorithm to form the nodes into clusters, which can significantly reduce the energy consumption of intracluster communication. Distances between cluster heads and event and energy of clusters are fuzzified, thus to use a fuzzy logic to select the clusters that will participate in data uploading and fusion. Fuzzy logic method is also used by cluster heads for local decision, and then the local decision results are sent to the base station. Decision-level fusion for final decision of event is performed by base station according to the uploaded local decisions and fusion support degree of clusters calculated by fuzzy logic method. The effectiveness of this algorithm is demonstrated by simulation results.

  17. Gene Fusions Associated with Recurrent Amplicons Represent a Class of Passenger Aberrations in Breast Cancer

    Directory of Open Access Journals (Sweden)

    Shanker Kalyana-Sundaram

    2012-08-01

    Full Text Available Application of high-throughput transcriptome sequencing has spurred highly sensitive detection and discovery of gene fusions in cancer, but distinguishing potentially oncogenic fusions from random, “passenger” aberrations has proven challenging. Here we examine a distinctive group of gene fusions that involve genes present in the loci of chromosomal amplifications—a class of oncogenic aberrations that are widely prevalent in breast cancers. Integrative analysis of a panel of 14 breast cancer cell lines comparing gene fusions discovered by high-throughput transcriptome sequencing and genome-wide copy number aberrations assessed by array comparative genomic hybridization, led to the identification of 77 gene fusions, of which more than 60% were localized to amplicons including 17q12, 17q23, 20q13, chr8q, and others. Many of these fusions appeared to be recurrent or involved highly expressed oncogenic drivers, frequently fused with multiple different partners, but sometimes displaying loss of functional domains. As illustrative examples of the “amplicon-associated” gene fusions, we examined here a recurrent gene fusion involving the mediator of mammalian target of rapamycin signaling, RPS6KB1 kinase in BT-474, and the therapeutically important receptor tyrosine kinase EGFR in MDA-MB-468 breast cancer cell line. These gene fusions comprise a minor allelic fraction relative to the highly expressed full-length transcripts and encode chimera lacking the kinase domains, which do not impart dependence on the respective cells. Our study suggests that amplicon-associated gene fusions in breast cancer primarily represent a by-product of chromosomal amplifications, which constitutes a subset of passenger aberrations and should be factored accordingly during prioritization of gene fusion candidates.

  18. Explaining Lifelong Loyalty: The Role of Identity Fusion and Self-Shaping Group Events.

    Science.gov (United States)

    Newson, Martha; Buhrmester, Michael; Whitehouse, Harvey

    2016-01-01

    Pledging lifelong loyalty to an ingroup can have far-reaching behavioural effects, ranging from ordinary acts of ingroup kindness to extraordinary acts of self-sacrifice. What motivates this important form of group commitment? Here, we propose one especially potent answer to this question-the experience of a visceral sense of oneness with a group (i.e., identity fusion). In a sample of British football fans, a population in which high levels of lifelong loyalty are thought to be common, we first examined the hypothesised relationship between fusion and perceptions of lifelong loyalty to one's club. We further explored the hypothesis that fusion and lifelong loyalty are not merely a reflection of past time investment in a group, but also reflect a deeper, memory-based process of feeling personally shaped by key group events, both euphoric and dysphoric. We found broad support for these hypotheses. Results suggest that feeling personally self-shaped by club events (e.g., crucial wins and losses), rather than time invested in the club, leads to greater identity fusion to one's club. In turn, fusion engenders a sense of lifelong club loyalty. We discuss our findings in relation to the growing literature on the experiential origins of intense social cohesion.

  19. Explaining Lifelong Loyalty: The Role of Identity Fusion and Self-Shaping Group Events.

    Directory of Open Access Journals (Sweden)

    Martha Newson

    Full Text Available Pledging lifelong loyalty to an ingroup can have far-reaching behavioural effects, ranging from ordinary acts of ingroup kindness to extraordinary acts of self-sacrifice. What motivates this important form of group commitment? Here, we propose one especially potent answer to this question-the experience of a visceral sense of oneness with a group (i.e., identity fusion. In a sample of British football fans, a population in which high levels of lifelong loyalty are thought to be common, we first examined the hypothesised relationship between fusion and perceptions of lifelong loyalty to one's club. We further explored the hypothesis that fusion and lifelong loyalty are not merely a reflection of past time investment in a group, but also reflect a deeper, memory-based process of feeling personally shaped by key group events, both euphoric and dysphoric. We found broad support for these hypotheses. Results suggest that feeling personally self-shaped by club events (e.g., crucial wins and losses, rather than time invested in the club, leads to greater identity fusion to one's club. In turn, fusion engenders a sense of lifelong club loyalty. We discuss our findings in relation to the growing literature on the experiential origins of intense social cohesion.

  20. Tyrosine kinase chromosomal translocations mediate distinct and overlapping gene regulation events

    International Nuclear Information System (INIS)

    Kim, Hani; Gillis, Lisa C; Jarvis, Jordan D; Yang, Stuart; Huang, Kai; Der, Sandy; Barber, Dwayne L

    2011-01-01

    Leukemia is a heterogeneous disease commonly associated with recurrent chromosomal translocations that involve tyrosine kinases including BCR-ABL, TEL-PDGFRB and TEL-JAK2. Most studies on the activated tyrosine kinases have focused on proximal signaling events, but little is known about gene transcription regulated by these fusions. Oligonucleotide microarray was performed to compare mRNA changes attributable to BCR-ABL, TEL-PDGFRB and TEL-JAK2 after 1 week of activation of each fusion in Ba/F3 cell lines. Imatinib was used to control the activation of BCR-ABL and TEL-PDGFRB, and TEL-JAK2-mediated gene expression was examined 1 week after Ba/F3-TEL-JAK2 cells were switched to factor-independent conditions. Microarray analysis revealed between 800 to 2000 genes induced or suppressed by two-fold or greater by each tyrosine kinase, with a subset of these genes commonly induced or suppressed among the three fusions. Validation by Quantitative PCR confirmed that eight genes (Dok2, Mrvi1, Isg20, Id1, gp49b, Cxcl10, Scinderin, and collagen Vα1(Col5a1)) displayed an overlapping regulation among the three tested fusion proteins. Stat1 and Gbp1 were induced uniquely by TEL-PDGFRB. Our results suggest that BCR-ABL, TEL-PDGFRB and TEL-JAK2 regulate distinct and overlapping gene transcription profiles. Many of the genes identified are known to be involved in processes associated with leukemogenesis, including cell migration, proliferation and differentiation. This study offers the basis for further work that could lead to an understanding of the specificity of diseases caused by these three chromosomal translocations

  1. A Foreign Object Damage Event Detector Data Fusion System for Turbofan Engines

    Science.gov (United States)

    Turso, James A.; Litt, Jonathan S.

    2004-01-01

    A Data Fusion System designed to provide a reliable assessment of the occurrence of Foreign Object Damage (FOD) in a turbofan engine is presented. The FOD-event feature level fusion scheme combines knowledge of shifts in engine gas path performance obtained using a Kalman filter, with bearing accelerometer signal features extracted via wavelet analysis, to positively identify a FOD event. A fuzzy inference system provides basic probability assignments (bpa) based on features extracted from the gas path analysis and bearing accelerometers to a fusion algorithm based on the Dempster-Shafer-Yager Theory of Evidence. Details are provided on the wavelet transforms used to extract the foreign object strike features from the noisy data and on the Kalman filter-based gas path analysis. The system is demonstrated using a turbofan engine combined-effects model (CEM), providing both gas path and rotor dynamic structural response, and is suitable for rapid-prototyping of control and diagnostic systems. The fusion of the disparate data can provide significantly more reliable detection of a FOD event than the use of either method alone. The use of fuzzy inference techniques combined with Dempster-Shafer-Yager Theory of Evidence provides a theoretical justification for drawing conclusions based on imprecise or incomplete data.

  2. An Efficient Method for Identifying Gene Fusions by Targeted RNA Sequencing from Fresh Frozen and FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Jonathan A Scolnick

    Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.

  3. Statistical Assessment of Gene Fusion Detection Algorithms using RNASequencing Data

    NARCIS (Netherlands)

    Varadan, V.; Janevski, A.; Kamalakaran, S.; Banerjee, N.; Harris, L.; Dimitrova, D.

    2012-01-01

    The detection and quantification of fusion transcripts has both biological and clinical implications. RNA sequencing technology provides a means for unbiased and high resolution characterization of fusion transcript information in tissue samples. We evaluated two fusiondetection algorithms,

  4. BCR-ABL fusion genes are inducible by X-irradiation in vitro

    International Nuclear Information System (INIS)

    Ito, Takashi; Seyama, Toshio; Mizuno, Terumi; Hayashi, Tomonori; Nakamura, Nori; Akiyama, Mitoshi; Dohi, Kiyohiko.

    1992-01-01

    The Philadelphia chromosome consists of a reciprocal translocation between the ABL oncogene at chromosome 9q34 and the BCR gene at chromosome 22q resulting in the expression of chimeric BCR-ABL mRNAs specific to chronic myelogenous leukemia (CML). The presence of the fusion genes can be detected with high specificity and sensitivity by means of reverse transcription and polymerase chain reaction. Using this assay, it was possible to detect BCR-ABL fusion genes induced among HL60 cells after 100 Gy of X-irradiation in vitro. A total of five fusion gene transcripts were obtained. These fusion genes contained not only CML-specific BCR-ABL rearrangements, but also other forms of BCR-ABL fusions. These latter genes had junctions of BCR exon 4/ABL exon 2 intervened by a segment of DNA of unknown origin, BCR exon 5/ABL exon 2, and BCR exon 4/ABL exon 2. The results appear to be the first evidence for the induction of the BCR-ABL fusion gene by X-irradiation. In terms of leukemogenesis, it is suggested that only those cells bearing certain CML-related BCR-ABL fusion genes are positively selected by virtue of a growth advantage in vivo. (author)

  5. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  6. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    International Nuclear Information System (INIS)

    Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

    2014-01-01

    In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

  7. Gene fusions with lacZ by duplication insertion in the radioresistant bacterium Deinococcus radiodurans

    International Nuclear Information System (INIS)

    Lennon, E.; Minton, K.W.

    1990-01-01

    Deinococcus radiodurans is the most-studied species of a eubacterial family characterized by extreme resistance to DNA damage. We have focused on developing molecular biological techniques to investigate the genetics of this organism. We report construction of lacZ gene fusions by a method involving both in vitro splicing and the natural transformation of D. radiodurans. Numerous fusion strains were identified by expression of beta-galactosidase. Among these fusion strains, several were inducible by exposure to the DNA-damaging agent mitomycin C, and four of the inducible fusion constructs were cloned in Escherichia coli. Hybridization studies indicate that one of the damage-inducible genes contains a sequence reiterated throughout the D. radiodurans chromosome. Survival measurements show that two of the fusion strains have increased sensitivity to mitomycin C, suggesting that the fusions within these strains inactivate repair functions

  8. Regulation of membrane fusion and secretory events in the sea urchin embryo

    International Nuclear Information System (INIS)

    Roe, J.L.

    1990-01-01

    Membrane fusion and secretory events play a key role in fertilization and early development in the sea urchin embryo. To investigate the mechanism of membrane fusion, the effect of inhibitors of metalloendoprotease activity was studied on two model systems of cell fusion; fertilization and spiculogenesis by primary mesenchyme cells in the embryo. Both the zinc chelator, 1,10-phenanthroline, and peptide metalloprotease substrates were found to inhibit both fertilization and gamete fusion, while peptides that are not substrates of metalloproteases did not affect either process. Primary mesenchyme cells form the larval skeleton in the embryo by deposition of mineral and an organic matrix into a syncytial cavity formed by fusion of filopodia of these cells. Metalloprotease inhibitors were found to inhibit spiculogenesis both in vivo and in cultures of isolated primary mesenchyme cells, and the activity of a metalloprotease of the appropriate specificity was found in the primary mesenchyme cells. These two studies implicate the activity of a metalloprotease in a necessary step in membrane fusion. Following fertilization, exocytosis of the cortical granules results in the formation of the fertilization envelope and the hyaline layer, that surround the developing embryo. The hatching enzyme is secreted by the blastula stage sea urchin embryo, which proteolyzes the fertilization envelope surrounding the embryo, allowing the embryo to hatch. Using an assay that measures 125 I-fertilization envelope degradation, the hatching enzyme was identified as a 33 kDa metalloprotease, and was purified by ion-exchange and affinity chromatography from the hatching media of Strongylocentrotus purpuratus embryos. The hatching enzyme showed a substrate preference for only a minor subset of fertilization envelope proteins

  9. Engineering and Functional Characterization of Fusion Genes Identifies Novel Oncogenic Drivers of Cancer. | Office of Cancer Genomics

    Science.gov (United States)

    Oncogenic gene fusions drive many human cancers, but tools to more quickly unravel their functional contributions are needed. Here we describe methodology permitting fusion gene construction for functional evaluation. Using this strategy, we engineered the known fusion oncogenes, BCR-ABL1, EML4-ALK, and ETV6-NTRK3, as well as 20 previously uncharacterized fusion genes identified in TCGA datasets.

  10. LINE FUSION GENES: a database of LINE expression in human genes

    Directory of Open Access Journals (Sweden)

    Park Hong-Seog

    2006-06-01

    Full Text Available Abstract Background Long Interspersed Nuclear Elements (LINEs are the most abundant retrotransposons in humans. About 79% of human genes are estimated to contain at least one segment of LINE per transcription unit. Recent studies have shown that LINE elements can affect protein sequences, splicing patterns and expression of human genes. Description We have developed a database, LINE FUSION GENES, for elucidating LINE expression throughout the human gene database. We searched the 28,171 genes listed in the NCBI database for LINE elements and analyzed their structures and expression patterns. The results show that the mRNA sequences of 1,329 genes were affected by LINE expression. The LINE expression types were classified on the basis of LINEs in the 5' UTR, exon or 3' UTR sequences of the mRNAs. Our database provides further information, such as the tissue distribution and chromosomal location of the genes, and the domain structure that is changed by LINE integration. We have linked all the accession numbers to the NCBI data bank to provide mRNA sequences for subsequent users. Conclusion We believe that our work will interest genome scientists and might help them to gain insight into the implications of LINE expression for human evolution and disease. Availability http://www.primate.or.kr/line

  11. Automatically Identifying Fusion Events between GLUT4 Storage Vesicles and the Plasma Membrane in TIRF Microscopy Image Sequences

    Directory of Open Access Journals (Sweden)

    Jian Wu

    2015-01-01

    Full Text Available Quantitative analysis of the dynamic behavior about membrane-bound secretory vesicles has proven to be important in biological research. This paper proposes a novel approach to automatically identify the elusive fusion events between VAMP2-pHluorin labeled GLUT4 storage vesicles (GSVs and the plasma membrane. The differentiation is implemented to detect the initiation of fusion events by modified forward subtraction of consecutive frames in the TIRFM image sequence. Spatially connected pixels in difference images brighter than a specified adaptive threshold are grouped into a distinct fusion spot. The vesicles are located at the intensity-weighted centroid of their fusion spots. To reveal the true in vivo nature of a fusion event, 2D Gaussian fitting for the fusion spot is used to derive the intensity-weighted centroid and the spot size during the fusion process. The fusion event and its termination can be determined according to the change of spot size. The method is evaluated on real experiment data with ground truth annotated by expert cell biologists. The evaluation results show that it can achieve relatively high accuracy comparing favorably to the manual analysis, yet at a small fraction of time.

  12. Fusion

    CERN Document Server

    Mahaffey, James A

    2012-01-01

    As energy problems of the world grow, work toward fusion power continues at a greater pace than ever before. The topic of fusion is one that is often met with the most recognition and interest in the nuclear power arena. Written in clear and jargon-free prose, Fusion explores the big bang of creation to the blackout death of worn-out stars. A brief history of fusion research, beginning with the first tentative theories in the early 20th century, is also discussed, as well as the race for fusion power. This brand-new, full-color resource examines the various programs currently being funded or p

  13. Discovery and characterization of a novel CCND1/MRCK gene fusion in mantle cell lymphoma

    Directory of Open Access Journals (Sweden)

    Chioniso Patience Masamha

    2016-03-01

    Full Text Available Abstract The t(11;14 translocation resulting in constitutive cyclin D1 expression is an early event in mantle cell lymphoma (MCL transformation. Patients with a highly proliferative phenotype produce cyclin D1 transcripts with truncated 3′UTRs that evade miRNA regulation. Here, we report the recurrence of a novel gene fusion in MCL cell lines and MCL patient isolates that consists of the full protein coding region of cyclin D1 (CCND1 and a 3′UTR consisting of sequences from both the CCND1 3′UTR and myotonic dystrophy kinase-related Cdc42-binding kinase's (MRCK intron one. The resulting CCND1/MRCK mRNA is resistant to CCND1-targeted miRNA regulation, and targeting the MRCK region of the chimeric 3′UTR with siRNA results in decreased CCND1 levels.

  14. Conceptual design of a generic pulse schedule and event handling editor for improved fusion device operation

    International Nuclear Information System (INIS)

    Barana, Oliviero; Nouailletas, Rémy; Brémond, Sylvain; Moreau, Philippe; Allegretti, Ludovic; Balme, Stéphane; Ravenel, Nathalie; Mannori, Simone; Guillerminet, Bernard; Leroux, Fabrice; Douai, David; Nardon, Eric; Hertout, Patrick; Saint-Laurent, François

    2013-01-01

    Highlights: ► Real-time event handling requires extended functionalities of pulse schedule editors and plasma control systems ► A new pulse schedule editor, conceived for parameterization of systematic off-normal event handling, is described ► A global, generic approach on off-normal event handling is highlighted ► The functional architecture of an off-normal event handling oriented plasma control system is discussed ► The main objects of the pulse schedule editor are the segment-descriptor object and the scenario-descriptor object. -- Abstract: Coping with unexpected events is an important issue of nuclear fusion experiments. The future machines, characterized by very long plasma discharges and actively cooled metallic plasma-facing components, will require a systematic intervention in real time, in order to maximize the performance and protect the investment. The real-time management of events will require extending the functionalities of the current pulse schedule editors with the possibility of using reference waveforms provided with acceptability margins and setting up advanced mitigation strategies and event countermeasures. With this purpose, a new pulse schedule editor, based on a time-segment approach for the preparation of experimental scenarios, is being conceived on Tore Supra, together with a new plasma control system. This paper will report on their conceptual design and give account of the preliminary results of a feasibility study currently under way in order to prepare a possible implementation on Tore Supra

  15. Conceptual design of a generic pulse schedule and event handling editor for improved fusion device operation

    Energy Technology Data Exchange (ETDEWEB)

    Barana, Oliviero, E-mail: oliviero.barana@cea.fr [CEA, IRFM, F-13108 Saint-Paul-Lez Durance (France); Nouailletas, Rémy; Brémond, Sylvain; Moreau, Philippe; Allegretti, Ludovic; Balme, Stéphane; Ravenel, Nathalie [CEA, IRFM, F-13108 Saint-Paul-Lez Durance (France); Mannori, Simone [ENEA C.R. Brasimone, 40032 Camugnano (Italy); Guillerminet, Bernard; Leroux, Fabrice; Douai, David; Nardon, Eric; Hertout, Patrick; Saint-Laurent, François [CEA, IRFM, F-13108 Saint-Paul-Lez Durance (France)

    2013-10-15

    Highlights: ► Real-time event handling requires extended functionalities of pulse schedule editors and plasma control systems ► A new pulse schedule editor, conceived for parameterization of systematic off-normal event handling, is described ► A global, generic approach on off-normal event handling is highlighted ► The functional architecture of an off-normal event handling oriented plasma control system is discussed ► The main objects of the pulse schedule editor are the segment-descriptor object and the scenario-descriptor object. -- Abstract: Coping with unexpected events is an important issue of nuclear fusion experiments. The future machines, characterized by very long plasma discharges and actively cooled metallic plasma-facing components, will require a systematic intervention in real time, in order to maximize the performance and protect the investment. The real-time management of events will require extending the functionalities of the current pulse schedule editors with the possibility of using reference waveforms provided with acceptability margins and setting up advanced mitigation strategies and event countermeasures. With this purpose, a new pulse schedule editor, based on a time-segment approach for the preparation of experimental scenarios, is being conceived on Tore Supra, together with a new plasma control system. This paper will report on their conceptual design and give account of the preliminary results of a feasibility study currently under way in order to prepare a possible implementation on Tore Supra.

  16. Long-Term Endurance Exercise in Humans Stimulates Cell Fusion of Myoblasts along with Fusogenic Endogenous Retroviral Genes In Vivo.

    Directory of Open Access Journals (Sweden)

    Sebastian Frese

    Full Text Available Myogenesis is defined as growth, differentiation and repair of muscles where cell fusion of myoblasts to multinucleated myofibers is one major characteristic. Other cell fusion events in humans are found with bone resorbing osteoclasts and placental syncytiotrophoblasts. No unifying gene regulation for natural cell fusions has been found. We analyzed skeletal muscle biopsies of competitive cyclists for muscle-specific attributes and expression of human endogenous retrovirus (ERV envelope genes due to their involvement in cell fusion of osteoclasts and syncytiotrophoblasts. Comparing muscle biopsies from post- with the pre-competitive seasons a significant 2.25-fold increase of myonuclei/mm fiber, a 2.38-fold decrease of fiber area/nucleus and a 3.1-fold decrease of satellite cells (SCs occurred. We propose that during the pre-competitive season SC proliferation occurred following with increased cell fusion during the competitive season. Expression of twenty-two envelope genes of muscle biopsies demonstrated a significant increase of putative muscle-cell fusogenic genes Syncytin-1 and Syncytin-3, but also for the non-fusogenic erv3. Immunohistochemistry analyses showed that Syncytin-1 mainly localized to the sarcolemma of myofibers positive for myosin heavy-chain isotypes. Cellular receptors SLC1A4 and SLC1A5 of Syncytin-1 showed significant decrease of expression in post-competitive muscles compared with the pre-competitive season, but only SLC1A4 protein expression localized throughout the myofiber. Erv3 protein was strongly expressed throughout the myofiber, whereas envK1-7 localized to SC nuclei and myonuclei. Syncytin-1 transcription factors, PPARγ and RXRα, showed no protein expression in the myofiber, whereas the pCREB-Ser133 activator of Syncytin-1 was enriched to SC nuclei and myonuclei. Syncytin-1, Syncytin-3, SLC1A4 and PAX7 gene regulations along with MyoD1 and myogenin were verified during proliferating or actively-fusing human

  17. Tyrosine kinase fusion genes in pediatric BCR-ABL1-like acute lymphoblastic leukemia

    Science.gov (United States)

    Boer, Judith M.; Steeghs, Elisabeth M.P.; Marchante, João R.M.; Boeree, Aurélie; Beaudoin, James J.; Berna Beverloo, H.; Kuiper, Roland P.; Escherich, Gabriele; van der Velden, Vincent H.J.; van der Schoot, C. Ellen; de Groot-Kruseman, Hester A.; Pieters, Rob; den Boer, Monique L.

    2017-01-01

    Approximately 15% of pediatric B cell precursor acute lymphoblastic leukemia (BCP-ALL) is characterized by gene expression similar to that of BCR-ABL1-positive disease and unfavorable prognosis. This BCR-ABL1-like subtype shows a high frequency of B-cell development gene aberrations and tyrosine kinase-activating lesions. To evaluate the clinical significance of tyrosine kinase gene fusions in children with BCP-ALL, we studied the frequency of recently identified tyrosine kinase fusions, associated genetic features, and prognosis in a representative Dutch/German cohort. We identified 14 tyrosine kinase fusions among 77 BCR-ABL1-like cases (18%) and none among 76 non-BCR-ABL1-like B-other cases. Novel exon fusions were identified for RCSD1-ABL2 and TERF2-JAK2. JAK2 mutation was mutually exclusive with tyrosine kinase fusions and only occurred in cases with high CRLF2 expression. The non/late response rate and levels of minimal residual disease in the fusion-positive BCR-ABL1-like group were higher than in the non-BCR-ABL1-like B-others (p<0.01), and also higher, albeit not statistically significant, compared with the fusion-negative BCR-ABL1-like group. The 8-year cumulative incidence of relapse in the fusion-positive BCR-ABL1-like group (35%) was comparable with that in the fusion-negative BCR-ABL1-like group (35%), and worse than in the non-BCR-ABL1-like B-other group (17%, p=0.07). IKZF1 deletions, predominantly other than the dominant-negative isoform and full deletion, co-occurred with tyrosine kinase fusions. This study shows that tyrosine kinase fusion-positive cases are a high-risk subtype of BCP-ALL, which warrants further studies with specific kinase inhibitors to improve outcome. PMID:27894077

  18. TMPRSS2-ERG gene fusion status in minute (minimal) prostatic adenocarcinoma.

    Science.gov (United States)

    Albadine, Roula; Latour, Mathieu; Toubaji, Antoun; Haffner, Michael; Isaacs, William B; A Platz, Elizabeth; Meeker, Alan K; Demarzo, Angelo M; Epstein, Jonathan I; Netto, George J

    2009-11-01

    Minute prostatic adenocarcinomas are considered to be of insufficient virulence. Given recent suggestions of TMPRSS2-ERG gene fusion association with aggressive prostatic adenocarcinoma, we evaluated the incidence of TMPRSS2-ERG fusion in minute prostatic adenocarcinomas. A total of 45 consecutive prostatectomies with minute adenocarcinoma were used for tissue microarray construction. A total of 63 consecutive non-minimal, Gleason Score 6 tumors, from a separate PSA Era prostatectomy tissue microarray, were used for comparison. FISH was carried out using ERG break-apart probes. Tumors were assessed for fusion by deletion (Edel) or split (Esplit), duplicated fusions and low-level copy number gain in normal ERG gene locus. Minute adenocarcinomas: Fusion was evaluable in 32/45 tumors (71%). Fifteen out of 32 (47%) tumors were positive for fusion. Six (19%) were of the Edel class and 7 (22%) were classified as combined Edel+Esplit. Non-minute adenocarcinomas (pT2): Fusion was identified in 20/30 tumors (67%). Four (13%) were of Edel class and 5 (17%) were combined Edel+Esplit. Duplicated fusions were encountered in 5 (16%) tumors. Non-minute adenocarcinomas (pT3): Fusion was identified in 19/33 (58%). Fusion was due to a deletion in 6 (18%) tumors. Seven tumors (21%) were classified as combined Edel+Esplit. One tumor showed Esplit alone. Duplicated fusions were encountered in 3 (9%) cases. The incidence of duplicated fusions was higher in non-minute adenocarcinomas (13 vs 0%; P=0.03). A trend for higher incidence of low-level copy number gain in normal ERG gene locus without fusion was noted in non-minute adenocarcinomas (10 vs 0%; P=0.07). We found a TMPRSS2-ERG fusion rate of 47% in minute adenocarcinomas. The latter is not significantly different from that of grade matched non-minute adenocarcinomas. The incidence of duplicated fusion was higher in non-minute adenocarcinomas. Our finding of comparable rate of TMPRSS2-ERG fusion in minute adenocarcinomas may argue

  19. TMPRSS2-ERG gene fusions are infrequent in prostatic ductal adenocarcinomas.

    Science.gov (United States)

    Lotan, Tamara L; Toubaji, Antoun; Albadine, Roula; Latour, Mathieu; Herawi, Mehsati; Meeker, Alan K; DeMarzo, Angelo M; Platz, Elizabeth A; Epstein, Jonathan I; Netto, George J

    2009-03-01

    Ductal adenocarcinoma of the prostate is an unusual subtype that may be associated with a more aggressive clinical course, and is less responsive to conventional therapies than the more common prostatic acinar adenocarcinoma. However, given its frequent association with an acinar component at prostatectomy, some have challenged the concept of prostatic ductal adenocarcinoma as a distinct clinicopathologic entity. We studied the occurrence of the TMPRSS2-ERG gene fusion, in 40 surgically resected ductal adenocarcinoma cases, and in their associated acinar component using fluorescence in situ hybridization. A group of 38 'pure' acinar adenocarcinoma cases matched with the ductal adenocarcinoma group for pathological grade and stage was studied as a control. Compared with the matched acinar adenocarcinoma cases, the TMPRSS2-ERG gene fusion was significantly less frequently observed in ductal adenocarcinoma (45 vs 11% of cases, P=0.002, Fisher's exact test). Here, of the ductal adenocarcinoma cases with the gene fusion, 75% were fused through deletion, and the remaining case was fused through translocation. The TMPRSS2-ERG gene fusion was also rare in the acinar component of mixed ductal-acinar tumors when compared with the pure acinar adenocarcinoma controls (5 vs 45%, P=0.001, Fisher's exact test). In 95% of the ductal adenocarcinoma cases in which a concurrent acinar component was analyzed, there was concordance for presence/absence of the TMPRSS2-ERG gene fusion between the different histologic subtypes. In the control group of pure acinar adenocarcinoma cases, 59% were fused through deletion and 41% were fused through translocation. The presence of the TMPRSS2-ERG gene fusion in some cases of prostatic ductal adenocarcinoma supports the concept that ductal adenocarcinoma and acinar adenocarcinoma may be related genetically. However, the significantly lower rate of the gene fusion in pure ductal adenocarcinoma cases underscores the fact that genetic and biologic

  20. Recurrent Fusion Genes in Gastric Cancer: CLDN18-ARHGAP26 Induces Loss of Epithelial Integrity

    Directory of Open Access Journals (Sweden)

    Fei Yao

    2015-07-01

    Full Text Available Genome rearrangements, a hallmark of cancer, can result in gene fusions with oncogenic properties. Using DNA paired-end-tag (DNA-PET whole-genome sequencing, we analyzed 15 gastric cancers (GCs from Southeast Asians. Rearrangements were enriched in open chromatin and shaped by chromatin structure. We identified seven rearrangement hot spots and 136 gene fusions. In three out of 100 GC cases, we found recurrent fusions between CLDN18, a tight junction gene, and ARHGAP26, a gene encoding a RHOA inhibitor. Epithelial cell lines expressing CLDN18-ARHGAP26 displayed a dramatic loss of epithelial phenotype and long protrusions indicative of epithelial-mesenchymal transition (EMT. Fusion-positive cell lines showed impaired barrier properties, reduced cell-cell and cell-extracellular matrix adhesion, retarded wound healing, and inhibition of RHOA. Gain of invasion was seen in cancer cell lines expressing the fusion. Thus, CLDN18-ARHGAP26 mediates epithelial disintegration, possibly leading to stomach H+ leakage, and the fusion might contribute to invasiveness once a cell is transformed.

  1. Development of time dependent safety analysis code for plasma anomaly events in fusion reactors

    International Nuclear Information System (INIS)

    Honda, Takuro; Okazaki, Takashi; Bartels, H.W.; Uckan, N.A.; Seki, Yasushi.

    1997-01-01

    A safety analysis code SAFALY has been developed to analyze plasma anomaly events in fusion reactors, e.g., a loss of plasma control. The code is a hybrid code comprising a zero-dimensional plasma dynamics and a one-dimensional thermal analysis of in-vessel components. The code evaluates the time evolution of plasma parameters and temperature distributions of in-vessel components. As the plasma-safety interface model, we proposed a robust plasma physics model taking into account updated data for safety assessment. For example, physics safety guidelines for beta limit, density limit and H-L mode confinement transition threshold power, etc. are provided in the model. The model of the in-vessel components are divided into twenty temperature regions in the poloidal direction taking account of radiative heat transfer between each surface of each region. This code can also describe the coolant behavior under hydraulic accidents with the results by hydraulics code and treat vaporization (sublimation) from plasma facing components (PFCs). Furthermore, the code includes the model of impurity transport form PFCs by using a transport probability and a time delay. Quantitative analysis based on the model is possible for a scenario of plasma passive shutdown. We examined the possibility of the code as a safety analysis code for plasma anomaly events in fusion reactors and had a prospect that it would contribute to the safety analysis of the International Thermonuclear Experimental Reactor (ITER). (author)

  2. A Protein Disulfide Isomerase Gene Fusion Expression System That Increases the Extracellular Productivity of Bacillus brevis

    Science.gov (United States)

    Kajino, Tsutomu; Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Udaka, Shigezo; Yamada, Yukio; Takahashi, Haruo

    2000-01-01

    We have developed a versatile Bacillus brevis expression and secretion system based on the use of fungal protein disulfide isomerase (PDI) as a gene fusion partner. Fusion with PDI increased the extracellular production of heterologous proteins (light chain of immunoglobulin G, 8-fold; geranylgeranyl pyrophosphate synthase, 12-fold). Linkage to PDI prevented the aggregation of the secreted proteins, resulting in high-level accumulation of fusion proteins in soluble and biologically active forms. We also show that the disulfide isomerase activity of PDI in a fusion protein is responsible for the suppression of the aggregation of the protein with intradisulfide, whereas aggregation of the protein without intradisulfide was prevented even when the protein was fused to a mutant PDI whose two active sites were disrupted, suggesting that another PDI function, such as chaperone-like activity, synergistically prevented the aggregation of heterologous proteins in the PDI fusion expression system. PMID:10653729

  3. Transcriptome analysis of paired primary colorectal carcinoma and liver metastases reveals fusion transcripts and similar gene expression profiles in primary carcinoma and liver metastases

    International Nuclear Information System (INIS)

    Lee, Ja-Rang; Kwon, Chae Hwa; Choi, Yuri; Park, Hye Ji; Kim, Hyun Sung; Jo, Hong-Jae; Oh, Nahmgun; Park, Do Youn

    2016-01-01

    Despite the clinical significance of liver metastases, the difference between molecular and cellular changes in primary colorectal cancers (CRC) and matched liver metastases is poorly understood. In order to compare gene expression patterns and identify fusion genes in these two types of tumors, we performed high-throughput transcriptome sequencing of five sets of quadruple-matched tissues (primary CRC, liver metastases, normal colon, and liver). The gene expression patterns in normal colon and liver were successfully distinguished from those in CRCs; however, RNA sequencing revealed that the gene expression between primary CRCs and their matched liver metastases is highly similar. We identified 1895 genes that were differentially expressed in the primary carcinoma and liver metastases, than that in the normal colon tissues. A major proportion of the transcripts, identified by gene expression profiling as significantly enriched in the primary carcinoma and metastases, belonged to gene ontology categories involved in the cell cycle, mitosis, and cell division. Furthermore, we identified gene fusion events in primary carcinoma and metastases, and the fusion transcripts were experimentally confirmed. Among these, a chimeric transcript resulting from the fusion of RNF43 and SUPT4H1 was found to occur frequently in primary colorectal carcinoma. In addition, knockdown of the expression of this RNF43-SUPT4H1 chimeric transcript was found to have a growth-inhibitory effect in colorectal cancer cells. The present study reports a high concordance of gene expression in the primary carcinoma and liver metastases, and reveals potential new targets, such as fusion genes, against primary and metastatic colorectal carcinoma. The online version of this article (doi:10.1186/s12885-016-2596-3) contains supplementary material, which is available to authorized users

  4. Dual-therapeutic reporter genes fusion for enhanced cancer gene therapy and imaging.

    Science.gov (United States)

    Sekar, T V; Foygel, K; Willmann, J K; Paulmurugan, R

    2013-05-01

    Two of the successful gene-directed enzyme prodrug therapies include herpes simplex virus-thymidine kinase (HSV1-TK) enzyme-ganciclovir prodrug and the Escherichia coli nitroreductase (NTR) enzyme-CB1954 prodrug strategies; these enzyme-prodrug combinations produce activated cytotoxic metabolites of the prodrugs capable of tumor cell death by inhibiting DNA synthesis and killing quiescent cells, respectively. Both these strategies also affect significant bystander cell killing of neighboring tumor cells that do not express these enzymes. We have developed a dual-combination gene strategy, where we identified HSV1-TK and NTR fused in a particular orientation can effectively kill tumor cells when the tumor cells are treated with a fusion HSV1-TK-NTR gene- along with a prodrug combination of GCV and CB1954. In order to determine whether the dual-system demonstrate superior therapeutic efficacy than either HSV1-TK or NTR systems alone, we conducted both in vitro and in vivo tumor xenograft studies using triple negative SUM159 breast cancer cells, by evaluating the efficacy of cell death by apoptosis and necrosis upon treatment with the dual HSV1-TK genes-GCV-CB1954 prodrugs system, and compared the efficiency to HSV1-TK-GCV and NTR-CB1954. Our cell-based studies, tumor regression studies in xenograft mice, histological analyses of treated tumors and bystander studies indicate that the dual HSV1-TK-NTR-prodrug system is two times more efficient even with half the doses of both prodrugs than the respective single gene-prodrug system, as evidenced by enhanced apoptosis and necrosis of tumor cells in vitro in culture and xenograft of tumor tissues in animals.

  5. Construction and prokaryotic expression of the fusion gene PRRSV ...

    African Journals Online (AJOL)

    ajl4

    2013-07-24

    Jul 24, 2013 ... The fusion expressing plasmid pET32-GP5-Hsp70 was constructed and expressed in ... 2004). Hsps, expressed by prokaryotes and eukaryotes and their action as molecular ..... Facts, thoughts, and dreams. Shock. 12(4): ...

  6. Radiological consequences of a bounding event sequence of Advanced Fusion Neutron Source (A-FNS)

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Makoto M., E-mail: nakamura.makoto@qst.go.jp; Ochiai, Kentaro

    2017-05-15

    Advanced Fusion Neutron Source (A-FNS) is an accelerator-based neutron source utilizing Li(d,xn) nuclear stripping reactions to simulate D-T fusion neutrons for testing and qualifying structural and functional materials of fusion reactor components, which is to be constructed at the Rokkasho site of National Institutes for Quantum and Radiological Science and Technology, Japan, in the near future. The purpose of the study reported here is to demonstrate the ultimate safety margins of A-FNS in the worst case of release of radioactive materials outside the A-FNS confinement system. For this purpose, we analyzed a ‘bounding event’ postulated in A-FNS. The postulated event sequence consists of fire of the purification system of the liquid Li loop during the maintenance, of mobilization of the tritium and {sup 7}Be, which are the impurities of the loop, and of the entire loss of confinement of the radioactive materials. We have calculated the early doses to the public due to the release of the tritium and {sup 7}Be source terms to the environment. The UFOTRI/COSYMA simulations have been performed considering the site boundary of 500 m away from the facility. The obtained results indicate that the early dose is below the level that requires the emergent public evacuation. Such results demonstrate that the A-FNS complies with the defined safety objective against its radiation hazard. The simulation results suggest that the inherent, ultimate safety characteristic found by this study may assist a licensing process for installation of A-FNS.

  7. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Directory of Open Access Journals (Sweden)

    Etchells J Peter

    2009-10-01

    Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.

  8. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    International Nuclear Information System (INIS)

    Robinson, Claire; Kolb, Andreas F.

    2009-01-01

    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A β-galactosidase reporter gene was inserted in place of the β-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the β-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal β-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the β-casein gene

  9. CRTC1-MAML2 gene fusion in mucoepidermoid carcinoma of the lacrimal gland

    DEFF Research Database (Denmark)

    von Holstein, Sarah Linea; Fehr, André; Heegaard, Steffen

    2012-01-01

    -grade MEC of the lacrimal gland. There were no signs of recurrence or metastases during a five-year follow-up. Using RT-PCR and FISH we demonstrated that the tumor was positive for the CRTC1-MAML2 gene fusion previously shown to be associated with in particular low-grade salivary MECs with favorable...... prognosis. By immunohistochemistry we showed that the majority of tumor cells, including epidermoid, intermediate and mucous producing cells, expressed the CRTC1-MAML2 fusion protein. In contrast, 15 non-MEC lacrimal neoplasm were fusion-negative. Our findings show that lacrimal MEC is not only clinically...... anatomical sites and organs. Moreover, our findings indicate that the CRTC1-MAML2 fusion may be a useful diagnostic and prognostic biomarker for lacrimal MEC....

  10. ChimerDB 3.0: an enhanced database for fusion genes from cancer transcriptome and literature data mining.

    Science.gov (United States)

    Lee, Myunggyo; Lee, Kyubum; Yu, Namhee; Jang, Insu; Choi, Ikjung; Kim, Pora; Jang, Ye Eun; Kim, Byounggun; Kim, Sunkyu; Lee, Byungwook; Kang, Jaewoo; Lee, Sanghyuk

    2017-01-04

    Fusion gene is an important class of therapeutic targets and prognostic markers in cancer. ChimerDB is a comprehensive database of fusion genes encompassing analysis of deep sequencing data and manual curations. In this update, the database coverage was enhanced considerably by adding two new modules of The Cancer Genome Atlas (TCGA) RNA-Seq analysis and PubMed abstract mining. ChimerDB 3.0 is composed of three modules of ChimerKB, ChimerPub and ChimerSeq. ChimerKB represents a knowledgebase including 1066 fusion genes with manual curation that were compiled from public resources of fusion genes with experimental evidences. ChimerPub includes 2767 fusion genes obtained from text mining of PubMed abstracts. ChimerSeq module is designed to archive the fusion candidates from deep sequencing data. Importantly, we have analyzed RNA-Seq data of the TCGA project covering 4569 patients in 23 cancer types using two reliable programs of FusionScan and TopHat-Fusion. The new user interface supports diverse search options and graphic representation of fusion gene structure. ChimerDB 3.0 is available at http://ercsb.ewha.ac.kr/fusiongene/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Analysis of a MULE-cyanide hydratase gene fusion in Verticillium dahliae

    Science.gov (United States)

    The genome of the phytopathogenic fungus Verticillium dahliae encodes numerous Class II “cut-and-paste” transposable elements, including those of a small group of MULE transposons. We have previously identified a fusion event between a MULE transposon sequence and sequence encoding a cyanide hydrata...

  13. Driver Fusions and Their Implications in the Development and Treatment of Human Cancers

    Directory of Open Access Journals (Sweden)

    Qingsong Gao

    2018-04-01

    Full Text Available Summary: Gene fusions represent an important class of somatic alterations in cancer. We systematically investigated fusions in 9,624 tumors across 33 cancer types using multiple fusion calling tools. We identified a total of 25,664 fusions, with a 63% validation rate. Integration of gene expression, copy number, and fusion annotation data revealed that fusions involving oncogenes tend to exhibit increased expression, whereas fusions involving tumor suppressors have the opposite effect. For fusions involving kinases, we found 1,275 with an intact kinase domain, the proportion of which varied significantly across cancer types. Our study suggests that fusions drive the development of 16.5% of cancer cases and function as the sole driver in more than 1% of them. Finally, we identified druggable fusions involving genes such as TMPRSS2, RET, FGFR3, ALK, and ESR1 in 6.0% of cases, and we predicted immunogenic peptides, suggesting that fusions may provide leads for targeted drug and immune therapy. : Gao et al. analyze a 9,624 sample TCGA cohort with 33 cancer types to detect gene fusion events. They provide a landscape of fusion events detected, relate fusions to gene expression, focus on kinase fusion structures, examine mutually exclusive mutation and fusion patterns, and highlight fusion druggability. Keywords: fusion, cancer, RNA, translocation, gene fusions

  14. Imaging transient blood vessel fusion events in zebrafish by correlative volume electron microscopy.

    Directory of Open Access Journals (Sweden)

    Hannah E J Armer

    Full Text Available The study of biological processes has become increasingly reliant on obtaining high-resolution spatial and temporal data through imaging techniques. As researchers demand molecular resolution of cellular events in the context of whole organisms, correlation of non-invasive live-organism imaging with electron microscopy in complex three-dimensional samples becomes critical. The developing blood vessels of vertebrates form a highly complex network which cannot be imaged at high resolution using traditional methods. Here we show that the point of fusion between growing blood vessels of transgenic zebrafish, identified in live confocal microscopy, can subsequently be traced through the structure of the organism using Focused Ion Beam/Scanning Electron Microscopy (FIB/SEM and Serial Block Face/Scanning Electron Microscopy (SBF/SEM. The resulting data give unprecedented microanatomical detail of the zebrafish and, for the first time, allow visualization of the ultrastructure of a time-limited biological event within the context of a whole organism.

  15. The strategy of fusion genes construction determines efficient expression of introduced transcription factors.

    Science.gov (United States)

    Adamus, Tomasz; Konieczny, Paweł; Sekuła, Małgorzata; Sułkowski, Maciej; Majka, Marcin

    2014-01-01

    The main goal in gene therapy and biomedical research is an efficient transcription factors (TFs) delivery system. SNAIL, a zinc finger transcription factor, is strongly involved in tumor, what makes its signaling pathways an interesting research subject. The necessity of tracking activation of intracellular pathways has prompted fluorescent proteins usage as localization markers. Advanced molecular cloning techniques allow to generate fusion proteins from fluorescent markers and transcription factors. Depending on fusion strategy, the protein expression levels and nuclear transport ability are significantly different. The P2A self-cleavage motif through its cleavage ability allows two single proteins to be simultaneously expressed. The aim of this study was to compare two strategies for introducing a pair of genes using expression vector system. We have examined GFP and SNAI1 gene fusions by comprising common nucleotide polylinker (multiple cloning site) or P2A motif in between them, resulting in one fusion or two independent protein expressions respectively. In each case transgene expression levels and translation efficiency as well as nuclear localization of expressed protein have been analyzed. Our data showed that usage of P2A motif provides more effective nuclear transport of SNAIL transcription factor than conventional genes linker. At the same time the fluorescent marker spreads evenly in subcellular space.

  16. Recurrent MET fusion genes represent a drug target in pediatric glioblastoma

    DEFF Research Database (Denmark)

    Sehested, Astrid Marie

    2016-01-01

    Pediatric glioblastoma is one of the most common and most deadly brain tumors in childhood. Using an integrative genetic analysis of 53 pediatric glioblastomas and five in vitro model systems, we identified previously unidentified gene fusions involving the MET oncogene in ∼10% of cases. These MET...

  17. Investigation of PAX3/7-FKHR fusion genes and IGF2 gene expression in rhabdomyosarcoma tumors.

    Science.gov (United States)

    de Souza, Robson Ramos; Oliveira, Indhira Dias; Caran, Eliana Maria Monteiro; Alves, Maria Teresa de Seixas; Abib, Simone; Toledo, Silvia Regina Caminada

    2012-12-01

    The purpose of our study was to investigate the prevalence of the PAX3/7-FKHR fusion genes and quantify the IGF2 gene expression in rhabdomyosarcoma (RMS) samples. Soft tissue sarcomas account 5% of childhood cancers and 50% of them are RMS. Morphological evaluation of pediatric RMS has defined two histological subtypes, embryonal (ERMS) and alveolar (ARMS). Chromosomal analyses have demonstrated two translocations associated with ARMS, resulting in the PAX3/7-FKHR rearrangements. Reverse transcriptase-polymerase chain reaction (RT-PCR) is extremely useful in the diagnosis of ARMS positive for these rearrangements. Additionally, several studies have shown a significant involvement of IGF pathway in the pathogenesis of RMS. The presence of PAX3/7-FKHR gene fusions was studied in 25 RMS samples from patients attending the IOP-GRAACC/UNIFESP and three RMS cell lines by RT-PCR. IGF2 gene expression was quantified by qPCR and related with clinic pathological parameters. Of the 25 samples, nine (36%) were ARMS and 16 (64%) were ERMS. PAX3/7-FKHR gene fusions expression was detected in 56% of ARMS tumor samples. IGF2 overexpression was observed in 80% of samples and could indicate an important role of this pathway in RMS biology. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Higgs boson produced via vector boson fusion event recorded by CMS (Run 2, 13 TeV)

    CERN Multimedia

    Mc Cauley, Thomas

    2016-01-01

    Real proton-proton collision event at 13 TeV in the CMS detector in which two high-energy electrons (green lines), two high-energy muons (red lines), and two-high energy jets (dark yellow cones) are observed. The event shows characteristics expected from Higgs boson production via vector boson fusion with subsequent decay of the Higgs boson in four leptons, and is also consistent with background standard model physics processes.

  19. Potential off-normal events and associated radiological source terms for the compact ignition tokamak: Fusion Safety Program

    International Nuclear Information System (INIS)

    Holland, D.F.; Lyon, R.E.

    1987-10-01

    The Compact Ignition Tokamak (CIT), the latest step in the United States program to develop the commercial application of fusion power, is designed as the first fusion device to achieve ignition conditions. It is to be constructed near Princeton, New Jersey on the site of the existing Tokamak Fusion Test Reactor (TFTR). To address the environmental impact and public safety concerns, a preliminary analysis was performed of potential off-normal radiological releases. Operational occurrences, natural phenomena, accidents with external origins, and accidents external to the PPPL site were considered as potential sources for off-normal events. Based on an initial screening, events were selected for preliminary analysis. Included in these events were tritium releases from the tritium delivery and recovery system, tritium releases from the torus, releases of activated nitrogen from the test cell or cryostat, seismic events, and shipping accidents. In each case, the design considerations related to the event were reviewed and the release scenarios discussed. Because of the complexity of some of the proposed safety systems, in some cases event trees were used to describe the accident scenarios. For each scenario, the probability was estimated as well as the release magnitude, isotope, chemical form, and release mode. 10 refs., 17 figs., 5 tabs

  20. IGF1 is a common target gene of Ewing's sarcoma fusion proteins in mesenchymal progenitor cells.

    Directory of Open Access Journals (Sweden)

    Luisa Cironi

    Full Text Available BACKGROUND: The EWS-FLI-1 fusion protein is associated with 85-90% of Ewing's sarcoma family tumors (ESFT, the remaining 10-15% of cases expressing chimeric genes encoding EWS or FUS fused to one of several ets transcription factor family members, including ERG-1, FEV, ETV1 and ETV6. ESFT are dependent on insulin-like growth factor-1 (IGF-1 for growth and survival and recent evidence suggests that mesenchymal progenitor/stem cells constitute a candidate ESFT origin. METHODOLOGY/PRINCIPAL FINDINGS: To address the functional relatedness between ESFT-associated fusion proteins, we compared mouse progenitor cell (MPC permissiveness for EWS-FLI-1, EWS-ERG and FUS-ERG expression and assessed the corresponding expression profile changes. Whereas all MPC isolates tested could stably express EWS-FLI-1, only some sustained stable EWS-ERG expression and none could express FUS-ERG for more than 3-5 days. Only 14% and 4% of the total number of genes that were respectively induced and repressed in MPCs by the three fusion proteins were shared. However, all three fusion proteins, but neither FLI-1 nor ERG-1 alone, activated the IGF1 promoter and induced IGF1 expression. CONCLUSION/SIGNIFICANCE: Whereas expression of different ESFT-associated fusion proteins may require distinct cellular microenvironments and induce transcriptome changes of limited similarity, IGF1 induction may provide one common mechanism for their implication in ESFT pathogenesis.

  1. A Search for Gene Fusions/Translocations in Breast Cancer

    Science.gov (United States)

    2009-10-01

    Freemont PS, Solomon E . Characterization of a zinc finger gene disrupted by the t(15;17) in acute promyelocytic leukemia. Science 1991;254:1371–1374...characterization of gene f usions potentially provides novel di agnostic a nd t herapeutic markers, as e xemplified by th e successful application of BCR-ABL1...or e xons) are nominated a s c andidate g ene f usion partners (Figure 1). Further an alysis o f C NT loci b y s pectral k aryotyping ( SKY

  2. A Search for Gene Fusions/Translocations in Breast Cancer

    Science.gov (United States)

    2013-11-01

    2008). The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320, 1344–1349. Palanisamy, N., Ateeq, B., Kalyana-Sundaram...census of human cancer genes. Nat Rev Cancer 4, 177–183. [2] Santarius T, Shipley J, Brewer D, Stratton MR, and Cooper CS (2010). A census of amplified

  3. The leukemia-specific fusion gene ETV6/RUNX1 perturbs distinct key biological functions primarily by gene repression.

    Directory of Open Access Journals (Sweden)

    Gerhard Fuka

    Full Text Available BACKGROUND: ETV6/RUNX1 (E/R (also known as TEL/AML1 is the most frequent gene fusion in childhood acute lymphoblastic leukemia (ALL and also most likely the crucial factor for disease initiation; its role in leukemia propagation and maintenance, however, remains largely elusive. To address this issue we performed a shRNA-mediated knock-down (KD of the E/R fusion gene and investigated the ensuing consequences on genome-wide gene expression patterns and deducible regulatory functions in two E/R-positive leukemic cell lines. FINDINGS: Microarray analyses identified 777 genes whose expression was substantially altered. Although approximately equal proportions were either up- (KD-UP or down-regulated (KD-DOWN, the effects on biological processes and pathways differed considerably. The E/R KD-UP set was significantly enriched for genes included in the "cell activation", "immune response", "apoptosis", "signal transduction" and "development and differentiation" categories, whereas in the E/R KD-DOWN set only the "PI3K/AKT/mTOR signaling" and "hematopoietic stem cells" categories became evident. Comparable expression signatures obtained from primary E/R-positive ALL samples underline the relevance of these pathways and molecular functions. We also validated six differentially expressed genes representing the categories "stem cell properties", "B-cell differentiation", "immune response", "cell adhesion" and "DNA damage" with RT-qPCR. CONCLUSION: Our analyses provide the first preliminary evidence that the continuous expression of the E/R fusion gene interferes with key regulatory functions that shape the biology of this leukemia subtype. E/R may thus indeed constitute the essential driving force for the propagation and maintenance of the leukemic process irrespective of potential consequences of associated secondary changes. Finally, these findings may also provide a valuable source of potentially attractive therapeutic targets.

  4. Basic experiments during loss of vacuum event (LOVE) in fusion experimental reactor

    International Nuclear Information System (INIS)

    Ogawa, Masuro; Kunugi, Tomoaki; Seki, Yasushi

    1993-01-01

    If a loss of vacuum event (LOVE) occurs due to damage of the vacuum vessel of a nuclear fusion experimental reactor, some chemical reactions such as a graphic oxidation and a buoyancy-driven exchange flow take place after equalization of the gas pressure between the inside and outside of the vacuum vessel. The graphite oxidation would generate inflammable carbon monoxide and release tritium retained in the graphite. The exchange flow through the breaches may transport the carbon monoxide and tritium out of the vacuum vessel. To add confidence to the safety evaluations and analyses, it is important to grasp the basic phenomena such as the exchange flow and the graphite oxidation. Experiments of the exchange flow and the graphite oxidation were carried out to obtain the exchange flow rate and the rate constant for the carbon monoxide combustion, respectively. These experimental results were compared with existing correlations. The authors plan a scaled-model test and a full-scale model test for the LOVE

  5. The distribution of BRAF gene fusions in solid tumors and response to targeted therapy.

    Science.gov (United States)

    Ross, Jeffrey S; Wang, Kai; Chmielecki, Juliann; Gay, Laurie; Johnson, Adrienne; Chudnovsky, Jacob; Yelensky, Roman; Lipson, Doron; Ali, Siraj M; Elvin, Julia A; Vergilio, Jo-Anne; Roels, Steven; Miller, Vincent A; Nakamura, Brooke N; Gray, Adam; Wong, Michael K; Stephens, Philip J

    2016-02-15

    Although the BRAF V600E base substitution is an approved target for the BRAF inhibitors in melanoma, BRAF gene fusions have not been investigated as anticancer drug targets. In our study, a wide variety of tumors underwent comprehensive genomic profiling for hundreds of known cancer genes using the FoundationOne™ or FoundationOne Heme™ comprehensive genomic profiling assays. BRAF fusions involving the intact in-frame BRAF kinase domain were observed in 55 (0.3%) of 20,573 tumors, across 12 distinct tumor types, including 20 novel BRAF fusions. These comprised 29 unique 5' fusion partners, of which 31% (9) were known and 69% (20) were novel. BRAF fusions included 3% (14/531) of melanomas; 2% (15/701) of gliomas; 1.0% (3/294) of thyroid cancers; 0.3% (3/1,062) pancreatic carcinomas; 0.2% (8/4,013) nonsmall-cell lung cancers and 0.2% (4/2,154) of colorectal cancers, and were enriched in pilocytic (30%) vs. nonpilocytic gliomas (1%; p < 0.0001), Spitzoid (75%) vs. nonSpitzoid melanomas (1%; p = 0.0001), acinar (67%) vs. nonacinar pancreatic cancers (<1%; p < 0.0001) and papillary (3%) vs. nonpapillary thyroid cancers (0%; p < 0.03). Clinical responses to trametinib and sorafenib are presented. In conclusion, BRAF fusions are rare driver alterations in a wide variety of malignant neoplasms, but enriched in Spitzoid melanoma, pilocytic astrocytomas, pancreatic acinar and papillary thyroid cancers. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of UICC.

  6. Detection of Promyelocytic Leukemia/Retinoic Acid Receptor α (PML/RARα Fusion Gene with Functionalized Graphene Oxide

    Directory of Open Access Journals (Sweden)

    Hongwei Wang

    2013-06-01

    Full Text Available An attempt was made to use functionalized graphene oxide (GO to detect the Promyelocytic leukemia/Retinoic acid receptor α fusion gene (PML/RARα fusion gene, a marker gene of acute promyelocytic leukemia. The functionalized GO was prepared by chemical exfoliation method, followed by a polyethylene glycol grafting. It is found that the functionalized GO can selectively adsorb the fluorescein isothiocyanate (FITC-labeled single-stranded DNA probe and quench its fluorescence. The probe can be displaced by the PML/RARα fusion gene to restore the fluorescence, which can be detected by laser confocal microscopy and flow cytometry. These can be used to detect the presence of the PML/RARα fusion gene. This detection method is verified to be fast, simple and reliable.

  7. Identification of target genes of synovial sarcoma-associated fusion oncoprotein using human pluripotent stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Hayakawa, Kazuo [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya (Japan); Ikeya, Makoto [Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Fukuta, Makoto [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya (Japan); Woltjen, Knut [Department of Reprogramming Sciences, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Tamaki, Sakura; Takahara, Naoko; Kato, Tomohisa; Sato, Shingo [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Otsuka, Takanobu [Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya (Japan); Toguchida, Junya, E-mail: togjun@frontier.kyoto-u.ac.jp [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Department of Orthopaedic Surgery, Graduate School of Medicine, Kyoto University, Kyoto (Japan)

    2013-03-22

    Highlights: ► We tried to identify targets of synovial sarcoma (SS)-associated SYT–SSX fusion gene. ► We established pluripotent stem cell (PSC) lines with inducible SYT–SSX gene. ► SYT–SSX responsive genes were identified by the induction of SYT–SSX in PSC. ► SS-related genes were selected from database by in silico analyses. ► 51 genes were finally identified among SS-related genes as targets of SYT–SSX in PSC. -- Abstract: Synovial sarcoma (SS) is a malignant soft tissue tumor harboring chromosomal translocation t(X; 18)(p11.2; q11.2), which produces SS-specific fusion gene, SYT–SSX. Although precise function of SYT–SSX remains to be investigated, accumulating evidences suggest its role in gene regulation via epigenetic mechanisms, and the product of SYT–SSX target genes may serve as biomarkers of SS. Lack of knowledge about the cell-of-origin of SS, however, has placed obstacle in the way of target identification. Here we report a novel approach to identify SYT–SSX2 target genes using human pluripotent stem cells (hPSCs) containing a doxycycline-inducible SYT–SSX2 gene. SYT–SSX2 was efficiently induced both at mRNA and protein levels within three hours after doxycycline administration, while no morphological change of hPSCs was observed until 24 h. Serial microarray analyses identified genes of which the expression level changed more than twofold within 24 h. Surprisingly, the majority (297/312, 95.2%) were up-regulated genes and a result inconsistent with the current concept of SYT–SSX as a transcriptional repressor. Comparing these genes with SS-related genes which were selected by a series of in silico analyses, 49 and 2 genes were finally identified as candidates of up- and down-regulated target of SYT–SSX, respectively. Association of these genes with SYT–SSX in SS cells was confirmed by knockdown experiments. Expression profiles of SS-related genes in hPSCs and human mesenchymal stem cells (hMSCs) were strikingly

  8. Detection of water-quality contamination events based on multi-sensor fusion using an extented Dempster–Shafer method

    International Nuclear Information System (INIS)

    Hou, Dibo; He, Huimei; Huang, Pingjie; Zhang, Guangxin; Loaiciga, Hugo

    2013-01-01

    This study presents a method for detecting contamination events of sources of drinking water based on the Dempster–Shafer (D-S) evidence theory. The detection method has the purpose of protecting water supply systems against accidental and intentional contamination events. This purpose is achieved by first predicting future water-quality parameters using an autoregressive (AR) model. The AR model predicts future water-quality parameters using recent measurements of these parameters made with automated (on-line) water-quality sensors. Next, a probabilistic method assigns probabilities to the time series of residuals formed by comparing predicted water-quality parameters with threshold values. Finally, the D-S fusion method searches for anomalous probabilities of the residuals and uses the result of that search to determine whether the current water quality is normal (that is, free of pollution) or contaminated. The D-S fusion method is extended and improved in this paper by weighted averaging of water-contamination evidence and by the analysis of the persistence of anomalous probabilities of water-quality parameters. The extended D-S fusion method makes determinations that have a high probability of being correct concerning whether or not a source of drinking water has been contaminated. This paper's method for detecting water-contamination events was tested with water-quality time series from automated (on-line) water quality sensors. In addition, a small-scale, experimental, water-pipe network was tested to detect water-contamination events. The two tests demonstrated that the extended D-S fusion method achieves a low false alarm rate and high probabilities of detecting water contamination events. (paper)

  9. Intrafocal heterogeneity of ERG protein expression and gene fusion pattern in prostate cancer.

    Science.gov (United States)

    Suh, Ja Hee; Park, Jeong Hwan; Lee, Cheol; Moon, Kyung Chul

    2017-10-01

    Prostate cancer is considered to be highly heterogeneous, with various morphologic features and biologic behaviors. The TMPRSS2-ERG gene fusion is the most frequently observed genetic aberration in prostate cancer. The aim of this study was to elucidate the intrafocal heterogeneity of ERG gene fusion status. ERG immunohistochemistry (IHC) was performed in samples from 168 prostate cancer patients who had undergone radical prostatectomy, and 40 cases showing ERG-positive IHC staining were selected for tissue microarray (TMA) construction. Two to six representative cores were selected from each tumor focus. In the cases with heterogeneous ERG IHC staining intensity, the areas showing different intensities were separately selected. Using the TMA blocks, IHC and fluorescence in situ hybridization (FISH) were conducted to evaluate the heterogeneity of ERG protein expression and ERG fusion gene patterns, respectively, in a single tumor focus. Heterogeneity of ERG IHC staining was defined as the simultaneous presence of negative and positive cores in the same tumor focus. Heterogeneity of ERG FISH was defined by the presence of cores with positive and negative FISH signals or cores with break-apart and interstitial deletion FISH signals in the same tumor focus. A total of 202 TMA cores were isolated from 40 ERG-positive cases. Of the 202 total cores, 19 were negative for ERG IHC staining, and 46 showed 1+, 52 showed 2+, and 85 showed 3+ ERG staining intensity. Eleven cores were negative for ERG FISH signal, 119 cores showed ERG break-apart FISH signals, and the remaining 72 cores revealed interstitial deletion. Intrafocal heterogeneity of ERG IHC staining was found in 20% (8/40) of cases, and intrafocal heterogeneity of ERG gene fusion pattern was found in 32.5% (13/40) of cases. In summary, this study showed significantly frequent intrafocal heterogeneity of ERG protein expression, gene fusion status and fusion pattern. This heterogeneity can be caused by the development

  10. [Prokaryotic expression of trigeminy artificial fusion gene of Leptospira interrogans and the immunogenicity of its products].

    Science.gov (United States)

    Luo, Dong-jiao; Qiu, Xiao-feng; Wang, Jiang; Yan, Jin; Wang, Hai-bin; Zhou, Jin-cheng; Yan, Jie

    2008-11-01

    To construct lipL32/1-lipL21-OmpL1/2 fusion gene of Leptospira interrogans and its prokaryotic expression system, and to identify the immunogenicity of its products. PCR using linking primers was applied to construct lipL32/1-lipL21-OmpL1/2 fusion gene and a prokaryotic expression system of the fusion gene was then established using routine genetic engineering technique. SDS-PAGE was used to examine output of the target recombinant protein rLipL32/1-LipL21-OmpL1/2. Double immunodiffusion and Western Blot assay were applied to identify immunogenicity of rLipL32/1-LipL21-OmpL1/2. lipL32/1-lipL21-OmpL1/2 fusion gene with correct sequence and its prokaryotic expression system E.coli BL21DE3pET42a-lipL32/1-lipL21-ompL1/2 was obtained in this study. The output of rLipL32/1-LipL21- OmpL1/2 after optimisation was 37.78 mg/L. The immunodiffusion titer of rabbit antiserum against rLipL32/1-LipL21-OmpL1/2 was 1:4. The rLipL32/1-LipL21-OmpL1/2 antiserum was able to recognize rLipL32/1-LipL21-OmpL1/2, rLipL32/1, rLipL21 and rOmpL1/2. Positive Western hybridization signals were found among rLipL32/1-LipL21-OmpL1/2 and rabbit antiserum against whole cell of strain 56601 and serum from patients infected with L.interrogans serogroups Icterohaemorrhagiae, Grippotyphosa, Autumnalis and Pomona. The fusion gene lipL32/1-lipL21-OmpL1/2 and its prokaryotic expression system were successfully constructed in this study. The expressed fusion protein can be used as the antigen for developing universal genetic engineering vaccine and universal serological tests of leptospirosis.

  11. ETS Gene Fusions as Predictive Biomarkers of Resistance to Radiation Therapy for Prostate Cancer

    Science.gov (United States)

    2016-05-01

    phenotype  in   preclinical  models  of  prostate  cancer,  2)  to  explore  the  mechanism  of  interaction  between   ERG  (the  predominant  ETS...established  this  axis  as  a  potential  therapeutic   target.         15. SUBJECT  TERMS Prostate cancer, ETS gene fusions, ERG , radiation resistance, DNA...interaction  between   ERG   (the   predominant   ETS   gene   fusion   product)   and   the   DNA   repair   protein   DNA-­PK,   and   3)   to

  12. Identification of Driving ALK Fusion Genes and Genomic Landscape of Medullary Thyroid Cancer.

    Directory of Open Access Journals (Sweden)

    Jun Ho Ji

    2015-08-01

    Full Text Available The genetic landscape of medullary thyroid cancer (MTC is not yet fully understood, although some oncogenic mutations have been identified. To explore genetic profiles of MTCs, formalin-fixed, paraffin-embedded tumor tissues from MTC patients were assayed on the Ion AmpliSeq Cancer Panel v2. Eighty-four sporadic MTC samples and 36 paired normal thyroid tissues were successfully sequenced. We discovered 101 hotspot mutations in 18 genes in the 84 MTC tissue samples. The most common mutation was in the ret proto-oncogene, which occurred in 47 cases followed by mutations in genes encoding Harvey rat sarcoma viral oncogene homolog (N = 14, serine/threonine kinase 11 (N = 11, v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (N = 6, mutL homolog 1 (N = 4, Kiesten rat sarcoma viral oncogene homolog (N = 3 and MET proto-oncogene (N = 3. We also evaluated anaplastic lymphoma kinase (ALK rearrangement by immunohistochemistry and break-apart fluorescence in situ hybridization (FISH. Two of 98 screened cases were positive for ALK FISH. To identify the genomic breakpoint and 5' fusion partner of ALK, customized targeted cancer panel sequencing was performed using DNA from tumor samples of the two patients. Glutamine:fructose-6-phosphate transaminase 1 (GFPT1-ALK and echinoderm microtubule-associated protein-like 4 (EML4-ALK fusions were identified. Additional PCR analysis, followed by Sanger sequencing, confirmed the GFPT1-ALK fusion, indicating that the fusion is a result of intra-chromosomal translocation or deletion. Notably, a metastatic MTC case harboring the EML4-ALK fusion showed a dramatic response to an ALK inhibitor, crizotinib. In conclusion, we found several genetic mutations in MTC and are the first to identify ALK fusions in MTC. Our results suggest that the EML4-ALK fusion in MTC may be a potential driver mutation and a valid target of ALK inhibitors. Furthermore, the GFPT1-ALK fusion may be a potential candidate for molecular

  13. Gene expression profiling analysis of CRTC1-MAML2 fusion oncogene-induced transcriptional program in human mucoepidermoid carcinoma cells

    International Nuclear Information System (INIS)

    Chen, Jie; Li, Jian-Liang; Chen, Zirong; Griffin, James D.; Wu, Lizi

    2015-01-01

    Mucoepidermoid carcinoma (MEC) arises from multiple organs and accounts for the most common types of salivary gland malignancies. Currently, patients with unresectable and metastatic MEC have poor long-term clinical outcomes and no targeted therapies are available. The majority of MEC tumors contain a t(11;19) chromosomal translocation that fuses two genes, CRTC1 and MAML2, to generate the chimeric protein CRTC1-MAML2. CRTC1-MAML2 displays transforming activity in vitro and is required for human MEC cell growth and survival, partially due to its ability to constitutively activate CREB-mediated transcription. Consequently, CRTC1-MAML2 is implicated as a major etiologic molecular event and a therapeutic target for MEC. However, the molecular mechanisms underlying CRTC1-MAML2 oncogenic action in MEC have not yet been systematically analyzed. Elucidation of the CRTC1-MAML2-regulated transcriptional program and its underlying mechanisms will provide important insights into MEC pathogenesis that are essential for the development of targeted therapeutics. Transcriptional profiling was performed on human MEC cells with the depletion of endogenous CRTC1-MAML2 fusion or its interacting partner CREB via shRNA-mediated gene knockdown. A subset of target genes was validated via real-time RT-PCR assays. CRTC1-MAML2-perturbed molecular pathways in MEC were identified through pathway analyses. Finally, comparative analysis of CRTC1-MAML2-regulated and CREB-regulated transcriptional profiles was carried out to assess the contribution of CREB in mediating CRTC1-MAML2-induced transcription. A total of 808 differentially expressed genes were identified in human MEC cells after CRTC1-MAML2 knockdown and a subset of known and novel fusion target genes was confirmed by real-time RT-PCR. Pathway Analysis revealed that CRTC1-MAML2-regulated genes were associated with network functions that are important for cell growth, proliferation, survival, migration, and metabolism. Comparison of CRTC

  14. Expanding the molecular toolbox for Lactococcus lactis: construction of an inducible thioredoxin gene fusion expression system

    LENUS (Irish Health Repository)

    Douillard, Francois P

    2011-08-09

    Abstract Background The development of the Nisin Inducible Controlled Expression (NICE) system in the food-grade bacterium Lactococcus lactis subsp. cremoris represents a cornerstone in the use of Gram-positive bacterial expression systems for biotechnological purposes. However, proteins that are subjected to such over-expression in L. lactis may suffer from improper folding, inclusion body formation and\\/or protein degradation, thereby significantly reducing the yield of soluble target protein. Although such drawbacks are not specific to L. lactis, no molecular tools have been developed to prevent or circumvent these recurrent problems of protein expression in L. lactis. Results Mimicking thioredoxin gene fusion systems available for E. coli, two nisin-inducible expression vectors were constructed to over-produce various proteins in L. lactis as thioredoxin fusion proteins. In this study, we demonstrate that our novel L. lactis fusion partner expression vectors allow high-level expression of soluble heterologous proteins Tuc2009 ORF40, Bbr_0140 and Tuc2009 BppU\\/BppL that were previously insoluble or not expressed using existing L. lactis expression vectors. Over-expressed proteins were subsequently purified by Ni-TED affinity chromatography. Intact heterologous proteins were detected by immunoblotting analyses. We also show that the thioredoxin moiety of the purified fusion protein was specifically and efficiently cleaved off by enterokinase treatment. Conclusions This study is the first description of a thioredoxin gene fusion expression system, purposely developed to circumvent problems associated with protein over-expression in L. lactis. It was shown to prevent protein insolubility and degradation, allowing sufficient production of soluble proteins for further structural and functional characterization.

  15. Recombinant hepatitis B surface antigen production in Aspergillus niger: evaluating the strategy of gene fusion to native glucoamylase

    CSIR Research Space (South Africa)

    James, ER

    2012-10-01

    Full Text Available Microbiology and Biotechnology October 2012/ Vol. 96, No.2 Recombinant hepatitis B surface antigen production in Aspergillus niger: evaluating the strategy of gene fusion to native glucoamylase ER James a,c & WH van Zyl b & PJ van Zyl c & JF Görgens..., Pretoria 0001, South Africa Abstract This study demonstrates the potential of Aspergillus niger as a candidate expression system for virus- like particle production using gene fusion. Hepatitis B surface antigen (HBsAg) production, targeted...

  16. Kinase impact assessment in the landscape of fusion genes that retain kinase domains: a pan-cancer study

    Science.gov (United States)

    Kim, Pora; Jia, Peilin; Zhao, Zhongming

    2018-01-01

    Abstract Assessing the impact of kinase in gene fusion is essential for both identifying driver fusion genes (FGs) and developing molecular targeted therapies. Kinase domain retention is a crucial factor in kinase fusion genes (KFGs), but such a systematic investigation has not been done yet. To this end, we analyzed kinase domain retention (KDR) status in chimeric protein sequences of 914 KFGs covering 312 kinases across 13 major cancer types. Based on 171 kinase domain-retained KFGs including 101 kinases, we studied their recurrence, kinase groups, fusion partners, exon-based expression depth, short DNA motifs around the break points and networks. Our results, such as more KDR than 5′-kinase fusion genes, combinatorial effects between 3′-KDR kinases and their 5′-partners and a signal transduction-specific DNA sequence motif in the break point intronic sequences, supported positive selection on 3′-kinase fusion genes in cancer. We introduced a degree-of-frequency (DoF) score to measure the possible number of KFGs of a kinase. Interestingly, kinases with high DoF scores tended to undergo strong gene expression alteration at the break points. Furthermore, our KDR gene fusion network analysis revealed six of the seven kinases with the highest DoF scores (ALK, BRAF, MET, NTRK1, NTRK3 and RET) were all observed in thyroid carcinoma. Finally, we summarized common features of ‘effective’ (highly recurrent) kinases in gene fusions such as expression alteration at break point, redundant usage in multiple cancer types and 3′-location tendency. Collectively, our findings are useful for prioritizing driver kinases and FGs and provided insights into KFGs’ clinical implications. PMID:28013235

  17. Numerical analysis on ingress-of-coolant events in fusion reactors with TRAC-PF1 code

    International Nuclear Information System (INIS)

    Ose, Yasuo; Takase, Kazuyuki; Akimoto, Hajime

    2000-01-01

    As for accident events related with thermal-hydraulics, in a fusion experimental reactor an ingress-of-coolant event (ICE) and a loss-of-vacuum-accident event (LOVA) should be considered. An integrated ICE/LOVA test apparatus is under planning in order to estimate quantitatively heat transfer and fluid flow characteristics under ICE and LOVA events. This study was carried out to predict numerically the thermal-hydraulic characteristics in fusion reactors at the ICE events before construction of the integrated ICE/LOVA test apparatus. The TRAC-PF1 code, which was originally developed for the thermal-hydraulic safety analysis in light water reactors, was used. The numerical analyses were performed for two kinds of system configuration with/without a pressure-suppression tank:the former for is investigation of the pressure rise characteristics and two-phase flow behavior; the latter for estimation of an effect of the pressure reduction due to the pressure-suppression tank. From the present analytical results, effects of the ingress water flow rate and vessel temperatures on the pressure rise ware clarified quantitatively. Furthermore, the pressure-rise suppression effect due to the vapor condensation in the pressure-suppression tank was predicted numerically. In addition, the useful information regarding to the design of the integrated ICE/LOVA test apparatus and the knowledge with respect to the effective usage of the TRAC-PF1 code were obtained through the present numerical study. (author)

  18. Membrane fusion inducers, chloroquine and spermidine increase lipoplex-mediated gene transfection

    International Nuclear Information System (INIS)

    Wong-Baeza, Carlos; Bustos, Israel; Serna, Manuel; Tescucano, Alonso; Alcantara-Farfan, Veronica; Ibanez, Miguel; Montanez, Cecilia; Wong, Carlos; Baeza, Isabel

    2010-01-01

    Gene transfection into mammalian cells can be achieved with viral and non-viral vectors. Non-viral vectors, such as cationic lipids that form lipoplexes with DNA, are safer and more stable than viral vectors, but their transfection efficiencies are lower. Here we describe that the simultaneous treatment with a membrane fusion inducer (chlorpromazine or procainamide) plus the lysosomotropic agent chloroquine increases lipoplex-mediated gene transfection in human (HEK293 and C-33 A) and rat (PC12) cell lines (up to 9.2-fold), as well as in situ in BALB/c mice spleens and livers (up to 6-fold); and that the polyamine spermidine increases lipoplex-mediated gene transfection and expression in cell cultures. The use of these four drugs provides a novel, safe and relatively inexpensive way to considerably increase lipoplex-mediated gene transfection efficiency.

  19. A distributed real-time system for event-driven control and dynamic data acquisition on a fusion plasma experiment

    International Nuclear Information System (INIS)

    Sousa, J.; Combo, A.; Batista, A.; Correia, M.; Trotman, D.; Waterhouse, J.; Varandas, C.A.F.

    2000-01-01

    A distributed real-time trigger and timing system, designed in a tree-type topology and implemented in VME and CAMAC versions, has been developed for a magnetic confinement fusion experiment. It provides sub-microsecond time latencies for the transport of small data objects allowing event-driven discharge control with failure counteraction, dynamic pre-trigger sampling and event recording as well as accurate simultaneous triggers and synchronism on all nodes with acceptable optimality and predictability of timeliness. This paper describes the technical characteristics of the hardware components (central unit composed by one or more reflector crates, event and synchronism reflector cards, event and pulse node module, fan-out and fan-in modules) as well as software for both tests and integration on a global data acquisition system. The results of laboratory operation for several configurations and the overall performance of the system are presented and analysed

  20. Highly efficient retrograde gene transfer into motor neurons by a lentiviral vector pseudotyped with fusion glycoprotein.

    Directory of Open Access Journals (Sweden)

    Miyabi Hirano

    Full Text Available The development of gene therapy techniques to introduce transgenes that promote neuronal survival and protection provides effective therapeutic approaches for neurological and neurodegenerative diseases. Intramuscular injection of adenoviral and adeno-associated viral vectors, as well as lentiviral vectors pseudotyped with rabies virus glycoprotein (RV-G, permits gene delivery into motor neurons in animal models for motor neuron diseases. Recently, we developed a vector with highly efficient retrograde gene transfer (HiRet by pseudotyping a human immunodeficiency virus type 1 (HIV-1-based vector with fusion glycoprotein B type (FuG-B or a variant of FuG-B (FuG-B2, in which the cytoplasmic domain of RV-G was replaced by the corresponding part of vesicular stomatitis virus glycoprotein (VSV-G. We have also developed another vector showing neuron-specific retrograde gene transfer (NeuRet with fusion glycoprotein C type, in which the short C-terminal segment of the extracellular domain and transmembrane/cytoplasmic domains of RV-G was substituted with the corresponding regions of VSV-G. These two vectors afford the high efficiency of retrograde gene transfer into different neuronal populations in the brain. Here we investigated the efficiency of the HiRet (with FuG-B2 and NeuRet vectors for retrograde gene transfer into motor neurons in the spinal cord and hindbrain in mice after intramuscular injection and compared it with the efficiency of the RV-G pseudotype of the HIV-1-based vector. The main highlight of our results is that the HiRet vector shows the most efficient retrograde gene transfer into both spinal cord and hindbrain motor neurons, offering its promising use as a gene therapeutic approach for the treatment of motor neuron diseases.

  1. Osteoclast Fusion

    DEFF Research Database (Denmark)

    Marie Julie Møller, Anaïs; Delaissé, Jean-Marie; Søe, Kent

    2017-01-01

    on the nuclearity of fusion partners. While CD47 promotes cell fusions involving mono-nucleated pre-osteoclasts, syncytin-1 promotes fusion of two multi-nucleated osteoclasts, but also reduces the number of fusions between mono-nucleated pre-osteoclasts. Furthermore, CD47 seems to mediate fusion mostly through...... individual fusion events using time-lapse and antagonists of CD47 and syncytin-1. All time-lapse recordings have been studied by two independent observers. A total of 1808 fusion events were analyzed. The present study shows that CD47 and syncytin-1 have different roles in osteoclast fusion depending...... broad contact surfaces between the partners' cell membrane while syncytin-1 mediate fusion through phagocytic-cup like structure. J. Cell. Physiol. 9999: 1-8, 2016. © 2016 Wiley Periodicals, Inc....

  2. Fusion

    International Nuclear Information System (INIS)

    Bolwell, J. J.

    2009-01-01

    Full text:A 5-year-old female with a history of right sided hypertonia and frequent seizures presented to our department for investigation. She had previously undergone two MRI scans, one in 2004 which demonstrated significant loss of volume of the left hemisphere, a loss of deep and subcortical white matter, markedly dilated left lateral ventricle. This MRI gave a diagnosis of cerebral palsy. In 2007 she underwent an additional brain MRI at the Royal Children's Hospital which demonstrated no significant change from 2004 images and the report was suggestive of an old antenatal/perinatal ischaemic event as the cause of her brain condition. In September of 2008 she was investigated in our department looking for a focus of epilepsy. She underwent a 99mTc-ECD Ictal SPECT/CT study and an 18F-FDG Inter-ictal PET brain study which were later both fused with an additional MRI performed in September of 2008 at the RCH. The PET and SPECT datasets were both corrected for attenuation using their own low dose CT acquisitions and then they were fused with the T2 MRI images. The fused images demonstrated multiple epileptic foci in both sides of the brain with the left side being the more severe of the two. Based on the result of findings of the PET/CT and SPECT/CT fused with the MRI and the failure of medication and dietary strategies, the treating team has decided to perform a partial hemispherectomy of the left side of the brain to alleviate the seizures.

  3. Protection against California 2002 NDV strain afforded by adenovirus vectored vaccine expressing Fusion or Hemagglutination-neuraminidase genes

    Science.gov (United States)

    Vectored vaccines expressing the combination of the hemagglutinin-neuraminidase (HN) and fusion (F) genes generally have better clinical protection against Newcastle disease virus (NDV) than when either the F and HN genes are expressed alone. Interestingly, the protection induced by F is usually bet...

  4. A case of lung adenocarcinoma harboring EGFR mutation and EML4-ALK fusion gene

    International Nuclear Information System (INIS)

    Tanaka, Hisashi; Hayashi, Akihito; Morimoto, Takeshi; Taima, Kageaki; Tanaka, Yoshihito; Shimada, Michiko; Kurose, Akira; Takanashi, Shingo; Okumura, Ken

    2012-01-01

    Lung cancer is the leading cause of cancer-related death worldwide. Epidermal growth factor receptor (EGFR) - tyrosine kinase inhibitor (TKI) is used for the patients with EGFR-mutant lung cancer. Recently, phase III studies in the patients with EGFR-mutant demonstrated that EGFR-TKI monotherapy improved progression-free survival compared with platinum-doublet chemotherapy. The echinoderm microtubule-associated protein-like 4 (EML4) - anaplastic lymphoma kinase (ALK) fusion oncogene represents one of the newest molecular targets in non-small cell lung cancer (NSCLC). Patients who harbor EML4-ALK fusions have been associated with a lack of EGFR or KRAS mutations. We report a 39-year-old patient diagnosed as adenocarcinoma harboring EGFR mutation and EML4-ALK fusion gene. We treated this patient with erlotinib as the third line therapy, but no clinical benefit was obtained. We experienced a rare case with EGFR mutation and EML4-ALK. Any clinical benefit using EGFR-TKI was not obtained in our case. The therapeutic choice for the patients with more than one driver mutations is unclear. We needs further understanding of the lung cancer molecular biology and the biomarker infomation

  5. NUTM1 Gene Fusions Characterize a Subset of Undifferentiated Soft Tissue and Visceral Tumors.

    Science.gov (United States)

    Dickson, Brendan C; Sung, Yun-Shao; Rosenblum, Marc K; Reuter, Victor E; Harb, Mohammed; Wunder, Jay S; Swanson, David; Antonescu, Cristina R

    2018-05-01

    NUT midline carcinoma is an aggressive tumor that occurs mainly in the head and neck and, less frequently, the mediastinum and lung. Following identification of an index case of a NUTM1 fusion positive undifferentiated soft tissue tumor, we interrogated additional cases of primary undifferentiated soft tissue and visceral tumors for NUTM1 abnormalities. Targeted next-generation sequencing was performed on RNA extracted from formalin-fixed paraffin-embedded tissue, and results validated by fluorescence in situ hybridization using custom bacterial artificial chromosome probes. Six patients were identified: mean age of 42 years (range, 3 to 71 y); equal sex distribution; and, tumors involved the extremity soft tissues (N=2), kidney (N=2), stomach, and brain. On systemic work-up at presentation all patients lacked a distant primary tumor. Morphologically, the tumors were heterogenous, with undifferentiated round-epithelioid-rhabdoid cells arranged in solid sheets, nests, and cords. Mitotic activity was generally brisk. Four cases expressed pancytokeratin, but in only 2 cases was this diffuse. Next-generation sequencing demonstrated the following fusions: BRD4-NUTM1 (3 cases), BRD3-NUTM1, MXD1-NUTM1, and BCORL1-NUTM1. Independent testing by fluorescence in situ hybridization confirmed the presence of NUTM1 and partner gene rearrangement. This study establishes that NUT-associated tumors transgress the midline and account for a subset of primitive neoplasms occurring in soft tissue and viscera. Tumors harboring NUTM1 gene fusions are presumably underrecognized, and the extent to which they account for undifferentiated mesenchymal, neuroendocrine, and/or epithelial neoplasms is unclear. Moreover, the relationship, if any, between NUT-associated tumors in soft tissue and/or viscera, and conventional NUT carcinoma, remains to be elucidated.

  6. Construction of a fusion gene containing hepatitis B virus L gene ...

    African Journals Online (AJOL)

    Jane

    2011-10-05

    Oct 5, 2011 ... the successful construction of a recombinant yeast expression vector containing gene coding L protein and Ag85B ..... the production of memory T cells, promote cytokine secretion and ... Dual DNA vaccination of rainbow trout.

  7. Novel gene fusion of PRCC-MITF defines a new member of MiT family translocation renal cell carcinoma: clinicopathological analysis and detection of the gene fusion by RNA sequencing and FISH.

    Science.gov (United States)

    Xia, Qiu-Yuan; Wang, Xiao-Tong; Ye, Sheng-Bing; Wang, Xuan; Li, Rui; Shi, Shan-Shan; Fang, Ru; Zhang, Ru-Song; Ma, Heng-Hui; Lu, Zhen-Feng; Shen, Qin; Bao, Wei; Zhou, Xiao-Jun; Rao, Qiu

    2018-04-01

    MITF, TFE3, TFEB and TFEC belong to the same microphthalmia-associated transcription factor family (MiT). Two transcription factors in this family have been identified in two unusual types of renal cell carcinoma (RCC): Xp11 translocation RCC harbouring TFE3 gene fusions and t(6;11) RCC harbouring a MALAT1-TFEB gene fusion. The 2016 World Health Organisation classification of renal neoplasia grouped these two neoplasms together under the category of MiT family translocation RCC. RCCs associated with the other two MiT family members, MITF and TFEC, have rarely been reported. Herein, we identify a case of MITF translocation RCC with the novel PRCC-MITF gene fusion by RNA sequencing. Histological examination of the present tumour showed typical features of MiT family translocation RCCs, overlapping with Xp11 translocation RCC and t(6;11) RCC. However, this tumour showed negative results in TFE3 and TFEB immunochemistry and split fluorescence in-situ hybridisation (FISH) assays. The other MiT family members, MITF and TFEC, were tested further immunochemically and also showed negative results. RNA sequencing and reverse transcription-polymerase chain reaction confirmed the presence of a PRCC-MITF gene fusion: a fusion of PRCC exon 5 to MITF exon 4. We then developed FISH assays covering MITF break-apart probes and PRCC-MITF fusion probes to detect the MITF gene rearrangement. This study both proves the recurring existence of MITF translocation RCC and expands the genotype spectrum of MiT family translocation RCCs. © 2017 John Wiley & Sons Ltd.

  8. Construction of a fusion gene containing hepatitis B virus L gene ...

    African Journals Online (AJOL)

    The results of SDS-PAGE and Western blot showed that the recombinant protein was induced by methanol and stably expressed in P. pastoris, while it has specific reaction with the serum containing anti-HbsAg or anti-Ag85B. However, the successful construction of a recombinant yeast expression vector containing gene ...

  9. Gene trapping in differentiating cell lines: regulation of the lysosomal protease cathepsin B in skeletal myoblast growth and fusion.

    Science.gov (United States)

    Gogos, J A; Thompson, R; Lowry, W; Sloane, B F; Weintraub, H; Horwitz, M

    1996-08-01

    To identify genes regulated during skeletal muscle differentiation, we have infected mouse C2C12 myoblasts with retroviral gene trap vectors, containing a promoterless marker gene with a 5' splice acceptor signal. Integration of the vector adjacent to an actively transcribed gene places the marker under the transcriptional control of the endogenous gene, while the adjacent vector sequences facilitate cloning. The vector insertionally mutates the trapped locus and may also form fusion proteins with the endogenous gene product. We have screened several hundred clones, each containing a trapping vector integrated into a different endogenous gene. In agreement with previous estimates based on hybridization kinetics, we find that a large proportion of all genes expressed in myoblasts are regulated during differentiation. Many of these genes undergo unique temporal patterns of activation or repression during cell growth and myotube formation, and some show specific patterns of subcellular localization. The first gene we have identified with this strategy is the lysosomal cysteine protease cathepsin B. Expression from the trapped allele is upregulated during early myoblast fusion and downregulated in myotubes. A direct role for cathepsin B in myoblast growth and fusion is suggested by the observation that the trapped cells deficient in cathepsin B activity have an unusual morphology and reduced survival in low-serum media and undergo differentiation with impaired cellular fusion. The phenotype is reproduced by antisense cathepsin B expression in parental C2C12 myoblasts. The cellular phenotype is similar to that observed in cultured myoblasts from patients with I cell disease, in which there is diminished accumulation of lysosomal enzymes. This suggests that a specific deficiency of cathepsin B could contribute to the myopathic component of this illness.

  10. Early events in the evolution of spider silk genes.

    Directory of Open Access Journals (Sweden)

    James Starrett

    Full Text Available Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers, from the suborder Araneomorphae ('true spiders'. Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs, is known only from the orbicularian species, Lactrodectus hesperus (Western black widow. In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders, which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae. We use the spidroin gene tree to reconstruct the evolution of amino acid

  11. Measurement of the relative fraction of ttbar events produced via gluon fusion in ppbar collision at s**(1/2) = 1.96 TeV at CDF

    International Nuclear Information System (INIS)

    Yamaoka, Jared Andrew; Rutgers U., Piscataway

    2007-01-01

    In this thesis we present a measurement of the relative fraction of t(bar t) events produced via gluon-fusion to the total number of t(bar t) events. Using the kinematics of the production and decay of the top and antitop quark pair, we trained a Neural Network to discriminate the gluon-fusion events. The Neural Network was then used as a template to fit for the gluon-fusion fraction in data. Using a total integrated luminosity of 955 pb -1 we find σ(gg→t(bar t))/σ(p(bar p)→t(bar t)) < 0.33 at 68% confidence level and σ(gg→t(bar t))/σ(p(bar p)→t(bar t)) < 0.61 at 95% confidence level

  12. Gene conversion and reversion events in Saccharomyces cerevisiae. Model for study of gamma radiation damage

    International Nuclear Information System (INIS)

    Moreno, Damaris; Fuentes, Jorge L.; Prieto Miranda, Enrique F.; Sanchez Lamar, Angel; Baluja, Ligia

    2004-01-01

    Radiosensitivity and kinetics of induction of gene conversion and reversion events in Saccharomyces cerevisiae strain D7 to gamma radiation at dose ranges from 100 to 800 Gy and 50 to 300 Gy respectively were studied. A source of 60Co PX- -30 at a dose rate of 49,43 GY/min was utilized. The cell survival curve showed DL50 of 150 Gy. Cell death kinetics was linear and adjusted over 98 %. The induction of gene conversion events was significant in relation to control from 50 Gy on. However, gene reversion was significant only at 200 Gy. Generally speaking, gene conversion event frequencies were higher than those of reversion, which indicates that gamma radiation preferably induces recombinogenic events. Both the conversion and reversion events showed exponential dependence on gamma radiation dose. The relative benefits of this test for mutagenesis and anti-mutagenesis studies were debated in this paper

  13. Development of Peptidomimetic Inhibitors of the ERG Gene Fusion Product in Prostate Cancer.

    Science.gov (United States)

    Wang, Xiaoju; Qiao, Yuanyuan; Asangani, Irfan A; Ateeq, Bushra; Poliakov, Anton; Cieślik, Marcin; Pitchiaya, Sethuramasundaram; Chakravarthi, Balabhadrapatruni V S K; Cao, Xuhong; Jing, Xiaojun; Wang, Cynthia X; Apel, Ingrid J; Wang, Rui; Tien, Jean Ching-Yi; Juckette, Kristin M; Yan, Wei; Jiang, Hui; Wang, Shaomeng; Varambally, Sooryanarayana; Chinnaiyan, Arul M

    2017-04-10

    Transcription factors play a key role in the development of diverse cancers, and therapeutically targeting them has remained a challenge. In prostate cancer, the gene encoding the transcription factor ERG is recurrently rearranged and plays a critical role in prostate oncogenesis. Here, we identified a series of peptides that interact specifically with the DNA binding domain of ERG. ERG inhibitory peptides (EIPs) and derived peptidomimetics bound ERG with high affinity and specificity, leading to proteolytic degradation of the ERG protein. The EIPs attenuated ERG-mediated transcription, chromatin recruitment, protein-protein interactions, cell invasion and proliferation, and tumor growth. Thus, peptidomimetic targeting of transcription factor fusion products may provide a promising therapeutic strategy for prostate cancer as well as other malignancies. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Safety analyses for transient behavior of plasma and in-vessel components during plasma abnormal events in fusion reactor

    International Nuclear Information System (INIS)

    Honda, Takuro; Okazaki, Takashi; Bartels, H.W.; Uckan, N.A.; Seki, Yasushi.

    1997-01-01

    Safety analyses on plasma abnormal events have been performed using a hybrid code of a plasma dynamics model and a heat transfer model of in-vessel components. Several abnormal events, e.g., increase in fueling rate, were selected for the International Thermonuclear Experimental Reactor (ITER) and transient behavior of the plasma and the invessel components during the events was analyzed. The physics model for safety analysis was conservatively prepared. In most cases, the plasma is terminated by a disruption or it returns to the original operation point. When the energy confinement improves by a factor of 2.0 in the steady state, which is a hypothetical assumption under the present plasma data, the maximum fusion power reaches about 3.3 GW at about 3.6 s and the plasma is terminated due to a disruption. However, the results obtained in this study show the confinement boundary of ITER can be kept almost intact during the abnormal plasma transients, as long as the cooling system works normally. Several parametric studies are needed to comprehend the overpower transient including structure behavior, since many uncertainties are connected to the filed of the plasma physics. And, future work will need to discuss the burn control scenario considering confinement mode transition, system specifications, experimental plans and safety regulations, etc. to confirm the safety related to the plasma anomaly. (author)

  15. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events

    Directory of Open Access Journals (Sweden)

    Tigst Demeke

    2018-05-01

    Full Text Available Droplet digital PCR (ddPCR has been used for absolute quantification of genetically engineered (GE events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences (HMG-I/Y, FatA(A, CruA and Ccf for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A, reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes. Keywords: Canola, Digital PCR, DNA extraction, GMO, Reference genes

  16. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  17. Association of TMPRSS2-ERG gene fusion with clinical characteristics and outcomes: results from a population-based study of prostate cancer

    International Nuclear Information System (INIS)

    FitzGerald, Liesel M; Cox, Michael E; Ostrander, Elaine A; Stanford, Janet L; Huntsman, David G; Agalliu, Ilir; Johnson, Karynn; Miller, Melinda A; Kwon, Erika M; Hurtado-Coll, Antonio; Fazli, Ladan; Rajput, Ashish B; Gleave, Martin E

    2008-01-01

    The presence of the TMPRSS2-ERG fusion gene in prostate tumors has recently been associated with an aggressive phenotype, as well as recurrence and death from prostate cancer. These associations suggest the hypothesis that the gene fusion may be used as a prognostic indicator for prostate cancer. In this study, fluorescent in situ hybridization (FISH) assays were used to assess TMPRSS2-ERG fusion status in a group of 214 prostate cancer cases from two population-based studies. The FISH assays were designed to detect both fusion type (deletion vs. translocation) and the number of fusion copies (single vs. multiple). Genotyping of four ERG and one TMPRSS2 SNPs using germline DNA was also performed in a sample of the cases (n = 127). Of the 214 tumors scored for the TMPRSS2-ERG fusion, 64.5% were negative and 35.5% were positive for the fusion. Cases with the TMPRSS2-ERG fusion did not exhibit reduced prostate cancer survival (HR = 0.92, 95% CI = 0.22–3.93), nor was there a significant difference in cause-specific survival when stratifying by translocation or deletion (HR = 0.84, 95% CI = 0.23–3.12) or by the number of retained fusion copies (HR = 1.22, 95% CI = 0.45–3.34). However, evidence for reduced prostate cancer-specific survival was apparent in those cases whose tumor had multiple copies of the fusion. The variant T allele of the TMPRSS2 SNP, rs12329760, was positively associated with TMPRSS2-ERG fusion by translocation (p = 0.05) and with multiple copies of the gene fusion (p = 0.03). If replicated, the results presented here may provide insight into the mechanism by which the TMPRSS2-ERG gene fusion arises and also contribute to diagnostic evaluations for determining the subset of men who will go on to develop metastatic prostate cancer

  18. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

    Science.gov (United States)

    Demeke, Tigst; Eng, Monika

    2018-05-01

    Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

  19. Estimation of the environmental or radiological impact in the event of accidental release of radionuclides in a DCLL fusion reactor; Estimacion del impacto radiologico ambiental en caso de liberacion accidental de radionucleidos en un reactor de fusion DCLL

    Energy Technology Data Exchange (ETDEWEB)

    Palermo, I.; Gomez Ros, J. M.; Sanz, J.; Mota, F.

    2013-07-01

    Tritium production and activation in the LiPb products can pose a radiological risk in the event of accidental release in a fusion reactor. Within the research programme Consolider TECNO{sub F}US (CSD2008-079) fusion technology has developed a design for a reactor with regenerative wrap with dual refrigeration (DCLL). The purpose of this communication is to present estimates of the radiological impact derived from an accidental release of radionuclides from the circuit of LiPb provinients. (Author)

  20. Communication and relations with industry. Publications and events-Fusion programme

    International Nuclear Information System (INIS)

    2007-01-01

    As ITER construction is starting in the European site of Cadarache, several initiatives have been launched by ENEA in order to provide the relevant information to Italian industries potentially interested in the realisation of the ITER. One hundred and eighty people, representing almost one hundred industrial companies from all over Italy, gathered on 17 January in Villa Tuscolana, close to ENEA Frascati, to participate in the Presentation of the ITER Project to Italian Industry. The event was organised by ENEA with the objective of informing Italian industry about the present status of ITER and the possibilities of participation in its construction

  1. Glioma stem cells targeted by oncolytic virus carrying endostatin-angiostatin fusion gene and the expression of its exogenous gene in vitro.

    Science.gov (United States)

    Zhu, Guidong; Su, Wei; Jin, Guishan; Xu, Fujian; Hao, Shuyu; Guan, Fangxia; Jia, William; Liu, Fusheng

    2011-05-16

    The development of the cancer stem cell (CSCs) niche theory has provided a new target for the treatment of gliomas. Gene therapy using oncolytic viral vectors has shown great potential for the therapeutic targeting of CSCs. To explore whether a viral vector carrying an exogenous Endo-Angio fusion gene (VAE) can infect and kill glioma stem cells (GSCs), as well as inhibit their vascular niche in vitro, we have collected surgical specimens of human high-grade glioma (world health organization, WHO Classes III-VI) from which we isolated and cultured GSCs under conditions originally designed for the selective expansion of neural stem cells. Our results demonstrate the following: (1) Four lines of GSCs (isolated from 20 surgical specimens) could grow in suspension, were multipotent, had the ability to self-renew and expressed the neural stem cell markers, CD133 and nestin. (2) VAE could infect GSCs and significantly inhibit their viability. (3) The Endo-Angio fusion gene was expressed in GSCs 48 h after VAE infection and could inhibit the proliferation of human brain microvascular endothelial cells (HBMEC). (4) Residual viable cells lose the ability of self-renewal and adherent differentiation. In conclusion, VAE can significantly inhibit the activity of GSCs in vitro and the expression of exogenous Endo-Angio fusion gene can inhibit HBMEC proliferation. VAE can be used as a novel virus-gene therapy strategy for glioma. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. [Construction and prokaryotic expression of recombinant gene EGFRvIII HBcAg and immunogenicity analysis of the fusion protein].

    Science.gov (United States)

    Duan, Xiao-yi; Wang, Jian-sheng; Guo, You-min; Han, Jun-li; Wang, Quan-ying; Yang, Guang-xiao

    2007-01-01

    To construct recombinant prokaryotic expression plasmid pET28a(+)/c-PEP-3-c and evaluate the immunogenicity of the fusion protein. cDNA fragment encoding PEP-3 was obtained from pGEM-T Easy/PEP-3 and inserted into recombinant plasmid pGEMEX/HBcAg. Then it was subcloned in prokaryotic expression vector and transformed into E.coli BL21(DE3). The fusion protein was expressed by inducing IPTG and purified by Ni(2+)-NTA affinity chromatography. BALB/c mice were immunized with fusion protein and the antibody titre was determined by indirect ELISA. The recombinant gene was confirmed to be correct by restriction enzyme digestion and DNA sequencing. After prokaryotic expression, fusion protein existed in sediment and accounted for 56% of all bacterial lysate. The purified product accounted for 92% of all protein and its concentration was 8 g/L. The antibody titre in blood serum reached 1:16 000 after the fourth immunization and reached 1:2.56x10(5) after the sixth immunization. The titre of anti-PEP-3 antibody reached 1:1.28x10(5) and the titre of anti-HBcAg antibody was less than 1:4x10(3). Fusion gene PEP-3-HBcAg is highly expressed in E.coli BL21. The expressed fusion protein can induce neutralizing antibody with high titer and specificity, which lays a foundation for the study of genetically engineering vaccine for malignant tumors with the high expression of EGFRvIII.

  3. Development of RNA-FISH Assay for Detection of Oncogenic FGFR3-TACC3 Fusion Genes in FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Masahiro Kurobe

    Full Text Available Oncogenic FGFR3-TACC3 fusions and FGFR3 mutations are target candidates for small molecule inhibitors in bladder cancer (BC. Because FGFR3 and TACC3 genes are located very closely on chromosome 4p16.3, detection of the fusion by DNA-FISH (fluorescent in situ hybridization is not a feasible option. In this study, we developed a novel RNA-FISH assay using branched DNA probe to detect FGFR3-TACC3 fusions in formaldehyde-fixed paraffin-embedded (FFPE human BC samples.The RNA-FISH assay was developed and validated using a mouse xenograft model with human BC cell lines. Next, we assessed the consistency of the RNA-FISH assay using 104 human BC samples. In this study, primary BC tissues were stored as frozen and FFPE tissues. FGFR3-TACC3 fusions were independently detected in FFPE sections by the RNA-FISH assay and in frozen tissues by RT-PCR. We also analyzed the presence of FGFR3 mutations by targeted sequencing of genomic DNA extracted from deparaffinized FFPE sections.FGFR3-TACC3 fusion transcripts were identified by RNA-FISH and RT-PCR in mouse xenograft FFPE tissues using the human BC cell lines RT112 and RT4. These cell lines have been reported to be fusion-positive. Signals for FGFR3-TACC3 fusions by RNA-FISH were positive in 2/60 (3% of non-muscle-invasive BC (NMIBC and 2/44 (5% muscle-invasive BC (MIBC patients. The results of RT-PCR of all 104 patients were identical to those of RNA-FISH. FGFR3 mutations were detected in 27/60 (45% NMIBC and 8/44 (18% MIBC patients. Except for one NMIBC patient, FGFR3 mutation and FGFR3-TACC3 fusion were mutually exclusive.We developed an RNA-FISH assay for detection of the FGFR3-TACC3 fusion in FFPE samples of human BC tissues. Screening for not only FGFR3 mutations, but also for FGFR3-TACC3 fusion transcripts has the potential to identify additional patients that can be treated with FGFR inhibitors.

  4. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Mycobacterium tuberculosis HspX/EsxS Fusion Protein: Gene Cloning, Protein Expression, and Purification in Escherichia coli.

    Science.gov (United States)

    Khademi, Farzad; Yousefi-Avarvand, Arshid; Derakhshan, Mohammad; Meshkat, Zahra; Tafaghodi, Mohsen; Ghazvini, Kiarash; Aryan, Ehsan; Sankian, Mojtaba

    2017-10-01

    The purpose of this study was to clone, express, and purify a novel multidomain fusion protein of Micobacterium tuberculosis (Mtb) in a prokaryotic system. An hspX/esxS gene construct was synthesized and ligated into a pGH plasmid, E. coli TOP10 cells were transformed, and the vector was purified. The vector containing the construct and pET-21b (+) plasmid were digested with the same enzymes and the construct was ligated into pET-21b (+). The accuracy of cloning was confirmed by colony PCR and sequencing. E. coli BL21 cells were transformed with the pET-21b (+)/hspX/esxS expression vector and protein expression was evaluated. Finally, the expressed fusion protein was purified on a Ni-IDA column and verified by SDS-PAGE and western blotting. The hspX/esxS gene construct was inserted into pET-21b (+) and recombinant protein expression was induced with IPTG in E. coli BL21 cells. Various concentrations of IPTG were tested to determine the optimum concentration for expression induction. The recombinant protein was expressed in insoluble inclusion bodies. Three molar guanidine HCl was used to solubilize the insoluble protein. An HspX/EsxS Mtb fusion protein was expressed in E. coli and the recombinant protein was purified. After immunological analysis, the HspX/EsxS fusion protein might be an anti-tuberculosis vaccine candidate in future clinical trial studies.

  6. The chicken embryo as an efficient model to test the function of muscle fusion genes in amniotes.

    Directory of Open Access Journals (Sweden)

    Daniel Sieiro

    Full Text Available The fusion of myoblasts into multinucleated myotubes is a crucial step of muscle growth during development and of muscle repair in the adult. While multiple genes were shown to play a role in this process, a vertebrate model where novel candidates can be tested and analyzed at high throughput and relative ease has been lacking. Here, we show that the early chicken embryo is a fast and robust model in which functional testing of muscle fusion candidate genes can be performed. We have used known modulators of muscle fusion, Rac1 and Cdc42, along with the in vivo electroporation of integrated, inducible vectors, to show that the chicken embryo is a suitable model in which their function can be tested and quantified. In addition to nuclei content, specific characteristics of the experimental model allow a fine characterization of additional morphological features that are nearly impossible to assess in other model organisms. This study should establish the chicken embryo as a cheap, reliable and powerful model in which novel vertebrate muscle fusion candidates can be evaluated.

  7. Transfer of the Fusarium resistant gene from Solanum integrifolium into S. melongena by asymmetric fusion

    International Nuclear Information System (INIS)

    Akamatsu, T.; Yoshida, M.; Shiga, T.

    1990-01-01

    Full text: In order to transfer the Fusarium resistant gene from the wild species into eggplants, asymmetric fusions were done between Solanum integrifolium and S. melongena. Protoplasts of S. melongena were isolated from hypocotyIes, and protoplasts of S. integrifolium were isolated from young leaves. Protoplasts of S. integrifolium were irradiated by soft x-rays (40-60kR), and fused with protoplasts of S. melongena by electric pulses. Fused protoplasts were cultured using TM-2 basal medium supplemented with 2,4-D (0.5 mg/l), NAA (0.35mg/l), and BA (2mg/l). After 30 days, calli of 1-2 mm in diameter were subcultured on agar medium supplemented with IAA (0.2mg/l) and Zeatin (4mg/l). After 15-30 days, shoots were regenerated from green calli. Regenerated plants were transplanted to the greenhouse and 382 plants were inoculated with Fusarium oxysporum. Thirty-two plants were resistant or tolerant, their chromosome numbers varied in the range of 35-42 (S. integrifolium, S. melongena 2n=2x=24). (author)

  8. Membrane cholesterol regulates lysosome-plasma membrane fusion events and modulates Trypanosoma cruzi invasion of host cells.

    Directory of Open Access Journals (Sweden)

    Bárbara Hissa

    Full Text Available BACKGROUND: Trypomastigotes of Trypanosoma cruzi are able to invade several types of non-phagocytic cells through a lysosomal dependent mechanism. It has been shown that, during invasion, parasites trigger host cell lysosome exocytosis, which initially occurs at the parasite-host contact site. Acid sphingomyelinase released from lysosomes then induces endocytosis and parasite internalization. Lysosomes continue to fuse with the newly formed parasitophorous vacuole until the parasite is completely enclosed by lysosomal membrane, a process indispensable for a stable infection. Previous work has shown that host membrane cholesterol is also important for the T. cruzi invasion process in both professional (macrophages and non-professional (epithelial phagocytic cells. However, the mechanism by which cholesterol-enriched microdomains participate in this process has remained unclear. METHODOLOGY/PRINCIPAL FINDING: In the present work we show that cardiomyocytes treated with MβCD, a drug able to sequester cholesterol from cell membranes, leads to a 50% reduction in invasion by T. cruzi trypomastigotes, as well as a decrease in the number of recently internalized parasites co-localizing with lysosomal markers. Cholesterol depletion from host membranes was accompanied by a decrease in the labeling of host membrane lipid rafts, as well as excessive lysosome exocytic events during the earlier stages of treatment. Precocious lysosomal exocytosis in MβCD treated cells led to a change in lysosomal distribution, with a reduction in the number of these organelles at the cell periphery, and probably compromises the intracellular pool of lysosomes necessary for T. cruzi invasion. CONCLUSION/SIGNIFICANCE: Based on these results, we propose that cholesterol depletion leads to unregulated exocytic events, reducing lysosome availability at the cell cortex and consequently compromise T. cruzi entry into host cells. The results also suggest that two different pools of

  9. Temperature distributions in a Tokamak vacuum vessel of fusion reactor after the loss-of-vacuum-events occurred

    International Nuclear Information System (INIS)

    Takase, K.; Kunugi, T.; Shibata, M.; Seki, Y.

    1998-01-01

    If a loss-of-vacuum-event (LOVA) occurred in a fusion reactor, buoyancy-driven exchange flows would occur at breaches of a vacuum vessel (VV) due to the temperature difference between the inside and outside of the VV. The exchange flows may bring mixtures of activated materials and tritium in the VV to the outside through the breaches, and remove decay heat from the plasma-facing components of the VV. Therefore, the LOVA experiments were carried out under the condition that one or two breaches was opened and that the VV was heated to a maximum 200 C, using a small-scaled LOVA experimental apparatus. Air and helium gas were provided as working fluids. Fluid and wall temperature distributions in the VV were measured and the flow patterns in the VV were estimated by using these temperature distributions. It was found that: (1) the exchange mass in the VV depended on the breach positions; (2) the exchange flow at the single breach case became a counter-current flow when the breach was at the roof of the VV and a stratified flow when it was at the side wall; (3) and that at the double breach case, a one-way flow between two breaches was formed. (orig.)

  10. Clinicopathological differences between variants of the NAB2-STAT6 fusion gene in solitary fibrous tumors of the meninges and extra-central nervous system.

    Science.gov (United States)

    Nakada, Satoko; Minato, Hiroshi; Nojima, Takayuki

    2016-07-01

    Investigations on the NAB2-STAT6 fusion gene in solitary fibrous tumors (SFTs) and hemangiopericytomas (HPCs) have increased since its discovery in 2013. Although several SFTs reported without NAB2-STAT6 fusion gene analysis, we reviewed 546 SFTs/HPCs with NAB2-STAT6 fusion gene analysis in this study and investigated differences between the gene variants. In total, 452 cases tested positive for the NAB2-STAT6 fusion gene, with more than 40 variants being detected. The most frequent of these were NAB2 exon 6-STAT6 exon 16/17/18 and NAB2 exon 4-STAT6 exon 2/3, with the former occurring most frequently in SFTs in meninges, soft tissues, and head and neck; the latter predominated in SFTs in the pleura and lung. There was no difference between the histology of SFTs and fusion gene variants. A follow-up analysis of SFTs showed that 51 of 202 cases had a recurrence, with 18 of 53 meningeal SFTs having a local recurrence and/or metastasis within 0-19 years. In meninges and soft tissue, SFTs with the NAB2 exon 6-STAT6 exon 16/17/18 tended to recur more frequently than SFTs with the NAB2 exon 4-STAT6 exon 2/3. Clinicopathological data, including yearly follow-ups, are required for meningeal SFTs/HPCs to define the correlation of variants of NAB2-STAT6 fusion gene.

  11. Two coiled-coil domains of Chlamydia trachomatis IncA affect membrane fusion events during infection.

    Science.gov (United States)

    Ronzone, Erik; Paumet, Fabienne

    2013-01-01

    Chlamydia trachomatis replicates in a parasitophorous membrane-bound compartment called an inclusion. The inclusions corrupt host vesicle trafficking networks to avoid the degradative endolysosomal pathway but promote fusion with each other in order to sustain higher bacterial loads in a process known as homotypic fusion. The Chlamydia protein IncA (Inclusion protein A) appears to play central roles in both these processes as it participates to homotypic fusion and inhibits endocytic SNARE-mediated membrane fusion. How IncA selectively inhibits or activates membrane fusion remains poorly understood. In this study, we analyzed the spatial and molecular determinants of IncA's fusogenic and inhibitory functions. Using a cell-free membrane fusion assay, we found that inhibition of SNARE-mediated fusion requires IncA to be on the same membrane as the endocytic SNARE proteins. IncA displays two coiled-coil domains showing high homology with SNARE proteins. Domain swap and deletion experiments revealed that although both these domains are capable of independently inhibiting SNARE-mediated fusion, these two coiled-coil domains cooperate in mediating IncA multimerization and homotypic membrane interaction. Our results support the hypothesis that Chlamydia employs SNARE-like virulence factors that positively and negatively affect membrane fusion and promote infection.

  12. Two coiled-coil domains of Chlamydia trachomatis IncA affect membrane fusion events during infection.

    Directory of Open Access Journals (Sweden)

    Erik Ronzone

    Full Text Available Chlamydia trachomatis replicates in a parasitophorous membrane-bound compartment called an inclusion. The inclusions corrupt host vesicle trafficking networks to avoid the degradative endolysosomal pathway but promote fusion with each other in order to sustain higher bacterial loads in a process known as homotypic fusion. The Chlamydia protein IncA (Inclusion protein A appears to play central roles in both these processes as it participates to homotypic fusion and inhibits endocytic SNARE-mediated membrane fusion. How IncA selectively inhibits or activates membrane fusion remains poorly understood. In this study, we analyzed the spatial and molecular determinants of IncA's fusogenic and inhibitory functions. Using a cell-free membrane fusion assay, we found that inhibition of SNARE-mediated fusion requires IncA to be on the same membrane as the endocytic SNARE proteins. IncA displays two coiled-coil domains showing high homology with SNARE proteins. Domain swap and deletion experiments revealed that although both these domains are capable of independently inhibiting SNARE-mediated fusion, these two coiled-coil domains cooperate in mediating IncA multimerization and homotypic membrane interaction. Our results support the hypothesis that Chlamydia employs SNARE-like virulence factors that positively and negatively affect membrane fusion and promote infection.

  13. Transcriptomic Profiling and Functional Characterization of Fusion Genes in Recurrent Ovarian Cancer

    Science.gov (United States)

    2017-09-01

    late lesion (Figure 1A). 152 fusions were predicted to produce an in-frame, chimeric protein—48 being acquired in late disease and 55 being...recurrence, fusions of particular interest included an acquired WNT2-CTTNBP2 in case OVCA_04, which retained a Wnt signaling peptide in the N-terminal

  14. Dominant negative selection of vaccinia virus using a thymidine kinase/thymidylate kinase fusion gene and the prodrug azidothymidine

    International Nuclear Information System (INIS)

    Holzer, Georg W.; Mayrhofer, Josef; Gritschenberger, Werner; Falkner, Falko G.

    2005-01-01

    The Escherichia coli thymidine kinase/thymidylate kinase (tk/tmk) fusion gene encodes an enzyme that efficiently converts the prodrug 3'-azido-2',3'-dideoxythymidine (AZT) into its toxic triphosphate derivative, a substance which stops DNA chain elongation. Integration of this marker gene into vaccinia virus that normally is not inhibited by AZT allowed the establishment of a powerful selection procedure for recombinant viruses. In contrast to the conventional vaccinia thymidine kinase (tk) selection that is performed in tk-negative cell lines, AZT selection can be performed in normal (tk-positive) cell lines. The technique is especially useful for the generation of replication-deficient vaccinia viruses and may also be used for gene knock-out studies of essential vaccinia genes

  15. Characterization of foot-and-mouth disease virus gene products with antisera against bacterially synthesized fusion proteins

    International Nuclear Information System (INIS)

    Strebel, K.; Beck, E.; Strohmaier, K.; Schaller, H.

    1986-01-01

    Defined segments of the cloned foot-and-mouth disease virus genome corresponding to all parts of the coding region were expressed in Escherichia coli as fusions to the N-terminal part of the MS2-polymerase gene under the control of the inducible λPL promoter. All constructs yielded large amounts of proteins, which were purified and used to raise sequence-specific antisera in rabbits. These antisera were used to identify the corresponding viral gene products in 35 S-labeled extracts from foot-and-mouth disease virus-infected BHK cells. This allowed us to locate unequivocally all mature foot-and-mouth disease virus gene products in the nucleotide sequence, to identify precursor-product relationships, and to detect several foot-and mouth disease virus gene products not previously identified in vivo or in vitro

  16. [The Influence of New Medium with RGD on Cell Growth,Cell Fusion and Expression of Exogenous Gene].

    Science.gov (United States)

    Wang, Pei-Pei; Wei, Da-Peng; Zhu, Tong-Bo

    2018-03-01

    To investigate the influence of a new culture medium added with RGD on cell growth,cell fusion and expression of exogenous gene. A new medium was prepared by adding different concentrations of RGD to ordinary culture medium. The optimum concentration of RGD was determined by observation of the growth of human pancreatic epithelial cell line HPDE6-C7. After determining the optimum concentration of RGD,different concentrations of cells HPDE6-C7 (5×10 4 ,10 5 ,5×10 5 mL -1 ) were inoculated in the two mediums. The morphology,adherence,growth and density of the cells were observed by inverted microscope; The ratio of clone formation and the positive rate of cloning were compared between the two cultures after fusion; The fluorescence intensity after the transfection of plasmid with green fluorescent protein ( GFP ) and the protein expression after transfection of plasmid with KRAS were observed to campare the expression of exogenous genes between the new medium with ordinary medium. Firstly,the optimal concentration of RGD was 10 ng/mL. Compared with the normal medium,the cultured cells with RGD had better morphology,adhesion and faster proliferation. In addition,both of the number and positive rate of clones formed in the new medium were significantly higher than that in the ordinary medium ( P exogenous gene GFP in the new medium was significantly higher than that in normal medium ( P exogenous gene KRAS of the new medium was also significantly higher than that in normal medium. The new culture medium has highlighted advantages in cell growth,cell fusion and expression of exogenous genes. RGD peptide has widely prospect and potential value in the cell culture. Copyright© by Editorial Board of Journal of Sichuan University (Medical Science Edition).

  17. [Construction of eukaryotic recombinant vector and expression in COS7 cell of LipL32-HlyX fusion gene from Leptospira serovar Lai].

    Science.gov (United States)

    Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying

    2009-04-01

    This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.

  18. TMPRSS2-ERG gene fusion is not associated with outcome in patients treated by prostatectomy

    Science.gov (United States)

    Gopalan, Anuradha; Leversha, Margaret A.; Satagopan, Jaya M.; Zhou, Qin; Al-Ahmadie, Hikmat A.; Fine, Samson W.; Eastham, James A.; Scardino, Peter T.; Scher, Howard I.; Tickoo, Satish K.; Reuter, Victor E.; Gerald, William L.

    2009-01-01

    A significant number of prostate cancers have been shown to have recurrent chromosomal rearrangements resulting in the fusion of the androgen regulated TMPRSS2 promoter to a member of the ETS transcription factor family, most commonly ERG. This results in ERG overexpression which may have a direct causal role in prostate tumorigenesis or progression. However, the clinical significance of the rearrangement is unclear and, in particular, relationship to outcome has been inconsistent in recent reports. We analyzed TMPRSS2-ERG gene rearrangement status by fluorescence in situ hybridization (FISH) in 521 cases of clinically localized surgically treated prostate cancer with 95 months median follow-up and also in 40 unmatched metastases. 42% of primary tumors and 40% of metastases had rearrangements. 11% had copy number increase (CNI) of the TMPRRS2-ERG region. Rearrangement alone was associated with lower grade, but not with stage, biochemical recurrence, metastases or death. CNI with and without rearrangement was associated with high grade and advanced stage. Further, a subgroup of cancers with CNI and rearrangement by deletion, with two or more copies of the deleted locus, tended to be more clinically aggressive. DNA index assessment revealed that the majority of tumors with CNI of TMPRSS2-ERG had generalized aneuploidy/ tetraploidy in contrast to tumors without TMPRSS2-ERG CNI, which were predominantly diploid. We therefore conclude that translocation of TMPRSS2-ERG is not associated with outcome and the aggressive clinical features associated with CNI of chromosome 21 reflect generalized aneuploidy and are not due to CNI specifically of rearranged TMPRSS2-ERG. PMID:19190343

  19. Recent adaptive events in human brain revealed by meta-analysis of positively selected genes.

    Directory of Open Access Journals (Sweden)

    Yue Huang

    Full Text Available BACKGROUND AND OBJECTIVES: Analysis of positively-selected genes can help us understand how human evolved, especially the evolution of highly developed cognitive functions. However, previous works have reached conflicting conclusions regarding whether human neuronal genes are over-represented among genes under positive selection. METHODS AND RESULTS: We divided positively-selected genes into four groups according to the identification approaches, compiling a comprehensive list from 27 previous studies. We showed that genes that are highly expressed in the central nervous system are enriched in recent positive selection events in human history identified by intra-species genomic scan, especially in brain regions related to cognitive functions. This pattern holds when different datasets, parameters and analysis pipelines were used. Functional category enrichment analysis supported these findings, showing that synapse-related functions are enriched in genes under recent positive selection. In contrast, immune-related functions, for instance, are enriched in genes under ancient positive selection revealed by inter-species coding region comparison. We further demonstrated that most of these patterns still hold even after controlling for genomic characteristics that might bias genome-wide identification of positively-selected genes including gene length, gene density, GC composition, and intensity of negative selection. CONCLUSION: Our rigorous analysis resolved previous conflicting conclusions and revealed recent adaptation of human brain functions.

  20. Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene

    International Nuclear Information System (INIS)

    Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo

    2006-01-01

    In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains

  1. Association of a Chromosomal Rearrangement Event with Mouse Posterior Polymorphous Corneal Dystrophy and Alterations in Csrp2bp, Dzank1, and Ovol2 Gene Expression.

    Directory of Open Access Journals (Sweden)

    Anna L Shen

    Full Text Available We have previously described a mouse model of human posterior polymorphous corneal dystrophy (PPCD and localized the causative mutation to a 6.2 Mbp region of chromosome 2, termed Ppcd1. We now show that the gene rearrangement linked to mouse Ppcd1 is a 3.9 Mbp chromosomal inversion flanked by 81 Kbp and 542 bp deletions. This recombination event leads to deletion of Csrp2bp Exons 8 through 11, Dzank1 Exons 20 and 21, and the pseudogene Znf133. In addition, we identified translocation of novel downstream sequences to positions adjacent to Csrp2bp Exon 7 and Dzank1 Exon 20. Twelve novel fusion transcripts involving Csrp2bp or Dzank1 linked to downstream sequences have been identified. Eight are expressed at detectable levels in PPCD1 but not wildtype eyes. Upregulation of two Csrp2bp fusion transcripts, as well as upregulation of the adjacent gene, Ovol2, was observed. Absence of the PPCD1 phenotype in animals haploinsufficient for Csrp2bp or both Csrp2bp and Dzank1 rules out haploinsufficiency of these genes as a cause of mouse PPCD1. Complementation experiments confirm that PPCD1 embryonic lethality is due to disruption of Csrp2bp expression. The ocular expression pattern of Csrp2bp is consistent with a role for this protein in corneal development and pathogenesis of PPCD1.

  2. Expanding the molecular signature of ossifying fibromyxoid tumors with two novel gene fusions: CREBBP-BCORL1 and KDM2A-WWTR1.

    Science.gov (United States)

    Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R

    2017-01-01

    Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CREBBP-BCORL1 fusion candidate in an axillary mass of a 51 year-old male and a KDM2A-WWTR1 in a thigh mass of a 36 year-old male. The gene fusions were validated by RT-PCR and FISH in the index cases and then screened by FISH on 4 additional OFMTs lacking known fusions. An identical CREBBP-BCORL1 fusion was found in an elbow tumor from a 30 year-old male. Both OFMTs with CREBBP-BCORL1 fusions had areas of typical OFMT morphology, exhibiting uniform round to epithelioid cells arranged in cords or nesting pattern in a fibromyxoid stroma. The OFMT with KDM2A-WWTR1 fusion involved dermis and superficial subcutis, being composed of ovoid cells in a fibromyxoid background with hyalinized giant rosettes. The S100 immunoreactivity ranged from very focal to absent. Similar to other known fusion genes in OFMT, BCORL1, CREBBP and KDM2A are also involved in histone modification. In summary, we expand the spectrum of molecular abnormalities in OFMT with 2 novel fusions, CREBBP-BCORL1 and KDM2A-WWTR1, further implicating the epigenetic deregulation as the leading pathogenetic mechanism in OFMT. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. Expanding the Molecular Signature of Ossifying Fibromyxoid Tumors with 2 Novel Gene Fusions: CREBBP-BCORL1 and KDM2A-WWTR1

    Science.gov (United States)

    Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R.

    2017-01-01

    Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CREBBP-BCORL1 fusion candidate in an axillary mass of a 51 year-old male and a KDM2A-WWTR1 in a thigh mass of a 36 year-old male. The gene fusions were validated by RT-PCR and FISH in the index cases and then screened by FISH on 4 additional OFMTs lacking known fusions. An identical CREBBP-BCORL1 fusion was found in an elbow tumor from a 30 year-old male. Both OFMTs with CREBBP-BCORL1 fusions had areas of typical OFMT morphology, exhibiting uniform round to epithelioid cells arranged in cords or nesting pattern in a fibromyxoid stroma. The OFMT with KDM2A-WWTR1 fusion involved dermis and superficial subcutis, being composed of ovoid cells in a fibromyxoid background with hyalinized giant rosettes. The S100 immunoreactivity ranged from very focal to absent. Similar to other known fusion genes in OFMT, BCORL1, CREBBP and KDM2A are also involved in histone modification. In summary, we expand the spectrum of molecular abnormalities in OFMT with 2 novel fusions, CREBBP-BCORL1 and KDM2A-WWTR1, further implicating the epigenetic deregulation as the leading pathogenetic mechanism in OFMT. PMID:27537276

  4. Cell surface expression system for the display of heterologous gene products using chimeric flagellin fusions of bacillus halodurans isolate

    CSIR Research Space (South Africa)

    Du Plessis, A

    2006-10-01

    Full Text Available system for the display of heterologous gene products using chimeric flagellin fusions of a Bacillus halodurans isolate Slide 2 © CSIR 2006 www.csir.co.za Bacillus halodurans Alk 36 xrhombus Ability to over-produce cell... for functionality of the His-tag for metal binding. Slide 13 © CSIR 2006 www.csir.co.za PAGE gel showing over-production of chimeric poly-His flagellin proteins 66.2 kDa 45.0 kDa 31.0 kDa 1. LMW ladder 2. NC3 3. NHisC3 4. NC6 5...

  5. Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

    Science.gov (United States)

    Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

    2015-05-15

    Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

  6. Making memories of stressful events: a journey along epigenetic, gene transcription and signaling pathways

    Directory of Open Access Journals (Sweden)

    Johannes M.H.M. eReul

    2014-01-01

    Full Text Available Strong psychologically stressful events are known to have a long-lasting impact on behavior. The consolidation of such, largely adaptive, behavioral responses to stressful events involves changes in gene expression in limbic brain regions such as the hippocampus and amygdala. The underlying molecular mechanisms however were until recently unresolved. More than a decade ago we started to investigate the role of these hormones in signaling and epigenetic mechanisms participating in the effects of stress on gene transcription in hippocampal neurons. We discovered a novel, rapid non-genomic mechanism in which glucocorticoids via glucocorticoid receptors (GRs facilitate signaling of the ERK MAPK signaling pathway to the downstream nuclear kinases MSK1 and Elk-1 in dentate gyrus (DG granule neurons. Activation of this signaling pathway results in serine10 (S10 phosphorylation and lysine14 (K14 acetylation at histone H3 (H3S10p-K14ac, leading to the induction of the immediate early genes c-Fos and Egr-1. In addition, we found a role of the DNA methylation status of gene promoters. A series of studies showed that these molecular mechanisms play a critical role in the long-lasting consolidation of behavioral responses in the forced swim test and Morris water maze. Furthermore, an important role of GABA was found in controlling the epigenetic and gene transcriptional responses to psychological stress. Thus, psychologically stressful events evoke a long-term impact on behavior through changes in hippocampal function brought about by distinct glutamatergic and glucocorticoid-driven changes in epigenetic regulation of gene transcription which are modulated by (local GABAergic interneurons and limbic afferent inputs. These epigenetic processes may play an important role in the etiology of stress-related mental disorders such as major depressive and anxiety disorders like PTSD.

  7. Expanding the Molecular Signature of Ossifying Fibromyxoid Tumors with 2 Novel Gene Fusions: CREBBP-BCORL1 and KDM2A-WWTR1

    OpenAIRE

    Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R.

    2016-01-01

    Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CRE...

  8. Acute hypoxia stress induced abundant differential expression genes and alternative splicing events in heart of tilapia.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Li, Bi Jun; Gu, Xiao Hui; Lin, Hao Ran

    2018-01-10

    Hypoxia is one of the critical environmental stressors for fish in aquatic environments. Although accumulating evidences indicate that gene expression is regulated by hypoxia stress in fish, how genes undergoing differential gene expression and/or alternative splicing (AS) in response to hypoxia stress in heart are not well understood. Using RNA-seq, we surveyed and detected 289 differential expressed genes (DEG) and 103 genes that undergo differential usage of exons and splice junctions events (DUES) in heart of a hypoxia tolerant fish, Nile tilapia, Oreochromis niloticus following 12h hypoxic treatment. The spatio-temporal expression analysis validated the significant association of differential exon usages in two randomly selected DUES genes (fam162a and ndrg2) in 5 tissues (heart, liver, brain, gill and spleen) sampled at three time points (6h, 12h, and 24h) under acute hypoxia treatment. Functional analysis significantly associated the differential expressed genes with the categories related to energy conservation, protein synthesis and immune response. Different enrichment categories were found between the DEG and DUES dataset. The Isomerase activity, Oxidoreductase activity, Glycolysis and Oxidative stress process were significantly enriched for the DEG gene dataset, but the Structural constituent of ribosome and Structural molecule activity, Ribosomal protein and RNA binding protein were significantly enriched only for the DUES genes. Our comparative transcriptomic analysis reveals abundant stress responsive genes and their differential regulation function in the heart tissues of Nile tilapia under acute hypoxia stress. Our findings will facilitate future investigation on transcriptome complexity and AS regulation during hypoxia stress in fish. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. End-to-end gene fusions and their impact on the production of multifunctional biomass degrading enzymes

    International Nuclear Information System (INIS)

    Rizk, Mazen; Antranikian, Garabed; Elleuche, Skander

    2012-01-01

    Highlights: ► Multifunctional enzymes offer an interesting approach for biomass degradation. ► Size and conformation of separate constructs play a role in the effectiveness of chimeras. ► A connecting linker allows for maximal flexibility and increased thermostability. ► Genes with functional similarities are the best choice for fusion candidates. -- Abstract: The reduction of fossil fuels, coupled with its increase in price, has made the search for alternative energy resources more plausible. One of the topics gaining fast interest is the utilization of lignocellulose, the main component of plants. Its primary constituents, cellulose and hemicellulose, can be degraded by a series of enzymes present in microorganisms, into simple sugars, later used for bioethanol production. Thermophilic bacteria have proven to be an interesting source of enzymes required for hydrolysis since they can withstand high and denaturing temperatures, which are usually required for processes involving biomass degradation. However, the cost associated with the whole enzymatic process is staggering. A solution for cost effective and highly active production is through the construction of multifunctional enzyme complexes harboring the function of more than one enzyme needed for the hydrolysis process. There are various strategies for the degradation of complex biomass ranging from the regulation of the enzymes involved, to cellulosomes, and proteins harboring more than one enzymatic activity. In this review, the construction of multifunctional biomass degrading enzymes through end-to-end gene fusions, and its impact on production and activity by choosing the enzymes and linkers is assessed.

  10. Different sets of ER-resident J-proteins regulate distinct polar nuclear-membrane fusion events in Arabidopsis thaliana.

    Science.gov (United States)

    Maruyama, Daisuke; Yamamoto, Masaya; Endo, Toshiya; Nishikawa, Shuh-ichi

    2014-11-01

    Angiosperm female gametophytes contain a central cell with two polar nuclei. In many species, including Arabidopsis thaliana, the polar nuclei fuse during female gametogenesis. We previously showed that BiP, an Hsp70 in the endoplasmic reticulum (ER), was essential for membrane fusion during female gametogenesis. Hsp70 function requires partner proteins for full activity. J-domain containing proteins (J-proteins) are the major Hsp70 functional partners. A. thaliana ER contains three soluble J-proteins, AtERdj3A, AtERdj3B, and AtP58(IPK). Here, we analyzed mutants of these proteins and determined that double-mutant ovules lacking AtP58(IPK) and AtERdj3A or AtERdj3B were defective in polar nuclear fusion. Electron microscopy analysis identified that polar nuclei were in close contact, but no membrane fusion occurred in mutant ovules lacking AtP58(IPK) and AtERdj3A. The polar nuclear outer membrane appeared to be connected via the ER remaining at the inner unfused membrane in mutant ovules lacking AtP58(IPK) and AtERdj3B. These results indicate that ER-resident J-proteins, AtP58(IPK)/AtERdj3A and AtP58(IPK)/AtERdj3B, function at distinct steps of polar nuclear-membrane fusion. Similar to the bip1 bip2 double mutant female gametophytes, the aterdj3a atp58(ipk) double mutant female gametophytes defective in fusion of the outer polar nuclear membrane displayed aberrant endosperm proliferation after fertilization with wild-type pollen. However, endosperm proliferated normally after fertilization of the aterdj3b atp58(ipk) double mutant female gametophytes defective in fusion of the inner membrane. Our results indicate that the polar nuclear fusion defect itself does not cause an endosperm proliferation defect. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  11. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  12. A PTEN-COL17A1 fusion gene and its novel regulatory role in Collagen XVII expression and GBM malignance.

    Science.gov (United States)

    Yan, Xiaoyan; Zhang, Chuanbao; Liang, Tingyu; Yang, Fan; Wang, Haoyuan; Wu, Fan; Wang, Wen; Wang, Zheng; Cheng, Wen; Xu, Jiangnan; Jiang, Tao; Chen, Jing; Ding, Yaozhong

    2017-10-17

    Collagen XVII expression has recently been demonstrated to be correlated with the tumor malignance. While Collagen XVII is known to be widely distributed in neurons of the human brain, its precise role in pathogenesis of glioblastoma multiforme (GBM) is unknown. In this study, we identified and characterized a new PTEN-COL17A1 fusion gene in GMB using transcriptome sequencing. Although fusion gene did not result in measurable fusion protein production, its presence is accompanied with high levels of COL17A1 expression, revealed a novel regulatory mechanism of Collagen XVII expression by PTEN-COL17A1 gene fusion. Knocked down Collagen XVII expression in glioma cell lines resulted in decreased tumor invasiveness, along with significant reduction of MMP9 expression, while increased Collagen XVII expression promotes invasive activities of glioma cells and associated with GBM recurrences. Together, our results uncovered a new PTEN-COL17A1 fusion gene and its novel regulatory role in Collagen XVII expression and GBM malignance, and demonstrated that COL17A1 could serve as a useful prognostic biomarker and therapeutic targets for GBM.

  13. Conservation of transcription factor binding events predicts gene expression across species

    Science.gov (United States)

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661

  14. Gene-Tree Reconciliation with MUL-Trees to Resolve Polyploidy Events.

    Science.gov (United States)

    Gregg, W C Thomas; Ather, S Hussain; Hahn, Matthew W

    2017-11-01

    Polyploidy can have a huge impact on the evolution of species, and it is a common occurrence, especially in plants. The two types of polyploids-autopolyploids and allopolyploids-differ in the level of divergence between the genes that are brought together in the new polyploid lineage. Because allopolyploids are formed via hybridization, the homoeologous copies of genes within them are at least as divergent as orthologs in the parental species that came together to form them. This means that common methods for estimating the parental lineages of allopolyploidy events are not accurate, and can lead to incorrect inferences about the number of gene duplications and losses. Here, we have adapted an algorithm for topology-based gene-tree reconciliation to work with multi-labeled trees (MUL-trees). By definition, MUL-trees have some tips with identical labels, which makes them a natural representation of the genomes of polyploids. Using this new reconciliation algorithm we can: accurately place allopolyploidy events on a phylogeny, identify the parental lineages that hybridized to form allopolyploids, distinguish between allo-, auto-, and (in most cases) no polyploidy, and correctly count the number of duplications and losses in a set of gene trees. We validate our method using gene trees simulated with and without polyploidy, and revisit the history of polyploidy in data from the clades including both baker's yeast and bread wheat. Our re-analysis of the yeast data confirms the allopolyploid origin and parental lineages previously identified for this group. The method presented here should find wide use in the growing number of genomes from species with a history of polyploidy. [Polyploidy; reconciliation; whole-genome duplication.]. © The Author(s) 2017. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Translational coupling in Escherichia coli of a heterologous Bacillus subtilis-Escherichia coli gene fusion.

    OpenAIRE

    Zaghloul, T I; Doi, R H

    1986-01-01

    The efficient expression in Escherichia coli of the Tn9-derived chloramphenicol acetyltransferase (EC 2.3.1.28) gene fused distal to the promoter and N terminus of the Bacillus subtilis aprA gene was dependent on the initiation of translation from the ribosome-binding site in the aprA gene.

  16. Imaging of dihydrofolate reductase fusion gene expression in xenografts of human liver metastases of colorectal cancer in living rats

    Energy Technology Data Exchange (ETDEWEB)

    Mayer-Kuckuk, Philipp; Bertino, Joseph R.; Banerjee, Debabrata [Molecular Pharmacology and Therapeutics Program, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); The Cancer Institute of New Jersey, Robert Wood Johnson Medical School/UMDNJ, 195 Little Albany Street, NJ 08903, New Brunswick (United States); Doubrovin, Mikhail; Blasberg, Ronald; Tjuvajev, Juri Gelovani [Department of Neurooncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Gusani, Niraj J.; Fong, Yuman [Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Gade, Terence; Koutcher, Jason A. [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Balatoni, Julius; Finn, Ronald [Radiochemistry/Cyclotron Core Facility, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Akhurst, Tim; Larson, Steven [Nuclear Medicine Service, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

    2003-09-01

    Radionuclide imaging has been demonstrated to be feasible to monitor transgene expression in vivo. We hypothesized that a potential application of this technique is to non-invasively detect in deep tissue, such as cancer cells metastatic to the liver, a specific molecular response following systemic drug treatment. Utilizing human colon adenocarcinoma cells derived from a patient's liver lesion we first developed a nude rat xenograft model for colorectal cancer metastatic to the liver. Expression of a dihydrofolate reductase-herpes simplex virus 1 thymidine kinase fusion (DHFR-HSV1 TK) transgene in the hepatic tumors was monitored in individual animals using the tracer [{sup 124}I]2'-fluoro-2'-deoxy-5-iodouracil-{beta}-d-arabinofuranoside (FIAU) and a small animal micro positron emission tomograph (microPET), while groups of rats were imaged using the tracer [{sup 131}I]FIAU and a clinical gamma camera. Growth of the human metastatic colorectal cancer cells in the rat liver was detected using magnetic resonance imaging and confirmed by surgical inspection. Single as well as multiple lesions of different sizes and sites were observed in the liver of the animals. Next, using a subset of rats bearing hepatic tumors, which were retrovirally bulk transduced to express the DHFR-HSV1 TK transgene, we imaged the fusion protein expression in the hepatic tumor of living rats using the tracer [{sup 124}I]FIAU and a microPET. The observed deep tissue signals were highly specific for the tumors expressing the DHFR-HSV1 TK fusion protein compared with parental untransduced tumors and other tissues as determined by gamma counting of tissue samples. A subsequent study used the tracer [{sup 131}I]FIAU and a gamma camera to monitor two groups of transduced hepatic tumor-bearing rats. Prior to imaging, one group was treated with trimetrexate to exploit DHFR-mediated upregulation of the fusion gene product. Imaging in the living animal as well as subsequent gamma

  17. Fusion genes with ALK as recurrent partner in ependymoma-like gliomas

    DEFF Research Database (Denmark)

    Olsen, Thale Kristin; Panagopoulos, Ioannis; Meling, Torstein R

    2015-01-01

    , we identified the 2 first ever reported ALK rearrangements in CNS tumors. Such rearrangements may represent the hallmark of a new entity of pediatric glioma characterized by both ependymal and astrocytic features. Our findings are of particular importance because crizotinib, a selective ALK inhibitor......, has demonstrated effect in patients with lung cancer harboring ALK rearrangements. Thus, ALK emerges as an interesting therapeutic target in patients with ependymal tumors carrying ALK fusions....

  18. Large-scale event extraction from literature with multi-level gene normalization.

    Directory of Open Access Journals (Sweden)

    Sofie Van Landeghem

    Full Text Available Text mining for the life sciences aims to aid database curation, knowledge summarization and information retrieval through the automated processing of biomedical texts. To provide comprehensive coverage and enable full integration with existing biomolecular database records, it is crucial that text mining tools scale up to millions of articles and that their analyses can be unambiguously linked to information recorded in resources such as UniProt, KEGG, BioGRID and NCBI databases. In this study, we investigate how fully automated text mining of complex biomolecular events can be augmented with a normalization strategy that identifies biological concepts in text, mapping them to identifiers at varying levels of granularity, ranging from canonicalized symbols to unique gene and proteins and broad gene families. To this end, we have combined two state-of-the-art text mining components, previously evaluated on two community-wide challenges, and have extended and improved upon these methods by exploiting their complementary nature. Using these systems, we perform normalization and event extraction to create a large-scale resource that is publicly available, unique in semantic scope, and covers all 21.9 million PubMed abstracts and 460 thousand PubMed Central open access full-text articles. This dataset contains 40 million biomolecular events involving 76 million gene/protein mentions, linked to 122 thousand distinct genes from 5032 species across the full taxonomic tree. Detailed evaluations and analyses reveal promising results for application of this data in database and pathway curation efforts. The main software components used in this study are released under an open-source license. Further, the resulting dataset is freely accessible through a novel API, providing programmatic and customized access (http://www.evexdb.org/api/v001/. Finally, to allow for large-scale bioinformatic analyses, the entire resource is available for bulk download from

  19. Events

    Directory of Open Access Journals (Sweden)

    Igor V. Karyakin

    2016-02-01

    Full Text Available The 9th ARRCN Symposium 2015 was held during 21st–25th October 2015 at the Novotel Hotel, Chumphon, Thailand, one of the most favored travel destinations in Asia. The 10th ARRCN Symposium 2017 will be held during October 2017 in the Davao, Philippines. International Symposium on the Montagu's Harrier (Circus pygargus «The Montagu's Harrier in Europe. Status. Threats. Protection», organized by the environmental organization «Landesbund für Vogelschutz in Bayern e.V.» (LBV was held on November 20-22, 2015 in Germany. The location of this event was the city of Wurzburg in Bavaria.

  20. Diagnosis of extraskeletal myxoid chondrosarcoma in the thigh using EWSR1-NR4A3 gene fusion: a case report.

    Science.gov (United States)

    Kobayashi, Hiroki; Kikuta, Kazutaka; Sekita, Tetsuya; Susa, Michiro; Nishimoto, Kazumasa; Sasaki, Aya; Kameyama, Kaori; Sugita, Shintaro; Hasegawa, Tadashi; Nakamura, Masaya; Matsumoto, Morio; Morioka, Hideo

    2016-11-10

    Extraskeletal myxoid chondrosarcoma is a rare soft tissue sarcoma that has unusual ultrastructural and molecular features. However, unlike other soft tissue sarcomas, it does not have specific clinical symptoms or radiological features, which can make its diagnosis difficult. Nevertheless, extraskeletal myxoid chondrosarcoma has a rare gene fusion (EWSR1-NR4A3) that is useful for making a differential diagnosis. A 43-year-old Japanese man presented with a soft tissue mass in his right thigh. A physical examination and radiography revealed a large soft tissue mass. During magnetic resonance imaging, the mass exhibited isointensity on T1-weighted images and high intensity on T2-weighted images, as well as gadolinium enhancement at the side edge of the partition structure. Thus, we considered a possible diagnosis of a malignant myxoid soft tissue tumor, such as myxoid liposarcoma, myxofibrosarcoma, or metastatic carcinomas, including myoepithelial tumor and neuroendocrine tumor, and performed an incisional biopsy to make a definitive diagnosis. The pathological findings revealed a lobulated tumor with a myxoid structure and atypical spindle-shaped cells that created eosinophilic cord-like forms. Immunohistochemistry revealed that the tumor was positive for S-100 and negative for synaptophysin, chromogranin A, and pan keratin (AE1/AE3). The percentage of Ki-67 was 10 % in the hot spot area. Based on these clinicopathological findings, we initially considered the possibility of a myxoid liposarcoma, although we did not observe any lipoblasts. Therefore, we considered the possibility of an extraskeletal myxoid chondrosarcoma. As this tumor is very rare, we searched for the EWSR1-NR4A3 gene fusion using fluorescence in situ hybridization, which confirmed the diagnosis of extraskeletal myxoid chondrosarcoma. Positron emission tomography-computed tomography did not identify any obvious metastases, and we performed radical resection of our patient's vastus medialis and

  1. Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia

    Directory of Open Access Journals (Sweden)

    Berhanu Ayalew

    2010-08-01

    Full Text Available Abstract Background Newcastle disease (ND, caused by Newcastle disease virus (NDV, is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. Results The coding region of eleven NDV isolates fusion (F gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia, Ch/2000 (China, local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. Conclusions The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

  2. Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia.

    Science.gov (United States)

    Berhanu, Ayalew; Ideris, Aini; Omar, Abdul R; Bejo, Mohd Hair

    2010-08-08

    Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. The coding region of eleven NDV isolates fusion (F) gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN) gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia), Ch/2000 (China), local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

  3. Frequent gene conversion events between the X and Y homologous chromosomal regions in primates

    Directory of Open Access Journals (Sweden)

    Hirai Hirohisa

    2010-07-01

    Full Text Available Abstract Background Mammalian sex-chromosomes originated from a pair of autosomes. A step-wise cessation of recombination is necessary for the proper maintenance of sex-determination and, consequently, generates a four strata structure on the X chromosome. Each stratum shows a specific per-site nucleotide sequence difference (p-distance between the X and Y chromosomes, depending on the time of recombination arrest. Stratum 4 covers the distal half of the human X chromosome short arm and the p-distance of the stratum is ~10%, on average. However, a 100-kb region, which includes KALX and VCX, in the middle of stratum 4 shows a significantly lower p-distance (1-5%, suggesting frequent sequence exchanges or gene conversions between the X and Y chromosomes in humans. To examine the evolutionary mechanism for this low p-distance region, sequences of a corresponding region including KALX/Y from seven species of non-human primates were analyzed. Results Phylogenetic analysis of this low p-distance region in humans and non-human primate species revealed that gene conversion like events have taken place at least ten times after the divergence of New World monkeys and Catarrhini (i.e., Old World monkeys and hominoids. A KALY-converted KALX allele in white-handed gibbons also suggests a possible recent gene conversion between the X and Y chromosomes. In these primate sequences, the proximal boundary of this low p-distance region is located in a LINE element shared between the X and Y chromosomes, suggesting the involvement of this element in frequent gene conversions. Together with a palindrome on the Y chromosome, a segmental palindrome structure on the X chromosome at the distal boundary near VCX, in humans and chimpanzees, may mediate frequent sequence exchanges between X and Y chromosomes. Conclusion Gene conversion events between the X and Y homologous regions have been suggested, mainly in humans. Here, we found frequent gene conversions in the

  4. Morphogenesis in sea urchin embryos: linking cellular events to gene regulatory network states

    Science.gov (United States)

    Lyons, Deidre; Kaltenbach, Stacy; McClay, David R.

    2013-01-01

    Gastrulation in the sea urchin begins with ingression of the primary mesenchyme cells (PMCs) at the vegetal pole of the embryo. After entering the blastocoel the PMCs migrate, form a syncitium, and synthesize the skeleton of the embryo. Several hours after the PMCs ingress the vegetal plate buckles to initiate invagination of the archenteron. That morphogenetic process occurs in several steps. The non-skeletogenic cells produce the initial inbending of the vegetal plate. Endoderm cells then rearrange and extend the length of the gut across the blastocoel to a target near the animal pole. Finally, cells that will form part of the midgut and hindgut are added to complete gastrulation. Later, the stomodeum invaginates from the oral ectoderm and fuses with the foregut to complete the archenteron. In advance of, and during these morphogenetic events an increasingly complex gene regulatory network controls the specification and the cell biological events that conduct the gastrulation movements. PMID:23801438

  5. Identification of new alternative splice events in the TCIRG1 gene in different human tissues

    International Nuclear Information System (INIS)

    Smirnova, Anna S.; Morgun, Andrey; Shulzhenko, Natalia; Silva, Ismael D.C.G.; Gerbase-DeLima, Maria

    2005-01-01

    Two transcript variants (TV) of the T cell immune regulator gene 1 (TCIRG1) have already been characterized. TV1 encodes a subunit of the osteoclast vacuolar proton pump and TV2 encodes a T cell inhibitory receptor. Based on the search in dbEST, we validated by RT-PCR six new alternative splice events in TCIRG1 in most of the 28 human tissues studied. In addition, we observed that transcripts using the TV1 transcription start site and two splice forms previously described in a patient with infantile malignant osteopetrosis are also expressed in various tissues of healthy individuals. Studies of these nine splice forms in cytoplasmic RNA of peripheral blood mononuclear cells showed that at least six of them could be efficiently exported from the nucleus. Since various products with nearly ubiquitous tissue distribution are generated from TCIRG1, this gene may be involved in other processes besides immune response and bone resorption

  6. TALE-PvuII Fusion Proteins – Novel Tools for Gene Targeting

    Science.gov (United States)

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity. PMID:24349308

  7. TALE-PvuII fusion proteins--novel tools for gene targeting.

    Science.gov (United States)

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity.

  8. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  9. A fluorescence resonance energy transfer-based approach for investigating late endosome–lysosome retrograde fusion events

    Science.gov (United States)

    Kaufmann, A.M.; Goldman, S.D.B.; Krise, J.P.

    2009-01-01

    Traditionally, lysosomes have been considered to be a terminal endocytic compartment. Recent studies suggest that lysosomes are quite dynamic, being able to fuse with other late endocytic compartments as well as with the plasma membrane. Here we describe a quantitative fluorescence energy transfer (FRET)-based method for assessing rates of retrograde fusion between terminal lysosomes and late endosomes in living cells. Late endosomes were specifically labeled with 800-nm latex beads that were conjugated with streptavidin and Alexa Fluor 555 (FRET donor). Terminal lysosomes were specifically labeled with 10,000-MW dextran polymers conjugated with biotin and Alexa Fluor 647 (FRET acceptor). Following late endosome–lysosome fusion, the strong binding affinity between streptavidin and biotin brought the donor and acceptor fluorophore molecules into close proximity, thereby facilitating the appearance of a FRET emission signal. Because apparent size restrictions in the endocytic pathway do not permit endocytosed latex beads from reaching terminal lysosomes in an anterograde fashion, the appearance of the FRET signal is consistent with retrograde transport of lysosomal cargo back to late endosomes. We assessed the efficiency of this transport step in fibroblasts affected by different lysosome storage disorders—Niemann–Pick type C, mucolipidosis type IV, and Sandhoff’s disease, all of which have a similar lysosomal lipid accumulation phenotype. We report here, for the first time, that these disorders can be distinguished by their rate of transfer of lysosome cargos to late endosomes, and we discuss the implications of these findings for developing new therapeutic strategies. PMID:19109922

  10. A fluorescence resonance energy transfer-based approach for investigating late endosome-lysosome retrograde fusion events.

    Science.gov (United States)

    Kaufmann, A M; Goldman, S D B; Krise, J P

    2009-03-01

    Traditionally, lysosomes have been considered to be a terminal endocytic compartment. Recent studies suggest that lysosomes are quite dynamic, being able to fuse with other late endocytic compartments as well as with the plasma membrane. Here we describe a quantitative fluorescence energy transfer (FRET)-based method for assessing rates of retrograde fusion between terminal lysosomes and late endosomes in living cells. Late endosomes were specifically labeled with 800-nm latex beads that were conjugated with streptavidin and Alexa Fluor 555 (FRET donor). Terminal lysosomes were specifically labeled with 10,000-MW dextran polymers conjugated with biotin and Alexa Fluor 647 (FRET acceptor). Following late endosome-lysosome fusion, the strong binding affinity between streptavidin and biotin brought the donor and acceptor fluorophore molecules into close proximity, thereby facilitating the appearance of a FRET emission signal. Because apparent size restrictions in the endocytic pathway do not permit endocytosed latex beads from reaching terminal lysosomes in an anterograde fashion, the appearance of the FRET signal is consistent with retrograde transport of lysosomal cargo back to late endosomes. We assessed the efficiency of this transport step in fibroblasts affected by different lysosome storage disorders-Niemann-Pick type C, mucolipidosis type IV, and Sandhoff's disease, all of which have a similar lysosomal lipid accumulation phenotype. We report here, for the first time, that these disorders can be distinguished by their rate of transfer of lysosome cargos to late endosomes, and we discuss the implications of these findings for developing new therapeutic strategies.

  11. A novel type of EWS-CHOP fusion gene in myxoid liposarcoma

    International Nuclear Information System (INIS)

    Matsui, Yoshito; Ueda, Takafumi; Kubo, Takahiro; Hasegawa, Tadashi; Tomita, Yasuhiko; Okamoto, Mina; Myoui, Akira; Kakunaga, Shigeki; Yasui, Natsuo; Yoshikawa, Hideki

    2006-01-01

    The cytogenetic hallmark of myxoid type and round cell type liposarcoma consists of reciprocal translocation of t(12;16)(q13;p11) and t(12;22)(q13;q12), which results in fusion of TLS/FUS and CHOP, and EWS and CHOP, respectively. Nine structural variations of the TLS/FUS-CHOP chimeric transcript have been reported, however, only two types of EWS-CHOP have been described. We describe here a case of myxoid liposarcoma containing a novel EWS-CHOP chimeric transcript and identified the breakpoint occurring in intron 13 of EWS. Reverse transcription-polymerase chain reaction and direct sequence showed that exon 13 of EWS was in-frame fused to exon 2 of CHOP. Genomic analysis revealed that the breaks were located in intron 13 of EWS and intron 1 of CHOP

  12. Adverse events in families with hypertrophic or dilated cardiomyopathy and mutations in the MYBPC3 gene

    Directory of Open Access Journals (Sweden)

    Lehrke Stephanie

    2008-10-01

    Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.

  13. Enhancing potency of siRNA targeting fusion genes by optimization outside of target sequence.

    Science.gov (United States)

    Gavrilov, Kseniya; Seo, Young-Eun; Tietjen, Gregory T; Cui, Jiajia; Cheng, Christopher J; Saltzman, W Mark

    2015-12-01

    Canonical siRNA design algorithms have become remarkably effective at predicting favorable binding regions within a target mRNA, but in some cases (e.g., a fusion junction site) region choice is restricted. In these instances, alternative approaches are necessary to obtain a highly potent silencing molecule. Here we focus on strategies for rational optimization of two siRNAs that target the junction sites of fusion oncogenes BCR-ABL and TMPRSS2-ERG. We demonstrate that modifying the termini of these siRNAs with a terminal G-U wobble pair or a carefully selected pair of terminal asymmetry-enhancing mismatches can result in an increase in potency at low doses. Importantly, we observed that improvements in silencing at the mRNA level do not necessarily translate to reductions in protein level and/or cell death. Decline in protein level is also heavily influenced by targeted protein half-life, and delivery vehicle toxicity can confound measures of cell death due to silencing. Therefore, for BCR-ABL, which has a long protein half-life that is difficult to overcome using siRNA, we also developed a nontoxic transfection vector: poly(lactic-coglycolic acid) nanoparticles that release siRNA over many days. We show that this system can achieve effective killing of leukemic cells. These findings provide insights into the implications of siRNA sequence for potency and suggest strategies for the design of more effective therapeutic siRNA molecules. Furthermore, this work points to the importance of integrating studies of siRNA design and delivery, while heeding and addressing potential limitations such as restricted targetable mRNA regions, long protein half-lives, and nonspecific toxicities.

  14. Simulation of the fusion materials irradiation test facility lithium and heat transport systems for abnormal events study

    International Nuclear Information System (INIS)

    Carlson, W.F.; Elyashar, N.N.

    1981-01-01

    A digital computer model of Fusion Materials Irradiation Test Facility's heat transport system has been developed. The model utilizes a set of coupled differential equations to simulate the dynamic behavior of the primary and secondary heat transport loop systems. The model has been used to investigate the stability of the proposed control schemes for lithium temperature and flow rate and for an extensive study of equipment failures and malfunction analysis. It was determined that certain equipment failures and malfunctions in the primary loop require a response from the control system within less than one second of the occurrence of the failure. The effects of equipment failures in the secondary loop were found to be less dramatic than the equivalent failures in the primary loop. The failures in the secondary loop generally required control action in time frames of the order of minutes

  15. Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

    Science.gov (United States)

    Sandoval, V.; Barton, K.; Longhurst, A.

    2012-12-01

    Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

  16. A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma.

    Science.gov (United States)

    Söling, Ariane; Theiss, Christian; Jungmichel, Stephanie; Rainov, Nikolai G

    2004-08-04

    BACKGROUND: Suicide gene therapy employing the prodrug activating system Herpes simplex virus type 1 thymidine kinase (HSV-TK)/ ganciclovir (GCV) has proven to be effective in killing experimental brain tumors. In contrast, glioma patients treated with HSV-TK/ GCV did not show significant treatment benefit, most likely due to insufficient transgene delivery to tumor cells. Therefore, this study aimed at developing a strategy for real-time noninvasive in vivo monitoring of the activity of a therapeutic gene in brain tumor cells. METHODS: The HSV-TK gene was fused to the firefly luciferase (Luc) gene and the fusion construct HSV-TK-Luc was expressed in U87MG human malignant glioma cells. Nude mice with subcutaneous gliomas stably expressing HSV-TK-Luc were subjected to GCV treatment and tumor response to therapy was monitored in vivo by serial bioluminescence imaging. Bioluminescent signals over time were compared with tumor volumes determined by caliper. RESULTS: Transient and stable expression of the HSV-TK-Luc fusion protein in U87MG glioma cells demonstrated close correlation of both enzyme activities. Serial optical imaging of tumor bearing mice detected in all cases GCV induced death of tumor cells expressing the fusion protein and proved that bioluminescence can be reliably used for repetitive and noninvasive quantification of HSV-TK/ GCV mediated cell kill in vivo. CONCLUSION: This approach may represent a valuable tool for the in vivo evaluation of gene therapy strategies for treatment of malignant disease.

  17. Bioinformatic analysis of patient-derived ASPS gene expressions and ASPL-TFE3 fusion transcript levels identify potential therapeutic targets.

    Directory of Open Access Journals (Sweden)

    David G Covell

    Full Text Available Gene expression data, collected from ASPS tumors of seven different patients and from one immortalized ASPS cell line (ASPS-1, was analyzed jointly with patient ASPL-TFE3 (t(X;17(p11;q25 fusion transcript data to identify disease-specific pathways and their component genes. Data analysis of the pooled patient and ASPS-1 gene expression data, using conventional clustering methods, revealed a relatively small set of pathways and genes characterizing the biology of ASPS. These results could be largely recapitulated using only the gene expression data collected from patient tumor samples. The concordance between expression measures derived from ASPS-1 and both pooled and individual patient tumor data provided a rationale for extending the analysis to include patient ASPL-TFE3 fusion transcript data. A novel linear model was exploited to link gene expressions to fusion transcript data and used to identify a small set of ASPS-specific pathways and their gene expression. Cellular pathways that appear aberrantly regulated in response to the t(X;17(p11;q25 translocation include the cell cycle and cell adhesion. The identification of pathways and gene subsets characteristic of ASPS support current therapeutic strategies that target the FLT1 and MET, while also proposing additional targeting of genes found in pathways involved in the cell cycle (CHK1, cell adhesion (ARHGD1A, cell division (CDC6, control of meiosis (RAD51L3 and mitosis (BIRC5, and chemokine-related protein tyrosine kinase activity (CCL4.

  18. Transactivation of Ds by Ac-transposase gene fusions in tobacco

    NARCIS (Netherlands)

    Rommens, Caius M.T.; Haaren, Mark J.J. van; Buchel, Annemarie S.; Mol, Joseph N.M.; Tunen, Arjen J. van; Nijkamp, H. John J.; Hille, Jacques

    1992-01-01

    To study regulation of the (Ds) transposition process in heterologous plant species, the transposase gene of Ac was fused to several promoters that are active late during plant development. These promoters are the flower-specific chalcone synthase A promoter (CHS A), the anther-specific chalcone

  19. Novel cancer gene variants and gene fusions of triple-negative breast cancers (TNBCs) reveal their molecular diversity conserved in the patient-derived xenograft (PDX) model.

    Science.gov (United States)

    Jung, Jaeyun; Jang, Kiwon; Ju, Jung Min; Lee, Eunji; Lee, Jong Won; Kim, Hee Jung; Kim, Jisun; Lee, Sae Byul; Ko, Beom Seok; Son, Byung Ho; Lee, Hee Jin; Gong, Gyungyup; Ahn, Sei Yeon; Choi, Jung Kyoon; Singh, Shree Ram; Chang, Suhwan

    2018-04-20

    Despite the improved 5-year survival rate of breast cancer, triple-negative breast cancer (TNBC) remains a challenge due to lack of effective targeted therapy and higher recurrence and metastasis than other subtypes. To identify novel druggable targets and to understand its unique biology, we tried to implement 24 patient-derived xenografts (PDXs) of TNBC. The overall success rate of PDX implantation was 45%, much higher than estrogen receptor (ER)-positive cases. Immunohistochemical analysis revealed conserved ER/PR/Her2 negativity (with two exceptions) between the original and PDX tumors. Genomic analysis of 10 primary tumor-PDX pairs with Ion AmpliSeq CCP revealed high degree of variant conservation (85.0% to 96.9%) between primary and PDXs. Further analysis showed 44 rare variants with a predicted high impact in 36 genes including Trp53, Pten, Notch1, and Col1a1. Among them, we confirmed frequent Notch1 variant. Furthermore, RNA-seq analysis of 24 PDXs revealed 594 gene fusions, of which 163 were in-frame, including AZGP1-GJC3 and NF1-AARSD1. Finally, western blot analysis of oncogenic signaling proteins supporting molecular diversity of TNBC PDXs. Overall, our report provides a molecular basis for the usefulness of the TNBC PDX model in preclinical study. Copyright © 2018. Published by Elsevier B.V.

  20. MVA recombinants expressing the fusion and hemagglutinin genes of PPRV protects goats against virulent challenge.

    Science.gov (United States)

    Chandran, Dev; Reddy, Kolli Bhaktavatsala; Vijayan, Shahana Pallichera; Sugumar, Parthasarthy; Rani, Gudavalli Sudha; Kumar, Ponsekaran Santha; Rajendra, Lingala; Srinivasan, Villuppanoor Alwar

    2010-09-01

    Peste des Petits Ruminants (PPR) is a highly contagious animal disease caused by the Peste des Petits Ruminants virus (PPRV) belonging to the genus morbillivirus and family Paramyxoviridae. The disease results in high morbidity and mortality in goats, sheep and in some small wild ruminants. The presence of large number of small ruminants reared in endemic areas makes PPR a notorious disease threatening the livelihood of poor farmers. Conventional vaccination using a live, attenuated vaccine gives adequate protection but cannot be used in case of eradication of the disease due to difficulty in differentiation of infected animals from the vaccinated ones.In the present study, we constructed two recombinant viruses using attenuated Modified Vaccinia virus Ankara virus (MVA) namely MVA-F and MVA-H expressing the full length PPRV fusion (F) and hemagglutinin (H) glycoproteins, respectively. Goats were vaccinated intramuscularly with 105 plaque forming units (PFU) each of the recombinant viruses and a live attenuated vaccine (RAKSHA PPR) and challenged 4 months later with PPRV challenge virus (10(3) goat LD(50)). All goats were completely protected from the clinical disease. This study gave an indication that mass vaccination of small ruminants with either of the above or both recombinant inexpensive virus vaccines could help in possible eradication of PPRV from endemic countries like India and subsequent seromonitoring of the disease for differentiation of infected animals from vaccinated ones.

  1. A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin

    International Nuclear Information System (INIS)

    Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang; Liu, Yan-Hong; Li, Yan; Wang, Jia-Ye; Hattori, Toshio; Ling, Hong; Zhang, Feng-Min

    2010-01-01

    To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potential entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.

  2. Efficient Knock-in of a Point Mutation in Porcine Fibroblasts Using the CRISPR/Cas9-GMNN Fusion Gene.

    Science.gov (United States)

    Gerlach, Max; Kraft, Theresia; Brenner, Bernhard; Petersen, Björn; Niemann, Heiner; Montag, Judith

    2018-06-13

    During CRISPR/Cas9 mediated genome editing, site-specific double strand breaks are introduced and repaired either unspecific by non-homologous end joining (NHEJ) or sequence dependent by homology directed repair (HDR). Whereas NHEJ-based generation of gene knock-out is widely performed, the HDR-based knock-in of specific mutations remains a bottleneck. Especially in primary cell lines that are essential for the generation of cell culture and animal models of inherited human diseases, knock-in efficacy is insufficient and needs significant improvement. Here, we tested two different approaches to increase the knock-in frequency of a specific point mutation into the MYH7 -gene in porcine fetal fibroblasts. We added a small molecule inhibitor of NHEJ, SCR7 (5,6-bis((E)-benzylideneamino)-2-mercaptopyrimidin-4-ol), during genome editing and screened cell cultures for the point mutation. However, this approach did not yield increased knock-in rates. In an alternative approach, we fused humanized Cas9 (hCas9) to the N-terminal peptide of the Geminin gene ( GMNN ). The fusion protein is degraded in NHEJ-dominated cell cycle phases, which should increase HDR-rates. Using hCas9- GMNN and point mutation-specific real time PCR screening, we found a two-fold increase in genome edited cell cultures. This increase of HDR by hCas9- GMNN provides a promising way to enrich specific knock-in in porcine fibroblast cultures for somatic cloning approaches.

  3. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  4. Experimental verification of integrated pressure suppression systems in fusion reactors at in-vessel loss-of-coolant events

    International Nuclear Information System (INIS)

    Takase, K.; Akimoto, H.

    2001-01-01

    An integrated ICE (Ingress-of-Coolant Event) test facility was constructed to demonstrate that the ITER safety design approach and design parameters for the ICE events are adequate. Major objectives of the integrated ICE test facility are: to estimate the performance of an integrated pressure suppression system; to obtain the validation data for safety analysis codes; and to clarify the effects of two-phase pressure drop at a divertor and the direct-contact condensation in a suppression tank. A scaling factor between the test facility and ITER-FEAT is around 1/1600. The integrated ICE test facility simulates the ITER pressure suppression system and mainly consists of a plasma chamber, vacuum vessel, simulated divertor, relief pipe and suppression tank. From the experimental results it was found quantitatively that the ITER pressure suppression system is very effective to reduce the pressurization due to the ICE event. Furthermore, it was confirmed that the analytical results of the TRAC-PF1 code can simulate the experimental results with high accuracy. (author)

  5. CRISPR/Cas9 Engineering of Adult Mouse Liver Demonstrates That the Dnajb1–Prkaca Gene Fusion Is Sufficient to Induce Tumors Resembling Fibrolamellar Hepatocellular Carcinoma

    DEFF Research Database (Denmark)

    Engelholm, Lars H.; Riaz, Anjum; Serra, Denise

    2017-01-01

    Background & Aims Fibrolamellar hepatocellular carcinoma (FL-HCC) is a primary liver cancer that predominantly affects children and young adults with no underlying liver disease. A somatic, 400 Kb deletion on chromosome 19 that fuses part of the DnaJ heat shock protein family (Hsp40) member B1 gene...... (DNAJB1) to the protein kinase cAMP-activated catalytic subunit alpha gene (PRKACA) has been repeatedly identified in patients with FL-HCC. However, the DNAJB1–PRKACA gene fusion has not been shown to induce liver tumorigenesis. We used the CRISPR/Cas9 technique to delete in mice the syntenic region...... on chromosome 8 to create a Dnajb1–Prkaca fusion and monitored the mice for liver tumor development. Methods We delivered CRISPR/Cas9 vectors designed to juxtapose exon 1 of Dnajb1 with exon 2 of Prkaca to create the Dnajb1–Prkaca gene fusion associated with FL-HCC, or control Cas9 vector, via hydrodynamic tail...

  6. Aspirin exposure reveals novel genes associated with platelet function and cardiovascular events.

    Science.gov (United States)

    Voora, Deepak; Cyr, Derek; Lucas, Joseph; Chi, Jen-Tsan; Dungan, Jennifer; McCaffrey, Timothy A; Katz, Richard; Newby, L Kristin; Kraus, William E; Becker, Richard C; Ortel, Thomas L; Ginsburg, Geoffrey S

    2013-10-01

    The aim of this study was to develop ribonucleic acid (RNA) profiles that could serve as novel biomarkers for the response to aspirin. Aspirin reduces death and myocardial infarction (MI), suggesting that aspirin interacts with biological pathways that may underlie these events. Aspirin was administered, followed by whole-blood RNA microarray profiling, in a discovery cohort of healthy volunteers (HV1) (n = 50) and 2 validation cohorts of healthy volunteers (HV2) (n = 53) and outpatient cardiology patients (OPC) (n = 25). Platelet function was assessed using the platelet function score (PFS) in HV1 and HV2 and the VerifyNow Aspirin Test (Accumetrics, Inc., San Diego, California) in OPC. Bayesian sparse factor analysis identified sets of coexpressed transcripts, which were examined for associations with PFS in HV1 and validated in HV2 and OPC. Proteomic analysis confirmed the association of validated transcripts in platelet proteins. Validated gene sets were tested for association with death or MI in 2 patient cohorts (n = 587 total) from RNA samples collected at cardiac catheterization. A set of 60 coexpressed genes named the "aspirin response signature" (ARS) was associated with PFS in HV1 (r = -0.31, p = 0.03), HV2 (r = -0.34, Bonferroni p = 0.03), and OPC (p = 0.046). Corresponding proteins for the 17 ARS genes were identified in the platelet proteome, of which 6 were associated with PFS. The ARS was associated with death or MI in both patient cohorts (odds ratio: 1.2 [p = 0.01]; hazard ratio: 1.5 [p = 0.001]), independent of cardiovascular risk factors. Compared with traditional risk factors, reclassification (net reclassification index = 31% to 37%, p ≤ 0.0002) was improved by including the ARS or 1 of its genes, ITGA2B. RNA profiles of platelet-specific genes are novel biomarkers for identifying patients who do not respond adequately to aspirin and who are at risk for death or MI. Copyright © 2013 American College of Cardiology Foundation. Published by

  7. Renal cell carcinoma associated with Xp11.2 translocation/TFE gene fusion: imaging findings in 21 patients

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xiao; Zhou, Hao; Duan, Na; Liu, Yongkang; Wang, Zhongqiu [Affiliated Hospital of Nanjing University of Chinese Medicine, Department of Radiology, Nanjing (China); Zhu, Qingqiang [Medical School of Yangzhou University, Department of Medical Imaging, Subei People' s Hospital, Yangzhou (China); Li, Baoxin [Gulou Hospital, Department of Radiology, Nanjing (China); Cui, Wenjing [Affiliated Hospital of Nanjing University of Chinese Medicine, Department of Radiology, Nanjing (China); Nanjing University Medical School, Department of Radiology, Jinling Hospital, Nanjing (China); Kundra, Vikas [The University of Texas, M.D. Anderson Cancer Center, Department of Radiology, Houston, TX (United States)

    2017-02-15

    To characterize imaging features of renal cell carcinoma (RCC) associated with Xp11.2 translocation/TFE gene fusion. Twenty-one patients with Xp11.2/TFE RCC were retrospectively evaluated. Tumour location, size, density, cystic or solid appearance, calcification, capsule sign, enhancement pattern and metastases were assessed. Fourteen women and seven men were identified with 12 being 25 years old or younger. Tumours were solitary and cystic-solid (76.2 %) masses with a capsule (76.2 %); 90.5 % were located in the medulla. Calcifications and lymph node metastases were each observed in 24 %. On unenhanced CT, tumour attenuation was greater than in normal renal parenchyma (85.7 %). Tumour enhancement was less than in normal renal cortex on all enhanced phases, greater than in normal renal medulla on cortical and medullary phases, but less than in normal renal medulla on delayed phase. On MR, the tumours were isointense on T1WI, heterogeneously hypointense on T2WI and slightly hyperintense on diffusion-weighted imaging. Xp11.2/TFE RCC usually occurs in young women. It is a cystic-solid, hyperdense mass with a capsule. It arises from the renal medulla with enhancement less than in the cortex but greater than in the medulla in all phases except the delayed phase, when it is lower than in the medulla. (orig.)

  8. Novel real-time polymerase chain reaction assay for simultaneous detection of recurrent fusion genes in acute myeloid leukemia.

    Science.gov (United States)

    Dolz, Sandra; Barragán, Eva; Fuster, Óscar; Llop, Marta; Cervera, José; Such, Esperanza; De Juan, Inmaculada; Palanca, Sarai; Murria, Rosa; Bolufer, Pascual; Luna, Irene; Gómez, Inés; López, María; Ibáñez, Mariam; Sanz, Miguel A

    2013-09-01

    The recent World Health Organization classification recognizes different subtypes of acute myeloid leukemia (AML) according to the presence of several recurrent genetic abnormalities. Detection of these abnormalities and other molecular changes is of increasing interest because it contributes to a refined diagnosis and prognostic assessment in AML and enables monitoring of minimal residual disease. These genetic abnormalities can be detected using single RT-PCR, although the screening is still labor intensive and costly. We have developed a novel real-time RT-PCR assay to simultaneously detect 15 AML-associated rearrangements that is a simple and easily applicable method for use in clinical diagnostic laboratories. This method showed 100% specificity and sensitivity (95% confidence interval, 91% to 100% and 92% to 100%, respectively). The procedure was validated in a series of 105 patients with AML. The method confirmed all translocations detected using standard cytogenetics and fluorescence in situ hybridization and some additional undetected rearrangements. Two patients demonstrated two molecular rearrangements simultaneously, with BCR-ABL1 implicated in both, in addition to RUNX1-MECOM in one patient and PML-RARA in another. In conclusion, this novel real-time RT-PCR assay for simultaneous detection of multiple AML-associated fusion genes is a versatile and sensitive method for reliable screening of recurrent rearrangements in AML. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  9. A new microcolumn-type microchip for examining the expression of chimeric fusion genes using a nucleic acid sandwich hybridization technique.

    Science.gov (United States)

    Ohnishi, Michihiro; Sasaki, Naoyuki; Kishimoto, Takuya; Watanabe, Hidetoshi; Takagi, Masatoshi; Mizutani, Shuki; Kishii, Noriyuki; Yasuda, Akio

    2014-11-01

    We report a new type of microcolumn installed in a microchip. The architecture allows use of a nucleic acid sandwich hybridization technique to detect a messenger RNA (mRNA) chain as a target. Data are presented that demonstrate that the expression of a chimeric fusion gene can be detected. The microcolumn was filled with semi-transparent microbeads made of agarose gel that acted as carriers, allowing increased efficiency of the optical detection of fluorescence from the microcolumn. The hybrid between the target trapped on the microbeads and a probe DNA labeled with a fluorescent dye was detected by measuring the intensity of the fluorescence from the microcolumn directly. These results demonstrate an easy and simple method for determining the expression of chimeric fusion genes with no preamplification. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. FUSION TRANSCRIPTS OF BCR/ABL GENE IN PATIENTES WITH CHRONIC MYELOID LEUKEMIA

    OpenAIRE

    Artigas, Carmen Gloria; Melo, Angélica; Roa, Juan Carlos; Roa, Iván; Quijada, Ingrid; Vittini, Cecilia; Cabrera, María Elena; Risueño, Concepción

    2003-01-01

    La anormalidad citogenética más común en la leucemia mieloide crónica (LMC) es el cromosoma Philadelphia, producida por la t(9;22), cuya expresión molecular es el gen de fusión BCR-ABL, que codifica proteínas con actividad tirosinquinasa. Según el punto de ruptura de los genes BCR o ABL se produce una proteína de fusión de 210-kD(p210) o 190-kD(p190). La presencia de este gen de fusión en pacientes con LMC tiene implicancia diagnóstica. Con el propósito de detectar transcriptos de fusión del ...

  11. Gene expression profiling of low-grade endometrial stromal sarcoma indicates fusion protein-mediated activation of the Wnt signaling pathway.

    Science.gov (United States)

    Przybyl, Joanna; Kidzinski, Lukasz; Hastie, Trevor; Debiec-Rychter, Maria; Nusse, Roel; van de Rijn, Matt

    2018-05-01

    Low-grade endometrial stromal sarcomas (LGESS) harbor chromosomal translocations that affect proteins associated with chromatin remodeling Polycomb Repressive Complex 2 (PRC2), including SUZ12, PHF1 and EPC1. Roughly half of LGESS also demonstrate nuclear accumulation of β-catenin, which is a hallmark of Wnt signaling activation. However, the targets affected by the fusion proteins and the role of Wnt signaling in the pathogenesis of these tumors remain largely unknown. Here we report the results of a meta-analysis of three independent gene expression profiling studies on LGESS and immunohistochemical evaluation of nuclear expression of β-catenin and Lef1 in 112 uterine sarcoma specimens obtained from 20 LGESS and 89 LMS patients. Our results demonstrate that 143 out of 310 genes overexpressed in LGESS are known to be directly regulated by SUZ12. In addition, our gene expression meta-analysis shows activation of multiple genes implicated in Wnt signaling. We further emphasize the role of the Wnt signaling pathway by demonstrating concordant nuclear expression of β-catenin and Lef1 in 7/16 LGESS. Based on our findings, we suggest that LGESS-specific fusion proteins disrupt the repressive function of the PRC2 complex similar to the mechanism seen in synovial sarcoma, where the SS18-SSX fusion proteins disrupt the mSWI/SNF (BAF) chromatin remodeling complex. We propose that these fusion proteins in LGESS contribute to overexpression of Wnt ligands with subsequent activation of Wnt signaling pathway and formation of an active β-catenin/Lef1 transcriptional complex. These observations could lead to novel therapeutic approaches that focus on the Wnt pathway in LGESS. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Bone marrow mesenchymal stem cells from infants with MLL-AF4+ acute leukemia harbor and express the MLL-AF4 fusion gene

    Science.gov (United States)

    Catalina, Purificación; Rodríguez, René; Melen, Gustavo J.; Bueno, Clara; Arriero, Mar; García-Sánchez, Félix; Lassaletta, Alvaro; García-Sanz, Ramón

    2009-01-01

    MLL-AF4 fusion is a hallmark genetic abnormality in infant B-acute lymphoblastic leukemia (B-ALL) known to arise in utero. The cellular origin of leukemic fusion genes during human development is difficult to ascertain. The bone marrow (BM) microenvironment plays an important role in the pathogenesis of several hematological malignances. BM mesenchymal stem cells (BM-MSC) from 38 children diagnosed with cytogenetically different acute leukemias were screened for leukemic fusion genes. Fusion genes were absent in BM-MSCs of childhood leukemias carrying TEL-AML1, BCR-ABL, AML1-ETO, MLL-AF9, MLL-AF10, MLL-ENL or hyperdiploidy. However, MLL-AF4 was detected and expressed in BM-MSCs from all cases of MLL-AF4+ B-ALL. Unlike leukemic blasts, MLL-AF4+ BM-MSCs did not display monoclonal Ig gene rearrangements. Endogenous or ectopic expression of MLL-AF4 exerted no effect on MSC culture homeostasis. These findings suggest that MSCs may be in part tumor-related, highlighting an unrecognized role of the BM milieu on the pathogenesis of MLL-AF4+ B-ALL. MLL-AF4 itself is not sufficient for MSC transformation and the expression of MLL-AF4 in MSCs is compatible with a mesenchymal phenotype, suggesting a differential impact in the hematopoietic system and mesenchyme. The absence of monoclonal rearrangements in MLL-AF4+ BM-MSCs precludes the possibility of cellular plasticity or de-differentiation of B-ALL blasts and suggests that MLL-AF4 might arise in a population of prehematopoietic precursors. PMID:19995953

  13. Fundamental study of a water jet injected into a vacuum vessel of fusion reactor under the ingress of coolant event

    International Nuclear Information System (INIS)

    Takase, Kazuyuki; Kunugi, Tomoaki; Seki, Yasushi; Kurihara, Ryouichi; Ueda, Shuzou

    1996-01-01

    As one of some transient sequences for the thermofluid safety in ITER, pressure rise and boiling heat transfer characteristics in a Tokamak vacuum vessel during an ingress of coolant event (ICE) are being investigated experimentally by using the preliminary ICE apparatus. The pressure rise rates in the vacuum vessel and the wall temperature distributions on the target plate were measured quantitatively and clarified at first. In addition, a two-phase flow under the ICE conditions was analyzed numerically for predicting the experimental results using one-dimensional transport equations and the drift-flux model. The experimental results were compared with the numerical results. It was found that the pressurization behavior during the ICE conditions could be estimated qualitatively by the present numerical analyses. 5 refs., 5 figs

  14. The interaction of combined effects of the BDNF and PRKCG genes and negative life events in major depressive disorder.

    Science.gov (United States)

    Yang, Chunxia; Sun, Ning; Liu, Zhifen; Li, Xinrong; Xu, Yong; Zhang, Kerang

    2016-03-30

    Major depressive disorder (MDD) is a mental disorder that results from complex interplay between multiple and partially overlapping sets of susceptibility genes and environmental factors. The brain derived neurotrophic factor (BDNF) and Protein kinase C gamma type (PRKCG) are logical candidate genes in MDD. Among diverse environmental factors, negative life events have been suggested to exert a crucial impact on brain development. In the present study, we hypothesized that interactions between genetic variants in BDNF and PRKCG and negative life events may play an important role in the development of MDD. We recruited a total of 406 patients with MDD and 391 age- and gender-matched control subjects. Gene-environment interactions were analyzed using generalized multifactor dimensionality reduction (GMDR). Under a dominant model, we observed a significant three-way interaction among BDNF rs6265, PRKCG rs3745406, and negative life events. The gene-environment combination of PRKCG rs3745406 C allele, BDNF rs6265 G allele and high level of negative life events (C-G-HN) was significantly associated with MDD (OR, 5.97; 95% CI, 2.71-13.15). To our knowledge, this is the first report of evidence that the BDNF-PRKCG interaction may modify the relationship between negative life events and MDD in the Chinese population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Investigating effect of fusion gene therapy by MR diffusion-weighted imaging in a rat C6 glioma model

    International Nuclear Information System (INIS)

    Shen Huicong; Dai Jianping; Wei Xinhua; Wang Jianjiao; Li Shaowu; Ma Jun; Ai Lin; Liu Fengsheng; Chai Qi; Zhao Weijiang; Gao Peiyi

    2008-01-01

    Objective: To evaluate the use of diffusion-weighted imaging (DWI) for early detection of tumor response to Angiostatin-Endostatin (Statin-AE) fusion gene therapy in a rat C6 glioma model. Methods: Fifty male wistar rats with C6 tumor cells implanted into the striatum were examined by a 3.0T MR scanner, then the rats bearing tumors were divided into two groups, treatment group and control group. Rats in the treatment group received 107 plaque forming unit (pfu) recombinant herps simplex viral (R-HSV) mediated Statin-AE fusion gene therapy on day 7, and then the tumors were conformed on MRI. Conventional MR and DWI examination were acquired on 1, 2, 3 weeks after implantation with a 5-inch surface coil. Two (1 w), eight (2 w) and all the residual rats (3 w) of each group were sacrificed to perform the histopathological examination after each MRI examination. Pretreatment and post treatment tumor volumes and apparent diffusion coefficient (ADC) values were calculated. Bank sum test and t test were employed for statistical analysis. Results: On MRI, 43 rats demonstrated tumors on day 7 with a successful rate of 86%. On week 2, the tumor volumes of the controls and treatment group were 90. 6 and 91.64 mm 3 , with no significant difference (Z=-0.14, P>0.05). On week 3, the tumor volumes of the controls and treatment group were 156.64 and 29.64 mm 3 , and a significant difference was observed (Z=-3.45, P -3 and (0.99 ± 0.08) x 10 -3 mm 2 /s, and the values of the tumor peripheral parts of the two groups were (1.00 ± 0.25) x 10 -3 and (0.83 ± 0.12) x 10 -3 mm 2 /s, the ADC values of both tumor centers and peripheral parts of the treatment group were significantly higher than those of the control group (t=-0.82 and -0.46, P -3 and (0.99 ± 0.09) x 10 -3 mm 2 /s, and the values of the tumor peripheral parts of the two groups were (0.81±0.19) x 10 -3 and (0.78±0.11) x 10 -3 mm 2 /s, there were no statistical difference between the two groups (t=0.82, and -0.46, P<0

  16. Superficial EWSR1-negative undifferentiated small round cell sarcoma with CIC/DUX4 gene fusion: a new variant of Ewing-like tumors with locoregional lymph node metastasis.

    Science.gov (United States)

    Machado, Isidro; Cruz, Julia; Lavernia, Javier; Rubio, Luis; Campos, Jorge; Barrios, María; Grison, Camille; Chene, Virginie; Pierron, Gaelle; Delattre, Olivier; Llombart-Bosch, Antonio

    2013-12-01

    The present study describes a new case of EWSR1-negative undifferentiated sarcoma with CIC/DUX4 gene fusion. This case is similar to tumors described as primitive undifferentiated round cell sarcomas that occur mainly in the trunk and display an aggressive behavior. To our knowledge, this is the first report of such a tumor presenting locoregional lymph node metastasis. In view of previous studies that prove the existence of a particular variant of undifferentiated sarcoma with Ewing-like morphology and CIC/DUX-4 gene fusion, a search for this gene fusion in all undifferentiated round cell sarcomas should be considered if a conclusive diagnosis cannot be reached following other conventional studies. Although additional cases with more extensive follow-up studies are needed, we believe that EWSR1-negative undifferentiated small round cell sarcoma with CIC/DUX4 gene fusion should be added to the list of new sarcoma variants with the possibility of lymph node metastasis.

  17. Nuclear topography and expression of the BCR/ABL fusion gene and its protein level influenced by cell differentiation and RNA interference

    Czech Academy of Sciences Publication Activity Database

    Bártová, Eva; Harničarová, Andrea; Pacherník, Jiří; Kozubek, Stanislav

    2005-01-01

    Roč. 29, č. 8 (2005), s. 901-913 ISSN 0145-2126 R&D Projects: GA AV ČR(CZ) 1QS500040508; GA ČR(CZ) GA202/04/0907; GA MZd NC6987; GA AV ČR(CZ) IAA5004306; GA MŠk(CZ) LC535 Institutional research plan: CEZ:AV0Z50040507 Keywords : BCR /ABL fusion gene * chromatin arrangement * gene expression Subject RIV: BO - Biophysics Impact factor: 2.372, year: 2005

  18. DNA methyl transferase (DNMT gene polymorphisms could be a primary event in epigenetic susceptibility to schizophrenia.

    Directory of Open Access Journals (Sweden)

    Koramannil Radha Saradalekshmi

    Full Text Available DNA methylation has been implicated in the etiopathology of various complex disorders. DNA methyltransferases are involved in maintaining and establishing new methylation patterns. The aim of the present study was to investigate the inherent genetic variations within DNA methyltransferase genes in predisposing to susceptibility to schizophrenia. We screened for polymorphisms in DNA methyltransferases, DNMT1, DNMT3A, DNMT3B and DNMT3L in 330 schizophrenia patients and 302 healthy controls for association with Schizophrenia in south Indian population. These polymorphisms were also tested for subgroup analysis with patient's gender, age of onset and family history. DNMT1 rs2114724 (genotype P = .004, allele P = 0.022 and rs2228611 (genotype P = 0.004, allele P = 0.022 were found to be significantly associated at genotypic and allelic level with Schizophrenia in South Indian population. DNMT3B rs2424932 genotype (P = 0.023 and allele (P = 0.0063 increased the risk of developing schizophrenia in males but not in females. DNMT3B rs1569686 (genotype P = 0.027, allele P = 0.033 was found to be associated with early onset of schizophrenia and also with family history and early onset (genotype P = 0.009. DNMT3L rs2070565 (genotype P = 0.007, allele P = 0.0026 confers an increased risk of developing schizophrenia at an early age in individuals with family history. In-silico prediction indicated functional relevance of these SNPs in regulating the gene. These observations might be crucial in addressing and understanding the genetic control of methylation level differences from ethnic viewpoint. Functional significance of genotype variations within the DNMTs indeed suggest that the genetic nature of methyltransferases should be considered while addressing epigenetic events mediated by methylation in Schizophrenia.

  19. [Construction and application of prokaryotic expression system of Leptospira interrogans lipL32/1-lipL41/1 fusion gene].

    Science.gov (United States)

    Luo, Dong-jiao; Yan, Jie; Mao, Ya-fei; Li, Shu-ping; Luo, Yi-hui; Li, Li-wei

    2005-01-01

    To construct lipL32/1-lipL41/1 fusion gene and its prokaryotic expression system and to determine frequencies of carrying and expression of lipL32 and lipL41 genes in L.interrogans wild strains and specific antibody levels in sera from leptospirosis patients. lipL32/1-lipL41/1 fusion gene was constructed using linking primer PCR method and the prokaryotic expression system of the fusion gene done with routine techniques. SDS-PAGE was used to examine expression of the target recombinant protein rLipL32/1-rLipL41/1. Immunogenicity of rLipL32/1-rLipL41/1 was identified by Western blot. PCR and MAT were performed to detect carrying and expression of lipL32 and lipL41 genes in 97 wild L.interrogans strains. Antibodies against products of lipL32 and lipL41 genes in serum samples from 228 leptospirosis patients were detected by ELISA method. The homogeneity of nucleotide and putative amino acid sequence of lipL32/1-lipL41/1 fusion gene were 99.9 % and 99.8 % in comparison with the reported sequences. Expression output of the target recombinant protein rLipL32/1-rLipL41/1, mainly present in inclusion body, accounted for 10 % of the total bacterial proteins. Both the rabbit antisera against rLipL32/1 and rLipL41/1 could combine to rLipL32/1-rLipL41/1. 97.9 % and 87.6 % of the L.interrogans wild strains had lipL32 and lipL41 genes, respectively. 95.9 % and 84.5 % of the wild strains were positive for MAT with titers of 1:4 - 1:128 using rabbit anti-rLipL32s or anti-rLipL41s sera, respectively. 94.7 % - 97.4 % of the patients'serum samples were positive for rLipL32s antibodies, while 78.5 % - 84.6 % of them were rLipL41s antibodies detectable. lipL32/1-jlipL41/1 fusion gene and its prokaryotic expression system were successfully constructed. The expressed fusion protein had qualified immunogenicity. Both the lipL32 and lipL41 genes are extensively carried and frequently expressed by different serogroups of L.interrogans, and their expression products exhibit cross-antigenicity.

  20. In Silico Prediction of Horizontal Gene Transfer Events in Lactobacillus bulgaricus and Streptococcus thermophilus Reveals Protocooperation in Yogurt Manufacturing▿ †

    Science.gov (United States)

    Liu, Mengjin; Siezen, Roland J.; Nauta, Arjen

    2009-01-01

    Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions. PMID:19395564

  1. In silico prediction of horizontal gene transfer events in Lactobacillus bulgaricus and Streptococcus thermophilus reveals protocooperation in yogurt manufacturing.

    Science.gov (United States)

    Liu, Mengjin; Siezen, Roland J; Nauta, Arjen

    2009-06-01

    Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions.

  2. Pandemic H1N1 influenza A directly induces a robust and acute inflammatory gene signature in primary human bronchial epithelial cells downstream of membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Paquette, Stéphane G. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Institute of Medical Science, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada); Banner, David [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Chi, Le Thi Bao [Department of Microbiology, Hue University of Medicine and Pharmacy, Thua Thien Hue (Viet Nam); Carlo Urbani Centre, Hue University of Medicine and Pharmacy, Thua Thien Hue (Viet Nam); Leon, Alberto J. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); International Institute of Infection and Immunity, Shantou University Medical College, Shantou, Guangdong (China); Xu, Luoling; Ran, Longsi [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Huang, Stephen S.H. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Department of Immunology, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada); Farooqui, Amber [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); International Institute of Infection and Immunity, Shantou University Medical College, Shantou, Guangdong (China); and others

    2014-01-05

    Pandemic H1N1 influenza A (H1N1pdm) elicits stronger pulmonary inflammation than previously circulating seasonal H1N1 influenza A (sH1N1), yet mechanisms of inflammatory activation in respiratory epithelial cells during H1N1pdm infection are unclear. We investigated host responses to H1N1pdm/sH1N1 infection and virus entry mechanisms in primary human bronchial epithelial cells in vitro. H1N1pdm infection rapidly initiated a robust inflammatory gene signature (3 h post-infection) not elicited by sH1N1 infection. Protein secretion inhibition had no effect on gene induction. Infection with membrane fusion deficient H1N1pdm failed to induce robust inflammatory gene expression which was rescued with restoration of fusion ability, suggesting H1N1pdm directly triggered the inflammatory signature downstream of membrane fusion. Investigation of intra-virion components revealed H1N1pdm viral RNA (vRNA) triggered a stronger inflammatory phenotype than sH1N1 vRNA. Thus, our study is first to report H1N1pdm induces greater inflammatory gene expression than sH1N1 in vitro due to direct virus–epithelial cell interaction. - Highlights: • We investigated H1N1pdm/sH1N1 infection in primary epithelial cells. • H1N1pdm directly initiated a robust inflammatory gene signature, sH1N1 did not. • H1N1pdm viral RNA triggered a stronger response than sH1N1. • H1N1pdm induces greater response due to direct virus–cell interaction. • These results have potential to impact vaccine and therapeutic development.

  3. Pandemic H1N1 influenza A directly induces a robust and acute inflammatory gene signature in primary human bronchial epithelial cells downstream of membrane fusion

    International Nuclear Information System (INIS)

    Paquette, Stéphane G.; Banner, David; Chi, Le Thi Bao; Leon, Alberto J.; Xu, Luoling; Ran, Longsi; Huang, Stephen S.H.; Farooqui, Amber

    2014-01-01

    Pandemic H1N1 influenza A (H1N1pdm) elicits stronger pulmonary inflammation than previously circulating seasonal H1N1 influenza A (sH1N1), yet mechanisms of inflammatory activation in respiratory epithelial cells during H1N1pdm infection are unclear. We investigated host responses to H1N1pdm/sH1N1 infection and virus entry mechanisms in primary human bronchial epithelial cells in vitro. H1N1pdm infection rapidly initiated a robust inflammatory gene signature (3 h post-infection) not elicited by sH1N1 infection. Protein secretion inhibition had no effect on gene induction. Infection with membrane fusion deficient H1N1pdm failed to induce robust inflammatory gene expression which was rescued with restoration of fusion ability, suggesting H1N1pdm directly triggered the inflammatory signature downstream of membrane fusion. Investigation of intra-virion components revealed H1N1pdm viral RNA (vRNA) triggered a stronger inflammatory phenotype than sH1N1 vRNA. Thus, our study is first to report H1N1pdm induces greater inflammatory gene expression than sH1N1 in vitro due to direct virus–epithelial cell interaction. - Highlights: • We investigated H1N1pdm/sH1N1 infection in primary epithelial cells. • H1N1pdm directly initiated a robust inflammatory gene signature, sH1N1 did not. • H1N1pdm viral RNA triggered a stronger response than sH1N1. • H1N1pdm induces greater response due to direct virus–cell interaction. • These results have potential to impact vaccine and therapeutic development

  4. Fusion of Nonionic Vesicles

    DEFF Research Database (Denmark)

    Bulut, Sanja; Oskolkova, M. Z.; Schweins, R.

    2010-01-01

    We present an experimental study of vesicle fusion using light and neutron scattering to monitor fusion events. Vesicles are reproducibly formed with an extrusion procedure using an single amphiphile triethylene glycol mono-n-decyl ether in water. They show long-term stability for temperatures ar...... a barrier to fusion changing from 15 k(B)T at T = 26 degrees C to 10k(H) T at T = 35 degrees C. These results are compatible with the theoretical predictions using the stalk model of vesicle fusion....

  5. Interaction between serotonin transporter gene variants and life events predicts response to antidepressants in the GENDEP project

    DEFF Research Database (Denmark)

    Keers, R.; Uher, R.; Huezo-Diaz, P.

    2011-01-01

    , and several polymorphisms in the serotonin transporter gene (SLC6A4) have been genotyped including the serotonin transporter-linked polymorphic region (5-HTTLPR). Stressful life events were shown to predict a significantly better response to escitalopram but had no effect on response to nortriptyline...

  6. Fusion energy

    International Nuclear Information System (INIS)

    Gross, R.A.

    1984-01-01

    This textbook covers the physics and technology upon which future fusion power reactors will be based. It reviews the history of fusion, reaction physics, plasma physics, heating, and confinement. Descriptions of commercial plants and design concepts are included. Topics covered include: fusion reactions and fuel resources; reaction rates; ignition, and confinement; basic plasma directory; Tokamak confinement physics; fusion technology; STARFIRE: A commercial Tokamak fusion power plant. MARS: A tandem-mirror fusion power plant; and other fusion reactor concepts

  7. Horizontal transmission of malignancy: in-vivo fusion of human lymphomas with hamster stroma produces tumors retaining human genes and lymphoid pathology.

    Directory of Open Access Journals (Sweden)

    David M Goldenberg

    Full Text Available We report the in-vivo fusion of two Hodgkin lymphomas with golden hamster cheek pouch cells, resulting in serially-transplanted (over 5-6 years GW-532 and GW-584 heterosynkaryon tumor cells displaying both human and hamster DNA (by FISH, lymphoma-like morphology, aggressive metastasis, and retention of 7 human genes (CD74, CXCR4, CD19, CD20, CD71, CD79b, and VIM out of 24 tested by PCR. The prevalence of B-cell restricted genes (CD19, CD20, and CD79b suggests that this uniform population may be the clonal initiating (malignant cells of Hodgkin lymphoma, despite their not showing translation to their respective proteins by immunohistochemical analysis. This is believed to be the first report of in-vivo cell-cell fusion of human lymphoma and rodent host cells, and may be a method to disclose genes regulating both organoid and metastasis signatures, suggesting that the horizontal transfer of tumor DNA to adjacent stromal cells may be implicated in tumor heterogeneity and progression. The B-cell gene signature of the hybrid xenografts suggests that Hodgkin lymphoma, or its initiating cells, is a B-cell malignancy.

  8. Laser fusion

    International Nuclear Information System (INIS)

    Eliezer, S.

    1982-02-01

    In this paper, the physics of laser fusion is described on an elementary level. The irradiated matter consists of a dense inner core surrounded by a less dense plasma corona. The laser radiation is mainly absorbed in the outer periphery of the plasma. The absorbed energy is transported inward to the ablation surface where plasma flow is created. Due to this plasma flow, a sequence of inward going shock waves and heat waves are created, resulting in the compression and heating of the core to high density and temperature. The interaction physics between laser and matter leading to thermonuclear burn is summarized by the following sequence of events: Laser absorption → Energy transport → Compression → Nuclear Fusion. This scenario is shown in particular for a Nd:laser with a wavelength of 1 μm. The wavelength scaling of the physical processes is also discussed. In addition to the laser-plasma physics, the Nd high power pulsed laser is described. We give a very brief description of the oscillator, the amplifiers, the spatial filters, the isolators and the diagnostics involved. Last, but not least, the concept of reactors for laser fusion and the necessary laser system are discussed. (author)

  9. Differential transactivation by orphan nuclear receptor NOR1 and its fusion gene product EWS/NOR1: possible involvement of poly(ADP-ribose) polymerase I, PARP-1.

    Science.gov (United States)

    Ohkura, Naganari; Nagamura, Yuko; Tsukada, Toshihiko

    2008-10-15

    In extraskeletal myxoid chondrosarcoma, a chromosomal translocation creates a gene fusion between EWS and an orphan nuclear receptor, NOR1. The resulting fusion protein EWS/NOR1 has been believed to lead to malignant transformation by functioning as a transactivator for NOR1-target genes. By comparing the gene expression profiles of NOR1- and EWS/NOR1-overexpressing cells, we found that they largely shared up-regulated genes, but no significant correlation was observed with respect to the transactivation levels of each gene. In addition, the proteins associated with NOR1 and EWS/NOR1 were mostly the same in these cells. The results suggest that these proteins differentially transactivate overlapping target genes through a similar transcriptional machinery. To clarify the mechanisms underlying the transcriptional divergence between NOR1 and EWS/NOR1, we searched for alternatively associated proteins, and identified poly(ADP-ribose) polymerase I (PARP-1) as an NOR1-specific binding protein. Consistent with its binding properties, PARP-1 acted as a transcriptional repressor of NOR1, but not EWS/NOR1, in a luciferase reporter assay employing PARP-1(-/-) fibroblasts. Interestingly, suppressive activity of PARP-1 was observed in a DNA response element-specific manner, and in a subtype-specific manner toward the NR4A family (Nur77, Nurr1, and NOR1), suggesting that PARP-1 plays a role in the diversity of transcriptional regulation mediated by the NR4A family in normal cells. Altogether, our findings suggest that NOR1 and EWS/NOR1 regulate overlapping target genes differently by utilizing associated proteins, including PARP-1; and that EWS/NOR1 may acquire oncogenic activities by avoiding (or gaining) transcription factor-specific modulation by the associated proteins. (c) 2008 Wiley-Liss, Inc.

  10. RNA-seq of 272 gliomas revealed a novel, recurrent PTPRZ1-MET fusion transcript in secondary glioblastomas.

    Science.gov (United States)

    Bao, Zhao-Shi; Chen, Hui-Min; Yang, Ming-Yu; Zhang, Chuan-Bao; Yu, Kai; Ye, Wan-Lu; Hu, Bo-Qiang; Yan, Wei; Zhang, Wei; Akers, Johnny; Ramakrishnan, Valya; Li, Jie; Carter, Bob; Liu, Yan-Wei; Hu, Hui-Min; Wang, Zheng; Li, Ming-Yang; Yao, Kun; Qiu, Xiao-Guang; Kang, Chun-Sheng; You, Yong-Ping; Fan, Xiao-Long; Song, Wei Sonya; Li, Rui-Qiang; Su, Xiao-Dong; Chen, Clark C; Jiang, Tao

    2014-11-01

    Studies of gene rearrangements and the consequent oncogenic fusion proteins have laid the foundation for targeted cancer therapy. To identify oncogenic fusions associated with glioma progression, we catalogued fusion transcripts by RNA-seq of 272 gliomas. Fusion transcripts were more frequently found in high-grade gliomas, in the classical subtype of gliomas, and in gliomas treated with radiation/temozolomide. Sixty-seven in-frame fusion transcripts were identified, including three recurrent fusion transcripts: FGFR3-TACC3, RNF213-SLC26A11, and PTPRZ1-MET (ZM). Interestingly, the ZM fusion was found only in grade III astrocytomas (1/13; 7.7%) or secondary GBMs (sGBMs, 3/20; 15.0%). In an independent cohort of sGBMs, the ZM fusion was found in three of 20 (15%) specimens. Genomic analysis revealed that the fusion arose from translocation events involving introns 3 or 8 of PTPRZ and intron 1 of MET. ZM fusion transcripts were found in GBMs irrespective of isocitrate dehydrogenase 1 (IDH1) mutation status. sGBMs harboring ZM fusion showed higher expression of genes required for PIK3CA signaling and lowered expression of genes that suppressed RB1 or TP53 function. Expression of the ZM fusion was mutually exclusive with EGFR overexpression in sGBMs. Exogenous expression of the ZM fusion in the U87MG glioblastoma line enhanced cell migration and invasion. Clinically, patients afflicted with ZM fusion harboring glioblastomas survived poorly relative to those afflicted with non-ZM-harboring sGBMs (P < 0.001). Our study profiles the shifting RNA landscape of gliomas during progression and reveled ZM as a novel, recurrent fusion transcript in sGBMs. © 2014 Bao et al.; Published by Cold Spring Harbor Laboratory Press.

  11. Trans-activation function of a 3' truncated X gene-cell fusion product from integrated hepatitis B virus DNA in chronic hepatitis tissues

    International Nuclear Information System (INIS)

    Takada, Shinako; Koike, Katsuro

    1990-01-01

    To investigate the expression and transactivation function of the X gene in integrated hepatitis B virus (HBV) DNA from chronic hepatitis tissues, a series of transfectants containing cloned integrated HBV DNAs was made and analyzed for X mRNA expression and trans-activation activity by using a chloramphenicol acetyltransferase assay. Most of the integrated HBV DNAs expressed X mRNA and encoded a product with trans-activation activity in spite of the loss of the 3' end region of the X gene due to integration. From cDNA cloning and sequence analysis of X mRNA transcribed from native or integrated HBV DNA, the X protein was found to be translated from the X open reading frame without splicing. For integrated HBV DNA, transcription was extended to a cellular flanking DNA and an X gene-cell fusion transcript was terminated by using a cellular poly(A) signal. The amino acid sequence deduced from an X-cell fusion transcript indicated truncation of the carboxyl-terminal five amino acids, but the upstream region of seven amino acids conserved among hepadnaviruses was retained in the integrated HBV DNA, suggesting that this conserved region is essential for the transactivation function of the X protein. These findings support the following explanation for hepatocarcinogenesis by HBV DNA integration: the expression of a cellular oncogene(s) is transactivated at the time of chronic infection by the increasing amounts of the integrated HBV gene product(s), such as the X-cell fusion product

  12. Characterization of a Cellulomonas fimi exoglucanase/xylanase-endoglucanase gene fusion which improves microbial degradation of cellulosic biomass.

    Science.gov (United States)

    Duedu, Kwabena O; French, Christopher E

    2016-11-01

    Effective degradation of cellulose requires multiple classes of enzyme working together. However, naturally occurring cellulases with multiple catalytic domains seem to be rather rare in known cellulose-degrading organisms. A fusion protein made from Cellulomonas fimi exo- and endo- glucanases, Cex and CenA which improves breakdown of cellulose is described. A homologous carbohydrate binding module (CBM-2) present in both glucanases was fused to give a fusion protein CxnA. CxnA or unfused constructs (Cex+CenA, Cex, or CenA) were expressed in Escherichia coli and Citrobacter freundii. The latter recombinant strains were cultured at the expense of cellulose filter paper. The expressed CxnA had both exo- and endo- glucanase activities. It was also exported to the supernatant as were the non-fused proteins. In addition, the hybrid CBM from the fusion could bind to microcrystalline cellulose. Growth of C. freundii expressing CxnA was superior to that of cells expressing the unfused proteins. Physical degradation of filter paper was also faster with the cells expressing fusion protein than the other constructs. Our results show that fusion proteins with multiple catalytic domains can improve the efficiency of cellulose degradation. Such fusion proteins could potentially substitute cloning of multiple enzymes as well as improving product yields. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. SIGNIFICANCE OF ETV6-RUNX1 FUSION GENE TRANSCRIPT DETECTION IN PEDIATRIC B-CELL PRECURSOR ACUTE LYMPHOBLASTIC LEUKEMIA WITH TRANSLOCATION t(12;21(p13;q22

    Directory of Open Access Journals (Sweden)

    G. A. Tsaur

    2017-01-01

    Full Text Available Introduction. Translocation t(12;21(p13;q22 is one of the most common structural genetic abnormalities in childhood acute lymphoblastic leukemia (ALL. It cannot be detected by conventional G-banding, so a reverse-transcriptase polymerase chain reaction (RT-PCR or fluorescent in situ hybridization are used for this purpose.The aim of the study was to evaluate the prognostic significance of qualitative and quantitative detection of ETV6-RUNX1 fusion gene transcript at various time points in childhood B-cell precursor acute lymphoblastic leukemia (BCP-ALL patients.Materials and methods. ETV6-RUNX1 fusion gene transcript was revealed by both reverse-transcriptase PCR and quantitative real-time PCR (RQ-PCR in 34 out of 166 (20.5 % children with BCP-ALL. Qualitative ETV6-RUNX1-positivity at days 36 and 85 led to unfavorable outcome (lower event-free survival –EFS and higher cumulative incidence of relapse – CIR. While ETV6-RUNX1 status at day 15 did not allow to divide patients with different outcomes. By ROC curve analysis we determined threshold levels (TL for ETV6-RUNX1/ABL1 ratio at days 0, 15, 36 and 85. Afterwards we adjusted obtained results to 10-fold scale.Results. So practically applicable TL were as follows 500.0 %, 1 %, 0.1 % и 0.01 % for days 0, 15, 36 and 85, respectively. EFS and CIR were both worse in patients with ETV6-RUNX1/ABL1 ratio equal or above defined TL. Moreover, initial ratio ≥500,0 % corresponded to delayed blast clearance at days 15 and 36. We showed good qualitative (84.8 % and quantitative (R2 = 0.953 concordance between ETV6-RUNX1/ABL1 ratio and MRD data obtained by flow cytometry at days 15, 36, 85. Of note, defined TL for ETV6-RUNX1/ABL1 at days 15, 36, 85 were equal to prognostically important levels for flow cytometry MRD.Conclusion. Thus, qualitative detection and quantitative value of ETV6-RUNX1 fusion gene transcript showed prognostic significance in the course of treatment in children with BCP-ALL. Based

  14. Imaging Expression of Cytosine Deaminase-Herpes Virus Thymidine Kinase Fusion Gene (CD/TK Expression with [124I]FIAU and PET

    Directory of Open Access Journals (Sweden)

    Trevor Hackman

    2002-01-01

    Full Text Available Double prodrug activation gene therapy using the Escherichia coli cytosine deaminase (CDherpes simplex virus type 1 thymidine kinase (HSV1-tk fusion gene (CD/TK with 5-fluorocytosine (5FC, ganciclovir (GCV, and radiotherapy is currently under evaluation for treatment of different tumors. We assessed the efficacy of noninvasive imaging with [124I]FIAU (2′-fluoro-2′-deoxy-1-β-d-arabinofuranosyl-5-iodo-uracil and positron emission tomography (PET for monitoring expression of the CD/TK fusion gene. Walker-256 tumor cells were transduced with a retroviral vector bearing the CD/TK gene (W256CD/TK cells. The activity of HSV1-TK and CD subunits of the CD/TK gene product was assessed in different single cell-derived clones of W256CD/TK cells using the FIAU radiotracer accumulation assay in cells and a CD enzyme assay in cell homogenates, respectively. A linear relationship was observed between the levels of CD and HSV1-tk subunit expression in corresponding clones in vitro over a wide range of CD/TK expression levels. Several clones of W256CD/TK cells with significantly different levels of CD/TK expression were selected and used to produce multiple subcutaneous tumors in rats. PET imaging of HSV1-TK subunit activity with [124I]FIAU was performed on these animals and demonstrated that different levels of CD/TK expression in subcutaneous W256CD/TK tumors can be imaged quantitatively. CD expression in subcutaneous tumor sample homogenates was measured using a CD enzyme assay. A comparison of CD and HSV1-TK subunit enzymatic activity of the CD/TK fusion protein in vivo showed a significant correlation. Knowing this relationship, the parametric images of CD subunit activity were generated. Imaging with [124I]FIAU and PET could provide pre- and posttreatment assessments of CD/TK-based double prodrug activation in clinical gene therapy trials.

  15. The Influence of Major Life Events on Economic Attitudes in a World of Gene-Environment Interplay.

    Science.gov (United States)

    Hatemi, Peter K

    2013-10-01

    The role of "genes" on political attitudes has gained attention across disciplines. However, person-specific experiences have yet to be incorporated into models that consider genetic influences. Relying on a gene-environment interplay approach, this study explicates how life-events, such as losing one's job or suffering a financial loss, influence economic policy attitudes. The results indicate genetic and environmental variance on support for unions, immigration, capitalism, socialism and property tax is moderated by financial risks. Changes in the magnitude of genetic influences, however, are temporary. After two years, the phenotypic effects of the life events remain on most attitudes, but changes in the sources of individual differences do not. Univariate twin models that estimate the independent contributions of genes and environment on the variation of attitudes appear to provide robust baseline indicators of sources of individual differences. These estimates, however, are not event or day specific. In this way, genetic influences add stability, while environment cues change, and this process is continually updated.

  16. Lack of a synergistic effect of a non-viral ALS gene therapy based on BDNF and a TTC fusion molecule

    Directory of Open Access Journals (Sweden)

    Navarro Xavier

    2011-03-01

    Full Text Available Abstract Background Amyotrophic lateral sclerosis (ALS is one of the most devastating neurodegenerative diseases. Neurotrophic factors have been widely tested to counteract neurodegenerative conditions, despite their unspecific neuronal access. The non-toxic C-terminal fragment of the tetanus toxin (TTC heavy chain has been studied not only as a carrier molecule to the CNS but also as a neuroprotective agent. Because the neurotrophic effects of BDNF have been demonstrated in vitro and in vivo, the question addressed in this work is whether a fusion molecule of BDNF-TTC may have a synergistic effect and enhance the neuroprotective properties of TTC alone in a mouse model of ALS. Methods Recombinant plasmid constructs (pCMV-TTC and pCMV-BDNF-TTC were injected into the quadriceps femoris and triceps brachialis muscles of SOD1G93A transgenic mice at 8 weeks of age. The hanging wire and rotarod tests were performed to assess motor coordination, strength and balance. Electrophysiological tests, morphological assays of spinal cord sections of L2 and L4 segments, and gene and protein expression analyses were performed. The Kaplan-Meier survival analysis test was used for comparisons of survival. Multiple comparisons of data were analyzed using a one-way analysis of variance (ANOVA. Results Treatment with the fusion-molecule BDNF-TTC and with TTC alone significantly delayed the onset of symptoms and functional deficits of SOD1G93A mice. Muscle innervation was partially preserved with these treatments, and the number of surviving motoneurons in L2 spinal cord segment was increased particularly by the fusion protein induction. Inhibition of pro-apoptotic protein targets (caspase-3 and Bax and significant phosphorylation of Akt and ERK were also found in the spinal cord of treated mice. Conclusions Significant improvements in behavioral and electrophysiological results, motoneuron survival and anti-apoptotic/survival-activated pathways were observed with

  17. Gene design, fusion technology and TEV cleavage conditions influence the purification of oxidized disulphide-rich venom peptides in Escherichia coli.

    Science.gov (United States)

    Sequeira, Ana Filipa; Turchetto, Jeremy; Saez, Natalie J; Peysson, Fanny; Ramond, Laurie; Duhoo, Yoan; Blémont, Marilyne; Fernandes, Vânia O; Gama, Luís T; Ferreira, Luís M A; Guerreiro, Catarina I P I; Gilles, Nicolas; Darbon, Hervé; Fontes, Carlos M G A; Vincentelli, Renaud

    2017-01-17

    Animal venoms are large, complex libraries of bioactive, disulphide-rich peptides. These peptides, and their novel biological activities, are of increasing pharmacological and therapeutic importance. However, recombinant expression of venom peptides in Escherichia coli remains difficult due to the significant number of cysteine residues requiring effective post-translational processing. There is also an urgent need to develop high-throughput recombinant protocols applicable to the production of reticulated peptides to enable efficient screening of their drug potential. Here, a comprehensive study was developed to investigate how synthetic gene design, choice of fusion tag, compartment of expression, tag removal conditions and protease recognition site affect levels of solubility of oxidized venom peptides produced in E. coli. The data revealed that expression of venom peptides imposes significant pressure on cysteine codon selection. DsbC was the best fusion tag for venom peptide expression, in particular when the fusion was directed to the bacterial periplasm. While the redox activity of DsbC was not essential to maximize expression of recombinant fusion proteins, redox activity did lead to higher levels of correctly folded target peptides. With the exception of proline, the canonical TEV protease recognition site tolerated all other residues at its C-terminus, confirming that no non-native residues, which might affect activity, need to be incorporated at the N-terminus of recombinant peptides for tag removal. This study reveals that E. coli is a convenient heterologous host for the expression of soluble and functional venom peptides. Using the optimal construct design, a large and diverse range of animal venom peptides were produced in the µM scale. These results open up new possibilities for the high-throughput production of recombinant disulphide-rich peptides in E. coli.

  18. KIAA1549-BRAF fusions and IDH mutations can coexist in diffuse gliomas of adults.

    Science.gov (United States)

    Badiali, Manuela; Gleize, Vincent; Paris, Sophie; Moi, Loredana; Elhouadani, Selma; Arcella, Antonietta; Morace, Roberta; Antonelli, Manila; Buttarelli, Francesca Romana; Figarella-Branger, Dominique; Kim, Young-Ho; Ohgaki, Hiroko; Mokhtari, Karima; Sanson, Marc; Giangaspero, Felice

    2012-11-01

    KIAA1549-BRAF fusion gene and isocitrate dehydrogenase (IDH) mutations are considered two mutually exclusive genetic events in pilocytic astrocytomas and diffuse gliomas, respectively. We investigated the presence of the KIAA1549-BRAF fusion gene in conjunction with IDH mutations and 1p/19q loss in 185 adult diffuse gliomas. Moreover BRAF(v600E) mutation was also screened. The KIAA1549-BRAF fusion gene was evaluated by reverse-transcription polymerase chain reaction (RT-PCR) and sequencing. We found IDH mutations in 125 out 175 cases (71.4%). There were KIAA1549-BRAF fusion gene in 17 out of 180 (9.4%) cases and BRAF(v600E) in 2 out of 133 (1.5%) cases. In 11 of these 17 cases, both IDH mutations and the KIAA1549-BRAF fusion were present, as independent molecular events. Moreover, 6 of 17 cases showed co-presence of 1p/19q loss, IDH mutations and KIAA1549-BRAF fusion. Among the 17 cases with KIAA1549-BRAF fusion gene 15 (88.2%) were oligodendroglial neoplasms. Similarly, the two cases with BRAF(v600E) mutation were both oligodendroglioma and one had IDH mutations and 1p/19q co-deletion. Our results suggest that in a small fraction of diffuse gliomas, KIAA1549-BRAF fusion gene and BRAF(v600E) mutation may be responsible for deregulation of the Ras-RAF-ERK signaling pathway. Such alterations are more frequent in oligodendroglial neoplasm and may be co-present with IDH mutations and 1p/19q loss. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

  19. CRISPR/Cas9 Engineering of Adult Mouse Liver Demonstrates That the Dnajb1-Prkaca Gene Fusion Is Sufficient to Induce Tumors Resembling Fibrolamellar Hepatocellular Carcinoma.

    Science.gov (United States)

    Engelholm, Lars H; Riaz, Anjum; Serra, Denise; Dagnæs-Hansen, Frederik; Johansen, Jens V; Santoni-Rugiu, Eric; Hansen, Steen H; Niola, Francesco; Frödin, Morten

    2017-12-01

    Fibrolamellar hepatocellular carcinoma (FL-HCC) is a primary liver cancer that predominantly affects children and young adults with no underlying liver disease. A somatic, 400 Kb deletion on chromosome 19 that fuses part of the DnaJ heat shock protein family (Hsp40) member B1 gene (DNAJB1) to the protein kinase cAMP-activated catalytic subunit alpha gene (PRKACA) has been repeatedly identified in patients with FL-HCC. However, the DNAJB1-PRKACA gene fusion has not been shown to induce liver tumorigenesis. We used the CRISPR/Cas9 technique to delete in mice the syntenic region on chromosome 8 to create a Dnajb1-Prkaca fusion and monitored the mice for liver tumor development. We delivered CRISPR/Cas9 vectors designed to juxtapose exon 1 of Dnajb1 with exon 2 of Prkaca to create the Dnajb1-Prkaca gene fusion associated with FL-HCC, or control Cas9 vector, via hydrodynamic tail vein injection to livers of 8-week-old female FVB/N mice. These mice did not have any other engineered genetic alterations and were not exposed to liver toxins or carcinogens. Liver tissues were collected 14 months after delivery; genomic DNA was analyzed by PCR to detect the Dnajb1-Prkaca fusion, and tissues were characterized by histology, immunohistochemistry, RNA sequencing, and whole-exome sequencing. Livers from 12 of the 15 mice given the vectors to induce the Dnajb1-Prkaca gene fusion, but none of the 11 mice given the control vector, developed neoplasms. The tumors contained the Dnajb1-Prkaca gene fusion and had histologic and cytologic features of human FL-HCCs: large polygonal cells with granular, eosinophilic, and mitochondria-rich cytoplasm, prominent nucleoli, and markers of hepatocytes and cholangiocytes. In comparing expression levels of genes between the mouse tumor and non-tumor liver cells, we identified changes similar to those detected in human FL-HCC, which included genes that affect cell cycle and mitosis regulation. Genomic analysis of mouse neoplasms induced by

  20. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event.

    Science.gov (United States)

    Kyndt, Tina; Haegeman, Annelies; Gheysen, Godelieve

    2008-11-03

    the whole gene cassette, i.e. the GHF5 catalytic domain and the CBM2, rather than that it evolved by domain shuffling. Our evolutionary model for the gene structure in PPN GHF5 endoglucanases implies the occurrence of an early duplication event, and more recent gene duplications at genus or species level.

  1. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event

    Directory of Open Access Journals (Sweden)

    Gheysen Godelieve

    2008-11-01

    PPN GHF5 endoglucanase gene most probably consisted of the whole gene cassette, i.e. the GHF5 catalytic domain and the CBM2, rather than that it evolved by domain shuffling. Our evolutionary model for the gene structure in PPN GHF5 endoglucanases implies the occurrence of an early duplication event, and more recent gene duplications at genus or species level.

  2. Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

    Science.gov (United States)

    Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila

    2017-05-08

    In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. EMP Fusion

    OpenAIRE

    KUNTAY, Isık

    2010-01-01

    This paper introduces a novel fusion scheme, called EMP Fusion, which has the promise of achieving breakeven and realizing commercial fusion power. The method is based on harnessing the power of an electromagnetic pulse generated by the now well-developed flux compression technology. The electromagnetic pulse acts as a means of both heating up the plasma and confining the plasma, eliminating intermediate steps. The EMP Fusion device is simpler compared to other fusion devices and this reduces...

  4. Bridge-Induced Translocation between NUP145 and TOP2 Yeast Genes Models the Genetic Fusion between the Human Orthologs Associated With Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Valentina Tosato

    2017-09-01

    Full Text Available In mammalian organisms liquid tumors such as acute myeloid leukemia (AML are related to spontaneous chromosomal translocations ensuing in gene fusions. We previously developed a system named bridge-induced translocation (BIT that allows linking together two different chromosomes exploiting the strong endogenous homologous recombination system of the yeast Saccharomyces cerevisiae. The BIT system generates a heterogeneous population of cells with different aneuploidies and severe aberrant phenotypes reminiscent of a cancerogenic transformation. In this work, thanks to a complex pop-out methodology of the marker used for the selection of translocants, we succeeded by BIT technology to precisely reproduce in yeast the peculiar chromosome translocation that has been associated with AML, characterized by the fusion between the human genes NUP98 and TOP2B. To shed light on the origin of the DNA fragility within NUP98, an extensive analysis of the curvature, bending, thermostability, and B-Z transition aptitude of the breakpoint region of NUP98 and of its yeast ortholog NUP145 has been performed. On this basis, a DNA cassette carrying homologous tails to the two genes was amplified by PCR and allowed the targeted fusion between NUP145 and TOP2, leading to reproduce the chimeric transcript in a diploid strain of S. cerevisiae. The resulting translocated yeast obtained through BIT appears characterized by abnormal spherical bodies of nearly 500 nm of diameter, absence of external membrane and defined cytoplasmic localization. Since Nup98 is a well-known regulator of the post-transcriptional modification of P53 target genes, and P53 mutations are occasionally reported in AML, this translocant yeast strain can be used as a model to test the constitutive expression of human P53. Although the abnormal phenotype of the translocant yeast was never rescued by its expression, an exogenous P53 was recognized to confer increased vitality to the translocants, in

  5. Delivery of human NKG2D-IL-15 fusion gene by chitosan nanoparticles to enhance antitumor immunity

    International Nuclear Information System (INIS)

    Yan, Chen; Jie, Leng; Yongqi, Wang; Weiming, Xiao; Juqun, Xi; Yanbing, Ding; Li, Qian; Xingyuan, Pan; Mingchun, Ji; Weijuan, Gong

    2015-01-01

    Nanoparticles are becoming promising carriers for gene delivery because of their high capacity in gene loading and low cell cytotoxicity. In this study, a chitosan-based nanoparticle encapsulated within a recombinant pcDNA3.1-dsNKG2D-IL-15 plasmid was generated. The fused dsNKG2D-IL-15 gene fragment consisted of double extracellular domains of NKG2D with IL-15 gene at downstream. The average diameter of the gene nanoparticles ranged from 200 nm to 400 nm, with mean zeta potential value of 53.8 ± 6.56 mV. The nanoparticles which were loaded with the dsNKG2D-IL-15 gene were uptaken by tumor cells with low cytotoxicity. Tumor cells pre-transfected by gene nanopartilces stimulated NK and T cells in vitro. Intramuscular injection of gene nanoparticles suppressed tumor growth and prolonged survival of tumor-bearing mice through activation of NK and CD8 + T cells. Thus, chitosan-based nanoparticle delivery of dsNKG2D-IL-15 gene vaccine can be potentially used for tumor therapy. - Highlights: • Generation of a nanoparticle for delivery of dsNKG2D-IL-15 gene. • Characterization of the gene nanoparticle. • Antitumor activity mediated by the gene nanoparticle

  6. Delivery of human NKG2D-IL-15 fusion gene by chitosan nanoparticles to enhance antitumor immunity

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Chen; Jie, Leng; Yongqi, Wang [Department of Immunology, School of Medicine, Yangzhou University, Yangzhou, 225009 (China); Weiming, Xiao [Department of Gastroenterology, The Second Clinical Medical College, Yangzhou University, Yangzhou, 225009 (China); Juqun, Xi [Jiangsu Key Laboratory of Integrated Traditional Chinese and Western Medicine for Prevention and Treatment of Senile Diseases, Yangzhou, 225009 (China); Yanbing, Ding [Department of Gastroenterology, The Second Clinical Medical College, Yangzhou University, Yangzhou, 225009 (China); Li, Qian [Department of Immunology, School of Medicine, Yangzhou University, Yangzhou, 225009 (China); Xingyuan, Pan [Jiangsu Key Laboratory of Zoonosis, Yangzhou University, Yangzhou, 225009 (China); Mingchun, Ji [Department of Immunology, School of Medicine, Yangzhou University, Yangzhou, 225009 (China); Weijuan, Gong, E-mail: wjgong@yzu.edu.cn [Department of Immunology, School of Medicine, Yangzhou University, Yangzhou, 225009 (China); Department of Gastroenterology, The Second Clinical Medical College, Yangzhou University, Yangzhou, 225009 (China); Jiangsu Key Laboratory of Integrated Traditional Chinese and Western Medicine for Prevention and Treatment of Senile Diseases, Yangzhou, 225009 (China); Jiangsu Key Laboratory of Zoonosis, Yangzhou University, Yangzhou, 225009 (China); Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, 225009 (China)

    2015-07-31

    Nanoparticles are becoming promising carriers for gene delivery because of their high capacity in gene loading and low cell cytotoxicity. In this study, a chitosan-based nanoparticle encapsulated within a recombinant pcDNA3.1-dsNKG2D-IL-15 plasmid was generated. The fused dsNKG2D-IL-15 gene fragment consisted of double extracellular domains of NKG2D with IL-15 gene at downstream. The average diameter of the gene nanoparticles ranged from 200 nm to 400 nm, with mean zeta potential value of 53.8 ± 6.56 mV. The nanoparticles which were loaded with the dsNKG2D-IL-15 gene were uptaken by tumor cells with low cytotoxicity. Tumor cells pre-transfected by gene nanopartilces stimulated NK and T cells in vitro. Intramuscular injection of gene nanoparticles suppressed tumor growth and prolonged survival of tumor-bearing mice through activation of NK and CD8{sup +} T cells. Thus, chitosan-based nanoparticle delivery of dsNKG2D-IL-15 gene vaccine can be potentially used for tumor therapy. - Highlights: • Generation of a nanoparticle for delivery of dsNKG2D-IL-15 gene. • Characterization of the gene nanoparticle. • Antitumor activity mediated by the gene nanoparticle.

  7. Specific Genes Associated with Adverse Events of Methylphenidate Use in the Pediatric Population

    DEFF Research Database (Denmark)

    Joensen, Beinta; Meyer, Morten; Aagaard, Lise

    2017-01-01

    were significantly associated with the following genes: appetite reduction (CES1*G); buccal-lingual movements (T1065G); diastolic blood pressure (ADRA2A Mspl C/C-GC); emotionality (DAT1*9/9); irritability (SNAP25 T1065G); picking (DRD4*7/DRD4*4); social withdrawal (DRD4*7/DRD4*4); somatic complaints...

  8. Gene-Environment Interaction Effects of Peer Deviance, Parental Knowledge and Stressful Life Events on Adolescent Alcohol Use.

    Science.gov (United States)

    Cooke, Megan E; Meyers, Jacquelyn L; Latvala, Antti; Korhonen, Tellervo; Rose, Richard J; Kaprio, Jaakko; Salvatore, Jessica E; Dick, Danielle M

    2015-10-01

    The purpose of this study was to address two methodological issues that have called into question whether previously reported gene-environment interaction (GxE) effects for adolescent alcohol use are 'real'. These issues are (1) the potential correlation between the environmental moderator and the outcome across twins and (2) non-linear transformations of the behavioral outcome. Three environments that have been previously studied (peer deviance, parental knowledge, and potentially stressful life events) were examined here. For each moderator (peer deviance, parental knowledge, and potentially stressful life events), a series of models was fit to both a raw and transformed measure of monthly adolescent alcohol use in a sample that included 825 dizygotic (DZ) and 803 monozygotic (MZ) twin pairs. The results showed that the moderating effect of peer deviance was robust to transformation, and that although the significance of moderating effects of parental knowledge and potentially stressful life events were dependent on the scale of the adolescent alcohol use outcome, the overall results were consistent across transformation. In addition, the findings did not vary across statistical models. The consistency of the peer deviance results and the shift of the parental knowledge and potentially stressful life events results between trending and significant, shed some light on why previous findings for certain moderators have been inconsistent and emphasize the importance of considering both methodological issues and previous findings when conducting and interpreting GxE analyses.

  9. Deduction of probable events of lateral gene transfer through comparison of phylogenetic trees by recursive consolidation and rearrangement

    Directory of Open Access Journals (Sweden)

    Charlebois Robert L

    2005-04-01

    Full Text Available Abstract Background When organismal phylogenies based on sequences of single marker genes are poorly resolved, a logical approach is to add more markers, on the assumption that weak but congruent phylogenetic signal will be reinforced in such multigene trees. Such approaches are valid only when the several markers indeed have identical phylogenies, an issue which many multigene methods (such as the use of concatenated gene sequences or the assembly of supertrees do not directly address. Indeed, even when the true history is a mixture of vertical descent for some genes and lateral gene transfer (LGT for others, such methods produce unique topologies. Results We have developed software that aims to extract evidence for vertical and lateral inheritance from a set of gene trees compared against an arbitrary reference tree. This evidence is then displayed as a synthesis showing support over the tree for vertical inheritance, overlaid with explicit lateral gene transfer (LGT events inferred to have occurred over the history of the tree. Like splits-tree methods, one can thus identify nodes at which conflict occurs. Additionally one can make reasonable inferences about vertical and lateral signal, assigning putative donors and recipients. Conclusion A tool such as ours can serve to explore the reticulated dimensionality of molecular evolution, by dissecting vertical and lateral inheritance at high resolution. By this, we mean that individual nodes can be examined not only for congruence, but also for coherence in light of LGT. We assert that our tools will facilitate the comparison of phylogenetic trees, and the interpretation of conflicting data.

  10. The Asia 2 specific signal peptide region and other domains in fusion protein genes characterized Asia 1 and Asia 2 canine distemper viruses

    Science.gov (United States)

    Sultan, Serageldeen; Charoenvisal, Nataya; Lan, Nguyen Thi; Yamaguchi, Ryoji; Maeda, Ken; Kai, Kazushige

    2009-01-01

    Background Although the presence of Asia 2 group of canine distemper virus (CDV) was known by the sequencing and phylogenetic analysis of hemagglutinin (H) gene, the fusion (F) protein gene sequence of Asia 2 group had not been identified. So, the sequence analysis of F gene was carried out to elucidate the genotypic varaitons among Asian isolates. Results The phylogenetic analysis of F and H gene sequences from fourteen CDV isolates obtained from diseased dogs in Japan and Thailand indicated that the F genes had a new initiation codon and extra 27 nucleotides upstream of the usual open reading frame (ORF) and the F proteins had extra 9 amino acids at the N-terminal position only in Asia 2 isolates. On the contrary, the Asia 1 isolates had three extra putative N-glycosylation sites (two sites in the signal peptide region and one site in the F1 region) except for two strains of Th12 and Ac96I (two sites in signal peptide region) adding to four putative N-glycosylation sites that were conserved among all Asian isolates and Onderstepoort strain. In addition to this difference in N-glycosylation sites, the signal peptide region had a great diversity between Asia 1 and Asia 2 isolates. Also, characteristic amino acids were detected for some strains. Conclusion Asia 2 isolates were distinguished from other CDV lineages by the extra 27 nucleotide sequence. The signal peptide region of F gene gives a remarkable differentiation between Asia 1 and Asia 2 isolates. Strains Th12 and Ac96I were differentiated from other Asia 1 strains by the F protein glycosylation sites. PMID:19807927

  11. Comparative Assessment of Induced Immune Responses Following Intramuscular Immunization with Fusion and Cocktail of LeIF, LACK and TSA Genes Against Cutaneous Leishmaniasis in BALB/c Mice.

    Science.gov (United States)

    Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

    2018-02-01

    In the present study, we evaluated induced immune responses following DNA vaccine containing cocktail or fusion of LeIF, LACK and TSA genes or each gene alone. Mice were injected with 100 µg of each plasmid containing the gene of insert, plasmid DNA alone as the first control group or phosphate buffer saline as the second control group. Then, cellular and humoral responses, lesion size were measured for all groups. All vaccinated mice induced Th1 immune responses against Leishmania characterized by higher IFN-γ and IgG2a levels compared with control groups (p < 0.05). In addition, IFN-γ levels increased in groups immunized with fusion and cocktail vaccines in comparison with LACK (p < 0.001) and LeIF (p < 0.01) groups after challenge. In addition, fusion and cocktail groups produced higher IgG2a values than groups vaccinated with a gene alone (p < 0.05). Lesion progression delayed for all immunized groups compared with control groups from 5th week post-infection (p < 0.05). Mean lesion size decreased in immunized mice with fusion DNA than three groups vaccinated with one gene alone (p < 0.05). While, lesion size decreased significantly in cocktail recipient group than LeIF recipient group (p < 0.05). There was no difference in lesion size between fusion and cocktail groups. Overall, immunized mice with cocktail and fusion vaccines showed stronger Th1 response by production of higher IFN-γ and IgG2a and showed smaller mean lesion size. Therefore, use of multiple antigens can improve induced immune responses by DNA vaccination.

  12. Different receptors binding to distinct interfaces on herpes simplex virus gD can trigger events leading to cell fusion and viral entry

    International Nuclear Information System (INIS)

    Spear, Patricia G.; Manoj, Sharmila; Yoon, Miri; Jogger, Cheryl R.; Zago, Anna; Myscofski, Dawn

    2006-01-01

    One of the herpes simplex virus envelope glycoproteins, designated gD, is the principal determinant of cell recognition for viral entry. Other viral glycoproteins, gB, gH and gL, cooperate with gD to mediate the membrane fusion that is required for viral entry and cell fusion. Membrane fusion is triggered by the binding of gD to one of its receptors. These receptors belong to three different classes of cell surface molecules. This review summarizes recent findings on the structure and function of gD. The results presented indicate that gD may assume more than one conformation, one in the absence of receptor, another when gD is bound to the herpesvirus entry mediator, a member of the TNF receptor family, and a third when gD is bound to nectin-1, a cell adhesion molecule in the immunoglobulin superfamily. Finally, information and ideas are presented about a membrane-proximal region of gD that is required for membrane fusion, but not for receptor binding, and that may have a role in activating the fusogenic activity of gB, gH and gL

  13. High-level SUMO-mediated fusion expression of ABP-dHC-cecropin A from multiple joined genes in Escherichia coli.

    Science.gov (United States)

    Zhang, Jiaxin; Movahedi, Ali; Wei, Zhiheng; Sang, Ming; Wu, Xiaolong; Wang, Mengyang; Wei, Hui; Pan, Huixin; Yin, Tongming; Zhuge, Qiang

    2016-09-15

    The antimicrobial peptide ABP-dHC-cecropin A is a small cationic peptide with potent activity against a wide range of bacterial species. Evidence of antifungal activity has also been suggested; however, evaluation of this peptide has been limited due to the low expression of cecropin proteins in Escherichia coli. To improve the expression level of ABP-dHC-cecropin A in E. coli, tandem repeats of the ABP-dHC-cecropin A gene were constructed and expressed as fusion proteins (SUMO-nABP-dHC-cecropin, n = 1, 2, 3, 4) via pSUMO-nABP-dHC-cecropin A vectors (n = 1, 2, 3, 4). Comparison of the expression levels of soluble SUMO-nABP-dHC-cecropin A fusion proteins (n = 1, 2, 3, 4) suggested that BL21 (DE3)/pSUMO-3ABP-dHC-cecropin A is an ideal recombinant strain for ABP-dHC-cecropin A production. Under the selected conditions of cultivation and isopropylthiogalactoside (IPTG) induction, the expression level of ABP-dHC-cecropin A was as high as 65 mg/L, with ∼21.3% of the fusion protein in soluble form. By large-scale fermentation, protein production reached nearly 300 mg/L, which is the highest yield of ABP-dHC-cecropin A reported to date. In antibacterial experiments, the efficacy was approximately the same as that of synthetic ABP-dHC-cecropin A. This method provides a novel and effective means of producing large amounts of ABP-dHC-cecropin A. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Conservation of transcription factor binding events predicts gene expression across species

    OpenAIRE

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to funct...

  15. Fusion power

    International Nuclear Information System (INIS)

    Hancox, R.

    1981-01-01

    The principles of fusion power, and its advantages and disadvantages, are outlined. Present research programmes and future plans directed towards the development of a fusion power reactor, are summarized. (U.K.)

  16. Persistence of TEL-AML1 fusion gene as minimal residual disease has no additive prognostic value in CD 10 positive B-acute lymphoblastic leukemia: a FISH study

    Directory of Open Access Journals (Sweden)

    Ezz-Eldin Azza M

    2008-10-01

    Full Text Available Abstract Objectives We have analyzed t(12;21(p13:q22 in an attempt to evaluate the frequency and prognostic significance of TEL-AML1 fusion gene in patients with childhood CD 10 positive B-ALL by fluorescence in situ hybridization (FISH. Also, we have monitored the prognostic value of this gene as a minimal residual disease (MRD. Methods All bone marrow samples of eighty patients diagnosed as CD 10 positive B-ALL in South Egypt Cancer Institute were evaluated by fluorescence in situ hybridization (FISH for t(12;21 in newly diagnosed cases and after morphological complete remission as a minimal residual disease (MRD. We determined the prognostic significance of TEL-AML1 fusion represented by disease course and survival. Results TEL-AML1 fusion gene was positive in (37.5% in newly diagnosed patients. There was a significant correlation between TEL-AML1 fusion gene both at diagnosis (r = 0.5, P = 0.003 and as a MRD (r = 0.4, P = 0.01 with favorable course. Kaplan-Meier curve for the presence of TEL-AML1 fusion at the diagnosis was associated with a better probability of overall survival (OS; mean survival time was 47 ± 1 month, in contrast to 28 ± 5 month in its absence (P = 0.006. Also, the persistence at TEL-AML1 fusion as a MRD was not significantly associated with a better probability of OS; the mean survival time was 42 ± 2 months in the presence of MRD and it was 40 ± 1 months in its absence. So, persistence of TEL-AML1 fusion as a MRD had no additive prognostic value over its measurement at diagnosis in terms of predicting the probability of OS. Conclusion For most patients, the presence of TEL-AML1 fusion gene at diagnosis suggests a favorable prognosis. The present study suggests that persistence of TEL-AML1 fusion as MRD has no additive prognostic value.

  17. Fusion rings and fusion ideals

    DEFF Research Database (Denmark)

    Andersen, Troels Bak

    by the so-called fusion ideals. The fusion rings of Wess-Zumino-Witten models have been widely studied and are well understood in terms of precise combinatorial descriptions and explicit generating sets of the fusion ideals. They also appear in another, more general, setting via tilting modules for quantum......This dissertation investigates fusion rings, which are Grothendieck groups of rigid, monoidal, semisimple, abelian categories. Special interest is in rational fusion rings, i.e., fusion rings which admit a finite basis, for as commutative rings they may be presented as quotients of polynomial rings...

  18. [Construction of cTnC-linker-TnI (P) Genes, Expression of Fusion Protein and Preparation of Lyophilized Protein].

    Science.gov (United States)

    Song, Xiaoli; Liu, Xiaoyun; Cai, Lei; Wu, Jianwei; Wang, Jihua

    2015-12-01

    In order to construct and express human cardiac troponin C-linker-troponin I(P) [ cTnC-linker-TnI(P)] fusion protein, detect its activity and prepare lyophilized protein, we searched the CDs of human cTnC and cTnI from GenBank, synthesized cTnC and cTnI(30-110aa) into cloning vector by a short DNA sequence coding for 15 neutral amino acid residues. pCold I-cTnC-linker-TnI(P) was constructed and transformed into E. coli BL21(DE3). Then, cTnC-linker-TnI(P) fusion protein was induced by isopropyl-β-D-thiogalactopyranoside (IPTG). Soluable expression of cTnC-linker-TnI(P) in prokaryotic system was successfully obtained. The fusion protein was purified by Ni²⁺ Sepharose 6 Fast Flow affinity chromatography with over 95% purity and prepared into lyophilized protein. The activity of purified cTnC-linker-TnI(P) and its lyophilized protein were detected by Wondfo Finecare™ cTnI Test. Lyophilized protein of cTnC-linker-TnI(P) was stable for 10 or more days at 37 °C and 4 or more months at 25 °C and 4 °C. The expression system established in this research is feasible and efficient. Lyophilized protein is stable enough to be provided as biological raw materials for further research.

  19. Fusion: introduction

    International Nuclear Information System (INIS)

    Decreton, M.

    2006-01-01

    The article gives an overview and introduction to the activities of SCK-CEN's research programme on fusion. The decision to construct the ITER international nuclear fusion experiment in Cadarache is highlighted. A summary of the Belgian contributions to fusion research is given with particular emphasis on studies of radiation effects on diagnostics systems, radiation effects on remote handling sensing systems, fusion waste management and socio-economic studies

  20. Membrane fusion

    DEFF Research Database (Denmark)

    Bendix, Pól Martin

    2015-01-01

    At Stanford University, Boxer lab, I worked on membrane fusion of small unilamellar lipid vesicles to flat membranes tethered to glass surfaces. This geometry closely resembles biological systems in which liposomes fuse to plasma membranes. The fusion mechanism was studied using DNA zippering...... between complementary strands linked to the two apposing membranes closely mimicking the zippering mechanism of SNARE fusion complexes....

  1. Fusion Canada

    International Nuclear Information System (INIS)

    1987-07-01

    This first issue of a quarterly newsletter announces the startup of the Tokamak de Varennes, describes Canada's national fusion program, and outlines the Canadian Fusion Fuels Technology Program. A map gives the location of the eleven principal fusion centres in Canada. (L.L.)

  2. The elementary fusion modalities of osteoclasts

    DEFF Research Database (Denmark)

    Søe, Kent; Hobolt-Pedersen, Anne Sofie; Delaisse, Jean Marie

    2015-01-01

    , are not known for the osteoclast. Here we show that osteoclast fusion partners are characterized by differences in mobility, nuclearity, and differentiation level. Our demonstration was based on time-laps videos of human osteoclast preparations from three donors where 656 fusion events were analyzed. Fusions......The last step of the osteoclast differentiation process is cell fusion. Most efforts to understand the fusion mechanism have focused on the identification of molecules involved in the fusion process. Surprisingly, the basic fusion modalities, which are well known for fusion of other cell types...... between a mobile and an immobile partner were most frequent (62%), while fusion between two mobile (26%) or two immobile partners (12%) was less frequent (p fusion partner contained more nuclei than the mobile one (p

  3. Myeloid Neoplasms with t(5;12 and ETV6-ACSL6 Gene Fusion, Potential Mimickers of Myeloid Neoplasm with PDGFRB Rearrangement: Case Report with Imatinib Therapy and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Javier De Luca-Johnson

    2016-01-01

    Full Text Available We report the second case of ETV6-ACSL6 associated myeloproliferative neoplasm that has received a full course of imatinib therapy. The patient was a 51-year-old previously healthy man who presented with three months of worsening dyspnea and was found to have a white count of 216,000/cmm, of which 84% were eosinophil lineage. Cytogenetic analysis revealed a t(5;12(q31~33;p13. FISH was negative for PDGFRB rearrangement but additional FISH testing demonstrated an ACSL6 rearrangement. ETV6-ACSL6 gene fusion is a rare abnormality that most often presents as a myeloproliferative-type disorder with prominent eosinophilia or basophilia. Review of the literature yielded a total of 11 previous cases. This gene fusion results in a t(5;12(q31~33;p13 that mimics the t(5;12 found in ETV6-PDGFRB neoplasms. Identification of the fusion genes involved in t(5;12 in eosinophilia-associated myeloproliferative disorders is crucial to direct an effective treatment plan. In particular, while tyrosine kinase inhibitor therapy is effective in patients with PDGFRB rearrangement, there is little information on imatinib efficacy in patients with ETV6-ACSL6 gene fusion. Our patient was found to be nonresponsive to imatinib therapy.

  4. Discrete gene replication events drive coupling between the cell cycle and circadian clocks.

    Science.gov (United States)

    Paijmans, Joris; Bosman, Mark; Ten Wolde, Pieter Rein; Lubensky, David K

    2016-04-12

    Many organisms possess both a cell cycle to control DNA replication and a circadian clock to anticipate changes between day and night. In some cases, these two rhythmic systems are known to be coupled by specific, cross-regulatory interactions. Here, we use mathematical modeling to show that, additionally, the cell cycle generically influences circadian clocks in a nonspecific fashion: The regular, discrete jumps in gene-copy number arising from DNA replication during the cell cycle cause a periodic driving of the circadian clock, which can dramatically alter its behavior and impair its function. A clock built on negative transcriptional feedback either phase-locks to the cell cycle, so that the clock period tracks the cell division time, or exhibits erratic behavior. We argue that the cyanobacterium Synechococcus elongatus has evolved two features that protect its clock from such disturbances, both of which are needed to fully insulate it from the cell cycle and give it its observed robustness: a phosphorylation-based protein modification oscillator, together with its accompanying push-pull read-out circuit that responds primarily to the ratios of different phosphoform concentrations, makes the clock less susceptible to perturbations in protein synthesis; the presence of multiple, asynchronously replicating copies of the same chromosome diminishes the effect of replicating any single copy of a gene.

  5. Catechol-o-methyltransferase gene polymorphism modifies the effect of coffee intake on incidence of acute coronary events.

    Directory of Open Access Journals (Sweden)

    Pertti Happonen

    Full Text Available BACKGROUND: The role of coffee intake as a risk factor for coronary heart disease (CHD has been debated for decades. We examined whether the relationship between coffee intake and incidence of CHD events is dependent on the metabolism of circulating catecholamines, as determined by functional polymorphism of the catechol-O-methyltransferase (COMT gene. METHODOLOGY/PRINCIPAL FINDINGS: In a cohort of 773 men who were 42 to 60 years old and free of symptomatic CHD at baseline in 1984-89, 78 participants experienced an acute coronary event during an average follow-up of 13 years. In logistic regression adjusting for age, smoking, family history of CHD, vitamin C deficiency, blood pressure, plasma cholesterol concentration, and diabetes, the odds ratio (90% confidence interval comparing heavy coffee drinkers with the low activity COMT genotype with those with the high activity or heterozygotic genotypes was 3.2 (1.2-8.4. Urinary adrenaline excretion increased with increasing coffee intake, being over two-fold in heavy drinkers compared with nondrinkers (p = 0.008 for trend. CONCLUSIONS/SIGNIFICANCE: Heavy coffee consumption increases the incidence of acute coronary events in men with low but not high COMT activity. Further studies are required to determine to which extent circulating catecholamines mediate the relationship between coffee intake and CHD.

  6. Fusion neutronics

    CERN Document Server

    Wu, Yican

    2017-01-01

    This book provides a systematic and comprehensive introduction to fusion neutronics, covering all key topics from the fundamental theories and methodologies, as well as a wide range of fusion system designs and experiments. It is the first-ever book focusing on the subject of fusion neutronics research. Compared with other nuclear devices such as fission reactors and accelerators, fusion systems are normally characterized by their complex geometry and nuclear physics, which entail new challenges for neutronics such as complicated modeling, deep penetration, low simulation efficiency, multi-physics coupling, etc. The book focuses on the neutronics characteristics of fusion systems and introduces a series of theories and methodologies that were developed to address the challenges of fusion neutronics, and which have since been widely applied all over the world. Further, it introduces readers to neutronics design’s unique principles and procedures, experimental methodologies and technologies for fusion systems...

  7. Postnatal events in intestinal gene expression and splenic cell composition is altered in NOD mice

    DEFF Research Database (Denmark)

    Damlund, Dina Silke Malling; Metzdorff, Stine Broeng; Kristensen, Matilde Bylov

    2013-01-01

    microbiota seems to play an important role in the development and control of T1D. We hypothesized that NOD mice in the perinatal period respond differently than mice not prone to develop T1D (C57/Bl6), and we investigated the differences in postnatal expression of genes in gut, spleen, liver and pancreas......Evidence suggests that colonisation pattern of the gut in the early postnatal period is highly correlated with the risk of developing type 1 diabetes (T1D). We have recently shown that colonization in SPF mice accelerates gut maturation and that at postnatal day (PND) 1, in comparison with germ...... free mice, certain chemokines, including Cxcl2 encoding macrophage inflammatory protein (MIP)-2 and involved in attraction of neutrophils was downregulated in the gut epithelium. The non-obese diabetes (NOD) mouse is widely used as a model for studying the pathogenesis of T1D. The neonatal gut...

  8. Switch-like reprogramming of gene expression after fusion of multinucleate plasmodial cells of two Physarum polycephalum sporulation mutants

    Energy Technology Data Exchange (ETDEWEB)

    Walter, Pauline; Hoffmann, Xenia-Katharina; Ebeling, Britta; Haas, Markus; Marwan, Wolfgang, E-mail: wolfgang.marwan@ovgu.de

    2013-05-24

    Highlights: •We investigate reprogramming of gene expression in multinucleate single cells. •Cells of two differentiation control mutants are fused. •Fused cells proceed to alternative gene expression patterns. •The population of nuclei damps stochastic fluctuations in gene expression. •Dynamic processes of cellular reprogramming can be observed by repeated sampling of a cell. -- Abstract: Nonlinear dynamic processes involving the differential regulation of transcription factors are considered to impact the reprogramming of stem cells, germ cells, and somatic cells. Here, we fused two multinucleate plasmodial cells of Physarum polycephalum mutants defective in different sporulation control genes while being in different physiological states. The resulting heterokaryons established one of two significantly different expression patterns of marker genes while the plasmodial halves that were fused to each other synchronized spontaneously. Spontaneous synchronization suggests that switch-like control mechanisms spread over and finally control the entire plasmodium as a result of cytoplasmic mixing. Regulatory molecules due to the large volume of the vigorously streaming cytoplasm will define concentrations in acting on the population of nuclei and in the global setting of switches. Mixing of a large cytoplasmic volume is expected to damp stochasticity when individual nuclei deliver certain RNAs at low copy number into the cytoplasm. We conclude that spontaneous synchronization, the damping of molecular noise in gene expression by the large cytoplasmic volume, and the option to take multiple macroscopic samples from the same plasmodium provide unique options for studying the dynamics of cellular reprogramming at the single cell level.

  9. Switch-like reprogramming of gene expression after fusion of multinucleate plasmodial cells of two Physarum polycephalum sporulation mutants

    International Nuclear Information System (INIS)

    Walter, Pauline; Hoffmann, Xenia-Katharina; Ebeling, Britta; Haas, Markus; Marwan, Wolfgang

    2013-01-01

    Highlights: •We investigate reprogramming of gene expression in multinucleate single cells. •Cells of two differentiation control mutants are fused. •Fused cells proceed to alternative gene expression patterns. •The population of nuclei damps stochastic fluctuations in gene expression. •Dynamic processes of cellular reprogramming can be observed by repeated sampling of a cell. -- Abstract: Nonlinear dynamic processes involving the differential regulation of transcription factors are considered to impact the reprogramming of stem cells, germ cells, and somatic cells. Here, we fused two multinucleate plasmodial cells of Physarum polycephalum mutants defective in different sporulation control genes while being in different physiological states. The resulting heterokaryons established one of two significantly different expression patterns of marker genes while the plasmodial halves that were fused to each other synchronized spontaneously. Spontaneous synchronization suggests that switch-like control mechanisms spread over and finally control the entire plasmodium as a result of cytoplasmic mixing. Regulatory molecules due to the large volume of the vigorously streaming cytoplasm will define concentrations in acting on the population of nuclei and in the global setting of switches. Mixing of a large cytoplasmic volume is expected to damp stochasticity when individual nuclei deliver certain RNAs at low copy number into the cytoplasm. We conclude that spontaneous synchronization, the damping of molecular noise in gene expression by the large cytoplasmic volume, and the option to take multiple macroscopic samples from the same plasmodium provide unique options for studying the dynamics of cellular reprogramming at the single cell level

  10. Genetic variability available through cell fusion

    Energy Technology Data Exchange (ETDEWEB)

    Smith, H.H.; Mastrangelo-Hough, I.A.

    1977-01-01

    Results are reported for the following studies: plant hybridization through protoplast fusion using species of Nicotiana and Petunia; chromosome instability studies on culture-induced chromosome changes and chromosome elimination; chloroplast distribution in parasexual hybrids; chromosomal introgression following fusion; plant-animal fusion; and microcell-mediated chromosome transfer and chromosome-mediated gene transfer. (HLW)

  11. Cloning of fusion protein gene of Newcastle disease virus into a baculovirus derived bacmid shuttle vector, in order to express it in insect cell line

    Directory of Open Access Journals (Sweden)

    Hashemzadeh MS

    2015-05-01

    Full Text Available Abstract Background: Newcastle disease virus (NDV is one of the major pathogens in poultry and vaccination is intended to control the disease, as an effective solution, yet. Fusion protein (F on surface of NDV, has a fundamental role in virus pathogenicity and can induce protective immunity, alone. With this background, here our aim was to construct a baculovirus derived recombinant bacmid shuttle vector (encoding F-protein in order to express it in insect cell line. Materials and Methods: In this experimental study, at first complete F gene from avirulent strain La Sota of NDV was amplified by RT-PCR to produce F cDNA. The amplicon was cloned into T/A cloning vector and afterwards into pFastBac Dual donor plasmid. After the verification of cloning process by two methods, PCR and enzymatic digestion analysis, the accuracy of F gene sequence was confirmed by sequencing. Finally, F-containing recombinant bacmid was subsequently generated in DH10Bac cell and the construct production was confirmed by a special PCR panel, using F specific primers and M13 universal primers. Results: Analysis of confirmatory tests showed that the recombinant bacmid, expressing of F-protein gene in correct sequence and framework, has been constructed successfully. Conclusion: The product of this F-containing recombinant bacmid, in addition to its independent application in the induction of protective immunity, can be used with the other individual recombinant baculoviruses, expressing HN and NP genes to produce NDV-VLPs in insect cell line.

  12. Structural and functional studies of FKHR-PAX3, a reciprocal fusion gene of the t(2;13 chromosomal translocation in alveolar rhabdomyosarcoma.

    Directory of Open Access Journals (Sweden)

    Qiande Hu

    Full Text Available Alveolar rhabdomyosarcoma (ARMS is an aggressive pediatric cancer of skeletal muscle. More than 70% of ARMS tumors carry balanced t(2;13 chromosomal translocation that leads to the production of two novel fusion genes, PAX3-FKHR and FKHR-PAX3. While the PAX3-FKHR gene has been intensely studied, the reciprocal FKHR-PAX3 gene has rarely been described. We report here the cloning and functional characterization of the FKHR-PAX3 gene as the first step towards a better understanding of its potential impact on ARMS biology. From RH30 ARMS cells, we detected and isolated three versions of FKHR-PAX3 cDNAs whose C-terminal sequences corresponded to PAX3c, PAX3d, and PAX3e isoforms. Unlike the nuclear-specific localization of PAX3-FKHR, the reciprocal FKHR-PAX3 proteins stayed predominantly in the cytoplasm. FKHR-PAX3 potently inhibited myogenesis in both non-transformed myoblast cells and ARMS cells. We showed that FKHR-PAX3 was not a classic oncogene but could act as a facilitator in oncogenic pathways by stabilizing PAX3-FKHR expression, enhancing cell proliferation, clonogenicity, anchorage-independent growth, and matrix adhesion in vitro, and accelerating the onset of tumor formation in xenograft mouse model in vivo. In addition to these pro-oncogenic behaviors, FKHR-PAX3 also negatively affected cell migration and invasion in vitro and lung metastasis in vivo. Taken together, these functional characteristics suggested that FKHR-PAX3 might have a critical role in the early stage of ARMS development.

  13. Depletion of Key Meiotic Genes and Transcriptome-Wide Abiotic Stress Reprogramming Mark Early Preparatory Events Ahead of Apomeiotic Transition

    Directory of Open Access Journals (Sweden)

    Jubin N Shah

    2016-10-01

    Full Text Available Molecular dissection of apomixis - an asexual reproductive mode - is anticipated to solve the enigma of loss of meiotic sex, and to help fixing elite agronomic traits. The Brassicaceae genus Boechera comprises of both sexual and apomictic species, permitting comparative analyses of meiotic circumvention (apomeiosis and parthenogenesis. Whereas previous studies reported local transcriptome changes during these events, it remained unclear whether global changes associated with hybridization, polyploidy and environmental adaptation that arose during evolution of Boechera might hint as (epigenetic regulators of early development prior apomictic initiation. To identify these signatures during vegetative stages, we compared seedling RNA-seq transcriptomes of an obligate triploid apomict and a diploid sexual, both isolated from a drought-prone habitat. Uncovered were several genes differentially expressed between sexual and apomictic seedlings, including homologues of meiotic genes ASYNAPTIC 1 (ASY1 and MULTIPOLAR SPINDLE 1 (MPS1 that were down-regulated in apomicts. An intriguing class of apomict-specific deregulated genes included several NAC transcription factors, homologues of which are known to be transcriptionally reprogrammed during abiotic stress in other plants. Deregulation of both meiotic and stress-response genes during seedling stages might possibly be important in preparation for meiotic circumvention, as similar transcriptional alteration was discernible in apomeiotic floral buds too. Furthermore, we noted that the apomict showed better tolerance to osmotic stress in vitro than the sexual, in conjunction with significant upregulation of a subset of NAC genes. In support of the current model that DNA methylation epigenetically regulates stress, ploidy, hybridization and apomixis, we noted that ASY1, MPS1 and NAC019 homologues were deregulated in Boechera seedlings upon DNA demethylation, and ASY1 in particular seems to be repressed by

  14. Fusion Physics

    Energy Technology Data Exchange (ETDEWEB)

    Kikuchi, Mitsuru; Lackner, Karl; Tran, Minh Quang [eds.

    2012-09-15

    Recreating the energy production process of the Sun - nuclear fusion - on Earth in a controlled fashion is one of the greatest challenges of this century. If achieved at affordable costs, energy supply security would be greatly enhanced and environmental degradation from fossil fuels greatly diminished. Fusion Physics describes the last fifty years or so of physics and research in innovative technologies to achieve controlled thermonuclear fusion for energy production. The International Atomic Energy Agency (IAEA) has been involved since its establishment in 1957 in fusion research. It has been the driving force behind the biennial conferences on Plasma Physics and Controlled Thermonuclear Fusion, today known as the Fusion Energy Conference. Hosted by several Member States, this biennial conference provides a global forum for exchange of the latest achievements in fusion research against the backdrop of the requirements for a net energy producing fusion device and, eventually, a fusion power plant. The scientific and technological knowledge compiled during this series of conferences, as well as by the IAEA Nuclear Fusion journal, is immense and will surely continue to grow in the future. It has led to the establishment of the International Thermonuclear Experimental Reactor (ITER), which represents the biggest experiment in energy production ever envisaged by humankind.

  15. Fusion breeder

    International Nuclear Information System (INIS)

    Moir, R.W.

    1982-01-01

    The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outline specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs

  16. Genomic Evidence of Chemotrophic Metabolisms in Deep-Dwelling Chloroflexi Conferred by Ancient Horizontal Gene Transfer Events

    Science.gov (United States)

    Momper, L. M.; Magnabosco, C.; Amend, J.; Osburn, M. R.; Fournier, G. P.

    2017-12-01

    The marine and terrestrial subsurface biospheres represent quite likely the largest reservoirs for life on Earth, directly impacting surface processes and global cycles throughout Earth's history. In the deep subsurface biosphere (DSB) organic carbon and energy are often extremely scarce. However, archaea and bacteria are able to persist in the DSB to at least 3.5 km below surface [1]. Understanding how they persist, and by what metabolisms they subsist, are key questions in this biosphere. To address these questions we investigated 5 global DSB environments: one legacy mine in South Dakota, USA, 3 mines in South Africa and marine fluids circulating beneath the Juan de Fuca Ridge. Boreholes within these mines provided access to fluids buried beneath the earth's surface and sampled depths down to 3.1 km. Geochemical data were collected concomitantly with DNA for metagenomic sequencing. We examined genomes of the ancient and deeply branching Chloroflexi for metabolic capabilities and interrogated the geochemical drivers behind those metabolisms with in situ thermodynamic modeling of reaction energetics. In total, 23 Chloroflexi genomes were identified and analyzed from the 5 subsurface sites. Genes for nitrate reduction (nar) and sulfite reduction (dsr) were found in many of the South Africa Chloroflexi but were absent from genomes collected in South Dakota. Indeed, nitrate reduction was among the most energetically favorable reactions in South African fluids (10-14 kJ cell-1 sec -1 per mol of reactant) and sulfur reduction with Fe2+ or H2 was also exergonic [2]. Conversely, genes for nitrite and nitrous oxide reduction (nrf, nir and nos) were found in genomes collected in South Dakota and Juan de Fuca, but not South Africa. We examined the origin of genes conferring these metabolisms in the Chloroflexi genomes. We discovered evidence for horizontal gene transfer (HGT) for all of these putative metabolisms. Retention of these genes in Chloroflexi lineages indicates

  17. Fusion Implementation

    International Nuclear Information System (INIS)

    Schmidt, J.A.

    2002-01-01

    If a fusion DEMO reactor can be brought into operation during the first half of this century, fusion power production can have a significant impact on carbon dioxide production during the latter half of the century. An assessment of fusion implementation scenarios shows that the resource demands and waste production associated with these scenarios are manageable factors. If fusion is implemented during the latter half of this century it will be one element of a portfolio of (hopefully) carbon dioxide limiting sources of electrical power. It is time to assess the regional implications of fusion power implementation. An important attribute of fusion power is the wide range of possible regions of the country, or countries in the world, where power plants can be located. Unlike most renewable energy options, fusion energy will function within a local distribution system and not require costly, and difficult, long distance transmission systems. For example, the East Coast of the United States is a prime candidate for fusion power deployment by virtue of its distance from renewable energy sources. As fossil fuels become less and less available as an energy option, the transmission of energy across bodies of water will become very expensive. On a global scale, fusion power will be particularly attractive for regions separated from sources of renewable energy by oceans

  18. A serotonin transporter gene polymorphism (5-HTTLPR), drinking-to-cope motivation, and negative life events among college students.

    Science.gov (United States)

    Armeli, Stephen; Conner, Tamlin S; Covault, Jonathan; Tennen, Howard; Kranzler, Henry R

    2008-11-01

    This study was performed to examine whether a polymorphism (5-HTTLPR) in the serotonin transporter gene was related to college students' reports of relief drinking (drinking-to-cope motives) and whether it moderated the associations between negative life events and drinking to cope. We examined reward drinking (drinking-to-enhance motives) as a comparison and to see whether these effects varied across gender. Using an Internet-based survey, college students (N = 360; 192 women) self-reported on drinking motives and negative life events for up to 4 years. Study participants provided saliva for genotyping the triallelic (LA vs LG or S) variants of 5-HTTLPR. Among men, individuals with two risk alleles (LG or S), compared with individuals with the LA/LA allele, displayed lower drinking-to-cope motives. Among women, individuals with one risk allele (either LG or S), compared with individuals with the LA/LA allele, displayed stronger drinking-to-enhance motives. The association between yearly changes in negative life events and drinking-to-cope motives varied across 5-HTTLPR genotype and gender and was strongest in the positive direction for women with the LA/LA variant. Our findings are not consistent with prior speculation that stronger positive associations between life stress and alcohol use among individuals with the LG or S allele are the result of increased use of alcohol as a method for coping with stress. The importance of examining gender differences in the relations between 5-HTTLPR, substance use, and related constructs is also noted.

  19. Paraoxonase 1 (Q192R) gene polymorphism, coronary heart disease and the risk of a new acute coronary event.

    Science.gov (United States)

    Martínez-Quintana, Efrén; Rodríguez-González, Fayna; Medina-Gil, José María; Garay-Sánchez, Paloma; Tugores, Antonio

    Paraoxonase 1 (PON1) plays a major role in the oxidation of low density lipoprotein and in the prevention of coronary atherogenesis. In this context, coding region polymorphisms of PON1 gene, responsible for the enzyme activity, has become of interest as a marker for atherogenesis. A study and follow-up was conducted on 529 patients with an acute coronary event in order to assess the association between the PON1 Q192R (rs662;A/G) polymorphism, the type of acute coronary syndrome, cardiovascular risk factors (arterial hypertension, diabetes mellitus, dyslipidaemia, and smoking), the extent and severity of coronary atherosclerosis, and the medium-term clinical follow-up. The QQ genotype was found in 245 (46.3%) patients, with 218 (41.2%) patients showing the QR genotype, and 66 (14.5%) patients had the RR genotype. No significant differences were found between the QQ and QR/RR genotypes as regards the clinical characteristics, the analytical data, and the angiographic variables. Similarly, Kaplan-Meier survival analysis showed no significant differences in presenting with a new acute coronary event (p=0.598), cardiac mortality (p=0.701), stent thrombosis (p=0.508), or stent re-stenosis (p=0.598) between QQ and QR/RR genotypes during the follow-up period (3.3±2.2 years). In patients with an acute coronary syndrome, the PON1 Q192R genotypes did not influence the risk of suffering a new acute coronary event during the medium-term follow-up. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

  20. [Eukaryotic expression of Leptospira interrogans lipL32/1-ompL1/1 fusion gene encoding genus-specific protein antigens and the immunoreactivity of expression products].

    Science.gov (United States)

    Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei

    2005-01-01

    To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific

  1. Isolation of probes specific to human chromosomal region 6p21 from immunoselected irradiation-fusion gene transfer hybrids

    International Nuclear Information System (INIS)

    Ragoussis, J.; Jones, T.A.; Sheer, D.; Shrimpton, A.E.; Goodfellow, P.N.; Trowsdale, J.; Ziegler, A.

    1991-01-01

    A hybrid cell line (R21/B1) containing a truncated human chromosome 6 (6pter-6q21) and a human Y chromosome on a hamster background was irradiated and fused to A23 (TK-) or W3GH (HPRT-) hamster cells. Clones containing expressed HLA class I genes (4/40) were selected using monoclonal antibodies. These clones were recloned and analyzed with a panel of probes from the HLA region. One hybrid (4G6) contained the entire HLA complex. Two other hybrids (4J4 and 4H2) contained only the HLA class I region, while the fourth hybrid (5P9) contained HLA class I and III genes in addition to other genes located in the 6p21 chromosomal region. In situ hybridization showed that the hybrid cells contained more than one fragment of human DNA. Alu and LINE PCR products were derived from these cells and compared to each other as well as to products from two somatic cell hybrids having the 6p21 region in common. The PCR fragments were then screened on conventional Southern blots of the somatic cell hybrids to select a panel of novel probes encompassing the 6p21 region. In addition, the origin of the human DNA fragments in hybrid 4J4 was determined by regional mapping of PCR products

  2. Detection and characterization of Newcastle disease virus in clinical samples using real time RT-PCR and melting curve analysis based on matrix and fusion genes amplification

    Directory of Open Access Journals (Sweden)

    Saad Sharawi

    2013-10-01

    Full Text Available Aim: Newcastle disease is still one of the major threats for poultry industry allover the world. Therefore, attempt was made in this study to use the SYBR Green I real-time PCR with melting curves analysis as for detection and differentiation of NDV strains in suspected infected birds. Materials and Methods: Two sets of primers were used to amplify matrix and fusion genes in samples collected from suspectly infected birds (chickens and pigeons. Melting curve analysis in conjunction with real time PCR was conducted for identifying different pathotypes of the isolated NDVs. Clinical samples were propagated on specific pathogen free ECE and tested for MDT and ICIP. Results: The velogenic NDVs isolated from chickens and pigeons were distinguished with mean T 85.03±0.341 and m 83.78±0.237 respectively for M-gene amplification and for F-gene amplification the mean T were 84.04±0.037 and m 84.53±0.223. On the other hand the lentogenic NDV isolates including the vaccinal strains (HB1 and LaSota have a higher mean T (86.99±0.021 for M-gene amplification and 86.50±0.063 for F-gene amplification. The test showed no reaction with m unrelated RNA samples. In addition, the results were in good agreement with both virus isolation and biological pathotyping (MDT and ICIP. The assay offers an attractive alternative method for the diagnosis of NDV that can be easily applied in laboratory diagnosis as a screening test for the detection and differentiation of NDV infections. Conclusion: As was shown by the successful rapid detection and pathotyping of 15 NDV strains in clinical samples representing velogenic and lentogenic NDV strains, and the agreement with the results of virus isolation , biological pathotyping and pathogenicity indices. The results of this report suggests that the described SybrGreen I real-time RT-PCR assay in conjunction with Melting curve analysis used as a rapid, specific and simple diagnostic tools for detection and pathotyping of

  3. Development of novel prime-boost strategies based on a tri-gene fusion recombinant L. tarentolae vaccine against experimental murine visceral leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Noushin Saljoughian

    Full Text Available Visceral leishmaniasis (VL is a vector-borne disease affecting humans and domestic animals that constitutes a serious public health problem in many countries. Although many antigens have been examined so far as protein- or DNA-based vaccines, none of them conferred complete long-term protection. The use of the lizard non-pathogenic to humans Leishmania (L. tarentolae species as a live vaccine vector to deliver specific Leishmania antigens is a recent approach that needs to be explored further. In this study, we evaluated the effectiveness of live vaccination in protecting BALB/c mice against L. infantum infection using prime-boost regimens, namely Live/Live and DNA/Live. As a live vaccine, we used recombinant L. tarentolae expressing the L. donovani A2 antigen along with cysteine proteinases (CPA and CPB without its unusual C-terminal extension (CPB(-CTE as a tri-fusion gene. For DNA priming, the tri-fusion gene was encoded in pcDNA formulated with cationic solid lipid nanoparticles (cSLN acting as an adjuvant. At different time points post-challenge, parasite burden and histopathological changes as well as humoral and cellular immune responses were assessed. Our results showed that immunization with both prime-boost A2-CPA-CPB(-CTE-recombinant L. tarentolae protects BALB/c mice against L. infantum challenge. This protective immunity is associated with a Th1-type immune response due to high levels of IFN-γ production prior and after challenge and with lower levels of IL-10 production after challenge, leading to a significantly higher IFN-γ/IL-10 ratio compared to the control groups. Moreover, this immunization elicited high IgG1 and IgG2a humoral immune responses. Protection in mice was also correlated with a high nitric oxide production and low parasite burden. Altogether, these results indicate the promise of the A2-CPA-CPB(-CTE-recombinant L. tarentolae as a safe live vaccine candidate against VL.

  4. Thermonuclear fusion

    International Nuclear Information System (INIS)

    Weisse, J.

    2000-01-01

    This document takes stock of the two ways of thermonuclear fusion research explored today: magnetic confinement fusion and inertial confinement fusion. The basic physical principles are recalled first: fundamental nuclear reactions, high temperatures, elementary properties of plasmas, ignition criterion, magnetic confinement (charged particle in a uniform magnetic field, confinement and Tokamak principle, heating of magnetized plasmas (ohmic, neutral particles, high frequency waves, other heating means), results obtained so far (scale laws and extrapolation of performances, tritium experiments, ITER project), inertial fusion (hot spot ignition, instabilities, results (Centurion-Halite program, laser experiments). The second part presents the fusion reactor and its associated technologies: principle (tritium production, heat source, neutron protection, tritium generation, materials), magnetic fusion (superconducting magnets, divertor (role, principle, realization), inertial fusion (energy vector, laser adaptation, particle beams, reaction chamber, stresses, chamber concepts (dry and wet walls, liquid walls), targets (fabrication, injection and pointing)). The third chapter concerns the socio-economic aspects of thermonuclear fusion: safety (normal operation and accidents, wastes), costs (costs structure and elementary comparison, ecological impact and external costs). (J.S.)

  5. Fusion devices

    International Nuclear Information System (INIS)

    Fowler, T.K.

    1977-01-01

    Three types of thermonuclear fusion devices currently under development are reviewed for an electric utilities management audience. Overall design features of laser fusion, tokamak, and magnetic mirror type reactors are described and illustrated. Thrusts and trends in current research on these devices that promise to improve performance are briefly reviewed. Twenty photographs and drawings are included

  6. Exercise-Induced Rhabdomyolysis and Stress-Induced Malignant Hyperthermia Events, Association with Malignant Hyperthermia Susceptibility, and RYR1 Gene Sequence Variations

    Directory of Open Access Journals (Sweden)

    Antonella Carsana

    2013-01-01

    Full Text Available Exertional rhabdomyolysis (ER and stress-induced malignant hyperthermia (MH events are syndromes that primarily afflict military recruits in basic training and athletes. Events similar to those occurring in ER and in stress-induced MH events are triggered after exposure to anesthetic agents in MH-susceptible (MHS patients. MH is an autosomal dominant hypermetabolic condition that occurs in genetically predisposed subjects during general anesthesia, induced by commonly used volatile anesthetics and/or the neuromuscular blocking agent succinylcholine. Triggering agents cause an altered intracellular calcium regulation. Mutations in RYR1 gene have been found in about 70% of MH families. The RYR1 gene encodes the skeletal muscle calcium release channel of the sarcoplasmic reticulum, commonly known as ryanodine receptor type 1 (RYR1. The present work reviews the documented cases of ER or of stress-induced MH events in which RYR1 sequence variations, associated or possibly associated to MHS status, have been identified.

  7. Expression of the RET/PTC fusion gene as a marker for papillary carcinoma in Hashimoto's thyroiditis

    DEFF Research Database (Denmark)

    Wirtschafter, A; Schmidt, R; Rosen, D

    1997-01-01

    specific genes in patients diagnosed with Hashimoto's disease. The newly identified oncogenes RET/PTC1 and RET/PTC3 provide useful and specific markers of the early stages of papillary carcinoma as they are highly specific for malignant cells. Using a sensitive and specific reverse transcriptase......-polymerase chain reaction (RT-PCR) assay, we found messenger RNA (mRNA) expression for the RET/PTC1 and RET/PTC3 oncogenes in 95% of the Hashimoto's patients studied. All Hashimoto's patients presenting without histopathologic evidence of papillary thyroid cancer showed molecular genetic evidence of cancer...

  8. Lister vaccine strain of vaccinia virus armed with the endostatin-angiostatin fusion gene: an oncolytic virus superior to dl1520 (ONYX-015) for human head and neck cancer.

    Science.gov (United States)

    Tysome, James R; Wang, Pengju; Alusi, Ghassan; Briat, Arnaud; Gangeswaran, Rathi; Wang, Jiwei; Bhakta, Vipul; Fodor, Istvan; Lemoine, Nick R; Wang, Yaohe

    2011-09-01

    Oncolytic viral therapy represents a promising strategy for the treatment of head and neck squamous cell carcinoma (HNSCC), with dl1520 (ONYX-015) the most widely used oncolytic adenovirus in clinical trials. This study aimed to determine the effectiveness of the Lister vaccine strain of vaccinia virus as well as a vaccinia virus armed with the endostatin-angiostatin fusion gene (VVhEA) as a novel therapy for HNSCC and to compare them with dl1520. The potency and replication of the Lister strain and VVhEA and the expression and function of the fusion protein were determined in human HNSCC cells in vitro and in vivo. Finally, the efficacy of VVhEA was compared with dl1520 in vivo in a human HNSCC model. The Lister vaccine strain of vaccinia virus was more effective than the adenovirus against all HNSCC cell lines tested in vitro. Although the potency of VVhEA was attenuated in vitro, the expression and function of the endostatin-angiostatin fusion protein was confirmed in HNSCC models both in vitro and in vivo. This novel vaccinia virus (VVhEA) demonstrated superior antitumor potency in vivo compared with both dl1520 and the control vaccinia virus. This study suggests that the Lister strain vaccinia virus armed with an endostatin-angiostatin fusion gene may be a potential therapeutic agent for HNSCC.

  9. C-reactive protein gene C1444T polymorphism and risk of recurrent ischemic events in patients with symptomatic intracranial atherostenoses.

    Science.gov (United States)

    Arenillas, Juan F; Massot, Andreu; Alvarez-Sabín, Jose; Fernandez-Cadenas, Israel; del Rio-Espinola, Albert; Chacon, Pilar; Quintana, Manuel; Molina, Carlos A; Rovira, Alex; Montaner, Joan

    2009-01-01

    High levels of C-reactive protein (CRP) are associated with an increased risk of further ischemic events in patients with symptomatic intracranial atherosclerotic disease (ICAD). It remains unknown to which extent this increased risk might be genetically predetermined. We aimed to investigate the relationship between a common genetic polymorphism of the CRP gene and the risk of recurrent ischemic events in symptomatic ICAD patients. We studied 75 consecutive patients with a first-ever cerebral ischemic event attributable to symptomatic ICAD. Blood samples were drawn 3 months after the qualifying event. Genomic DNA was isolated and the C1444T single nucleotide polymorphism (SNP) of the CRP gene was determined. The blood concentration of CRP was also measured. Patients underwent long-term clinical follow-up to detect the occurrence of further major ischemic events. During a median follow-up time of 23 months, 18 patients (24%) suffered a major ischemic event (10 ischemic strokes, 3 transient ischemic attacks and 5 myocardial infarctions). Raised CRP levels at baseline (p = 0.02) and the presence of the T allele within the CRP C1444T SNP were associated with a higher risk of recurrent ischemic events (p = 0.02). Kaplan-Meier and multivariable Cox regression analyses adjusted for age, sex, vascular risk factors and CRP level identified that the presence of the T allele in the studied polymorphism predicted the occurrence of further ischemic events (hazard ratio 3.6, 95% confidence interval 1.2-11.1; p = 0.025). The presence of the T allele within the CRP gene C1444T polymorphism may be associated with a higher risk of further ischemic events in symptomatic ICAD patients. (c) 2009 S. Karger AG, Basel.

  10. Atomic fusion, Gerrard atomic fusion

    International Nuclear Information System (INIS)

    Gerrard, T.H.

    1980-01-01

    In the approach to atomic fusion described here the heat produced in a fusion reaction, which is induced in a chamber by the interaction of laser beams and U.H.F. electromagnetic beams with atom streams, is transferred to a heat exchanger for electricity generation by a coolant flowing through a jacket surrounding the chamber. (U.K.)

  11. Coupling a universal DNA circuit with graphene sheets/polyaniline/AuNPs nanocomposites for the detection of BCR/ABL fusion gene

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xueping [Key Laboratory of Laboratory Medical Diagnostics of Education, Department of Laboratory Medicine, Chongqing Medical University, Chongqing, 400016 (China); Wang, Li [Key Laboratory of Laboratory Medical Diagnostics of Education, Department of Laboratory Medicine, Chongqing Medical University, Chongqing, 400016 (China); Department of Medical Laboratory, Chongqing Emergency Medical Center (Chongqing The Fourth Hospital), Chongqing, 400016 (China); Sheng, Shangchun [The No.2 Peoples' Hospital of Yibin, Sichuan, 644000 (China); Wang, Teng; Yang, Juan [Key Laboratory of Laboratory Medical Diagnostics of Education, Department of Laboratory Medicine, Chongqing Medical University, Chongqing, 400016 (China); Xie, Guoming, E-mail: guomingxie@cqmu.edu.cn [Key Laboratory of Laboratory Medical Diagnostics of Education, Department of Laboratory Medicine, Chongqing Medical University, Chongqing, 400016 (China); Feng, Wenli, E-mail: fengwlcqmu@sina.com [Key Laboratory of Laboratory Medical Diagnostics of Education, Department of Laboratory Medicine, Chongqing Medical University, Chongqing, 400016 (China)

    2015-08-19

    This article described a novel method by coupling a universal DNA circuit with graphene sheets/polyaniline/AuNPs nanocomposites (GS/PANI/AuNPs) for highly sensitive and specific detection of BCR/ABL fusion gene (bcr/abl) in chronic myeloid leukemia (CML). DNA circuit known as catalyzed hairpin assembly (CHA) is enzyme-free and can be simply operated to achieve exponential amplification, which has been widely employed in biosensing. However, application of CHA has been hindered by the need of specially redesigned sequences for each single-stranded DNA input. Herein, a transducer hairpin (HP) was designed to obtain a universal DNA circuit with favorable signal-to-background ratio. To further improve signal amplification, GS/PANI/AuNPs with excellent conductivity and enlarged effective area were introduced into this DNA circuit. Consequently, by combining the advantages of CHA and GS/PANI/AuNPs, bcr/abl could be detected in a linear range from 10 pM to 20 nM with a detection limit of 1.05 pM. Moreover, this protocol showed excellent specificity, good stability and was successfully applied for the detection of real sample, which demonstrated its great potential in clinical application. - Highlights: • A transducer hairpin was designed to improve the versatility of DNA circuit. • GS/PANI/AuNPs were introduced to the DNA circuit for further signal amplification. • The established biosensor displayed high sensitivity and good specificity.

  12. Differential roles of SS18-SSX fusion gene and insulin-like growth factor-1 receptor in synovial sarcoma cell growth

    International Nuclear Information System (INIS)

    Toernkvist, Maria; Natalishvili, Natalia; Xie Yuntao; Girnita, Ada; D'Arcy, Padraig; Brodin, Bertha; Axelson, Magnus; Girnita, Leonard

    2008-01-01

    Recently we demonstrated that the synovial sarcoma specific fusion gene SS18-SSX is crucial for cyclin D1 expression and is linked to cell proliferation. In this report we explore the role of SS18-SSX and IGF-1R for their potential functions in cellular proliferation and survival in cultured synovial sarcoma cells. We found that targeting of SS18-SSX mRNA by antisense oligonucleotide treatment drastically and rapidly decreased cell proliferation but caused only a slight increase of apoptosis. The synovial sarcoma cells were confirmed to express IGF-1R, and treatment with an IGF-1R inhibitor resulted in substantially reduced cell viability by inducing apoptosis in these cells. Conversely, inhibition of the IGF-1R resulted only in a slight to moderate decrease in DNA synthesis. In conclusion, SS18-SSX and IGF-1R seem to play important but different roles in maintaining malignant growth of synovial sarcoma cells. Whereas SS18-SSX maintains cyclin D1 and cell proliferation, IGF-1R protects from apoptosis

  13. Increased production of wax esters in transgenic tobacco plants by expression of a fatty acid reductase:wax synthase gene fusion.

    Science.gov (United States)

    Aslan, Selcuk; Hofvander, Per; Dutta, Paresh; Sun, Chuanxin; Sitbon, Folke

    2015-12-01

    Wax esters are hydrophobic lipids consisting of a fatty acid moiety linked to a fatty alcohol with an ester bond. Plant-derived wax esters are today of particular concern for their potential as cost-effective and sustainable sources of lubricants. However, this aspect is hampered by the fact that the level of wax esters in plants generally is too low to allow commercial exploitation. To investigate whether wax ester biosynthesis can be increased in plants using transgenic approaches, we have here exploited a fusion between two bacterial genes together encoding a single wax ester-forming enzyme, and targeted the resulting protein to chloroplasts in stably transformed tobacco (Nicotiana benthamiana) plants. Compared to wild-type controls, transgenic plants showed both in leaves and stems a significant increase in the total level of wax esters, being eight-fold at the whole plant level. The profiles of fatty acid methyl ester and fatty alcohol in wax esters were related, and C16 and C18 molecules constituted predominant forms. Strong transformants displayed certain developmental aberrations, such as stunted growth and chlorotic leaves and stems. These negative effects were associated with an accumulation of fatty alcohols, suggesting that an adequate balance between formation and esterification of fatty alcohols is crucial for a high wax ester production. The results show that wax ester engineering in transgenic plants is feasible, and suggest that higher yields may become achieved in the near future.

  14. Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

    Science.gov (United States)

    Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

    2011-12-01

    Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  15. Gene fusions AHRR-NCOA2, NCOA2-ETV4, ETV4-AHRR, P4HA2-TBCK, and TBCK-P4HA2 resulting from the translocations t(5;8;17)(p15;q13;q21) and t(4;5)(q24;q31) in a soft tissue angiofibroma.

    Science.gov (United States)

    Panagopoulos, Ioannis; Gorunova, Ludmila; Viset, Trond; Heim, Sverre

    2016-11-01

    We present an angiofibroma of soft tissue with the karyotype 46,XY,t(4;5)(q24;q31),t(5;8;17)(p15;q13;q21)[8]/46,XY,t(1;14)(p31;q32)[2]/46,XY[3]. RNA‑sequencing showed that the t(4;5)(q24;q31) resulted in recombination of the genes TBCK on 4q24 and P4HA2 on 5q31.1 with generation of an in‑frame TBCK‑P4HA2 and the reciprocal but out‑of‑frame P4HA2‑TBCK fusion transcripts. The putative TBCK‑P4HA2 protein would contain the kinase, the rhodanese‑like domain, and the Tre‑2/Bub2/Cdc16 (TBC) domains of TBCK together with the P4HA2 protein which is a component of the prolyl 4‑hydroxylase. The t(5;8;17)(p15;q13;q21) three‑way chromosomal translocation targeted AHRR (on 5p15), NCOA2 (on 8q13), and ETV4 (on 17q21) generating the in‑frame fusions AHRR‑NCOA2 and NCOA2‑ETV4 as well as an out‑of‑frame ETV4‑AHRR transcript. In the AHRR‑NCOA2 protein, the C‑terminal part of AHRR is replaced by the C‑terminal part of NCOA2 which contains two activation domains. The NCOA2‑ETV4 protein would contain the helix‑loop‑helix, PAS_9 and PAS_11, CITED domains, the SRC‑1 domain of NCOA2 and the ETS DNA‑binding domain of ETV4. No fusion gene corresponding to t(1;14)(p31;q32) was found. Our findings indicate that, in spite of the recurrence of AHRR‑NCOA2 in angiofibroma of soft tissue, additional genetic events (or fusion genes) might be required for the development of this tumor.

  16. Peaceful fusion

    Energy Technology Data Exchange (ETDEWEB)

    Englert, Matthias [IANUS, TU Darmstadt (Germany)

    2014-07-01

    Like other intense neutron sources fusion reactors have in principle a potential to be used for military purposes. Although the use of fissile material is usually not considered when thinking of fusion reactors (except in fusion-fission hybrid concepts) quantitative estimates about the possible production potential of future commercial fusion reactor concepts show that significant amounts of weapon grade fissile materials could be produced even with very limited amounts of source materials. In this talk detailed burnup calculations with VESTA and MCMATH using an MCNP model of the PPCS-A will be presented. We compare different irradiation positions and the isotopic vectors of the plutonium bred in different blankets of the reactor wall with the liquid lead-lithium alloy replaced by uranium. The technical, regulatory and policy challenges to manage the proliferation risks of fusion power will be addressed as well. Some of these challenges would benefit if addressed at an early stage of the research and development process. Hence, research on fusion reactor safeguards should start as early as possible and accompany the current research on experimental fusion reactors.

  17. Myoblast fusion in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Haralalka, Shruti [Stowers Institute for Medical Research, Kansas City, MO 64110 (United States); Abmayr, Susan M., E-mail: sma@stowers.org [Stowers Institute for Medical Research, Kansas City, MO 64110 (United States); Department of Anatomy and Cell Biology, University of Kansas Medical Center, Kansas City, MO 66160 (United States)

    2010-11-01

    The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

  18. Myoblast fusion in Drosophila

    International Nuclear Information System (INIS)

    Haralalka, Shruti; Abmayr, Susan M.

    2010-01-01

    The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

  19. Interleukin-1 beta gene deregulation associated with chromosomal rearrangement: A candidate initiating event for murine radiation-myeloid leukemogenesis

    International Nuclear Information System (INIS)

    Silver, A.; Boultwood, J.; Breckon, G.; Masson, W.; Adam, J.; Shaw, A.R.; Cox, R.

    1989-01-01

    The incidence of acute myeloid leukemia (AML) in CBA/H mice following exposure to single acute doses of ionizing radiation has previously been determined. A high proportion of these AMLs are characterized by rearrangement of murine chromosome 2 in the C2 and/or E5-F regions, and there is evidence that these events are a direct consequence of radiation damage to multipotential hemopoietic cells. Using a combination of in situ chromosome hybridization and mRNA analyses, we show that the cytokine gene interleukin-1 beta (IL-1 beta) is encoded in the chromosome 2 F region and is translocated in a chromosome 2---2 rearrangement in an x-ray-induced AML (N36). Also, IL-1 beta is specifically deregulated in N36 and in two other chromosome 2-rearranged AMLs but not in a fourth, which has two cytogenetically normal chromosome 2 copies. We suggest that radiation-induced specific chromosome 2 rearrangement associated with IL-1 beta deregulation may initiate murine leukemogenesis through the uncoupling of normal proliferative control mechanisms in multipotential hemopoietic cells

  20. Cold fusion

    International Nuclear Information System (INIS)

    Suh, Suk Yong; Sung, Ki Woong; Kang, Joo Sang; Lee, Jong Jik

    1995-02-01

    So called 'cold fusion phenomena' are not confirmed yet. Excess heat generation is very delicate one. Neutron generation is most reliable results, however, the records are erratic and the same results could not be repeated. So there is no reason to exclude the malfunction of testing instruments. The same arguments arise in recording 4 He, 3 He, 3 H, which are not rich in quantity basically. An experiment where plenty of 4 He were recorded is attached in appendix. The problem is that we are trying to search cold fusion which is permitted by nature or not. The famous tunneling effect in quantum mechanics will answer it, however, the most fusion rate is known to be negligible. The focus of this project is on the theme that how to increase that negligible fusion rate. 6 figs, 4 tabs, 1512 refs. (Author)

  1. Cold fusion

    Energy Technology Data Exchange (ETDEWEB)

    Suh, Suk Yong; Sung, Ki Woong; Kang, Joo Sang; Lee, Jong Jik [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1995-02-01

    So called `cold fusion phenomena` are not confirmed yet. Excess heat generation is very delicate one. Neutron generation is most reliable results, however, the records are erratic and the same results could not be repeated. So there is no reason to exclude the malfunction of testing instruments. The same arguments arise in recording {sup 4}He, {sup 3}He, {sup 3}H, which are not rich in quantity basically. An experiment where plenty of {sup 4}He were recorded is attached in appendix. The problem is that we are trying to search cold fusion which is permitted by nature or not. The famous tunneling effect in quantum mechanics will answer it, however, the most fusion rate is known to be negligible. The focus of this project is on the theme that how to increase that negligible fusion rate. 6 figs, 4 tabs, 1512 refs. (Author).

  2. Laser fusion

    International Nuclear Information System (INIS)

    Ashby, D.E.T.F.

    1976-01-01

    A short survey is given on laser fusion its basic concepts and problems and the present theoretical and experimental methods. The future research program of the USA in this field is outlined. (WBU) [de

  3. Fusion energy

    International Nuclear Information System (INIS)

    Anon.

    1979-01-01

    The efforts of the Chemical Technology Division in fusion energy include the areas of fuel handling, processing, and containment. Current studies are concerned largely with the development of vacuum pumps for fusion reactors and experiments and with development and evaluation of techniques for recovering tritium from solid or liquid breeding blankets. In addition, a small effort is devoted to support of the ORNL design of a major Tokamak experiment, The Next Step (TNS)

  4. Laser fusion

    International Nuclear Information System (INIS)

    Key, M.H.; Oxford Univ.

    1990-04-01

    The use of lasers to drive implosions for the purpose of inertially confined fusion is an area of intense activity where progress compares favourably with that made in magnetic fusion and there are significant prospects for future development. In this brief review the basic concept is summarised and the current status is outlined both in the area of laser technology and in the most recent results from implosion experiments. Prospects for the future are also considered. (author)

  5. Nuclear fusion

    International Nuclear Information System (INIS)

    Al-zaelic, M.M.

    2013-01-01

    Nuclear fusion can be relied on to solve the global energy crisis if the process of limiting the heat produced by the fusion reaction (Plasma) is successful. Currently scientists are progressively working on this aspect whereas there are two methods to limit the heat produced by fusion reaction, the two methods are auto-restriction using laser beam and magnetic restriction through the use of magnetic fields and research is carried out to improve these two methods. It is expected that at the end of this century the nuclear fusion energy will play a vital role in overcoming the global energy crisis and for these reasons, acquiring energy through the use of nuclear fusion reactors is one of the most urge nt demands of all mankind at this time. The conclusion given is that the source of fuel for energy production is readily available and inexpensive ( hydrogen atoms) and whole process is free of risks and hazards, especially to general health and the environment . Nuclear fusion importance lies in the fact that energy produced by the process is estimated to be about four to five times the energy produced by nuclear fission. (author)

  6. Low-dose gamma-rays and simulated solar particle event protons modify splenocyte gene and cytokine expression patterns

    International Nuclear Information System (INIS)

    Rizvi, A.; Pecaut, M.J.; Gridley, D.S.

    2011-01-01

    The goal was to investigate the T helper (Th) response in splenocytes of mice exposed to low-dose/low-dose-rate (LDR) γ-rays, simulated solar particle event protons (sSPE), or combination of both. C57BL/6 mice were exposed to LDR γ-radiation ( 57 Co) to a total dose of 0.05 Gray (Gy) at 0.024 cGy/h, either with or without subsequent exposure to 2 Gy sSPE protons. Expression of genes related to Th cells was evaluated immediately after exposure (day 0). On day 21, intra- and extracellular cytokine production was assessed after activation with anti-CD3 monoclonal antibodies (mAb) or phorbol 12-myristate 13-acetate/ionophore (PMA/I). Five genes were significantly modulated on day 0 in one or more of the irradiated groups compared to controls (p<0.05): Ccl11, Ccr5, Cd80, Inha, and Il9. On day 21, numbers of cells positive for interferon-γ were high in the LDR + sSPE group versus 0 Gy and LDR γ-rays (p<0.05), but there was no difference in interleukin (IL)-2 and tumor necrosis factor (TNF)-α. Levels of secreted cytokines after anti-CD3 mAb activation were high for 5 (maximum intensity projection (MIP)-1α, GM-CSF, interferon (IFN)-γ, TNF-α, IL-13) and low for 2 (IL-7, IL-9) in all irradiated groups. Priming with LDR photons had a significant effect on IFN-γ and IL-17 compared to sSPE protons alone; IL-2 was low only in the LDR + sSPE group. The cytokine patterns after anti-phorbol myristate acetate (PMA)/ionomycin (I) activation were different compared to anti-CD3 mAb and with fewer differences among groups. The data show that total-body exposure to space-relevant radiation has profound effects on Th cell status and that priming with LDR γ-rays can in some cases modulate the response to sSPE. (author)

  7. The multislice CT findings of renal carcinoma associated with XP11.2 translocation/TFE gene fusion and collecting duct carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Qingqiang; Zhu Wenrong; Chen Wenxin; Wu Jingtao [Subei People' s Hospital, Clinical School of Medical Coll., Yangzhou (China)], e-mail: wujingtaodoctor@163.com; Wang Zhongqiu [Dept. of Radiology, East Hospital, Tongji Univ. School of Medicine, Shanghai (China)

    2013-04-15

    Background: Renal cell carcinoma associated with Xp11.2 translocation and TFE gene fusion (Xp11.2/TFE RCC), and collecting duct carcinoma (CDC) are uncommon subtypes of renal cell carcinomas. Purpose: To investigate the multislice CT (MSCT) characteristics of these two tumor types. Material and Methods Nine patients with Xp11.2/TFE RCC and 10 patients with CDC were studied retrospectively. MSCT was undertaken to investigate differences in tumor characteristics and enhancement patterns. Results: All patients had single tumors centered in the renal medulla. Two patients with each tumor type had lymph node involvement and there was a single case of hepatic metastasis (Xp11.2/TFE RCC). The mean tumor diameter of Xp11.2/TFE RCC tumors was significantly larger than for CDC tumors. Two patients with Xp11.2/TFE RCC had cystic components as did eight patients with CDC (P < 0.05). Calcifications were present in six patients, each with CDC. Clear tumor boundaries were visible in two patients with CDC and in nine with Xp11.2/TFE RCC (P < 0.05). The density of Xp11.2/TFE RCC tumors was greater than that of CDC tumors, normal renal cortex, or medulla on unenhanced CT. Enhancement was higher with Xp11.2/TFE RCC than with CDC tumors during all phases. Xp11.2/TFE RCC enhancement was higher than in the renal medulla during cortical and medullary phase but lower than in normal renal medulla during the delayed phase. CDC tumor enhancement was lower than that for normal renal medulla during all enhanced phases. Conclusion: Both tumor types originated from the renal medulla. Distinguishing features included density on unenhanced CT, enhancement patterns, and capsule signs. Identifying these differences may aid diagnosis.

  8. Transient Co-Expression of Post-Transcriptional Gene Silencing Suppressors for Increased in Planta Expression of a Recombinant Anthrax Receptor Fusion Protein

    Directory of Open Access Journals (Sweden)

    Kittipong Rattanaporn

    2011-08-01

    Full Text Available Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin, CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA domain of human capillary morphogenesis 2 (CMG2, an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG. We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS: p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI, with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

  9. Transient co-expression of post-transcriptional gene silencing suppressors for increased in planta expression of a recombinant anthrax receptor fusion protein.

    Science.gov (United States)

    Arzola, Lucas; Chen, Junxing; Rattanaporn, Kittipong; Maclean, James M; McDonald, Karen A

    2011-01-01

    Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin), CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA) domain of human capillary morphogenesis 2 (CMG2), an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG). We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS): p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI), with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

  10. Transcriptomic events involved in melon mature-fruit abscission comprise the sequential induction of cell-wall degrading genes coupled to a stimulation of endo and exocytosis.

    Directory of Open Access Journals (Sweden)

    Jorge Corbacho

    Full Text Available Mature-fruit abscission (MFA in fleshy-fruit is a genetically controlled process with mechanisms that, contrary to immature-fruit abscission, has not been fully characterized. Here, we use pyrosequencing to characterize the transcriptomes of melon abscission zone (AZ at three stages during AZ-cell separation in order to understand MFA control at an early stage of AZ-activation.The results show that by early induction of MFA, the melon AZ exhibits major gene induction, while by late induction of MFA, melon AZ shows major gene repression. Although some genes displayed similar regulation in both early and late induction of abscission, such as EXT1-EXT4, EGase1, IAA2, ERF1, AP2D15, FLC, MADS2, ERAF17, SAP5 and SCL13 genes, the majority had different expression patterns. This implies that time-specific events occur during MFA, and emphasizes the value of characterizing multiple time-specific abscission transcriptomes. Analysis of gene-expression from these AZs reveal that a sequential induction of cell-wall-degrading genes is associated with the upregulation of genes involved in endo and exocytosis, and a shift in plant-hormone metabolism and signaling genes during MFA. This is accompanied by transcriptional activity of small-GTPases and synthaxins together with tubulins, dynamins, V-type ATPases and kinesin-like proteins potentially involved in MFA signaling. Early events are potentially controlled by down-regulation of MADS-box, AP2/ERF and Aux/IAA transcription-factors, and up-regulation of homeobox, zinc finger, bZIP, and WRKY transcription-factors, while late events may be controlled by up-regulation of MYB transcription-factors.Overall, the data provide a comprehensive view on MFA in fleshy-fruit, identifying candidate genes and pathways associated with early induction of MFA. Our comprehensive gene-expression profile will be very useful for elucidating gene regulatory networks of the MFA in fleshy-fruit.

  11. Driver Fusions and Their Implications in the Development and Treatment of Human Cancers

    NARCIS (Netherlands)

    Gao, Qingsong; Liang, Wen Wei; Foltz, Steven M.; Mutharasu, Gnanavel; Jayasinghe, Reyka G.; Cao, Song; Liao, Wen Wei; Reynolds, Sheila M.; Wyczalkowski, Matthew A.; Yao, Lijun; Yu, Lihua; Sun, Sam Q.; Caesar-Johnson, Samantha J.; Demchok, John A.; Felau, Ina; Kasapi, Melpomeni; Ferguson, Martin L.; Hutter, Carolyn M.; Sofia, Heidi J.; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C.; Zhang, Jiashan (Julia); Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Cho, Juok; DeFreitas, Timothy; Frazer, Scott; Gehlenborg, Nils; Getz, Gad; Heiman, David I.; Kim, Jaegil; Lawrence, Michael S.; Lin, Pei; Meier, Sam; Noble, Michael S.; Saksena, Gordon; Voet, Doug; Zhang, Hailei; Bernard, Brady; Chambwe, Nyasha; Dhankani, Varsha; Knijnenburg, Theo; Kramer, Roger; Leinonen, Kalle; Liu, Yuexin; Miller, Michael; Reynolds, Sheila; Shmulevich, Ilya; Thorsson, Vesteinn; Zhang, Wei; Akbani, Rehan; Broom, Bradley M.; Hegde, Apurva M.; Ju, Zhenlin; Kanchi, Rupa S.; Korkut, Anil; Li, Jun; Liang, Han; Ling, Shiyun; Liu, Wenbin; Lu, Yiling; Mills, Gordon B.; Ng, Kwok Shing; Rao, Arvind; Ryan, Michael; Wang, Jing; Weinstein, John N.; Zhang, Jiexin; Abeshouse, Adam; Armenia, Joshua; Chakravarty, Debyani; Chatila, Walid K.; de Bruijn, Ino; Gao, Jianjiong; Gross, Benjamin E.; Heins, Zachary J.; Kundra, Ritika; La, Konnor; Ladanyi, Marc; Luna, Augustin; Nissan, Moriah G.; Ochoa, Angelica; Phillips, Sarah M.; Reznik, Ed; Sanchez-Vega, Francisco; Sander, Chris; Schultz, Nikolaus; Sheridan, Robert; Sumer, S. Onur; Sun, Yichao; Taylor, Barry S.; Wang, Jioajiao; Zhang, Hongxin; Anur, Pavana; Peto, Myron; Spellman, Paul; Benz, Christopher; Stuart, Joshua M.; Wong, Christopher K.; Yau, Christina; Hayes, D. Neil; Parker, Joel S.; Wilkerson, Matthew D.; Ally, Adrian; Balasundaram, Miruna; Bowlby, Reanne; Brooks, Denise; Carlsen, Rebecca; Chuah, Eric; Dhalla, Noreen; Holt, Robert; Jones, Steven J.M.; Kasaian, Katayoon; Lee, Darlene; Ma, Yussanne; Marra, Marco A.; Mayo, Michael; Moore, Richard A.; Mungall, Andrew J.; Mungall, Karen; Robertson, A. Gordon; Sadeghi, Sara; Schein, Jacqueline E.; Sipahimalani, Payal; Tam, Angela; Thiessen, Nina; Tse, Kane; Wong, Tina; Berger, Ashton C.; Beroukhim, Rameen; Cherniack, Andrew D.; Cibulskis, Carrie; Gabriel, Stacey B.; Gao, Galen F.; Ha, Gavin; Meyerson, Matthew; Schumacher, Steven E.; Shih, Juliann; Kucherlapati, Melanie H.; Kucherlapati, Raju S.; Baylin, Stephen; Cope, Leslie; Danilova, Ludmila; Bootwalla, Moiz S.; Lai, Phillip H.; Maglinte, Dennis T.; Van Den Berg, David J.; Weisenberger, Daniel J.; Auman, J. Todd; Balu, Saianand; Bodenheimer, Tom; Fan, Cheng; Hoadley, Katherine A.; Hoyle, Alan P.; Jefferys, Stuart R.; Jones, Corbin D.; Meng, Shaowu; Mieczkowski, Piotr A.; Mose, Lisle E.; Perou, Amy H.; Perou, Charles M.; Roach, Jeffrey; Shi, Yan; Simons, Janae V.; Skelly, Tara; Soloway, Matthew G.; Tan, Donghui; Veluvolu, Umadevi; Fan, Huihui; Hinoue, Toshinori; Laird, Peter W.; Shen, Hui; Zhou, Wanding; Bellair, Michelle; Chang, Kyle; Covington, Kyle; Creighton, Chad J.; Dinh, Huyen; Doddapaneni, Harsha Vardhan; Donehower, Lawrence A.; Drummond, Jennifer; Gibbs, Richard A.; Glenn, Robert; Hale, Walker; Han, Yi; Hu, Jianhong; Korchina, Viktoriya; Lee, Sandra; Lewis, Lora; Li, Wei; Liu, Xiuping; Morgan, Margaret; Morton, Donna; Muzny, Donna; Santibanez, Jireh; Sheth, Margi; Shinbrot, Eve; Wang, Linghua; Wang, Min; Wheeler, David A.; Xi, Liu; Zhao, Fengmei; Hess, Julian; Appelbaum, Elizabeth L.; Bailey, Matthew; Cordes, Matthew G.; Ding, Li; Fronick, Catrina C.; Fulton, Lucinda A.; Fulton, Robert S.; Kandoth, Cyriac; Mardis, Elaine R.; McLellan, Michael D.; Miller, Christopher A.; Schmidt, Heather K.; Wilson, Richard K.; Crain, Daniel; Curley, Erin; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph; Penny, Robert; Shelton, Candace; Shelton, Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Bowen, Jay; Gastier-Foster, Julie M.; Gerken, Mark; Leraas, Kristen M.; Lichtenberg, Tara M.; Ramirez, Nilsa C.; Wise, Lisa; Zmuda, Erik; Corcoran, Niall; Costello, Tony; Hovens, Christopher; Carvalho, Andre L.; de Carvalho, Ana C.; Fregnani, José H.; Longatto-Filho, Adhemar; Reis, Rui M.; Scapulatempo-Neto, Cristovam; Silveira, Henrique C.S.; Vidal, Daniel O.; Burnette, Andrew; Eschbacher, Jennifer; Hermes, Beth; Noss, Ardene; Singh, Rosy; Anderson, Matthew L.; Castro, Patricia D.; Ittmann, Michael; Huntsman, David; Kohl, Bernard; Le, Xuan; Thorp, Richard; Andry, Chris; Duffy, Elizabeth R.; Lyadov, Vladimir; Paklina, Oxana; Setdikova, Galiya; Shabunin, Alexey; Tavobilov, Mikhail; McPherson, Christopher; Warnick, Ronald; Berkowitz, Ross; Cramer, Daniel; Feltmate, Colleen; Horowitz, Neil; Kibel, Adam; Muto, Michael; Raut, Chandrajit P.; Malykh, Andrei; Barnholtz-Sloan, Jill S.; Barrett, Wendi; Devine, Karen; Fulop, Jordonna; Ostrom, Quinn T.; Shimmel, Kristen; Wolinsky, Yingli; Sloan, Andrew E.; De Rose, Agostino; Giuliante, Felice; Goodman, Marc; Karlan, Beth Y.; Hagedorn, Curt H.; Eckman, John; Harr, Jodi; Myers, Jerome; Tucker, Kelinda; Zach, Leigh Anne; Deyarmin, Brenda; Hu, Hai; Kvecher, Leonid; Larson, Caroline; Mural, Richard J.; Somiari, Stella; Vicha, Ales; Zelinka, Tomas; Bennett, Joseph; Iacocca, Mary; Rabeno, Brenda; Swanson, Patricia; Latour, Mathieu; Lacombe, Louis; Têtu, Bernard; Bergeron, Alain; McGraw, Mary; Staugaitis, Susan M.; Chabot, John; Hibshoosh, Hanina; Sepulveda, Antonia; Su, Tao; Wang, Timothy; Potapova, Olga; Voronina, Olga; Desjardins, Laurence; Mariani, Odette; Roman-Roman, Sergio; Sastre, Xavier; Stern, Marc Henri; Cheng, Feixiong; Signoretti, Sabina; Berchuck, Andrew; Bigner, Darell; Lipp, Eric; Marks, Jeffrey; McCall, Shannon; McLendon, Roger; Secord, Angeles; Sharp, Alexis; Behera, Madhusmita; Brat, Daniel J.; Chen, Amy; Delman, Keith; Force, Seth; Khuri, Fadlo; Magliocca, Kelly; Maithel, Shishir; Olson, Jeffrey J.; Owonikoko, Taofeek; Pickens, Alan; Ramalingam, Suresh; Shin, Dong M.; Sica, Gabriel; Van Meir, Erwin G.; Zhang, Hongzheng; Eijckenboom, Wil; Gillis, Ad; Korpershoek, Esther; Looijenga, Leendert; Oosterhuis, Wolter; Stoop, Hans; van Kessel, Kim E.; Zwarthoff, Ellen C.; Calatozzolo, Chiara; Cuppini, Lucia; Cuzzubbo, Stefania; DiMeco, Francesco; Finocchiaro, Gaetano; Mattei, Luca; Perin, Alessandro; Pollo, Bianca; Chen, Chu; Houck, John; Lohavanichbutr, Pawadee; Hartmann, Arndt; Stoehr, Christine; Stoehr, Robert; Taubert, Helge; Wach, Sven; Wullich, Bernd; Kycler, Witold; Murawa, Dawid; Wiznerowicz, Maciej; Chung, Ki; Edenfield, W. Jeffrey; Martin, Julie; Baudin, Eric; Bubley, Glenn; Bueno, Raphael; De Rienzo, Assunta; Richards, William G.; Kalkanis, Steven; Mikkelsen, Tom; Noushmehr, Houtan; Scarpace, Lisa; Girard, Nicolas; Aymerich, Marta; Campo, Elias; Giné, Eva; Guillermo, Armando López; Van Bang, Nguyen; Hanh, Phan Thi; Phu, Bui Duc; Tang, Yufang; Colman, Howard; Evason, Kimberley; Dottino, Peter R.; Martignetti, John A.; Gabra, Hani; Juhl, Hartmut; Akeredolu, Teniola; Stepa, Serghei; Hoon, Dave; Ahn, Keunsoo; Kang, Koo Jeong; Beuschlein, Felix; Breggia, Anne; Birrer, Michael; Bell, Debra; Borad, Mitesh; Bryce, Alan H.; Castle, Erik; Chandan, Vishal; Cheville, John; Copland, John A.; Farnell, Michael; Flotte, Thomas; Giama, Nasra; Ho, Thai; Kendrick, Michael; Kocher, Jean Pierre; Kopp, Karla; Moser, Catherine; Nagorney, David; O'Brien, Daniel; O'Neill, Brian Patrick; Patel, Tushar; Petersen, Gloria; Que, Florencia; Rivera, Michael; Roberts, Lewis; Smallridge, Robert; Smyrk, Thomas; Stanton, Melissa; Thompson, R. Houston; Torbenson, Michael; Yang, Ju Dong; Zhang, Lizhi; Brimo, Fadi; Ajani, Jaffer A.; Gonzalez, Ana Maria Angulo; Behrens, Carmen; Bondaruk, Jolanta; Broaddus, Russell; Czerniak, Bogdan; Esmaeli, Bita; Fujimoto, Junya; Gershenwald, Jeffrey; Guo, Charles; Lazar, Alexander J.; Logothetis, Christopher; Meric-Bernstam, Funda; Moran, Cesar; Ramondetta, Lois; Rice, David; Sood, Anil; Tamboli, Pheroze; Thompson, Timothy; Troncoso, Patricia; Tsao, Anne; Wistuba, Ignacio; Carter, Candace; Haydu, Lauren; Hersey, Peter; Jakrot, Valerie; Kakavand, Hojabr; Kefford, Richard; Lee, Kenneth; Long, Georgina; Mann, Graham; Quinn, Michael; Saw, Robyn; Scolyer, Richard; Shannon, Kerwin; Spillane, Andrew; Stretch, Jonathan; Synott, Maria; Thompson, John; Wilmott, James; Al-Ahmadie, Hikmat; Chan, Timothy A.; Ghossein, Ronald; Gopalan, Anuradha; Levine, Douglas A.; Reuter, Victor; Singer, Samuel; Singh, Bhuvanesh; Tien, Nguyen Viet; Broudy, Thomas; Mirsaidi, Cyrus; Nair, Praveen; Drwiega, Paul; Miller, Judy; Smith, Jennifer; Zaren, Howard; Park, Joong Won; Hung, Nguyen Phi; Kebebew, Electron; Linehan, W. Marston; Metwalli, Adam R.; Pacak, Karel; Pinto, Peter A.; Schiffman, Mark; Schmidt, Laura S.; Vocke, Cathy D.; Wentzensen, Nicolas; Worrell, Robert; Yang, Hannah; Moncrieff, Marc; Goparaju, Chandra; Melamed, Jonathan; Pass, Harvey; Botnariuc, Natalia; Caraman, Irina; Cernat, Mircea; Chemencedji, Inga; Clipca, Adrian; Doruc, Serghei; Gorincioi, Ghenadie; Mura, Sergiu; Pirtac, Maria; Stancul, Irina; Tcaciuc, Diana; Albert, Monique; Alexopoulou, Iakovina; Arnaout, Angel; Bartlett, John; Engel, Jay; Gilbert, Sebastien; Parfitt, Jeremy; Sekhon, Harman; Thomas, George; Rassl, Doris M.; Rintoul, Robert C.; Bifulco, Carlo; Tamakawa, Raina; Urba, Walter; Hayward, Nicholas; Timmers, Henri; Antenucci, Anna; Facciolo, Francesco; Grazi, Gianluca; Marino, Mirella; Merola, Roberta; de Krijger, Ronald; Gimenez-Roqueplo, Anne Paule; Piché, Alain; Chevalier, Simone; McKercher, Ginette; Birsoy, Kivanc; Barnett, Gene; Brewer, Cathy; Farver, Carol; Naska, Theresa; Pennell, Nathan A.; Raymond, Daniel; Schilero, Cathy; Smolenski, Kathy; Williams, Felicia; Morrison, Carl; Borgia, Jeffrey A.; Liptay, Michael J.; Pool, Mark; Seder, Christopher W.; Junker, Kerstin; Omberg, Larsson; Dinkin, Mikhail; Manikhas, George; Alvaro, Domenico; Bragazzi, Maria Consiglia; Cardinale, Vincenzo; Carpino, Guido; Gaudio, Eugenio; Chesla, David; Cottingham, Sandra; Dubina, Michael; Moiseenko, Fedor; Dhanasekaran, Renumathy; Becker, Karl Friedrich; Janssen, Klaus Peter; Slotta-Huspenina, Julia; Abdel-Rahman, Mohamed H.; Aziz, Dina; Bell, Sue; Cebulla, Colleen M.; Davis, Amy; Duell, Rebecca; Elder, J. Bradley; Hilty, Joe; Kumar, Bahavna; Lang, James; Lehman, Norman L.; Mandt, Randy; Nguyen, Phuong; Pilarski, Robert; Rai, Karan; Schoenfield, Lynn; Senecal, Kelly; Wakely, Paul; Hansen, Paul; Lechan, Ronald; Powers, James; Tischler, Arthur; Grizzle, William E.; Sexton, Katherine C.; Kastl, Alison; Henderson, Joel; Porten, Sima; Waldmann, Jens; Fassnacht, Martin; Asa, Sylvia L.; Schadendorf, Dirk; Couce, Marta; Graefen, Markus; Huland, Hartwig; Sauter, Guido; Schlomm, Thorsten; Simon, Ronald; Tennstedt, Pierre; Olabode, Oluwole; Nelson, Mark; Bathe, Oliver; Carroll, Peter R.; Chan, June M.; Disaia, Philip; Glenn, Pat; Kelley, Robin K.; Landen, Charles N.; Phillips, Joanna; Prados, Michael; Simko, Jeffry; Smith-McCune, Karen; VandenBerg, Scott; Roggin, Kevin; Fehrenbach, Ashley; Kendler, Ady; Sifri, Suzanne; Steele, Ruth; Jimeno, Antonio; Carey, Francis; Forgie, Ian; Mannelli, Massimo; Carney, Michael; Hernandez, Brenda; Campos, Benito; Herold-Mende, Christel; Jungk, Christin; Unterberg, Andreas; von Deimling, Andreas; Bossler, Aaron; Galbraith, Joseph; Jacobus, Laura; Knudson, Michael; Knutson, Tina; Ma, Deqin; Milhem, Mohammed; Sigmund, Rita; Godwin, Andrew K.; Madan, Rashna; Rosenthal, Howard G.; Adebamowo, Clement; Adebamowo, Sally N.; Boussioutas, Alex; Beer, David; Giordano, Thomas; Mes-Masson, Anne Marie; Saad, Fred; Bocklage, Therese; Landrum, Lisa; Mannel, Robert; Moore, Kathleen; Moxley, Katherine; Postier, Russel; Walker, Joan; Zuna, Rosemary; Feldman, Michael; Valdivieso, Federico; Dhir, Rajiv; Luketich, James; Pinero, Edna M.Mora; Quintero-Aguilo, Mario; Carlotti, Carlos Gilberto; Dos Santos, Jose Sebastião; Kemp, Rafael; Sankarankuty, Ajith; Tirapelli, Daniela; Catto, James; Agnew, Kathy; Swisher, Elizabeth; Creaney, Jenette; Robinson, Bruce; Shelley, Carl Simon; Godwin, Eryn M.; Kendall, Sara; Shipman, Cassaundra; Bradford, Carol; Carey, Thomas; Haddad, Andrea; Moyer, Jeffey; Peterson, Lisa; Prince, Mark; Rozek, Laura; Wolf, Gregory; Bowman, Rayleen; Fong, Kwun M.; Yang, Ian; Korst, Robert; Rathmell, W. Kimryn; Fantacone-Campbell, J. Leigh; Hooke, Jeffrey A.; Kovatich, Albert J.; Shriver, Craig D.; DiPersio, John; Drake, Bettina; Govindan, Ramaswamy; Heath, Sharon; Ley, Timothy; Van Tine, Brian; Westervelt, Peter; Rubin, Mark A.; Lee, Jung Il; Aredes, Natália D.; Mariamidze, Armaz; Chen, Ken; Lazar, Alexander J.; Fields, Ryan C.; Wendl, Michael C.; Van Tine, Brian A.; Vij, Ravi; Chen, Feng; Nykter, Matti; Shmulevich, Ilya; Ding, Li

    2018-01-01

    Gene fusions represent an important class of somatic alterations in cancer. We systematically investigated fusions in 9,624 tumors across 33 cancer types using multiple fusion calling tools. We identified a total of 25,664 fusions, with a 63% validation rate. Integration of gene expression, copy

  12. Cold fusion

    International Nuclear Information System (INIS)

    Koster, J.

    1989-01-01

    In this contribution the author the phenomenom of so-called cold fusion, inspired by the memorable lecture of Moshe Gai on his own search for this effect. Thus much of what follows was presented by Dr. Gai; the rest is from independent reading. What is referred to as cold fusion is of course the observation of possible products of deuteron-deuteron (d-d) fusion within deuterium-loaded (dentended) electrodes. The debate over the two vanguard cold fusion experiments has raged under far more public attention than usually accorded new scientific phenomena. The clamor commenced with the press conference of M. Fleishmann and S. Pons on March 23, 1989 and the nearly simultaneous wide circulation of a preprint of S. Jones and collaborators. The majority of work attempting to confirm these observations has at the time of this writing yet to appear in published form, but contributions to conferences and electronic mail over computer networks were certainly filled with preliminary results. To keep what follows to a reasonable length the author limit this discussion to the searches for neutron (suggested by ref. 2) or for excessive heat production (suggested by ref. 1), following a synopsis of the hypotheses of cold fusion

  13. Fusion technology 1998

    International Nuclear Information System (INIS)

    Beaumont, B.; Libeyre, P.; Gentile, B. de; Tonon, G.

    1998-01-01

    The Symposium On Fusion Technology (SOFT) is held every two years with the objective to set the stage for the exchange of information on the design, construction and operation of fusion experiments and on the technology which is being developed for the next step devices and fusion reactors. By decision of the International Organizing Committee, the 20. SOFT includes invited talks, and oral and poster contributions in the following topics: plasma facing components, plasma heating and current drive, plasma engineering and control, experimental systems and diagnostics, magnets and power supplies, fuel technologies, remote operation, blanket and shield technologies, safety and environment, and system engineering and future devices. This symposium differs from the previous ones of this series by the way the present proceedings are produced. In order to have the written material available to the participants and the community at the nearest to the conference event, the papers have been collected 2 months in advance and printed in the present books. The goal was to deliver them to each participant upon arrival to the conference centre. These books contain all the papers corresponding to poster presentation, and the abstracts of the oral contributions and invited papers. The papers corresponding to these presentations, both oral and invited, will be published in 1999, after a standard review process, in a supplement of Fusion Engineering and Design. (author)

  14. Oncogenic Activation of Fibroblast Growth Factor Receptor-3 and RAS Genes as Non-Overlapping Mutual Exclusive Events in Urinary Bladder Cancer.

    Science.gov (United States)

    Pandith, Arshad A; Hussain, Aashaq; Khan, Mosin S; Shah, Zafar A; Wani, M Saleem; Siddiqi, Mushtaq A

    2016-01-01

    Urinary bladder cancer is a common malignancy in the West and ranks as the 7th most common cancer in our region of Kashmir, India. FGFR3 mutations are frequent in superficial urothelial carcinoma (UC) differing from the RAS gene mutational pattern. The aim of this study was to analyze the frequency and association of FGFR3 and RAS gene mutations in UC cases. Paired tumor and adjacent normal tissue specimens of 65 consecutive UC patients were examined. DNA preparations were evaluated for the occurrence of FGFR3 and RAS gene mutations by PCR-SCCP and DNA sequencing. Somatic point mutations of FGFR3 were identified in 32.3% (21 of 65). The pattern and distribution were significantly associated with low grade/stage (<0.05). The overall mutations in exon 1 and 2 in all the forms of RAS genes aggregated to 21.5% and showed no association with any clinic-pathological parameters. In total, 53.8% (35 of 65) of the tumors studied had mutations in either a RAS or FGFR3 gene, but these were totally mutually exclusive in and none of the samples showed both the mutational events in mutually exclusive RAS and FGFR3. We conclude that RAS and FGFR3 mutations in UC are mutually exclusive and non-overlapping events which reflect activation of oncogenic pathways through different elements.

  15. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

    Science.gov (United States)

    Boulila, Moncef

    2010-06-01

    To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

  16. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  17. Nuclear fusion

    International Nuclear Information System (INIS)

    Huber, H.

    1978-01-01

    A comprehensive survey is presented of the present state of knowledge in nuclear fusion research. In the first part, potential thermonuclear reactions, basic energy balances of the plasma (Lawson criterion), and the main criteria to be observed in the selection of appropriate thermonuclear reactions are dealt with. This is followed by a discussion of the problems encountered in plasma physics (plasma confinement and heating, transport processes, plasma impurities, plasma instabilities and plasma diagnostics) and by a consideration of the materials problems involved, such as material of the first wall, fuel inlet and outlet, magnetic field generation, as well as repair work and in-service inspections. Two main methods have been developed to tackle these problems: reactor concepts using the magnetic pinch (stellarator, Tokamak, High-Beta reactors, mirror machines) on the one hand, and the other concept using the inertial confinement (laser fusion reactor). These two approaches and their specific problems as well as past, present and future fusion experiments are treated in detail. The last part of the work is devoted to safety and environmental aspects of the potential thermonuclear aspects of the potential thermonuclear reactor, discussing such problems as fusion-specific hazards, normal operation and potential hazards, reactor incidents, environmental pollution by thermal effluents, radiological pollution, radioactive wastes and their disposal, and siting problems. (orig./GG) [de

  18. Short fusion

    CERN Multimedia

    2002-01-01

    French and UK researchers are perfecting a particle accelerator technique that could aid the quest for fusion energy or make X-rays that are safer and produce higher-resolution images. Led by Dr Victor Malka from the Ecole Nationale Superieure des Techniques Avancees in Paris, the team has developed a better way of accelerating electrons over short distances (1 page).

  19. Magnetic fusion

    International Nuclear Information System (INIS)

    2002-01-01

    This document is a detailed lecture on thermonuclear fusion. The basic physics principles are recalled and the technological choices that have led to tokamaks or stellarators are exposed. Different aspects concerning thermonuclear reactors such as safety, economy and feasibility are discussed. Tore-supra is described in details as well as the ITER project

  20. Cold fusion

    International Nuclear Information System (INIS)

    Seo, Suk Yong; You, Jae Jun

    1996-01-01

    Nearly every technical information is chased in the world. All of them are reviewed and analyzed. Some of them are chosen to study further more to review every related documents. And a probable suggestion about the excitonic process in deuteron absorbed condensed matter is proposed a way to cold fusion. 8 refs. (Author)

  1. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    Directory of Open Access Journals (Sweden)

    Jacobs Jeanne ME

    2011-10-01

    Full Text Available Abstract Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.. Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM, Phthorimaea operculella (Zeller. Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event.

  2. Effects of subtherapeutic concentrations of antimicrobials on gene acquisition events in Yersinia, Proteus, Shigella, and Salmonella recipient organisms in isolated ligated intestinal loops of swine.

    Science.gov (United States)

    Brewer, Matt T; Xiong, Nalee; Anderson, Kristi L; Carlson, Steve A

    2013-08-01

    To assess antimicrobial resistance and transfer of virulence genes facilitated by subtherapeutic concentrations of antimicrobials in swine intestines. 20 anesthetized pigs experimentally inoculated with donor and recipient bacteria. 4 recipient pathogenic bacteria (Salmonella enterica serotype Typhimurium, Yersinia enterocolitica, Shigella flexneri, or Proteus mirabilis) were incubated with donor bacteria in the presence of subinhibitory concentrations of 1 of 16 antimicrobials in isolated ligated intestinal loops in swine. Donor Escherichia coli contained transferrable antimicrobial resistance or virulence genes. After coincubations, intestinal contents were removed and assessed for pathogens that acquired new antimicrobial resistance or virulence genes following exposure to the subtherapeutic concentrations of antimicrobials. 3 antimicrobials (apramycin, lincomycin, and neomycin) enhanced transfer of an antimicrobial resistance plasmid from commensal E coli organisms to Yersinia and Proteus organisms, whereas 7 antimicrobials (florfenicol, hygromycin, penicillin G, roxarsone, sulfamethazine, tetracycline, and tylosin) exacerbated transfer of an integron (Salmonella genomic island 1) from Salmonella organisms to Yersinia organisms. Sulfamethazine induced the transfer of Salmonella pathogenicity island 1 from pathogenic to nonpathogenic Salmonella organisms. Six antimicrobials (bacitracin, carbadox, erythromycin, sulfathiazole, tiamulin, and virginiamycin) did not mediate any transfer events. Sulfamethazine was the only antimicrobial implicated in 2 types of transfer events. 10 of 16 antimicrobials at subinhibitory or subtherapeutic concentrations augmented specific antimicrobial resistance or transfer of virulence genes into pathogenic bacteria in isolated intestinal loops in swine. Use of subtherapeutic antimicrobials in animal feed may be associated with unwanted collateral effects.

  3. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  4. Cold fusion, Alchemist's dream

    International Nuclear Information System (INIS)

    Clayton, E.D.

    1989-09-01

    In this report the following topics relating to cold fusion are discussed: muon catalysed cold fusion; piezonuclear fusion; sundry explanations pertaining to cold fusion; cosmic ray muon catalysed cold fusion; vibrational mechanisms in excited states of D 2 molecules; barrier penetration probabilities within the hydrogenated metal lattice/piezonuclear fusion; branching ratios of D 2 fusion at low energies; fusion of deuterons into 4 He; secondary D+T fusion within the hydrogenated metal lattice; 3 He to 4 He ratio within the metal lattice; shock induced fusion; and anomalously high isotopic ratios of 3 He/ 4 He

  5. Magnetic fusion; La fusion magnetique

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-07-01

    This document is a detailed lecture on thermonuclear fusion. The basic physics principles are recalled and the technological choices that have led to tokamaks or stellarators are exposed. Different aspects concerning thermonuclear reactors such as safety, economy and feasibility are discussed. Tore-supra is described in details as well as the ITER project.

  6. Mitochondrial fusion is increased by the nuclear coactivator PGC-1beta.

    Directory of Open Access Journals (Sweden)

    Marc Liesa

    Full Text Available There is no evidence to date on whether transcriptional regulators are able to shift the balance between mitochondrial fusion and fission events through selective control of gene expression.Here, we demonstrate that reduced mitochondrial size observed in knock-out mice for the transcriptional regulator PGC-1beta is associated with a selective reduction in Mitofusin 2 (Mfn2 expression, a mitochondrial fusion protein. This decrease in Mfn2 is specific since expression of the remaining components of mitochondrial fusion and fission machinery were not affected. Furthermore, PGC-1beta increases mitochondrial fusion and elongates mitochondrial tubules. This PGC-1beta-induced elongation specifically requires Mfn2 as this process is absent in Mfn2-ablated cells. Finally, we show that PGC-1beta increases Mfn2 promoter activity and transcription by coactivating the nuclear receptor Estrogen Related Receptor alpha (ERRalpha.Taken together, our data reveal a novel mechanism by which mammalian cells control mitochondrial fusion. In addition, we describe a novel role of PGC-1beta in mitochondrial physiology, namely the control of mitochondrial fusion mainly through Mfn2.

  7. Splenogonadal Fusion

    Directory of Open Access Journals (Sweden)

    Sung-Lang Chen

    2008-11-01

    Full Text Available Splenogonadal fusion (SGF is a rare congenital non-malignant anomaly characterized by fusion of splenic tissue to the gonad, and can be continuous or discontinuous. Very few cases have been diagnosed preoperatively, and many patients who present with testicular swelling undergo unnecessary orchiectomy under the suspicion of testicular neoplasm. A 16-year-old boy presented with a left scrotal mass and underwent total excision of a 1.6-cm tumor without damaging the testis, epididymis or its accompanying vessels. Pathologic examination revealed SFG (discontinuous type. If clinically suspected before surgery, the diagnosis may be confirmed by Tc-99m sulfur colloid imaging, which shows uptake in both the spleen and accessory splenic tissue within the scrotum. Frozen section should be considered if there remains any doubt regarding the diagnosis during operation.

  8. Interactions between the vascular endothelial growth factor gene polymorphism and life events in susceptibility to major depressive disorder in a Chinese population.

    Science.gov (United States)

    Han, Dong; Qiao, Zhengxue; Chen, Lu; Qiu, Xiaohui; Fang, Deyu; Yang, Xiuxian; Ma, Jingsong; Chen, Mingqi; Yang, Jiarun; Wang, Lin; Zhu, Xiongzhao; Zhang, Congpei; Yang, Yanjie; Pan, Hui

    2017-08-01

    Recent studies suggest that vascular endothelial growth factor (VEGF) is involved in the development of major depressive disorder. The aim of this study is to investigate the interaction between vascular endothelial growth factor (VEGF) polymorphism (+405G/C, rs2010963) and negative life events in the pathogenesis of major depressive disorder (MDD). DNA genotyping was performed on peripheral blood leukocytes in 274 patients with MDD and 273 age-and sex-matched controls. The frequency and severity of negative life events were assessed by the Life Events Scale (LES). A logistics method was employed to assess the gene-environment interaction (G×E). Differences in rs2010963 genotype distributions were observed between MDD patients and controls. Significant G×E interactions between allelic variation of rs2010963 and negative life events were observed. Individuals carrying the C alleles were susceptible to MDD only when exposed to high-negative life events. These results indicate that interactions between the VEGF rs2010963 polymorphism and environment increases the risk of developing MDD. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Fusion of the subunits α and β of succinyl-CoA synthetase as a phylogenetic marker for Pezizomycotina fungi

    Directory of Open Access Journals (Sweden)

    Amanda M. Koire

    2011-01-01

    Full Text Available Gene fusions, yielding the formation of multidomain proteins, are evolutionary events that can be utilized as phylogenetic markers. Here we describe a fusion gene comprising the α and β subunits of succinyl-coA synthetase, an enzyme of the TCA cycle, in Pezizomycotina fungi. This fusion is present in all Pezizomycotina with complete genome sequences and absent from all other organisms. Phylogenetic analysis of the α and β subunits of succinyl-CoA synthetase suggests that both subunits were duplicated and retained in Pezizomycotina while one copy was lost from other fungi. One of the duplicated copies was then fused in Pezizomycotina. Our results suggest that the fusion of the α and β subunits of succinyl-CoA synthetase can be used as a molecular marker for membership in the Pezizomycotina subphylum. If a species has the fusion it can be reliably classified as Pezizomycotina, while the absence of the fusion is suggestive that the species is not a member of this subphylum.

  10. Fusion spectroscopy

    International Nuclear Information System (INIS)

    Peacock, N.J.

    1995-09-01

    This article traces developments in the spectroscopy of high temperature laboratory plasma used in controlled fusion research from the early 1960's until the present. These three and a half decades have witnessed many orders of magnitude increase in accessible plasma parameters such as density and temperature as well as particle and energy confinement timescales. Driven by the need to interpret the radiation in terms of the local plasma parameters, the thrust of fusion spectroscopy has been to develop our understanding of (i) the atomic structure of highly ionised atoms, usually of impurities in the hydrogen isotope fuel; (ii) the atomic collision rates and their incorporation into ionization structure and emissivity models that take into account plasma phenomena like plasma-wall interactions, particle transport and radiation patterns; (iii) the diagnostic applications of spectroscopy aided by increasingly sophisticated characterisation of the electron fluid. These topics are discussed in relation to toroidal magnetically confined plasmas, particularly the Tokamak which appears to be the most promising approach to controlled fusion to date. (author)

  11. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Energy Technology Data Exchange (ETDEWEB)

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia); Slamka, Tomas; Martinicky, David; Ilencikova, Denisa [National Cancer Institute, Department of Oncologic Genetics, Klenova 1, 833 01 Bratislava (Slovakia); Bartosova, Zdena [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia)

    2009-11-20

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  12. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Directory of Open Access Journals (Sweden)

    Ilencikova Denisa

    2009-11-01

    Full Text Available Abstract Background Depending on the population studied, large genomic rearrangements (LGRs of the mismatch repair (MMR genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC. It has been reported that loss of heterozygosity (LOH at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. Methods The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. Results We found six rearrangements in the MSH2 gene (five deletions and dup5-6, and one aberration in the MLH1 gene (del5-6. The MSH2 deletions were of three types (del1, del1-3, del1-7. We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. Conclusion LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1

  13. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    International Nuclear Information System (INIS)

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova; Slamka, Tomas; Martinicky, David; Ilencikova, Denisa; Bartosova, Zdena

    2009-01-01

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  14. Gene expression profiling of preovulatory follicle in the buffalo cow: effects of increased IGF-I concentration on periovulatory events.

    Directory of Open Access Journals (Sweden)

    Jyotsna U Rao

    Full Text Available The preovulatory follicle in response to gonadotropin surge undergoes dramatic biochemical, and morphological changes orchestrated by expression changes in hundreds of genes. Employing well characterized bovine preovulatory follicle model, granulosa cells (GCs and follicle wall were collected from the preovulatory follicle before, 1, 10 and 22 h post peak LH surge. Microarray analysis performed on GCs revealed that 450 and 111 genes were differentially expressed at 1 and 22 h post peak LH surge, respectively. For validation, qPCR and immunocytochemistry analyses were carried out for some of the differentially expressed genes. Expression analysis of many of these genes showed distinct expression patterns in GCs and the follicle wall. To study molecular functions and genetic networks, microarray data was analyzed using Ingenuity Pathway Analysis which revealed majority of the differentially expressed genes to cluster within processes like steroidogenesis, cell survival and cell differentiation. In the ovarian follicle, IGF-I is established to be an important regulator of the above mentioned molecular functions. Thus, further experiments were conducted to verify the effects of increased intrafollicular IGF-I levels on the expression of genes associated with the above mentioned processes. For this purpose, buffalo cows were administered with exogenous bGH to transiently increase circulating and intrafollicular concentrations of IGF-I. The results indicated that increased intrafollicular concentrations of IGF-I caused changes in expression of genes associated with steroidogenesis (StAR, SRF and apoptosis (BCL-2, FKHR, PAWR. These results taken together suggest that onset of gonadotropin surge triggers activation of various biological pathways and that the effects of growth factors and peptides on gonadotropin actions could be examined during preovulatory follicle development.

  15. LDL receptor-GFP fusion proteins: new tools for the characterization of disease-causing mutations in the LDL receptor gene

    DEFF Research Database (Denmark)

    Holst, Henrik Uffe; Dagnæs-Hansen, Frederik; Corydon, Thomas Juhl

    2001-01-01

    . In cultured liver cells this mutation was found to inhibit the transport of LDL receptor GFP fusion protein to the cell surface, thus leading to impaired internalisation of fluorescent labelled LDL. Co-locallisation studies confirmed the retention of the mutant protein in the endoplasmic reticulum....

  16. Early detection of clinically significant prostate cancer at diagnosis: a prospective study using a novel panel of TMPRSS2:ETS fusion gene markers

    International Nuclear Information System (INIS)

    Chan, Sam W.; Nguyen, Phuong-Nam; Violette, Philippe; Brimo, Fadi; Taguchi, Yosh; Aprikian, Armen; Chen, Junjian Z.

    2013-01-01

    We explore noninvasive clinical applications of multiple disease-specific fusion markers recently discovered in prostate cancer to predict the risk of cancer occurrence and aggressiveness at diagnosis. A total of 92 men who were prostate-specific antigen (PSA) screened and scheduled for diagnostic biopsy were enrolled for this study. Prospectively collected urine was blind coded for laboratory tests. RNA from urine sediments was analyzed using a panel of 6 TMPRSS2:ETS fusion markers with a sensitive quantitative PCR platform. The pathology reported 39 biopsy-positive cases from 92 patients (42.4%). In urine test, 10 unique combinations of fusion types were detected in 32 of 92 (34.8%) prebiopsy samples. A novel combination of fusion markers, termed Fx (III, IV, ETS), was identified with a sensitivity of 51.3% and an odds ratio of 10.1 in detecting cancer on biopsy. Incorporating a categorical variable of Fx (III, IV, ETS) with urine PCA3 and serum PSA, a regression model was developed to predict biopsy outcomes with an overall accuracy of 77%. Moreover, the overexpression of Fx (III, IV, or ETS) was shown to be an independent predictor to the high-grade cancer, with a predictive accuracy of 80% when coupled with PSA density. The individualized risk scores further stratified a high-risk group that is composed of 92% high-grade cancers and a low-risk group that harbors mainly clinically insignificant cancers. In conclusion, we have identified a novel combination of fusion types very specific to the clinically significant prostate cancer and developed effective regression models to predict biopsy outcomes and aggressive cancers at diagnosis

  17. Temporal variations in the gene expression levels of cyanobacterial anti-oxidant enzymes through geological history: implications for biological evolution during the Great Oxidation Event

    Science.gov (United States)

    Harada, M.; Furukawa, R.; Yokobori, S. I.; Tajika, E.; Yamagishi, A.

    2016-12-01

    A significant rise in atmospheric O2 levels during the GOE (Great Oxidation Event), ca. 2.45-2.0 Ga, must have caused a great stress to biosphere, enforcing life to adapt to oxic conditions. Cyanobacteria, oxygenic photosynthetic bacteria that had been responsible for the GOE, are at the same time one of the organisms that would have been greatly affected by the rise of O2 level in the surface environments. Knowledge on the evolution of cyanobacteria is not only important to elucidate the cause of the GOE, but also helps us to better understand the adaptive evolution of life in response to the GOE. Here we performed phylogenetic analysis of an anti-oxidant enzyme Fe-SOD (iron superoxide dismutase) of cyanobacteria, to assess the adaptive evolution of life under the GOE. The rise of O2 level must have increased the level of toxic reactive oxygen species in cyanobacterial cells, thus forced them to change activities or the gene expression levels of Fe-SOD. In the present study, we focus on the change in the gene expression levels of the enzyme, which can be estimated from the promoter sequences of the gene. Promoters are DNA sequences found upstream of protein encoding regions, where RNA polymerase binds and initiates transcription. "Strong" promoters that efficiently interact with RNA polymerase induce high rates of transcription, leading to high levels of gene expression. Thus, from the temporal changes in the promoter sequences, we can estimate the variations in the gene expression levels during the geological time. Promoter sequences of Fe-SOD at each ancestral node of cyanobacteria were predicted from phylogenetic analysis, and the ancestral promoter sequences were compared to the promoters of known highly expressed genes. The similarity was low at the time of the emergence of cyanobacteria; however, increased at the branching nodes diverged 2.4 billon years ago. This roughly coincided with the onset of the GOE, implying that the transition from low to high gene

  18. Low TLR7 gene expression in atherosclerotic plaques is associated with major adverse cardio- and cerebrovascular events

    DEFF Research Database (Denmark)

    Karadimou, Glykeria; Folkersen, Lasse; Berg, Martin

    2016-01-01

    Aims: Processes in the development of atherosclerotic lesions can lead to plaque rupture or erosion, which can in turn elicit myocardial infarction or ischaemic stroke. The aims of this study were to determine whether Toll-like receptor 7 (TLR7) gene expression levels influence patient outcome an...

  19. Fusion Machines

    International Nuclear Information System (INIS)

    Weynants, R.R.

    2004-01-01

    A concise overview is given of the principles of inertial and magnetic fusion, with an emphasis on the latter in view of the aim of this summer school. The basis of magnetic confinement in mirror and toroidal geometry is discussed and applied to the tokamak concept. A brief discussion of the reactor prospects of this configuration identifies which future developments are crucial and where alternative concepts might help in optimising the reactor design. The text also aims at introducing the main concepts encountered in tokamak research that will be studied and used in the subsequent lectures

  20. Identification and analysis of Eimeria nieschulzi gametocyte genes reveal splicing events of gam genes and conserved motifs in the wall-forming proteins within the genus Eimeria (Coccidia, Apicomplexa

    Directory of Open Access Journals (Sweden)

    Wiedmer Stefanie

    2017-01-01

    Full Text Available The genus Eimeria (Apicomplexa, Coccidia provides a wide range of different species with different hosts to study common and variable features within the genus and its species. A common characteristic of all known Eimeria species is the oocyst, the infectious stage where its life cycle starts and ends. In our study, we utilized Eimeria nieschulzi as a model organism. This rat-specific parasite has complex oocyst morphology and can be transfected and even cultivated in vitro up to the oocyst stage. We wanted to elucidate how the known oocyst wall-forming proteins are preserved in this rodent Eimeria species compared to other Eimeria. In newly obtained genomics data, we were able to identify different gametocyte genes that are orthologous to already known gam genes involved in the oocyst wall formation of avian Eimeria species. These genes appeared putatively as single exon genes, but cDNA analysis showed alternative splicing events in the transcripts. The analysis of the translated sequence revealed different conserved motifs but also dissimilar regions in GAM proteins, as well as polymorphic regions. The occurrence of an underrepresented gam56 gene version suggests the existence of a second distinct E. nieschulzi genotype within the E. nieschulzi Landers isolate that we maintain.

  1. Identification and analysis of Eimeria nieschulzi gametocyte genes reveal splicing events of gam genes and conserved motifs in the wall-forming proteins within the genus Eimeria (Coccidia, Apicomplexa)

    Science.gov (United States)

    Wiedmer, Stefanie; Erdbeer, Alexander; Volke, Beate; Randel, Stephanie; Kapplusch, Franz; Hanig, Sacha; Kurth, Michael

    2017-01-01

    The genus Eimeria (Apicomplexa, Coccidia) provides a wide range of different species with different hosts to study common and variable features within the genus and its species. A common characteristic of all known Eimeria species is the oocyst, the infectious stage where its life cycle starts and ends. In our study, we utilized Eimeria nieschulzi as a model organism. This rat-specific parasite has complex oocyst morphology and can be transfected and even cultivated in vitro up to the oocyst stage. We wanted to elucidate how the known oocyst wall-forming proteins are preserved in this rodent Eimeria species compared to other Eimeria. In newly obtained genomics data, we were able to identify different gametocyte genes that are orthologous to already known gam genes involved in the oocyst wall formation of avian Eimeria species. These genes appeared putatively as single exon genes, but cDNA analysis showed alternative splicing events in the transcripts. The analysis of the translated sequence revealed different conserved motifs but also dissimilar regions in GAM proteins, as well as polymorphic regions. The occurrence of an underrepresented gam56 gene version suggests the existence of a second distinct E. nieschulzi genotype within the E. nieschulzi Landers isolate that we maintain. PMID:29210668

  2. Fusion Canada issue 10

    International Nuclear Information System (INIS)

    1990-02-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on Fusion Materials Research, ITER physics research, fusion performance record at JET, and design options for reactor building. 4 figs

  3. Gene conversion events and variable degree of homogenization of rDNA loci in cultivars of Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Sochorova, Jana; Coriton, O.; Kuderová, Alena; Lunerová Bedřichová, Jana; Chevre, A.-M.; Kovařík, Aleš

    2017-01-01

    Roč. 119, č. 1 (2017), s. 13-26 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA13-10057S Institutional support: RVO:68081707 Keywords : ribosomal-rna genes * concerted evolution * intergenic spacer Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 4.041, year: 2016

  4. Recombination Events Involving the atp9 Gene Are Associated with Male Sterility of CMS PET2 in Sunflower.

    Science.gov (United States)

    Reddemann, Antje; Horn, Renate

    2018-03-11

    Cytoplasmic male sterility (CMS) systems represent ideal mutants to study the role of mitochondria in pollen development. In sunflower, CMS PET2 also has the potential to become an alternative CMS source for commercial sunflower hybrid breeding. CMS PET2 originates from an interspecific cross of H. petiolaris and H. annuus as CMS PET1, but results in a different CMS mechanism. Southern analyses revealed differences for atp6 , atp9 and cob between CMS PET2, CMS PET1 and the male-fertile line HA89. A second identical copy of atp6 was present on an additional CMS PET2-specific fragment. In addition, the atp9 gene was duplicated. However, this duplication was followed by an insertion of 271 bp of unknown origin in the 5' coding region of the atp9 gene in CMS PET2, which led to the creation of two unique open reading frames orf288 and orf231 . The first 53 bp of orf288 are identical to the 5' end of atp9 . Orf231 consists apart from the first 3 bp, being part of the 271-bp-insertion, of the last 228 bp of atp9 . These CMS PET2-specific orfs are co-transcribed. All 11 editing sites of the atp9 gene present in orf231 are fully edited. The anther-specific reduction of the co-transcript in fertility-restored hybrids supports the involvement in male-sterility based on CMS PET2.

  5. Recombination Events Involving the atp9 Gene Are Associated with Male Sterility of CMS PET2 in Sunflower

    Directory of Open Access Journals (Sweden)

    Antje Reddemann

    2018-03-01

    Full Text Available Cytoplasmic male sterility (CMS systems represent ideal mutants to study the role of mitochondria in pollen development. In sunflower, CMS PET2 also has the potential to become an alternative CMS source for commercial sunflower hybrid breeding. CMS PET2 originates from an interspecific cross of H. petiolaris and H. annuus as CMS PET1, but results in a different CMS mechanism. Southern analyses revealed differences for atp6, atp9 and cob between CMS PET2, CMS PET1 and the male-fertile line HA89. A second identical copy of atp6 was present on an additional CMS PET2-specific fragment. In addition, the atp9 gene was duplicated. However, this duplication was followed by an insertion of 271 bp of unknown origin in the 5′ coding region of the atp9 gene in CMS PET2, which led to the creation of two unique open reading frames orf288 and orf231. The first 53 bp of orf288 are identical to the 5′ end of atp9. Orf231 consists apart from the first 3 bp, being part of the 271-bp-insertion, of the last 228 bp of atp9. These CMS PET2-specific orfs are co-transcribed. All 11 editing sites of the atp9 gene present in orf231 are fully edited. The anther-specific reduction of the co-transcript in fertility-restored hybrids supports the involvement in male-sterility based on CMS PET2.

  6. Genetic recombination variation in wild Robertsonian mice: on the role of chromosomal fusions and Prdm9 allelic background

    OpenAIRE

    Capilla, Laia; Medarde, Nuria; Alemany-Schmidt, Alexandra; Oliver-Bonet, Maria; Ventura, Jacint; Ruiz-Herrera, Aurora

    2014-01-01

    Despite the existence of formal models to explain how chromosomal rearrangements can be fixed in a population in the presence of gene flow, few empirical data are available regarding the mechanisms by which genome shuffling contributes to speciation, especially in mammals. In order to shed light on this intriguing evolutionary process, here we present a detailed empirical study that shows how Robertsonian (Rb) fusions alter the chromosomal distribution of recombination events during the forma...

  7. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  8. Neurotensin receptor 1 gene activation by the Tcf/beta-catenin pathway is an early event in human colonic adenomas.

    Science.gov (United States)

    Souazé, Frédérique; Viardot-Foucault, Véronique; Roullet, Nicolas; Toy-Miou-Leong, Mireille; Gompel, Anne; Bruyneel, Erik; Comperat, Eva; Faux, Maree C; Mareel, Marc; Rostène, William; Fléjou, Jean-François; Gespach, Christian; Forgez, Patricia

    2006-04-01

    Alterations in the Wnt/APC (adenomatous polyposis coli) signalling pathway, resulting in beta-catenin/T cell factor (Tcf)-dependent transcriptional gene activation, are frequently detected in familial and sporadic colon cancers. The neuropeptide neurotensin (NT) is widely distributed in the gastrointestinal tract. Its proliferative and survival effects are mediated by a G-protein coupled receptor, the NT1 receptor. NT1 receptor is not expressed in normal colon epithelial cells, but is over expressed in a number of cancer cells and tissues suggesting a link to the outgrowth of human colon cancer. Our results demonstrate that the upregulation of NT1 receptor occurring in colon cancer is the result of Wnt/APC signalling pathway activation. We first established the functionality of the Tcf response element within the NT1 receptor promoter. Consequently, we observed the activation of NT1 receptor gene by agents causing beta-catenin cytosolic accumulation, as well as a strong decline of endogenous receptor when wt-APC was restored. At the cellular level, the re-establishment of wt-APC phenotype resulted in the impaired functionality of NT1 receptor, like the breakdown in NT-induced intracellular calcium mobilization and the loss of NT pro-invasive effect. We corroborated the Wnt/APC signalling pathway on the NT1 receptor promoter activation with human colon carcinogenesis, and showed that NT1 receptor gene activation was perfectly correlated with nuclear or cytoplasmic beta-catenin localization while NT1 receptor was absent when beta-catenin was localized at the cell-cell junction in early adenomas of patients with familial adenomatous polyposis, hereditary non-polyposis colorectal cancer and loss of heterozygosity tumours. In this report we establish a novel link in vitro between the Tcf/beta-catenin pathway and NT1 receptor promoter activation.

  9. Centrosome clustering and cyclin D1 gene amplification in double minutes are common events in chromosomal unstable bladder tumors

    International Nuclear Information System (INIS)

    Rey, Javier del; Prat, Esther; Ponsa, Immaculada; Lloreta, Josep; Gelabert, Antoni; Algaba, Ferran; Camps, Jordi; Miró, Rosa

    2010-01-01

    Aneuploidy, centrosome abnormalities and gene amplification are hallmarks of chromosome instability (CIN) in cancer. Yet there are no studies of the in vivo behavior of these phenomena within the same bladder tumor. Twenty-one paraffin-embedded bladder tumors were analyzed by conventional comparative genome hybridization and fluorescence in situ hybridization (FISH) with a cyclin D1 gene (CCND1)/centromere 11 dual-color probe. Immunofluorescent staining of α, β and γ tubulin was also performed. Based on the CIN index, defined as the percentage of cells not displaying the modal number for chromosome 11, tumors were classified as CIN-negative and CIN-positive. Fourteen out of 21 tumors were considered CIN-positive. All T1G3 tumors were included in the CIN-positive group whereas the majority of Ta samples were classified as CIN-negative tumors. Centrosome clustering was observed in six out of 12 CIN-positive tumors analyzed. CCND1 amplification in homogeneously staining regions was present in six out of 14 CIN-positive tumors; three of them also showed amplification of this gene in double minutes. Complex in vivo behavior of CCND1 amplicon in bladder tumor cells has been demonstrated by accurate FISH analysis on paraffin-embedded tumors. Positive correlation between high heterogeneity, centrosome abnormalities and CCND1 amplification was found in T1G3 bladder carcinomas. This is the first study to provide insights into the coexistence of CCND1 amplification in homogeneously staining regions and double minutes in primary bladder tumors. It is noteworthy that those patients whose tumors showed double minutes had a significantly shorter overall survival rate (p < 0.001)

  10. Revitalizing Fusion via Fission Fusion

    Science.gov (United States)

    Manheimer, Wallace

    2001-10-01

    Existing tokamaks could generate significant nuclear fuel. TFTR, operating steady state with DT might generate enough fuel for a 300 MW nuclear reactor. The immediate goals of the magnetic fusion program would necessarily shift from a study of advanced plasma regimes in larger sized devices, to mostly known plasmas regimes, but at steady state or high duty cycle operation in DT plasmas. The science and engineering of breeding blankets would be equally important. Follow on projects could possibly produce nuclear fuel in large quantity at low price. Although today there is strong opposition to nuclear power in the United States, in a 21st century world of 10 billion people, all of whom will demand a middle class life style, nuclear energy will be important. Concern over greenhouse gases will also drive the world toward nuclear power. There are studies indicating that the world will need 10 TW of carbon free energy by 2050. It is difficult to see how this can be achieved without the breeding of nuclear fuel. By using the thorium cycle, proliferation risks are minimized. [1], [2]. 1 W. Manheimer, Fusion Technology, 36, 1, 1999, 2.W. Manheimer, Physics and Society, v 29, #3, p5, July, 2000

  11. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    Directory of Open Access Journals (Sweden)

    Tartar Aurélien

    2010-06-01

    Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting

  12. The Interacting Effect of the BDNF Val66Met Polymorphism and Stressful Life Events on Adolescent Depression Is Not an Artifact of Gene-Environment Correlation: Evidence from a Longitudinal Twin Study

    Science.gov (United States)

    Chen, Jie; Li, Xinying; McGue, Matt

    2013-01-01

    Background: Confounding introduced by gene-environment correlation (rGE) may prevent one from observing a true gene-environment interaction (G × E) effect on psychopathology. The present study investigated the interacting effect of the BDNF Val66Met polymorphism and stressful life events (SLEs) on adolescent depression while controlling for the…

  13. Catalysed fusion

    CERN Document Server

    Farley, Francis

    2012-01-01

    A sizzling romance and a romp with subatomic particles at CERN. Love, discovery and adventure in the city where nations meet and beams collide. Life in a large laboratory. As always, the challenges are the same. Who leads? Who follows? Who succeeds? Who gets the credit? Who gets the women or the men? Young Jeremy arrives in CERN and joins the quest for green energy. Coping with baffling jargon and manifold dangers, he is distracted by radioactive rats, lovely ladies and an unscrupulous rival. Full of doubts and hesitations, he falls for a dazzling Danish girl, who leads him astray. His brilliant idea leads to a discovery and a new route to cold fusion. But his personal life is scrambled. Does it bring fame or failure? Tragedy or triumph?

  14. Fusion cuisine

    DEFF Research Database (Denmark)

    Peters, Chris; Broersma, Marcel

    2018-01-01

    JJournalism studies as an academic field is characterized by multidisciplinarity. Focusing on one object of study, journalism and the news, it established itself by integrating and synthesizing approaches from established disciplines – a tendency that lives on today. This constant gaze to the out......JJournalism studies as an academic field is characterized by multidisciplinarity. Focusing on one object of study, journalism and the news, it established itself by integrating and synthesizing approaches from established disciplines – a tendency that lives on today. This constant gaze...... to the outside for conceptual inspiration and methodological tools lends itself to a journalism studies that is a fusion cuisine of media, communication, and related scholarship. However, what happens when this object becomes as fragmented and multifaceted as the ways we study it? This essay addresses...

  15. Pollination: a key event controlling the expression of genes related to phytohormone biosynthesis during grapevine berry formation.

    Science.gov (United States)

    Kühn, Nathalie; Arce-Johnson, Patricio

    2012-01-01

    Berry formation is the process of ovary conversion into a functional fruit, and is characterized by abrupt changes in the content of several phytohormones, associated with pollination and fertilization. Much effort has been made in order to improve our understanding of berry development, particularly from veraison to post-harvest time. However, the period of berry formation has been poorly investigated, despite its importance. Phytohormones are involved in the control of fruit formation; hence it is important to understand the regulation of their content at this stage. Grapevine is an excellent fleshy-fruit plant model since its fruits have particularities that differentiate them from those of commonly studied organisms. For instance, berries are prepared to cope with stress by producing several antioxidants and they are non-climacteric fruits. Also its genome is fully sequenced, which allows to identify genes involved in developmental processes. In grapevine, no link has been established between pollination and phytohormone biosynthesis, until recently. Here we highlight relevant findings regarding pollination effect on gene expression related to phytohormone biosynthesis, and present unpublished results showing how quickly this effect is achieved.

  16. SimFuse: A Novel Fusion Simulator for RNA Sequencing (RNA-Seq Data

    Directory of Open Access Journals (Sweden)

    Yuxiang Tan

    2015-01-01

    Full Text Available The performance evaluation of fusion detection algorithms from high-throughput sequencing data crucially relies on the availability of data with known positive and negative cases of gene rearrangements. The use of simulated data circumvents some shortcomings of real data by generation of an unlimited number of true and false positive events, and the consequent robust estimation of accuracy measures, such as precision and recall. Although a few simulated fusion datasets from RNA Sequencing (RNA-Seq are available, they are of limited sample size. This makes it difficult to systematically evaluate the performance of RNA-Seq based fusion-detection algorithms. Here, we present SimFuse to address this problem. SimFuse utilizes real sequencing data as the fusions’ background to closely approximate the distribution of reads from a real sequencing library and uses a reference genome as the template from which to simulate fusions’ supporting reads. To assess the supporting read-specific performance, SimFuse generates multiple datasets with various numbers of fusion supporting reads. Compared to an extant simulated dataset, SimFuse gives users control over the supporting read features and the sample size of the simulated library, based on which the performance metrics needed for the validation and comparison of alternative fusion-detection algorithms can be rigorously estimated.

  17. Towards nuclear fusion reactors

    International Nuclear Information System (INIS)

    1993-11-01

    The results of nuclear fusion researches in JAERI are summarized. In this report, following themes are collected: the concept of fusion reactor (including ITER), fusion reactor safety, plasma confinement, fusion reactor equipment, and so on. Includes glossary. (J.P.N.)

  18. Fusion Canada issue 28

    International Nuclear Information System (INIS)

    1995-06-01

    A short bulletin from the National Fusion Program highlighting in this issue the Canada - US fusion meeting in Montreal, fusion breeder work in Chile, new management at CFFTP, fast electrons in tokamaks: new data from TdeV, a program review of CCFM and Velikhov to address Montreal fusion meeting. 1 fig

  19. Fusion systems engineering

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    Summaries of research are included for each of the following topics: (1) fusion reactor systems studies, (2) development of blanket processing technology for fusion reactors, (3) safety studies of fusion concepts, (4) the MACK/MACKLIB system for nuclear response functions, and (5) energy storage and power supply systems for fusion reactors

  20. Association of single nucleotide polymorphisms in a glutamate receptor gene (GRM8) with theta power of event-related oscillations and alcohol dependence.

    Science.gov (United States)

    Chen, Andrew C H; Tang, Yongqiang; Rangaswamy, Madhavi; Wang, Jen C; Almasy, Laura; Foroud, Tatiana; Edenberg, Howard J; Hesselbrock, Victor; Nurnberger, John; Kuperman, Samuel; O'Connor, Sean J; Schuckit, Marc A; Bauer, Lance O; Tischfield, Jay; Rice, John P; Bierut, Laura; Goate, Alison; Porjesz, Bernice

    2009-04-05

    Evidence suggests the P3 amplitude of the event-related potential and its underlying superimposed event-related oscillations (EROs), primarily in the theta (4-5 Hz) and delta (1-3 Hz) frequencies, as endophenotypes for the risk of alcoholism and other disinhibitory disorders. Major neurochemical substrates contributing to theta and delta rhythms and P3 involve strong GABAergic, cholinergic and glutamatergic system interactions. The aim of this study was to test the potential associations between single nucleotide polymorphisms (SNPs) in glutamate receptor genes and ERO quantitative traits. GRM8 was selected because it maps at chromosome 7q31.3-q32.1 under the peak region where we previously identified significant linkage (peak LOD = 3.5) using a genome-wide linkage scan of the same phenotype (event-related theta band for the target visual stimuli). Neural activities recorded from scalp electrodes during a visual oddball task in which rare target elicited P3s were analyzed in a subset of the Collaborative Study on the Genetics of Alcoholism (COGA) sample comprising 1,049 Caucasian subjects from 209 families (with 472 DSM-IV alcohol dependent individuals). The family-based association test (FBAT) detected significant association (P power to target visual stimuli, and also with alcohol dependence, even after correction for multiple comparisons by false discovery rate (FDR). Our results suggest that variation in GRM8 may be involved in modulating event-related theta oscillations during information processing and also in vulnerability to alcoholism. These findings underscore the utility of electrophysiology and the endophenotype approach in the genetic study of psychiatric disorders. (c) 2008 Wiley-Liss, Inc.

  1. Single histidine residue in head-group region is sufficient to impart remarkable gene transfection properties to cationic lipids: evidence for histidine-mediated membrane fusion at acidic pH.

    Science.gov (United States)

    Kumar, V V; Pichon, C; Refregiers, M; Guerin, B; Midoux, P; Chaudhuri, A

    2003-08-01

    Presence of endosome-disrupting multiple histidine functionalities in the molecular architecture of cationic polymers, such as polylysine, has previously been demonstrated to significantly enhance their in vitro gene delivery efficiencies. Towards harnessing improved transfection property through covalent grafting of endosome-disrupting single histidine functionality in the molecular structure of cationic lipids, herein, we report on the design, the synthesis and the transfection efficiency of two novel nonglycerol-based histidylated cationic amphiphiles. We found that L-histidine-(N,N-di-n-hexadecylamine)ethylamide (lipid 1) and L-histidine-(N,N-di-n-hexadecylamine,-N-methyl)ethylamide (lipid 2) in combination with cholesterol gave efficient transfections into various cell lines. The transfection efficiency of Chol/lipid 1 lipoplexes into HepG2 cells was two order of magnitude higher than that of FuGENE(TM)6 and DC-Chol lipoplexes, whereas it was similar into A549, 293T7 and HeLa cells. A better efficiency was obtained with Chol/lipid 2 lipoplexes when using the cytosolic luciferase expression vector (pT7Luc) under the control of the bacterial T7 promoter. Membrane fusion activity measurements using fluorescence resonance energy transfer (FRET) technique showed that the histidine head-groups of Chol/lipid 1 liposomes mediated membrane fusion in the pH range 5-7. In addition, the transgene expression results using the T7Luc expression vector convincingly support the endosome-disrupting role of the presently described mono-histidylated cationic transfection lipids and the release of DNA into the cytosol. We conclude that covalent grafting of a single histidine amino acid residue to suitable twin-chain hydrophobic compounds is able to impart remarkable transfection properties on the resulting mono-histidylated cationic amphiphile, presumably via the endosome-disrupting characteristics of the histidine functionalities.

  2. Fusion systems engineering

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    Research during this report period has covered the following areas: (1) fusion reactor systems studies, (2) development of blanket processing technology for fusion reactors, (3) safety studies of fusion concepts, (4) MACKLIB-IV, a new library of nuclear response functions, (5) energy storage and power supply requirements for commercial fusion reactors, (6) blanket/shield design evaluation for commercial fusion reactors, and (7) cross section measurements, evaluations, and techniques

  3. Fusion fuel and renewables

    International Nuclear Information System (INIS)

    Entler, Slavomir

    2015-01-01

    It is shown that fusion fuel meets all aspects applied when defining renewables. A table of definitions of renewables is presented. The sections of the paper are as follows: An industrial renewable source; Nuclear fusion; Current situation in research; Definitions of renewable sources; Energy concept of nuclear fusion; Fusion fuel; Natural energy flow; Environmental impacts; Fusion fuel assessment; Sustainable power; and Energy mix from renewables. (P.A.)

  4. Resistance to dual-gene Bt maize in Spodoptera frugiperda: selection, inheritance, and cross-resistance to other transgenic events.

    Science.gov (United States)

    Santos-Amaya, Oscar F; Rodrigues, João V C; Souza, Thadeu C; Tavares, Clébson S; Campos, Silverio O; Guedes, Raul N C; Pereira, Eliseu J G

    2015-12-17

    Transgenic crop "pyramids" producing two or more Bacillus thuringiensis (Bt) toxins active against the same pest are used to delay evolution of resistance in insect pest populations. Laboratory and greenhouse experiments were performed with fall armyworm, Spodoptera frugiperda, to characterize resistance to Bt maize producing Cry1A.105 and Cry2Ab and test some assumptions of the "pyramid" resistance management strategy. Selection of a field-derived strain of S. frugiperda already resistant to Cry1F maize with Cry1A.105 + Cry2Ab maize for ten generations produced resistance that allowed the larvae to colonize and complete the life cycle on these Bt maize plants. Greenhouse experiments revealed that the resistance was completely recessive (Dx = 0), incomplete, autosomal, and without maternal effects or cross-resistance to the Vip3Aa20 toxin produced in other Bt maize events. This profile of resistance supports some of the assumptions of the pyramid strategy for resistance management. However, laboratory experiments with purified Bt toxin and plant leaf tissue showed that resistance to Cry1A.105 + Cry2Ab2 maize further increased resistance to Cry1Fa, which indicates that populations of fall armyworm have high potential for developing resistance to some currently available pyramided maize used against this pest, especially where resistance to Cry1Fa was reported in the field.

  5. Cold fusion

    International Nuclear Information System (INIS)

    Bush, R.T.

    1991-01-01

    The transmission resonance model (TRM) is combined with some electrochemistry of the cathode surface and found to provide a good fit to new data on excess heat. For the first time, a model for cold fusion not only fits calorimetric data but also predicts optimal trigger points. This suggests that the model is meaningful and that the excess heat phenomenon claimed by Fleischmann and Pons is genuine. A crucial role is suggested for the overpotential and, in particular, for the concentration overpotential, i.e., the hydrogen overvoltage. Self-similar geometry, or scale invariance, i.e., a fractal nature, is revealed by the relative excess power function. Heat bursts are predicted with a scale invariance in time, suggesting a possible link between the TRM and chaos theory. The model describes a near-surface phenomenon with an estimated excess power yield of ∼1 kW/cm 3 Pd, as compared to 50 W/cm 3 of reactor core for a good fission reactor. Transmission resonance-induced nuclear transmutation, a new type of nuclear reaction, is strongly suggested with two types emphasized: transmission resonance-induced neutron transfer reactions yielding essentially the same end result as Teller's hypothesized catalytic neutron transfer and a three-body reaction promoted by standing de Broglie waves. In this paper suggestions for the anomalous production of heat, particles, and radiation are given

  6. Fusion energy

    International Nuclear Information System (INIS)

    1990-09-01

    The main purpose of the International Thermonuclear Experimental Reactor (ITER) is to develop an experimental fusion reactor through the united efforts of many technologically advanced countries. The ITER terms of reference, issued jointly by the European Community, Japan, the USSR, and the United States, call for an integrated international design activity and constitute the basis of current activities. Joint work on ITER is carried out under the auspices of the International Atomic Energy Agency (IAEA), according to the terms of quadripartite agreement reached between the European Community, Japan, the USSR, and the United States. The site for joint technical work sessions is at the MaxPlanck Institute of Plasma Physics. Garching, Federal Republic of Germany. The ITER activities have two phases: a definition phase performed in 1988 and the present design phase (1989--1990). During the definition phase, a set of ITER technical characteristics and supporting research and development (R ampersand D) activities were developed and reported. The present conceptual design phase of ITER lasts until the end of 1990. The objectives of this phase are to develop the design of ITER, perform a safety and environmental analysis, develop site requirements, define future R ampersand D needs, and estimate cost, manpower, and schedule for construction and operation. A final report will be submitted at the end of 1990. This paper summarizes progress in the ITER program during the 1989 design phase

  7. A novel Robertsonian translocation event leads to transfer of a stem rust resistance gene (Sr52) effective against race Ug99 from Dasypyrum villosum into bread wheat.

    Science.gov (United States)

    Qi, L L; Pumphrey, M O; Friebe, Bernd; Zhang, P; Qian, C; Bowden, R L; Rouse, M N; Jin, Y; Gill, B S

    2011-06-01

    Stem rust (Puccinia graminis f. sp. tritici Eriks. & E. Henn.) (the causal agent of wheat stem rust) race Ug99 (also designated TTKSK) and its derivatives have defeated several important stem rust resistance genes widely used in wheat (Triticum aestivum L.) production, rendering much of the worldwide wheat acreage susceptible. In order to identify new resistance sources, a large collection of wheat relatives and genetic stocks maintained at the Wheat Genetic and Genomic Resources Center was screened. The results revealed that most accessions of the diploid relative Dasypyrum villosum (L.) Candargy were highly resistant. The screening of a set of wheat-D. villosum chromosome addition lines revealed that the wheat-D. villosum disomic addition line DA6V#3 was moderately resistant to race Ug99. The objective of the present study was to produce and characterize compensating wheat-D. villosum whole arm Robertsonian translocations (RobTs) involving chromosomes 6D of wheat and 6V#3 of D. villosum through the mechanism of centric breakage-fusion. Seven 6V#3-specific EST-STS markers were developed for screening F(2) progeny derived from plants double-monosomic for chromosomes 6D and 6V#3. Surprisingly, although 6D was the target chromosome, all recovered RobTs involved chromosome 6A implying a novel mechanism for the origin of RobTs. Homozygous translocations (T6AS·6V#3L and T6AL·6V#3S) with good plant vigor and full fertility were selected from F(3) families. A stem rust resistance gene was mapped to the long arm 6V#3L in T6AS·6V#3L and was designated as Sr52. Sr52 is temperature-sensitive and is most effective at 16°C, partially effective at 24°C, and ineffective at 28°C. The T6AS·6V#3L stock is a new source of resistance to Ug99, is cytogenetically stable, and may be useful in wheat improvement.

  8. Novel ZEB2-BCL11B Fusion Gene Identified by RNA-Sequencing in Acute Myeloid Leukemia with t(2;14(q22;q32.

    Directory of Open Access Journals (Sweden)

    Synne Torkildsen

    Full Text Available RNA-sequencing of a case of acute myeloid leukemia with the bone marrow karyotype 46,XY,t(2;14(q22;q32[5]/47,XY,idem,+?4,del(6(q13q21[cp6]/46,XY[4] showed that the t(2;14 generated a ZEB2-BCL11B chimera in which exon 2 of ZEB2 (nucleotide 595 in the sequence with accession number NM_014795.3 was fused to exon 2 of BCL11B (nucleotide 554 in the sequence with accession number NM_022898.2. RT-PCR together with Sanger sequencing verified the presence of the above-mentioned fusion transcript. All functional domains of BCL11B are retained in the chimeric protein. Abnormal expression of BCL11B coding regions subjected to control by the ZEB2 promoter seems to be the leukemogenic mechanism behind the translocation.

  9. Association of Allelic Interaction of Single Nucleotide Polymorphisms of Influx and Efflux Transporters Genes With Nonhematologic Adverse Events of Docetaxel in Breast Cancer Patients.

    Science.gov (United States)

    Jabir, Rafid Salim; Ho, Gwo Fuang; Annuar, Muhammad Azrif Bin Ahmad; Stanslas, Johnson

    2018-05-04

    Nonhematologic adverse events (AEs) of docetaxel constitute an extra burden in the treatment of cancer patients and necessitate either a dose reduction or an outright switch of docetaxel for other regimens. These AEs are frequently associated with genetic polymorphisms of genes encoding for proteins involved docetaxel disposition. Therefore, we investigated that association in Malaysian breast cancer patients. A total of 110 Malaysian breast cancer patients were enrolled in the present study, and their blood samples were investigated for different single nucleotide polymorphisms using polymerase chain reaction restriction fragment length polymorphism. AEs were evaluated using the Common Terminology Criteria for Adverse Events, version 4.0. Fatigue, nausea, oral mucositis, and vomiting were the most common nonhematologic AEs. Rash was associated with heterozygous and mutant genotypes of ABCB1 3435C>T (P A/T reported more fatigue than those carrying the heterozygous genotype GA (P T polymorphism could be a potential predictive biomarker of docetaxel-induced rash, and homozygous wild-type ABCB1 2677G>A/T might predict for a greater risk of fatigue. In addition, the concurrent presence of specific alleles could be predictive of vomiting, nausea, and oral mucositis. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Association between ß2-adrenergic receptor gene polymorphisms and adverse events of ritodrine in the treatment of preterm labor: a prospective observational study.

    Science.gov (United States)

    Chung, Jee Eun; Choi, Soo An; Hwang, Han Sung; Park, Jin Young; Lee, Kyung Eun; Yee, Jeong; Kim, Young Ju; Gwak, Hye Sun

    2017-11-13

    Ritodrine, a tocolytic β2-agonist, has been used extensively in Europe and Asia despite its safety concerns. This study was designed to identify associations between β2-adrenergic receptor (ADRB2) polymorphisms and adverse drug events (ADEs) in patients with preterm labor treated with ritodrine. This follow-up study was prospectively conducted at Ewha Womans University Mokdong Hospital in Korea. Five single nucleotide polymorphisms (SNPs) of the ADRB2 gene (rs1042713, rs1042714, rs1042717, rs1042718, and rs1042719) were analyzed in 186 pregnant women with preterm labor. Patients with the AA genotype of rs1042717 had significantly lower incidence of ADEs compared to those with the G allele (p = 0.009). In multivariate analysis, one of the predictors of ADEs was the maximum infusion rate of ritodrine (AOR 4.47, 95% CI 1.31-15.25). Rs1042719 was also a significant factor for ritodrine-induced ADEs. The CC genotype carriers had 78% decreased risk of ADEs compared to those with other genotypes. This study demonstrates that ADEs induced by ritodrine are associated with ADRB2 gene polymorphisms, as well as the infusion rate of ritodrine in pregnant women with preterm labor.

  11. LimTox: a web tool for applied text mining of adverse event and toxicity associations of compounds, drugs and genes.

    Science.gov (United States)

    Cañada, Andres; Capella-Gutierrez, Salvador; Rabal, Obdulia; Oyarzabal, Julen; Valencia, Alfonso; Krallinger, Martin

    2017-07-03

    A considerable effort has been devoted to retrieve systematically information for genes and proteins as well as relationships between them. Despite the importance of chemical compounds and drugs as a central bio-entity in pharmacological and biological research, only a limited number of freely available chemical text-mining/search engine technologies are currently accessible. Here we present LimTox (Literature Mining for Toxicology), a web-based online biomedical search tool with special focus on adverse hepatobiliary reactions. It integrates a range of text mining, named entity recognition and information extraction components. LimTox relies on machine-learning, rule-based, pattern-based and term lookup strategies. This system processes scientific abstracts, a set of full text articles and medical agency assessment reports. Although the main focus of LimTox is on adverse liver events, it enables also basic searches for other organ level toxicity associations (nephrotoxicity, cardiotoxicity, thyrotoxicity and phospholipidosis). This tool supports specialized search queries for: chemical compounds/drugs, genes (with additional emphasis on key enzymes in drug metabolism, namely P450 cytochromes-CYPs) and biochemical liver markers. The LimTox website is free and open to all users and there is no login requirement. LimTox can be accessed at: http://limtox.bioinfo.cnio.es. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Influence of Nitrous Oxide Anesthesia, B-Vitamins, and MTHFR gene polymorphisms on Perioperative Cardiac Events: The Vitamins in Nitrous Oxide (VINO) Randomized Trial

    Science.gov (United States)

    Nagele, Peter; Brown, Frank; Francis, Amber; Scott, Mitchell G.; Gage, Brian F.; Miller, J. Philip

    2013-01-01

    Background Nitrous oxide causes an acute increase in plasma homocysteine that is more pronounced in patients with the MTHFR C677T or A1298C gene variant. In this randomized controlled trial we sought to determine if patients carrying the MTHFR C677T or A1298C variant had a higher risk for perioperative cardiac events after nitrous oxide anesthesia and if this risk could be mitigated by B-vitamins. Methods We randomized adult patients with cardiac risk factors undergoing noncardiac surgery to receive nitrous oxide plus intravenous B-vitamins before and after surgery or to nitrous oxide and placebo. Serial cardiac biomarkers and 12-lead electrocardiograms were obtained. The primary study endpoint was the incidence of myocardial injury, as defined by cardiac troponin I elevation within the first 72 hours after surgery. Results A total of 500 patients completed the trial. Patients who were homozygous for either MTHFR C677T or A1298C gene variant (n= 98; 19.6%) had no increased rate of postoperative cardiac troponin I elevation compared to wild-type and heterozygous patients (11.2% vs. 14.0%; relative risk 0.96, 95% CI 0.85 to 1.07, p=0.48). B-vitamins blunted the rise in homocysteine, but had no effect on cardiac troponin I elevation compared to patients receiving placebo (13.2% vs. 13.6%; relative risk 1.02, 95% CI 0.78 to 1.32, p=0.91). Conclusions Neither MTHFR C677T and A1298C gene variant nor acute homocysteine increase are associated with perioperative cardiac troponin elevation after nitrousoxide anesthesia. B-vitamins blunt nitrous oxide-induced homocysteine increase but have no effect on cardiac troponin elevation. PMID:23856660

  13. Influence of nitrous oxide anesthesia, B-vitamins, and MTHFR gene polymorphisms on perioperative cardiac events: the vitamins in nitrous oxide (VINO) randomized trial.

    Science.gov (United States)

    Nagele, Peter; Brown, Frank; Francis, Amber; Scott, Mitchell G; Gage, Brian F; Miller, J Philip

    2013-07-01

    Nitrous oxide causes an acute increase in plasma homocysteine that is more pronounced in patients with the methylenetetrahydrofolate reductase (MTHFR) C677T or A1298C gene variant. In this randomized controlled trial, the authors sought to determine whether patients carrying the MTHFR C677T or A1298C variant had a higher risk for perioperative cardiac events after nitrous oxide anesthesia and whether this risk could be mitigated by B-vitamins. The authors randomized adult patients with cardiac risk factors undergoing noncardiac surgery, to receive nitrous oxide plus intravenous B-vitamins before and after surgery, or to nitrous oxide and placebo. Serial cardiac biomarkers and 12-lead electrocardiograms were obtained. The primary study endpoint was the incidence of myocardial injury, as defined by cardiac troponin I increase within the first 72 h after surgery. A total of 500 patients completed the trial. Patients who were homozygous for either MTHFR C677T, or A1298C gene variant (n=98; 19.6%) had no increased rate of postoperative cardiac troponin I increase compared with wild-type and heterozygous patients (11.2 vs. 14.0%; relative risk 0.96; 95% CI, 0.85-1.07; P=0.48). B-vitamins blunted the rise in homocysteine, but had no effect on cardiac troponin I increase compared with patients receiving placebo (13.2 vs. 13.6%; relative risk 1.02; 95% CI 0.78 to 1.32; P=0.91). Neither MTHFR C677T and A1298C gene variant, nor acute homocysteine increase are associated with perioperative cardiac troponin increase after nitrous oxide anesthesia. B-vitamins blunt nitrous oxide-induced homocysteine increase but have no effect on cardiac troponin I increase.

  14. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner.

    Science.gov (United States)

    Pai, Vaibhav P; Willocq, Valerie; Pitcairn, Emily J; Lemire, Joan M; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A; Levin, Michael

    2017-10-15

    Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels ( I h currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal , Lefty , and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. © 2017. Published by The Company of Biologists Ltd.

  15. Fusion technology: The Iter fusion experiment

    International Nuclear Information System (INIS)

    Dietz, K.J.

    1994-01-01

    Plans for the Iter international fusion experiment, in which the European Union, Japan, Canada, Russia, Sweden, Switzerland, and the USA cooperate, were begun in 1985, and construction work started in early 1994. These activities serve for the preparation of the design and construction documents for a research reactor in which a stable fusion plasma is to be generated. This is to be the basis for the construction of a fusion reactor for electricity generation. Preparatory work was performed in the Tokamak experiments with JET and TFTR. The fusion power of 1.5 GW will be attained, thus enabling Iter to keep a deuterium-tritium plasma burning. (orig.) [de

  16. Review of fusion synfuels

    International Nuclear Information System (INIS)

    Fillo, J.A.

    1980-01-01

    Thermonuclear fusion offers an inexhaustible source of energy for the production of hydrogen from water. Depending on design, electric generation efficiencies of approx. 40 to 60% and hydrogen production efficiencies by high-temperature electrolysis of approx. 50 to 65% are projected for fusion reactors using high-temperatures blankets. Fusion/coal symbiotic systems appear economically promising for the first generation of commercial fusion synfuels plants. Coal production requirements and the environmental effects of large-scale coal usage would be greatly reduced by a fusion/coal system. In the long term, there could be a gradual transition to an inexhaustible energy system based solely on fusion

  17. Barriers to fusion

    International Nuclear Information System (INIS)

    Berriman, A.C.; Butt, R.D.; Dasgupta, M.; Hinde, D.J.; Morton, C.R.; Newton, J.O.

    1999-01-01

    The fusion barrier is formed by the combination of the repulsive Coulomb and attractive nuclear forces. Recent research at the Australian National University has shown that when heavy nuclei collide, instead of a single fusion barrier, there is a set of fusion barriers. These arise due to intrinsic properties of the interacting nuclei such deformation, rotations and vibrations. Thus the range of barrier energies depends on the properties of both nuclei. The transfer of matter between nuclei, forming a neck, can also affect the fusion process. High precision data have been used to determine fusion barrier distributions for many nuclear reactions, leading to new insights into the fusion process

  18. Paramyxovirus F1 protein has two fusion peptides: implications for the mechanism of membrane fusion.

    Science.gov (United States)

    Peisajovich, S G; Samuel, O; Shai, Y

    2000-03-10

    Viral fusion proteins contain a highly hydrophobic segment, named the fusion peptide, which is thought to be responsible for the merging of the cellular and viral membranes. Paramyxoviruses are believed to contain a single fusion peptide at the N terminus of the F1 protein. However, here we identified an additional internal segment in the Sendai virus F1 protein (amino acids 214-226) highly homologous to the fusion peptides of HIV-1 and RSV. A synthetic peptide, which includes this region, was found to induce membrane fusion of large unilamellar vesicles, at concentrations where the known N-terminal fusion peptide is not effective. A scrambled peptide as well as several peptides from other regions of the F1 protein, which strongly bind to membranes, are not fusogenic. The functional and structural characterization of this active segment suggest that the F1 protein has an additional internal fusion peptide that could participate in the actual fusion event. The presence of homologous regions in other members of the same family suggests that the concerted action of two fusion peptides, one N-terminal and the other internal, is a general feature of paramyxoviruses. Copyright 2000 Academic Press.

  19. Rho GTPase activity modulates paramyxovirus fusion protein-mediated cell-cell fusion

    International Nuclear Information System (INIS)

    Schowalter, Rachel M.; Wurth, Mark A.; Aguilar, Hector C.; Lee, Benhur; Moncman, Carole L.; McCann, Richard O.; Dutch, Rebecca Ellis

    2006-01-01

    The paramyxovirus fusion protein (F) promotes fusion of the viral envelope with the plasma membrane of target cells as well as cell-cell fusion. The plasma membrane is closely associated with the actin cytoskeleton, but the role of actin dynamics in paramyxovirus F-mediated membrane fusion is unclear. We examined cell-cell fusion promoted by two different paramyxovirus F proteins in three cell types in the presence of constitutively active Rho family GTPases, major cellular coordinators of actin dynamics. Reporter gene and syncytia assays demonstrated that expression of either Rac1 V12 or Cdc42 V12 could increase cell-cell fusion promoted by the Hendra or SV5 glycoproteins, though the effect was dependent on the cell type expressing the viral glycoproteins. In contrast, RhoA L63 decreased cell-cell fusion promoted by Hendra glycoproteins but had little affect on SV5 F-mediated fusion. Also, data suggested that GTPase activation in the viral glycoprotein-containing cell was primarily responsible for changes in fusion. Additionally, we found that activated Cdc42 promoted nuclear rearrangement in syncytia

  20. Warming up to cold fusion

    International Nuclear Information System (INIS)

    Storms, E.

    1994-01-01

    The idea that tabletop equipment at room temperature could produce nuclear fusion was widely rejected five years ago by the scientific community. Nevertheless, recent results from numerous labs show that a novel phenomena of some kind may indeed be occurring, though theorist are still groping for an explanation. Many aspects of the cold fusion effect are now reproducible if known procedures are used. Palladium, when reacted with enough deuterium, apparently converts to a special condition of matter in which various nuclear reactions--including deuterium-deuterium fusion--can occur despite the repulsive force of the two positive charged nuclei. These reactions can be made to proceed rapidly enough to produce measurable heat. Scientist have published several dozen models, ranging from highly analytical approaches to pictorial representations, to explain these events. Most theories address only the problem of overcoming the coulombic barrier--how it is possible for nuclei to overcome their natural repulsion for each other without an infusion of massive amounts of energy from the outside. None of the proposed explanations accounts for the full range of experimental observations. Nevertheless a workable theory is crucial if we ever hope to apply cold fusion

  1. New developments in heavy ion fusion

    International Nuclear Information System (INIS)

    Herrmannsfeldt, W.B.

    1984-01-01

    Beginning in 1984, the US Department of Energy plans a program aimed at determining the feasibility of using heavy ion accelerators as pellet drivers for Inertial Confinement Fusion (ICF). This paper will describe the events in the field of Heavy Ion Fusion (HIF) that have occurred in the three years since the Lausanne Conference in this series. The emphasis will be on the events leading towards the energy oriented program. In addition to providing an overview of progress in HIF, such a discussion may prove useful for promoters of any ''emerging'' energy technology. (orig.) [de

  2. Real-time polymerase chain reaction-based approach for quantification of the pat gene in the T25 Zea mays event.

    Science.gov (United States)

    Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy

    2004-01-01

    In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement

  3. Novel RNA hybridization method for the in situ detection of ETV1, ETV4, and ETV5 gene fusions in prostate cancer.

    Science.gov (United States)

    Kunju, Lakshmi P; Carskadon, Shannon; Siddiqui, Javed; Tomlins, Scott A; Chinnaiyan, Arul M; Palanisamy, Nallasivam

    2014-09-01

    The genetic basis of 50% to 60% of prostate cancer (PCa) is attributable to rearrangements in E26 transformation-specific (ETS) (ERG, ETV1, ETV4, and ETV5), BRAF, and RAF1 genes and overexpression of SPINK1. The development and validation of reliable detection methods are warranted to classify various molecular subtypes of PCa for diagnostic and prognostic purposes. ETS gene rearrangements are typically detected by fluorescence in situ hybridization and reverse-transcription polymerase chain reaction methods. Recently, monoclonal antibodies against ERG have been developed that detect the truncated ERG protein in immunohistochemical assays where staining levels are strongly correlated with ERG rearrangement status by fluorescence in situ hybridization. However, specific antibodies for ETV1, ETV4, and ETV5 are unavailable, challenging their clinical use. We developed a novel RNA in situ hybridization-based assay for the in situ detection of ETV1, ETV4, and ETV5 in formalin-fixed paraffin-embedded tissues from prostate needle biopsies, prostatectomy, and metastatic PCa specimens using RNA probes. Further, with combined RNA in situ hybridization and immunohistochemistry we identified a rare subset of PCa with dual ETS gene rearrangements in collisions of independent tumor foci. The high specificity and sensitivity of RNA in situ hybridization provides an alternate method enabling bright-field in situ detection of ETS gene aberrations in routine clinically available PCa specimens.

  4. CRISPR/Cas9 Engineering of Adult Mouse Liver Demonstrates That the Dnajb1-Prkaca Gene Fusion is Sufficient to Induce Tumors Resembling Fibrolamellar Hepatocellular Carcinoma

    DEFF Research Database (Denmark)

    Engelholm, Lars H; Riaz, Anjum; Serra, Denise

    2017-01-01

    BACKGROUND & AIMS: Fibrolamellar hepatocellular carcinoma (FL-HCC) is a primary liver cancer that predominantly affects young adults with no underlying liver disease. A somatic, 400 Kb deletion on chromosome 19 that fuses part of the DnaJ heat shock protein family (Hsp40) member B1 gene (DNAJB1...

  5. Fusion reactor design studies

    International Nuclear Information System (INIS)

    Emmert, G.A.; Kulcinski, G.L.; Santarius, J.F.

    1990-01-01

    This report discusses the following topics on the ARIES tokamak: systems; plasma power balance; impurity control and fusion ash removal; fusion product ripple loss; energy conversion; reactor fueling; first wall design; shield design; reactor safety; and fuel cost and resources

  6. Laser fusion: an overview

    International Nuclear Information System (INIS)

    Boyer, K.

    1975-01-01

    The laser fusion concept is described along with developments in neodymium and carbon dioxide lasers. Fuel design and fabrication are reviewed. Some spin-offs of the laser fusion program are discussed. (U.S.)

  7. Fusion Canada issue 23

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-01-01

    A short bulletin from the National Fusion Program highlighting in this issue TdeV tokamak updates, fusion research in Korea, CCFM program review, TdeV divertor plasma, and CFFTP program review. 4 figs.

  8. Fusion Canada issue 27

    International Nuclear Information System (INIS)

    1995-03-01

    A short bulletin from the National Fusion Program highlighting in this issue ITER reactor siting, a major upgrade for TdeV tokamak, Ceramic Breeders: new tritium mapping technique and Joint Fusion Symposium. 2 figs

  9. Fusion Canada issue 20

    International Nuclear Information System (INIS)

    1993-03-01

    Fusion Canada's publication of the National Fusion Program. Included in this issue is the CFFTP Industrial Impact Study, CCFM/TdeV Update:helium pumping, research funds, and deuterium in beryllium - high temperature behaviour. 3 figs

  10. Fusion Canada issue 23

    International Nuclear Information System (INIS)

    1994-01-01

    A short bulletin from the National Fusion Program highlighting in this issue TdeV tokamak updates, fusion research in Korea, CCFM program review, TdeV divertor plasma, and CFFTP program review. 4 figs

  11. Canada's Fusion Program

    International Nuclear Information System (INIS)

    Jackson, D. P.

    1990-01-01

    Canada's fusion strategy is based on developing specialized technologies in well-defined areas and supplying these technologies to international fusion projects. Two areas are specially emphasized in Canada: engineered fusion system technologies, and specific magnetic confinement and materials studies. The Canadian Fusion Fuels Technology Project focuses on the first of these areas. It tritium and fusion reactor fuel systems, remote maintenance and related safety studies. In the second area, the Centre Canadian de fusion magnetique operates the Tokamak de Varennes, the main magnetic fusion device in Canada. Both projects are partnerships linking the Government of Canada, represented by Atomic Energy of Canada Limited, and provincial governments, electrical utilities, universities and industry. Canada's program has extensive international links, through which it collaborates with the major world fusion programs, including participation in the International Thermonuclear Experimental Reactor project

  12. Fusion systems engineering

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    Information is given on each of the following topics: (1) fusion reactor systems studies, (2) development of blanket processing technology for fusion reactors, (3) safety studies of CTR concepts, and (4) cross section measurements and techniques

  13. Fusion Canada issue 6

    International Nuclear Information System (INIS)

    1989-02-01

    A short bulletin from the National Fusion Program. Included in this issue is a funding report for CFFTP, a technical update for Tokamak de Varennes and a network for university research by the National Fusion Program. 4 figs

  14. Prospects of measuring gluon fusion and weak boson fusion cross sections at the LHC with CMS

    CERN Document Server

    Nicollerat, Anne-Sylvie

    2001-01-01

    The possibility to observe a Higgs boson having a mass between 300 and 600 GeV and to measure its couplings to vector bosons and top quark with CMS at the LHC is studied. Six different signatures are analyzed. The possibility to separate the Higgs events produced through weak boson fusion from the Higgs produced through gluon fusion using the forward going jets emitted in the weak boson fusion process is discussed for each of these different channels. The results are then used to determine the possible statistical errors on the ratio between the two Higgs decay branching fractions when it decays into Ws and into Zs and the possible statistical errors on the weak boson fusion and gluon fusion cross sections after one year of LHC running.

  15. Targeting of a chimeric human histone fusion mRNA to membrane-bound polysomes in HeLa cells

    International Nuclear Information System (INIS)

    Zambetti, G.; Stein, J.; Stein, G.

    1987-01-01

    The subcellular location of histone mRNA-containing polysomes may play a key role in the posttranscriptional events that mediate histone mRNA turnover following inhibition of DNA synthesis. Previously, it has been shown that histone mRNA is found primarily on free polysomes that are associated with the cytoskeleton. The authors report here the construction of an Escherichia coli pBR322 β-lactamase signal peptide-human H3 histone fusion gene. The fusion transcript is targeted to membrane-bound polysomes and remains stable following interruption of DNA replication. Relocating mRNA within the cell may provide a procedure for studying the posttranscriptional regulation of gene expression

  16. Fusion Canada issue 18

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1992-08-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on the ITER agreement signed with the EDA, the robotic maintenance for NET, the CFFTP Fusion Pilot Study, the new IEA joint programs on environment, safety and economic aspects of fusion power, and a review by the CCFM advisory committee. 3 figs.

  17. User's perspective on fusion

    International Nuclear Information System (INIS)

    Ashworth, C.P.

    1976-01-01

    The need in fusion, from the electric utilities viewpoint, is for fusion to be a real option, not huge, complicated nuclear plants costing $10 billion each and requiring restructuring the energy industry to provide and use them. A course for future fusion reactor work in order to be a real option is discussed. The advantages of alternate concepts to the tokamak are presented

  18. Fusion Canada issue 17

    International Nuclear Information System (INIS)

    1992-05-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on increased funding for the Canadian Fusion Program, news of the compact Toroid fuelling gun, an update on Tokamak de Varennes, the Canada - U.S. fusion meeting, measurements of plasma flow velocity, and replaceable Tokamak divertors. 4 figs

  19. Fusion Canada issue 18

    International Nuclear Information System (INIS)

    1992-08-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on the ITER agreement signed with the EDA, the robotic maintenance for NET, the CFFTP Fusion Pilot Study, the new IEA joint programs on environment, safety and economic aspects of fusion power, and a review by the CCFM advisory committee. 3 figs

  20. CO2-laser fusion

    International Nuclear Information System (INIS)

    Stark, E.E. Jr.

    1978-01-01

    The basic concept of laser fusion is described, with a set of requirements on the laser system. Systems and applications concepts are presented and discussed. The CO 2 laser's characteristics and advantages for laser fusion are described. Finally, technological issues in the development of CO 2 laser systems for fusion applications are discussed

  1. Fusion Canada issue 9

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-11-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on availability of Canadian Tritium, an ITER update, a CCFM update on Tokamak and the new team organization, an international report on Fusion in Canada and a Laser Fusion Project at the University of Toronto. 3 figs.

  2. Heavy ion fusion

    International Nuclear Information System (INIS)

    Bangerter, R.O.

    1986-01-01

    This report on the International Symposium on Heavy Ion Fusion held May 27-29, 1986 summarizes the problems and achievements in the areas of targets, accelerators, focussing, reactor studies, and system studies. The symposium participants recognize that there are large uncertainties in Heavy Ion Fusion but many of them are also optimistic that HIF may ultimately be the best approach to fusion

  3. Fusion Canada issue 17

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1992-05-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on increased funding for the Canadian Fusion Program, news of the compact Toroid fuelling gun, an update on Tokamak de Varennes, the Canada - U.S. fusion meeting, measurements of plasma flow velocity, and replaceable Tokamak divertors. 4 figs.

  4. Fusion Canada issue 25

    International Nuclear Information System (INIS)

    1994-08-01

    A short bulletin from the National Fusion Program highlighting in this issue an economic impact study of the Canadian site for ITER, Harvey Skarsgard: fusion pioneer retires, NFP: Phillips and Holtslander exchange roles, Europe's fusion funding proposals and an update of CCFM/TdeV. 1 fig

  5. Fusion reactors - types - problems

    International Nuclear Information System (INIS)

    Schmitter, K.H.

    1979-07-01

    A short account is given of the principles of fusion reactions and of the expected advantages of fusion reactors. Descriptions are presented of various Tokamak experimental devices being developed in a number of countries and of some mirror machines. The technical obstacles to be overcome before a fusion reactor could be self-supporting are discussed. (U.K.)

  6. Cold fusion research

    International Nuclear Information System (INIS)

    1989-11-01

    I am pleased to forward to you the Final Report of the Cold Fusion Panel. This report reviews the current status of cold fusion and includes major chapters on Calorimetry and Excess Heat, Fusion Products and Materials Characterization. In addition, the report makes a number of conclusions and recommendations, as requested by the Secretary of Energy

  7. Fusion Canada issue 9

    International Nuclear Information System (INIS)

    1989-11-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on availability of Canadian Tritium, an ITER update, a CCFM update on Tokamak and the new team organization, an international report on Fusion in Canada and a Laser Fusion Project at the University of Toronto. 3 figs

  8. Genetic variability of attachment (G and Fusion (F protein genes of human metapneumovirus strains circulating during 2006-2009 in Kolkata, Eastern India

    Directory of Open Access Journals (Sweden)

    Chawla-Sarkar Mamta

    2011-02-01

    Full Text Available Abstract Background Human metapneumovirus (hMPV is associated with the acute respiratory tract infection (ARTI in all the age groups. However, there is limited information on prevalence and genetic diversity of human metapneumovirus (hMPV strains circulating in India. Objective To study prevalence and genomic diversity of hMPV strains among ARTI patients reporting in outpatient departments of hospitals in Kolkata, Eastern India. Methods Nasal and/or throat swabs from 2309 patients during January 2006 to December 2009, were screened for the presence of hMPV by RT-PCR of nucleocapsid (N gene. The G and F genes of representative hMPV positive samples were sequenced. Results 118 of 2309 (5.11% clinical samples were positive for hMPV. The majority (≈80% of the positive cases were detected during July−November all through the study period. Genetic analysis revealed that 77% strains belong to A2 subgroup whereas rest clustered in B1 subgroup. G sequences showed higher diversity at the nucleotide and amino acid level. In contrast, less than 10% variation was observed in F gene of representative strains of all four years. Sequence analysis also revealed changes in the position of stop codon in G protein, which resulted in variable length (217-231 aa polypeptides. Conclusion The study suggests that approximately 5% of ARTI in the region were caused by hMPV. This is the first report on the genetic variability of G and F gene of hMPV strains from India which clearly shows that the G protein of hMPV is continuously evolving. Though the study partially fulfills lacunae of information, further studies from other regions are necessary for better understanding of prevalence, epidemiology and virus evolution in Indian subcontinent.

  9. Visualization of graphical information fusion results

    Science.gov (United States)

    Blasch, Erik; Levchuk, Georgiy; Staskevich, Gennady; Burke, Dustin; Aved, Alex

    2014-06-01

    Graphical fusion methods are popular to describe distributed sensor applications such as target tracking and pattern recognition. Additional graphical methods include network analysis for social, communications, and sensor management. With the growing availability of various data modalities, graphical fusion methods are widely used to combine data from multiple sensors and modalities. To better understand the usefulness of graph fusion approaches, we address visualization to increase user comprehension of multi-modal data. The paper demonstrates a use case that combines graphs from text reports and target tracks to associate events and activities of interest visualization for testing Measures of Performance (MOP) and Measures of Effectiveness (MOE). The analysis includes the presentation of the separate graphs and then graph-fusion visualization for linking network graphs for tracking and classification.

  10. Robust expression and secretion of Xylanase1 in Chlamydomonas reinhardtii by fusion to a selection gene and processing with the FMDV 2A peptide.

    Directory of Open Access Journals (Sweden)

    Beth A Rasala

    Full Text Available Microalgae have recently received attention as a potential low-cost host for the production of recombinant proteins and novel metabolites. However, a major obstacle to the development of algae as an industrial platform has been the poor expression of heterologous genes from the nuclear genome. Here we describe a nuclear expression strategy using the foot-and-mouth-disease-virus 2A self-cleavage peptide to transcriptionally fuse heterologous gene expression to antibiotic resistance in Chlamydomonas reinhardtii. We demonstrate that strains transformed with ble-2A-GFP are zeocin-resistant and accumulate high levels of GFP that is properly 'cleaved' at the FMDV 2A peptide resulting in monomeric, cytosolic GFP that is easily detectable by in-gel fluorescence analysis or fluorescent microscopy. Furthermore, we used our ble2A nuclear expression vector to engineer the heterologous expression of the industrial enzyme, xylanase. We demonstrate that linking xyn1 expression to ble2A expression on the same open reading frame led to a dramatic (~100-fold increase in xylanase activity in cells lysates compared to the unlinked construct. Finally, by inserting an endogenous secretion signal between the ble2A and xyn1 coding regions, we were able to target monomeric xylanase for secretion. The novel microalgae nuclear expression strategy described here enables the selection of transgenic lines that are efficiently expressing the heterologous gene-of-interest and should prove valuable for basic research as well as algal biotechnology.

  11. Fusion reactors and the environment

    International Nuclear Information System (INIS)

    Wrixon, A.D.

    1976-01-01

    A summary is given of the report of a study group set up in 1971 by the Director of the UKAEA Culham Laboratory to investigate environmental and safety aspects of future commercial fusion reactors (1975, Carruthers, R., Dunster, H.J., Smith, R.D., Watson, C.J.H., and Mitchell, J.T.D., Culham Study Group Report on Fusion Reactors and the Environment, CLM-R148, HMSO, London). This report was originally issued in 1973 under limited distribution, but has only recently been made available for open circulation. Deuterium/tritium fusion is thought to be the most likely reaction to be used in the first generation of reactors. Estimates were made of the local and world-wide population hazards from the release of tritium, both under normal operating conditions and in the event of an accident. One serious type of accident would be a lithium metal fire in the blanket region of the reactor. The use of a fusible lithium salt (FLIBE), eliminating the lithium fire risk, is considered but the report concentrates on lithium metal in the blanket region. The main hazards to operating staff arise both from tritium and from neutron activation of the construction materials. Remote servicing of the reactor structure will be essential, but radioactive waste management seems less onerous than for fission reactors. Meaningful comparison of the overall hazards associated with fusion and fission power programmes is not yet possible. The study group emphasized the need for more data to aid the safety assessments, and the need for such assessments to keep pace with fusion power station design. (U.K.)

  12. Characterization of a structural intermediate of flavivirus membrane fusion.

    Directory of Open Access Journals (Sweden)

    Karin Stiasny

    2007-02-01

    Full Text Available Viral membrane fusion proceeds through a sequence of steps that are driven by triggered conformational changes of viral envelope glycoproteins, so-called fusion proteins. Although high-resolution structural snapshots of viral fusion proteins in their prefusion and postfusion conformations are available, it has been difficult to define intermediate structures of the fusion pathway because of their transient nature. Flaviviruses possess a class II viral fusion protein (E mediating fusion at acidic pH that is converted from a dimer to a trimer with a hairpin-like structure during the fusion process. Here we show for tick-borne encephalitis virus that exposure of virions to alkaline instead of acidic pH traps the particles in an intermediate conformation in which the E dimers dissociate and interact with target membranes via the fusion peptide without proceeding to the merger of the membranes. Further treatment to low pH, however, leads to fusion, suggesting that these monomers correspond to an as-yet-elusive intermediate required to convert the prefusion dimer into the postfusion trimer. Thus, the use of nonphysiological conditions allows a dissection of the flavivirus fusion process and the identification of two separate steps, in which membrane insertion of multiple copies of E monomers precedes the formation of hairpin-like trimers. This sequence of events provides important new insights for understanding the dynamic process of viral membrane fusion.

  13. The yeast cell fusion protein Prm1p requires covalent dimerization to promote membrane fusion.

    Directory of Open Access Journals (Sweden)

    Alex Engel

    2010-05-01

    Full Text Available Prm1p is a multipass membrane protein that promotes plasma membrane fusion during yeast mating. The mechanism by which Prm1p and other putative regulators of developmentally controlled cell-cell fusion events facilitate membrane fusion has remained largely elusive. Here, we report that Prm1p forms covalently linked homodimers. Covalent Prm1p dimer formation occurs via intermolecular disulfide bonds of two cysteines, Cys-120 and Cys-545. PRM1 mutants in which these cysteines have been substituted are fusion defective. These PRM1 mutants are normally expressed, retain homotypic interaction and can traffic to the fusion zone. Because prm1-C120S and prm1-C545S mutants can form covalent dimers when coexpressed with wild-type PRM1, an intermolecular C120-C545 disulfide linkage is inferred. Cys-120 is adjacent to a highly conserved hydrophobic domain. Mutation of a charged residue within this hydrophobic domain abrogates formation of covalent dimers, trafficking to the fusion zone, and fusion-promoting activity. The importance of intermolecular disulfide bonding informs models regarding the mechanism of Prm1-mediated cell-cell fusion.

  14. Viral membrane fusion

    International Nuclear Information System (INIS)

    Harrison, Stephen C.

    2015-01-01

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism

  15. Viral membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, Stephen C., E-mail: harrison@crystal.harvard.edu

    2015-05-15

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.

  16. Fusion technology 1992

    International Nuclear Information System (INIS)

    Ferro, C.; Gasparatto, M.; Knoepfel, H.

    1993-01-01

    The aim of the biennial series of symposia on the title subject, organized by the European Fusion Laboratories, is the exchange of information on the design, construction and operation of fusion experiments and on the technology being developed for the next step devices and fusion reactors. The coverage of the volume includes the technological aspects of fusion reactors in relation to new developments, this forming a guideline for the definition of future work. These proceedings comprise three volumes and contain both the invited lectures and contributed papers presented at the symposium which was attended by 569 participants from around the globe. The 343 papers, including 12 invited papers, characterize the increasing interest of industry in the fusion programme, giving a broad and current overview on the progress and trends fusion technology is experiencing now, as well as indicating the future for fusion devices

  17. Cell fusion in tumor progression: the isolation of cell fusion products by physical methods

    Directory of Open Access Journals (Sweden)

    Vincitorio Massimo

    2011-09-01

    Full Text Available Abstract Background Cell fusion induced by polyethylene glycol (PEG is an efficient but poorly controlled procedure for obtaining somatic cell hybrids used in gene mapping, monoclonal antibody production, and tumour immunotherapy. Genetic selection techniques and fluorescent cell sorting are usually employed to isolate cell fusion products, but both procedures have several drawbacks. Results Here we describe a simple improvement in PEG-mediated cell fusion that was obtained by modifying the standard single-step procedure. We found that the use of two PEG undertreatments obtains a better yield of cell fusion products than the standard method, and most of these products are bi- or trinucleated polykaryocytes. Fusion rate was quantified using fluorescent cell staining microscopy. We used this improved cell fusion and cell isolation method to compare giant cells obtained in vitro and giant cells obtained in vivo from patients with Hodgkin's disease and erythroleukemia. Conclusions In the present study we show how to improve PEG-mediated cell fusion and that cell separation by velocity sedimentation offers a simple alternative for the efficient purification of cell fusion products and to investigate giant cell formation in tumor development.

  18. Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus

    Directory of Open Access Journals (Sweden)

    Wanyi Li

    2014-03-01

    Full Text Available Influenza (flu pandemics have exhibited a great threat to human health throughout history. With the emergence of drug-resistant strains of influenza A virus (IAV, it is necessary to look for new agents for treatment and transmission prevention of the flu. Defensins are small (2–6 kDa cationic peptides known for their broad-spectrum antimicrobial activity. Beta-defensins (β-defensins are mainly produced by barrier epithelial cells and play an important role in attacking microbe invasion by epithelium. In this study, we focused on the anti-influenza A virus activity of mouse β-defensin 1 (mBD1 and β defensin-3 (mBD3 by synthesizing their fusion peptide with standard recombinant methods. The eukaryotic expression vectors pcDNA3.1(+/mBD1-mBD3 were constructed successfully by overlap-PCR and transfected into Madin-Darby canine kidney (MDCK cells. The MDCK cells transfected by pcDNA3.1(+/mBD1-mBD3 were obtained by G418 screening, and the mBD1-mBD3 stable expression pattern was confirmed in MDCK cells by RT-PCR and immunofluorescence assay. The acquired stable transfected MDCK cells were infected with IAV (A/PR/8/34, H1N1, 0.1 MOI subsequently and the virus titers in cell culture supernatants were analyzed by TCID50 72 h later. The TCID50 titer of the experimental group was clearly lower than that of the control group (p < 0.001. Furthermore, BALB/C mice were injected with liposome-encapsulated pcDNA3.1(+/mBD1-mBD3 through muscle and then challenged with the A/PR/8/34 virus. Results showed the survival rate of 100% and lung index inhibitory rate of 32.6% in pcDNA3.1(+/mBD1-mBD3group; the TCID50 titer of lung homogenates was clearly lower than that of the control group (p < 0.001. This study demonstrates that mBD1-mBD3 expressed by the recombinant plasmid pcDNA3.1(+/mBD1-mBD3 could inhibit influenza A virus replication both in vitro and in vivo. These observations suggested that the recombinant mBD1-mBD3 might be developed into an agent for

  19. Distributed video data fusion and mining

    Science.gov (United States)

    Chang, Edward Y.; Wang, Yuan-Fang; Rodoplu, Volkan

    2004-09-01

    This paper presents an event sensing paradigm for intelligent event-analysis in a wireless, ad hoc, multi-camera, video surveillance system. In particilar, we present statistical methods that we have developed to support three aspects of event sensing: 1) energy-efficient, resource-conserving, and robust sensor data fusion and analysis, 2) intelligent event modeling and recognition, and 3) rapid deployment, dynamic configuration, and continuous operation of the camera networks. We outline our preliminary results, and discuss future directions that research might take.

  20. Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

    International Nuclear Information System (INIS)

    Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

    1986-01-01

    The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

  1. Case Study: Organotypic human in vitro models of embryonic morphogenetic fusion

    Science.gov (United States)

    Morphogenetic fusion of tissues is a common event in embryonic development and disruption of fusion is associated with birth defects of the eye, heart, neural tube, phallus, palate, and other organ systems. Embryonic tissue fusion requires precise regulation of cell-cell and cell...

  2. Method for measurement of viral fusion kinetics at the single particle level

    NARCIS (Netherlands)

    Floyd, D.L.; Harrison, S.C.; Oijen, A.M. van

    2009-01-01

    Membrane fusion is an essential step during entry of enveloped viruses into cells. Conventional fusion assays typically report on a large number of fusion events, making it difficult to quantitatively analyze the sequence of the molecular steps involved. We have developed an in vitro, two-color

  3. Three Cell Fusions during Double Fertilization.

    Science.gov (United States)

    Sprunck, Stefanie; Dresselhaus, Thomas

    2015-05-07

    Fertilization of both egg and central cell is a major distinguishing feature of flowering plants. Now, Maruyama et al. report a third cell fusion event between the persistent synergid and the fertilized central cell shortly after double fertilization in Arabidopsis. This causes rapid dilution of pollen tube attractant(s), preventing polytubey. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Genetically Controlled Fusion, Exocytosis and Fission of Artificial Vesicles

    DEFF Research Database (Denmark)

    Bönzli, Eva; Hadorn, Maik; De Lucrezia, Davide

    if a special class of viral proteins, termed fusogenic peptides, were added to the external medium. In the present work, we intend to develop genetically controlled fusion, fission and exocytosis of vesicles by the synthesis of peptides within vesicles. First, we enclosed synthesized peptides in vesicles...... to induce in a next step fusion of adjacent vesicles, fission and exocytosis of nested vesicles. Second, we will replace the peptides by an enclosed cell-free expression system to internally synthesize fusion peptides. To control the gene expression, different mechanisms are available, e.g. addition...... fusion, fission and exocytosis....

  5. Dominant integration locus drives continuous diversification of plant immune receptors with exogenous domain fusions.

    Science.gov (United States)

    Bailey, Paul C; Schudoma, Christian; Jackson, William; Baggs, Erin; Dagdas, Gulay; Haerty, Wilfried; Moscou, Matthew; Krasileva, Ksenia V

    2018-02-19

    The plant immune system is innate and encoded in the germline. Using it efficiently, plants are capable of recognizing a diverse range of rapidly evolving pathogens. A recently described phenomenon shows that plant immune receptors are able to recognize pathogen effectors through the acquisition of exogenous protein domains from other plant genes. We show that plant immune receptors with integrated domains are distributed unevenly across their phylogeny in grasses. Using phylogenetic analysis, we uncover a major integration clade, whose members underwent repeated independent integration events producing diverse fusions. This clade is ancestral in grasses with members often found on syntenic chromosomes. Analyses of these fusion events reveals that homologous receptors can be fused to diverse domains. Furthermore, we discover a 43 amino acid long motif associated with this dominant integration clade which is located immediately upstream of the fusion site. Sequence analysis reveals that DNA transposition and/or ectopic recombination are the most likely mechanisms of formation for nucleotide binding leucine rich repeat proteins with integrated domains. The identification of this subclass of plant immune receptors that is naturally adapted to new domain integration will inform biotechnological approaches for generating synthetic receptors with novel pathogen "baits."

  6. Economics of fusion research

    International Nuclear Information System (INIS)

    1977-01-01

    This report provides the results of a study of methods of economic analysis applied to the evaluation of fusion research. The study recognizes that a hierarchy of economic analyses of research programs exists: standard benefit-cost analysis, expected value of R and D information, and expected utility analysis. It is shown that standard benefit-cost analysis, as commonly applied to research programs, is inadequate for the evaluation of a high technology research effort such as fusion research. A methodology for performing an expected value analysis is developed and demonstrated and an overview of an approach to perform an expected utility analysis of fusion research is presented. In addition, a potential benefit of fusion research, not previously identified, is discussed and rough estimates of its magnitude are presented. This benefit deals with the effect of a fusion research program on optimal fossil fuel consumption patterns. The results of this study indicate that it is both appropriate and possible to perform an expected value analysis of fusion research in order to assess the economics of a fusion research program. The results indicate further that the major area of benefits of fusion research is likely due to the impact of a fusion research program on optimal fossil fuel consumption patterns and it is recommended that this benefit be included in future assessments of fusion research economics

  7. Economics of fusion research

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    1977-10-15

    This report provides the results of a study of methods of economic analysis applied to the evaluation of fusion research. The study recognizes that a hierarchy of economic analyses of research programs exists: standard benefit-cost analysis, expected value of R and D information, and expected utility analysis. It is shown that standard benefit-cost analysis, as commonly applied to research programs, is inadequate for the evaluation of a high technology research effort such as fusion research. A methodology for performing an expected value analysis is developed and demonstrated and an overview of an approach to perform an expected utility analysis of fusion research is presented. In addition, a potential benefit of fusion research, not previously identified, is discussed and rough estimates of its magnitude are presented. This benefit deals with the effect of a fusion research program on optimal fossil fuel consumption patterns. The results of this study indicate that it is both appropriate and possible to perform an expected value analysis of fusion research in order to assess the economics of a fusion research program. The results indicate further that the major area of benefits of fusion research is likely due to the impact of a fusion research program on optimal fossil fuel consumption patterns and it is recommended that this benefit be included in future assessments of fusion research economics.

  8. Chemical Hazards and Safety Issues in Fusion Safety Design

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    2003-01-01

    Radiological inventory releases have dominated accident consequences for fusion; these consequences are important to analyze and are generally the most severe result of a fusion facility accident event. However, the advent of, or plan for, large-scale usage of some toxic materials poses the additional hazard of chemical exposure from an accident event. Examples of toxic chemicals are beryllium for magnetic fusion and fluorine for laser fusion. Therefore, chemical exposure consequences must also be addressed in fusion safety assessment. This paper provides guidance for fusion safety analysis. US Department of Energy (DOE) chemical safety assessment practices for workers and the public are reviewed. The US Environmental Protection Agency (EPA) has published some guidance on public exposure to releases of mixtures of chemicals, this guidance has been used to create an initial guideline for treating mixed radiological and toxicological releases in fusion; for example, tritiated hazardous dust from a tokamak vacuum vessel. There is no convenient means to judge the hazard severity of exposure to mixed materials. The chemical fate of mixed material constituents must be reviewed to determine if there is a separate or combined radiological and toxicological carcinogenesis, or if other health threats exist with radiological carcinogenesis. Recommendations are made for fusion facility chemical safety evaluation and safety guidance for protecting the public from chemical releases, since such levels are not specifically identified in the DOE fusion safety standard

  9. Changes in Parthenogenetic Imprinting Patterns during Reprogramming by Cell Fusion.

    Directory of Open Access Journals (Sweden)

    Hyun Sik Jang

    Full Text Available Differentiated somatic cells can be reprogrammed into the pluripotent state by cell-cell fusion. In the pluripotent state, reprogrammed cells may then self-renew and differentiate into all three germ layers. Fusion-induced reprogramming also epigenetically modifies the somatic cell genome through DNA demethylation, X chromosome reactivation, and histone modification. In this study, we investigated whether fusion with embryonic stem cells (ESCs also reprograms genomic imprinting patterns in somatic cells. In particular, we examined imprinting changes in parthenogenetic neural stem cells fused with biparental ESCs, as well as in biparental neural stem cells fused with parthenogenetic ESCs. The resulting hybrid cells expressed the pluripotency markers Oct4 and Nanog. In addition, methylation of several imprinted genes except Peg3 was comparable between hybrid cells and ESCs. This finding indicates that reprogramming by cell fusion does not necessarily reverse the status of all imprinted genes to the state of pluripotent fusion partner.

  10. Trends in fusion reactor safety research

    International Nuclear Information System (INIS)

    Herring, J.S.; Holland, D.F.; Piet, S.J.

    1991-01-01

    Fusion has the potential to be an attractive energy source. From the safety and environmental perspective, fusion must avoid concerns about catastrophic accidents and unsolvable waste disposal. In addition, fusion must achieve an acceptable level of risk from operational accidents that result in public exposure and economic loss. Finally, fusion reactors must control routine radioactive effluent, particularly tritium. Major progress in achieving this potential rests on development of low-activation materials or alternative fuels. The safety and performance of various material choices and fuels for commercial fusion reactors can be investigated relatively inexpensively through reactor design studies. These studies bring together experts in a wide range of backgrounds and force the group to either agree on a reactor design or identify areas for further study. Fusion reactors will be complex with distributed radioactive inventories. The next generation of experiments will be critical in demonstrating that acceptable levels of safe operation can be achieved. These machines will use materials which are available today and for which a large database exists (e.g. for 316 stainless steel). Researchers have developed a good understanding of the risks associated with operation of these devices. Specifically, consequences from coolant system failures, loss of vacuum events, tritium releases, and liquid metal reactions have been studied. Recent studies go beyond next step designs and investigate commercial reactor concerns including tritium release and liquid metal reactions. 18 refs

  11. Recycling fusion materials

    International Nuclear Information System (INIS)

    Ooms, L.

    2005-01-01

    The inherent safety and environmental advantages of fusion power in comparison with other energy sources play an important role in the public acceptance. No waste burden for future generations is therefore one of the main arguments to decide for fusion power. The waste issue has thus been studied in several documents and the final conclusion of which it is stated that there is no permanent disposal waste needed if recycling is applied. But recycling of fusion reactor materials is far to be obvious regarding mostly the very high specific activity of the materials to be handled, the types of materials and the presence of tritium. The main objective of research performed by SCK-CEN is to study the possible ways of recycling fusion materials and analyse the challenges of the materials management from fusion reactors, based on current practices used in fission reactors and the requirements for the manufacture of fusion equipment

  12. The controlled thermonuclear fusion

    International Nuclear Information System (INIS)

    Barre, Bertrand

    2014-01-01

    After some generalities on particle physics, and on fusion and fission reactions, the author outlines that the fission reaction is easier to obtain than the fusion reaction, evokes the fusion which takes place in stars, and outlines the difficulty to manage and control this reaction: one of its application is the H bomb. The challenge is therefore to find a way to control this reaction and make it a steady and continuous source of energy. The author then presents the most promising way: the magnetic confinement fusion. He evokes its main issues, the already performed experiments (tokamak), and gives a larger presentation of the ITER project. Then, he evokes another way, the inertial confinement fusion, and the two main experimental installations (National Ignition Facility in Livermore, and the Laser Megajoule in Bordeaux). Finally, he gives a list of benefits and drawbacks of an industrial nuclear fusion

  13. Laser fusion overview

    International Nuclear Information System (INIS)

    Nuckolls, J.

    1976-01-01

    Because of recent breakthroughs in the target area, and in the glass laser area, the scientific feasibility of laser fusion--and of inertial fusion--may be demonstrated in the early 1980's. Then the development in that time period of a suitable laser (or storage ring or other driving source) would make possible an operational inertial fusion reactor in this century. These are roughly the same time scales as projected by the Tokamak magnetic confinement approach. It thus appears that the 15-20 year earlier start by magnetic confinement fusion may be overcome. Because inertial confinement has been demonstrated, and inertial fusion reactors may operate on smaller scales than Tokamaks, laser fusion may have important technical and economic advantages

  14. Synthetic fuels and fusion

    Energy Technology Data Exchange (ETDEWEB)

    Fillo, J A; Powell, J; Steinberg, M [Brookhaven National Lab., Upton, NY (USA)

    1981-03-01

    The decreasing availability of fossil fuels emphasizes the need to develop systems which will produce synthetic fuel to substitute for and supplement the natural supply. An important first step in the synthesis of liquid and gaseous fuels is the production of hydrogen. Thermonuclear fusion offers an inexhaustible source of energy for the production of hydrogen from water. Depending on design, electric generation efficiencies of approx. equal to 40-60% and hydrogen production efficiencies by high temperature electrolysis of approx. equal to 50-70% are projected for fusion reactors using high temperature blankets. Fusion/coal symbiotic systems appear economically promising for the first generation of commercial fusion synfuels plants. Coal production requirements and the environmental effects of large-scale coal usage would be greatly reduced by a fusion/coal system. In the long-term, there could be a gradual transition to an inexhaustible energy system based solely on fusion.

  15. Disentangling complete and incomplete fusion for 9Be+187Re system at near barrier energies

    International Nuclear Information System (INIS)

    Kharab, Rajesh; Chahal, Rajiv; Rajiv Kumar

    2015-01-01

    The breakup of projectile before fusion leads to some unusual fusion mechanisms like incomplete fusion (ICF) and sequential complete fusion (SCF). Experimentally, it is not possible to separate SCF events from direct complete fusion (DCF). However, the complete fusion and incomplete fusion can be measured separately. Theoretically it is very difficult to calculate the complete and incomplete fusion cross section separately using different models. Very recently A. Diaz-Torres has developed a computer code platypus based on classical dynamical model wherein the complete and incomplete fusion cross sections are calculated separately. But this model is found to work very well at energies above the barrier energy. Here we have attempted to extrapolate the results of the code platypus by using simple Wong's formula in conjunction with the energy dependent Woods-Saxon potential (EDWSP) in the below barrier energy region

  16. Magnetic-fusion program

    International Nuclear Information System (INIS)

    1980-08-01

    In February 1980, the Director of Energy Research requested that the Energy Research Advisory Board (ERAB) review the Department of Energy (DOE) Magnetic Fusion Program. Of particular concern to the DOE was the judicious choice of the next major steps toward demonstration of economic power production from fusion. Of equal concern was the overall soundness of the DOE Magnetic Fusion Program: its pace, scope, and funding profiles. Their finding and recommendations are included

  17. Magnetic fusion technology

    CERN Document Server

    Dolan, Thomas J

    2014-01-01

    Magnetic Fusion Technology describes the technologies that are required for successful development of nuclear fusion power plants using strong magnetic fields. These technologies include: ? magnet systems, ? plasma heating systems, ? control systems, ? energy conversion systems, ? advanced materials development, ? vacuum systems, ? cryogenic systems, ? plasma diagnostics, ? safety systems, and ? power plant design studies. Magnetic Fusion Technology will be useful to students and to specialists working in energy research.

  18. Status of fusion maintenance

    International Nuclear Information System (INIS)

    Fuller, G.M.

    1984-01-01

    Effective maintenance will be an essential ingredient in determining fusion system productivity. This level of productivity will result only after close attention is paid to the entire system as an entity and appropriate integration of the elements is made. The status of fusion maintenance is reviewed in the context of the entire system. While there are many challenging developmental tasks ahead in fusion maintenance, the required technologies are available in several high-technology industries, including nuclear fission

  19. Membrane fusion and exocytosis.

    Science.gov (United States)

    Jahn, R; Südhof, T C

    1999-01-01

    Membrane fusion involves the merger of two phospholipid bilayers in an aqueous environment. In artificial lipid bilayers, fusion proceeds by means of defined transition states, including hourglass-shaped intermediates in which the proximal leaflets of the fusing membranes are merged whereas the distal leaflets are separate (fusion stalk), followed by the reversible opening of small aqueous fusion pores. Fusion of biological membranes requires the action of specific fusion proteins. Best understood are the viral fusion proteins that are responsible for merging the viral with the host cell membrane during infection. These proteins undergo spontaneous and dramatic conformational changes upon activation. In the case of the paradigmatic fusion proteins of the influenza virus and of the human immunodeficiency virus, an amphiphilic fusion peptide is inserted into the target membrane. The protein then reorients itself, thus forcing the fusing membranes together and inducing lipid mixing. Fusion of intracellular membranes in eukaryotic cells involves several protein families including SNAREs, Rab proteins, and Sec1/Munc-18 related proteins (SM-proteins). SNAREs form a novel superfamily of small and mostly membrane-anchored proteins that share a common motif of about 60 amino acids (SNARE motif). SNAREs reversibly assemble into tightly packed helical bundles, the core complexes. Assembly is thought to pull the fusing membranes closely together, thus inducing fusion. SM-proteins comprise a family of soluble proteins that bind to certain types of SNAREs and prevent the formation of core complexes. Rab proteins are GTPases that undergo highly regulated GTP-GDP cycles. In their GTP form, they interact with specific proteins, the effector proteins. Recent evidence suggests that Rab proteins function in the initial membrane contact connecting the fusing membranes but are not involved in the fusion reaction itself.

  20. Fusion facility siting considerations

    International Nuclear Information System (INIS)

    Bussell, G.T.

    1985-01-01

    Inherent in the fusion program's transition from hydrogen devices to commercial power machines is a general increase in the size and scope of succeeding projects. This growth will lead to increased emphasis on safety, environmental impact, and the external effects of fusion in general, and of each new device in particular. A critically important consideration in this regard is site selection. The purpose of this paper is to examine major siting issues that may affect the economics, safety, and environmental impact of fusion

  1. Fusion research principles

    CERN Document Server

    Dolan, Thomas James

    2013-01-01

    Fusion Research, Volume I: Principles provides a general description of the methods and problems of fusion research. The book contains three main parts: Principles, Experiments, and Technology. The Principles part describes the conditions necessary for a fusion reaction, as well as the fundamentals of plasma confinement, heating, and diagnostics. The Experiments part details about forty plasma confinement schemes and experiments. The last part explores various engineering problems associated with reactor design, vacuum and magnet systems, materials, plasma purity, fueling, blankets, neutronics

  2. Nuclear fusion power

    International Nuclear Information System (INIS)

    Dinghee, D.A.

    1983-01-01

    In this chapter, fusion is compared with other inexhaustible energy sources. Research is currently being conducted both within and outside the USA. The current confinement principles of thermonuclear reactions are reveiwed with the discussion of economics mainly focusing on the magnetic confinement concepts. Environmental, health and safety factors are of great concern to the public and measures are being taken to address them. The magnetic fusion program logic and the inertial fusion program logic are compared

  3. Inertial confinement fusion (ICF)

    International Nuclear Information System (INIS)

    Nuckolls, J.

    1977-01-01

    The principal goal of the inertial confinement fusion program is the development of a practical fusion power plant in this century. Rapid progress has been made in the four major areas of ICF--targets, drivers, fusion experiments, and reactors. High gain targets have been designed. Laser, electron beam, and heavy ion accelerator drivers appear to be feasible. Record-breaking thermonuclear conditions have been experimentally achieved. Detailed diagnostics of laser implosions have confirmed predictions of the LASNEX computer program. Experimental facilities are being planned and constructed capable of igniting high gain fusion microexplosions in the mid 1980's. A low cost long lifetime reactor design has been developed

  4. Inertial fusion energy

    International Nuclear Information System (INIS)

    Decroisette, M.; Andre, M.; Bayer, C.; Juraszek, D.; Le Garrec, B.; Deutsch, C.; Migus, A.

    2005-01-01

    We first recall the scientific basis of inertial fusion and then describe a generic fusion reactor with the different components: the driver, the fusion chamber, the material treatment unit, the target factory and the turbines. We analyse the options proposed at the present time for the driver and for target irradiation scheme giving the state of art for each approach. We conclude by the presentation of LMJ (laser Megajoule) and NIF (national ignition facility) projects. These facilities aim to demonstrate the feasibility of laboratory DT ignition, first step toward Inertial Fusion Energy. (authors)

  5. Laser fusion program overview

    International Nuclear Information System (INIS)

    Emmett, J.L.

    1977-01-01

    This program is structured to proceed through a series of well defined fusion milestones to proof of the scientific feasibility, of laser fusion with the Shiva Nova system. Concurrently, those key technical areas, such as advanced lasers, which are required to progress beyond proof of feasibility, are being studied. We have identified and quantified the opportunities and key technical issues in military applications, such as weapons effects simulations, and in civilian applications, such as central-station electric power production. We summarize the current status and future plans for the laser fusion program at LLL, emphasizing the civilian applications of laser fusion

  6. Frontiers in fusion research

    CERN Document Server

    Kikuchi, Mitsuru

    2011-01-01

    Frontiers in Fusion Research provides a systematic overview of the latest physical principles of fusion and plasma confinement. It is primarily devoted to the principle of magnetic plasma confinement, that has been systematized through 50 years of fusion research. Frontiers in Fusion Research begins with an introduction to the study of plasma, discussing the astronomical birth of hydrogen energy and the beginnings of human attempts to harness the Sun's energy for use on Earth. It moves on to chapters that cover a variety of topics such as: * charged particle motion, * plasma kinetic theory, *

  7. Fusion reactor safety

    International Nuclear Information System (INIS)

    1987-12-01

    Nuclear fusion could soon become a viable energy source. Work in plasma physics, fusion technology and fusion safety is progressing rapidly in a number of Member States and international collaboration continues on work aiming at the demonstration of fusion power generation. Safety of fusion reactors and technological and radiological aspects of waste management are important aspects in the development and design of fusion machines. In order to provide an international forum to review and discuss the status and the progress made since 1983 in programmes related to operational safety aspects of fusion reactors, their waste management and decommissioning concepts, the IAEA had organized the Technical Committee on ''Fusion Reactor Safety'' in Culham, 3-7 November 1986. All presentations of this meeting were divided into four sessions: 1. Statements on National-International Fusion Safety Programmes (5 papers); 2. Operation and System Safety (15 papers); 3. Waste Management and Decommissioning (5 papers); 4. Environmental Impacts (6 papers). A separate abstract was prepared for each of these 31 papers. Refs, figs, tabs

  8. Magnetic fusion reactor economics

    International Nuclear Information System (INIS)

    Krakowski, R.A.

    1995-01-01

    An almost primordial trend in the conversion and use of energy is an increased complexity and cost of conversion systems designed to utilize cheaper and more-abundant fuels; this trend is exemplified by the progression fossil fission → fusion. The present projections of the latter indicate that capital costs of the fusion ''burner'' far exceed any commensurate savings associated with the cheapest and most-abundant of fuels. These projections suggest competitive fusion power only if internal costs associate with the use of fossil or fission fuels emerge to make them either uneconomic, unacceptable, or both with respect to expensive fusion systems. This ''implementation-by-default'' plan for fusion is re-examined by identifying in general terms fusion power-plant embodiments that might compete favorably under conditions where internal costs (both economic and environmental) of fossil and/or fission are not as great as is needed to justify the contemporary vision for fusion power. Competitive fusion power in this context will require a significant broadening of an overly focused program to explore the physics and simbiotic technologies leading to more compact, simplified, and efficient plasma-confinement configurations that reside at the heart of an attractive fusion power plant

  9. Non-fusion and fusion expression of beta-galactosidase from Lactobacillus bulgaricus in Lactococcus lactis.

    Science.gov (United States)

    Wang, Chuan; Zhang, Chao-Wu; Liu, Heng-Chuan; Yu, Qian; Pei, Xiao-Fang

    2008-10-01

    To construct four recombinant Lactococcus lactis strains exhibiting high beta-galactosidase activity in fusion or non-fusion ways, and to study the influence factors for their protein expression and secretion. The gene fragments encoding beta-galactosidase from two strains of Lactobacillus bulgaricus, wch9901 isolated from yogurt and 1.1480 purchased from the Chinese Academy of Sciences, were amplified and inserted into lactococcal expression vector pMG36e. For fusion expression, the open reading frame of the beta-galactosidase gene was amplified, while for non-fusion expression, the open reading frame of the beta-galactosidase gene was amplified with its native Shine-Dalgarno sequence upstream. The start codon of the beta-galactosidase gene partially overlapped with the stop codon of vector origin open reading frame. Then, the recombinant plasmids were transformed into Escherichia coli DH5 alpha and Lactococcus lactis subsp. lactis MG1363 and confirmed by determining beta-galactosidase activities. The non-fusion expression plasmids showed a significantly higher beta-galactosidase activity in transformed strains than the fusion expression plasmids. The highest enzyme activity was observed in Lactococcus lactis transformed with the non-fusion expression plasmids which were inserted into the beta-galactosidase gene from Lactobacillus bulgaricus wch9901. The beta-galactosidase activity was 2.75 times as high as that of the native counterpart. In addition, beta-galactosidase expressed by recombinant plasmids in Lactococcus lactis could be secreted into the culture medium. The highest secretion rate (27.1%) was observed when the culture medium contained 20 g/L of lactose. Different properties of the native bacteria may have some effects on the protein expression of recombinant plasmids. Non-fusion expression shows a higher enzyme activity in host bacteria. There may be a host-related weak secretion signal peptide gene within the structure gene of Lb. bulgaricus beta

  10. Incomplete fusion studies

    International Nuclear Information System (INIS)

    Singh, B.P.

    2011-01-01

    In order to study the incomplete fusion reaction dynamics at energies ≅ 4-7 MeV/nucleon, several experiments have been carried out using accelerator facilities available in India. The measurements presented here cover a wide range of projectile-target combinations and enhance significantly our knowledge about incomplete fusion reaction dynamics. Here, the three sets of measurements have been presented; (i) excitation functions, (ii) forward recoil range distributions and (iii) the spin distributions. The first evidence of these reactions has been obtained from the measurement and analysis of excitation functions for xn/αxn/2αxn-channels. The measured excitation functions have been analyzed within the framework of compound nucleus model. The results obtained indicate the occurrence of fusion incompleteness at low beam energies. However, in order to determine the relative contribution of complete and incomplete fusion reaction processes, the recoil range distributions of the heavy residues have also been measured and analyzed within the framework of breakup fusion model which confirmed the fusion incompleteness in several heavy ion reactions involving α-emitting reaction channels. Further, in order to study the role of l-values in these reactions the spin distributions of the residues populated in case of complete and incomplete channels have been measured and are found to be distinctly different. The analysis of the data on spin distribution measurements indicate that the mean values of driving input angular momenta associated with direct-α-emitting (incomplete fusion) channels are higher than that observed for fusion-evaporation xn or α-emitting (complete fusion) channels, and is found to increase with direct α-multiplicity in the forward cone. One of the important conclusions drawn in the present work is that, there is significant incomplete fusion contribution even at energies slightly above the barrier. Further, the projectile structure has been found to

  11. Mirror fusion--fission hybrids

    International Nuclear Information System (INIS)

    Lee, J.D.

    1978-01-01

    The fusion-fission concept and the mirror fusion-fission hybrid program are outlined. Magnetic mirror fusion drivers and blankets for hybrid reactors are discussed. Results of system analyses are presented and a reference design is described

  12. Cell fusion and nuclear fusion in plants.

    Science.gov (United States)

    Maruyama, Daisuke; Ohtsu, Mina; Higashiyama, Tetsuya

    2016-12-01

    Eukaryotic cells are surrounded by a plasma membrane and have a large nucleus containing the genomic DNA, which is enclosed by a nuclear envelope consisting of the outer and inner nuclear membranes. Although these membranes maintain the identity of cells, they sometimes fuse to each other, such as to produce a zygote during sexual reproduction or to give rise to other characteristically polyploid tissues. Recent studies have demonstrated that the mechanisms of plasma membrane or nuclear membrane fusion in plants are shared to some extent with those of yeasts and animals, despite the unique features of plant cells including thick cell walls and intercellular connections. Here, we summarize the key factors in the fusion of these membranes during plant reproduction, and also focus on "non-gametic cell fusion," which was thought to be rare in plant tissue, in which each cell is separated by a cell wall. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Autophagy contributes to regulation of nuclear dynamics during vegetative growth and hyphal fusion in Fusarium oxysporum.

    Science.gov (United States)

    Corral-Ramos, Cristina; Roca, M Gabriela; Di Pietro, Antonio; Roncero, M Isabel G; Ruiz-Roldán, Carmen

    2015-01-01

    In the fungal pathogen Fusarium oxysporum, vegetative hyphal fusion triggers nuclear mitotic division in the invading hypha followed by migration of a nucleus into the receptor hypha and degradation of the resident nucleus. Here we examined the role of autophagy in fusion-induced nuclear degradation. A search of the F. oxysporum genome database for autophagy pathway components identified putative orthologs of 16 core autophagy-related (ATG) genes in yeast, including the ubiquitin-like protein Atg8, which is required for the formation of autophagosomal membranes. F. oxysporum Foatg8Δ mutants were generated in a strain harboring H1-cherry fluorescent protein (ChFP)-labeled nuclei to facilitate analysis of nuclear dynamics. The Foatg8Δ mutants did not show MDC-positive staining in contrast to the wild type and the FoATG8-complemented (cFoATG8) strain, suggesting that FoAtg8 is required for autophagy in F. oxysporum. The Foatg8Δ strains displayed reduced rates of hyphal growth, conidiation, and fusion, and were significantly attenuated in virulence on tomato plants and in the nonvertebrate animal host Galleria mellonella. In contrast to wild-type hyphae, which are almost exclusively composed of uninucleated hyphal compartments, the hyphae of the Foatg8Δ mutants contained a significant fraction of hyphal compartments with 2 or more nuclei. The increase in the number of nuclei per hyphal compartment was particularly evident after hyphal fusion events. Time-lapse microscopy analyses revealed abnormal mitotic patterns during vegetative growth in the Foatg8Δ mutants. Our results suggest that autophagy mediates nuclear degradation after hyphal fusion and has a general function in the control of nuclear distribution in F. oxysporum.

  14. The fusion reactor

    International Nuclear Information System (INIS)

    Brennan, M.H.

    1974-01-01

    Basic principles of the fusion reactor are outlined. Plasma heating and confinement schemes are described. These confinement systems include the linear Z pinch, magnetic mirrors and Tokamaks. A fusion reactor is described and a discussion is given of its environmental impact and its fuel situation. (R.L.)

  15. Fusion Canada issue 8

    International Nuclear Information System (INIS)

    1989-08-01

    A short bulletin from the National Fusion Program. Included in this issue are Canada-ITER contributions, NET Fuel Processing Loop, Bilateral Meeting for Canada-Europe, report from Tokamak de Varennes and a report from the University of Toronto on materials research for Fusion Reactors. 3 figs

  16. Fusion Canada issue 15

    International Nuclear Information System (INIS)

    1991-10-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on the 1996 IAEA Fusion Conference site, operations at the Tokamak de Varennes including divertor pumping of impurities and pumping of carbon monoxide and methane, a discussion of the CFFTP and it's role. 1 fig

  17. Energy by nuclear fusion

    International Nuclear Information System (INIS)

    Buende, R.; Daenner, W.; Herold, H.; Raeder, J.

    1976-12-01

    This report reviews the state of knowledge in a number of fields of fusion research up to autumn 1976. Section 1 gives a very brief presentation of the elementary fusion reactions, the energies delivered by them and the most basic energy balances leading to Lawson-type diagrams. Section 2 outlines the reserves and cost of lithium and deuterium, gives estimates of the total energy available from DT fusion and comments on production technology, availlability and handling of the fuels. In section 3 a survey is given of the different concepts of magnetic confinement (stellarators, tokamaks, toroidal pinches, mirror machines, two-component plasmas), of confinement by walls, gas blankets and imploding liners and, finally, of the concepts of interial confinement (laser fusion, beam fusion). The reactors designed or outlined on the basis of the tokamak, high-β, mirror, and laser fusion concepts are presented in section 4, which is followed in section 5 by a discussion of the key problems of fusion power plants. The present-day knowledge of the cost structure of fusion power plants and the sensitivity of this structure with respect to the physical and technical assumptions made is analysed in section 6. Section 7 and 8 treat the aspects of safety and environment. The problems discussed include the hazard potentials of different designs (radiological, toxicological, and with respect to stored energies), release of radioactivity, possible kinds of malfunctioning, and the environmental impact of waste heat, radiation and radioactive waste (orig.) [de

  18. Fusion helps diversification

    NARCIS (Netherlands)

    Liang, S.; Ren, Z.; de Rijke, M.

    2014-01-01

    A popular strategy for search result diversification is to first retrieve a set of documents utilizing a standard retrieval method and then rerank the results. We adopt a different perspective on the problem, based on data fusion. Starting from the hypothesis that data fusion can improve performance

  19. Fusion Canada issue 22

    International Nuclear Information System (INIS)

    1993-10-01

    A short bulletin from the National Fusion Program highlighting in this issue a bi-lateral meeting between Canada and Japan, water and hydrogen detritiation, in-situ tokamak surface analysis, an update of CCFM/TdeV and tritium accounting Industry guidance in Fusion, fast probe for plasma-surface interaction. 4 figs

  20. International fusion research council

    International Nuclear Information System (INIS)

    Belozerov, A.N.

    1977-01-01

    A brief history of the International Fusion Research Council (IFRC) is given and the minutes of the 1976 meeting in Garching are summarized. At the Garching meeting, the IFRC evaluated the quality of papers presented at recent IAEA conferences on plasma physics and controlled thermonuclear research, and made recommendations on the organization and timing of future meetings on nuclear fusion

  1. Fusion Canada issue 15

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-10-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on the 1996 IAEA Fusion Conference site, operations at the Tokamak de Varennes including divertor pumping of impurities and pumping of carbon monoxide and methane, a discussion of the CFFTP and it`s role. 1 fig.

  2. Magnetic Fusion Program Plan

    International Nuclear Information System (INIS)

    1985-02-01

    This Plan reflects the present conditions of the energy situation and is consistent with national priorities for the support of basic and applied research. It is realistic in taking advantage of the technical position that the United States has already established in fusion research to make cost-effective progress toward the development of fusion power as a future energy option

  3. Fusion Canada issue 8

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-08-01

    A short bulletin from the National Fusion Program. Included in this issue are Canada-ITER contributions, NET Fuel Processing Loop, Bilateral Meeting for Canada-Europe, report from Tokamak de Varennes and a report from the University of Toronto on materials research for Fusion Reactors. 3 figs.

  4. Sensor Data Fusion

    DEFF Research Database (Denmark)

    Plascencia, Alfredo; Stepán, Petr

    2006-01-01

    The main contribution of this paper is to present a sensor fusion approach to scene environment mapping as part of a Sensor Data Fusion (SDF) architecture. This approach involves combined sonar array with stereo vision readings.  Sonar readings are interpreted using probability density functions...

  5. Coatings for laser fusion

    International Nuclear Information System (INIS)

    Lowdermilk, W.H.

    1981-01-01

    Optical coatings are used in lasers systems for fusion research to control beam propagation and reduce surface reflection losses. The performance of coatings is important in the design, reliability, energy output, and cost of the laser systems. Significant developments in coating technology are required for future lasers for fusion research and eventual power reactors

  6. Fusion reactor materials

    International Nuclear Information System (INIS)

    Sethi, V.K.; Scholz, R.; Nolfi, F.V. Jr.; Turner, A.P.L.

    1980-01-01

    Data are given for each of the following areas: (1) effects of irradiation on fusion reactor materials, (2) hydrogen permeation and materials behavior in alloys, (3) carbon coatings for fusion applications, (4) surface damage of TiB 2 coatings under energetic D + and 4 He + irradiations, and (5) neutron dosimetry

  7. The IGNITEX fusion project

    International Nuclear Information System (INIS)

    Carrera, R.

    1987-01-01

    The author discusses the recently proposed fusion ignition experiment, IGNITEX. He emphasizes the basic ideas of this concept rather than the specific details of the physics and engineering aspects of the experiment. This concept is a good example of the importance of maintaining an adequate balance between the basic scientific progress in fusion physics and the new technologies that are becoming available in order to make fusion work. The objective of the IGNITEX project is to produce and control ignited plasmas for scientific study in the simplest and least expensive way possible. Being able to study this not-yet-produced regime of plasma operation is essential to fusion research. Two years after the fission nuclear reaction was discovered, a non-self-sustained fission reaction was produced in a laboratory, and in one more year a self-sustained reaction was achieved at the University of Chicago. However, after almost forty years of fusion research, a self-sustained fusion reaction has yet not been produced in a laboratory experiment. This fact indicates the greater difficulty of the fusion experiment. Because of the difficulty involved in the production of a self-sustained fusion reaction, it is necessary to propose such an experiment with maximum ignition margins, maximum simplicity, and minimum financial risk

  8. Controlled thermonuclear fusion

    CERN Document Server

    Bobin, Jean Louis

    2014-01-01

    The book is a presentation of the basic principles and main achievements in the field of nuclear fusion. It encompasses both magnetic and inertial confinements plus a few exotic mechanisms for nuclear fusion. The state-of-the-art regarding thermonuclear reactions, hot plasmas, tokamaks, laser-driven compression and future reactors is given.

  9. Fusion Power Deployment

    International Nuclear Information System (INIS)

    Schmidt, J.A.; Ogden, J.M.

    2002-01-01

    Fusion power plants could be part of a future portfolio of non-carbon dioxide producing energy supplies such as wind, solar, biomass, advanced fission power, and fossil energy with carbon dioxide sequestration. In this paper, we discuss key issues that could impact fusion energy deployment during the last half of this century. These include geographic issues such as resource availability, scale issues, energy storage requirements, and waste issues. The resource needs and waste production associated with fusion deployment in the U.S. should not pose serious problems. One important feature of fusion power is the fact that a fusion power plant should be locatable within most local or regional electrical distribution systems. For this reason, fusion power plants should not increase the burden of long distance power transmission to our distribution system. In contrast to fusion power, regional factors could play an important role in the deployment of renewable resources such as wind, solar and biomass or fossil energy with CO2 sequestration. We examine the role of these regional factors and their implications for fusion power deployment

  10. Fusion Canada issue 4

    International Nuclear Information System (INIS)

    1988-05-01

    A short bulletin from the National Fusion Program. Included in this issue is a technical update on Tokamak de Varennes, a report on the Beatrix II Breeding Materials Test Program, the Tritium glovebox system for UPM, Saudi Arabia, a broad update of the Canadian Fusion Fuels Technology Project is also included. 1 fig

  11. Fusion Canada issue 12

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-10-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on Darlington`s Tritium Removal Facility, work at universities on Deuterium Diffusivity in Beryllium, Fusion Studies, confinement research and the operation of divertors at Tokamak de Varennes. 5 figs.

  12. Fusion Canada issue 22

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1993-10-01

    A short bulletin from the National Fusion Program highlighting in this issue a bi-lateral meeting between Canada and Japan, water and hydrogen detritiation, in-situ tokamak surface analysis, an update of CCFM/TdeV and tritium accounting Industry guidance in Fusion, fast probe for plasma-surface interaction. 4 figs.

  13. Fusion Canada issue 4

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1988-05-01

    A short bulletin from the National Fusion Program. Included in this issue is a technical update on Tokamak de Varennes, a report on the Beatrix II Breeding Materials Test Program, the Tritium glovebox system for UPM, Saudi Arabia, a broad update of the Canadian Fusion Fuels Technology Project is also included. 1 fig.

  14. Fusion Canada issue 19

    International Nuclear Information System (INIS)

    1992-12-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on the IAEA Plasma Biasing Meeting, the new IEA program -Nuclear Technology of Fusion reactors, TFTR tritium purification system, an update by CCFM on machine additions and modifications, and news of a new compact Toroid injector at the University of Saskatchewan. 1 fig

  15. Fusion Canada issue 14

    International Nuclear Information System (INIS)

    1991-05-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on a fusion cooperation agreement between Japan and Canada, an update at Tokamak de Varennes on plasma biasing experiments and boronization tests and a collaboration between Canada and the U.S. on a compact toroid fuelling gun. 4 figs

  16. Fusion Canada issue 12

    International Nuclear Information System (INIS)

    1990-10-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on Darlington's Tritium Removal Facility, work at universities on Deuterium Diffusivity in Beryllium, Fusion Studies, confinement research and the operation of divertors at Tokamak de Varennes. 5 figs

  17. Controlled Nuclear Fusion.

    Science.gov (United States)

    Glasstone, Samuel

    This publication is one of a series of information booklets for the general public published by The United States Atomic Energy Commission. Among the topics discussed are: Importance of Fusion Energy; Conditions for Nuclear Fusion; Thermonuclear Reactions in Plasmas; Plasma Confinement by Magnetic Fields; Experiments With Plasmas; High-Temperature…

  18. [Rumination and cognitive fusion in dementia family caregivers].

    Science.gov (United States)

    Romero-Moreno, Rosa; Márquez-González, María; Losada, Andrés; Fernández-Fernández, Virginia; Nogales-González, Celia

    2015-01-01

    Rumination has been described as a dysfunctional coping strategy related to emotional distress. Recently, it has been highlighted from the Acceptance and Commitment Therapy therapeutic approach, the negative role that cognitive fusion (the extent to which we are psychologically tangled with and dominated by the form or content of our thoughts) has on the explanation of distress. The aim of this study is to simultaneously analyze the role of rumination and cognitive fusion in the caregiving stress process. The sample of 176 dementia caregivers was divided in four groups, taking into account their levels of rumination and cognitive fusion: HRHF=high rumination+high cognitive fusion; HRLF=high rumination+low cognitive fusion; LRHF= low rumination+high cognitive fusion; and LRLC=low rumination and low cognitive fusion. Caregiver stress factors, frequency of pleasant events, experiential avoidance, coherence and satisfaction with personal values, depression, anxiety and satisfaction with life, were measured. The HRHF group showed higher levels of depression, anxiety, experiential avoidance and lower levels of satisfaction with life, frequency of pleasant events, coherence and satisfaction with personal values, than the other three groups. Considering simultaneously rumination and cognitive fusion may contribute to a better understanding of caregiver coping and distress. Copyright © 2014 SEGG. Published by Elsevier Espana. All rights reserved.

  19. Industry's role in inertial fusion

    International Nuclear Information System (INIS)

    Glass, A.J.

    1983-01-01

    This paper is an address to the Tenth Symposium on Fusion Engineering. The speaker first addressed the subject of industry's role in inertial fusion three years earlier in 1980, outlining programs that included participation in the Shiva construction project, and the industrial participants' program set up in the laser fusion program to bring industrial scientists and engineers into the laboratory to work on laser fusion. The speaker is now the president of KMS Fusion, Inc., the primary industrial participant in the inertial fusion program. The outlook for fusion energy and the attitude of the federal government toward the fusion program is discussed

  20. Towards fusion power

    International Nuclear Information System (INIS)

    Venkataraman, G.

    1975-01-01

    An attempt has been made to present general but broad review of the recent developments in the field of plasma physics and its application to fusion power. The first chapter describes the fusion reactions and fusion power systems. The second chapter deals in detail with production and behaviour of plasma, screening, oscillations, instability, energy losses, temperature effects, etc. Magnetic confinements, including pinch systems, toroidal systems such as Tokamac and stellarator, minor machine, etc. are discussed in detail in chapter III. Laser produced plasma, laser implosion and problems associated with it and future prospects are explained in chapter IV. Chapter V is devoted entirely to the various aspects of hybrid systems. The last chapter throws light on problems of fusion technology, such as plasma heating, vacuum requirements, radiation damage, choice of materials, blanket problems, hazards of fusion reactions, etc. (K.B.)

  1. Fusion fuel blanket technology

    International Nuclear Information System (INIS)

    Hastings, I.J.; Gierszewski, P.

    1987-05-01

    The fusion blanket surrounds the burning hydrogen core of a fusion reactor. It is in this blanket that most of the energy released by the nuclear fusion of deuterium-tritium is converted into useful product, and where tritium fuel is produced to enable further operation of the reactor. As fusion research turns from present short-pulse physics experiments to long-burn engineering tests in the 1990's, energy removal and tritium production capabilities become important. This technology will involve new materials, conditions and processes with applications both to fusion and beyond. In this paper, we introduce features of proposed blanket designs and update and status of international research. In focusing on the Canadian blanket technology program, we discuss the aqueous lithium salt blanket concept, and the in-reactor tritium recovery test program

  2. Decomposition of incomplete fusion

    International Nuclear Information System (INIS)

    Sobotka, L.B.; Sarantities, D.G.; Stracener, D.W.; Majka, Z.; Abenante, V.; Semkow, T.M.; Hensley, D.C.; Beene, J.R.; Halbert, M.L.

    1989-01-01

    The velocity distribution of fusion-like products formed in the reaction 701 MeV 28 Si+ 100 Mo is decomposed into 26 incomplete fusion channels. The momentum deficit of the residue per nonevaporative mass unit is approximately equal to the beam momentum per nucleon. The yields of the incomplete fusion channels correlate with the Q-value for projectile fragmentation rather than that for incomplete fusion. The backward angle multiplicities of light particles and heavy ions increase with momentum transfer, however, the heavy ion multiplicities also depend on the extent of the fragmentation of the incomplete fusion channel. These data indicate that at fixed linear momentum transfer, increased fragmentation of the unfused component is related to a reduced transferred angular momentum. 22 refs., 6 figs., 1 tab

  3. Nuclear fusion: The issues

    International Nuclear Information System (INIS)

    Griffin, R.D.

    1993-01-01

    The taming of fusion energy, has proved one of the most elusive quests of modern science. For four decades, the United States has doggedly pursued energy's holy grail, pumping more than $9 billion into research and reactor prototypes. This year, the federal government is slated to spend $339 million on fusion, more than the combined amount the government will spend for research on oil, natural gas, solar power, wind power, geothermal energy, biofuels and conservation. This article summarizes the technical, political in terms of international cooperation, economic, planning, etc. issues surrounding the continued development of fusion as a possible power source for the next century. Brief descriptions of how fusion works and of the design of a tokamak fusion machine are included

  4. Fusion safety data base

    International Nuclear Information System (INIS)

    Laats, E.T.; Hardy, H.A.

    1983-01-01

    The purpose of this Fusion Safety Data Base Program is to provide a repository of data for the design and development of safe commercial fusion reactors. The program is sponsored by the United States Department of Energy (DOE), Office of Fusion Energy. The function of the program is to collect, examine, permanently store, and make available the safety data to the entire US magnetic-fusion energy community. The sources of data will include domestic and foreign fusion reactor safety-related research programs. Any participant in the DOE Program may use the Data Base Program from his terminal through user friendly dialog and can view the contents in the form of text, tables, graphs, or system diagrams

  5. Compact fusion reactors

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    Fusion research is currently to a large extent focused on tokamak (ITER) and inertial confinement (NIF) research. In addition to these large international or national efforts there are private companies performing fusion research using much smaller devices than ITER or NIF. The attempt to achieve fusion energy production through relatively small and compact devices compared to tokamaks decreases the costs and building time of the reactors and this has allowed some private companies to enter the field, like EMC2, General Fusion, Helion Energy, Lawrenceville Plasma Physics and Lockheed Martin. Some of these companies are trying to demonstrate net energy production within the next few years. If they are successful their next step is to attempt to commercialize their technology. In this presentation an overview of compact fusion reactor concepts is given.

  6. Some fusion perspectives

    International Nuclear Information System (INIS)

    McNally, J.R. Jr.

    1977-01-01

    Some of the concepts of nuclear fusion reactions, advanced fusion fuels, environmental impacts, etc., are explored using the following general outline: I. Principles of Fusion (Nuclear Fuels and Reactions, Lawson Condition, n tau vs T, Nuclear Burn Characteristics); II. Magnetic Mirror Possibilities (the Ion Layer and Electron Layer, Exponential Build-up at MeV energies, Lorentz trapping at GeV energies); III. Pellet Fuel Fusion Prospects (Advanced Pellet Fuel Fusion Prospects, Burn Characteristics and Applications, Excitation-heating Prospects for Runaway Ion Temperatures). Inasmuch as the outline is very skeletal, a significant research and development effort may be in order to evaluate these prospects in more detail and hopefully ''harness the H-bomb'' for peaceful applications, the author concludes. 28 references

  7. DNA Amplification by Breakage/Fusion/Bridge Cycles Initiated by Spontaneous Telomere Loss in a Human Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Anthony W.l. Lo

    2002-01-01

    Full Text Available The development of genomic instability is an important step in generatingthe multiple genetic changes required for cancer. One consequence of genomic instability is the overexpression of oncogenes due to gene amplification. One mechanism for gene amplification is the breakagelfusionlbridge (B/F/Bcyclethatinvolvesthe repeated fusion and breakage of chromosomes following the loss of a telomere. B/F/B cycles have been associated with low-copy gene amplification in human cancer cells, and have been proposed to be an initiating event in high-copy gene amplification. We have found that spontaneous telomere loss on a marker chromosome 16 in a human tumor cell line results in sister chromatid fusion and prolonged periods of chromosome instability. The high rate of anaphase bridges involving chromosome 16 demonstrates that this instability results from B/F/B cycles. The amplification of subtelomeric DNA on the marker chromosome provides conclusive evidence that B/F/B cycles initiated by spontaneous telomere loss are a mechanism for gene amplification in human cancer cells.

  8. Investigations of image fusion

    Science.gov (United States)

    Zhang, Zhong

    1999-12-01

    The objective of image fusion is to combine information from multiple images of the same scene. The result of image fusion is a single image which is more suitable for the purpose of human visual perception or further image processing tasks. In this thesis, a region-based fusion algorithm using the wavelet transform is proposed. The identification of important features in each image, such as edges and regions of interest, are used to guide the fusion process. The idea of multiscale grouping is also introduced and a generic image fusion framework based on multiscale decomposition is studied. The framework includes all of the existing multiscale-decomposition- based fusion approaches we found in the literature which did not assume a statistical model for the source images. Comparisons indicate that our framework includes some new approaches which outperform the existing approaches for the cases we consider. Registration must precede our fusion algorithms. So we proposed a hybrid scheme which uses both feature-based and intensity-based methods. The idea of robust estimation of optical flow from time- varying images is employed with a coarse-to-fine multi- resolution approach and feature-based registration to overcome some of the limitations of the intensity-based schemes. Experiments show that this approach is robust and efficient. Assessing image fusion performance in a real application is a complicated issue. In this dissertation, a mixture probability density function model is used in conjunction with the Expectation- Maximization algorithm to model histograms of edge intensity. Some new techniques are proposed for estimating the quality of a noisy image of a natural scene. Such quality measures can be used to guide the fusion. Finally, we study fusion of images obtained from several copies of a new type of camera developed for video surveillance. Our techniques increase the capability and reliability of the surveillance system and provide an easy way to obtain 3-D

  9. Hemi-fused structure mediates and controls fusion and fission in live cells.

    Science.gov (United States)

    Zhao, Wei-Dong; Hamid, Edaeni; Shin, Wonchul; Wen, Peter J; Krystofiak, Evan S; Villarreal, Seth A; Chiang, Hsueh-Cheng; Kachar, Bechara; Wu, Ling-Gang

    2016-06-23

    Membrane fusion and fission are vital for eukaryotic life. For three decades, it has been proposed that fusion is mediated by fusion between the proximal leaflets of two bilayers (hemi-fusion) to produce a hemi-fused structure, followed by fusion between the distal leaflets, whereas fission is via hemi-fission, which also produces a hemi-fused structure, followed by full fission. This hypothesis remained unsupported owing to the lack of observation of hemi-fusion or hemi-fission in live cells. A competing fusion hypothesis involving protein-lined pore formation has also been proposed. Here we report the observation of a hemi-fused Ω-shaped structure in live neuroendocrine chromaffin cells and pancreatic β-cells, visualized using confocal and super-resolution stimulated emission depletion microscopy. This structure is generated from fusion pore opening or closure (fission) at the plasma membrane. Unexpectedly, the transition to full fusion or fission is determined by competition between fusion and calcium/dynamin-dependent fission mechanisms, and is notably slow (seconds to tens of seconds) in a substantial fraction of the events. These results provide key missing evidence in support of the hemi-fusion and hemi-fission hypothesis in live cells, and reveal the hemi-fused intermediate as a key structure controlling fusion and fission, as fusion and fission mechanisms compete to determine the transition to fusion or fission.

  10. The international magnetic fusion energy program

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, T.K.

    1988-10-06

    In May of 1988, the long tradition of international cooperation in magnetic fusion energy research culminated in the initiation of design work on the International Thermonuclear Experimental Reactor (ITER). If eventually constructed in the 1990s, ITER would be the world's first magnetic fusion reactor. This paper discusses the background events that led to ITER and the present status of the ITER activity. This paper presents a brief summary of the technical, political, and organizational activities that have led to the creation of the ITER design activity. The ITER activity is now the main focus of international cooperation in magnetic fusion research and one of the largest international cooperative efforts in all of science. 2 refs., 12 figs.

  11. The international magnetic fusion energy program

    International Nuclear Information System (INIS)

    Fowler, T.K.

    1988-01-01

    In May of 1988, the long tradition of international cooperation in magnetic fusion energy research culminated in the initiation of design work on the International Thermonuclear Experimental Reactor (ITER). If eventually constructed in the 1990s, ITER would be the world's first magnetic fusion reactor. This paper discusses the background events that led to ITER and the present status of the ITER activity. This paper presents a brief summary of the technical, political, and organizational activities that have led to the creation of the ITER design activity. The ITER activity is now the main focus of international cooperation in magnetic fusion research and one of the largest international cooperative efforts in all of science. 2 refs., 12 figs

  12. Prenatal diagnosis of the fragile X syndrome : loss of mutation owing to a double recombinant or gene conversion event at the FMR1 locus

    NARCIS (Netherlands)

    Losekoot, M; Hoogendoorn, E; Olmer, R; Jansen, CCAM; Oosterwijk, JC; vandenOuweland, AMW; Halley, DJJ; Warren, ST; Willemsen, R; Oostra, BA; Bakker, E

    1997-01-01

    The fragile X syndrome, an X linked mental retardation syndrome, is caused by an expanded CGG repeat in the first exon of the FMR1 gene. In patients with an expanded repeat the FMR1 promoter is methylated and, consequently, the gene is silenced and no FMR1 protein (FMRP) is produced, thus leading to

  13. US fusion community discussion on fusion strategies

    International Nuclear Information System (INIS)

    Marton, W.A.

    1998-01-01

    On April 26 - May 1, 1998, a US Fusion Community Forum for Major Next-Step Experiments was held at Madison, Wisconsin, USA. Both the Single Integrated Step strategy and the Multiple Machine strategy have substantial support from the about 180 scientists and engineers who participated

  14. Jamb and jamc are essential for vertebrate myocyte fusion.

    Directory of Open Access Journals (Sweden)

    Gareth T Powell

    2011-12-01

    Full Text Available Cellular fusion is required in the development of several tissues, including skeletal muscle. In vertebrates, this process is poorly understood and lacks an in vivo-validated cell surface heterophilic receptor pair that is necessary for fusion. Identification of essential cell surface interactions between fusing cells is an important step in elucidating the molecular mechanism of cellular fusion. We show here that the zebrafish orthologues of JAM-B and JAM-C receptors are essential for fusion of myocyte precursors to form syncytial muscle fibres. Both jamb and jamc are dynamically co-expressed in developing muscles and encode receptors that physically interact. Heritable mutations in either gene prevent myocyte fusion in vivo, resulting in an overabundance of mononuclear, but otherwise overtly normal, functional fast-twitch muscle fibres. Transplantation experiments show that the Jamb and Jamc receptors must interact between neighbouring cells (in trans for fusion to occur. We also show that jamc is ectopically expressed in prdm1a mutant slow muscle precursors, which inappropriately fuse with other myocytes, suggesting that control of myocyte fusion through regulation of jamc expression has important implications for the growth and patterning of muscles. Our discovery of a receptor-ligand pair critical for fusion in vivo has important implications for understanding the molecular mechanisms responsible for myocyte fusion and its regulation in vertebrate myogenesis.

  15. The MARVEL domain protein, Singles Bar, is required for progression past the pre-fusion complex stage of myoblast fusion.

    Science.gov (United States)

    Estrada, Beatriz; Maeland, Anne D; Gisselbrecht, Stephen S; Bloor, James W; Brown, Nicholas H; Michelson, Alan M

    2007-07-15

    Multinucleated myotubes develop by the sequential fusion of individual myoblasts. Using a convergence of genomic and classical genetic approaches, we have discovered a novel gene, singles bar (sing), that is essential for myoblast fusion. sing encodes a small multipass transmembrane protein containing a MARVEL domain, which is found in vertebrate proteins involved in processes such as tight junction formation and vesicle trafficking where--as in myoblast fusion--membrane apposition occurs. sing is expressed in both founder cells and fusion competent myoblasts preceding and during myoblast fusion. Examination of embryos injected with double-stranded sing RNA or embryos homozygous for ethane methyl sulfonate-induced sing alleles revealed an identical phenotype: replacement of multinucleated myofibers by groups of single, myosin-expressing myoblasts at a stage when formation of the mature muscle pattern is complete in wild-type embryos. Unfused sing mutant myoblasts form clusters, suggesting that early recognition and adhesion of these cells are unimpaired. To further investigate this phenotype, we undertook electron microscopic ultrastructural studies of fusing myoblasts in both sing and wild-type embryos. These experiments revealed that more sing mutant myoblasts than wild-type contain pre-fusion complexes, which are characterized by electron-dense vesicles paired on either side of the fusing plasma membranes. In contrast, embryos mutant for another muscle fusion gene, blown fuse (blow), have a normal number of such complexes. Together, these results lead to the hypothesis that sing acts at a step distinct from that of blow, and that sing is required on both founder cell and fusion-competent myoblast membranes to allow progression past the pre-fusion complex stage of myoblast fusion, possibly by mediating fusion of the electron-dense vesicles to the plasma membrane.

  16. The mitochondrial genome of the stingless bee Melipona bicolor (Hymenoptera, Apidae, Meliponini: sequence, gene organization and a unique tRNA translocation event conserved across the tribe Meliponini

    Directory of Open Access Journals (Sweden)

    Daniela Silvestre

    2008-01-01

    Full Text Available At present a complete mtDNA sequence has been reported for only two hymenopterans, the Old World honey bee, Apis mellifera and the sawfly Perga condei. Among the bee group, the tribe Meliponini (stingless bees has some distinction due to its Pantropical distribution, great number of species and large importance as main pollinators in several ecosystems, including the Brazilian rain forest. However few molecular studies have been conducted on this group of bees and few sequence data from mitochondrial genomes have been described. In this project, we PCR amplified and sequenced 78% of the mitochondrial genome of the stingless bee Melipona bicolor (Apidae, Meliponini. The sequenced region contains all of the 13 mitochondrial protein-coding genes, 18 of 22 tRNA genes, and both rRNA genes (one of them was partially sequenced. We also report the genome organization (gene content and order, gene translation, genetic code, and other molecular features, such as base frequencies, codon usage, gene initiation and termination. We compare these characteristics of M. bicolor to those of the mitochondrial genome of A. mellifera and other insects. A highly biased A+T content is a typical characteristic of the A. mellifera mitochondrial genome and it was even more extreme in that of M. bicolor. Length and compositional differences between M. bicolor and A. mellifera genes were detected and the gene order was compared. Eleven tRNA gene translocations were observed between these two species. This latter finding was surprising, considering the taxonomic proximity of these two bee tribes. The tRNA Lys gene translocation was investigated within Meliponini and showed high conservation across the Pantropical range of the tribe.

  17. Assessing molecular initiating events (MIEs), key events (KEs) and modulating factors (MFs) for styrene responses in mouse lungs using whole genome gene expression profiling following 1-day and multi-week exposures.

    Science.gov (United States)

    Andersen, Melvin E; Cruzan, George; Black, Michael B; Pendse, Salil N; Dodd, Darol; Bus, James S; Sarang, Satinder S; Banton, Marcy I; Waites, Robbie; McMullen, Patrick D

    2017-11-15

    Styrene increased lung tumors in mice at chronic inhalation exposures of 20ppm and greater. MIEs, KEs and MFs were examined using gene expression in three strains of male mice (the parental C57BL/6 strain, a CYP2F2(-/-) knock out and a CYP2F2(-/-) transgenic containing human CYP2F1, 2A13 and 2B6). Exposures were for 1-day and 1, 4 and 26weeks. After 1-day exposures at 1, 5, 10, 20, 40 and 120ppm significant increases in differentially expressed genes (DEGs) occurred only in parental strain lungs where there was already an increase in DEGs at 5ppm and then many thousands of DEGs by 120ppm. Enrichment for 1-day and 1-week exposures included cell cycle, mitotic M-M/G1 phases, DNA-synthesis and metabolism of lipids and lipoproteins pathways. The numbers of DEGs decreased steadily over time with no DEGs meeting both statistical significance and fold-change criteria at 26weeks. At 4 and 26weeks, some key transcription factors (TFs) - Nr1d1, Nr1d2, Dbp, Tef, Hlf, Per3, Per2 and Bhlhe40 - were upregulated (|FC|>1.5), while others - Npas, Arntl, Nfil3, Nr4a1, Nr4a2, and Nr4a3 - were down-regulated. At all times, consistent changes in gene expression only occurred in the parental strain. Our results support a MIE for styrene of direct mitogenicity from mouse-specific CYP2F2-mediated metabolites activating Nr4a signaling. Longer-term MFs include down-regulation of Nr4a genes and shifts in both circadian clock TFs and other TFs, linking circadian clock to cellular metabolism. We found no gene expression changes indicative of cytotoxicity or activation of p53-mediated DNA-damage pathways. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Materials for fusion reactors

    International Nuclear Information System (INIS)

    Ehrlich, K.; Kaletta, D.

    1978-03-01

    The following report describes five papers which were given during the IMF seminar series summer 1977. The purpose of this series was to discuss especially the irradiation behaviour of materials intended for the first wall of future fusion reactors. The first paper deals with the basic understanding of plasma physics relating to the fusion reactor and presents the current state of art of fusion technology. The next two talks discuss the metals intended for the first wall and structural components of a fusion reactor. Since 14 MeV neutrons play an important part in the process of irradiation damage their role is discussed in detail. The question which machines are presently available to simulate irradiation damage under conditions similar to the ones found in a fusion reactor are investigated in the fourth talk which also presents the limitations of the different methods of simulation. In this context also discussed is the importance future intensive neutron sources and materials test reactors will have for this problem area. The closing paper has as a theme the review of the present status of research of metallic and non-metallic materials in view of the quite different requirements for different fusion systems; a closing topic is the world supply on rare materials required for fusion reactors. (orig) [de

  19. Nova Event Logging System

    International Nuclear Information System (INIS)

    Calliger, R.J.; Suski, G.J.

    1981-01-01

    Nova is a 200 terawatt, 10-beam High Energy Glass Laser currently under construction at LLNL. This facility, designed to demonstrate the feasibility of laser driven inertial confinement fusion, contains over 5000 elements requiring coordinated control, data acquisition, and analysis functions. The large amounts of data that will be generated must be maintained over the life of the facility. Often the most useful but inaccessible data is that related to time dependent events associated with, for example, operator actions or experiment activity. We have developed an Event Logging System to synchronously record, maintain, and analyze, in part, this data. We see the system as being particularly useful to the physics and engineering staffs of medium and large facilities in that it is entirely separate from experimental apparatus and control devices. The design criteria, implementation, use, and benefits of such a system will be discussed

  20. Fusion research in Hungary

    International Nuclear Information System (INIS)

    Zoletnik, S.

    2004-01-01

    Hungarian fusion research started in the 1970s, when the idea of installing a small tokamak experiment emerged. In return to computer equipment a soviet tokamak was indeed sent to Hungary and started to operate as MT-1 at the Central Research Institute for Physics (KFKI) in 1979. Major research topics included diagnostic development, edge plasma studies and investigation of disruptions. Following a major upgrade in 1992 (new vacuum vessel, active position control and PC network based data acquisition system) the MT-1M tokamak was used for the study of transport processes with trace impurity injection, micropellet ablation studies, X-ray tomography and laser blow-off diagnostic development. Although funding ceased in the middle of the 90's the group was held alive by collaborations with EU fusion labs: FZ -Juelich, IPP-Garching and CRPP-EPFL Lausanne. In 1998 the machine was dismantled due to reorganization of the Hungarian Academy of Sciences. New horizons opened to fusion research from 1999, when Hungary joined EURATOM and a fusion Association was formed. Since then fusion physics studies are done in collaboration with major EU fusion laboratories, Hungarian researchers also play an active role in JET diagnostics upgrade and ITER design. Major topics are pellet ablation studies, plasma turbulence diagnosis using Beam Emission Spectroscopy and other techniques, tomography and plasma diagnostics using various neutral beams. In fusion relevant technology R and D Hungary has less records. Before joining EURATOM some materials irradiation studies were done at the Budapest Research Reactor at KFKI-AEKI. The present day fusion technology programme focuses still on irradiation studies, nuclear material database and electromagnetic testing techniques. Increasing the fusion technology research activities is a difficult task, as the competition in Hungarian industry is very strong and the interest of organizations in long-term investments into R and D is rather weak and

  1. Mitochondrial Fusion Proteins and Human Diseases

    Directory of Open Access Journals (Sweden)

    Michela Ranieri

    2013-01-01

    Full Text Available Mitochondria are highly dynamic, complex organelles that continuously alter their shape, ranging between two opposite processes, fission and fusion, in response to several stimuli and the metabolic demands of the cell. Alterations in mitochondrial dynamics due to mutations in proteins involved in the fusion-fission machinery represent an important pathogenic mechanism of human diseases. The most relevant proteins involved in the mitochondrial fusion process are three GTPase dynamin-like proteins: mitofusin 1 (MFN1 and 2 (MFN2, located in the outer mitochondrial membrane, and optic atrophy protein 1 (OPA1, in the inner membrane. An expanding number of degenerative disorders are associated with mutations in the genes encoding MFN2 and OPA1, including Charcot-Marie-Tooth disease type 2A and autosomal dominant optic atrophy. While these disorders can still be considered rare, defective mitochondrial dynamics seem to play a significant role in the molecular and cellular pathogenesis of more common neurodegenerative diseases, for example, Alzheimer’s and Parkinson’s diseases. This review provides an overview of the basic molecular mechanisms involved in mitochondrial fusion and focuses on the alteration in mitochondrial DNA amount resulting from impairment of mitochondrial dynamics. We also review the literature describing the main disorders associated with the disruption of mitochondrial fusion.

  2. Mirror fusion reactors

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    Conceptual design studies were made of fusion reactors based on the three current mirror-confinement concepts: the standard mirror, the tandem mirror, and the field-reversed mirror. Recent studies of the standard mirror have emphasized its potential as a fusion-fission hybrid reactor, designed to produce fuel for fission reactors. We have designed a large commercial hybrid and a small pilot-plant hybrid based on standard mirror confinement. Tandem mirror designs include a commercial 1000-MWe fusion power plant and a nearer term tandem mirror hybrid. Field-reversed mirror designs include a multicell commercial reactor producing 75 MWe and a single-cell pilot plant

  3. Mirror fusion reactors

    International Nuclear Information System (INIS)

    Carlson, G.A.; Moir, R.W.

    1978-01-01

    We have carried out conceptual design studies of fusion reactors based on the three current mirror confinement concepts: the standard mirror, the tandem mirror, and the field-reversed mirror. Recent studies of the standard mirror have emphasized its potential as a fusion-fission hybrid reactor, designed to produce fission fuel for fission reactors. We have designed a large commercial hybrid based on standard mirror confinement, and also a small pilot plant hybrid. Tandem mirror designs include a commercial 1000 MWe fusion power plant and a nearer term tandem mirror hybrid. Field-reversed mirror designs include a multicell commercial reactor producing 75 MWe and a single cell pilot plant

  4. Fusion Reactor Materials

    International Nuclear Information System (INIS)

    Decreton, M.

    2002-01-01

    The objective of SCK-CEN's programme on fusion reactor materials is to contribute to the knowledge on the radiation-induced behaviour of fusion reactor materials and components as well as to help the international community in building the scientific and technical basis needed for the construction of the future reactor. Ongoing projects include: the study of the mechanical and chemical (corrosion) behaviour of structural materials under neutron irradiation and water coolant environment; the investigation of the characteristics of irradiated first wall material such as beryllium; investigations on the management of materials resulting from the dismantling of fusion reactors including waste disposal. Progress and achievements in these areas in 2001 are discussed

  5. Remote sensing image fusion

    CERN Document Server

    Alparone, Luciano; Baronti, Stefano; Garzelli, Andrea

    2015-01-01

    A synthesis of more than ten years of experience, Remote Sensing Image Fusion covers methods specifically designed for remote sensing imagery. The authors supply a comprehensive classification system and rigorous mathematical description of advanced and state-of-the-art methods for pansharpening of multispectral images, fusion of hyperspectral and panchromatic images, and fusion of data from heterogeneous sensors such as optical and synthetic aperture radar (SAR) images and integration of thermal and visible/near-infrared images. They also explore new trends of signal/image processing, such as

  6. Beam dancer fusion device

    International Nuclear Information System (INIS)

    Maier, H.B.

    1984-01-01

    To accomplish fusion of two or more fusion fuel elements numerous minute spots of energy or laser light are directed to a micro target area, there to be moved or danced about by a precision mechanical controlling apparatus at the source of the laser light or electromagnetic energy beams, so that merging and coinciding patterns of light or energy beams can occur around the area of the fuel atoms or ions. The projecting of these merging patterns may be considered as target searching techniques to locate responsive clusters of fuel elements and to compress such elements into a condition in which fusion may occur. Computerized programming may be used

  7. Fusion Reactor Materials

    International Nuclear Information System (INIS)

    Decreton, M.

    2001-01-01

    The objective of SCK-CEN's programme on fusion reactor materials is to contribute to the knowledge on the behaviour of fusion reactor materials and components during and after irradiation. Ongoing projects include: the study of the mechanical behaviour of structural materials under neutron irradiation; the investigation of the characteristics of irradiated first wall material such as beryllium; the detection of abrupt electrical degradation of insulating ceramics under high temperature and neutron irradiation; and the study of dismantling and waste disposal strategy for fusion reactors. Progress and achievements in these areas in 2000 are discussed

  8. Japanese fusion research

    International Nuclear Information System (INIS)

    Uchida, T.

    1987-01-01

    The Japan experience during thirty years in nuclear fusion research is reported, after attending the 1st Geneva Conference in 1955, Osaka University, immedeately began linear pinch study using capacitor bank discharge. Subsequently to his trial several groups were organized to ward fusion R and D at universities in Tokyo, Nagoya, Kyoto, Sendai and son on. Based upon the recommendation of Japan Science Council, Institut of Plasma Physics (IPP) was established at Nagoya University in 1961 When the 1st International Conference on Plasma Physics and Controlled Nuclear Fusion Research was held in Saltzburg. The gloomy Bohm barrier had stood in front of many of experiments at that time. (author) [pt

  9. Safety considerations in next step fusion design and beyond

    International Nuclear Information System (INIS)

    Holland, D.F.

    1990-01-01

    Recent U.S. and international design studies provide insights into the potential safety and environmental advantages of fusion as well as the development needed to realize this potential. We in the Fusion Safety Program at EG ampersand G Idaho have analyzed the Compact Ignition Tokamak (CIT), the International Thermonuclear Engineering Reactor (ITER), and the Advanced Reactor Innovative Engineering Study (ARIES). I have reviewed these three designs to determine issues related to meeting the safety and the environmental goals that guide fusion development in the U.S. The paper lists safety and environmental issues that are generic to fusion and approaches to favorably resolve each issue. The technical developments that have the highest potential of contributing to improving the safety and environmental attractiveness of fusion are identified and discussed. These developments are in the areas of low-activation materials, plasma- facing components, and plasma physics relating to off-normal plasma events and tritium burn-up. 8 refs., 7 tabs

  10. Event Investigation

    International Nuclear Information System (INIS)

    Korosec, D.

    2000-01-01

    The events in the nuclear industry are investigated from the license point of view and from the regulatory side too. It is well known the importance of the event investigation. One of the main goals of such investigation is to prevent the circumstances leading to the event and the consequences of the event. The protection of the nuclear workers against nuclear hazard, and the protection of general public against dangerous effects of an event could be achieved by systematic approach to the event investigation. Both, the nuclear safety regulatory body and the licensee shall ensure that operational significant events are investigated in a systematic and technically sound manner to gather information pertaining to the probable causes of the event. One of the results should be appropriate feedback regarding the lessons of the experience to the regulatory body, nuclear industry and general public. In the present paper a general description of systematic approach to the event investigation is presented. The systematic approach to the event investigation works best where cooperation is present among the different divisions of the nuclear facility or regulatory body. By involving management and supervisors the safety office can usually improve their efforts in the whole process. The end result shall be a program which serves to prevent events and reduce the time and efforts solving the root cause which initiated each event. Selection of the proper method for the investigation and an adequate review of the findings and conclusions lead to the higher level of the overall nuclear safety. (author)

  11. Inertial thermonuclear fusion by laser

    International Nuclear Information System (INIS)

    Watteau, J.P.

    1993-12-01

    The principles of deuterium tritium (DT) magnetic or inertial thermonuclear fusion are given. Even if results would be better with heavy ions beams, most of the results on fusion are obtained with laser beams. Technical and theoretical aspects of the laser fusion are presented with an extrapolation to the future fusion reactor. (A.B.). 34 refs., 17 figs

  12. Inertial fusion commercial power plants

    International Nuclear Information System (INIS)

    Logan, B.G.

    1994-01-01

    This presentation discusses the motivation for inertial fusion energy, a brief synopsis of five recently-completed inertial fusion power plant designs, some general conclusions drawn from these studies, and an example of an IFE hydrogen synfuel plant to suggest that future fusion studies consider broadening fusion use to low-emission fuels production as well as electricity

  13. Why and how of fusion

    International Nuclear Information System (INIS)

    Miley, G.H.

    1977-01-01

    The potential advantages of fusion power are listed. The approaches to plasma containment are mentioned and the status of the fusion program is described. The ERDA and EPRI programs are discussed. The Fusion Energy Foundation's activities are mentioned. Fusion research at the U. of Ill. is described briefly

  14. Oral cancer/endothelial cell fusion experiences nuclear fusion and acquisition of enhanced survival potential

    International Nuclear Information System (INIS)

    Song, Kai; Song, Yong; Zhao, Xiao-Ping; Shen, Hui; Wang, Meng; Yan, Ting-lin; Liu, Ke; Shang, Zheng-jun

    2014-01-01

    Most previous studies have linked cancer–macrophage fusion with tumor progression and metastasis. However, the characteristics of hybrid cells derived from oral cancer and endothelial cells and their involvement in cancer remained unknown. Double-immunofluorescent staining and fluorescent in situ hybridization (FISH) were performed to confirm spontaneous cell fusion between eGFP-labeled human umbilical vein endothelial cells (HUVECs) and RFP-labeled SCC9, and to detect the expression of vementin and cytokeratin 18 in the hybrids. The property of chemo-resistance of such hybrids was examined by TUNEL assay. The hybrid cells in xenografted tumor were identified by FISH and GFP/RFP dual-immunofluoresence staining. We showed that SCC9 cells spontaneously fused with cocultured endothelial cells, and the resultant hybrid cells maintained the division and proliferation activity after re-plating and thawing. Such hybrids expressed markers of both parental cells and became more resistant to chemotherapeutic drug cisplatin as compared to the parental SCC9 cells. Our in vivo data indicated that the hybrid cells contributed to tumor composition by using of immunostaining and FISH analysis, even though the hybrid cells and SCC9 cells were mixed with 1:10,000, according to the FACS data. Our study suggested that the fusion events between oral cancer and endothelial cells undergo nuclear fusion and acquire a new property of drug resistance and consequently enhanced survival potential. These experimental findings provide further supportive evidence for the theory that cell fusion is involved in cancer progression. - Highlights: • The fusion events between oral cancer and endothelial cells undergo nuclear fusion. • The resulting hybrid cells acquire a new property of drug resistance. • The resulting hybrid cells express the markers of both parental cells (i.e. vimentin and cytokeratin 18). • The hybrid cells contribute to tumor repopulation in vivo

  15. Oral cancer/endothelial cell fusion experiences nuclear fusion and acquisition of enhanced survival potential

    Energy Technology Data Exchange (ETDEWEB)

    Song, Kai [Department of Oral and Maxillofacial Surgery, The Affiliated Hospital of Qingdao University, Shandong Province (China); The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedicine Ministry of Education, Wuhan University, Wuhan (China); Song, Yong [The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedicine Ministry of Education, Wuhan University, Wuhan (China); Department of Stomatology, Liu Zhou People' s Hospital, Guangxi (China); Zhao, Xiao-Ping; Shen, Hui; Wang, Meng; Yan, Ting-lin [The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedicine Ministry of Education, Wuhan University, Wuhan (China); Liu, Ke, E-mail: liuke.1999@aliyun.com [Department of Oral and Maxillofacial-Head and Neck oncology, School and Hospital of Stomatology, Wuhan University, 237 Luoyu Road, Wuhan 430079 (China); The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedicine Ministry of Education, Wuhan University, Wuhan (China); Shang, Zheng-jun, E-mail: shangzhengjun@hotmail.com [Department of Oral and Maxillofacial-Head and Neck oncology, School and Hospital of Stomatology, Wuhan University, 237 Luoyu Road, Wuhan 430079 (China); The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedicine Ministry of Education, Wuhan University, Wuhan (China)

    2014-10-15

    Most previous studies have linked cancer–macrophage fusion with tumor progression and metastasis. However, the characteristics of hybrid cells derived from oral cancer and endothelial cells and their involvement in cancer remained unknown. Double-immunofluorescent staining and fluorescent in situ hybridization (FISH) were performed to confirm spontaneous cell fusion between eGFP-labeled human umbilical vein endothelial cells (HUVECs) and RFP-labeled SCC9, and to detect the expression of vementin and cytokeratin 18 in the hybrids. The property of chemo-resistance of such hybrids was examined by TUNEL assay. The hybrid cells in xenografted tumor were identified by FISH and GFP/RFP dual-immunofluoresence staining. We showed that SCC9 cells spontaneously fused with cocultured endothelial cells, and the resultant hybrid cells maintained the division and proliferation activity after re-plating and thawing. Such hybrids expressed markers of both parental cells and became more resistant to chemotherapeutic drug cisplatin as compared to the parental SCC9 cells. Our in vivo data indicated that the hybrid cells contributed to tumor composition by using of immunostaining and FISH analysis, even though the hybrid cells and SCC9 cells were mixed with 1:10,000, according to the FACS data. Our study suggested that the fusion events between oral cancer and endothelial cells undergo nuclear fusion and acquire a new property of drug resistance and consequently enhanced survival potential. These experimental findings provide further supportive evidence for the theory that cell fusion is involved in cancer progression. - Highlights