WorldWideScience

Sample records for gene fusion events

  1. InFusion: Advancing Discovery of Fusion Genes and Chimeric Transcripts from Deep RNA-Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Konstantin Okonechnikov

    Full Text Available Analysis of fusion transcripts has become increasingly important due to their link with cancer development. Since high-throughput sequencing approaches survey fusion events exhaustively, several computational methods for the detection of gene fusions from RNA-seq data have been developed. This kind of analysis, however, is complicated by native trans-splicing events, the splicing-induced complexity of the transcriptome and biases and artefacts introduced in experiments and data analysis. There are a number of tools available for the detection of fusions from RNA-seq data; however, certain differences in specificity and sensitivity between commonly used approaches have been found. The ability to detect gene fusions of different types, including isoform fusions and fusions involving non-coding regions, has not been thoroughly studied yet. Here, we propose a novel computational toolkit called InFusion for fusion gene detection from RNA-seq data. InFusion introduces several unique features, such as discovery of fusions involving intergenic regions, and detection of anti-sense transcription in chimeric RNAs based on strand-specificity. Our approach demonstrates superior detection accuracy on simulated data and several public RNA-seq datasets. This improved performance was also evident when evaluating data from RNA deep-sequencing of two well-established prostate cancer cell lines. InFusion identified 26 novel fusion events that were validated in vitro, including alternatively spliced gene fusion isoforms and chimeric transcripts that include intergenic regions. The toolkit is freely available to download from http:/bitbucket.org/kokonech/infusion.

  2. Fusion and retrotransposition events in the evolution of the sea anemone Anemonia viridis neurotoxin genes.

    Science.gov (United States)

    Moran, Yehu; Weinberger, Hagar; Lazarus, Nimrod; Gur, Maya; Kahn, Roy; Gordon, Dalia; Gurevitz, Michael

    2009-08-01

    Sea anemones are sessile predators that use a variety of toxins to paralyze prey and foe. Among these toxins, Types I, II and III are short peptides that affect voltage-gated sodium channels. Anemonia viridis is the only sea anemone species that produces both Types I and III neurotoxin. Although the two toxin types are unrelated in sequence and three-dimensional structure, cloning and comparative analysis of their loci revealed a highly similar sequence at the 5' region, which encodes a signal peptide. This similarity was likely generated by gene fusion and could be advantageous in transcript stability and intracellular trafficking and secretion. In addition, these analyses identified the processed pseudogenes of the two gene families in the genome of A. viridis, probably resulting from retrotransposition events. As presence of processed pseudogenes in the genome requires transcription in germ-line cells, we analyzed oocyte-rich ovaries and found that indeed they contain Types I and III transcripts. This result raises questions regarding the role of toxin transcripts in these tissues. Overall, the retrotransposition and gene fusion events suggest that the genes of both Types I and III neurotoxins evolved in a similar fashion and share a partial common ancestry.

  3. Prevention of adverse events of interferon γ gene therapy by gene delivery of interferon γ-heparin-binding domain fusion protein in mice

    Directory of Open Access Journals (Sweden)

    Mitsuru Ando

    2014-01-01

    Full Text Available Sustained gene delivery of interferon (IFN γ can be an effective treatment, but our previous study showed high levels of IFNγ-induced adverse events, including the loss of body weight. These unwanted events could be reduced by target-specific delivery of IFNγ after in vivo gene transfer. To achieve this, we selected the heparin-binding domain (HBD of extracellular superoxide dismutase as a molecule to anchor IFNγ to the cell surface. We designed three IFNγ derivatives, IFNγ-HBD1, IFNγ-HBD2, and IFNγ-HBD3, each of which had 1, 2, or 3 HBDs, respectively. Each plasmid-encoding fusion proteins was delivered to the liver, a model target in this study, by hydrodynamic tail vein injection. The serum concentration of IFNγ-HBD2 and IFNγ-HBD3 after gene delivery was lower than that of IFNγ or IFNγ-HBD1. Gene delivery of IFNγ-HBD2, but not of IFNγ-HBD3, effectively increased the mRNA expression of IFNγ-inducible genes in the liver, suggesting liver-specific distribution of IFNγ-HBD2. Gene delivery of IFNγ-HBD2-suppressed tumor growth in the liver as efficiently as that of IFNγ with much less symptoms of adverse effects. These results indicate that the adverse events of IFNγ gene transfer can be prevented by gene delivery of IFNγ-HBD2, a fusion protein with high cell surface affinity.

  4. Fusion events

    International Nuclear Information System (INIS)

    Aboufirassi, M; Angelique, J.C.; Bizard, G.; Bougault, R.; Brou, R.; Buta, A.; Colin, J.; Cussol, D.; Durand, D.; Genoux-Lubain, A.; Horn, D.; Kerambrun, A.; Laville, J.L.; Le Brun, C.; Lecolley, J.F.; Lefebvres, F.; Lopez, O.; Louvel, M.; Meslin, C.; Metivier, V.; Nakagawa, T.; Peter, J.; Popescu, R.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E.; Wieloch, A.; Yuasa-Nakagawa, K.

    1998-01-01

    The fusion reactions between low energy heavy ions have a very high cross section. First measurements at energies around 30-40 MeV/nucleon indicated no residue of either complete or incomplete fusion, thus demonstrating the disappearance of this process. This is explained as being due to the high amount o energies transferred to the nucleus, what leads to its total dislocation in light fragments and particles. Exclusive analyses have permitted to mark clearly the presence of fusion processes in heavy systems at energies above 30-40 MeV/nucleon. Among the complete events of the Kr + Au reaction at 60 MeV/nucleon the majority correspond to binary collisions. Nevertheless, for the most considerable energy losses, a class of events do occur for which the detected fragments appears to be emitted from a unique source. These events correspond to an incomplete projectile-target fusion followed by a multifragmentation. Such events were singled out also in the reaction Xe + Sn at 50 MeV/nucleon. For the events in which the energy dissipation was maximal it was possible to isolate an isotropic group of events showing all the characteristics of fusion nuclei. The fusion is said to be incomplete as pre-equilibrium Z = 1 and Z = 2 particles are emitted. The cross section is of the order of 25 mb. Similar conclusions were drown for the systems 36 Ar + 27 Al and 64 Zn + nat Ti. A cross section value of ∼ 20 mb was determined at 55 MeV/nucleon in the first case, while the measurement of evaporation light residues in the last system gave an upper limit of 20-30 mb for the cross section at 50 MeV/nucleon

  5. Gene Fusion Markup Language: a prototype for exchanging gene fusion data.

    Science.gov (United States)

    Kalyana-Sundaram, Shanker; Shanmugam, Achiraman; Chinnaiyan, Arul M

    2012-10-16

    An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses.

  6. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Science.gov (United States)

    Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

    2012-01-01

    RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  7. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Directory of Open Access Journals (Sweden)

    Sara Kangaspeska

    Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  8. Protein functional links in Trypanosoma brucei, identified by gene fusion analysis

    Directory of Open Access Journals (Sweden)

    Trimpalis Philip

    2011-07-01

    Full Text Available Abstract Background Domain or gene fusion analysis is a bioinformatics method for detecting gene fusions in one organism by comparing its genome to that of other organisms. The occurrence of gene fusions suggests that the two original genes that participated in the fusion are functionally linked, i.e. their gene products interact either as part of a multi-subunit protein complex, or in a metabolic pathway. Gene fusion analysis has been used to identify protein functional links in prokaryotes as well as in eukaryotic model organisms, such as yeast and Drosophila. Results In this study we have extended this approach to include a number of recently sequenced protists, four of which are pathogenic, to identify fusion linked proteins in Trypanosoma brucei, the causative agent of African sleeping sickness. We have also examined the evolution of the gene fusion events identified, to determine whether they can be attributed to fusion or fission, by looking at the conservation of the fused genes and of the individual component genes across the major eukaryotic and prokaryotic lineages. We find relatively limited occurrence of gene fusions/fissions within the protist lineages examined. Our results point to two trypanosome-specific gene fissions, which have recently been experimentally confirmed, one fusion involving proteins involved in the same metabolic pathway, as well as two novel putative functional links between fusion-linked protein pairs. Conclusions This is the first study of protein functional links in T. brucei identified by gene fusion analysis. We have used strict thresholds and only discuss results which are highly likely to be genuine and which either have already been or can be experimentally verified. We discuss the possible impact of the identification of these novel putative protein-protein interactions, to the development of new trypanosome therapeutic drugs.

  9. FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events.

    Science.gov (United States)

    Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J P; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

    2015-01-01

    Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain-domain interactions, protein-protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist's mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop 'novel' therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE. © The Author(s) 2015. Published by Oxford University Press.

  10. Transcriptome sequencing in pediatric acute lymphoblastic leukemia identifies fusion genes associated with distinct DNA methylation profiles

    Directory of Open Access Journals (Sweden)

    Yanara Marincevic-Zuniga

    2017-08-01

    Full Text Available Abstract Background Structural chromosomal rearrangements that lead to expressed fusion genes are a hallmark of acute lymphoblastic leukemia (ALL. In this study, we performed transcriptome sequencing of 134 primary ALL patient samples to comprehensively detect fusion transcripts. Methods We combined fusion gene detection with genome-wide DNA methylation analysis, gene expression profiling, and targeted sequencing to determine molecular signatures of emerging ALL subtypes. Results We identified 64 unique fusion events distributed among 80 individual patients, of which over 50% have not previously been reported in ALL. Although the majority of the fusion genes were found only in a single patient, we identified several recurrent fusion gene families defined by promiscuous fusion gene partners, such as ETV6, RUNX1, PAX5, and ZNF384, or recurrent fusion genes, such as DUX4-IGH. Our data show that patients harboring these fusion genes displayed characteristic genome-wide DNA methylation and gene expression signatures in addition to distinct patterns in single nucleotide variants and recurrent copy number alterations. Conclusion Our study delineates the fusion gene landscape in pediatric ALL, including both known and novel fusion genes, and highlights fusion gene families with shared molecular etiologies, which may provide additional information for prognosis and therapeutic options in the future.

  11. External events analysis for experimental fusion facilities

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    1990-01-01

    External events are those off-normal events that threaten facilities either from outside or inside the building. These events, such as floods, fires, and earthquakes, are among the leading risk contributors for fission power plants, and the nature of fusion facilities indicates that they may also lead fusion risk. This paper gives overviews of analysis methods, references good analysis guidance documents, and gives design tips for mitigating the effects of floods and fires, seismic events, and aircraft impacts. Implications for future fusion facility siting are also discussed. Sites similar to fission plant sites are recommended. 46 refs

  12. Fusion events lead to truncation of FOS in epithelioid hemangioma of bone

    DEFF Research Database (Denmark)

    van IJzendoorn, David G P; de Jong, Danielle; Romagosa, Cleofe

    2015-01-01

    in exon 4 of the FOS gene and the fusion event led to the introduction of a stop codon. In all instances, the truncation of the FOS gene would result in the loss of the transactivation domain (TAD). Using FISH probes we found a break in the FOS gene in two additional cases, in none of these cases...... differential diagnosis of vascular tumors of bone. Our data suggest that the translocation causes truncation of the FOS protein, with loss of the TAD, which is thereby a novel mechanism involved in tumorigenesis....

  13. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  14. Gene fusion analysis in the battle against the African endemic sleeping sickness.

    Directory of Open Access Journals (Sweden)

    Philip Trimpalis

    Full Text Available The protozoan Trypanosoma brucei causes African Trypanosomiasis or sleeping sickness in humans, which can be lethal if untreated. Most available pharmacological treatments for the disease have severe side-effects. The purpose of this analysis was to detect novel protein-protein interactions (PPIs, vital for the parasite, which could lead to the development of drugs against this disease to block the specific interactions. In this work, the Domain Fusion Analysis (Rosetta Stone method was used to identify novel PPIs, by comparing T. brucei to 19 organisms covering all major lineages of the tree of life. Overall, 49 possible protein-protein interactions were detected, and classified based on (a statistical significance (BLAST e-value, domain length etc., (b their involvement in crucial metabolic pathways, and (c their evolutionary history, particularly focusing on whether a protein pair is split in T. brucei and fused in the human host. We also evaluated fusion events including hypothetical proteins, and suggest a possible molecular function or involvement in a certain biological process. This work has produced valuable results which could be further studied through structural biology or other experimental approaches so as to validate the protein-protein interactions proposed here. The evolutionary analysis of the proteins involved showed that, gene fusion or gene fission events can happen in all organisms, while some protein domains are more prone to fusion and fission events and present complex evolutionary patterns.

  15. A Hierarchical Convolutional Neural Network for vesicle fusion event classification.

    Science.gov (United States)

    Li, Haohan; Mao, Yunxiang; Yin, Zhaozheng; Xu, Yingke

    2017-09-01

    Quantitative analysis of vesicle exocytosis and classification of different modes of vesicle fusion from the fluorescence microscopy are of primary importance for biomedical researches. In this paper, we propose a novel Hierarchical Convolutional Neural Network (HCNN) method to automatically identify vesicle fusion events in time-lapse Total Internal Reflection Fluorescence Microscopy (TIRFM) image sequences. Firstly, a detection and tracking method is developed to extract image patch sequences containing potential fusion events. Then, a Gaussian Mixture Model (GMM) is applied on each image patch of the patch sequence with outliers rejected for robust Gaussian fitting. By utilizing the high-level time-series intensity change features introduced by GMM and the visual appearance features embedded in some key moments of the fusion process, the proposed HCNN architecture is able to classify each candidate patch sequence into three classes: full fusion event, partial fusion event and non-fusion event. Finally, we validate the performance of our method on 9 challenging datasets that have been annotated by cell biologists, and our method achieves better performances when comparing with three previous methods. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Can gene fusions serve for fingerprints of radiogenic cancers?

    International Nuclear Information System (INIS)

    Nakamura, Nori

    2016-01-01

    It has been recognized that malignancies in blood cells often bear specific chromosome translocations or gene fusions. In recent years, the presence of fusion genes became to be known also among solid cancers as driver mutations. However, representative solid cancers bearing specific gene fusions are limited to cancers of thyroid, prostate, and sarcomas among which only thyroid cancer risk is known to be related to radiation exposures. On the other hand, it is extremely rare to find recurrent reciprocal translocations among common cancers such as in the lung, stomach, breast, and colon, which form a major component of radiation risks. It is therefore unlikely that radiation increases the risk of cancer by inducing specific translocations (gene fusions) but more likely through induction of mutations (including deletions). Although gene fusions could play a role in radiation carcinogenesis, it does not seem good enough to serve for a radiation fingerprint. (author)

  17. Tyrosine kinase chromosomal translocations mediate distinct and overlapping gene regulation events

    International Nuclear Information System (INIS)

    Kim, Hani; Gillis, Lisa C; Jarvis, Jordan D; Yang, Stuart; Huang, Kai; Der, Sandy; Barber, Dwayne L

    2011-01-01

    Leukemia is a heterogeneous disease commonly associated with recurrent chromosomal translocations that involve tyrosine kinases including BCR-ABL, TEL-PDGFRB and TEL-JAK2. Most studies on the activated tyrosine kinases have focused on proximal signaling events, but little is known about gene transcription regulated by these fusions. Oligonucleotide microarray was performed to compare mRNA changes attributable to BCR-ABL, TEL-PDGFRB and TEL-JAK2 after 1 week of activation of each fusion in Ba/F3 cell lines. Imatinib was used to control the activation of BCR-ABL and TEL-PDGFRB, and TEL-JAK2-mediated gene expression was examined 1 week after Ba/F3-TEL-JAK2 cells were switched to factor-independent conditions. Microarray analysis revealed between 800 to 2000 genes induced or suppressed by two-fold or greater by each tyrosine kinase, with a subset of these genes commonly induced or suppressed among the three fusions. Validation by Quantitative PCR confirmed that eight genes (Dok2, Mrvi1, Isg20, Id1, gp49b, Cxcl10, Scinderin, and collagen Vα1(Col5a1)) displayed an overlapping regulation among the three tested fusion proteins. Stat1 and Gbp1 were induced uniquely by TEL-PDGFRB. Our results suggest that BCR-ABL, TEL-PDGFRB and TEL-JAK2 regulate distinct and overlapping gene transcription profiles. Many of the genes identified are known to be involved in processes associated with leukemogenesis, including cell migration, proliferation and differentiation. This study offers the basis for further work that could lead to an understanding of the specificity of diseases caused by these three chromosomal translocations

  18. Relevance of Fusion Genes in Pediatric Cancers: Toward Precision Medicine

    Directory of Open Access Journals (Sweden)

    Célia Dupain

    2017-03-01

    Full Text Available Pediatric cancers differ from adult tumors, especially by their very low mutational rate. Therefore, their etiology could be explained in part by other oncogenic mechanisms such as chromosomal rearrangements, supporting the possible implication of fusion genes in the development of pediatric cancers. Fusion genes result from chromosomal rearrangements leading to the juxtaposition of two genes. Consequently, an abnormal activation of one or both genes is observed. The detection of fusion genes has generated great interest in basic cancer research and in the clinical setting, since these genes can lead to better comprehension of the biological mechanisms of tumorigenesis and they can also be used as therapeutic targets and diagnostic or prognostic biomarkers. In this review, we discuss the molecular mechanisms of fusion genes and their particularities in pediatric cancers, as well as their relevance in murine models and in the clinical setting. We also point out the difficulties encountered in the discovery of fusion genes. Finally, we discuss future perspectives and priorities for finding new innovative therapies in childhood cancer.

  19. BCR-ABL fusion genes are inducible by X-irradiation in vitro

    International Nuclear Information System (INIS)

    Ito, Takashi; Seyama, Toshio; Mizuno, Terumi; Hayashi, Tomonori; Nakamura, Nori; Akiyama, Mitoshi; Dohi, Kiyohiko.

    1992-01-01

    The Philadelphia chromosome consists of a reciprocal translocation between the ABL oncogene at chromosome 9q34 and the BCR gene at chromosome 22q resulting in the expression of chimeric BCR-ABL mRNAs specific to chronic myelogenous leukemia (CML). The presence of the fusion genes can be detected with high specificity and sensitivity by means of reverse transcription and polymerase chain reaction. Using this assay, it was possible to detect BCR-ABL fusion genes induced among HL60 cells after 100 Gy of X-irradiation in vitro. A total of five fusion gene transcripts were obtained. These fusion genes contained not only CML-specific BCR-ABL rearrangements, but also other forms of BCR-ABL fusions. These latter genes had junctions of BCR exon 4/ABL exon 2 intervened by a segment of DNA of unknown origin, BCR exon 5/ABL exon 2, and BCR exon 4/ABL exon 2. The results appear to be the first evidence for the induction of the BCR-ABL fusion gene by X-irradiation. In terms of leukemogenesis, it is suggested that only those cells bearing certain CML-related BCR-ABL fusion genes are positively selected by virtue of a growth advantage in vivo. (author)

  20. Identification and selection of initiating events for experimental fusion facilities

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    1989-01-01

    This paper describes the current approaches used in probabilistic risk assessment (PRA) to identify and select accident initiating events for study in either probabilistic safety analysis or PRA. Current methods directly apply to fusion facilities as well as other types of industries, such as chemical processing and nuclear fission. These identification and selection methods include the Master Logic Diagram, historical document review, system level Failure Modes and Effects Analysis, and others. A combination of the historical document review, such as Safety Analysis Reports and fusion safety studies, and the Master Logic Diagram with appropriate quality assurance reviews, is suggested for standardizing US fusion PRA effects. A preliminary set of generalized initiating events applicable to fusion facilities derived from safety document review is presented as a framework to start from for the historical document review and Master Logic Diagram approach. Fusion designers should find this list useful for their design reviews. 29 refs., 2 tabs

  1. Identification and selection of initiating events for experimental fusion facilities

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    1989-01-01

    This paper describes the current approaches used in probabilistic risk assessment (PRA) to identify and select accident initiating events for study in either probabilistic safety analysis or PRA. Current methods directly apply to fusion facilities as well as other types of industries, such as chemical processing and nuclear fission. These identification and selection methods include the Master Logic Diagram, historical document review, system level Failure Modes and Effects Analysis, and others. A combination of the historical document review, such as Safety Analysis Reports and fusion safety studies, and the Master Logic Diagram with appropriate quality assurance reviews, is suggested for standardizing U.S. fusion PRA efforts. A preliminary set of generalized initiating events applicable to fusion facilities derived from safety document review is presented as a framework to start from for the historical document review and Master Logic Diagram approach. Fusion designers should find this list useful for their design reviews. 29 refs., 1 tab

  2. Selection of Photon Gluon Fusion Events in DIS

    International Nuclear Information System (INIS)

    Kowalik, K.; Rondio, E.; Sulej, R.; Zaremba, K.

    2001-01-01

    A selection of the Photon Gluon Fusion (PGF) process with light quarks for deep inelastic scattering events is presented. This process is directly sensitive to gluon polarization and our goal is to find out the most effective selection on a sample of events simulated for the SMC experiment. We compare two general multi-class classification methods - Bayes method and neural network with a conventional selection procedure. The neural network algorithm presented here is a modification of method belonging to the family of directional minimization algorithms. This method is convenient and effective for photon gluon fusion selection and determination of gluon polarization. Finally we present the estimation for precision of gluon polarization for neural network method. (author)

  3. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  4. A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin

    International Nuclear Information System (INIS)

    Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang; Liu, Yan-Hong; Li, Yan; Wang, Jia-Ye; Hattori, Toshio; Ling, Hong; Zhang, Feng-Min

    2010-01-01

    To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potential entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.

  5. Driver Fusions and Their Implications in the Development and Treatment of Human Cancers

    Directory of Open Access Journals (Sweden)

    Qingsong Gao

    2018-04-01

    Full Text Available Summary: Gene fusions represent an important class of somatic alterations in cancer. We systematically investigated fusions in 9,624 tumors across 33 cancer types using multiple fusion calling tools. We identified a total of 25,664 fusions, with a 63% validation rate. Integration of gene expression, copy number, and fusion annotation data revealed that fusions involving oncogenes tend to exhibit increased expression, whereas fusions involving tumor suppressors have the opposite effect. For fusions involving kinases, we found 1,275 with an intact kinase domain, the proportion of which varied significantly across cancer types. Our study suggests that fusions drive the development of 16.5% of cancer cases and function as the sole driver in more than 1% of them. Finally, we identified druggable fusions involving genes such as TMPRSS2, RET, FGFR3, ALK, and ESR1 in 6.0% of cases, and we predicted immunogenic peptides, suggesting that fusions may provide leads for targeted drug and immune therapy. : Gao et al. analyze a 9,624 sample TCGA cohort with 33 cancer types to detect gene fusion events. They provide a landscape of fusion events detected, relate fusions to gene expression, focus on kinase fusion structures, examine mutually exclusive mutation and fusion patterns, and highlight fusion druggability. Keywords: fusion, cancer, RNA, translocation, gene fusions

  6. Horizontal gene transfers with or without cell fusions in all categories of the living matter.

    Science.gov (United States)

    Sinkovics, Joseph G

    2011-01-01

    This article reviews the history of widespread exchanges of genetic segments initiated over 3 billion years ago, to be part of their life style, by sphero-protoplastic cells, the ancestors of archaea, prokaryota, and eukaryota. These primordial cells shared a hostile anaerobic and overheated environment and competed for survival. "Coexist with, or subdue and conquer, expropriate its most useful possessions, or symbiose with it, your competitor" remain cellular life's basic rules. This author emphasizes the role of viruses, both in mediating cell fusions, such as the formation of the first eukaryotic cell(s) from a united crenarchaeon and prokaryota, and the transfer of host cell genes integrated into viral (phages) genomes. After rising above the Darwinian threshold, rigid rules of speciation and vertical inheritance in the three domains of life were established, but horizontal gene transfers with or without cell fusions were never abolished. The author proves with extensive, yet highly selective documentation, that not only unicellular microorganisms, but the most complex multicellular entities of the highest ranks resort to, and practice, cell fusions, and donate and accept horizontally (laterally) transferred genes. Cell fusions and horizontally exchanged genetic materials remain the fundamental attributes and inherent characteristics of the living matter, whether occurring accidentally or sought after intentionally. These events occur to cells stagnating for some 3 milliard years at a lower yet amazingly sophisticated level of evolution, and to cells achieving the highest degree of differentiation, and thus functioning in dependence on the support of a most advanced multicellular host, like those of the human brain. No living cell is completely exempt from gene drains or gene insertions.

  7. Gene Fusions Associated with Recurrent Amplicons Represent a Class of Passenger Aberrations in Breast Cancer

    Directory of Open Access Journals (Sweden)

    Shanker Kalyana-Sundaram

    2012-08-01

    Full Text Available Application of high-throughput transcriptome sequencing has spurred highly sensitive detection and discovery of gene fusions in cancer, but distinguishing potentially oncogenic fusions from random, “passenger” aberrations has proven challenging. Here we examine a distinctive group of gene fusions that involve genes present in the loci of chromosomal amplifications—a class of oncogenic aberrations that are widely prevalent in breast cancers. Integrative analysis of a panel of 14 breast cancer cell lines comparing gene fusions discovered by high-throughput transcriptome sequencing and genome-wide copy number aberrations assessed by array comparative genomic hybridization, led to the identification of 77 gene fusions, of which more than 60% were localized to amplicons including 17q12, 17q23, 20q13, chr8q, and others. Many of these fusions appeared to be recurrent or involved highly expressed oncogenic drivers, frequently fused with multiple different partners, but sometimes displaying loss of functional domains. As illustrative examples of the “amplicon-associated” gene fusions, we examined here a recurrent gene fusion involving the mediator of mammalian target of rapamycin signaling, RPS6KB1 kinase in BT-474, and the therapeutically important receptor tyrosine kinase EGFR in MDA-MB-468 breast cancer cell line. These gene fusions comprise a minor allelic fraction relative to the highly expressed full-length transcripts and encode chimera lacking the kinase domains, which do not impart dependence on the respective cells. Our study suggests that amplicon-associated gene fusions in breast cancer primarily represent a by-product of chromosomal amplifications, which constitutes a subset of passenger aberrations and should be factored accordingly during prioritization of gene fusion candidates.

  8. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    International Nuclear Information System (INIS)

    Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

    2014-01-01

    In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

  9. TMPRSS2-ERG gene fusions are infrequent in prostatic ductal adenocarcinomas.

    Science.gov (United States)

    Lotan, Tamara L; Toubaji, Antoun; Albadine, Roula; Latour, Mathieu; Herawi, Mehsati; Meeker, Alan K; DeMarzo, Angelo M; Platz, Elizabeth A; Epstein, Jonathan I; Netto, George J

    2009-03-01

    Ductal adenocarcinoma of the prostate is an unusual subtype that may be associated with a more aggressive clinical course, and is less responsive to conventional therapies than the more common prostatic acinar adenocarcinoma. However, given its frequent association with an acinar component at prostatectomy, some have challenged the concept of prostatic ductal adenocarcinoma as a distinct clinicopathologic entity. We studied the occurrence of the TMPRSS2-ERG gene fusion, in 40 surgically resected ductal adenocarcinoma cases, and in their associated acinar component using fluorescence in situ hybridization. A group of 38 'pure' acinar adenocarcinoma cases matched with the ductal adenocarcinoma group for pathological grade and stage was studied as a control. Compared with the matched acinar adenocarcinoma cases, the TMPRSS2-ERG gene fusion was significantly less frequently observed in ductal adenocarcinoma (45 vs 11% of cases, P=0.002, Fisher's exact test). Here, of the ductal adenocarcinoma cases with the gene fusion, 75% were fused through deletion, and the remaining case was fused through translocation. The TMPRSS2-ERG gene fusion was also rare in the acinar component of mixed ductal-acinar tumors when compared with the pure acinar adenocarcinoma controls (5 vs 45%, P=0.001, Fisher's exact test). In 95% of the ductal adenocarcinoma cases in which a concurrent acinar component was analyzed, there was concordance for presence/absence of the TMPRSS2-ERG gene fusion between the different histologic subtypes. In the control group of pure acinar adenocarcinoma cases, 59% were fused through deletion and 41% were fused through translocation. The presence of the TMPRSS2-ERG gene fusion in some cases of prostatic ductal adenocarcinoma supports the concept that ductal adenocarcinoma and acinar adenocarcinoma may be related genetically. However, the significantly lower rate of the gene fusion in pure ductal adenocarcinoma cases underscores the fact that genetic and biologic

  10. Exploration of the gene fusion landscape of glioblastoma using transcriptome sequencing and copy number data.

    Science.gov (United States)

    Shah, Nameeta; Lankerovich, Michael; Lee, Hwahyung; Yoon, Jae-Geun; Schroeder, Brett; Foltz, Greg

    2013-11-22

    RNA-seq has spurred important gene fusion discoveries in a number of different cancers, including lung, prostate, breast, brain, thyroid and bladder carcinomas. Gene fusion discovery can potentially lead to the development of novel treatments that target the underlying genetic abnormalities. In this study, we provide comprehensive view of gene fusion landscape in 185 glioblastoma multiforme patients from two independent cohorts. Fusions occur in approximately 30-50% of GBM patient samples. In the Ivy Center cohort of 24 patients, 33% of samples harbored fusions that were validated by qPCR and Sanger sequencing. We were able to identify high-confidence gene fusions from RNA-seq data in 53% of the samples in a TCGA cohort of 161 patients. We identified 13 cases (8%) with fusions retaining a tyrosine kinase domain in the TCGA cohort and one case in the Ivy Center cohort. Ours is the first study to describe recurrent fusions involving non-coding genes. Genomic locations 7p11 and 12q14-15 harbor majority of the fusions. Fusions on 7p11 are formed in focally amplified EGFR locus whereas 12q14-15 fusions are formed by complex genomic rearrangements. All the fusions detected in this study can be further visualized and analyzed using our website: http://ivygap.swedish.org/fusions. Our study highlights the prevalence of gene fusions as one of the major genomic abnormalities in GBM. The majority of the fusions are private fusions, and a minority of these recur with low frequency. A small subset of patients with fusions of receptor tyrosine kinases can benefit from existing FDA approved drugs and drugs available in various clinical trials. Due to the low frequency and rarity of clinically relevant fusions, RNA-seq of GBM patient samples will be a vital tool for the identification of patient-specific fusions that can drive personalized therapy.

  11. TMPRSS2-ERG gene fusion status in minute (minimal) prostatic adenocarcinoma.

    Science.gov (United States)

    Albadine, Roula; Latour, Mathieu; Toubaji, Antoun; Haffner, Michael; Isaacs, William B; A Platz, Elizabeth; Meeker, Alan K; Demarzo, Angelo M; Epstein, Jonathan I; Netto, George J

    2009-11-01

    Minute prostatic adenocarcinomas are considered to be of insufficient virulence. Given recent suggestions of TMPRSS2-ERG gene fusion association with aggressive prostatic adenocarcinoma, we evaluated the incidence of TMPRSS2-ERG fusion in minute prostatic adenocarcinomas. A total of 45 consecutive prostatectomies with minute adenocarcinoma were used for tissue microarray construction. A total of 63 consecutive non-minimal, Gleason Score 6 tumors, from a separate PSA Era prostatectomy tissue microarray, were used for comparison. FISH was carried out using ERG break-apart probes. Tumors were assessed for fusion by deletion (Edel) or split (Esplit), duplicated fusions and low-level copy number gain in normal ERG gene locus. Minute adenocarcinomas: Fusion was evaluable in 32/45 tumors (71%). Fifteen out of 32 (47%) tumors were positive for fusion. Six (19%) were of the Edel class and 7 (22%) were classified as combined Edel+Esplit. Non-minute adenocarcinomas (pT2): Fusion was identified in 20/30 tumors (67%). Four (13%) were of Edel class and 5 (17%) were combined Edel+Esplit. Duplicated fusions were encountered in 5 (16%) tumors. Non-minute adenocarcinomas (pT3): Fusion was identified in 19/33 (58%). Fusion was due to a deletion in 6 (18%) tumors. Seven tumors (21%) were classified as combined Edel+Esplit. One tumor showed Esplit alone. Duplicated fusions were encountered in 3 (9%) cases. The incidence of duplicated fusions was higher in non-minute adenocarcinomas (13 vs 0%; P=0.03). A trend for higher incidence of low-level copy number gain in normal ERG gene locus without fusion was noted in non-minute adenocarcinomas (10 vs 0%; P=0.07). We found a TMPRSS2-ERG fusion rate of 47% in minute adenocarcinomas. The latter is not significantly different from that of grade matched non-minute adenocarcinomas. The incidence of duplicated fusion was higher in non-minute adenocarcinomas. Our finding of comparable rate of TMPRSS2-ERG fusion in minute adenocarcinomas may argue

  12. Novel fusion genes and chimeric transcripts in ependymal tumors

    DEFF Research Database (Denmark)

    Olsen, Thale Kristin; Panagopoulos, Ioannis; Gorunova, Ludmila

    2016-01-01

    with subsequent Sanger sequencing was used to validate the potential fusions. Fluorescent in situ hybridization (FISH) using locus-specific probes was also performed. A total of 841 candidate chimeric transcripts were identified in the 12 tumors, with an average of 49 unique candidate fusions per tumor. After...... infratentorial anaplastic ependymoma. Our previously reported ALK rearrangements and the RELA and YAP1 fusions found in supratentorial ependymomas were until now the only known fusion genes present in ependymal tumors. The chimeric transcripts presented here are the first to be reported in infratentorial...

  13. An Efficient Method for Identifying Gene Fusions by Targeted RNA Sequencing from Fresh Frozen and FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Jonathan A Scolnick

    Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.

  14. A Cluster-Based Fuzzy Fusion Algorithm for Event Detection in Heterogeneous Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    ZiQi Hao

    2015-01-01

    Full Text Available As limited energy is one of the tough challenges in wireless sensor networks (WSN, energy saving becomes important in increasing the lifecycle of the network. Data fusion enables combining information from several sources thus to provide a unified scenario, which can significantly save sensor energy and enhance sensing data accuracy. In this paper, we propose a cluster-based data fusion algorithm for event detection. We use k-means algorithm to form the nodes into clusters, which can significantly reduce the energy consumption of intracluster communication. Distances between cluster heads and event and energy of clusters are fuzzified, thus to use a fuzzy logic to select the clusters that will participate in data uploading and fusion. Fuzzy logic method is also used by cluster heads for local decision, and then the local decision results are sent to the base station. Decision-level fusion for final decision of event is performed by base station according to the uploaded local decisions and fusion support degree of clusters calculated by fuzzy logic method. The effectiveness of this algorithm is demonstrated by simulation results.

  15. A Foreign Object Damage Event Detector Data Fusion System for Turbofan Engines

    Science.gov (United States)

    Turso, James A.; Litt, Jonathan S.

    2004-01-01

    A Data Fusion System designed to provide a reliable assessment of the occurrence of Foreign Object Damage (FOD) in a turbofan engine is presented. The FOD-event feature level fusion scheme combines knowledge of shifts in engine gas path performance obtained using a Kalman filter, with bearing accelerometer signal features extracted via wavelet analysis, to positively identify a FOD event. A fuzzy inference system provides basic probability assignments (bpa) based on features extracted from the gas path analysis and bearing accelerometers to a fusion algorithm based on the Dempster-Shafer-Yager Theory of Evidence. Details are provided on the wavelet transforms used to extract the foreign object strike features from the noisy data and on the Kalman filter-based gas path analysis. The system is demonstrated using a turbofan engine combined-effects model (CEM), providing both gas path and rotor dynamic structural response, and is suitable for rapid-prototyping of control and diagnostic systems. The fusion of the disparate data can provide significantly more reliable detection of a FOD event than the use of either method alone. The use of fuzzy inference techniques combined with Dempster-Shafer-Yager Theory of Evidence provides a theoretical justification for drawing conclusions based on imprecise or incomplete data.

  16. Organotypic three-dimensional culture model of mesenchymal and epithelial cells to examine tissue fusion events.

    Science.gov (United States)

    Tissue fusion during early mammalian development requires coordination of multiple cell types, the extracellular matrix, and complex signaling pathways. Fusion events during processes including heart development, neural tube closure, and palatal fusion are dependent on signaling ...

  17. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Directory of Open Access Journals (Sweden)

    Etchells J Peter

    2009-10-01

    Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.

  18. Automatically Identifying Fusion Events between GLUT4 Storage Vesicles and the Plasma Membrane in TIRF Microscopy Image Sequences

    Directory of Open Access Journals (Sweden)

    Jian Wu

    2015-01-01

    Full Text Available Quantitative analysis of the dynamic behavior about membrane-bound secretory vesicles has proven to be important in biological research. This paper proposes a novel approach to automatically identify the elusive fusion events between VAMP2-pHluorin labeled GLUT4 storage vesicles (GSVs and the plasma membrane. The differentiation is implemented to detect the initiation of fusion events by modified forward subtraction of consecutive frames in the TIRFM image sequence. Spatially connected pixels in difference images brighter than a specified adaptive threshold are grouped into a distinct fusion spot. The vesicles are located at the intensity-weighted centroid of their fusion spots. To reveal the true in vivo nature of a fusion event, 2D Gaussian fitting for the fusion spot is used to derive the intensity-weighted centroid and the spot size during the fusion process. The fusion event and its termination can be determined according to the change of spot size. The method is evaluated on real experiment data with ground truth annotated by expert cell biologists. The evaluation results show that it can achieve relatively high accuracy comparing favorably to the manual analysis, yet at a small fraction of time.

  19. Long-Term Endurance Exercise in Humans Stimulates Cell Fusion of Myoblasts along with Fusogenic Endogenous Retroviral Genes In Vivo.

    Directory of Open Access Journals (Sweden)

    Sebastian Frese

    Full Text Available Myogenesis is defined as growth, differentiation and repair of muscles where cell fusion of myoblasts to multinucleated myofibers is one major characteristic. Other cell fusion events in humans are found with bone resorbing osteoclasts and placental syncytiotrophoblasts. No unifying gene regulation for natural cell fusions has been found. We analyzed skeletal muscle biopsies of competitive cyclists for muscle-specific attributes and expression of human endogenous retrovirus (ERV envelope genes due to their involvement in cell fusion of osteoclasts and syncytiotrophoblasts. Comparing muscle biopsies from post- with the pre-competitive seasons a significant 2.25-fold increase of myonuclei/mm fiber, a 2.38-fold decrease of fiber area/nucleus and a 3.1-fold decrease of satellite cells (SCs occurred. We propose that during the pre-competitive season SC proliferation occurred following with increased cell fusion during the competitive season. Expression of twenty-two envelope genes of muscle biopsies demonstrated a significant increase of putative muscle-cell fusogenic genes Syncytin-1 and Syncytin-3, but also for the non-fusogenic erv3. Immunohistochemistry analyses showed that Syncytin-1 mainly localized to the sarcolemma of myofibers positive for myosin heavy-chain isotypes. Cellular receptors SLC1A4 and SLC1A5 of Syncytin-1 showed significant decrease of expression in post-competitive muscles compared with the pre-competitive season, but only SLC1A4 protein expression localized throughout the myofiber. Erv3 protein was strongly expressed throughout the myofiber, whereas envK1-7 localized to SC nuclei and myonuclei. Syncytin-1 transcription factors, PPARγ and RXRα, showed no protein expression in the myofiber, whereas the pCREB-Ser133 activator of Syncytin-1 was enriched to SC nuclei and myonuclei. Syncytin-1, Syncytin-3, SLC1A4 and PAX7 gene regulations along with MyoD1 and myogenin were verified during proliferating or actively-fusing human

  20. ChimerDB 3.0: an enhanced database for fusion genes from cancer transcriptome and literature data mining.

    Science.gov (United States)

    Lee, Myunggyo; Lee, Kyubum; Yu, Namhee; Jang, Insu; Choi, Ikjung; Kim, Pora; Jang, Ye Eun; Kim, Byounggun; Kim, Sunkyu; Lee, Byungwook; Kang, Jaewoo; Lee, Sanghyuk

    2017-01-04

    Fusion gene is an important class of therapeutic targets and prognostic markers in cancer. ChimerDB is a comprehensive database of fusion genes encompassing analysis of deep sequencing data and manual curations. In this update, the database coverage was enhanced considerably by adding two new modules of The Cancer Genome Atlas (TCGA) RNA-Seq analysis and PubMed abstract mining. ChimerDB 3.0 is composed of three modules of ChimerKB, ChimerPub and ChimerSeq. ChimerKB represents a knowledgebase including 1066 fusion genes with manual curation that were compiled from public resources of fusion genes with experimental evidences. ChimerPub includes 2767 fusion genes obtained from text mining of PubMed abstracts. ChimerSeq module is designed to archive the fusion candidates from deep sequencing data. Importantly, we have analyzed RNA-Seq data of the TCGA project covering 4569 patients in 23 cancer types using two reliable programs of FusionScan and TopHat-Fusion. The new user interface supports diverse search options and graphic representation of fusion gene structure. ChimerDB 3.0 is available at http://ercsb.ewha.ac.kr/fusiongene/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Engineering and Functional Characterization of Fusion Genes Identifies Novel Oncogenic Drivers of Cancer. | Office of Cancer Genomics

    Science.gov (United States)

    Oncogenic gene fusions drive many human cancers, but tools to more quickly unravel their functional contributions are needed. Here we describe methodology permitting fusion gene construction for functional evaluation. Using this strategy, we engineered the known fusion oncogenes, BCR-ABL1, EML4-ALK, and ETV6-NTRK3, as well as 20 previously uncharacterized fusion genes identified in TCGA datasets.

  2. Transcriptome analysis of paired primary colorectal carcinoma and liver metastases reveals fusion transcripts and similar gene expression profiles in primary carcinoma and liver metastases

    International Nuclear Information System (INIS)

    Lee, Ja-Rang; Kwon, Chae Hwa; Choi, Yuri; Park, Hye Ji; Kim, Hyun Sung; Jo, Hong-Jae; Oh, Nahmgun; Park, Do Youn

    2016-01-01

    Despite the clinical significance of liver metastases, the difference between molecular and cellular changes in primary colorectal cancers (CRC) and matched liver metastases is poorly understood. In order to compare gene expression patterns and identify fusion genes in these two types of tumors, we performed high-throughput transcriptome sequencing of five sets of quadruple-matched tissues (primary CRC, liver metastases, normal colon, and liver). The gene expression patterns in normal colon and liver were successfully distinguished from those in CRCs; however, RNA sequencing revealed that the gene expression between primary CRCs and their matched liver metastases is highly similar. We identified 1895 genes that were differentially expressed in the primary carcinoma and liver metastases, than that in the normal colon tissues. A major proportion of the transcripts, identified by gene expression profiling as significantly enriched in the primary carcinoma and metastases, belonged to gene ontology categories involved in the cell cycle, mitosis, and cell division. Furthermore, we identified gene fusion events in primary carcinoma and metastases, and the fusion transcripts were experimentally confirmed. Among these, a chimeric transcript resulting from the fusion of RNF43 and SUPT4H1 was found to occur frequently in primary colorectal carcinoma. In addition, knockdown of the expression of this RNF43-SUPT4H1 chimeric transcript was found to have a growth-inhibitory effect in colorectal cancer cells. The present study reports a high concordance of gene expression in the primary carcinoma and liver metastases, and reveals potential new targets, such as fusion genes, against primary and metastatic colorectal carcinoma. The online version of this article (doi:10.1186/s12885-016-2596-3) contains supplementary material, which is available to authorized users

  3. Investigation of PAX3/7-FKHR fusion genes and IGF2 gene expression in rhabdomyosarcoma tumors.

    Science.gov (United States)

    de Souza, Robson Ramos; Oliveira, Indhira Dias; Caran, Eliana Maria Monteiro; Alves, Maria Teresa de Seixas; Abib, Simone; Toledo, Silvia Regina Caminada

    2012-12-01

    The purpose of our study was to investigate the prevalence of the PAX3/7-FKHR fusion genes and quantify the IGF2 gene expression in rhabdomyosarcoma (RMS) samples. Soft tissue sarcomas account 5% of childhood cancers and 50% of them are RMS. Morphological evaluation of pediatric RMS has defined two histological subtypes, embryonal (ERMS) and alveolar (ARMS). Chromosomal analyses have demonstrated two translocations associated with ARMS, resulting in the PAX3/7-FKHR rearrangements. Reverse transcriptase-polymerase chain reaction (RT-PCR) is extremely useful in the diagnosis of ARMS positive for these rearrangements. Additionally, several studies have shown a significant involvement of IGF pathway in the pathogenesis of RMS. The presence of PAX3/7-FKHR gene fusions was studied in 25 RMS samples from patients attending the IOP-GRAACC/UNIFESP and three RMS cell lines by RT-PCR. IGF2 gene expression was quantified by qPCR and related with clinic pathological parameters. Of the 25 samples, nine (36%) were ARMS and 16 (64%) were ERMS. PAX3/7-FKHR gene fusions expression was detected in 56% of ARMS tumor samples. IGF2 overexpression was observed in 80% of samples and could indicate an important role of this pathway in RMS biology. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Recurrent Fusion Genes in Gastric Cancer: CLDN18-ARHGAP26 Induces Loss of Epithelial Integrity

    Directory of Open Access Journals (Sweden)

    Fei Yao

    2015-07-01

    Full Text Available Genome rearrangements, a hallmark of cancer, can result in gene fusions with oncogenic properties. Using DNA paired-end-tag (DNA-PET whole-genome sequencing, we analyzed 15 gastric cancers (GCs from Southeast Asians. Rearrangements were enriched in open chromatin and shaped by chromatin structure. We identified seven rearrangement hot spots and 136 gene fusions. In three out of 100 GC cases, we found recurrent fusions between CLDN18, a tight junction gene, and ARHGAP26, a gene encoding a RHOA inhibitor. Epithelial cell lines expressing CLDN18-ARHGAP26 displayed a dramatic loss of epithelial phenotype and long protrusions indicative of epithelial-mesenchymal transition (EMT. Fusion-positive cell lines showed impaired barrier properties, reduced cell-cell and cell-extracellular matrix adhesion, retarded wound healing, and inhibition of RHOA. Gain of invasion was seen in cancer cell lines expressing the fusion. Thus, CLDN18-ARHGAP26 mediates epithelial disintegration, possibly leading to stomach H+ leakage, and the fusion might contribute to invasiveness once a cell is transformed.

  5. Novel gene fusion of PRCC-MITF defines a new member of MiT family translocation renal cell carcinoma: clinicopathological analysis and detection of the gene fusion by RNA sequencing and FISH.

    Science.gov (United States)

    Xia, Qiu-Yuan; Wang, Xiao-Tong; Ye, Sheng-Bing; Wang, Xuan; Li, Rui; Shi, Shan-Shan; Fang, Ru; Zhang, Ru-Song; Ma, Heng-Hui; Lu, Zhen-Feng; Shen, Qin; Bao, Wei; Zhou, Xiao-Jun; Rao, Qiu

    2018-04-01

    MITF, TFE3, TFEB and TFEC belong to the same microphthalmia-associated transcription factor family (MiT). Two transcription factors in this family have been identified in two unusual types of renal cell carcinoma (RCC): Xp11 translocation RCC harbouring TFE3 gene fusions and t(6;11) RCC harbouring a MALAT1-TFEB gene fusion. The 2016 World Health Organisation classification of renal neoplasia grouped these two neoplasms together under the category of MiT family translocation RCC. RCCs associated with the other two MiT family members, MITF and TFEC, have rarely been reported. Herein, we identify a case of MITF translocation RCC with the novel PRCC-MITF gene fusion by RNA sequencing. Histological examination of the present tumour showed typical features of MiT family translocation RCCs, overlapping with Xp11 translocation RCC and t(6;11) RCC. However, this tumour showed negative results in TFE3 and TFEB immunochemistry and split fluorescence in-situ hybridisation (FISH) assays. The other MiT family members, MITF and TFEC, were tested further immunochemically and also showed negative results. RNA sequencing and reverse transcription-polymerase chain reaction confirmed the presence of a PRCC-MITF gene fusion: a fusion of PRCC exon 5 to MITF exon 4. We then developed FISH assays covering MITF break-apart probes and PRCC-MITF fusion probes to detect the MITF gene rearrangement. This study both proves the recurring existence of MITF translocation RCC and expands the genotype spectrum of MiT family translocation RCCs. © 2017 John Wiley & Sons Ltd.

  6. Detection of Promyelocytic Leukemia/Retinoic Acid Receptor α (PML/RARα Fusion Gene with Functionalized Graphene Oxide

    Directory of Open Access Journals (Sweden)

    Hongwei Wang

    2013-06-01

    Full Text Available An attempt was made to use functionalized graphene oxide (GO to detect the Promyelocytic leukemia/Retinoic acid receptor α fusion gene (PML/RARα fusion gene, a marker gene of acute promyelocytic leukemia. The functionalized GO was prepared by chemical exfoliation method, followed by a polyethylene glycol grafting. It is found that the functionalized GO can selectively adsorb the fluorescein isothiocyanate (FITC-labeled single-stranded DNA probe and quench its fluorescence. The probe can be displaced by the PML/RARα fusion gene to restore the fluorescence, which can be detected by laser confocal microscopy and flow cytometry. These can be used to detect the presence of the PML/RARα fusion gene. This detection method is verified to be fast, simple and reliable.

  7. Explaining Lifelong Loyalty: The Role of Identity Fusion and Self-Shaping Group Events.

    Directory of Open Access Journals (Sweden)

    Martha Newson

    Full Text Available Pledging lifelong loyalty to an ingroup can have far-reaching behavioural effects, ranging from ordinary acts of ingroup kindness to extraordinary acts of self-sacrifice. What motivates this important form of group commitment? Here, we propose one especially potent answer to this question-the experience of a visceral sense of oneness with a group (i.e., identity fusion. In a sample of British football fans, a population in which high levels of lifelong loyalty are thought to be common, we first examined the hypothesised relationship between fusion and perceptions of lifelong loyalty to one's club. We further explored the hypothesis that fusion and lifelong loyalty are not merely a reflection of past time investment in a group, but also reflect a deeper, memory-based process of feeling personally shaped by key group events, both euphoric and dysphoric. We found broad support for these hypotheses. Results suggest that feeling personally self-shaped by club events (e.g., crucial wins and losses, rather than time invested in the club, leads to greater identity fusion to one's club. In turn, fusion engenders a sense of lifelong club loyalty. We discuss our findings in relation to the growing literature on the experiential origins of intense social cohesion.

  8. Explaining Lifelong Loyalty: The Role of Identity Fusion and Self-Shaping Group Events.

    Science.gov (United States)

    Newson, Martha; Buhrmester, Michael; Whitehouse, Harvey

    2016-01-01

    Pledging lifelong loyalty to an ingroup can have far-reaching behavioural effects, ranging from ordinary acts of ingroup kindness to extraordinary acts of self-sacrifice. What motivates this important form of group commitment? Here, we propose one especially potent answer to this question-the experience of a visceral sense of oneness with a group (i.e., identity fusion). In a sample of British football fans, a population in which high levels of lifelong loyalty are thought to be common, we first examined the hypothesised relationship between fusion and perceptions of lifelong loyalty to one's club. We further explored the hypothesis that fusion and lifelong loyalty are not merely a reflection of past time investment in a group, but also reflect a deeper, memory-based process of feeling personally shaped by key group events, both euphoric and dysphoric. We found broad support for these hypotheses. Results suggest that feeling personally self-shaped by club events (e.g., crucial wins and losses), rather than time invested in the club, leads to greater identity fusion to one's club. In turn, fusion engenders a sense of lifelong club loyalty. We discuss our findings in relation to the growing literature on the experiential origins of intense social cohesion.

  9. Tyrosine kinase fusion genes in pediatric BCR-ABL1-like acute lymphoblastic leukemia

    Science.gov (United States)

    Boer, Judith M.; Steeghs, Elisabeth M.P.; Marchante, João R.M.; Boeree, Aurélie; Beaudoin, James J.; Berna Beverloo, H.; Kuiper, Roland P.; Escherich, Gabriele; van der Velden, Vincent H.J.; van der Schoot, C. Ellen; de Groot-Kruseman, Hester A.; Pieters, Rob; den Boer, Monique L.

    2017-01-01

    Approximately 15% of pediatric B cell precursor acute lymphoblastic leukemia (BCP-ALL) is characterized by gene expression similar to that of BCR-ABL1-positive disease and unfavorable prognosis. This BCR-ABL1-like subtype shows a high frequency of B-cell development gene aberrations and tyrosine kinase-activating lesions. To evaluate the clinical significance of tyrosine kinase gene fusions in children with BCP-ALL, we studied the frequency of recently identified tyrosine kinase fusions, associated genetic features, and prognosis in a representative Dutch/German cohort. We identified 14 tyrosine kinase fusions among 77 BCR-ABL1-like cases (18%) and none among 76 non-BCR-ABL1-like B-other cases. Novel exon fusions were identified for RCSD1-ABL2 and TERF2-JAK2. JAK2 mutation was mutually exclusive with tyrosine kinase fusions and only occurred in cases with high CRLF2 expression. The non/late response rate and levels of minimal residual disease in the fusion-positive BCR-ABL1-like group were higher than in the non-BCR-ABL1-like B-others (p<0.01), and also higher, albeit not statistically significant, compared with the fusion-negative BCR-ABL1-like group. The 8-year cumulative incidence of relapse in the fusion-positive BCR-ABL1-like group (35%) was comparable with that in the fusion-negative BCR-ABL1-like group (35%), and worse than in the non-BCR-ABL1-like B-other group (17%, p=0.07). IKZF1 deletions, predominantly other than the dominant-negative isoform and full deletion, co-occurred with tyrosine kinase fusions. This study shows that tyrosine kinase fusion-positive cases are a high-risk subtype of BCP-ALL, which warrants further studies with specific kinase inhibitors to improve outcome. PMID:27894077

  10. Gene fusions with lacZ by duplication insertion in the radioresistant bacterium Deinococcus radiodurans

    International Nuclear Information System (INIS)

    Lennon, E.; Minton, K.W.

    1990-01-01

    Deinococcus radiodurans is the most-studied species of a eubacterial family characterized by extreme resistance to DNA damage. We have focused on developing molecular biological techniques to investigate the genetics of this organism. We report construction of lacZ gene fusions by a method involving both in vitro splicing and the natural transformation of D. radiodurans. Numerous fusion strains were identified by expression of beta-galactosidase. Among these fusion strains, several were inducible by exposure to the DNA-damaging agent mitomycin C, and four of the inducible fusion constructs were cloned in Escherichia coli. Hybridization studies indicate that one of the damage-inducible genes contains a sequence reiterated throughout the D. radiodurans chromosome. Survival measurements show that two of the fusion strains have increased sensitivity to mitomycin C, suggesting that the fusions within these strains inactivate repair functions

  11. Kinase impact assessment in the landscape of fusion genes that retain kinase domains: a pan-cancer study

    Science.gov (United States)

    Kim, Pora; Jia, Peilin; Zhao, Zhongming

    2018-01-01

    Abstract Assessing the impact of kinase in gene fusion is essential for both identifying driver fusion genes (FGs) and developing molecular targeted therapies. Kinase domain retention is a crucial factor in kinase fusion genes (KFGs), but such a systematic investigation has not been done yet. To this end, we analyzed kinase domain retention (KDR) status in chimeric protein sequences of 914 KFGs covering 312 kinases across 13 major cancer types. Based on 171 kinase domain-retained KFGs including 101 kinases, we studied their recurrence, kinase groups, fusion partners, exon-based expression depth, short DNA motifs around the break points and networks. Our results, such as more KDR than 5′-kinase fusion genes, combinatorial effects between 3′-KDR kinases and their 5′-partners and a signal transduction-specific DNA sequence motif in the break point intronic sequences, supported positive selection on 3′-kinase fusion genes in cancer. We introduced a degree-of-frequency (DoF) score to measure the possible number of KFGs of a kinase. Interestingly, kinases with high DoF scores tended to undergo strong gene expression alteration at the break points. Furthermore, our KDR gene fusion network analysis revealed six of the seven kinases with the highest DoF scores (ALK, BRAF, MET, NTRK1, NTRK3 and RET) were all observed in thyroid carcinoma. Finally, we summarized common features of ‘effective’ (highly recurrent) kinases in gene fusions such as expression alteration at break point, redundant usage in multiple cancer types and 3′-location tendency. Collectively, our findings are useful for prioritizing driver kinases and FGs and provided insights into KFGs’ clinical implications. PMID:28013235

  12. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  13. KIAA1549-BRAF fusions and IDH mutations can coexist in diffuse gliomas of adults.

    Science.gov (United States)

    Badiali, Manuela; Gleize, Vincent; Paris, Sophie; Moi, Loredana; Elhouadani, Selma; Arcella, Antonietta; Morace, Roberta; Antonelli, Manila; Buttarelli, Francesca Romana; Figarella-Branger, Dominique; Kim, Young-Ho; Ohgaki, Hiroko; Mokhtari, Karima; Sanson, Marc; Giangaspero, Felice

    2012-11-01

    KIAA1549-BRAF fusion gene and isocitrate dehydrogenase (IDH) mutations are considered two mutually exclusive genetic events in pilocytic astrocytomas and diffuse gliomas, respectively. We investigated the presence of the KIAA1549-BRAF fusion gene in conjunction with IDH mutations and 1p/19q loss in 185 adult diffuse gliomas. Moreover BRAF(v600E) mutation was also screened. The KIAA1549-BRAF fusion gene was evaluated by reverse-transcription polymerase chain reaction (RT-PCR) and sequencing. We found IDH mutations in 125 out 175 cases (71.4%). There were KIAA1549-BRAF fusion gene in 17 out of 180 (9.4%) cases and BRAF(v600E) in 2 out of 133 (1.5%) cases. In 11 of these 17 cases, both IDH mutations and the KIAA1549-BRAF fusion were present, as independent molecular events. Moreover, 6 of 17 cases showed co-presence of 1p/19q loss, IDH mutations and KIAA1549-BRAF fusion. Among the 17 cases with KIAA1549-BRAF fusion gene 15 (88.2%) were oligodendroglial neoplasms. Similarly, the two cases with BRAF(v600E) mutation were both oligodendroglioma and one had IDH mutations and 1p/19q co-deletion. Our results suggest that in a small fraction of diffuse gliomas, KIAA1549-BRAF fusion gene and BRAF(v600E) mutation may be responsible for deregulation of the Ras-RAF-ERK signaling pathway. Such alterations are more frequent in oligodendroglial neoplasm and may be co-present with IDH mutations and 1p/19q loss. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

  14. The strategy of fusion genes construction determines efficient expression of introduced transcription factors.

    Science.gov (United States)

    Adamus, Tomasz; Konieczny, Paweł; Sekuła, Małgorzata; Sułkowski, Maciej; Majka, Marcin

    2014-01-01

    The main goal in gene therapy and biomedical research is an efficient transcription factors (TFs) delivery system. SNAIL, a zinc finger transcription factor, is strongly involved in tumor, what makes its signaling pathways an interesting research subject. The necessity of tracking activation of intracellular pathways has prompted fluorescent proteins usage as localization markers. Advanced molecular cloning techniques allow to generate fusion proteins from fluorescent markers and transcription factors. Depending on fusion strategy, the protein expression levels and nuclear transport ability are significantly different. The P2A self-cleavage motif through its cleavage ability allows two single proteins to be simultaneously expressed. The aim of this study was to compare two strategies for introducing a pair of genes using expression vector system. We have examined GFP and SNAI1 gene fusions by comprising common nucleotide polylinker (multiple cloning site) or P2A motif in between them, resulting in one fusion or two independent protein expressions respectively. In each case transgene expression levels and translation efficiency as well as nuclear localization of expressed protein have been analyzed. Our data showed that usage of P2A motif provides more effective nuclear transport of SNAIL transcription factor than conventional genes linker. At the same time the fluorescent marker spreads evenly in subcellular space.

  15. Multimodality imaging of reporter gene expression using a novel fusion vector in living cells and animals

    Science.gov (United States)

    Gambhir, Sanjiv [Portola Valley, CA; Pritha, Ray [Mountain View, CA

    2011-06-07

    Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.

  16. Intrafocal heterogeneity of ERG protein expression and gene fusion pattern in prostate cancer.

    Science.gov (United States)

    Suh, Ja Hee; Park, Jeong Hwan; Lee, Cheol; Moon, Kyung Chul

    2017-10-01

    Prostate cancer is considered to be highly heterogeneous, with various morphologic features and biologic behaviors. The TMPRSS2-ERG gene fusion is the most frequently observed genetic aberration in prostate cancer. The aim of this study was to elucidate the intrafocal heterogeneity of ERG gene fusion status. ERG immunohistochemistry (IHC) was performed in samples from 168 prostate cancer patients who had undergone radical prostatectomy, and 40 cases showing ERG-positive IHC staining were selected for tissue microarray (TMA) construction. Two to six representative cores were selected from each tumor focus. In the cases with heterogeneous ERG IHC staining intensity, the areas showing different intensities were separately selected. Using the TMA blocks, IHC and fluorescence in situ hybridization (FISH) were conducted to evaluate the heterogeneity of ERG protein expression and ERG fusion gene patterns, respectively, in a single tumor focus. Heterogeneity of ERG IHC staining was defined as the simultaneous presence of negative and positive cores in the same tumor focus. Heterogeneity of ERG FISH was defined by the presence of cores with positive and negative FISH signals or cores with break-apart and interstitial deletion FISH signals in the same tumor focus. A total of 202 TMA cores were isolated from 40 ERG-positive cases. Of the 202 total cores, 19 were negative for ERG IHC staining, and 46 showed 1+, 52 showed 2+, and 85 showed 3+ ERG staining intensity. Eleven cores were negative for ERG FISH signal, 119 cores showed ERG break-apart FISH signals, and the remaining 72 cores revealed interstitial deletion. Intrafocal heterogeneity of ERG IHC staining was found in 20% (8/40) of cases, and intrafocal heterogeneity of ERG gene fusion pattern was found in 32.5% (13/40) of cases. In summary, this study showed significantly frequent intrafocal heterogeneity of ERG protein expression, gene fusion status and fusion pattern. This heterogeneity can be caused by the development

  17. Earth Science Data Fusion with Event Building Approach

    Science.gov (United States)

    Lukashin, C.; Bartle, Ar.; Callaway, E.; Gyurjyan, V.; Mancilla, S.; Oyarzun, R.; Vakhnin, A.

    2015-01-01

    Objectives of the NASA Information And Data System (NAIADS) project are to develop a prototype of a conceptually new middleware framework to modernize and significantly improve efficiency of the Earth Science data fusion, big data processing and analytics. The key components of the NAIADS include: Service Oriented Architecture (SOA) multi-lingual framework, multi-sensor coincident data Predictor, fast into-memory data Staging, multi-sensor data-Event Builder, complete data-Event streaming (a work flow with minimized IO), on-line data processing control and analytics services. The NAIADS project is leveraging CLARA framework, developed in Jefferson Lab, and integrated with the ZeroMQ messaging library. The science services are prototyped and incorporated into the system. Merging the SCIAMACHY Level-1 observations and MODIS/Terra Level-2 (Clouds and Aerosols) data products, and ECMWF re- analysis will be used for NAIADS demonstration and performance tests in compute Cloud and Cluster environments.

  18. Potential off-normal events and associated radiological source terms for the compact ignition tokamak: Fusion Safety Program

    International Nuclear Information System (INIS)

    Holland, D.F.; Lyon, R.E.

    1987-10-01

    The Compact Ignition Tokamak (CIT), the latest step in the United States program to develop the commercial application of fusion power, is designed as the first fusion device to achieve ignition conditions. It is to be constructed near Princeton, New Jersey on the site of the existing Tokamak Fusion Test Reactor (TFTR). To address the environmental impact and public safety concerns, a preliminary analysis was performed of potential off-normal radiological releases. Operational occurrences, natural phenomena, accidents with external origins, and accidents external to the PPPL site were considered as potential sources for off-normal events. Based on an initial screening, events were selected for preliminary analysis. Included in these events were tritium releases from the tritium delivery and recovery system, tritium releases from the torus, releases of activated nitrogen from the test cell or cryostat, seismic events, and shipping accidents. In each case, the design considerations related to the event were reviewed and the release scenarios discussed. Because of the complexity of some of the proposed safety systems, in some cases event trees were used to describe the accident scenarios. For each scenario, the probability was estimated as well as the release magnitude, isotope, chemical form, and release mode. 10 refs., 17 figs., 5 tabs

  19. Early and late HIV-1 membrane fusion events are impaired by sphinganine lipidated peptides that target the fusion site.

    Science.gov (United States)

    Klug, Yoel A; Ashkenazi, Avraham; Viard, Mathias; Porat, Ziv; Blumenthal, Robert; Shai, Yechiel

    2014-07-15

    Lipid-conjugated peptides have advanced the understanding of membrane protein functions and the roles of lipids in the membrane milieu. These lipopeptides modulate various biological systems such as viral fusion. A single function has been suggested for the lipid, binding to the membrane and thus elevating the local concentration of the peptide at the target site. In the present paper, we challenged this argument by exploring in-depth the antiviral mechanism of lipopeptides, which comprise sphinganine, the lipid backbone of DHSM (dihydrosphingomyelin), and an HIV-1 envelope-derived peptide. Surprisingly, we discovered a partnership between the lipid and the peptide that impaired early membrane fusion events by reducing CD4 receptor lateral diffusion and HIV-1 fusion peptide-mediated lipid mixing. Moreover, only the joint function of sphinganine and its conjugate peptide disrupted HIV-1 fusion protein assembly and folding at the later fusion steps. Via imaging techniques we revealed for the first time the direct localization of these lipopeptides to the virus-cell and cell-cell contact sites. Overall, the findings of the present study may suggest lipid-protein interactions in various biological systems and may help uncover a role for elevated DHSM in HIV-1 and its target cell membranes.

  20. Osteoclast Fusion

    DEFF Research Database (Denmark)

    Marie Julie Møller, Anaïs; Delaissé, Jean-Marie; Søe, Kent

    2017-01-01

    on the nuclearity of fusion partners. While CD47 promotes cell fusions involving mono-nucleated pre-osteoclasts, syncytin-1 promotes fusion of two multi-nucleated osteoclasts, but also reduces the number of fusions between mono-nucleated pre-osteoclasts. Furthermore, CD47 seems to mediate fusion mostly through...... individual fusion events using time-lapse and antagonists of CD47 and syncytin-1. All time-lapse recordings have been studied by two independent observers. A total of 1808 fusion events were analyzed. The present study shows that CD47 and syncytin-1 have different roles in osteoclast fusion depending...... broad contact surfaces between the partners' cell membrane while syncytin-1 mediate fusion through phagocytic-cup like structure. J. Cell. Physiol. 9999: 1-8, 2016. © 2016 Wiley Periodicals, Inc....

  1. LINE FUSION GENES: a database of LINE expression in human genes

    Directory of Open Access Journals (Sweden)

    Park Hong-Seog

    2006-06-01

    Full Text Available Abstract Background Long Interspersed Nuclear Elements (LINEs are the most abundant retrotransposons in humans. About 79% of human genes are estimated to contain at least one segment of LINE per transcription unit. Recent studies have shown that LINE elements can affect protein sequences, splicing patterns and expression of human genes. Description We have developed a database, LINE FUSION GENES, for elucidating LINE expression throughout the human gene database. We searched the 28,171 genes listed in the NCBI database for LINE elements and analyzed their structures and expression patterns. The results show that the mRNA sequences of 1,329 genes were affected by LINE expression. The LINE expression types were classified on the basis of LINEs in the 5' UTR, exon or 3' UTR sequences of the mRNAs. Our database provides further information, such as the tissue distribution and chromosomal location of the genes, and the domain structure that is changed by LINE integration. We have linked all the accession numbers to the NCBI data bank to provide mRNA sequences for subsequent users. Conclusion We believe that our work will interest genome scientists and might help them to gain insight into the implications of LINE expression for human evolution and disease. Availability http://www.primate.or.kr/line

  2. Detection of water-quality contamination events based on multi-sensor fusion using an extented Dempster–Shafer method

    International Nuclear Information System (INIS)

    Hou, Dibo; He, Huimei; Huang, Pingjie; Zhang, Guangxin; Loaiciga, Hugo

    2013-01-01

    This study presents a method for detecting contamination events of sources of drinking water based on the Dempster–Shafer (D-S) evidence theory. The detection method has the purpose of protecting water supply systems against accidental and intentional contamination events. This purpose is achieved by first predicting future water-quality parameters using an autoregressive (AR) model. The AR model predicts future water-quality parameters using recent measurements of these parameters made with automated (on-line) water-quality sensors. Next, a probabilistic method assigns probabilities to the time series of residuals formed by comparing predicted water-quality parameters with threshold values. Finally, the D-S fusion method searches for anomalous probabilities of the residuals and uses the result of that search to determine whether the current water quality is normal (that is, free of pollution) or contaminated. The D-S fusion method is extended and improved in this paper by weighted averaging of water-contamination evidence and by the analysis of the persistence of anomalous probabilities of water-quality parameters. The extended D-S fusion method makes determinations that have a high probability of being correct concerning whether or not a source of drinking water has been contaminated. This paper's method for detecting water-contamination events was tested with water-quality time series from automated (on-line) water quality sensors. In addition, a small-scale, experimental, water-pipe network was tested to detect water-contamination events. The two tests demonstrated that the extended D-S fusion method achieves a low false alarm rate and high probabilities of detecting water contamination events. (paper)

  3. The leukemia-specific fusion gene ETV6/RUNX1 perturbs distinct key biological functions primarily by gene repression.

    Directory of Open Access Journals (Sweden)

    Gerhard Fuka

    Full Text Available BACKGROUND: ETV6/RUNX1 (E/R (also known as TEL/AML1 is the most frequent gene fusion in childhood acute lymphoblastic leukemia (ALL and also most likely the crucial factor for disease initiation; its role in leukemia propagation and maintenance, however, remains largely elusive. To address this issue we performed a shRNA-mediated knock-down (KD of the E/R fusion gene and investigated the ensuing consequences on genome-wide gene expression patterns and deducible regulatory functions in two E/R-positive leukemic cell lines. FINDINGS: Microarray analyses identified 777 genes whose expression was substantially altered. Although approximately equal proportions were either up- (KD-UP or down-regulated (KD-DOWN, the effects on biological processes and pathways differed considerably. The E/R KD-UP set was significantly enriched for genes included in the "cell activation", "immune response", "apoptosis", "signal transduction" and "development and differentiation" categories, whereas in the E/R KD-DOWN set only the "PI3K/AKT/mTOR signaling" and "hematopoietic stem cells" categories became evident. Comparable expression signatures obtained from primary E/R-positive ALL samples underline the relevance of these pathways and molecular functions. We also validated six differentially expressed genes representing the categories "stem cell properties", "B-cell differentiation", "immune response", "cell adhesion" and "DNA damage" with RT-qPCR. CONCLUSION: Our analyses provide the first preliminary evidence that the continuous expression of the E/R fusion gene interferes with key regulatory functions that shape the biology of this leukemia subtype. E/R may thus indeed constitute the essential driving force for the propagation and maintenance of the leukemic process irrespective of potential consequences of associated secondary changes. Finally, these findings may also provide a valuable source of potentially attractive therapeutic targets.

  4. A Screening Method for the ALK Fusion Gene in NSCLC

    International Nuclear Information System (INIS)

    Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

    2012-01-01

    Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

  5. Regulation of membrane fusion and secretory events in the sea urchin embryo

    International Nuclear Information System (INIS)

    Roe, J.L.

    1990-01-01

    Membrane fusion and secretory events play a key role in fertilization and early development in the sea urchin embryo. To investigate the mechanism of membrane fusion, the effect of inhibitors of metalloendoprotease activity was studied on two model systems of cell fusion; fertilization and spiculogenesis by primary mesenchyme cells in the embryo. Both the zinc chelator, 1,10-phenanthroline, and peptide metalloprotease substrates were found to inhibit both fertilization and gamete fusion, while peptides that are not substrates of metalloproteases did not affect either process. Primary mesenchyme cells form the larval skeleton in the embryo by deposition of mineral and an organic matrix into a syncytial cavity formed by fusion of filopodia of these cells. Metalloprotease inhibitors were found to inhibit spiculogenesis both in vivo and in cultures of isolated primary mesenchyme cells, and the activity of a metalloprotease of the appropriate specificity was found in the primary mesenchyme cells. These two studies implicate the activity of a metalloprotease in a necessary step in membrane fusion. Following fertilization, exocytosis of the cortical granules results in the formation of the fertilization envelope and the hyaline layer, that surround the developing embryo. The hatching enzyme is secreted by the blastula stage sea urchin embryo, which proteolyzes the fertilization envelope surrounding the embryo, allowing the embryo to hatch. Using an assay that measures 125 I-fertilization envelope degradation, the hatching enzyme was identified as a 33 kDa metalloprotease, and was purified by ion-exchange and affinity chromatography from the hatching media of Strongylocentrotus purpuratus embryos. The hatching enzyme showed a substrate preference for only a minor subset of fertilization envelope proteins

  6. Analysis of a MULE-cyanide hydratase gene fusion in Verticillium dahliae

    Science.gov (United States)

    The genome of the phytopathogenic fungus Verticillium dahliae encodes numerous Class II “cut-and-paste” transposable elements, including those of a small group of MULE transposons. We have previously identified a fusion event between a MULE transposon sequence and sequence encoding a cyanide hydrata...

  7. CRTC1-MAML2 gene fusion in mucoepidermoid carcinoma of the lacrimal gland

    DEFF Research Database (Denmark)

    von Holstein, Sarah Linea; Fehr, André; Heegaard, Steffen

    2012-01-01

    -grade MEC of the lacrimal gland. There were no signs of recurrence or metastases during a five-year follow-up. Using RT-PCR and FISH we demonstrated that the tumor was positive for the CRTC1-MAML2 gene fusion previously shown to be associated with in particular low-grade salivary MECs with favorable...... prognosis. By immunohistochemistry we showed that the majority of tumor cells, including epidermoid, intermediate and mucous producing cells, expressed the CRTC1-MAML2 fusion protein. In contrast, 15 non-MEC lacrimal neoplasm were fusion-negative. Our findings show that lacrimal MEC is not only clinically...... anatomical sites and organs. Moreover, our findings indicate that the CRTC1-MAML2 fusion may be a useful diagnostic and prognostic biomarker for lacrimal MEC....

  8. [Prokaryotic expression of trigeminy artificial fusion gene of Leptospira interrogans and the immunogenicity of its products].

    Science.gov (United States)

    Luo, Dong-jiao; Qiu, Xiao-feng; Wang, Jiang; Yan, Jin; Wang, Hai-bin; Zhou, Jin-cheng; Yan, Jie

    2008-11-01

    To construct lipL32/1-lipL21-OmpL1/2 fusion gene of Leptospira interrogans and its prokaryotic expression system, and to identify the immunogenicity of its products. PCR using linking primers was applied to construct lipL32/1-lipL21-OmpL1/2 fusion gene and a prokaryotic expression system of the fusion gene was then established using routine genetic engineering technique. SDS-PAGE was used to examine output of the target recombinant protein rLipL32/1-LipL21-OmpL1/2. Double immunodiffusion and Western Blot assay were applied to identify immunogenicity of rLipL32/1-LipL21-OmpL1/2. lipL32/1-lipL21-OmpL1/2 fusion gene with correct sequence and its prokaryotic expression system E.coli BL21DE3pET42a-lipL32/1-lipL21-ompL1/2 was obtained in this study. The output of rLipL32/1-LipL21- OmpL1/2 after optimisation was 37.78 mg/L. The immunodiffusion titer of rabbit antiserum against rLipL32/1-LipL21-OmpL1/2 was 1:4. The rLipL32/1-LipL21-OmpL1/2 antiserum was able to recognize rLipL32/1-LipL21-OmpL1/2, rLipL32/1, rLipL21 and rOmpL1/2. Positive Western hybridization signals were found among rLipL32/1-LipL21-OmpL1/2 and rabbit antiserum against whole cell of strain 56601 and serum from patients infected with L.interrogans serogroups Icterohaemorrhagiae, Grippotyphosa, Autumnalis and Pomona. The fusion gene lipL32/1-lipL21-OmpL1/2 and its prokaryotic expression system were successfully constructed in this study. The expressed fusion protein can be used as the antigen for developing universal genetic engineering vaccine and universal serological tests of leptospirosis.

  9. The distribution of BRAF gene fusions in solid tumors and response to targeted therapy.

    Science.gov (United States)

    Ross, Jeffrey S; Wang, Kai; Chmielecki, Juliann; Gay, Laurie; Johnson, Adrienne; Chudnovsky, Jacob; Yelensky, Roman; Lipson, Doron; Ali, Siraj M; Elvin, Julia A; Vergilio, Jo-Anne; Roels, Steven; Miller, Vincent A; Nakamura, Brooke N; Gray, Adam; Wong, Michael K; Stephens, Philip J

    2016-02-15

    Although the BRAF V600E base substitution is an approved target for the BRAF inhibitors in melanoma, BRAF gene fusions have not been investigated as anticancer drug targets. In our study, a wide variety of tumors underwent comprehensive genomic profiling for hundreds of known cancer genes using the FoundationOne™ or FoundationOne Heme™ comprehensive genomic profiling assays. BRAF fusions involving the intact in-frame BRAF kinase domain were observed in 55 (0.3%) of 20,573 tumors, across 12 distinct tumor types, including 20 novel BRAF fusions. These comprised 29 unique 5' fusion partners, of which 31% (9) were known and 69% (20) were novel. BRAF fusions included 3% (14/531) of melanomas; 2% (15/701) of gliomas; 1.0% (3/294) of thyroid cancers; 0.3% (3/1,062) pancreatic carcinomas; 0.2% (8/4,013) nonsmall-cell lung cancers and 0.2% (4/2,154) of colorectal cancers, and were enriched in pilocytic (30%) vs. nonpilocytic gliomas (1%; p < 0.0001), Spitzoid (75%) vs. nonSpitzoid melanomas (1%; p = 0.0001), acinar (67%) vs. nonacinar pancreatic cancers (<1%; p < 0.0001) and papillary (3%) vs. nonpapillary thyroid cancers (0%; p < 0.03). Clinical responses to trametinib and sorafenib are presented. In conclusion, BRAF fusions are rare driver alterations in a wide variety of malignant neoplasms, but enriched in Spitzoid melanoma, pilocytic astrocytomas, pancreatic acinar and papillary thyroid cancers. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of UICC.

  10. Identification of Driving ALK Fusion Genes and Genomic Landscape of Medullary Thyroid Cancer.

    Directory of Open Access Journals (Sweden)

    Jun Ho Ji

    2015-08-01

    Full Text Available The genetic landscape of medullary thyroid cancer (MTC is not yet fully understood, although some oncogenic mutations have been identified. To explore genetic profiles of MTCs, formalin-fixed, paraffin-embedded tumor tissues from MTC patients were assayed on the Ion AmpliSeq Cancer Panel v2. Eighty-four sporadic MTC samples and 36 paired normal thyroid tissues were successfully sequenced. We discovered 101 hotspot mutations in 18 genes in the 84 MTC tissue samples. The most common mutation was in the ret proto-oncogene, which occurred in 47 cases followed by mutations in genes encoding Harvey rat sarcoma viral oncogene homolog (N = 14, serine/threonine kinase 11 (N = 11, v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (N = 6, mutL homolog 1 (N = 4, Kiesten rat sarcoma viral oncogene homolog (N = 3 and MET proto-oncogene (N = 3. We also evaluated anaplastic lymphoma kinase (ALK rearrangement by immunohistochemistry and break-apart fluorescence in situ hybridization (FISH. Two of 98 screened cases were positive for ALK FISH. To identify the genomic breakpoint and 5' fusion partner of ALK, customized targeted cancer panel sequencing was performed using DNA from tumor samples of the two patients. Glutamine:fructose-6-phosphate transaminase 1 (GFPT1-ALK and echinoderm microtubule-associated protein-like 4 (EML4-ALK fusions were identified. Additional PCR analysis, followed by Sanger sequencing, confirmed the GFPT1-ALK fusion, indicating that the fusion is a result of intra-chromosomal translocation or deletion. Notably, a metastatic MTC case harboring the EML4-ALK fusion showed a dramatic response to an ALK inhibitor, crizotinib. In conclusion, we found several genetic mutations in MTC and are the first to identify ALK fusions in MTC. Our results suggest that the EML4-ALK fusion in MTC may be a potential driver mutation and a valid target of ALK inhibitors. Furthermore, the GFPT1-ALK fusion may be a potential candidate for molecular

  11. Recurrent MET fusion genes represent a drug target in pediatric glioblastoma

    DEFF Research Database (Denmark)

    Sehested, Astrid Marie

    2016-01-01

    Pediatric glioblastoma is one of the most common and most deadly brain tumors in childhood. Using an integrative genetic analysis of 53 pediatric glioblastomas and five in vitro model systems, we identified previously unidentified gene fusions involving the MET oncogene in ∼10% of cases. These MET...

  12. ETS Gene Fusions as Predictive Biomarkers of Resistance to Radiation Therapy for Prostate Cancer

    Science.gov (United States)

    2016-05-01

    phenotype  in   preclinical  models  of  prostate  cancer,  2)  to  explore  the  mechanism  of  interaction  between   ERG  (the  predominant  ETS...established  this  axis  as  a  potential  therapeutic   target.         15. SUBJECT  TERMS Prostate cancer, ETS gene fusions, ERG , radiation resistance, DNA...interaction  between   ERG   (the   predominant   ETS   gene   fusion   product)   and   the   DNA   repair   protein   DNA-­PK,   and   3)   to

  13. Study on Fusion Protein and Its gene in Baculovirus Specificity

    International Nuclear Information System (INIS)

    Nemr, W.A.H.

    2012-01-01

    Baculoviruses are subdivided into two groups depending on the type of budded virus envelop fusion protein; group I utilized gp64 which include the most of nucleopolyhedroviruses (NPVs), group II utilized F protein which include the remnants of NPVs and all Granuloviruses (GVs). Recent studies reported the viral F protein coding gene as a host cellular sourced gene and may evolutionary acquired from the host genome referring to phylogeny analysis of fusion proteins. Thus, it was deduced that F protein coding gene is species- specific nucleotide sequence related to the type of the specific host and if virus could infect an unexpected host, the resulted virus may encode a vary F gene. In this regard, the present study utilized the mentioned properties of F gene in an attempt to produce a model of specific and more economic wider range granulovirus bio- pesticide able to infect both Spodoptera littoralis and Phthorimaea operculella larvae. Multiple sequence alignment and phylogeny analysis were performed on six members of group II baculovirus, novel universal PCR primers were manually designed from the conserved regions in the alignment graph, targeted to amplify species- specific sequence entire F gene open reading frame (ORF) which is useful in molecular identification of baculovirus in unknown samples. So, the PCR product of SpliGV used to prepare a specific probe for the F gene of this type of virus. Results reflected that it is possible to infect S. littoralis larvae by PhopGV if injected into larval haemocoel, the resulted virus of this infection showed by using DNA hybridization technique to be encode to F gene homologous with the F gene of Spli GV, which is revealed that the resulted virus acquired this F gene sequence from the host genome after infection. Consequently, these results may infer that if genetic aberrations occur in the host genome, this may affect in baculoviral infectivity. So, this study aimed to investigate the effect of gamma radiation at

  14. Glioma stem cells targeted by oncolytic virus carrying endostatin-angiostatin fusion gene and the expression of its exogenous gene in vitro.

    Science.gov (United States)

    Zhu, Guidong; Su, Wei; Jin, Guishan; Xu, Fujian; Hao, Shuyu; Guan, Fangxia; Jia, William; Liu, Fusheng

    2011-05-16

    The development of the cancer stem cell (CSCs) niche theory has provided a new target for the treatment of gliomas. Gene therapy using oncolytic viral vectors has shown great potential for the therapeutic targeting of CSCs. To explore whether a viral vector carrying an exogenous Endo-Angio fusion gene (VAE) can infect and kill glioma stem cells (GSCs), as well as inhibit their vascular niche in vitro, we have collected surgical specimens of human high-grade glioma (world health organization, WHO Classes III-VI) from which we isolated and cultured GSCs under conditions originally designed for the selective expansion of neural stem cells. Our results demonstrate the following: (1) Four lines of GSCs (isolated from 20 surgical specimens) could grow in suspension, were multipotent, had the ability to self-renew and expressed the neural stem cell markers, CD133 and nestin. (2) VAE could infect GSCs and significantly inhibit their viability. (3) The Endo-Angio fusion gene was expressed in GSCs 48 h after VAE infection and could inhibit the proliferation of human brain microvascular endothelial cells (HBMEC). (4) Residual viable cells lose the ability of self-renewal and adherent differentiation. In conclusion, VAE can significantly inhibit the activity of GSCs in vitro and the expression of exogenous Endo-Angio fusion gene can inhibit HBMEC proliferation. VAE can be used as a novel virus-gene therapy strategy for glioma. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. [Construction of eukaryotic recombinant vector and expression in COS7 cell of LipL32-HlyX fusion gene from Leptospira serovar Lai].

    Science.gov (United States)

    Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying

    2009-04-01

    This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.

  16. A PTEN-COL17A1 fusion gene and its novel regulatory role in Collagen XVII expression and GBM malignance.

    Science.gov (United States)

    Yan, Xiaoyan; Zhang, Chuanbao; Liang, Tingyu; Yang, Fan; Wang, Haoyuan; Wu, Fan; Wang, Wen; Wang, Zheng; Cheng, Wen; Xu, Jiangnan; Jiang, Tao; Chen, Jing; Ding, Yaozhong

    2017-10-17

    Collagen XVII expression has recently been demonstrated to be correlated with the tumor malignance. While Collagen XVII is known to be widely distributed in neurons of the human brain, its precise role in pathogenesis of glioblastoma multiforme (GBM) is unknown. In this study, we identified and characterized a new PTEN-COL17A1 fusion gene in GMB using transcriptome sequencing. Although fusion gene did not result in measurable fusion protein production, its presence is accompanied with high levels of COL17A1 expression, revealed a novel regulatory mechanism of Collagen XVII expression by PTEN-COL17A1 gene fusion. Knocked down Collagen XVII expression in glioma cell lines resulted in decreased tumor invasiveness, along with significant reduction of MMP9 expression, while increased Collagen XVII expression promotes invasive activities of glioma cells and associated with GBM recurrences. Together, our results uncovered a new PTEN-COL17A1 fusion gene and its novel regulatory role in Collagen XVII expression and GBM malignance, and demonstrated that COL17A1 could serve as a useful prognostic biomarker and therapeutic targets for GBM.

  17. Association of TMPRSS2-ERG gene fusion with clinical characteristics and outcomes: results from a population-based study of prostate cancer

    International Nuclear Information System (INIS)

    FitzGerald, Liesel M; Cox, Michael E; Ostrander, Elaine A; Stanford, Janet L; Huntsman, David G; Agalliu, Ilir; Johnson, Karynn; Miller, Melinda A; Kwon, Erika M; Hurtado-Coll, Antonio; Fazli, Ladan; Rajput, Ashish B; Gleave, Martin E

    2008-01-01

    The presence of the TMPRSS2-ERG fusion gene in prostate tumors has recently been associated with an aggressive phenotype, as well as recurrence and death from prostate cancer. These associations suggest the hypothesis that the gene fusion may be used as a prognostic indicator for prostate cancer. In this study, fluorescent in situ hybridization (FISH) assays were used to assess TMPRSS2-ERG fusion status in a group of 214 prostate cancer cases from two population-based studies. The FISH assays were designed to detect both fusion type (deletion vs. translocation) and the number of fusion copies (single vs. multiple). Genotyping of four ERG and one TMPRSS2 SNPs using germline DNA was also performed in a sample of the cases (n = 127). Of the 214 tumors scored for the TMPRSS2-ERG fusion, 64.5% were negative and 35.5% were positive for the fusion. Cases with the TMPRSS2-ERG fusion did not exhibit reduced prostate cancer survival (HR = 0.92, 95% CI = 0.22–3.93), nor was there a significant difference in cause-specific survival when stratifying by translocation or deletion (HR = 0.84, 95% CI = 0.23–3.12) or by the number of retained fusion copies (HR = 1.22, 95% CI = 0.45–3.34). However, evidence for reduced prostate cancer-specific survival was apparent in those cases whose tumor had multiple copies of the fusion. The variant T allele of the TMPRSS2 SNP, rs12329760, was positively associated with TMPRSS2-ERG fusion by translocation (p = 0.05) and with multiple copies of the gene fusion (p = 0.03). If replicated, the results presented here may provide insight into the mechanism by which the TMPRSS2-ERG gene fusion arises and also contribute to diagnostic evaluations for determining the subset of men who will go on to develop metastatic prostate cancer

  18. Numerical analysis on ingress-of-coolant events in fusion reactors with TRAC-PF1 code

    International Nuclear Information System (INIS)

    Ose, Yasuo; Takase, Kazuyuki; Akimoto, Hajime

    2000-01-01

    As for accident events related with thermal-hydraulics, in a fusion experimental reactor an ingress-of-coolant event (ICE) and a loss-of-vacuum-accident event (LOVA) should be considered. An integrated ICE/LOVA test apparatus is under planning in order to estimate quantitatively heat transfer and fluid flow characteristics under ICE and LOVA events. This study was carried out to predict numerically the thermal-hydraulic characteristics in fusion reactors at the ICE events before construction of the integrated ICE/LOVA test apparatus. The TRAC-PF1 code, which was originally developed for the thermal-hydraulic safety analysis in light water reactors, was used. The numerical analyses were performed for two kinds of system configuration with/without a pressure-suppression tank:the former for is investigation of the pressure rise characteristics and two-phase flow behavior; the latter for estimation of an effect of the pressure reduction due to the pressure-suppression tank. From the present analytical results, effects of the ingress water flow rate and vessel temperatures on the pressure rise ware clarified quantitatively. Furthermore, the pressure-rise suppression effect due to the vapor condensation in the pressure-suppression tank was predicted numerically. In addition, the useful information regarding to the design of the integrated ICE/LOVA test apparatus and the knowledge with respect to the effective usage of the TRAC-PF1 code were obtained through the present numerical study. (author)

  19. Discovery and characterization of a novel CCND1/MRCK gene fusion in mantle cell lymphoma

    Directory of Open Access Journals (Sweden)

    Chioniso Patience Masamha

    2016-03-01

    Full Text Available Abstract The t(11;14 translocation resulting in constitutive cyclin D1 expression is an early event in mantle cell lymphoma (MCL transformation. Patients with a highly proliferative phenotype produce cyclin D1 transcripts with truncated 3′UTRs that evade miRNA regulation. Here, we report the recurrence of a novel gene fusion in MCL cell lines and MCL patient isolates that consists of the full protein coding region of cyclin D1 (CCND1 and a 3′UTR consisting of sequences from both the CCND1 3′UTR and myotonic dystrophy kinase-related Cdc42-binding kinase's (MRCK intron one. The resulting CCND1/MRCK mRNA is resistant to CCND1-targeted miRNA regulation, and targeting the MRCK region of the chimeric 3′UTR with siRNA results in decreased CCND1 levels.

  20. Higgs boson produced via vector boson fusion event recorded by CMS (Run 2, 13 TeV)

    CERN Multimedia

    Mc Cauley, Thomas

    2016-01-01

    Real proton-proton collision event at 13 TeV in the CMS detector in which two high-energy electrons (green lines), two high-energy muons (red lines), and two-high energy jets (dark yellow cones) are observed. The event shows characteristics expected from Higgs boson production via vector boson fusion with subsequent decay of the Higgs boson in four leptons, and is also consistent with background standard model physics processes.

  1. Gene trapping in differentiating cell lines: regulation of the lysosomal protease cathepsin B in skeletal myoblast growth and fusion.

    Science.gov (United States)

    Gogos, J A; Thompson, R; Lowry, W; Sloane, B F; Weintraub, H; Horwitz, M

    1996-08-01

    To identify genes regulated during skeletal muscle differentiation, we have infected mouse C2C12 myoblasts with retroviral gene trap vectors, containing a promoterless marker gene with a 5' splice acceptor signal. Integration of the vector adjacent to an actively transcribed gene places the marker under the transcriptional control of the endogenous gene, while the adjacent vector sequences facilitate cloning. The vector insertionally mutates the trapped locus and may also form fusion proteins with the endogenous gene product. We have screened several hundred clones, each containing a trapping vector integrated into a different endogenous gene. In agreement with previous estimates based on hybridization kinetics, we find that a large proportion of all genes expressed in myoblasts are regulated during differentiation. Many of these genes undergo unique temporal patterns of activation or repression during cell growth and myotube formation, and some show specific patterns of subcellular localization. The first gene we have identified with this strategy is the lysosomal cysteine protease cathepsin B. Expression from the trapped allele is upregulated during early myoblast fusion and downregulated in myotubes. A direct role for cathepsin B in myoblast growth and fusion is suggested by the observation that the trapped cells deficient in cathepsin B activity have an unusual morphology and reduced survival in low-serum media and undergo differentiation with impaired cellular fusion. The phenotype is reproduced by antisense cathepsin B expression in parental C2C12 myoblasts. The cellular phenotype is similar to that observed in cultured myoblasts from patients with I cell disease, in which there is diminished accumulation of lysosomal enzymes. This suggests that a specific deficiency of cathepsin B could contribute to the myopathic component of this illness.

  2. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    International Nuclear Information System (INIS)

    Robinson, Claire; Kolb, Andreas F.

    2009-01-01

    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A β-galactosidase reporter gene was inserted in place of the β-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the β-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal β-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the β-casein gene

  3. Recombinant hepatitis B surface antigen production in Aspergillus niger: evaluating the strategy of gene fusion to native glucoamylase

    CSIR Research Space (South Africa)

    James, ER

    2012-10-01

    Full Text Available Microbiology and Biotechnology October 2012/ Vol. 96, No.2 Recombinant hepatitis B surface antigen production in Aspergillus niger: evaluating the strategy of gene fusion to native glucoamylase ER James a,c & WH van Zyl b & PJ van Zyl c & JF Görgens..., Pretoria 0001, South Africa Abstract This study demonstrates the potential of Aspergillus niger as a candidate expression system for virus- like particle production using gene fusion. Hepatitis B surface antigen (HBsAg) production, targeted...

  4. Membrane fusion inducers, chloroquine and spermidine increase lipoplex-mediated gene transfection

    International Nuclear Information System (INIS)

    Wong-Baeza, Carlos; Bustos, Israel; Serna, Manuel; Tescucano, Alonso; Alcantara-Farfan, Veronica; Ibanez, Miguel; Montanez, Cecilia; Wong, Carlos; Baeza, Isabel

    2010-01-01

    Gene transfection into mammalian cells can be achieved with viral and non-viral vectors. Non-viral vectors, such as cationic lipids that form lipoplexes with DNA, are safer and more stable than viral vectors, but their transfection efficiencies are lower. Here we describe that the simultaneous treatment with a membrane fusion inducer (chlorpromazine or procainamide) plus the lysosomotropic agent chloroquine increases lipoplex-mediated gene transfection in human (HEK293 and C-33 A) and rat (PC12) cell lines (up to 9.2-fold), as well as in situ in BALB/c mice spleens and livers (up to 6-fold); and that the polyamine spermidine increases lipoplex-mediated gene transfection and expression in cell cultures. The use of these four drugs provides a novel, safe and relatively inexpensive way to considerably increase lipoplex-mediated gene transfection efficiency.

  5. [Construction and application of prokaryotic expression system of Leptospira interrogans lipL32/1-lipL41/1 fusion gene].

    Science.gov (United States)

    Luo, Dong-jiao; Yan, Jie; Mao, Ya-fei; Li, Shu-ping; Luo, Yi-hui; Li, Li-wei

    2005-01-01

    To construct lipL32/1-lipL41/1 fusion gene and its prokaryotic expression system and to determine frequencies of carrying and expression of lipL32 and lipL41 genes in L.interrogans wild strains and specific antibody levels in sera from leptospirosis patients. lipL32/1-lipL41/1 fusion gene was constructed using linking primer PCR method and the prokaryotic expression system of the fusion gene done with routine techniques. SDS-PAGE was used to examine expression of the target recombinant protein rLipL32/1-rLipL41/1. Immunogenicity of rLipL32/1-rLipL41/1 was identified by Western blot. PCR and MAT were performed to detect carrying and expression of lipL32 and lipL41 genes in 97 wild L.interrogans strains. Antibodies against products of lipL32 and lipL41 genes in serum samples from 228 leptospirosis patients were detected by ELISA method. The homogeneity of nucleotide and putative amino acid sequence of lipL32/1-lipL41/1 fusion gene were 99.9 % and 99.8 % in comparison with the reported sequences. Expression output of the target recombinant protein rLipL32/1-rLipL41/1, mainly present in inclusion body, accounted for 10 % of the total bacterial proteins. Both the rabbit antisera against rLipL32/1 and rLipL41/1 could combine to rLipL32/1-rLipL41/1. 97.9 % and 87.6 % of the L.interrogans wild strains had lipL32 and lipL41 genes, respectively. 95.9 % and 84.5 % of the wild strains were positive for MAT with titers of 1:4 - 1:128 using rabbit anti-rLipL32s or anti-rLipL41s sera, respectively. 94.7 % - 97.4 % of the patients'serum samples were positive for rLipL32s antibodies, while 78.5 % - 84.6 % of them were rLipL41s antibodies detectable. lipL32/1-jlipL41/1 fusion gene and its prokaryotic expression system were successfully constructed. The expressed fusion protein had qualified immunogenicity. Both the lipL32 and lipL41 genes are extensively carried and frequently expressed by different serogroups of L.interrogans, and their expression products exhibit cross-antigenicity.

  6. Clinicopathological differences between variants of the NAB2-STAT6 fusion gene in solitary fibrous tumors of the meninges and extra-central nervous system.

    Science.gov (United States)

    Nakada, Satoko; Minato, Hiroshi; Nojima, Takayuki

    2016-07-01

    Investigations on the NAB2-STAT6 fusion gene in solitary fibrous tumors (SFTs) and hemangiopericytomas (HPCs) have increased since its discovery in 2013. Although several SFTs reported without NAB2-STAT6 fusion gene analysis, we reviewed 546 SFTs/HPCs with NAB2-STAT6 fusion gene analysis in this study and investigated differences between the gene variants. In total, 452 cases tested positive for the NAB2-STAT6 fusion gene, with more than 40 variants being detected. The most frequent of these were NAB2 exon 6-STAT6 exon 16/17/18 and NAB2 exon 4-STAT6 exon 2/3, with the former occurring most frequently in SFTs in meninges, soft tissues, and head and neck; the latter predominated in SFTs in the pleura and lung. There was no difference between the histology of SFTs and fusion gene variants. A follow-up analysis of SFTs showed that 51 of 202 cases had a recurrence, with 18 of 53 meningeal SFTs having a local recurrence and/or metastasis within 0-19 years. In meninges and soft tissue, SFTs with the NAB2 exon 6-STAT6 exon 16/17/18 tended to recur more frequently than SFTs with the NAB2 exon 4-STAT6 exon 2/3. Clinicopathological data, including yearly follow-ups, are required for meningeal SFTs/HPCs to define the correlation of variants of NAB2-STAT6 fusion gene.

  7. Scaffold filling, contig fusion and comparative gene order inference

    Directory of Open Access Journals (Sweden)

    Rounsley Steve

    2010-06-01

    Full Text Available Abstract Background There has been a trend in increasing the phylogenetic scope of genome sequencing without finishing the sequence of the genome. Increasing numbers of genomes are being published in scaffold or contig form. Rearrangement algorithms, however, including gene order-based phylogenetic tools, require whole genome data on gene order or syntenic block order. How then can we use rearrangement algorithms to compare genomes available in scaffold form only? Can the comparative evidence predict the location of unsequenced genes? Results Our method involves optimally filling in genes missing from the scaffolds, while incorporating the augmented scaffolds directly into the rearrangement algorithms as if they were chromosomes. This is accomplished by an exact, polynomial-time algorithm. We then correct for the number of extra fusion/fission operations required to make scaffolds comparable to full assemblies. We model the relationship between the ratio of missing genes actually absent from the genome versus merely unsequenced ones, on one hand, and the increase of genomic distance after scaffold filling, on the other. We estimate the parameters of this model through simulations and by comparing the angiosperm genomes Ricinus communis and Vitis vinifera. Conclusions The algorithm solves the comparison of genomes with 18,300 genes, including 4500 missing from one genome, in less than a minute on a MacBook, putting virtually all genomes within range of the method.

  8. Scaffold filling, contig fusion and comparative gene order inference.

    Science.gov (United States)

    Muñoz, Adriana; Zheng, Chunfang; Zhu, Qian; Albert, Victor A; Rounsley, Steve; Sankoff, David

    2010-06-04

    There has been a trend in increasing the phylogenetic scope of genome sequencing without finishing the sequence of the genome. Increasing numbers of genomes are being published in scaffold or contig form. Rearrangement algorithms, however, including gene order-based phylogenetic tools, require whole genome data on gene order or syntenic block order. How then can we use rearrangement algorithms to compare genomes available in scaffold form only? Can the comparative evidence predict the location of unsequenced genes? Our method involves optimally filling in genes missing from the scaffolds, while incorporating the augmented scaffolds directly into the rearrangement algorithms as if they were chromosomes. This is accomplished by an exact, polynomial-time algorithm. We then correct for the number of extra fusion/fission operations required to make scaffolds comparable to full assemblies. We model the relationship between the ratio of missing genes actually absent from the genome versus merely unsequenced ones, on one hand, and the increase of genomic distance after scaffold filling, on the other. We estimate the parameters of this model through simulations and by comparing the angiosperm genomes Ricinus communis and Vitis vinifera. The algorithm solves the comparison of genomes with 18,300 genes, including 4500 missing from one genome, in less than a minute on a MacBook, putting virtually all genomes within range of the method.

  9. The chicken embryo as an efficient model to test the function of muscle fusion genes in amniotes.

    Directory of Open Access Journals (Sweden)

    Daniel Sieiro

    Full Text Available The fusion of myoblasts into multinucleated myotubes is a crucial step of muscle growth during development and of muscle repair in the adult. While multiple genes were shown to play a role in this process, a vertebrate model where novel candidates can be tested and analyzed at high throughput and relative ease has been lacking. Here, we show that the early chicken embryo is a fast and robust model in which functional testing of muscle fusion candidate genes can be performed. We have used known modulators of muscle fusion, Rac1 and Cdc42, along with the in vivo electroporation of integrated, inducible vectors, to show that the chicken embryo is a suitable model in which their function can be tested and quantified. In addition to nuclei content, specific characteristics of the experimental model allow a fine characterization of additional morphological features that are nearly impossible to assess in other model organisms. This study should establish the chicken embryo as a cheap, reliable and powerful model in which novel vertebrate muscle fusion candidates can be evaluated.

  10. Non-fusion and fusion expression of beta-galactosidase from Lactobacillus bulgaricus in Lactococcus lactis.

    Science.gov (United States)

    Wang, Chuan; Zhang, Chao-Wu; Liu, Heng-Chuan; Yu, Qian; Pei, Xiao-Fang

    2008-10-01

    To construct four recombinant Lactococcus lactis strains exhibiting high beta-galactosidase activity in fusion or non-fusion ways, and to study the influence factors for their protein expression and secretion. The gene fragments encoding beta-galactosidase from two strains of Lactobacillus bulgaricus, wch9901 isolated from yogurt and 1.1480 purchased from the Chinese Academy of Sciences, were amplified and inserted into lactococcal expression vector pMG36e. For fusion expression, the open reading frame of the beta-galactosidase gene was amplified, while for non-fusion expression, the open reading frame of the beta-galactosidase gene was amplified with its native Shine-Dalgarno sequence upstream. The start codon of the beta-galactosidase gene partially overlapped with the stop codon of vector origin open reading frame. Then, the recombinant plasmids were transformed into Escherichia coli DH5 alpha and Lactococcus lactis subsp. lactis MG1363 and confirmed by determining beta-galactosidase activities. The non-fusion expression plasmids showed a significantly higher beta-galactosidase activity in transformed strains than the fusion expression plasmids. The highest enzyme activity was observed in Lactococcus lactis transformed with the non-fusion expression plasmids which were inserted into the beta-galactosidase gene from Lactobacillus bulgaricus wch9901. The beta-galactosidase activity was 2.75 times as high as that of the native counterpart. In addition, beta-galactosidase expressed by recombinant plasmids in Lactococcus lactis could be secreted into the culture medium. The highest secretion rate (27.1%) was observed when the culture medium contained 20 g/L of lactose. Different properties of the native bacteria may have some effects on the protein expression of recombinant plasmids. Non-fusion expression shows a higher enzyme activity in host bacteria. There may be a host-related weak secretion signal peptide gene within the structure gene of Lb. bulgaricus beta

  11. Measurement of the relative fraction of ttbar events produced via gluon fusion in ppbar collision at s**(1/2) = 1.96 TeV at CDF

    International Nuclear Information System (INIS)

    Yamaoka, Jared Andrew; Rutgers U., Piscataway

    2007-01-01

    In this thesis we present a measurement of the relative fraction of t(bar t) events produced via gluon-fusion to the total number of t(bar t) events. Using the kinematics of the production and decay of the top and antitop quark pair, we trained a Neural Network to discriminate the gluon-fusion events. The Neural Network was then used as a template to fit for the gluon-fusion fraction in data. Using a total integrated luminosity of 955 pb -1 we find σ(gg→t(bar t))/σ(p(bar p)→t(bar t)) < 0.33 at 68% confidence level and σ(gg→t(bar t))/σ(p(bar p)→t(bar t)) < 0.61 at 95% confidence level

  12. Fusion of the subunits α and β of succinyl-CoA synthetase as a phylogenetic marker for Pezizomycotina fungi

    Directory of Open Access Journals (Sweden)

    Amanda M. Koire

    2011-01-01

    Full Text Available Gene fusions, yielding the formation of multidomain proteins, are evolutionary events that can be utilized as phylogenetic markers. Here we describe a fusion gene comprising the α and β subunits of succinyl-coA synthetase, an enzyme of the TCA cycle, in Pezizomycotina fungi. This fusion is present in all Pezizomycotina with complete genome sequences and absent from all other organisms. Phylogenetic analysis of the α and β subunits of succinyl-CoA synthetase suggests that both subunits were duplicated and retained in Pezizomycotina while one copy was lost from other fungi. One of the duplicated copies was then fused in Pezizomycotina. Our results suggest that the fusion of the α and β subunits of succinyl-CoA synthetase can be used as a molecular marker for membership in the Pezizomycotina subphylum. If a species has the fusion it can be reliably classified as Pezizomycotina, while the absence of the fusion is suggestive that the species is not a member of this subphylum.

  13. Protection against California 2002 NDV strain afforded by adenovirus vectored vaccine expressing Fusion or Hemagglutination-neuraminidase genes

    Science.gov (United States)

    Vectored vaccines expressing the combination of the hemagglutinin-neuraminidase (HN) and fusion (F) genes generally have better clinical protection against Newcastle disease virus (NDV) than when either the F and HN genes are expressed alone. Interestingly, the protection induced by F is usually bet...

  14. A Protein Disulfide Isomerase Gene Fusion Expression System That Increases the Extracellular Productivity of Bacillus brevis

    Science.gov (United States)

    Kajino, Tsutomu; Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Udaka, Shigezo; Yamada, Yukio; Takahashi, Haruo

    2000-01-01

    We have developed a versatile Bacillus brevis expression and secretion system based on the use of fungal protein disulfide isomerase (PDI) as a gene fusion partner. Fusion with PDI increased the extracellular production of heterologous proteins (light chain of immunoglobulin G, 8-fold; geranylgeranyl pyrophosphate synthase, 12-fold). Linkage to PDI prevented the aggregation of the secreted proteins, resulting in high-level accumulation of fusion proteins in soluble and biologically active forms. We also show that the disulfide isomerase activity of PDI in a fusion protein is responsible for the suppression of the aggregation of the protein with intradisulfide, whereas aggregation of the protein without intradisulfide was prevented even when the protein was fused to a mutant PDI whose two active sites were disrupted, suggesting that another PDI function, such as chaperone-like activity, synergistically prevented the aggregation of heterologous proteins in the PDI fusion expression system. PMID:10653729

  15. Expanding the Molecular Signature of Ossifying Fibromyxoid Tumors with 2 Novel Gene Fusions: CREBBP-BCORL1 and KDM2A-WWTR1

    Science.gov (United States)

    Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R.

    2017-01-01

    Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CREBBP-BCORL1 fusion candidate in an axillary mass of a 51 year-old male and a KDM2A-WWTR1 in a thigh mass of a 36 year-old male. The gene fusions were validated by RT-PCR and FISH in the index cases and then screened by FISH on 4 additional OFMTs lacking known fusions. An identical CREBBP-BCORL1 fusion was found in an elbow tumor from a 30 year-old male. Both OFMTs with CREBBP-BCORL1 fusions had areas of typical OFMT morphology, exhibiting uniform round to epithelioid cells arranged in cords or nesting pattern in a fibromyxoid stroma. The OFMT with KDM2A-WWTR1 fusion involved dermis and superficial subcutis, being composed of ovoid cells in a fibromyxoid background with hyalinized giant rosettes. The S100 immunoreactivity ranged from very focal to absent. Similar to other known fusion genes in OFMT, BCORL1, CREBBP and KDM2A are also involved in histone modification. In summary, we expand the spectrum of molecular abnormalities in OFMT with 2 novel fusions, CREBBP-BCORL1 and KDM2A-WWTR1, further implicating the epigenetic deregulation as the leading pathogenetic mechanism in OFMT. PMID:27537276

  16. IGF1 is a common target gene of Ewing's sarcoma fusion proteins in mesenchymal progenitor cells.

    Directory of Open Access Journals (Sweden)

    Luisa Cironi

    Full Text Available BACKGROUND: The EWS-FLI-1 fusion protein is associated with 85-90% of Ewing's sarcoma family tumors (ESFT, the remaining 10-15% of cases expressing chimeric genes encoding EWS or FUS fused to one of several ets transcription factor family members, including ERG-1, FEV, ETV1 and ETV6. ESFT are dependent on insulin-like growth factor-1 (IGF-1 for growth and survival and recent evidence suggests that mesenchymal progenitor/stem cells constitute a candidate ESFT origin. METHODOLOGY/PRINCIPAL FINDINGS: To address the functional relatedness between ESFT-associated fusion proteins, we compared mouse progenitor cell (MPC permissiveness for EWS-FLI-1, EWS-ERG and FUS-ERG expression and assessed the corresponding expression profile changes. Whereas all MPC isolates tested could stably express EWS-FLI-1, only some sustained stable EWS-ERG expression and none could express FUS-ERG for more than 3-5 days. Only 14% and 4% of the total number of genes that were respectively induced and repressed in MPCs by the three fusion proteins were shared. However, all three fusion proteins, but neither FLI-1 nor ERG-1 alone, activated the IGF1 promoter and induced IGF1 expression. CONCLUSION/SIGNIFICANCE: Whereas expression of different ESFT-associated fusion proteins may require distinct cellular microenvironments and induce transcriptome changes of limited similarity, IGF1 induction may provide one common mechanism for their implication in ESFT pathogenesis.

  17. Dual-therapeutic reporter genes fusion for enhanced cancer gene therapy and imaging.

    Science.gov (United States)

    Sekar, T V; Foygel, K; Willmann, J K; Paulmurugan, R

    2013-05-01

    Two of the successful gene-directed enzyme prodrug therapies include herpes simplex virus-thymidine kinase (HSV1-TK) enzyme-ganciclovir prodrug and the Escherichia coli nitroreductase (NTR) enzyme-CB1954 prodrug strategies; these enzyme-prodrug combinations produce activated cytotoxic metabolites of the prodrugs capable of tumor cell death by inhibiting DNA synthesis and killing quiescent cells, respectively. Both these strategies also affect significant bystander cell killing of neighboring tumor cells that do not express these enzymes. We have developed a dual-combination gene strategy, where we identified HSV1-TK and NTR fused in a particular orientation can effectively kill tumor cells when the tumor cells are treated with a fusion HSV1-TK-NTR gene- along with a prodrug combination of GCV and CB1954. In order to determine whether the dual-system demonstrate superior therapeutic efficacy than either HSV1-TK or NTR systems alone, we conducted both in vitro and in vivo tumor xenograft studies using triple negative SUM159 breast cancer cells, by evaluating the efficacy of cell death by apoptosis and necrosis upon treatment with the dual HSV1-TK genes-GCV-CB1954 prodrugs system, and compared the efficiency to HSV1-TK-GCV and NTR-CB1954. Our cell-based studies, tumor regression studies in xenograft mice, histological analyses of treated tumors and bystander studies indicate that the dual HSV1-TK-NTR-prodrug system is two times more efficient even with half the doses of both prodrugs than the respective single gene-prodrug system, as evidenced by enhanced apoptosis and necrosis of tumor cells in vitro in culture and xenograft of tumor tissues in animals.

  18. Bioinformatic analysis of patient-derived ASPS gene expressions and ASPL-TFE3 fusion transcript levels identify potential therapeutic targets.

    Directory of Open Access Journals (Sweden)

    David G Covell

    Full Text Available Gene expression data, collected from ASPS tumors of seven different patients and from one immortalized ASPS cell line (ASPS-1, was analyzed jointly with patient ASPL-TFE3 (t(X;17(p11;q25 fusion transcript data to identify disease-specific pathways and their component genes. Data analysis of the pooled patient and ASPS-1 gene expression data, using conventional clustering methods, revealed a relatively small set of pathways and genes characterizing the biology of ASPS. These results could be largely recapitulated using only the gene expression data collected from patient tumor samples. The concordance between expression measures derived from ASPS-1 and both pooled and individual patient tumor data provided a rationale for extending the analysis to include patient ASPL-TFE3 fusion transcript data. A novel linear model was exploited to link gene expressions to fusion transcript data and used to identify a small set of ASPS-specific pathways and their gene expression. Cellular pathways that appear aberrantly regulated in response to the t(X;17(p11;q25 translocation include the cell cycle and cell adhesion. The identification of pathways and gene subsets characteristic of ASPS support current therapeutic strategies that target the FLT1 and MET, while also proposing additional targeting of genes found in pathways involved in the cell cycle (CHK1, cell adhesion (ARHGD1A, cell division (CDC6, control of meiosis (RAD51L3 and mitosis (BIRC5, and chemokine-related protein tyrosine kinase activity (CCL4.

  19. RNA-seq of 272 gliomas revealed a novel, recurrent PTPRZ1-MET fusion transcript in secondary glioblastomas.

    Science.gov (United States)

    Bao, Zhao-Shi; Chen, Hui-Min; Yang, Ming-Yu; Zhang, Chuan-Bao; Yu, Kai; Ye, Wan-Lu; Hu, Bo-Qiang; Yan, Wei; Zhang, Wei; Akers, Johnny; Ramakrishnan, Valya; Li, Jie; Carter, Bob; Liu, Yan-Wei; Hu, Hui-Min; Wang, Zheng; Li, Ming-Yang; Yao, Kun; Qiu, Xiao-Guang; Kang, Chun-Sheng; You, Yong-Ping; Fan, Xiao-Long; Song, Wei Sonya; Li, Rui-Qiang; Su, Xiao-Dong; Chen, Clark C; Jiang, Tao

    2014-11-01

    Studies of gene rearrangements and the consequent oncogenic fusion proteins have laid the foundation for targeted cancer therapy. To identify oncogenic fusions associated with glioma progression, we catalogued fusion transcripts by RNA-seq of 272 gliomas. Fusion transcripts were more frequently found in high-grade gliomas, in the classical subtype of gliomas, and in gliomas treated with radiation/temozolomide. Sixty-seven in-frame fusion transcripts were identified, including three recurrent fusion transcripts: FGFR3-TACC3, RNF213-SLC26A11, and PTPRZ1-MET (ZM). Interestingly, the ZM fusion was found only in grade III astrocytomas (1/13; 7.7%) or secondary GBMs (sGBMs, 3/20; 15.0%). In an independent cohort of sGBMs, the ZM fusion was found in three of 20 (15%) specimens. Genomic analysis revealed that the fusion arose from translocation events involving introns 3 or 8 of PTPRZ and intron 1 of MET. ZM fusion transcripts were found in GBMs irrespective of isocitrate dehydrogenase 1 (IDH1) mutation status. sGBMs harboring ZM fusion showed higher expression of genes required for PIK3CA signaling and lowered expression of genes that suppressed RB1 or TP53 function. Expression of the ZM fusion was mutually exclusive with EGFR overexpression in sGBMs. Exogenous expression of the ZM fusion in the U87MG glioblastoma line enhanced cell migration and invasion. Clinically, patients afflicted with ZM fusion harboring glioblastomas survived poorly relative to those afflicted with non-ZM-harboring sGBMs (P < 0.001). Our study profiles the shifting RNA landscape of gliomas during progression and reveled ZM as a novel, recurrent fusion transcript in sGBMs. © 2014 Bao et al.; Published by Cold Spring Harbor Laboratory Press.

  20. Expanding the molecular signature of ossifying fibromyxoid tumors with two novel gene fusions: CREBBP-BCORL1 and KDM2A-WWTR1.

    Science.gov (United States)

    Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R

    2017-01-01

    Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CREBBP-BCORL1 fusion candidate in an axillary mass of a 51 year-old male and a KDM2A-WWTR1 in a thigh mass of a 36 year-old male. The gene fusions were validated by RT-PCR and FISH in the index cases and then screened by FISH on 4 additional OFMTs lacking known fusions. An identical CREBBP-BCORL1 fusion was found in an elbow tumor from a 30 year-old male. Both OFMTs with CREBBP-BCORL1 fusions had areas of typical OFMT morphology, exhibiting uniform round to epithelioid cells arranged in cords or nesting pattern in a fibromyxoid stroma. The OFMT with KDM2A-WWTR1 fusion involved dermis and superficial subcutis, being composed of ovoid cells in a fibromyxoid background with hyalinized giant rosettes. The S100 immunoreactivity ranged from very focal to absent. Similar to other known fusion genes in OFMT, BCORL1, CREBBP and KDM2A are also involved in histone modification. In summary, we expand the spectrum of molecular abnormalities in OFMT with 2 novel fusions, CREBBP-BCORL1 and KDM2A-WWTR1, further implicating the epigenetic deregulation as the leading pathogenetic mechanism in OFMT. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. Mitochondrial fusion is increased by the nuclear coactivator PGC-1beta.

    Directory of Open Access Journals (Sweden)

    Marc Liesa

    Full Text Available There is no evidence to date on whether transcriptional regulators are able to shift the balance between mitochondrial fusion and fission events through selective control of gene expression.Here, we demonstrate that reduced mitochondrial size observed in knock-out mice for the transcriptional regulator PGC-1beta is associated with a selective reduction in Mitofusin 2 (Mfn2 expression, a mitochondrial fusion protein. This decrease in Mfn2 is specific since expression of the remaining components of mitochondrial fusion and fission machinery were not affected. Furthermore, PGC-1beta increases mitochondrial fusion and elongates mitochondrial tubules. This PGC-1beta-induced elongation specifically requires Mfn2 as this process is absent in Mfn2-ablated cells. Finally, we show that PGC-1beta increases Mfn2 promoter activity and transcription by coactivating the nuclear receptor Estrogen Related Receptor alpha (ERRalpha.Taken together, our data reveal a novel mechanism by which mammalian cells control mitochondrial fusion. In addition, we describe a novel role of PGC-1beta in mitochondrial physiology, namely the control of mitochondrial fusion mainly through Mfn2.

  2. Expanding the molecular toolbox for Lactococcus lactis: construction of an inducible thioredoxin gene fusion expression system

    LENUS (Irish Health Repository)

    Douillard, Francois P

    2011-08-09

    Abstract Background The development of the Nisin Inducible Controlled Expression (NICE) system in the food-grade bacterium Lactococcus lactis subsp. cremoris represents a cornerstone in the use of Gram-positive bacterial expression systems for biotechnological purposes. However, proteins that are subjected to such over-expression in L. lactis may suffer from improper folding, inclusion body formation and\\/or protein degradation, thereby significantly reducing the yield of soluble target protein. Although such drawbacks are not specific to L. lactis, no molecular tools have been developed to prevent or circumvent these recurrent problems of protein expression in L. lactis. Results Mimicking thioredoxin gene fusion systems available for E. coli, two nisin-inducible expression vectors were constructed to over-produce various proteins in L. lactis as thioredoxin fusion proteins. In this study, we demonstrate that our novel L. lactis fusion partner expression vectors allow high-level expression of soluble heterologous proteins Tuc2009 ORF40, Bbr_0140 and Tuc2009 BppU\\/BppL that were previously insoluble or not expressed using existing L. lactis expression vectors. Over-expressed proteins were subsequently purified by Ni-TED affinity chromatography. Intact heterologous proteins were detected by immunoblotting analyses. We also show that the thioredoxin moiety of the purified fusion protein was specifically and efficiently cleaved off by enterokinase treatment. Conclusions This study is the first description of a thioredoxin gene fusion expression system, purposely developed to circumvent problems associated with protein over-expression in L. lactis. It was shown to prevent protein insolubility and degradation, allowing sufficient production of soluble proteins for further structural and functional characterization.

  3. [Construction and prokaryotic expression of recombinant gene EGFRvIII HBcAg and immunogenicity analysis of the fusion protein].

    Science.gov (United States)

    Duan, Xiao-yi; Wang, Jian-sheng; Guo, You-min; Han, Jun-li; Wang, Quan-ying; Yang, Guang-xiao

    2007-01-01

    To construct recombinant prokaryotic expression plasmid pET28a(+)/c-PEP-3-c and evaluate the immunogenicity of the fusion protein. cDNA fragment encoding PEP-3 was obtained from pGEM-T Easy/PEP-3 and inserted into recombinant plasmid pGEMEX/HBcAg. Then it was subcloned in prokaryotic expression vector and transformed into E.coli BL21(DE3). The fusion protein was expressed by inducing IPTG and purified by Ni(2+)-NTA affinity chromatography. BALB/c mice were immunized with fusion protein and the antibody titre was determined by indirect ELISA. The recombinant gene was confirmed to be correct by restriction enzyme digestion and DNA sequencing. After prokaryotic expression, fusion protein existed in sediment and accounted for 56% of all bacterial lysate. The purified product accounted for 92% of all protein and its concentration was 8 g/L. The antibody titre in blood serum reached 1:16 000 after the fourth immunization and reached 1:2.56x10(5) after the sixth immunization. The titre of anti-PEP-3 antibody reached 1:1.28x10(5) and the titre of anti-HBcAg antibody was less than 1:4x10(3). Fusion gene PEP-3-HBcAg is highly expressed in E.coli BL21. The expressed fusion protein can induce neutralizing antibody with high titer and specificity, which lays a foundation for the study of genetically engineering vaccine for malignant tumors with the high expression of EGFRvIII.

  4. Targeting of a chimeric human histone fusion mRNA to membrane-bound polysomes in HeLa cells

    International Nuclear Information System (INIS)

    Zambetti, G.; Stein, J.; Stein, G.

    1987-01-01

    The subcellular location of histone mRNA-containing polysomes may play a key role in the posttranscriptional events that mediate histone mRNA turnover following inhibition of DNA synthesis. Previously, it has been shown that histone mRNA is found primarily on free polysomes that are associated with the cytoskeleton. The authors report here the construction of an Escherichia coli pBR322 β-lactamase signal peptide-human H3 histone fusion gene. The fusion transcript is targeted to membrane-bound polysomes and remains stable following interruption of DNA replication. Relocating mRNA within the cell may provide a procedure for studying the posttranscriptional regulation of gene expression

  5. [Eukaryotic expression of Leptospira interrogans lipL32/1-ompL1/1 fusion gene encoding genus-specific protein antigens and the immunoreactivity of expression products].

    Science.gov (United States)

    Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei

    2005-01-01

    To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific

  6. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Gene expression profiling of low-grade endometrial stromal sarcoma indicates fusion protein-mediated activation of the Wnt signaling pathway.

    Science.gov (United States)

    Przybyl, Joanna; Kidzinski, Lukasz; Hastie, Trevor; Debiec-Rychter, Maria; Nusse, Roel; van de Rijn, Matt

    2018-05-01

    Low-grade endometrial stromal sarcomas (LGESS) harbor chromosomal translocations that affect proteins associated with chromatin remodeling Polycomb Repressive Complex 2 (PRC2), including SUZ12, PHF1 and EPC1. Roughly half of LGESS also demonstrate nuclear accumulation of β-catenin, which is a hallmark of Wnt signaling activation. However, the targets affected by the fusion proteins and the role of Wnt signaling in the pathogenesis of these tumors remain largely unknown. Here we report the results of a meta-analysis of three independent gene expression profiling studies on LGESS and immunohistochemical evaluation of nuclear expression of β-catenin and Lef1 in 112 uterine sarcoma specimens obtained from 20 LGESS and 89 LMS patients. Our results demonstrate that 143 out of 310 genes overexpressed in LGESS are known to be directly regulated by SUZ12. In addition, our gene expression meta-analysis shows activation of multiple genes implicated in Wnt signaling. We further emphasize the role of the Wnt signaling pathway by demonstrating concordant nuclear expression of β-catenin and Lef1 in 7/16 LGESS. Based on our findings, we suggest that LGESS-specific fusion proteins disrupt the repressive function of the PRC2 complex similar to the mechanism seen in synovial sarcoma, where the SS18-SSX fusion proteins disrupt the mSWI/SNF (BAF) chromatin remodeling complex. We propose that these fusion proteins in LGESS contribute to overexpression of Wnt ligands with subsequent activation of Wnt signaling pathway and formation of an active β-catenin/Lef1 transcriptional complex. These observations could lead to novel therapeutic approaches that focus on the Wnt pathway in LGESS. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events

    Directory of Open Access Journals (Sweden)

    Tigst Demeke

    2018-05-01

    Full Text Available Droplet digital PCR (ddPCR has been used for absolute quantification of genetically engineered (GE events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences (HMG-I/Y, FatA(A, CruA and Ccf for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A, reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes. Keywords: Canola, Digital PCR, DNA extraction, GMO, Reference genes

  9. Development of time dependent safety analysis code for plasma anomaly events in fusion reactors

    International Nuclear Information System (INIS)

    Honda, Takuro; Okazaki, Takashi; Bartels, H.W.; Uckan, N.A.; Seki, Yasushi.

    1997-01-01

    A safety analysis code SAFALY has been developed to analyze plasma anomaly events in fusion reactors, e.g., a loss of plasma control. The code is a hybrid code comprising a zero-dimensional plasma dynamics and a one-dimensional thermal analysis of in-vessel components. The code evaluates the time evolution of plasma parameters and temperature distributions of in-vessel components. As the plasma-safety interface model, we proposed a robust plasma physics model taking into account updated data for safety assessment. For example, physics safety guidelines for beta limit, density limit and H-L mode confinement transition threshold power, etc. are provided in the model. The model of the in-vessel components are divided into twenty temperature regions in the poloidal direction taking account of radiative heat transfer between each surface of each region. This code can also describe the coolant behavior under hydraulic accidents with the results by hydraulics code and treat vaporization (sublimation) from plasma facing components (PFCs). Furthermore, the code includes the model of impurity transport form PFCs by using a transport probability and a time delay. Quantitative analysis based on the model is possible for a scenario of plasma passive shutdown. We examined the possibility of the code as a safety analysis code for plasma anomaly events in fusion reactors and had a prospect that it would contribute to the safety analysis of the International Thermonuclear Experimental Reactor (ITER). (author)

  10. [The Influence of New Medium with RGD on Cell Growth,Cell Fusion and Expression of Exogenous Gene].

    Science.gov (United States)

    Wang, Pei-Pei; Wei, Da-Peng; Zhu, Tong-Bo

    2018-03-01

    To investigate the influence of a new culture medium added with RGD on cell growth,cell fusion and expression of exogenous gene. A new medium was prepared by adding different concentrations of RGD to ordinary culture medium. The optimum concentration of RGD was determined by observation of the growth of human pancreatic epithelial cell line HPDE6-C7. After determining the optimum concentration of RGD,different concentrations of cells HPDE6-C7 (5×10 4 ,10 5 ,5×10 5 mL -1 ) were inoculated in the two mediums. The morphology,adherence,growth and density of the cells were observed by inverted microscope; The ratio of clone formation and the positive rate of cloning were compared between the two cultures after fusion; The fluorescence intensity after the transfection of plasmid with green fluorescent protein ( GFP ) and the protein expression after transfection of plasmid with KRAS were observed to campare the expression of exogenous genes between the new medium with ordinary medium. Firstly,the optimal concentration of RGD was 10 ng/mL. Compared with the normal medium,the cultured cells with RGD had better morphology,adhesion and faster proliferation. In addition,both of the number and positive rate of clones formed in the new medium were significantly higher than that in the ordinary medium ( P exogenous gene GFP in the new medium was significantly higher than that in normal medium ( P exogenous gene KRAS of the new medium was also significantly higher than that in normal medium. The new culture medium has highlighted advantages in cell growth,cell fusion and expression of exogenous genes. RGD peptide has widely prospect and potential value in the cell culture. Copyright© by Editorial Board of Journal of Sichuan University (Medical Science Edition).

  11. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

    Science.gov (United States)

    Demeke, Tigst; Eng, Monika

    2018-05-01

    Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

  12. Computational challenges in modeling gene regulatory events.

    Science.gov (United States)

    Pataskar, Abhijeet; Tiwari, Vijay K

    2016-10-19

    Cellular transcriptional programs driven by genetic and epigenetic mechanisms could be better understood by integrating "omics" data and subsequently modeling the gene-regulatory events. Toward this end, computational biology should keep pace with evolving experimental procedures and data availability. This article gives an exemplified account of the current computational challenges in molecular biology.

  13. Gene expression profiling analysis of CRTC1-MAML2 fusion oncogene-induced transcriptional program in human mucoepidermoid carcinoma cells

    International Nuclear Information System (INIS)

    Chen, Jie; Li, Jian-Liang; Chen, Zirong; Griffin, James D.; Wu, Lizi

    2015-01-01

    Mucoepidermoid carcinoma (MEC) arises from multiple organs and accounts for the most common types of salivary gland malignancies. Currently, patients with unresectable and metastatic MEC have poor long-term clinical outcomes and no targeted therapies are available. The majority of MEC tumors contain a t(11;19) chromosomal translocation that fuses two genes, CRTC1 and MAML2, to generate the chimeric protein CRTC1-MAML2. CRTC1-MAML2 displays transforming activity in vitro and is required for human MEC cell growth and survival, partially due to its ability to constitutively activate CREB-mediated transcription. Consequently, CRTC1-MAML2 is implicated as a major etiologic molecular event and a therapeutic target for MEC. However, the molecular mechanisms underlying CRTC1-MAML2 oncogenic action in MEC have not yet been systematically analyzed. Elucidation of the CRTC1-MAML2-regulated transcriptional program and its underlying mechanisms will provide important insights into MEC pathogenesis that are essential for the development of targeted therapeutics. Transcriptional profiling was performed on human MEC cells with the depletion of endogenous CRTC1-MAML2 fusion or its interacting partner CREB via shRNA-mediated gene knockdown. A subset of target genes was validated via real-time RT-PCR assays. CRTC1-MAML2-perturbed molecular pathways in MEC were identified through pathway analyses. Finally, comparative analysis of CRTC1-MAML2-regulated and CREB-regulated transcriptional profiles was carried out to assess the contribution of CREB in mediating CRTC1-MAML2-induced transcription. A total of 808 differentially expressed genes were identified in human MEC cells after CRTC1-MAML2 knockdown and a subset of known and novel fusion target genes was confirmed by real-time RT-PCR. Pathway Analysis revealed that CRTC1-MAML2-regulated genes were associated with network functions that are important for cell growth, proliferation, survival, migration, and metabolism. Comparison of CRTC

  14. Identification of target genes of synovial sarcoma-associated fusion oncoprotein using human pluripotent stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Hayakawa, Kazuo [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya (Japan); Ikeya, Makoto [Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Fukuta, Makoto [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya (Japan); Woltjen, Knut [Department of Reprogramming Sciences, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Tamaki, Sakura; Takahara, Naoko; Kato, Tomohisa; Sato, Shingo [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Otsuka, Takanobu [Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya (Japan); Toguchida, Junya, E-mail: togjun@frontier.kyoto-u.ac.jp [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Department of Orthopaedic Surgery, Graduate School of Medicine, Kyoto University, Kyoto (Japan)

    2013-03-22

    Highlights: ► We tried to identify targets of synovial sarcoma (SS)-associated SYT–SSX fusion gene. ► We established pluripotent stem cell (PSC) lines with inducible SYT–SSX gene. ► SYT–SSX responsive genes were identified by the induction of SYT–SSX in PSC. ► SS-related genes were selected from database by in silico analyses. ► 51 genes were finally identified among SS-related genes as targets of SYT–SSX in PSC. -- Abstract: Synovial sarcoma (SS) is a malignant soft tissue tumor harboring chromosomal translocation t(X; 18)(p11.2; q11.2), which produces SS-specific fusion gene, SYT–SSX. Although precise function of SYT–SSX remains to be investigated, accumulating evidences suggest its role in gene regulation via epigenetic mechanisms, and the product of SYT–SSX target genes may serve as biomarkers of SS. Lack of knowledge about the cell-of-origin of SS, however, has placed obstacle in the way of target identification. Here we report a novel approach to identify SYT–SSX2 target genes using human pluripotent stem cells (hPSCs) containing a doxycycline-inducible SYT–SSX2 gene. SYT–SSX2 was efficiently induced both at mRNA and protein levels within three hours after doxycycline administration, while no morphological change of hPSCs was observed until 24 h. Serial microarray analyses identified genes of which the expression level changed more than twofold within 24 h. Surprisingly, the majority (297/312, 95.2%) were up-regulated genes and a result inconsistent with the current concept of SYT–SSX as a transcriptional repressor. Comparing these genes with SS-related genes which were selected by a series of in silico analyses, 49 and 2 genes were finally identified as candidates of up- and down-regulated target of SYT–SSX, respectively. Association of these genes with SYT–SSX in SS cells was confirmed by knockdown experiments. Expression profiles of SS-related genes in hPSCs and human mesenchymal stem cells (hMSCs) were strikingly

  15. Imaging transient blood vessel fusion events in zebrafish by correlative volume electron microscopy.

    Directory of Open Access Journals (Sweden)

    Hannah E J Armer

    Full Text Available The study of biological processes has become increasingly reliant on obtaining high-resolution spatial and temporal data through imaging techniques. As researchers demand molecular resolution of cellular events in the context of whole organisms, correlation of non-invasive live-organism imaging with electron microscopy in complex three-dimensional samples becomes critical. The developing blood vessels of vertebrates form a highly complex network which cannot be imaged at high resolution using traditional methods. Here we show that the point of fusion between growing blood vessels of transgenic zebrafish, identified in live confocal microscopy, can subsequently be traced through the structure of the organism using Focused Ion Beam/Scanning Electron Microscopy (FIB/SEM and Serial Block Face/Scanning Electron Microscopy (SBF/SEM. The resulting data give unprecedented microanatomical detail of the zebrafish and, for the first time, allow visualization of the ultrastructure of a time-limited biological event within the context of a whole organism.

  16. Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene

    International Nuclear Information System (INIS)

    Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo

    2006-01-01

    In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains

  17. Superficial EWSR1-negative undifferentiated small round cell sarcoma with CIC/DUX4 gene fusion: a new variant of Ewing-like tumors with locoregional lymph node metastasis.

    Science.gov (United States)

    Machado, Isidro; Cruz, Julia; Lavernia, Javier; Rubio, Luis; Campos, Jorge; Barrios, María; Grison, Camille; Chene, Virginie; Pierron, Gaelle; Delattre, Olivier; Llombart-Bosch, Antonio

    2013-12-01

    The present study describes a new case of EWSR1-negative undifferentiated sarcoma with CIC/DUX4 gene fusion. This case is similar to tumors described as primitive undifferentiated round cell sarcomas that occur mainly in the trunk and display an aggressive behavior. To our knowledge, this is the first report of such a tumor presenting locoregional lymph node metastasis. In view of previous studies that prove the existence of a particular variant of undifferentiated sarcoma with Ewing-like morphology and CIC/DUX-4 gene fusion, a search for this gene fusion in all undifferentiated round cell sarcomas should be considered if a conclusive diagnosis cannot be reached following other conventional studies. Although additional cases with more extensive follow-up studies are needed, we believe that EWSR1-negative undifferentiated small round cell sarcoma with CIC/DUX4 gene fusion should be added to the list of new sarcoma variants with the possibility of lymph node metastasis.

  18. Fusion of Nonionic Vesicles

    DEFF Research Database (Denmark)

    Bulut, Sanja; Oskolkova, M. Z.; Schweins, R.

    2010-01-01

    We present an experimental study of vesicle fusion using light and neutron scattering to monitor fusion events. Vesicles are reproducibly formed with an extrusion procedure using an single amphiphile triethylene glycol mono-n-decyl ether in water. They show long-term stability for temperatures ar...... a barrier to fusion changing from 15 k(B)T at T = 26 degrees C to 10k(H) T at T = 35 degrees C. These results are compatible with the theoretical predictions using the stalk model of vesicle fusion....

  19. Novel exon-exon breakpoint in CIC-DUX4 fusion sarcoma identified by anchored multiplex PCR (Archer FusionPlex Sarcoma Panel).

    Science.gov (United States)

    Loke, Benjamin Nathanael; Lee, Victor Kwan Min; Sudhanshi, Jain; Wong, Meng Kang; Kuick, Chik Hong; Puhaindran, Mark; Chang, Kenneth Tou En

    2017-08-01

    We describe the clinical and pathological features and novel genetic findings of a case of CIC-DUX4 sarcoma occurring in the thigh of a 35-year-old man. Fusion gene detection using a next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) was used to identify the novel fusion breakpoints of this CIC-DUX4 sarcoma using formalin-fixed and paraffin-embedded tumour material. This CIC-DUX4 sarcoma has a novel fusion breakpoint between exon 20 of the CIC gene and exon 1 of the DUX4 gene. This case report describes an additional case of CIC-DUX4 sarcoma with a novel fusion breakpoint, and demonstrates the value of this next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) in both diagnosis for patient care and in identification of a novel fusion breakpoint in this tumour type. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  20. Persistence of TEL-AML1 fusion gene as minimal residual disease has no additive prognostic value in CD 10 positive B-acute lymphoblastic leukemia: a FISH study

    Directory of Open Access Journals (Sweden)

    Ezz-Eldin Azza M

    2008-10-01

    Full Text Available Abstract Objectives We have analyzed t(12;21(p13:q22 in an attempt to evaluate the frequency and prognostic significance of TEL-AML1 fusion gene in patients with childhood CD 10 positive B-ALL by fluorescence in situ hybridization (FISH. Also, we have monitored the prognostic value of this gene as a minimal residual disease (MRD. Methods All bone marrow samples of eighty patients diagnosed as CD 10 positive B-ALL in South Egypt Cancer Institute were evaluated by fluorescence in situ hybridization (FISH for t(12;21 in newly diagnosed cases and after morphological complete remission as a minimal residual disease (MRD. We determined the prognostic significance of TEL-AML1 fusion represented by disease course and survival. Results TEL-AML1 fusion gene was positive in (37.5% in newly diagnosed patients. There was a significant correlation between TEL-AML1 fusion gene both at diagnosis (r = 0.5, P = 0.003 and as a MRD (r = 0.4, P = 0.01 with favorable course. Kaplan-Meier curve for the presence of TEL-AML1 fusion at the diagnosis was associated with a better probability of overall survival (OS; mean survival time was 47 ± 1 month, in contrast to 28 ± 5 month in its absence (P = 0.006. Also, the persistence at TEL-AML1 fusion as a MRD was not significantly associated with a better probability of OS; the mean survival time was 42 ± 2 months in the presence of MRD and it was 40 ± 1 months in its absence. So, persistence of TEL-AML1 fusion as a MRD had no additive prognostic value over its measurement at diagnosis in terms of predicting the probability of OS. Conclusion For most patients, the presence of TEL-AML1 fusion gene at diagnosis suggests a favorable prognosis. The present study suggests that persistence of TEL-AML1 fusion as MRD has no additive prognostic value.

  1. CRISPR/Cas9 Engineering of Adult Mouse Liver Demonstrates That the Dnajb1-Prkaca Gene Fusion Is Sufficient to Induce Tumors Resembling Fibrolamellar Hepatocellular Carcinoma.

    Science.gov (United States)

    Engelholm, Lars H; Riaz, Anjum; Serra, Denise; Dagnæs-Hansen, Frederik; Johansen, Jens V; Santoni-Rugiu, Eric; Hansen, Steen H; Niola, Francesco; Frödin, Morten

    2017-12-01

    Fibrolamellar hepatocellular carcinoma (FL-HCC) is a primary liver cancer that predominantly affects children and young adults with no underlying liver disease. A somatic, 400 Kb deletion on chromosome 19 that fuses part of the DnaJ heat shock protein family (Hsp40) member B1 gene (DNAJB1) to the protein kinase cAMP-activated catalytic subunit alpha gene (PRKACA) has been repeatedly identified in patients with FL-HCC. However, the DNAJB1-PRKACA gene fusion has not been shown to induce liver tumorigenesis. We used the CRISPR/Cas9 technique to delete in mice the syntenic region on chromosome 8 to create a Dnajb1-Prkaca fusion and monitored the mice for liver tumor development. We delivered CRISPR/Cas9 vectors designed to juxtapose exon 1 of Dnajb1 with exon 2 of Prkaca to create the Dnajb1-Prkaca gene fusion associated with FL-HCC, or control Cas9 vector, via hydrodynamic tail vein injection to livers of 8-week-old female FVB/N mice. These mice did not have any other engineered genetic alterations and were not exposed to liver toxins or carcinogens. Liver tissues were collected 14 months after delivery; genomic DNA was analyzed by PCR to detect the Dnajb1-Prkaca fusion, and tissues were characterized by histology, immunohistochemistry, RNA sequencing, and whole-exome sequencing. Livers from 12 of the 15 mice given the vectors to induce the Dnajb1-Prkaca gene fusion, but none of the 11 mice given the control vector, developed neoplasms. The tumors contained the Dnajb1-Prkaca gene fusion and had histologic and cytologic features of human FL-HCCs: large polygonal cells with granular, eosinophilic, and mitochondria-rich cytoplasm, prominent nucleoli, and markers of hepatocytes and cholangiocytes. In comparing expression levels of genes between the mouse tumor and non-tumor liver cells, we identified changes similar to those detected in human FL-HCC, which included genes that affect cell cycle and mitosis regulation. Genomic analysis of mouse neoplasms induced by

  2. Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

    Science.gov (United States)

    Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

    2015-05-15

    Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

  3. Mycobacterium tuberculosis HspX/EsxS Fusion Protein: Gene Cloning, Protein Expression, and Purification in Escherichia coli.

    Science.gov (United States)

    Khademi, Farzad; Yousefi-Avarvand, Arshid; Derakhshan, Mohammad; Meshkat, Zahra; Tafaghodi, Mohsen; Ghazvini, Kiarash; Aryan, Ehsan; Sankian, Mojtaba

    2017-10-01

    The purpose of this study was to clone, express, and purify a novel multidomain fusion protein of Micobacterium tuberculosis (Mtb) in a prokaryotic system. An hspX/esxS gene construct was synthesized and ligated into a pGH plasmid, E. coli TOP10 cells were transformed, and the vector was purified. The vector containing the construct and pET-21b (+) plasmid were digested with the same enzymes and the construct was ligated into pET-21b (+). The accuracy of cloning was confirmed by colony PCR and sequencing. E. coli BL21 cells were transformed with the pET-21b (+)/hspX/esxS expression vector and protein expression was evaluated. Finally, the expressed fusion protein was purified on a Ni-IDA column and verified by SDS-PAGE and western blotting. The hspX/esxS gene construct was inserted into pET-21b (+) and recombinant protein expression was induced with IPTG in E. coli BL21 cells. Various concentrations of IPTG were tested to determine the optimum concentration for expression induction. The recombinant protein was expressed in insoluble inclusion bodies. Three molar guanidine HCl was used to solubilize the insoluble protein. An HspX/EsxS Mtb fusion protein was expressed in E. coli and the recombinant protein was purified. After immunological analysis, the HspX/EsxS fusion protein might be an anti-tuberculosis vaccine candidate in future clinical trial studies.

  4. DNA Amplification by Breakage/Fusion/Bridge Cycles Initiated by Spontaneous Telomere Loss in a Human Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Anthony W.l. Lo

    2002-01-01

    Full Text Available The development of genomic instability is an important step in generatingthe multiple genetic changes required for cancer. One consequence of genomic instability is the overexpression of oncogenes due to gene amplification. One mechanism for gene amplification is the breakagelfusionlbridge (B/F/Bcyclethatinvolvesthe repeated fusion and breakage of chromosomes following the loss of a telomere. B/F/B cycles have been associated with low-copy gene amplification in human cancer cells, and have been proposed to be an initiating event in high-copy gene amplification. We have found that spontaneous telomere loss on a marker chromosome 16 in a human tumor cell line results in sister chromatid fusion and prolonged periods of chromosome instability. The high rate of anaphase bridges involving chromosome 16 demonstrates that this instability results from B/F/B cycles. The amplification of subtelomeric DNA on the marker chromosome provides conclusive evidence that B/F/B cycles initiated by spontaneous telomere loss are a mechanism for gene amplification in human cancer cells.

  5. Highly efficient retrograde gene transfer into motor neurons by a lentiviral vector pseudotyped with fusion glycoprotein.

    Directory of Open Access Journals (Sweden)

    Miyabi Hirano

    Full Text Available The development of gene therapy techniques to introduce transgenes that promote neuronal survival and protection provides effective therapeutic approaches for neurological and neurodegenerative diseases. Intramuscular injection of adenoviral and adeno-associated viral vectors, as well as lentiviral vectors pseudotyped with rabies virus glycoprotein (RV-G, permits gene delivery into motor neurons in animal models for motor neuron diseases. Recently, we developed a vector with highly efficient retrograde gene transfer (HiRet by pseudotyping a human immunodeficiency virus type 1 (HIV-1-based vector with fusion glycoprotein B type (FuG-B or a variant of FuG-B (FuG-B2, in which the cytoplasmic domain of RV-G was replaced by the corresponding part of vesicular stomatitis virus glycoprotein (VSV-G. We have also developed another vector showing neuron-specific retrograde gene transfer (NeuRet with fusion glycoprotein C type, in which the short C-terminal segment of the extracellular domain and transmembrane/cytoplasmic domains of RV-G was substituted with the corresponding regions of VSV-G. These two vectors afford the high efficiency of retrograde gene transfer into different neuronal populations in the brain. Here we investigated the efficiency of the HiRet (with FuG-B2 and NeuRet vectors for retrograde gene transfer into motor neurons in the spinal cord and hindbrain in mice after intramuscular injection and compared it with the efficiency of the RV-G pseudotype of the HIV-1-based vector. The main highlight of our results is that the HiRet vector shows the most efficient retrograde gene transfer into both spinal cord and hindbrain motor neurons, offering its promising use as a gene therapeutic approach for the treatment of motor neuron diseases.

  6. Rho GTPase activity modulates paramyxovirus fusion protein-mediated cell-cell fusion

    International Nuclear Information System (INIS)

    Schowalter, Rachel M.; Wurth, Mark A.; Aguilar, Hector C.; Lee, Benhur; Moncman, Carole L.; McCann, Richard O.; Dutch, Rebecca Ellis

    2006-01-01

    The paramyxovirus fusion protein (F) promotes fusion of the viral envelope with the plasma membrane of target cells as well as cell-cell fusion. The plasma membrane is closely associated with the actin cytoskeleton, but the role of actin dynamics in paramyxovirus F-mediated membrane fusion is unclear. We examined cell-cell fusion promoted by two different paramyxovirus F proteins in three cell types in the presence of constitutively active Rho family GTPases, major cellular coordinators of actin dynamics. Reporter gene and syncytia assays demonstrated that expression of either Rac1 V12 or Cdc42 V12 could increase cell-cell fusion promoted by the Hendra or SV5 glycoproteins, though the effect was dependent on the cell type expressing the viral glycoproteins. In contrast, RhoA L63 decreased cell-cell fusion promoted by Hendra glycoproteins but had little affect on SV5 F-mediated fusion. Also, data suggested that GTPase activation in the viral glycoprotein-containing cell was primarily responsible for changes in fusion. Additionally, we found that activated Cdc42 promoted nuclear rearrangement in syncytia

  7. Combinatorial events of insertion sequences and ICE in Gram-negative bacteria.

    Science.gov (United States)

    Toleman, Mark A; Walsh, Timothy R

    2011-09-01

    The emergence of antibiotic and antimicrobial resistance in Gram-negative bacteria is incremental and linked to genetic elements that function in a so-called 'one-ended transposition' manner, including ISEcp1, ISCR elements and Tn3-like transposons. The power of these elements lies in their inability to consistently recognize one of their own terminal sequences, while recognizing more genetically distant surrogate sequences. This has the effect of mobilizing the DNA sequence found adjacent to their initial location. In general, resistance in Gram-negatives is closely linked to a few one-off events. These include the capture of the class 1 integron by a Tn5090-like transposon; the formation of the 3' conserved segment (3'-CS); and the fusion of the ISCR1 element to the 3'-CS. The structures formed by these rare events have been massively amplified and disseminated in Gram-negative bacteria, but hitherto, are rarely found in Gram-positives. Such events dominate current resistance gene acquisition and are instrumental in the construction of large resistance gene islands on chromosomes and plasmids. Similar combinatorial events appear to have occurred between conjugative plasmids and phages constructing hybrid elements called integrative and conjugative elements or conjugative transposons. These elements are beginning to be closely linked to some of the more powerful resistance mechanisms such as the extended spectrum β-lactamases, metallo- and AmpC type β-lactamases. Antibiotic resistance in Gram-negative bacteria is dominated by unusual combinatorial mistakes of Insertion sequences and gene fusions which have been selected and amplified by antibiotic pressure enabling the formation of extended resistance islands. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  8. Comparative Assessment of Induced Immune Responses Following Intramuscular Immunization with Fusion and Cocktail of LeIF, LACK and TSA Genes Against Cutaneous Leishmaniasis in BALB/c Mice.

    Science.gov (United States)

    Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

    2018-02-01

    In the present study, we evaluated induced immune responses following DNA vaccine containing cocktail or fusion of LeIF, LACK and TSA genes or each gene alone. Mice were injected with 100 µg of each plasmid containing the gene of insert, plasmid DNA alone as the first control group or phosphate buffer saline as the second control group. Then, cellular and humoral responses, lesion size were measured for all groups. All vaccinated mice induced Th1 immune responses against Leishmania characterized by higher IFN-γ and IgG2a levels compared with control groups (p < 0.05). In addition, IFN-γ levels increased in groups immunized with fusion and cocktail vaccines in comparison with LACK (p < 0.001) and LeIF (p < 0.01) groups after challenge. In addition, fusion and cocktail groups produced higher IgG2a values than groups vaccinated with a gene alone (p < 0.05). Lesion progression delayed for all immunized groups compared with control groups from 5th week post-infection (p < 0.05). Mean lesion size decreased in immunized mice with fusion DNA than three groups vaccinated with one gene alone (p < 0.05). While, lesion size decreased significantly in cocktail recipient group than LeIF recipient group (p < 0.05). There was no difference in lesion size between fusion and cocktail groups. Overall, immunized mice with cocktail and fusion vaccines showed stronger Th1 response by production of higher IFN-γ and IgG2a and showed smaller mean lesion size. Therefore, use of multiple antigens can improve induced immune responses by DNA vaccination.

  9. Association of a Chromosomal Rearrangement Event with Mouse Posterior Polymorphous Corneal Dystrophy and Alterations in Csrp2bp, Dzank1, and Ovol2 Gene Expression.

    Directory of Open Access Journals (Sweden)

    Anna L Shen

    Full Text Available We have previously described a mouse model of human posterior polymorphous corneal dystrophy (PPCD and localized the causative mutation to a 6.2 Mbp region of chromosome 2, termed Ppcd1. We now show that the gene rearrangement linked to mouse Ppcd1 is a 3.9 Mbp chromosomal inversion flanked by 81 Kbp and 542 bp deletions. This recombination event leads to deletion of Csrp2bp Exons 8 through 11, Dzank1 Exons 20 and 21, and the pseudogene Znf133. In addition, we identified translocation of novel downstream sequences to positions adjacent to Csrp2bp Exon 7 and Dzank1 Exon 20. Twelve novel fusion transcripts involving Csrp2bp or Dzank1 linked to downstream sequences have been identified. Eight are expressed at detectable levels in PPCD1 but not wildtype eyes. Upregulation of two Csrp2bp fusion transcripts, as well as upregulation of the adjacent gene, Ovol2, was observed. Absence of the PPCD1 phenotype in animals haploinsufficient for Csrp2bp or both Csrp2bp and Dzank1 rules out haploinsufficiency of these genes as a cause of mouse PPCD1. Complementation experiments confirm that PPCD1 embryonic lethality is due to disruption of Csrp2bp expression. The ocular expression pattern of Csrp2bp is consistent with a role for this protein in corneal development and pathogenesis of PPCD1.

  10. The elementary fusion modalities of osteoclasts

    DEFF Research Database (Denmark)

    Søe, Kent; Hobolt-Pedersen, Anne Sofie; Delaisse, Jean Marie

    2015-01-01

    , are not known for the osteoclast. Here we show that osteoclast fusion partners are characterized by differences in mobility, nuclearity, and differentiation level. Our demonstration was based on time-laps videos of human osteoclast preparations from three donors where 656 fusion events were analyzed. Fusions......The last step of the osteoclast differentiation process is cell fusion. Most efforts to understand the fusion mechanism have focused on the identification of molecules involved in the fusion process. Surprisingly, the basic fusion modalities, which are well known for fusion of other cell types...... between a mobile and an immobile partner were most frequent (62%), while fusion between two mobile (26%) or two immobile partners (12%) was less frequent (p fusion partner contained more nuclei than the mobile one (p

  11. Bone marrow mesenchymal stem cells from infants with MLL-AF4+ acute leukemia harbor and express the MLL-AF4 fusion gene

    Science.gov (United States)

    Catalina, Purificación; Rodríguez, René; Melen, Gustavo J.; Bueno, Clara; Arriero, Mar; García-Sánchez, Félix; Lassaletta, Alvaro; García-Sanz, Ramón

    2009-01-01

    MLL-AF4 fusion is a hallmark genetic abnormality in infant B-acute lymphoblastic leukemia (B-ALL) known to arise in utero. The cellular origin of leukemic fusion genes during human development is difficult to ascertain. The bone marrow (BM) microenvironment plays an important role in the pathogenesis of several hematological malignances. BM mesenchymal stem cells (BM-MSC) from 38 children diagnosed with cytogenetically different acute leukemias were screened for leukemic fusion genes. Fusion genes were absent in BM-MSCs of childhood leukemias carrying TEL-AML1, BCR-ABL, AML1-ETO, MLL-AF9, MLL-AF10, MLL-ENL or hyperdiploidy. However, MLL-AF4 was detected and expressed in BM-MSCs from all cases of MLL-AF4+ B-ALL. Unlike leukemic blasts, MLL-AF4+ BM-MSCs did not display monoclonal Ig gene rearrangements. Endogenous or ectopic expression of MLL-AF4 exerted no effect on MSC culture homeostasis. These findings suggest that MSCs may be in part tumor-related, highlighting an unrecognized role of the BM milieu on the pathogenesis of MLL-AF4+ B-ALL. MLL-AF4 itself is not sufficient for MSC transformation and the expression of MLL-AF4 in MSCs is compatible with a mesenchymal phenotype, suggesting a differential impact in the hematopoietic system and mesenchyme. The absence of monoclonal rearrangements in MLL-AF4+ BM-MSCs precludes the possibility of cellular plasticity or de-differentiation of B-ALL blasts and suggests that MLL-AF4 might arise in a population of prehematopoietic precursors. PMID:19995953

  12. Radiological consequences of a bounding event sequence of Advanced Fusion Neutron Source (A-FNS)

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Makoto M., E-mail: nakamura.makoto@qst.go.jp; Ochiai, Kentaro

    2017-05-15

    Advanced Fusion Neutron Source (A-FNS) is an accelerator-based neutron source utilizing Li(d,xn) nuclear stripping reactions to simulate D-T fusion neutrons for testing and qualifying structural and functional materials of fusion reactor components, which is to be constructed at the Rokkasho site of National Institutes for Quantum and Radiological Science and Technology, Japan, in the near future. The purpose of the study reported here is to demonstrate the ultimate safety margins of A-FNS in the worst case of release of radioactive materials outside the A-FNS confinement system. For this purpose, we analyzed a ‘bounding event’ postulated in A-FNS. The postulated event sequence consists of fire of the purification system of the liquid Li loop during the maintenance, of mobilization of the tritium and {sup 7}Be, which are the impurities of the loop, and of the entire loss of confinement of the radioactive materials. We have calculated the early doses to the public due to the release of the tritium and {sup 7}Be source terms to the environment. The UFOTRI/COSYMA simulations have been performed considering the site boundary of 500 m away from the facility. The obtained results indicate that the early dose is below the level that requires the emergent public evacuation. Such results demonstrate that the A-FNS complies with the defined safety objective against its radiation hazard. The simulation results suggest that the inherent, ultimate safety characteristic found by this study may assist a licensing process for installation of A-FNS.

  13. Genetic variability available through cell fusion

    Energy Technology Data Exchange (ETDEWEB)

    Smith, H.H.; Mastrangelo-Hough, I.A.

    1977-01-01

    Results are reported for the following studies: plant hybridization through protoplast fusion using species of Nicotiana and Petunia; chromosome instability studies on culture-induced chromosome changes and chromosome elimination; chloroplast distribution in parasexual hybrids; chromosomal introgression following fusion; plant-animal fusion; and microcell-mediated chromosome transfer and chromosome-mediated gene transfer. (HLW)

  14. A case of lung adenocarcinoma harboring EGFR mutation and EML4-ALK fusion gene

    International Nuclear Information System (INIS)

    Tanaka, Hisashi; Hayashi, Akihito; Morimoto, Takeshi; Taima, Kageaki; Tanaka, Yoshihito; Shimada, Michiko; Kurose, Akira; Takanashi, Shingo; Okumura, Ken

    2012-01-01

    Lung cancer is the leading cause of cancer-related death worldwide. Epidermal growth factor receptor (EGFR) - tyrosine kinase inhibitor (TKI) is used for the patients with EGFR-mutant lung cancer. Recently, phase III studies in the patients with EGFR-mutant demonstrated that EGFR-TKI monotherapy improved progression-free survival compared with platinum-doublet chemotherapy. The echinoderm microtubule-associated protein-like 4 (EML4) - anaplastic lymphoma kinase (ALK) fusion oncogene represents one of the newest molecular targets in non-small cell lung cancer (NSCLC). Patients who harbor EML4-ALK fusions have been associated with a lack of EGFR or KRAS mutations. We report a 39-year-old patient diagnosed as adenocarcinoma harboring EGFR mutation and EML4-ALK fusion gene. We treated this patient with erlotinib as the third line therapy, but no clinical benefit was obtained. We experienced a rare case with EGFR mutation and EML4-ALK. Any clinical benefit using EGFR-TKI was not obtained in our case. The therapeutic choice for the patients with more than one driver mutations is unclear. We needs further understanding of the lung cancer molecular biology and the biomarker infomation

  15. Gene conversion and reversion events in Saccharomyces cerevisiae. Model for study of gamma radiation damage

    International Nuclear Information System (INIS)

    Moreno, Damaris; Fuentes, Jorge L.; Prieto Miranda, Enrique F.; Sanchez Lamar, Angel; Baluja, Ligia

    2004-01-01

    Radiosensitivity and kinetics of induction of gene conversion and reversion events in Saccharomyces cerevisiae strain D7 to gamma radiation at dose ranges from 100 to 800 Gy and 50 to 300 Gy respectively were studied. A source of 60Co PX- -30 at a dose rate of 49,43 GY/min was utilized. The cell survival curve showed DL50 of 150 Gy. Cell death kinetics was linear and adjusted over 98 %. The induction of gene conversion events was significant in relation to control from 50 Gy on. However, gene reversion was significant only at 200 Gy. Generally speaking, gene conversion event frequencies were higher than those of reversion, which indicates that gamma radiation preferably induces recombinogenic events. Both the conversion and reversion events showed exponential dependence on gamma radiation dose. The relative benefits of this test for mutagenesis and anti-mutagenesis studies were debated in this paper

  16. CRISPR/Cas9 Engineering of Adult Mouse Liver Demonstrates That the Dnajb1–Prkaca Gene Fusion Is Sufficient to Induce Tumors Resembling Fibrolamellar Hepatocellular Carcinoma

    DEFF Research Database (Denmark)

    Engelholm, Lars H.; Riaz, Anjum; Serra, Denise

    2017-01-01

    Background & Aims Fibrolamellar hepatocellular carcinoma (FL-HCC) is a primary liver cancer that predominantly affects children and young adults with no underlying liver disease. A somatic, 400 Kb deletion on chromosome 19 that fuses part of the DnaJ heat shock protein family (Hsp40) member B1 gene...... (DNAJB1) to the protein kinase cAMP-activated catalytic subunit alpha gene (PRKACA) has been repeatedly identified in patients with FL-HCC. However, the DNAJB1–PRKACA gene fusion has not been shown to induce liver tumorigenesis. We used the CRISPR/Cas9 technique to delete in mice the syntenic region...... on chromosome 8 to create a Dnajb1–Prkaca fusion and monitored the mice for liver tumor development. Methods We delivered CRISPR/Cas9 vectors designed to juxtapose exon 1 of Dnajb1 with exon 2 of Prkaca to create the Dnajb1–Prkaca gene fusion associated with FL-HCC, or control Cas9 vector, via hydrodynamic tail...

  17. A distributed real-time system for event-driven control and dynamic data acquisition on a fusion plasma experiment

    International Nuclear Information System (INIS)

    Sousa, J.; Combo, A.; Batista, A.; Correia, M.; Trotman, D.; Waterhouse, J.; Varandas, C.A.F.

    2000-01-01

    A distributed real-time trigger and timing system, designed in a tree-type topology and implemented in VME and CAMAC versions, has been developed for a magnetic confinement fusion experiment. It provides sub-microsecond time latencies for the transport of small data objects allowing event-driven discharge control with failure counteraction, dynamic pre-trigger sampling and event recording as well as accurate simultaneous triggers and synchronism on all nodes with acceptable optimality and predictability of timeliness. This paper describes the technical characteristics of the hardware components (central unit composed by one or more reflector crates, event and synchronism reflector cards, event and pulse node module, fan-out and fan-in modules) as well as software for both tests and integration on a global data acquisition system. The results of laboratory operation for several configurations and the overall performance of the system are presented and analysed

  18. Perspective on the fusion-fission energy concept

    International Nuclear Information System (INIS)

    Liikala, R.C.; Perry, R.T.; Teofilo, V.L.

    1978-01-01

    A concept which has potential for near-term application in the electric power sector of our energy economy is combining fusion and fission technology. The fusion-fission system, called a hybrid, is distinguished from its pure fusion counterpart by incorporation of fertile materials (uranium or thorium) in the blanket region of a fusion machine. The neutrons produced by the fusion process can be used to generate energy through fission events in the blanket or produce fuel for fission reactors through capture events in the fertile material. The performance requirements of the fusion component of hybrids is perceived as being less stringent than those for pure fusion electric power plants. The performance requirements for the fission component of hybrids is perceived as having been demonstrated or could be demonstrated with a modest investment of research and development funds. This paper presents our insights and observations of this concept in the context of why and where it might fit into the picture of meeting our future energy needs. A bibliography of hybrid research is given

  19. Conservation of transcription factor binding events predicts gene expression across species

    Science.gov (United States)

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661

  20. Characterization of foot-and-mouth disease virus gene products with antisera against bacterially synthesized fusion proteins

    International Nuclear Information System (INIS)

    Strebel, K.; Beck, E.; Strohmaier, K.; Schaller, H.

    1986-01-01

    Defined segments of the cloned foot-and-mouth disease virus genome corresponding to all parts of the coding region were expressed in Escherichia coli as fusions to the N-terminal part of the MS2-polymerase gene under the control of the inducible λPL promoter. All constructs yielded large amounts of proteins, which were purified and used to raise sequence-specific antisera in rabbits. These antisera were used to identify the corresponding viral gene products in 35 S-labeled extracts from foot-and-mouth disease virus-infected BHK cells. This allowed us to locate unequivocally all mature foot-and-mouth disease virus gene products in the nucleotide sequence, to identify precursor-product relationships, and to detect several foot-and mouth disease virus gene products not previously identified in vivo or in vitro

  1. NUTM1 Gene Fusions Characterize a Subset of Undifferentiated Soft Tissue and Visceral Tumors.

    Science.gov (United States)

    Dickson, Brendan C; Sung, Yun-Shao; Rosenblum, Marc K; Reuter, Victor E; Harb, Mohammed; Wunder, Jay S; Swanson, David; Antonescu, Cristina R

    2018-05-01

    NUT midline carcinoma is an aggressive tumor that occurs mainly in the head and neck and, less frequently, the mediastinum and lung. Following identification of an index case of a NUTM1 fusion positive undifferentiated soft tissue tumor, we interrogated additional cases of primary undifferentiated soft tissue and visceral tumors for NUTM1 abnormalities. Targeted next-generation sequencing was performed on RNA extracted from formalin-fixed paraffin-embedded tissue, and results validated by fluorescence in situ hybridization using custom bacterial artificial chromosome probes. Six patients were identified: mean age of 42 years (range, 3 to 71 y); equal sex distribution; and, tumors involved the extremity soft tissues (N=2), kidney (N=2), stomach, and brain. On systemic work-up at presentation all patients lacked a distant primary tumor. Morphologically, the tumors were heterogenous, with undifferentiated round-epithelioid-rhabdoid cells arranged in solid sheets, nests, and cords. Mitotic activity was generally brisk. Four cases expressed pancytokeratin, but in only 2 cases was this diffuse. Next-generation sequencing demonstrated the following fusions: BRD4-NUTM1 (3 cases), BRD3-NUTM1, MXD1-NUTM1, and BCORL1-NUTM1. Independent testing by fluorescence in situ hybridization confirmed the presence of NUTM1 and partner gene rearrangement. This study establishes that NUT-associated tumors transgress the midline and account for a subset of primitive neoplasms occurring in soft tissue and viscera. Tumors harboring NUTM1 gene fusions are presumably underrecognized, and the extent to which they account for undifferentiated mesenchymal, neuroendocrine, and/or epithelial neoplasms is unclear. Moreover, the relationship, if any, between NUT-associated tumors in soft tissue and/or viscera, and conventional NUT carcinoma, remains to be elucidated.

  2. Driver Fusions and Their Implications in the Development and Treatment of Human Cancers

    NARCIS (Netherlands)

    Gao, Qingsong; Liang, Wen Wei; Foltz, Steven M.; Mutharasu, Gnanavel; Jayasinghe, Reyka G.; Cao, Song; Liao, Wen Wei; Reynolds, Sheila M.; Wyczalkowski, Matthew A.; Yao, Lijun; Yu, Lihua; Sun, Sam Q.; Caesar-Johnson, Samantha J.; Demchok, John A.; Felau, Ina; Kasapi, Melpomeni; Ferguson, Martin L.; Hutter, Carolyn M.; Sofia, Heidi J.; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C.; Zhang, Jiashan (Julia); Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Cho, Juok; DeFreitas, Timothy; Frazer, Scott; Gehlenborg, Nils; Getz, Gad; Heiman, David I.; Kim, Jaegil; Lawrence, Michael S.; Lin, Pei; Meier, Sam; Noble, Michael S.; Saksena, Gordon; Voet, Doug; Zhang, Hailei; Bernard, Brady; Chambwe, Nyasha; Dhankani, Varsha; Knijnenburg, Theo; Kramer, Roger; Leinonen, Kalle; Liu, Yuexin; Miller, Michael; Reynolds, Sheila; Shmulevich, Ilya; Thorsson, Vesteinn; Zhang, Wei; Akbani, Rehan; Broom, Bradley M.; Hegde, Apurva M.; Ju, Zhenlin; Kanchi, Rupa S.; Korkut, Anil; Li, Jun; Liang, Han; Ling, Shiyun; Liu, Wenbin; Lu, Yiling; Mills, Gordon B.; Ng, Kwok Shing; Rao, Arvind; Ryan, Michael; Wang, Jing; Weinstein, John N.; Zhang, Jiexin; Abeshouse, Adam; Armenia, Joshua; Chakravarty, Debyani; Chatila, Walid K.; de Bruijn, Ino; Gao, Jianjiong; Gross, Benjamin E.; Heins, Zachary J.; Kundra, Ritika; La, Konnor; Ladanyi, Marc; Luna, Augustin; Nissan, Moriah G.; Ochoa, Angelica; Phillips, Sarah M.; Reznik, Ed; Sanchez-Vega, Francisco; Sander, Chris; Schultz, Nikolaus; Sheridan, Robert; Sumer, S. Onur; Sun, Yichao; Taylor, Barry S.; Wang, Jioajiao; Zhang, Hongxin; Anur, Pavana; Peto, Myron; Spellman, Paul; Benz, Christopher; Stuart, Joshua M.; Wong, Christopher K.; Yau, Christina; Hayes, D. Neil; Parker, Joel S.; Wilkerson, Matthew D.; Ally, Adrian; Balasundaram, Miruna; Bowlby, Reanne; Brooks, Denise; Carlsen, Rebecca; Chuah, Eric; Dhalla, Noreen; Holt, Robert; Jones, Steven J.M.; Kasaian, Katayoon; Lee, Darlene; Ma, Yussanne; Marra, Marco A.; Mayo, Michael; Moore, Richard A.; Mungall, Andrew J.; Mungall, Karen; Robertson, A. Gordon; Sadeghi, Sara; Schein, Jacqueline E.; Sipahimalani, Payal; Tam, Angela; Thiessen, Nina; Tse, Kane; Wong, Tina; Berger, Ashton C.; Beroukhim, Rameen; Cherniack, Andrew D.; Cibulskis, Carrie; Gabriel, Stacey B.; Gao, Galen F.; Ha, Gavin; Meyerson, Matthew; Schumacher, Steven E.; Shih, Juliann; Kucherlapati, Melanie H.; Kucherlapati, Raju S.; Baylin, Stephen; Cope, Leslie; Danilova, Ludmila; Bootwalla, Moiz S.; Lai, Phillip H.; Maglinte, Dennis T.; Van Den Berg, David J.; Weisenberger, Daniel J.; Auman, J. Todd; Balu, Saianand; Bodenheimer, Tom; Fan, Cheng; Hoadley, Katherine A.; Hoyle, Alan P.; Jefferys, Stuart R.; Jones, Corbin D.; Meng, Shaowu; Mieczkowski, Piotr A.; Mose, Lisle E.; Perou, Amy H.; Perou, Charles M.; Roach, Jeffrey; Shi, Yan; Simons, Janae V.; Skelly, Tara; Soloway, Matthew G.; Tan, Donghui; Veluvolu, Umadevi; Fan, Huihui; Hinoue, Toshinori; Laird, Peter W.; Shen, Hui; Zhou, Wanding; Bellair, Michelle; Chang, Kyle; Covington, Kyle; Creighton, Chad J.; Dinh, Huyen; Doddapaneni, Harsha Vardhan; Donehower, Lawrence A.; Drummond, Jennifer; Gibbs, Richard A.; Glenn, Robert; Hale, Walker; Han, Yi; Hu, Jianhong; Korchina, Viktoriya; Lee, Sandra; Lewis, Lora; Li, Wei; Liu, Xiuping; Morgan, Margaret; Morton, Donna; Muzny, Donna; Santibanez, Jireh; Sheth, Margi; Shinbrot, Eve; Wang, Linghua; Wang, Min; Wheeler, David A.; Xi, Liu; Zhao, Fengmei; Hess, Julian; Appelbaum, Elizabeth L.; Bailey, Matthew; Cordes, Matthew G.; Ding, Li; Fronick, Catrina C.; Fulton, Lucinda A.; Fulton, Robert S.; Kandoth, Cyriac; Mardis, Elaine R.; McLellan, Michael D.; Miller, Christopher A.; Schmidt, Heather K.; Wilson, Richard K.; Crain, Daniel; Curley, Erin; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph; Penny, Robert; Shelton, Candace; Shelton, Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Bowen, Jay; Gastier-Foster, Julie M.; Gerken, Mark; Leraas, Kristen M.; Lichtenberg, Tara M.; Ramirez, Nilsa C.; Wise, Lisa; Zmuda, Erik; Corcoran, Niall; Costello, Tony; Hovens, Christopher; Carvalho, Andre L.; de Carvalho, Ana C.; Fregnani, José H.; Longatto-Filho, Adhemar; Reis, Rui M.; Scapulatempo-Neto, Cristovam; Silveira, Henrique C.S.; Vidal, Daniel O.; Burnette, Andrew; Eschbacher, Jennifer; Hermes, Beth; Noss, Ardene; Singh, Rosy; Anderson, Matthew L.; Castro, Patricia D.; Ittmann, Michael; Huntsman, David; Kohl, Bernard; Le, Xuan; Thorp, Richard; Andry, Chris; Duffy, Elizabeth R.; Lyadov, Vladimir; Paklina, Oxana; Setdikova, Galiya; Shabunin, Alexey; Tavobilov, Mikhail; McPherson, Christopher; Warnick, Ronald; Berkowitz, Ross; Cramer, Daniel; Feltmate, Colleen; Horowitz, Neil; Kibel, Adam; Muto, Michael; Raut, Chandrajit P.; Malykh, Andrei; Barnholtz-Sloan, Jill S.; Barrett, Wendi; Devine, Karen; Fulop, Jordonna; Ostrom, Quinn T.; Shimmel, Kristen; Wolinsky, Yingli; Sloan, Andrew E.; De Rose, Agostino; Giuliante, Felice; Goodman, Marc; Karlan, Beth Y.; Hagedorn, Curt H.; Eckman, John; Harr, Jodi; Myers, Jerome; Tucker, Kelinda; Zach, Leigh Anne; Deyarmin, Brenda; Hu, Hai; Kvecher, Leonid; Larson, Caroline; Mural, Richard J.; Somiari, Stella; Vicha, Ales; Zelinka, Tomas; Bennett, Joseph; Iacocca, Mary; Rabeno, Brenda; Swanson, Patricia; Latour, Mathieu; Lacombe, Louis; Têtu, Bernard; Bergeron, Alain; McGraw, Mary; Staugaitis, Susan M.; Chabot, John; Hibshoosh, Hanina; Sepulveda, Antonia; Su, Tao; Wang, Timothy; Potapova, Olga; Voronina, Olga; Desjardins, Laurence; Mariani, Odette; Roman-Roman, Sergio; Sastre, Xavier; Stern, Marc Henri; Cheng, Feixiong; Signoretti, Sabina; Berchuck, Andrew; Bigner, Darell; Lipp, Eric; Marks, Jeffrey; McCall, Shannon; McLendon, Roger; Secord, Angeles; Sharp, Alexis; Behera, Madhusmita; Brat, Daniel J.; Chen, Amy; Delman, Keith; Force, Seth; Khuri, Fadlo; Magliocca, Kelly; Maithel, Shishir; Olson, Jeffrey J.; Owonikoko, Taofeek; Pickens, Alan; Ramalingam, Suresh; Shin, Dong M.; Sica, Gabriel; Van Meir, Erwin G.; Zhang, Hongzheng; Eijckenboom, Wil; Gillis, Ad; Korpershoek, Esther; Looijenga, Leendert; Oosterhuis, Wolter; Stoop, Hans; van Kessel, Kim E.; Zwarthoff, Ellen C.; Calatozzolo, Chiara; Cuppini, Lucia; Cuzzubbo, Stefania; DiMeco, Francesco; Finocchiaro, Gaetano; Mattei, Luca; Perin, Alessandro; Pollo, Bianca; Chen, Chu; Houck, John; Lohavanichbutr, Pawadee; Hartmann, Arndt; Stoehr, Christine; Stoehr, Robert; Taubert, Helge; Wach, Sven; Wullich, Bernd; Kycler, Witold; Murawa, Dawid; Wiznerowicz, Maciej; Chung, Ki; Edenfield, W. Jeffrey; Martin, Julie; Baudin, Eric; Bubley, Glenn; Bueno, Raphael; De Rienzo, Assunta; Richards, William G.; Kalkanis, Steven; Mikkelsen, Tom; Noushmehr, Houtan; Scarpace, Lisa; Girard, Nicolas; Aymerich, Marta; Campo, Elias; Giné, Eva; Guillermo, Armando López; Van Bang, Nguyen; Hanh, Phan Thi; Phu, Bui Duc; Tang, Yufang; Colman, Howard; Evason, Kimberley; Dottino, Peter R.; Martignetti, John A.; Gabra, Hani; Juhl, Hartmut; Akeredolu, Teniola; Stepa, Serghei; Hoon, Dave; Ahn, Keunsoo; Kang, Koo Jeong; Beuschlein, Felix; Breggia, Anne; Birrer, Michael; Bell, Debra; Borad, Mitesh; Bryce, Alan H.; Castle, Erik; Chandan, Vishal; Cheville, John; Copland, John A.; Farnell, Michael; Flotte, Thomas; Giama, Nasra; Ho, Thai; Kendrick, Michael; Kocher, Jean Pierre; Kopp, Karla; Moser, Catherine; Nagorney, David; O'Brien, Daniel; O'Neill, Brian Patrick; Patel, Tushar; Petersen, Gloria; Que, Florencia; Rivera, Michael; Roberts, Lewis; Smallridge, Robert; Smyrk, Thomas; Stanton, Melissa; Thompson, R. Houston; Torbenson, Michael; Yang, Ju Dong; Zhang, Lizhi; Brimo, Fadi; Ajani, Jaffer A.; Gonzalez, Ana Maria Angulo; Behrens, Carmen; Bondaruk, Jolanta; Broaddus, Russell; Czerniak, Bogdan; Esmaeli, Bita; Fujimoto, Junya; Gershenwald, Jeffrey; Guo, Charles; Lazar, Alexander J.; Logothetis, Christopher; Meric-Bernstam, Funda; Moran, Cesar; Ramondetta, Lois; Rice, David; Sood, Anil; Tamboli, Pheroze; Thompson, Timothy; Troncoso, Patricia; Tsao, Anne; Wistuba, Ignacio; Carter, Candace; Haydu, Lauren; Hersey, Peter; Jakrot, Valerie; Kakavand, Hojabr; Kefford, Richard; Lee, Kenneth; Long, Georgina; Mann, Graham; Quinn, Michael; Saw, Robyn; Scolyer, Richard; Shannon, Kerwin; Spillane, Andrew; Stretch, Jonathan; Synott, Maria; Thompson, John; Wilmott, James; Al-Ahmadie, Hikmat; Chan, Timothy A.; Ghossein, Ronald; Gopalan, Anuradha; Levine, Douglas A.; Reuter, Victor; Singer, Samuel; Singh, Bhuvanesh; Tien, Nguyen Viet; Broudy, Thomas; Mirsaidi, Cyrus; Nair, Praveen; Drwiega, Paul; Miller, Judy; Smith, Jennifer; Zaren, Howard; Park, Joong Won; Hung, Nguyen Phi; Kebebew, Electron; Linehan, W. Marston; Metwalli, Adam R.; Pacak, Karel; Pinto, Peter A.; Schiffman, Mark; Schmidt, Laura S.; Vocke, Cathy D.; Wentzensen, Nicolas; Worrell, Robert; Yang, Hannah; Moncrieff, Marc; Goparaju, Chandra; Melamed, Jonathan; Pass, Harvey; Botnariuc, Natalia; Caraman, Irina; Cernat, Mircea; Chemencedji, Inga; Clipca, Adrian; Doruc, Serghei; Gorincioi, Ghenadie; Mura, Sergiu; Pirtac, Maria; Stancul, Irina; Tcaciuc, Diana; Albert, Monique; Alexopoulou, Iakovina; Arnaout, Angel; Bartlett, John; Engel, Jay; Gilbert, Sebastien; Parfitt, Jeremy; Sekhon, Harman; Thomas, George; Rassl, Doris M.; Rintoul, Robert C.; Bifulco, Carlo; Tamakawa, Raina; Urba, Walter; Hayward, Nicholas; Timmers, Henri; Antenucci, Anna; Facciolo, Francesco; Grazi, Gianluca; Marino, Mirella; Merola, Roberta; de Krijger, Ronald; Gimenez-Roqueplo, Anne Paule; Piché, Alain; Chevalier, Simone; McKercher, Ginette; Birsoy, Kivanc; Barnett, Gene; Brewer, Cathy; Farver, Carol; Naska, Theresa; Pennell, Nathan A.; Raymond, Daniel; Schilero, Cathy; Smolenski, Kathy; Williams, Felicia; Morrison, Carl; Borgia, Jeffrey A.; Liptay, Michael J.; Pool, Mark; Seder, Christopher W.; Junker, Kerstin; Omberg, Larsson; Dinkin, Mikhail; Manikhas, George; Alvaro, Domenico; Bragazzi, Maria Consiglia; Cardinale, Vincenzo; Carpino, Guido; Gaudio, Eugenio; Chesla, David; Cottingham, Sandra; Dubina, Michael; Moiseenko, Fedor; Dhanasekaran, Renumathy; Becker, Karl Friedrich; Janssen, Klaus Peter; Slotta-Huspenina, Julia; Abdel-Rahman, Mohamed H.; Aziz, Dina; Bell, Sue; Cebulla, Colleen M.; Davis, Amy; Duell, Rebecca; Elder, J. Bradley; Hilty, Joe; Kumar, Bahavna; Lang, James; Lehman, Norman L.; Mandt, Randy; Nguyen, Phuong; Pilarski, Robert; Rai, Karan; Schoenfield, Lynn; Senecal, Kelly; Wakely, Paul; Hansen, Paul; Lechan, Ronald; Powers, James; Tischler, Arthur; Grizzle, William E.; Sexton, Katherine C.; Kastl, Alison; Henderson, Joel; Porten, Sima; Waldmann, Jens; Fassnacht, Martin; Asa, Sylvia L.; Schadendorf, Dirk; Couce, Marta; Graefen, Markus; Huland, Hartwig; Sauter, Guido; Schlomm, Thorsten; Simon, Ronald; Tennstedt, Pierre; Olabode, Oluwole; Nelson, Mark; Bathe, Oliver; Carroll, Peter R.; Chan, June M.; Disaia, Philip; Glenn, Pat; Kelley, Robin K.; Landen, Charles N.; Phillips, Joanna; Prados, Michael; Simko, Jeffry; Smith-McCune, Karen; VandenBerg, Scott; Roggin, Kevin; Fehrenbach, Ashley; Kendler, Ady; Sifri, Suzanne; Steele, Ruth; Jimeno, Antonio; Carey, Francis; Forgie, Ian; Mannelli, Massimo; Carney, Michael; Hernandez, Brenda; Campos, Benito; Herold-Mende, Christel; Jungk, Christin; Unterberg, Andreas; von Deimling, Andreas; Bossler, Aaron; Galbraith, Joseph; Jacobus, Laura; Knudson, Michael; Knutson, Tina; Ma, Deqin; Milhem, Mohammed; Sigmund, Rita; Godwin, Andrew K.; Madan, Rashna; Rosenthal, Howard G.; Adebamowo, Clement; Adebamowo, Sally N.; Boussioutas, Alex; Beer, David; Giordano, Thomas; Mes-Masson, Anne Marie; Saad, Fred; Bocklage, Therese; Landrum, Lisa; Mannel, Robert; Moore, Kathleen; Moxley, Katherine; Postier, Russel; Walker, Joan; Zuna, Rosemary; Feldman, Michael; Valdivieso, Federico; Dhir, Rajiv; Luketich, James; Pinero, Edna M.Mora; Quintero-Aguilo, Mario; Carlotti, Carlos Gilberto; Dos Santos, Jose Sebastião; Kemp, Rafael; Sankarankuty, Ajith; Tirapelli, Daniela; Catto, James; Agnew, Kathy; Swisher, Elizabeth; Creaney, Jenette; Robinson, Bruce; Shelley, Carl Simon; Godwin, Eryn M.; Kendall, Sara; Shipman, Cassaundra; Bradford, Carol; Carey, Thomas; Haddad, Andrea; Moyer, Jeffey; Peterson, Lisa; Prince, Mark; Rozek, Laura; Wolf, Gregory; Bowman, Rayleen; Fong, Kwun M.; Yang, Ian; Korst, Robert; Rathmell, W. Kimryn; Fantacone-Campbell, J. Leigh; Hooke, Jeffrey A.; Kovatich, Albert J.; Shriver, Craig D.; DiPersio, John; Drake, Bettina; Govindan, Ramaswamy; Heath, Sharon; Ley, Timothy; Van Tine, Brian; Westervelt, Peter; Rubin, Mark A.; Lee, Jung Il; Aredes, Natália D.; Mariamidze, Armaz; Chen, Ken; Lazar, Alexander J.; Fields, Ryan C.; Wendl, Michael C.; Van Tine, Brian A.; Vij, Ravi; Chen, Feng; Nykter, Matti; Shmulevich, Ilya; Ding, Li

    2018-01-01

    Gene fusions represent an important class of somatic alterations in cancer. We systematically investigated fusions in 9,624 tumors across 33 cancer types using multiple fusion calling tools. We identified a total of 25,664 fusions, with a 63% validation rate. Integration of gene expression, copy

  3. Dominant integration locus drives continuous diversification of plant immune receptors with exogenous domain fusions.

    Science.gov (United States)

    Bailey, Paul C; Schudoma, Christian; Jackson, William; Baggs, Erin; Dagdas, Gulay; Haerty, Wilfried; Moscou, Matthew; Krasileva, Ksenia V

    2018-02-19

    The plant immune system is innate and encoded in the germline. Using it efficiently, plants are capable of recognizing a diverse range of rapidly evolving pathogens. A recently described phenomenon shows that plant immune receptors are able to recognize pathogen effectors through the acquisition of exogenous protein domains from other plant genes. We show that plant immune receptors with integrated domains are distributed unevenly across their phylogeny in grasses. Using phylogenetic analysis, we uncover a major integration clade, whose members underwent repeated independent integration events producing diverse fusions. This clade is ancestral in grasses with members often found on syntenic chromosomes. Analyses of these fusion events reveals that homologous receptors can be fused to diverse domains. Furthermore, we discover a 43 amino acid long motif associated with this dominant integration clade which is located immediately upstream of the fusion site. Sequence analysis reveals that DNA transposition and/or ectopic recombination are the most likely mechanisms of formation for nucleotide binding leucine rich repeat proteins with integrated domains. The identification of this subclass of plant immune receptors that is naturally adapted to new domain integration will inform biotechnological approaches for generating synthetic receptors with novel pathogen "baits."

  4. Conceptual design of a generic pulse schedule and event handling editor for improved fusion device operation

    International Nuclear Information System (INIS)

    Barana, Oliviero; Nouailletas, Rémy; Brémond, Sylvain; Moreau, Philippe; Allegretti, Ludovic; Balme, Stéphane; Ravenel, Nathalie; Mannori, Simone; Guillerminet, Bernard; Leroux, Fabrice; Douai, David; Nardon, Eric; Hertout, Patrick; Saint-Laurent, François

    2013-01-01

    Highlights: ► Real-time event handling requires extended functionalities of pulse schedule editors and plasma control systems ► A new pulse schedule editor, conceived for parameterization of systematic off-normal event handling, is described ► A global, generic approach on off-normal event handling is highlighted ► The functional architecture of an off-normal event handling oriented plasma control system is discussed ► The main objects of the pulse schedule editor are the segment-descriptor object and the scenario-descriptor object. -- Abstract: Coping with unexpected events is an important issue of nuclear fusion experiments. The future machines, characterized by very long plasma discharges and actively cooled metallic plasma-facing components, will require a systematic intervention in real time, in order to maximize the performance and protect the investment. The real-time management of events will require extending the functionalities of the current pulse schedule editors with the possibility of using reference waveforms provided with acceptability margins and setting up advanced mitigation strategies and event countermeasures. With this purpose, a new pulse schedule editor, based on a time-segment approach for the preparation of experimental scenarios, is being conceived on Tore Supra, together with a new plasma control system. This paper will report on their conceptual design and give account of the preliminary results of a feasibility study currently under way in order to prepare a possible implementation on Tore Supra

  5. Conceptual design of a generic pulse schedule and event handling editor for improved fusion device operation

    Energy Technology Data Exchange (ETDEWEB)

    Barana, Oliviero, E-mail: oliviero.barana@cea.fr [CEA, IRFM, F-13108 Saint-Paul-Lez Durance (France); Nouailletas, Rémy; Brémond, Sylvain; Moreau, Philippe; Allegretti, Ludovic; Balme, Stéphane; Ravenel, Nathalie [CEA, IRFM, F-13108 Saint-Paul-Lez Durance (France); Mannori, Simone [ENEA C.R. Brasimone, 40032 Camugnano (Italy); Guillerminet, Bernard; Leroux, Fabrice; Douai, David; Nardon, Eric; Hertout, Patrick; Saint-Laurent, François [CEA, IRFM, F-13108 Saint-Paul-Lez Durance (France)

    2013-10-15

    Highlights: ► Real-time event handling requires extended functionalities of pulse schedule editors and plasma control systems ► A new pulse schedule editor, conceived for parameterization of systematic off-normal event handling, is described ► A global, generic approach on off-normal event handling is highlighted ► The functional architecture of an off-normal event handling oriented plasma control system is discussed ► The main objects of the pulse schedule editor are the segment-descriptor object and the scenario-descriptor object. -- Abstract: Coping with unexpected events is an important issue of nuclear fusion experiments. The future machines, characterized by very long plasma discharges and actively cooled metallic plasma-facing components, will require a systematic intervention in real time, in order to maximize the performance and protect the investment. The real-time management of events will require extending the functionalities of the current pulse schedule editors with the possibility of using reference waveforms provided with acceptability margins and setting up advanced mitigation strategies and event countermeasures. With this purpose, a new pulse schedule editor, based on a time-segment approach for the preparation of experimental scenarios, is being conceived on Tore Supra, together with a new plasma control system. This paper will report on their conceptual design and give account of the preliminary results of a feasibility study currently under way in order to prepare a possible implementation on Tore Supra.

  6. Dominant negative selection of vaccinia virus using a thymidine kinase/thymidylate kinase fusion gene and the prodrug azidothymidine

    International Nuclear Information System (INIS)

    Holzer, Georg W.; Mayrhofer, Josef; Gritschenberger, Werner; Falkner, Falko G.

    2005-01-01

    The Escherichia coli thymidine kinase/thymidylate kinase (tk/tmk) fusion gene encodes an enzyme that efficiently converts the prodrug 3'-azido-2',3'-dideoxythymidine (AZT) into its toxic triphosphate derivative, a substance which stops DNA chain elongation. Integration of this marker gene into vaccinia virus that normally is not inhibited by AZT allowed the establishment of a powerful selection procedure for recombinant viruses. In contrast to the conventional vaccinia thymidine kinase (tk) selection that is performed in tk-negative cell lines, AZT selection can be performed in normal (tk-positive) cell lines. The technique is especially useful for the generation of replication-deficient vaccinia viruses and may also be used for gene knock-out studies of essential vaccinia genes

  7. SimFuse: A Novel Fusion Simulator for RNA Sequencing (RNA-Seq Data

    Directory of Open Access Journals (Sweden)

    Yuxiang Tan

    2015-01-01

    Full Text Available The performance evaluation of fusion detection algorithms from high-throughput sequencing data crucially relies on the availability of data with known positive and negative cases of gene rearrangements. The use of simulated data circumvents some shortcomings of real data by generation of an unlimited number of true and false positive events, and the consequent robust estimation of accuracy measures, such as precision and recall. Although a few simulated fusion datasets from RNA Sequencing (RNA-Seq are available, they are of limited sample size. This makes it difficult to systematically evaluate the performance of RNA-Seq based fusion-detection algorithms. Here, we present SimFuse to address this problem. SimFuse utilizes real sequencing data as the fusions’ background to closely approximate the distribution of reads from a real sequencing library and uses a reference genome as the template from which to simulate fusions’ supporting reads. To assess the supporting read-specific performance, SimFuse generates multiple datasets with various numbers of fusion supporting reads. Compared to an extant simulated dataset, SimFuse gives users control over the supporting read features and the sample size of the simulated library, based on which the performance metrics needed for the validation and comparison of alternative fusion-detection algorithms can be rigorously estimated.

  8. Fragmentation, Fusion, and Genetic Homogeneity in a Calcareous Sponge (Porifera, Calcarea).

    Science.gov (United States)

    Padua, André; Leocorny, Pedro; Custódio, Márcio Reis; Klautau, Michelle

    2016-06-01

    Sessile marine invertebrates living on hard substrata usually present strategies such as size variations, longer life spans, fragmentation and fusion to occupy and compete for space. Calcareous sponges are usually small and short-lived, and some species are known to undergo frequent fragmentation and fusion events. However, whether fusion occurs only between genetically identical individuals remains unclear. We investigated the occurrence of chimaeras in the calcareous sponge Clathrina aurea by following the dynamics of fragmentation and fusion of 66 individuals in the field for up to 18 months and determined size variations and the life span of each individual. Microsatellites were used to determine whether fusion events occur among genetically different individuals. Growth and shrinkage of individuals were frequently observed, showing that size cannot be associated with age in C. aurea. The life span of the species ranged from 1 to 16 months (mean: 4.7 months). Short life spans and variable growth rates have been observed in other species of the class Calcarea. Fragmentation and fusion events were observed, but fusion events always occurred between genetically identical individuals, as has been suggested by graft experiments in adult Demospongiae and other Calcarea. These results suggest that at least C. aurea adults may have some mechanism to avoid chimaerism. © 2016 Wiley Periodicals, Inc.

  9. Imaging Expression of Cytosine Deaminase-Herpes Virus Thymidine Kinase Fusion Gene (CD/TK Expression with [124I]FIAU and PET

    Directory of Open Access Journals (Sweden)

    Trevor Hackman

    2002-01-01

    Full Text Available Double prodrug activation gene therapy using the Escherichia coli cytosine deaminase (CDherpes simplex virus type 1 thymidine kinase (HSV1-tk fusion gene (CD/TK with 5-fluorocytosine (5FC, ganciclovir (GCV, and radiotherapy is currently under evaluation for treatment of different tumors. We assessed the efficacy of noninvasive imaging with [124I]FIAU (2′-fluoro-2′-deoxy-1-β-d-arabinofuranosyl-5-iodo-uracil and positron emission tomography (PET for monitoring expression of the CD/TK fusion gene. Walker-256 tumor cells were transduced with a retroviral vector bearing the CD/TK gene (W256CD/TK cells. The activity of HSV1-TK and CD subunits of the CD/TK gene product was assessed in different single cell-derived clones of W256CD/TK cells using the FIAU radiotracer accumulation assay in cells and a CD enzyme assay in cell homogenates, respectively. A linear relationship was observed between the levels of CD and HSV1-tk subunit expression in corresponding clones in vitro over a wide range of CD/TK expression levels. Several clones of W256CD/TK cells with significantly different levels of CD/TK expression were selected and used to produce multiple subcutaneous tumors in rats. PET imaging of HSV1-TK subunit activity with [124I]FIAU was performed on these animals and demonstrated that different levels of CD/TK expression in subcutaneous W256CD/TK tumors can be imaged quantitatively. CD expression in subcutaneous tumor sample homogenates was measured using a CD enzyme assay. A comparison of CD and HSV1-TK subunit enzymatic activity of the CD/TK fusion protein in vivo showed a significant correlation. Knowing this relationship, the parametric images of CD subunit activity were generated. Imaging with [124I]FIAU and PET could provide pre- and posttreatment assessments of CD/TK-based double prodrug activation in clinical gene therapy trials.

  10. Estimation of the environmental or radiological impact in the event of accidental release of radionuclides in a DCLL fusion reactor; Estimacion del impacto radiologico ambiental en caso de liberacion accidental de radionucleidos en un reactor de fusion DCLL

    Energy Technology Data Exchange (ETDEWEB)

    Palermo, I.; Gomez Ros, J. M.; Sanz, J.; Mota, F.

    2013-07-01

    Tritium production and activation in the LiPb products can pose a radiological risk in the event of accidental release in a fusion reactor. Within the research programme Consolider TECNO{sub F}US (CSD2008-079) fusion technology has developed a design for a reactor with regenerative wrap with dual refrigeration (DCLL). The purpose of this communication is to present estimates of the radiological impact derived from an accidental release of radionuclides from the circuit of LiPb provinients. (Author)

  11. Trans-activation function of a 3' truncated X gene-cell fusion product from integrated hepatitis B virus DNA in chronic hepatitis tissues

    International Nuclear Information System (INIS)

    Takada, Shinako; Koike, Katsuro

    1990-01-01

    To investigate the expression and transactivation function of the X gene in integrated hepatitis B virus (HBV) DNA from chronic hepatitis tissues, a series of transfectants containing cloned integrated HBV DNAs was made and analyzed for X mRNA expression and trans-activation activity by using a chloramphenicol acetyltransferase assay. Most of the integrated HBV DNAs expressed X mRNA and encoded a product with trans-activation activity in spite of the loss of the 3' end region of the X gene due to integration. From cDNA cloning and sequence analysis of X mRNA transcribed from native or integrated HBV DNA, the X protein was found to be translated from the X open reading frame without splicing. For integrated HBV DNA, transcription was extended to a cellular flanking DNA and an X gene-cell fusion transcript was terminated by using a cellular poly(A) signal. The amino acid sequence deduced from an X-cell fusion transcript indicated truncation of the carboxyl-terminal five amino acids, but the upstream region of seven amino acids conserved among hepadnaviruses was retained in the integrated HBV DNA, suggesting that this conserved region is essential for the transactivation function of the X protein. These findings support the following explanation for hepatocarcinogenesis by HBV DNA integration: the expression of a cellular oncogene(s) is transactivated at the time of chronic infection by the increasing amounts of the integrated HBV gene product(s), such as the X-cell fusion product

  12. A new microcolumn-type microchip for examining the expression of chimeric fusion genes using a nucleic acid sandwich hybridization technique.

    Science.gov (United States)

    Ohnishi, Michihiro; Sasaki, Naoyuki; Kishimoto, Takuya; Watanabe, Hidetoshi; Takagi, Masatoshi; Mizutani, Shuki; Kishii, Noriyuki; Yasuda, Akio

    2014-11-01

    We report a new type of microcolumn installed in a microchip. The architecture allows use of a nucleic acid sandwich hybridization technique to detect a messenger RNA (mRNA) chain as a target. Data are presented that demonstrate that the expression of a chimeric fusion gene can be detected. The microcolumn was filled with semi-transparent microbeads made of agarose gel that acted as carriers, allowing increased efficiency of the optical detection of fluorescence from the microcolumn. The hybrid between the target trapped on the microbeads and a probe DNA labeled with a fluorescent dye was detected by measuring the intensity of the fluorescence from the microcolumn directly. These results demonstrate an easy and simple method for determining the expression of chimeric fusion genes with no preamplification. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Basic experiments during loss of vacuum event (LOVE) in fusion experimental reactor

    International Nuclear Information System (INIS)

    Ogawa, Masuro; Kunugi, Tomoaki; Seki, Yasushi

    1993-01-01

    If a loss of vacuum event (LOVE) occurs due to damage of the vacuum vessel of a nuclear fusion experimental reactor, some chemical reactions such as a graphic oxidation and a buoyancy-driven exchange flow take place after equalization of the gas pressure between the inside and outside of the vacuum vessel. The graphite oxidation would generate inflammable carbon monoxide and release tritium retained in the graphite. The exchange flow through the breaches may transport the carbon monoxide and tritium out of the vacuum vessel. To add confidence to the safety evaluations and analyses, it is important to grasp the basic phenomena such as the exchange flow and the graphite oxidation. Experiments of the exchange flow and the graphite oxidation were carried out to obtain the exchange flow rate and the rate constant for the carbon monoxide combustion, respectively. These experimental results were compared with existing correlations. The authors plan a scaled-model test and a full-scale model test for the LOVE

  14. Expanding the Molecular Signature of Ossifying Fibromyxoid Tumors with 2 Novel Gene Fusions: CREBBP-BCORL1 and KDM2A-WWTR1

    OpenAIRE

    Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R.

    2016-01-01

    Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CRE...

  15. New developments in heavy ion fusion

    International Nuclear Information System (INIS)

    Herrmannsfeldt, W.B.

    1984-01-01

    Beginning in 1984, the US Department of Energy plans a program aimed at determining the feasibility of using heavy ion accelerators as pellet drivers for Inertial Confinement Fusion (ICF). This paper will describe the events in the field of Heavy Ion Fusion (HIF) that have occurred in the three years since the Lausanne Conference in this series. The emphasis will be on the events leading towards the energy oriented program. In addition to providing an overview of progress in HIF, such a discussion may prove useful for promoters of any ''emerging'' energy technology. (orig.) [de

  16. Horizontal transmission of malignancy: in-vivo fusion of human lymphomas with hamster stroma produces tumors retaining human genes and lymphoid pathology.

    Directory of Open Access Journals (Sweden)

    David M Goldenberg

    Full Text Available We report the in-vivo fusion of two Hodgkin lymphomas with golden hamster cheek pouch cells, resulting in serially-transplanted (over 5-6 years GW-532 and GW-584 heterosynkaryon tumor cells displaying both human and hamster DNA (by FISH, lymphoma-like morphology, aggressive metastasis, and retention of 7 human genes (CD74, CXCR4, CD19, CD20, CD71, CD79b, and VIM out of 24 tested by PCR. The prevalence of B-cell restricted genes (CD19, CD20, and CD79b suggests that this uniform population may be the clonal initiating (malignant cells of Hodgkin lymphoma, despite their not showing translation to their respective proteins by immunohistochemical analysis. This is believed to be the first report of in-vivo cell-cell fusion of human lymphoma and rodent host cells, and may be a method to disclose genes regulating both organoid and metastasis signatures, suggesting that the horizontal transfer of tumor DNA to adjacent stromal cells may be implicated in tumor heterogeneity and progression. The B-cell gene signature of the hybrid xenografts suggests that Hodgkin lymphoma, or its initiating cells, is a B-cell malignancy.

  17. Review of the safety concept for fusion reactor concepts and transferability of the nuclear fission regulation to potential fusion power plants

    Energy Technology Data Exchange (ETDEWEB)

    Raeder, Juergen; Weller, Arthur; Wolf, Robert [Max-Planck-Institut fuer Plasmaphysik (IPP), Garching (Germany); Jin, Xue Zhou; Boccaccini, Lorenzo V.; Stieglitz, Robert; Carloni, Dario [Karlsruher Institute fuer Technologie (KIT), Eggenstein-Leopoldshafen (Germany); Pistner, Christoph [Oeko-Institut e.V., Darmstadt (Germany); Herb, Joachim [Gesellschaft fuer Anlagen- und Reaktorsicherheit, Koeln (Germany)

    2016-01-15

    This paper summarizes the current state of the art in science and technology of the safety concept for future fusion power plants (FPPs) and examines the transferability of the current nuclear fission regulation to the concepts of future fusion power plants. At the moment there exist only conceptual designs of future fusion power plants. The most detailed concepts with regards to safety aspects were found in the European Power Plant Conceptual Study (PPCS). The plant concepts discussed in the PPCS are based on magnetic confinement of the plasma. The safety concept of fusion power plants, which has been developed during the last decades, is based on the safety concepts of installations with radioactive inventories, especially nuclear fission power plants. It applies the concept of defence in depth. However, there are specific differences between the implementations of the safety concepts due to the physical and technological characteristics of fusion and fission. It is analysed whether for fusion a safety concept is required comparable to the one of fission. For this the consequences of a purely hypothetical release of large amounts of the radioactive inventory of a fusion power plant and a fission power plant are compared. In such an event the evacuation criterion outside the plant is exceeded by several orders of magnitude for a fission power plant. For a fusion power plant the expected radiological consequences are of the order of the evacuation criterion. Therefore, a safety concept is also necessary for fusion to guarantee the confinement of the radioactive inventory. The comparison between the safety concepts for fusion and fission shows that the fundamental safety function ''confinement of the radioactive materials'' can be transferred directly in a methodical way. For a fusion power plant this fundamental safety function is based on both, physical barriers as well as on active retention functions. After the termination of the fusion

  18. [Rumination and cognitive fusion in dementia family caregivers].

    Science.gov (United States)

    Romero-Moreno, Rosa; Márquez-González, María; Losada, Andrés; Fernández-Fernández, Virginia; Nogales-González, Celia

    2015-01-01

    Rumination has been described as a dysfunctional coping strategy related to emotional distress. Recently, it has been highlighted from the Acceptance and Commitment Therapy therapeutic approach, the negative role that cognitive fusion (the extent to which we are psychologically tangled with and dominated by the form or content of our thoughts) has on the explanation of distress. The aim of this study is to simultaneously analyze the role of rumination and cognitive fusion in the caregiving stress process. The sample of 176 dementia caregivers was divided in four groups, taking into account their levels of rumination and cognitive fusion: HRHF=high rumination+high cognitive fusion; HRLF=high rumination+low cognitive fusion; LRHF= low rumination+high cognitive fusion; and LRLC=low rumination and low cognitive fusion. Caregiver stress factors, frequency of pleasant events, experiential avoidance, coherence and satisfaction with personal values, depression, anxiety and satisfaction with life, were measured. The HRHF group showed higher levels of depression, anxiety, experiential avoidance and lower levels of satisfaction with life, frequency of pleasant events, coherence and satisfaction with personal values, than the other three groups. Considering simultaneously rumination and cognitive fusion may contribute to a better understanding of caregiver coping and distress. Copyright © 2014 SEGG. Published by Elsevier Espana. All rights reserved.

  19. Gene-Tree Reconciliation with MUL-Trees to Resolve Polyploidy Events.

    Science.gov (United States)

    Gregg, W C Thomas; Ather, S Hussain; Hahn, Matthew W

    2017-11-01

    Polyploidy can have a huge impact on the evolution of species, and it is a common occurrence, especially in plants. The two types of polyploids-autopolyploids and allopolyploids-differ in the level of divergence between the genes that are brought together in the new polyploid lineage. Because allopolyploids are formed via hybridization, the homoeologous copies of genes within them are at least as divergent as orthologs in the parental species that came together to form them. This means that common methods for estimating the parental lineages of allopolyploidy events are not accurate, and can lead to incorrect inferences about the number of gene duplications and losses. Here, we have adapted an algorithm for topology-based gene-tree reconciliation to work with multi-labeled trees (MUL-trees). By definition, MUL-trees have some tips with identical labels, which makes them a natural representation of the genomes of polyploids. Using this new reconciliation algorithm we can: accurately place allopolyploidy events on a phylogeny, identify the parental lineages that hybridized to form allopolyploids, distinguish between allo-, auto-, and (in most cases) no polyploidy, and correctly count the number of duplications and losses in a set of gene trees. We validate our method using gene trees simulated with and without polyploidy, and revisit the history of polyploidy in data from the clades including both baker's yeast and bread wheat. Our re-analysis of the yeast data confirms the allopolyploid origin and parental lineages previously identified for this group. The method presented here should find wide use in the growing number of genomes from species with a history of polyploidy. [Polyploidy; reconciliation; whole-genome duplication.]. © The Author(s) 2017. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Paramyxovirus F1 protein has two fusion peptides: implications for the mechanism of membrane fusion.

    Science.gov (United States)

    Peisajovich, S G; Samuel, O; Shai, Y

    2000-03-10

    Viral fusion proteins contain a highly hydrophobic segment, named the fusion peptide, which is thought to be responsible for the merging of the cellular and viral membranes. Paramyxoviruses are believed to contain a single fusion peptide at the N terminus of the F1 protein. However, here we identified an additional internal segment in the Sendai virus F1 protein (amino acids 214-226) highly homologous to the fusion peptides of HIV-1 and RSV. A synthetic peptide, which includes this region, was found to induce membrane fusion of large unilamellar vesicles, at concentrations where the known N-terminal fusion peptide is not effective. A scrambled peptide as well as several peptides from other regions of the F1 protein, which strongly bind to membranes, are not fusogenic. The functional and structural characterization of this active segment suggest that the F1 protein has an additional internal fusion peptide that could participate in the actual fusion event. The presence of homologous regions in other members of the same family suggests that the concerted action of two fusion peptides, one N-terminal and the other internal, is a general feature of paramyxoviruses. Copyright 2000 Academic Press.

  2. Oral cancer/endothelial cell fusion experiences nuclear fusion and acquisition of enhanced survival potential

    International Nuclear Information System (INIS)

    Song, Kai; Song, Yong; Zhao, Xiao-Ping; Shen, Hui; Wang, Meng; Yan, Ting-lin; Liu, Ke; Shang, Zheng-jun

    2014-01-01

    Most previous studies have linked cancer–macrophage fusion with tumor progression and metastasis. However, the characteristics of hybrid cells derived from oral cancer and endothelial cells and their involvement in cancer remained unknown. Double-immunofluorescent staining and fluorescent in situ hybridization (FISH) were performed to confirm spontaneous cell fusion between eGFP-labeled human umbilical vein endothelial cells (HUVECs) and RFP-labeled SCC9, and to detect the expression of vementin and cytokeratin 18 in the hybrids. The property of chemo-resistance of such hybrids was examined by TUNEL assay. The hybrid cells in xenografted tumor were identified by FISH and GFP/RFP dual-immunofluoresence staining. We showed that SCC9 cells spontaneously fused with cocultured endothelial cells, and the resultant hybrid cells maintained the division and proliferation activity after re-plating and thawing. Such hybrids expressed markers of both parental cells and became more resistant to chemotherapeutic drug cisplatin as compared to the parental SCC9 cells. Our in vivo data indicated that the hybrid cells contributed to tumor composition by using of immunostaining and FISH analysis, even though the hybrid cells and SCC9 cells were mixed with 1:10,000, according to the FACS data. Our study suggested that the fusion events between oral cancer and endothelial cells undergo nuclear fusion and acquire a new property of drug resistance and consequently enhanced survival potential. These experimental findings provide further supportive evidence for the theory that cell fusion is involved in cancer progression. - Highlights: • The fusion events between oral cancer and endothelial cells undergo nuclear fusion. • The resulting hybrid cells acquire a new property of drug resistance. • The resulting hybrid cells express the markers of both parental cells (i.e. vimentin and cytokeratin 18). • The hybrid cells contribute to tumor repopulation in vivo

  3. Oral cancer/endothelial cell fusion experiences nuclear fusion and acquisition of enhanced survival potential

    Energy Technology Data Exchange (ETDEWEB)

    Song, Kai [Department of Oral and Maxillofacial Surgery, The Affiliated Hospital of Qingdao University, Shandong Province (China); The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedicine Ministry of Education, Wuhan University, Wuhan (China); Song, Yong [The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedicine Ministry of Education, Wuhan University, Wuhan (China); Department of Stomatology, Liu Zhou People' s Hospital, Guangxi (China); Zhao, Xiao-Ping; Shen, Hui; Wang, Meng; Yan, Ting-lin [The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedicine Ministry of Education, Wuhan University, Wuhan (China); Liu, Ke, E-mail: liuke.1999@aliyun.com [Department of Oral and Maxillofacial-Head and Neck oncology, School and Hospital of Stomatology, Wuhan University, 237 Luoyu Road, Wuhan 430079 (China); The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedicine Ministry of Education, Wuhan University, Wuhan (China); Shang, Zheng-jun, E-mail: shangzhengjun@hotmail.com [Department of Oral and Maxillofacial-Head and Neck oncology, School and Hospital of Stomatology, Wuhan University, 237 Luoyu Road, Wuhan 430079 (China); The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedicine Ministry of Education, Wuhan University, Wuhan (China)

    2014-10-15

    Most previous studies have linked cancer–macrophage fusion with tumor progression and metastasis. However, the characteristics of hybrid cells derived from oral cancer and endothelial cells and their involvement in cancer remained unknown. Double-immunofluorescent staining and fluorescent in situ hybridization (FISH) were performed to confirm spontaneous cell fusion between eGFP-labeled human umbilical vein endothelial cells (HUVECs) and RFP-labeled SCC9, and to detect the expression of vementin and cytokeratin 18 in the hybrids. The property of chemo-resistance of such hybrids was examined by TUNEL assay. The hybrid cells in xenografted tumor were identified by FISH and GFP/RFP dual-immunofluoresence staining. We showed that SCC9 cells spontaneously fused with cocultured endothelial cells, and the resultant hybrid cells maintained the division and proliferation activity after re-plating and thawing. Such hybrids expressed markers of both parental cells and became more resistant to chemotherapeutic drug cisplatin as compared to the parental SCC9 cells. Our in vivo data indicated that the hybrid cells contributed to tumor composition by using of immunostaining and FISH analysis, even though the hybrid cells and SCC9 cells were mixed with 1:10,000, according to the FACS data. Our study suggested that the fusion events between oral cancer and endothelial cells undergo nuclear fusion and acquire a new property of drug resistance and consequently enhanced survival potential. These experimental findings provide further supportive evidence for the theory that cell fusion is involved in cancer progression. - Highlights: • The fusion events between oral cancer and endothelial cells undergo nuclear fusion. • The resulting hybrid cells acquire a new property of drug resistance. • The resulting hybrid cells express the markers of both parental cells (i.e. vimentin and cytokeratin 18). • The hybrid cells contribute to tumor repopulation in vivo.

  4. Conservation of proteo-lipid nuclear membrane fusion machinery during early embryogenesis.

    Science.gov (United States)

    Byrne, Richard D; Veeriah, Selvaraju; Applebee, Christopher J; Larijani, Banafshé

    2014-01-01

    The fusogenic lipid diacylglycerol is essential for remodeling gamete and zygote nuclear envelopes (NE) during early embryogenesis. It is unclear whether upstream signaling molecules are likewise conserved. Here we demonstrate PLCγ and its activator SFK1, which co-operate during male pronuclear envelope formation, also promote the subsequent male and female pronuclear fusion. PLCγ and SFK1 interact directly at the fusion site leading to PLCγ activation. This is accompanied by a spatially restricted reduction of PtdIns(4,5)P2. Consequently, pronuclear fusion is blocked by PLCγ or SFK1 inhibition. These findings identify new regulators of events in the early embryo and suggest a conserved "toolkit" of fusion machinery drives successive NE fusion events during embryogenesis.

  5. Development of RNA-FISH Assay for Detection of Oncogenic FGFR3-TACC3 Fusion Genes in FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Masahiro Kurobe

    Full Text Available Oncogenic FGFR3-TACC3 fusions and FGFR3 mutations are target candidates for small molecule inhibitors in bladder cancer (BC. Because FGFR3 and TACC3 genes are located very closely on chromosome 4p16.3, detection of the fusion by DNA-FISH (fluorescent in situ hybridization is not a feasible option. In this study, we developed a novel RNA-FISH assay using branched DNA probe to detect FGFR3-TACC3 fusions in formaldehyde-fixed paraffin-embedded (FFPE human BC samples.The RNA-FISH assay was developed and validated using a mouse xenograft model with human BC cell lines. Next, we assessed the consistency of the RNA-FISH assay using 104 human BC samples. In this study, primary BC tissues were stored as frozen and FFPE tissues. FGFR3-TACC3 fusions were independently detected in FFPE sections by the RNA-FISH assay and in frozen tissues by RT-PCR. We also analyzed the presence of FGFR3 mutations by targeted sequencing of genomic DNA extracted from deparaffinized FFPE sections.FGFR3-TACC3 fusion transcripts were identified by RNA-FISH and RT-PCR in mouse xenograft FFPE tissues using the human BC cell lines RT112 and RT4. These cell lines have been reported to be fusion-positive. Signals for FGFR3-TACC3 fusions by RNA-FISH were positive in 2/60 (3% of non-muscle-invasive BC (NMIBC and 2/44 (5% muscle-invasive BC (MIBC patients. The results of RT-PCR of all 104 patients were identical to those of RNA-FISH. FGFR3 mutations were detected in 27/60 (45% NMIBC and 8/44 (18% MIBC patients. Except for one NMIBC patient, FGFR3 mutation and FGFR3-TACC3 fusion were mutually exclusive.We developed an RNA-FISH assay for detection of the FGFR3-TACC3 fusion in FFPE samples of human BC tissues. Screening for not only FGFR3 mutations, but also for FGFR3-TACC3 fusion transcripts has the potential to identify additional patients that can be treated with FGFR inhibitors.

  6. Cell fusion in tumor progression: the isolation of cell fusion products by physical methods

    Directory of Open Access Journals (Sweden)

    Vincitorio Massimo

    2011-09-01

    Full Text Available Abstract Background Cell fusion induced by polyethylene glycol (PEG is an efficient but poorly controlled procedure for obtaining somatic cell hybrids used in gene mapping, monoclonal antibody production, and tumour immunotherapy. Genetic selection techniques and fluorescent cell sorting are usually employed to isolate cell fusion products, but both procedures have several drawbacks. Results Here we describe a simple improvement in PEG-mediated cell fusion that was obtained by modifying the standard single-step procedure. We found that the use of two PEG undertreatments obtains a better yield of cell fusion products than the standard method, and most of these products are bi- or trinucleated polykaryocytes. Fusion rate was quantified using fluorescent cell staining microscopy. We used this improved cell fusion and cell isolation method to compare giant cells obtained in vitro and giant cells obtained in vivo from patients with Hodgkin's disease and erythroleukemia. Conclusions In the present study we show how to improve PEG-mediated cell fusion and that cell separation by velocity sedimentation offers a simple alternative for the efficient purification of cell fusion products and to investigate giant cell formation in tumor development.

  7. Prospects of measuring gluon fusion and weak boson fusion cross sections at the LHC with CMS

    CERN Document Server

    Nicollerat, Anne-Sylvie

    2001-01-01

    The possibility to observe a Higgs boson having a mass between 300 and 600 GeV and to measure its couplings to vector bosons and top quark with CMS at the LHC is studied. Six different signatures are analyzed. The possibility to separate the Higgs events produced through weak boson fusion from the Higgs produced through gluon fusion using the forward going jets emitted in the weak boson fusion process is discussed for each of these different channels. The results are then used to determine the possible statistical errors on the ratio between the two Higgs decay branching fractions when it decays into Ws and into Zs and the possible statistical errors on the weak boson fusion and gluon fusion cross sections after one year of LHC running.

  8. SIGNIFICANCE OF ETV6-RUNX1 FUSION GENE TRANSCRIPT DETECTION IN PEDIATRIC B-CELL PRECURSOR ACUTE LYMPHOBLASTIC LEUKEMIA WITH TRANSLOCATION t(12;21(p13;q22

    Directory of Open Access Journals (Sweden)

    G. A. Tsaur

    2017-01-01

    Full Text Available Introduction. Translocation t(12;21(p13;q22 is one of the most common structural genetic abnormalities in childhood acute lymphoblastic leukemia (ALL. It cannot be detected by conventional G-banding, so a reverse-transcriptase polymerase chain reaction (RT-PCR or fluorescent in situ hybridization are used for this purpose.The aim of the study was to evaluate the prognostic significance of qualitative and quantitative detection of ETV6-RUNX1 fusion gene transcript at various time points in childhood B-cell precursor acute lymphoblastic leukemia (BCP-ALL patients.Materials and methods. ETV6-RUNX1 fusion gene transcript was revealed by both reverse-transcriptase PCR and quantitative real-time PCR (RQ-PCR in 34 out of 166 (20.5 % children with BCP-ALL. Qualitative ETV6-RUNX1-positivity at days 36 and 85 led to unfavorable outcome (lower event-free survival –EFS and higher cumulative incidence of relapse – CIR. While ETV6-RUNX1 status at day 15 did not allow to divide patients with different outcomes. By ROC curve analysis we determined threshold levels (TL for ETV6-RUNX1/ABL1 ratio at days 0, 15, 36 and 85. Afterwards we adjusted obtained results to 10-fold scale.Results. So practically applicable TL were as follows 500.0 %, 1 %, 0.1 % и 0.01 % for days 0, 15, 36 and 85, respectively. EFS and CIR were both worse in patients with ETV6-RUNX1/ABL1 ratio equal or above defined TL. Moreover, initial ratio ≥500,0 % corresponded to delayed blast clearance at days 15 and 36. We showed good qualitative (84.8 % and quantitative (R2 = 0.953 concordance between ETV6-RUNX1/ABL1 ratio and MRD data obtained by flow cytometry at days 15, 36, 85. Of note, defined TL for ETV6-RUNX1/ABL1 at days 15, 36, 85 were equal to prognostically important levels for flow cytometry MRD.Conclusion. Thus, qualitative detection and quantitative value of ETV6-RUNX1 fusion gene transcript showed prognostic significance in the course of treatment in children with BCP-ALL. Based

  9. Statistical Assessment of Gene Fusion Detection Algorithms using RNASequencing Data

    NARCIS (Netherlands)

    Varadan, V.; Janevski, A.; Kamalakaran, S.; Banerjee, N.; Harris, L.; Dimitrova, D.

    2012-01-01

    The detection and quantification of fusion transcripts has both biological and clinical implications. RNA sequencing technology provides a means for unbiased and high resolution characterization of fusion transcript information in tissue samples. We evaluated two fusiondetection algorithms,

  10. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  11. The yeast cell fusion protein Prm1p requires covalent dimerization to promote membrane fusion.

    Directory of Open Access Journals (Sweden)

    Alex Engel

    2010-05-01

    Full Text Available Prm1p is a multipass membrane protein that promotes plasma membrane fusion during yeast mating. The mechanism by which Prm1p and other putative regulators of developmentally controlled cell-cell fusion events facilitate membrane fusion has remained largely elusive. Here, we report that Prm1p forms covalently linked homodimers. Covalent Prm1p dimer formation occurs via intermolecular disulfide bonds of two cysteines, Cys-120 and Cys-545. PRM1 mutants in which these cysteines have been substituted are fusion defective. These PRM1 mutants are normally expressed, retain homotypic interaction and can traffic to the fusion zone. Because prm1-C120S and prm1-C545S mutants can form covalent dimers when coexpressed with wild-type PRM1, an intermolecular C120-C545 disulfide linkage is inferred. Cys-120 is adjacent to a highly conserved hydrophobic domain. Mutation of a charged residue within this hydrophobic domain abrogates formation of covalent dimers, trafficking to the fusion zone, and fusion-promoting activity. The importance of intermolecular disulfide bonding informs models regarding the mechanism of Prm1-mediated cell-cell fusion.

  12. The MARVEL domain protein, Singles Bar, is required for progression past the pre-fusion complex stage of myoblast fusion.

    Science.gov (United States)

    Estrada, Beatriz; Maeland, Anne D; Gisselbrecht, Stephen S; Bloor, James W; Brown, Nicholas H; Michelson, Alan M

    2007-07-15

    Multinucleated myotubes develop by the sequential fusion of individual myoblasts. Using a convergence of genomic and classical genetic approaches, we have discovered a novel gene, singles bar (sing), that is essential for myoblast fusion. sing encodes a small multipass transmembrane protein containing a MARVEL domain, which is found in vertebrate proteins involved in processes such as tight junction formation and vesicle trafficking where--as in myoblast fusion--membrane apposition occurs. sing is expressed in both founder cells and fusion competent myoblasts preceding and during myoblast fusion. Examination of embryos injected with double-stranded sing RNA or embryos homozygous for ethane methyl sulfonate-induced sing alleles revealed an identical phenotype: replacement of multinucleated myofibers by groups of single, myosin-expressing myoblasts at a stage when formation of the mature muscle pattern is complete in wild-type embryos. Unfused sing mutant myoblasts form clusters, suggesting that early recognition and adhesion of these cells are unimpaired. To further investigate this phenotype, we undertook electron microscopic ultrastructural studies of fusing myoblasts in both sing and wild-type embryos. These experiments revealed that more sing mutant myoblasts than wild-type contain pre-fusion complexes, which are characterized by electron-dense vesicles paired on either side of the fusing plasma membranes. In contrast, embryos mutant for another muscle fusion gene, blown fuse (blow), have a normal number of such complexes. Together, these results lead to the hypothesis that sing acts at a step distinct from that of blow, and that sing is required on both founder cell and fusion-competent myoblast membranes to allow progression past the pre-fusion complex stage of myoblast fusion, possibly by mediating fusion of the electron-dense vesicles to the plasma membrane.

  13. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with viral-vectored vaccines, various synergistic components may need to be incorporated into DNA vaccines. From the perspective of the future clinical use of DNA vaccines, it has been suggested that antigen presentation should be improved and cytokine coadministration attempted. However, even...

  14. Two coiled-coil domains of Chlamydia trachomatis IncA affect membrane fusion events during infection.

    Science.gov (United States)

    Ronzone, Erik; Paumet, Fabienne

    2013-01-01

    Chlamydia trachomatis replicates in a parasitophorous membrane-bound compartment called an inclusion. The inclusions corrupt host vesicle trafficking networks to avoid the degradative endolysosomal pathway but promote fusion with each other in order to sustain higher bacterial loads in a process known as homotypic fusion. The Chlamydia protein IncA (Inclusion protein A) appears to play central roles in both these processes as it participates to homotypic fusion and inhibits endocytic SNARE-mediated membrane fusion. How IncA selectively inhibits or activates membrane fusion remains poorly understood. In this study, we analyzed the spatial and molecular determinants of IncA's fusogenic and inhibitory functions. Using a cell-free membrane fusion assay, we found that inhibition of SNARE-mediated fusion requires IncA to be on the same membrane as the endocytic SNARE proteins. IncA displays two coiled-coil domains showing high homology with SNARE proteins. Domain swap and deletion experiments revealed that although both these domains are capable of independently inhibiting SNARE-mediated fusion, these two coiled-coil domains cooperate in mediating IncA multimerization and homotypic membrane interaction. Our results support the hypothesis that Chlamydia employs SNARE-like virulence factors that positively and negatively affect membrane fusion and promote infection.

  15. Two coiled-coil domains of Chlamydia trachomatis IncA affect membrane fusion events during infection.

    Directory of Open Access Journals (Sweden)

    Erik Ronzone

    Full Text Available Chlamydia trachomatis replicates in a parasitophorous membrane-bound compartment called an inclusion. The inclusions corrupt host vesicle trafficking networks to avoid the degradative endolysosomal pathway but promote fusion with each other in order to sustain higher bacterial loads in a process known as homotypic fusion. The Chlamydia protein IncA (Inclusion protein A appears to play central roles in both these processes as it participates to homotypic fusion and inhibits endocytic SNARE-mediated membrane fusion. How IncA selectively inhibits or activates membrane fusion remains poorly understood. In this study, we analyzed the spatial and molecular determinants of IncA's fusogenic and inhibitory functions. Using a cell-free membrane fusion assay, we found that inhibition of SNARE-mediated fusion requires IncA to be on the same membrane as the endocytic SNARE proteins. IncA displays two coiled-coil domains showing high homology with SNARE proteins. Domain swap and deletion experiments revealed that although both these domains are capable of independently inhibiting SNARE-mediated fusion, these two coiled-coil domains cooperate in mediating IncA multimerization and homotypic membrane interaction. Our results support the hypothesis that Chlamydia employs SNARE-like virulence factors that positively and negatively affect membrane fusion and promote infection.

  16. Nuclear topography and expression of the BCR/ABL fusion gene and its protein level influenced by cell differentiation and RNA interference

    Czech Academy of Sciences Publication Activity Database

    Bártová, Eva; Harničarová, Andrea; Pacherník, Jiří; Kozubek, Stanislav

    2005-01-01

    Roč. 29, č. 8 (2005), s. 901-913 ISSN 0145-2126 R&D Projects: GA AV ČR(CZ) 1QS500040508; GA ČR(CZ) GA202/04/0907; GA MZd NC6987; GA AV ČR(CZ) IAA5004306; GA MŠk(CZ) LC535 Institutional research plan: CEZ:AV0Z50040507 Keywords : BCR /ABL fusion gene * chromatin arrangement * gene expression Subject RIV: BO - Biophysics Impact factor: 2.372, year: 2005

  17. Chemical Hazards and Safety Issues in Fusion Safety Design

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    2003-01-01

    Radiological inventory releases have dominated accident consequences for fusion; these consequences are important to analyze and are generally the most severe result of a fusion facility accident event. However, the advent of, or plan for, large-scale usage of some toxic materials poses the additional hazard of chemical exposure from an accident event. Examples of toxic chemicals are beryllium for magnetic fusion and fluorine for laser fusion. Therefore, chemical exposure consequences must also be addressed in fusion safety assessment. This paper provides guidance for fusion safety analysis. US Department of Energy (DOE) chemical safety assessment practices for workers and the public are reviewed. The US Environmental Protection Agency (EPA) has published some guidance on public exposure to releases of mixtures of chemicals, this guidance has been used to create an initial guideline for treating mixed radiological and toxicological releases in fusion; for example, tritiated hazardous dust from a tokamak vacuum vessel. There is no convenient means to judge the hazard severity of exposure to mixed materials. The chemical fate of mixed material constituents must be reviewed to determine if there is a separate or combined radiological and toxicological carcinogenesis, or if other health threats exist with radiological carcinogenesis. Recommendations are made for fusion facility chemical safety evaluation and safety guidance for protecting the public from chemical releases, since such levels are not specifically identified in the DOE fusion safety standard

  18. Case Study: Organotypic human in vitro models of embryonic morphogenetic fusion

    Science.gov (United States)

    Morphogenetic fusion of tissues is a common event in embryonic development and disruption of fusion is associated with birth defects of the eye, heart, neural tube, phallus, palate, and other organ systems. Embryonic tissue fusion requires precise regulation of cell-cell and cell...

  19. Myeloid Neoplasms with t(5;12 and ETV6-ACSL6 Gene Fusion, Potential Mimickers of Myeloid Neoplasm with PDGFRB Rearrangement: Case Report with Imatinib Therapy and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Javier De Luca-Johnson

    2016-01-01

    Full Text Available We report the second case of ETV6-ACSL6 associated myeloproliferative neoplasm that has received a full course of imatinib therapy. The patient was a 51-year-old previously healthy man who presented with three months of worsening dyspnea and was found to have a white count of 216,000/cmm, of which 84% were eosinophil lineage. Cytogenetic analysis revealed a t(5;12(q31~33;p13. FISH was negative for PDGFRB rearrangement but additional FISH testing demonstrated an ACSL6 rearrangement. ETV6-ACSL6 gene fusion is a rare abnormality that most often presents as a myeloproliferative-type disorder with prominent eosinophilia or basophilia. Review of the literature yielded a total of 11 previous cases. This gene fusion results in a t(5;12(q31~33;p13 that mimics the t(5;12 found in ETV6-PDGFRB neoplasms. Identification of the fusion genes involved in t(5;12 in eosinophilia-associated myeloproliferative disorders is crucial to direct an effective treatment plan. In particular, while tyrosine kinase inhibitor therapy is effective in patients with PDGFRB rearrangement, there is little information on imatinib efficacy in patients with ETV6-ACSL6 gene fusion. Our patient was found to be nonresponsive to imatinib therapy.

  20. Characterization of a newly identified ETV6-NTRK3 fusion transcript in acute myeloid leukemia

    Directory of Open Access Journals (Sweden)

    Erdel Martin

    2011-03-01

    Full Text Available Abstract Background Characterization of novel fusion genes in acute leukemia is important for gaining information about leukemia genesis. We describe the characterization of a new ETV6 fusion gene in acute myeloid leukemia (AML FAB M0 as a result of an uncommon translocation involving chromosomes 12 and 15. Methods The ETV6 locus at 12p13 was shown to be translocated and to constitute the 5' end of the fusion product by ETV6 break apart fluorescence in situ hybridisation (FISH. To identify a fusion partner 3' rapid amplification of cDNA-ends with polymerase chain reaction (RACE PCR was performed followed by cloning and sequencing. Results The NTRK3 gene on chromosome 15 was found to constitute the 3' end of the fusion gene and the underlying ETV6-NTRK3 rearrangement was verified by reverse transcriptase PCR. No RNA of the reciprocal NTRK3-ETV6 fusion gene could be detected. Conclusion We have characterized a novel ETV6-NTRK3 fusion transcript which has not been previously described in AML FAB M0 by FISH and RACE PCR. ETV6-NTRK3 rearrangements have been described in secretory breast carcinoma and congenital fibrosarcoma.

  1. Genetic recombination variation in wild Robertsonian mice: on the role of chromosomal fusions and Prdm9 allelic background.

    Science.gov (United States)

    Capilla, Laia; Medarde, Nuria; Alemany-Schmidt, Alexandra; Oliver-Bonet, Maria; Ventura, Jacint; Ruiz-Herrera, Aurora

    2014-07-07

    Despite the existence of formal models to explain how chromosomal rearrangements can be fixed in a population in the presence of gene flow, few empirical data are available regarding the mechanisms by which genome shuffling contributes to speciation, especially in mammals. In order to shed light on this intriguing evolutionary process, here we present a detailed empirical study that shows how Robertsonian (Rb) fusions alter the chromosomal distribution of recombination events during the formation of the germline in a Rb system of the western house mouse (Mus musculus domesticus). Our results indicate that both the total number of meiotic crossovers and the chromosomal distribution of recombination events are reduced in mice with Rb fusions and that this can be related to alterations in epigenetic signatures for heterochromatinization. Furthermore, we detected novel house mouse Prdm9 allelic variants in the Rb system. Remarkably, mean recombination rates were positively correlated with a decrease in the number of ZnF domains in the Prdm9 gene. The suggestion that recombination can be modulated by both chromosomal reorganizations and genetic determinants that control the formation of double-stranded breaks during meiosis opens new avenues for understanding the role of recombination in chromosomal speciation. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  2. Menin-MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia.

    Science.gov (United States)

    Grembecka, Jolanta; He, Shihan; Shi, Aibin; Purohit, Trupta; Muntean, Andrew G; Sorenson, Roderick J; Showalter, Hollis D; Murai, Marcelo J; Belcher, Amalia M; Hartley, Thomas; Hess, Jay L; Cierpicki, Tomasz

    2012-01-29

    Translocations involving the mixed lineage leukemia (MLL) gene result in human acute leukemias with very poor prognosis. The leukemogenic activity of MLL fusion proteins is critically dependent on their direct interaction with menin, a product of the multiple endocrine neoplasia (MEN1) gene. Here we present what are to our knowledge the first small-molecule inhibitors of the menin-MLL fusion protein interaction that specifically bind menin with nanomolar affinities. These compounds effectively reverse MLL fusion protein-mediated leukemic transformation by downregulating the expression of target genes required for MLL fusion protein oncogenic activity. They also selectively block proliferation and induce both apoptosis and differentiation of leukemia cells harboring MLL translocations. Identification of these compounds provides a new tool for better understanding MLL-mediated leukemogenesis and represents a new approach for studying the role of menin as an oncogenic cofactor of MLL fusion proteins. Our findings also highlight a new therapeutic strategy for aggressive leukemias with MLL rearrangements.

  3. Genetic recombination variation in wild Robertsonian mice: on the role of chromosomal fusions and Prdm9 allelic background

    OpenAIRE

    Capilla, Laia; Medarde, Nuria; Alemany-Schmidt, Alexandra; Oliver-Bonet, Maria; Ventura, Jacint; Ruiz-Herrera, Aurora

    2014-01-01

    Despite the existence of formal models to explain how chromosomal rearrangements can be fixed in a population in the presence of gene flow, few empirical data are available regarding the mechanisms by which genome shuffling contributes to speciation, especially in mammals. In order to shed light on this intriguing evolutionary process, here we present a detailed empirical study that shows how Robertsonian (Rb) fusions alter the chromosomal distribution of recombination events during the forma...

  4. Event Discrimination Using Seismoacoustic Catalog Probabilities

    Science.gov (United States)

    Albert, S.; Arrowsmith, S.; Bowman, D.; Downey, N.; Koch, C.

    2017-12-01

    Presented here are three seismoacoustic catalogs from various years and locations throughout Utah and New Mexico. To create these catalogs, we combine seismic and acoustic events detected and located using different algorithms. Seismoacoustic events are formed based on similarity of origin time and location. Following seismoacoustic fusion, the data is compared against ground truth events. Each catalog contains events originating from both natural and anthropogenic sources. By creating these seismoacoustic catalogs, we show that the fusion of seismic and acoustic data leads to a better understanding of the nature of individual events. The probability of an event being a surface blast given its presence in each seismoacoustic catalog is quantified. We use these probabilities to discriminate between events from natural and anthropogenic sources. Sandia National Laboratories is a multimission laboratory managed and operated by National Technology and Engineering Solutions of Sandia, LLC., a wholly owned subsidiary of Honeywell International, Inc., for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-NA-0003525.

  5. A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma.

    Science.gov (United States)

    Söling, Ariane; Theiss, Christian; Jungmichel, Stephanie; Rainov, Nikolai G

    2004-08-04

    BACKGROUND: Suicide gene therapy employing the prodrug activating system Herpes simplex virus type 1 thymidine kinase (HSV-TK)/ ganciclovir (GCV) has proven to be effective in killing experimental brain tumors. In contrast, glioma patients treated with HSV-TK/ GCV did not show significant treatment benefit, most likely due to insufficient transgene delivery to tumor cells. Therefore, this study aimed at developing a strategy for real-time noninvasive in vivo monitoring of the activity of a therapeutic gene in brain tumor cells. METHODS: The HSV-TK gene was fused to the firefly luciferase (Luc) gene and the fusion construct HSV-TK-Luc was expressed in U87MG human malignant glioma cells. Nude mice with subcutaneous gliomas stably expressing HSV-TK-Luc were subjected to GCV treatment and tumor response to therapy was monitored in vivo by serial bioluminescence imaging. Bioluminescent signals over time were compared with tumor volumes determined by caliper. RESULTS: Transient and stable expression of the HSV-TK-Luc fusion protein in U87MG glioma cells demonstrated close correlation of both enzyme activities. Serial optical imaging of tumor bearing mice detected in all cases GCV induced death of tumor cells expressing the fusion protein and proved that bioluminescence can be reliably used for repetitive and noninvasive quantification of HSV-TK/ GCV mediated cell kill in vivo. CONCLUSION: This approach may represent a valuable tool for the in vivo evaluation of gene therapy strategies for treatment of malignant disease.

  6. Visualization of graphical information fusion results

    Science.gov (United States)

    Blasch, Erik; Levchuk, Georgiy; Staskevich, Gennady; Burke, Dustin; Aved, Alex

    2014-06-01

    Graphical fusion methods are popular to describe distributed sensor applications such as target tracking and pattern recognition. Additional graphical methods include network analysis for social, communications, and sensor management. With the growing availability of various data modalities, graphical fusion methods are widely used to combine data from multiple sensors and modalities. To better understand the usefulness of graph fusion approaches, we address visualization to increase user comprehension of multi-modal data. The paper demonstrates a use case that combines graphs from text reports and target tracks to associate events and activities of interest visualization for testing Measures of Performance (MOP) and Measures of Effectiveness (MOE). The analysis includes the presentation of the separate graphs and then graph-fusion visualization for linking network graphs for tracking and classification.

  7. Large-scale event extraction from literature with multi-level gene normalization.

    Directory of Open Access Journals (Sweden)

    Sofie Van Landeghem

    Full Text Available Text mining for the life sciences aims to aid database curation, knowledge summarization and information retrieval through the automated processing of biomedical texts. To provide comprehensive coverage and enable full integration with existing biomolecular database records, it is crucial that text mining tools scale up to millions of articles and that their analyses can be unambiguously linked to information recorded in resources such as UniProt, KEGG, BioGRID and NCBI databases. In this study, we investigate how fully automated text mining of complex biomolecular events can be augmented with a normalization strategy that identifies biological concepts in text, mapping them to identifiers at varying levels of granularity, ranging from canonicalized symbols to unique gene and proteins and broad gene families. To this end, we have combined two state-of-the-art text mining components, previously evaluated on two community-wide challenges, and have extended and improved upon these methods by exploiting their complementary nature. Using these systems, we perform normalization and event extraction to create a large-scale resource that is publicly available, unique in semantic scope, and covers all 21.9 million PubMed abstracts and 460 thousand PubMed Central open access full-text articles. This dataset contains 40 million biomolecular events involving 76 million gene/protein mentions, linked to 122 thousand distinct genes from 5032 species across the full taxonomic tree. Detailed evaluations and analyses reveal promising results for application of this data in database and pathway curation efforts. The main software components used in this study are released under an open-source license. Further, the resulting dataset is freely accessible through a novel API, providing programmatic and customized access (http://www.evexdb.org/api/v001/. Finally, to allow for large-scale bioinformatic analyses, the entire resource is available for bulk download from

  8. Changes in Parthenogenetic Imprinting Patterns during Reprogramming by Cell Fusion.

    Directory of Open Access Journals (Sweden)

    Hyun Sik Jang

    Full Text Available Differentiated somatic cells can be reprogrammed into the pluripotent state by cell-cell fusion. In the pluripotent state, reprogrammed cells may then self-renew and differentiate into all three germ layers. Fusion-induced reprogramming also epigenetically modifies the somatic cell genome through DNA demethylation, X chromosome reactivation, and histone modification. In this study, we investigated whether fusion with embryonic stem cells (ESCs also reprograms genomic imprinting patterns in somatic cells. In particular, we examined imprinting changes in parthenogenetic neural stem cells fused with biparental ESCs, as well as in biparental neural stem cells fused with parthenogenetic ESCs. The resulting hybrid cells expressed the pluripotency markers Oct4 and Nanog. In addition, methylation of several imprinted genes except Peg3 was comparable between hybrid cells and ESCs. This finding indicates that reprogramming by cell fusion does not necessarily reverse the status of all imprinted genes to the state of pluripotent fusion partner.

  9. Distributed video data fusion and mining

    Science.gov (United States)

    Chang, Edward Y.; Wang, Yuan-Fang; Rodoplu, Volkan

    2004-09-01

    This paper presents an event sensing paradigm for intelligent event-analysis in a wireless, ad hoc, multi-camera, video surveillance system. In particilar, we present statistical methods that we have developed to support three aspects of event sensing: 1) energy-efficient, resource-conserving, and robust sensor data fusion and analysis, 2) intelligent event modeling and recognition, and 3) rapid deployment, dynamic configuration, and continuous operation of the camera networks. We outline our preliminary results, and discuss future directions that research might take.

  10. Semantic Context Detection Using Audio Event Fusion

    Directory of Open Access Journals (Sweden)

    Cheng Wen-Huang

    2006-01-01

    Full Text Available Semantic-level content analysis is a crucial issue in achieving efficient content retrieval and management. We propose a hierarchical approach that models audio events over a time series in order to accomplish semantic context detection. Two levels of modeling, audio event and semantic context modeling, are devised to bridge the gap between physical audio features and semantic concepts. In this work, hidden Markov models (HMMs are used to model four representative audio events, that is, gunshot, explosion, engine, and car braking, in action movies. At the semantic context level, generative (ergodic hidden Markov model and discriminative (support vector machine (SVM approaches are investigated to fuse the characteristics and correlations among audio events, which provide cues for detecting gunplay and car-chasing scenes. The experimental results demonstrate the effectiveness of the proposed approaches and provide a preliminary framework for information mining by using audio characteristics.

  11. Method for measurement of viral fusion kinetics at the single particle level

    NARCIS (Netherlands)

    Floyd, D.L.; Harrison, S.C.; Oijen, A.M. van

    2009-01-01

    Membrane fusion is an essential step during entry of enveloped viruses into cells. Conventional fusion assays typically report on a large number of fusion events, making it difficult to quantitatively analyze the sequence of the molecular steps involved. We have developed an in vitro, two-color

  12. Making memories of stressful events: a journey along epigenetic, gene transcription and signaling pathways

    Directory of Open Access Journals (Sweden)

    Johannes M.H.M. eReul

    2014-01-01

    Full Text Available Strong psychologically stressful events are known to have a long-lasting impact on behavior. The consolidation of such, largely adaptive, behavioral responses to stressful events involves changes in gene expression in limbic brain regions such as the hippocampus and amygdala. The underlying molecular mechanisms however were until recently unresolved. More than a decade ago we started to investigate the role of these hormones in signaling and epigenetic mechanisms participating in the effects of stress on gene transcription in hippocampal neurons. We discovered a novel, rapid non-genomic mechanism in which glucocorticoids via glucocorticoid receptors (GRs facilitate signaling of the ERK MAPK signaling pathway to the downstream nuclear kinases MSK1 and Elk-1 in dentate gyrus (DG granule neurons. Activation of this signaling pathway results in serine10 (S10 phosphorylation and lysine14 (K14 acetylation at histone H3 (H3S10p-K14ac, leading to the induction of the immediate early genes c-Fos and Egr-1. In addition, we found a role of the DNA methylation status of gene promoters. A series of studies showed that these molecular mechanisms play a critical role in the long-lasting consolidation of behavioral responses in the forced swim test and Morris water maze. Furthermore, an important role of GABA was found in controlling the epigenetic and gene transcriptional responses to psychological stress. Thus, psychologically stressful events evoke a long-term impact on behavior through changes in hippocampal function brought about by distinct glutamatergic and glucocorticoid-driven changes in epigenetic regulation of gene transcription which are modulated by (local GABAergic interneurons and limbic afferent inputs. These epigenetic processes may play an important role in the etiology of stress-related mental disorders such as major depressive and anxiety disorders like PTSD.

  13. Near- and sub-barrier fusion of 6He+40Ar

    International Nuclear Information System (INIS)

    Hinnefeld, J.D.; Kolata, J.J.; Belbot, M.; Lamkin, K.; Zahar, M.; Santi, P.; Kugi, J.

    1993-01-01

    A measurement of the fusion cross section for 6 He + 40 Ar near and below the Coulomb barrier has been performed using a 6 He beam from the UND/Um radioactive beam facility. The 6 He nucleus is thought to have a neutron skin surrounding a 6 He core. If this is the case, then Coulomb polarization of the core relative to the halo might result in neutron flow along a neck, and therefore to a large enhancement of the sub-barrier fusion cross section. 6 He nuclei, of incident energy 10.05 ± 0.44 MeV, were directed into a segmented ionization counter (MUSIC) filled with P10 at 40 torr. The 40 Ar in the detector gas served also as the target nuclei. 6 He energies in the 50-cm active length of the detector varied from 7.75 MeV down to 3.05 MeV. Calculations indicate that fusion events should be distinguishable from most non-fusion events on the basis of energy deposition patterns in the ten MUSIC detector segments. For some large-angle scattering events a more elaborate analysis involving detailed Monte Carlo simulation of the various reactions is necessary

  14. Development of Peptidomimetic Inhibitors of the ERG Gene Fusion Product in Prostate Cancer.

    Science.gov (United States)

    Wang, Xiaoju; Qiao, Yuanyuan; Asangani, Irfan A; Ateeq, Bushra; Poliakov, Anton; Cieślik, Marcin; Pitchiaya, Sethuramasundaram; Chakravarthi, Balabhadrapatruni V S K; Cao, Xuhong; Jing, Xiaojun; Wang, Cynthia X; Apel, Ingrid J; Wang, Rui; Tien, Jean Ching-Yi; Juckette, Kristin M; Yan, Wei; Jiang, Hui; Wang, Shaomeng; Varambally, Sooryanarayana; Chinnaiyan, Arul M

    2017-04-10

    Transcription factors play a key role in the development of diverse cancers, and therapeutically targeting them has remained a challenge. In prostate cancer, the gene encoding the transcription factor ERG is recurrently rearranged and plays a critical role in prostate oncogenesis. Here, we identified a series of peptides that interact specifically with the DNA binding domain of ERG. ERG inhibitory peptides (EIPs) and derived peptidomimetics bound ERG with high affinity and specificity, leading to proteolytic degradation of the ERG protein. The EIPs attenuated ERG-mediated transcription, chromatin recruitment, protein-protein interactions, cell invasion and proliferation, and tumor growth. Thus, peptidomimetic targeting of transcription factor fusion products may provide a promising therapeutic strategy for prostate cancer as well as other malignancies. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Laser fusion

    International Nuclear Information System (INIS)

    Eliezer, S.

    1982-02-01

    In this paper, the physics of laser fusion is described on an elementary level. The irradiated matter consists of a dense inner core surrounded by a less dense plasma corona. The laser radiation is mainly absorbed in the outer periphery of the plasma. The absorbed energy is transported inward to the ablation surface where plasma flow is created. Due to this plasma flow, a sequence of inward going shock waves and heat waves are created, resulting in the compression and heating of the core to high density and temperature. The interaction physics between laser and matter leading to thermonuclear burn is summarized by the following sequence of events: Laser absorption → Energy transport → Compression → Nuclear Fusion. This scenario is shown in particular for a Nd:laser with a wavelength of 1 μm. The wavelength scaling of the physical processes is also discussed. In addition to the laser-plasma physics, the Nd high power pulsed laser is described. We give a very brief description of the oscillator, the amplifiers, the spatial filters, the isolators and the diagnostics involved. Last, but not least, the concept of reactors for laser fusion and the necessary laser system are discussed. (author)

  16. End-to-end gene fusions and their impact on the production of multifunctional biomass degrading enzymes

    International Nuclear Information System (INIS)

    Rizk, Mazen; Antranikian, Garabed; Elleuche, Skander

    2012-01-01

    Highlights: ► Multifunctional enzymes offer an interesting approach for biomass degradation. ► Size and conformation of separate constructs play a role in the effectiveness of chimeras. ► A connecting linker allows for maximal flexibility and increased thermostability. ► Genes with functional similarities are the best choice for fusion candidates. -- Abstract: The reduction of fossil fuels, coupled with its increase in price, has made the search for alternative energy resources more plausible. One of the topics gaining fast interest is the utilization of lignocellulose, the main component of plants. Its primary constituents, cellulose and hemicellulose, can be degraded by a series of enzymes present in microorganisms, into simple sugars, later used for bioethanol production. Thermophilic bacteria have proven to be an interesting source of enzymes required for hydrolysis since they can withstand high and denaturing temperatures, which are usually required for processes involving biomass degradation. However, the cost associated with the whole enzymatic process is staggering. A solution for cost effective and highly active production is through the construction of multifunctional enzyme complexes harboring the function of more than one enzyme needed for the hydrolysis process. There are various strategies for the degradation of complex biomass ranging from the regulation of the enzymes involved, to cellulosomes, and proteins harboring more than one enzymatic activity. In this review, the construction of multifunctional biomass degrading enzymes through end-to-end gene fusions, and its impact on production and activity by choosing the enzymes and linkers is assessed.

  17. The Influence of Major Life Events on Economic Attitudes in a World of Gene-Environment Interplay.

    Science.gov (United States)

    Hatemi, Peter K

    2013-10-01

    The role of "genes" on political attitudes has gained attention across disciplines. However, person-specific experiences have yet to be incorporated into models that consider genetic influences. Relying on a gene-environment interplay approach, this study explicates how life-events, such as losing one's job or suffering a financial loss, influence economic policy attitudes. The results indicate genetic and environmental variance on support for unions, immigration, capitalism, socialism and property tax is moderated by financial risks. Changes in the magnitude of genetic influences, however, are temporary. After two years, the phenotypic effects of the life events remain on most attitudes, but changes in the sources of individual differences do not. Univariate twin models that estimate the independent contributions of genes and environment on the variation of attitudes appear to provide robust baseline indicators of sources of individual differences. These estimates, however, are not event or day specific. In this way, genetic influences add stability, while environment cues change, and this process is continually updated.

  18. Global epigenomic analysis indicates protocadherin-7 activates osteoclastogenesis by promoting cell–cell fusion

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Haruhiko [Department of Orthopaedic Surgery, Faculty of Medicine, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033 (Japan); Department of Cell Signaling, Graduate School of Medical and Dental Science, Tokyo Medical and Dental University, Yushima 1-5-45, Bunkyo-ku, Tokyo 113-8549 (Japan); Nakashima, Tomoki [Department of Cell Signaling, Graduate School of Medical and Dental Science, Tokyo Medical and Dental University, Yushima 1-5-45, Bunkyo-ku, Tokyo 113-8549 (Japan); Japan Science and Technology Agency, PRESTO, Yushima 1-5-45, Bunkyo-ku, Tokyo 113-8549 (Japan); Hayashi, Mikihito [Department of Cell Signaling, Graduate School of Medical and Dental Science, Tokyo Medical and Dental University, Yushima 1-5-45, Bunkyo-ku, Tokyo 113-8549 (Japan); Japan Science and Technology Agency, ERATO, Takayanagi Osteonetwork Project, 7-3-1, Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Izawa, Naohiro; Yasui, Tetsuro [Department of Orthopaedic Surgery, Faculty of Medicine, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033 (Japan); Aburatani, Hiroyuki [Genome Science Division, Research Center for Advanced Science and Technology, The University of Tokyo, 4-6-1, Komaba, Meguro-ku, Tokyo 153-8904 (Japan); Tanaka, Sakae [Department of Orthopaedic Surgery, Faculty of Medicine, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033 (Japan); Takayanagi, Hiroshi, E-mail: takayana@m.u-tokyo.ac.jp [Japan Science and Technology Agency, ERATO, Takayanagi Osteonetwork Project, 7-3-1, Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Department of Immunology, Graduate School of Medicine and Faculty of Medicine, The University of Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan)

    2014-12-12

    Highlights: • Identification of epigenetically regulated genes during osteoclastogenesis. • Pcdh7 is regulated by H3K4me3 and H3K27me3 during osteoclastogenesis. • Pcdh7 expression is increased by RANKL during osteoclastogenesis. • Establishment of novel cell fusion analysis for osteoclasts by imaging cytometer. • Pcdh7 regulates osteoclastogenesis by promoting cell fusion related gene expressions. - Abstract: Gene expression is dependent not only on genomic sequences, but also epigenetic control, in which the regulation of chromatin by histone modification plays a crucial role. Histone H3 lysine 4 trimethylation (H3K4me3) and histone H3 lysine 27 trimethylation (H3K27me3) are related to transcriptionally activated and silenced sequences, respectively. Osteoclasts, the multinucleated cells that resorb bone, are generated by the fusion of precursor cells of monocyte/macrophage lineage. To elucidate the molecular and epigenetic regulation of osteoclast differentiation, we performed a chromatin immunoprecipitation sequencing (ChIP-seq) analysis for H3K4me3 and H3K27me3 in combination with RNA sequencing. We focused on the histone modification change from H3K4me3(+)H3K27me3(+) to H3K4me3(+)H3K27me3(–) and identified the protocadherin-7 gene (Pcdh7) to be among the genes epigenetically regulated during osteoclastogenesis. Pcdh7 was induced by RANKL stimulation in an NFAT-dependent manner. The knockdown of Pcdh7 inhibited RANKL-induced osteoclast differentiation due to the impairment of cell–cell fusion, accompanied by a decreased expression of the fusion-related genes Dcstamp, Ocstamp and Atp6v0d2. This study demonstrates that Pcdh7 plays a key role in osteoclastogenesis by promoting cell–cell fusion.

  19. Global epigenomic analysis indicates protocadherin-7 activates osteoclastogenesis by promoting cell–cell fusion

    International Nuclear Information System (INIS)

    Nakamura, Haruhiko; Nakashima, Tomoki; Hayashi, Mikihito; Izawa, Naohiro; Yasui, Tetsuro; Aburatani, Hiroyuki; Tanaka, Sakae; Takayanagi, Hiroshi

    2014-01-01

    Highlights: • Identification of epigenetically regulated genes during osteoclastogenesis. • Pcdh7 is regulated by H3K4me3 and H3K27me3 during osteoclastogenesis. • Pcdh7 expression is increased by RANKL during osteoclastogenesis. • Establishment of novel cell fusion analysis for osteoclasts by imaging cytometer. • Pcdh7 regulates osteoclastogenesis by promoting cell fusion related gene expressions. - Abstract: Gene expression is dependent not only on genomic sequences, but also epigenetic control, in which the regulation of chromatin by histone modification plays a crucial role. Histone H3 lysine 4 trimethylation (H3K4me3) and histone H3 lysine 27 trimethylation (H3K27me3) are related to transcriptionally activated and silenced sequences, respectively. Osteoclasts, the multinucleated cells that resorb bone, are generated by the fusion of precursor cells of monocyte/macrophage lineage. To elucidate the molecular and epigenetic regulation of osteoclast differentiation, we performed a chromatin immunoprecipitation sequencing (ChIP-seq) analysis for H3K4me3 and H3K27me3 in combination with RNA sequencing. We focused on the histone modification change from H3K4me3(+)H3K27me3(+) to H3K4me3(+)H3K27me3(–) and identified the protocadherin-7 gene (Pcdh7) to be among the genes epigenetically regulated during osteoclastogenesis. Pcdh7 was induced by RANKL stimulation in an NFAT-dependent manner. The knockdown of Pcdh7 inhibited RANKL-induced osteoclast differentiation due to the impairment of cell–cell fusion, accompanied by a decreased expression of the fusion-related genes Dcstamp, Ocstamp and Atp6v0d2. This study demonstrates that Pcdh7 plays a key role in osteoclastogenesis by promoting cell–cell fusion

  20. The international magnetic fusion energy program

    International Nuclear Information System (INIS)

    Fowler, T.K.

    1988-01-01

    In May of 1988, the long tradition of international cooperation in magnetic fusion energy research culminated in the initiation of design work on the International Thermonuclear Experimental Reactor (ITER). If eventually constructed in the 1990s, ITER would be the world's first magnetic fusion reactor. This paper discusses the background events that led to ITER and the present status of the ITER activity. This paper presents a brief summary of the technical, political, and organizational activities that have led to the creation of the ITER design activity. The ITER activity is now the main focus of international cooperation in magnetic fusion research and one of the largest international cooperative efforts in all of science. 2 refs., 12 figs

  1. Event tree analysis for the system of hybrid reactor

    International Nuclear Information System (INIS)

    Yang Yongwei; Qiu Lijian

    1993-01-01

    The application of probabilistic risk assessment for fusion-fission hybrid reactor is introduced. A hybrid reactor system has been analysed using event trees. According to the character of the conceptual design of Hefei Fusion-fission Experimental Hybrid Breeding Reactor, the probabilities of the event tree series induced by 4 typical initiating events were calculated. The results showed that the conceptual design is safe and reasonable. through this paper, the safety character of hybrid reactor system has been understood more deeply. Some suggestions valuable to safety design for hybrid reactor have been proposed

  2. Genetically Controlled Fusion, Exocytosis and Fission of Artificial Vesicles

    DEFF Research Database (Denmark)

    Bönzli, Eva; Hadorn, Maik; De Lucrezia, Davide

    if a special class of viral proteins, termed fusogenic peptides, were added to the external medium. In the present work, we intend to develop genetically controlled fusion, fission and exocytosis of vesicles by the synthesis of peptides within vesicles. First, we enclosed synthesized peptides in vesicles...... to induce in a next step fusion of adjacent vesicles, fission and exocytosis of nested vesicles. Second, we will replace the peptides by an enclosed cell-free expression system to internally synthesize fusion peptides. To control the gene expression, different mechanisms are available, e.g. addition...... fusion, fission and exocytosis....

  3. Pandemic H1N1 influenza A directly induces a robust and acute inflammatory gene signature in primary human bronchial epithelial cells downstream of membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Paquette, Stéphane G. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Institute of Medical Science, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada); Banner, David [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Chi, Le Thi Bao [Department of Microbiology, Hue University of Medicine and Pharmacy, Thua Thien Hue (Viet Nam); Carlo Urbani Centre, Hue University of Medicine and Pharmacy, Thua Thien Hue (Viet Nam); Leon, Alberto J. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); International Institute of Infection and Immunity, Shantou University Medical College, Shantou, Guangdong (China); Xu, Luoling; Ran, Longsi [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Huang, Stephen S.H. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Department of Immunology, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada); Farooqui, Amber [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); International Institute of Infection and Immunity, Shantou University Medical College, Shantou, Guangdong (China); and others

    2014-01-05

    Pandemic H1N1 influenza A (H1N1pdm) elicits stronger pulmonary inflammation than previously circulating seasonal H1N1 influenza A (sH1N1), yet mechanisms of inflammatory activation in respiratory epithelial cells during H1N1pdm infection are unclear. We investigated host responses to H1N1pdm/sH1N1 infection and virus entry mechanisms in primary human bronchial epithelial cells in vitro. H1N1pdm infection rapidly initiated a robust inflammatory gene signature (3 h post-infection) not elicited by sH1N1 infection. Protein secretion inhibition had no effect on gene induction. Infection with membrane fusion deficient H1N1pdm failed to induce robust inflammatory gene expression which was rescued with restoration of fusion ability, suggesting H1N1pdm directly triggered the inflammatory signature downstream of membrane fusion. Investigation of intra-virion components revealed H1N1pdm viral RNA (vRNA) triggered a stronger inflammatory phenotype than sH1N1 vRNA. Thus, our study is first to report H1N1pdm induces greater inflammatory gene expression than sH1N1 in vitro due to direct virus–epithelial cell interaction. - Highlights: • We investigated H1N1pdm/sH1N1 infection in primary epithelial cells. • H1N1pdm directly initiated a robust inflammatory gene signature, sH1N1 did not. • H1N1pdm viral RNA triggered a stronger response than sH1N1. • H1N1pdm induces greater response due to direct virus–cell interaction. • These results have potential to impact vaccine and therapeutic development.

  4. Pandemic H1N1 influenza A directly induces a robust and acute inflammatory gene signature in primary human bronchial epithelial cells downstream of membrane fusion

    International Nuclear Information System (INIS)

    Paquette, Stéphane G.; Banner, David; Chi, Le Thi Bao; Leon, Alberto J.; Xu, Luoling; Ran, Longsi; Huang, Stephen S.H.; Farooqui, Amber

    2014-01-01

    Pandemic H1N1 influenza A (H1N1pdm) elicits stronger pulmonary inflammation than previously circulating seasonal H1N1 influenza A (sH1N1), yet mechanisms of inflammatory activation in respiratory epithelial cells during H1N1pdm infection are unclear. We investigated host responses to H1N1pdm/sH1N1 infection and virus entry mechanisms in primary human bronchial epithelial cells in vitro. H1N1pdm infection rapidly initiated a robust inflammatory gene signature (3 h post-infection) not elicited by sH1N1 infection. Protein secretion inhibition had no effect on gene induction. Infection with membrane fusion deficient H1N1pdm failed to induce robust inflammatory gene expression which was rescued with restoration of fusion ability, suggesting H1N1pdm directly triggered the inflammatory signature downstream of membrane fusion. Investigation of intra-virion components revealed H1N1pdm viral RNA (vRNA) triggered a stronger inflammatory phenotype than sH1N1 vRNA. Thus, our study is first to report H1N1pdm induces greater inflammatory gene expression than sH1N1 in vitro due to direct virus–epithelial cell interaction. - Highlights: • We investigated H1N1pdm/sH1N1 infection in primary epithelial cells. • H1N1pdm directly initiated a robust inflammatory gene signature, sH1N1 did not. • H1N1pdm viral RNA triggered a stronger response than sH1N1. • H1N1pdm induces greater response due to direct virus–cell interaction. • These results have potential to impact vaccine and therapeutic development

  5. International research co-operation in the field of controlled thermonuclear fusion

    International Nuclear Information System (INIS)

    2004-01-01

    This 26th report by the Swiss Federal Office for Education and Science presents a review of work done in Swiss institutes in 2003 as part of international research into thermonuclear fusion. A broad outline of the project and of its significance within the wider field of thermonuclear fusion research is given. This is followed by a review of the significant events in the world of fusion research, with emphasis placed on ITER and on the EURATOM fusion programme. A further chapter summarises events in Switzerland in 2003 and the report closes with a list of contacts for more information. Three annexes provide information on the current situation in fusion research, as well as scientific and technical highlights of the work performed in 2003 at the Plasma Physics Research Centre CRPP at the Federal Institute of Technology EPFL in Lausanne, Switzerland. Annex 3 reports on results obtained at the Physics Institute of the University of Basle. The annexes are for the benefit of the technically and scientifically versed reader, and brief summaries of them are given in the main body of the report

  6. The international magnetic fusion energy program

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, T.K.

    1988-10-06

    In May of 1988, the long tradition of international cooperation in magnetic fusion energy research culminated in the initiation of design work on the International Thermonuclear Experimental Reactor (ITER). If eventually constructed in the 1990s, ITER would be the world's first magnetic fusion reactor. This paper discusses the background events that led to ITER and the present status of the ITER activity. This paper presents a brief summary of the technical, political, and organizational activities that have led to the creation of the ITER design activity. The ITER activity is now the main focus of international cooperation in magnetic fusion research and one of the largest international cooperative efforts in all of science. 2 refs., 12 figs.

  7. Myoblast fusion in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Haralalka, Shruti [Stowers Institute for Medical Research, Kansas City, MO 64110 (United States); Abmayr, Susan M., E-mail: sma@stowers.org [Stowers Institute for Medical Research, Kansas City, MO 64110 (United States); Department of Anatomy and Cell Biology, University of Kansas Medical Center, Kansas City, MO 66160 (United States)

    2010-11-01

    The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

  8. Myoblast fusion in Drosophila

    International Nuclear Information System (INIS)

    Haralalka, Shruti; Abmayr, Susan M.

    2010-01-01

    The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

  9. A novel spliced fusion of MLL with CT45A2 in a pediatric biphenotypic acute leukemia

    International Nuclear Information System (INIS)

    Cerveira, Nuno; Marschalek, Rolf; Teixeira, Manuel R; Meyer, Claus; Santos, Joana; Torres, Lurdes; Lisboa, Susana; Pinheiro, Manuela; Bizarro, Susana; Correia, Cecília; Norton, Lucília

    2010-01-01

    Abnormalities of 11q23 involving the MLL gene are found in approximately 10% of human leukemias. To date, nearly 100 different chromosome bands have been described in rearrangements involving 11q23 and 64 fusion genes have been cloned and characterized at the molecular level. In this work we present the identification of a novel MLL fusion partner in a pediatric patient with de novo biphenotypic acute leukemia. Cytogenetics, fluorescence in situ hybridization (FISH), molecular studies (RT-PCR and LDI-PCR), and bioinformatic sequence analysis were used to characterize the CT45A2 gene as novel MLL fusion partner in pediatric acute leukemia. Fluorescence in situ hybridization of bone marrow G-banded metaphases demonstrated a cryptic insertion of 11q23 in Xq26.3 involving the MLL gene. Breakpoint fusion analysis revealed that a DNA fragment of 653 kb from 11q23, containing MLL exons 1-9 in addition to 16 other 11q23 genes, was inserted into the upstream region of the CT45A2 gene located at Xq26.3. In addition, a deletion at Xq26.3 encompassing the 3' region of the DDX26B gene (exons 9-16) and the entire CT45A1 gene was identified. RNA analysis revealed the presence of a novel MLL-CT45A2 fusion transcript in which the first 9 exons of the MLL gene were fused in-frame to exon 2 of the CT45A2 gene, resulting in a spliced MLL fusion transcript with an intact open reading frame. The resulting chimeric transcript predicts a fusion protein where the N-terminus of MLL is fused to the entire open reading frame of CT45A2. Finally, we demonstrate that all breakpoint regions are rich in long repetitive motifs, namely LINE/L1 and SINE/Alu sequences, but all breakpoints were exclusively identified outside these repetitive DNA sequences. We have identified CT45A2 as a novel spliced MLL fusion partner in a pediatric patient with de novo biphenotypic acute leukemia, as a result of a cryptic insertion of 11q23 in Xq26.3. Since CT45A2 is the first Cancer/Testis antigen family gene

  10. Matrix metalloproteinase-9 (MMP9) is involved in the TNF-α-induced fusion of human M13SV1-Cre breast epithelial cells and human MDA-MB-435-pFDR1 cancer cells.

    Science.gov (United States)

    Weiler, Julian; Mohr, Marieke; Zänker, Kurt S; Dittmar, Thomas

    2018-04-10

    In addition to physiological events such as fertilisation, placentation, osteoclastogenesis, or tissue regeneration/wound healing, cell fusion is involved in pathophysiological conditions such as cancer. Cell fusion, which applies to both the proteins and conditions that induce the merging of two or more cells, is not a fully understood process. Inflammation/pro-inflammatory cytokines might be a positive trigger for cell fusion. Using a Cre-LoxP-based cell fusion assay we demonstrated that the fusion between human M13SV1-Cre breast epithelial cells and human MDA-MB-435-pFDR1 cancer cells was induced by the pro-inflammatory cytokine tumour necrosis factor-α (TNF-α). The gene expression profile of the cells in the presence of TNF-α and under normoxic and hypoxic conditions was analysed by cDNA microarray analysis. cDNA microarray data were verified by qPCR, PCR, Western blot and zymography. Quantification of cell fusion events was determined by flow cytometry. Proteins of interest were either blocked or knocked-down using a specific inhibitor, siRNA or a blocking antibody. The data showed an up-regulation of various genes, including claudin-1 (CLDN1), ICAM1, CCL2 and MMP9 in M13SV1-Cre and/or MDA-MB-435-pFDR1 cells. Inhibition of these proteins using a blocking ICAM1 antibody, CLDN1 siRNA or an MMP9 inhibitor showed that only the blockage of MMP9 was correlated with a decreased fusion rate of the cells. Likewise, the tetracycline-based antibiotic minocycline, which exhibits anti-inflammatory properties, was also effective in both inhibiting the TNF-α-induced MMP9 expression in M13SV1-Cre cells and blocking the TNF-α-induced fusion frequency of human M13SV1-Cre breast epithelial cells and human MDA-MB-435-pFDR1 cancer cells. The matrix metalloproteinase-9 (MMP9) is most likely involved in the TNF-α-mediated fusion of human M13SV1-Cre breast epithelial cells and human MDA-MB-435-pFDR1 cancer cells. Likewise, our data indicate that the tetracycline

  11. Fusion technology 1998

    International Nuclear Information System (INIS)

    Beaumont, B.; Libeyre, P.; Gentile, B. de; Tonon, G.

    1998-01-01

    The Symposium On Fusion Technology (SOFT) is held every two years with the objective to set the stage for the exchange of information on the design, construction and operation of fusion experiments and on the technology which is being developed for the next step devices and fusion reactors. By decision of the International Organizing Committee, the 20. SOFT includes invited talks, and oral and poster contributions in the following topics: plasma facing components, plasma heating and current drive, plasma engineering and control, experimental systems and diagnostics, magnets and power supplies, fuel technologies, remote operation, blanket and shield technologies, safety and environment, and system engineering and future devices. This symposium differs from the previous ones of this series by the way the present proceedings are produced. In order to have the written material available to the participants and the community at the nearest to the conference event, the papers have been collected 2 months in advance and printed in the present books. The goal was to deliver them to each participant upon arrival to the conference centre. These books contain all the papers corresponding to poster presentation, and the abstracts of the oral contributions and invited papers. The papers corresponding to these presentations, both oral and invited, will be published in 1999, after a standard review process, in a supplement of Fusion Engineering and Design. (author)

  12. Reprogramming of somatic cells induced by fusion of embryonic stem cells using hemagglutinating virus of Japan envelope (HVJ-E)

    International Nuclear Information System (INIS)

    Yue, Xiao-shan; Fujishiro, Masako; Toyoda, Masashi; Akaike, Toshihiro; Ito, Yoshihiro

    2010-01-01

    In this research, hemagglutinating virus of Japan envelope (HVJ-E) was used to reprogram somatic cells by fusion with mouse embryonic stem (ES) cells. Neomycin-resistant mouse embryonic fibroblasts (MEFs) were used as somatic cells. Nanog-overexpressing puromycin-resistant EB3 cells were used as mouse ES cells. These two cells were fused by exposing to HVJ-E and the generated fusion cells were selected by puromycin and G418 to get the stable fusion cell line. The fusion cells form colonies in feeder-free culture system. Microsatellite analysis of the fusion cells showed that they possessed genes from both ES cells and fibroblasts. The fusion cells were tetraploid, had alkali phosphatase activity, and expressed stem cell marker genes such as Pou5f1, Nanog, and Sox2, but not the fibroblast cell marker genes such as Col1a1 and Col1a2. The pluripotency of fusion cells was confirmed by their expression of marker genes for all the three germ layers after differentiation induction, and by their ability to form teratoma which contained all the three primary layers. Our results show that HVJ-E can be used as a fusion reagent for reprogramming of somatic cells.

  13. Reprogramming of somatic cells induced by fusion of embryonic stem cells using hemagglutinating virus of Japan envelope (HVJ-E)

    Energy Technology Data Exchange (ETDEWEB)

    Yue, Xiao-shan [Nano Medical Engineering Laboratory, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Department of Biomolecular Engineering, Graduate School of Bioscience and Technology, Tokyo Institute of Technology, Nagatsuta-cho, Midori-ku, Yokohama-shi, Kanagawa 226-8501 (Japan); Fujishiro, Masako [Nano Medical Engineering Laboratory, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Toyoda, Masashi [Department of Reproductive Biology, National Institute for Child Health and Development, 2-10-1, Okura, Setagaya-ku, Tokyo 157-8535 (Japan); Akaike, Toshihiro [Department of Biomolecular Engineering, Graduate School of Bioscience and Technology, Tokyo Institute of Technology, Nagatsuta-cho, Midori-ku, Yokohama-shi, Kanagawa 226-8501 (Japan); Ito, Yoshihiro, E-mail: y-ito@riken.jp [Nano Medical Engineering Laboratory, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Department of Biomolecular Engineering, Graduate School of Bioscience and Technology, Tokyo Institute of Technology, Nagatsuta-cho, Midori-ku, Yokohama-shi, Kanagawa 226-8501 (Japan)

    2010-04-16

    In this research, hemagglutinating virus of Japan envelope (HVJ-E) was used to reprogram somatic cells by fusion with mouse embryonic stem (ES) cells. Neomycin-resistant mouse embryonic fibroblasts (MEFs) were used as somatic cells. Nanog-overexpressing puromycin-resistant EB3 cells were used as mouse ES cells. These two cells were fused by exposing to HVJ-E and the generated fusion cells were selected by puromycin and G418 to get the stable fusion cell line. The fusion cells form colonies in feeder-free culture system. Microsatellite analysis of the fusion cells showed that they possessed genes from both ES cells and fibroblasts. The fusion cells were tetraploid, had alkali phosphatase activity, and expressed stem cell marker genes such as Pou5f1, Nanog, and Sox2, but not the fibroblast cell marker genes such as Col1a1 and Col1a2. The pluripotency of fusion cells was confirmed by their expression of marker genes for all the three germ layers after differentiation induction, and by their ability to form teratoma which contained all the three primary layers. Our results show that HVJ-E can be used as a fusion reagent for reprogramming of somatic cells.

  14. Analysis artefacts of the INS-IGF2 fusion transcript

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Frogne, Thomas; Rescan, Claude

    2015-01-01

    Background: In gene expression analysis, overlapping genes, splice variants, and fusion transcripts are potential sources of data analysis artefacts, depending on how the observed intensity is assigned to one, or more genes. We here exemplify this by an in-depth analysis of the INS-IGF2 fusion...... transcript, which has recently been reported to be among the highest expressed transcripts in human pancreatic beta cells and its protein indicated as a novel autoantigen in Type 1 Diabetes. Results: Through RNA sequencing and variant specific qPCR analyses we demonstrate that the true abundance of INS-IGF2...... is >20,000 fold lower than INS in human beta cells, and we suggest an explanation to the nature of the artefacts which have previously led to overestimation of the gene expression level in selected studies. We reinvestigated the previous reported findings of detection of INS-IGF2 using antibodies both...

  15. PAX-FOXO1 fusion status drives unfavorable outcome for children with rhabdomyosarcoma: a children's oncology group report.

    Science.gov (United States)

    Skapek, Stephen X; Anderson, James; Barr, Frederic G; Bridge, Julia A; Gastier-Foster, Julie M; Parham, David M; Rudzinski, Erin R; Triche, Timothy; Hawkins, Douglas S

    2013-09-01

    Rhabdomyosarcoma (RMS) is divided into two major histological subtypes: alveolar (ARMS) and embryonal (ERMS), with most ARMS expressing one of two oncogenic genes fusing PAX3 or PAX7 with FOXO1 (P3F and P7F, respectively). The Children's Oncology Group (COG) carried out a multi-institutional clinical trial to evaluate the prognostic value of PAX-FOXO1 fusion status. Study participants were treated on COG protocol D9803 for intermediate risk ARMS or ERMS using multi-agent chemotherapy, radiotherapy, and surgery. Central diagnostic pathology review and molecular testing for fusion genes were carried out on prospectively collected specimens. Event-free (EFS) and overall survival (OS) at 5 years were correlated with histological subtype and PAX-FOXO1 status. Of 616 eligible D9803 enrollees, 434 cases had adequate clinical, molecular, and pathology data for definitive classification as ERMS, ARMS P3F+ or P7F+, or ARMSn (without detectable fusion). EFS was worse for those with ARMS P3F+ (54%) and P7F+ (65%) than those with ERMS (77%; P < 0.001). EFS for ARMSn and ERMS were not statistically different (90% vs. 77%, P = 0.15). ARMS P3F+ had poorer OS (64%) than ARMS P7F+ (87%), ARMSn (89%), and ERMS (82%; P = 0.006). ARMSn has an outcome similar to ERMS and superior EFS compared to ARMS with either P3F or P7F, when given therapy designed for children with intermediate risk RMS. This prospective analysis supports incorporation of PAX-FOXO1 fusion status into risk stratification and treatment allocation. Copyright © 2013 Wiley Periodicals, Inc.

  16. Safety analyses for transient behavior of plasma and in-vessel components during plasma abnormal events in fusion reactor

    International Nuclear Information System (INIS)

    Honda, Takuro; Okazaki, Takashi; Bartels, H.W.; Uckan, N.A.; Seki, Yasushi.

    1997-01-01

    Safety analyses on plasma abnormal events have been performed using a hybrid code of a plasma dynamics model and a heat transfer model of in-vessel components. Several abnormal events, e.g., increase in fueling rate, were selected for the International Thermonuclear Experimental Reactor (ITER) and transient behavior of the plasma and the invessel components during the events was analyzed. The physics model for safety analysis was conservatively prepared. In most cases, the plasma is terminated by a disruption or it returns to the original operation point. When the energy confinement improves by a factor of 2.0 in the steady state, which is a hypothetical assumption under the present plasma data, the maximum fusion power reaches about 3.3 GW at about 3.6 s and the plasma is terminated due to a disruption. However, the results obtained in this study show the confinement boundary of ITER can be kept almost intact during the abnormal plasma transients, as long as the cooling system works normally. Several parametric studies are needed to comprehend the overpower transient including structure behavior, since many uncertainties are connected to the filed of the plasma physics. And, future work will need to discuss the burn control scenario considering confinement mode transition, system specifications, experimental plans and safety regulations, etc. to confirm the safety related to the plasma anomaly. (author)

  17. p-Glycoprotein ABCB5 and YB-1 expression plays a role in increased heterogeneity of breast cancer cells: correlations with cell fusion and doxorubicin resistance

    International Nuclear Information System (INIS)

    Yang, Ji Yeon; Ha, Seon-Ah; Yang, Yun-Sik; Kim, Jin Woo

    2010-01-01

    Cancer cells recurrently develop into acquired resistance to the administered drugs. The iatrogenic mechanisms of induced chemotherapy-resistance remain elusive and the degree of drug resistance did not exclusively correlate with reductions of drug accumulation, suggesting that drug resistance may involve additional mechanisms. Our aim is to define the potential targets, that makes drug-sensitive MCF-7 breast cancer cells turn to drug-resistant, for the anti-cancer drug development against drug resistant breast cancer cells. Doxorubicin resistant human breast MCF-7 clones were generated. The doxorubicin-induced cell fusion events were examined. Heterokaryons were identified and sorted by FACS. In the development of doxorubicin resistance, cell-fusion associated genes, from the previous results of microarray, were verified using dot blot array and quantitative RT-PCR. The doxorubicin-induced expression patterns of pro-survival and pro-apoptotic genes were validated. YB-1 and ABCB5 were up regulated in the doxorubicin treated MCF-7 cells that resulted in certain degree of genomic instability that accompanied by the drug resistance phenotype. Cell fusion increased diversity within the cell population and doxorubicin resistant MCF-7 cells emerged probably through clonal selection. Most of the drug resistant hybrid cells were anchorage independent. But some of the anchorage dependent MCF-7 cells exhibited several unique morphological appearances suggesting minor population of the fused cells maybe de-differentiated and have progenitor cell like characteristics. Our work provides valuable insight into the drug induced cell fusion event and outcome, and suggests YB-1, GST, ABCB5 and ERK3 could be potential targets for the anti-cancer drug development against drug resistant breast cancer cells. Especially, the ERK-3 serine/threonine kinase is specifically up-regulated in the resistant cells and known to be susceptible to synthetic antagonists

  18. Essential Role of DAP12 Signaling in Macrophage Programming into a Fusion-Competent State

    Science.gov (United States)

    Helming, Laura; Tomasello, Elena; Kyriakides, Themis R.; Martinez, Fernando O.; Takai, Toshiyuki; Gordon, Siamon; Vivier, Eric

    2009-01-01

    Multinucleated giant cells, formed by fusion of macrophages, are a hallmark of granulomatous inflammation. With a genetic approach, we show that signaling through the adaptor protein DAP12 (DNAX activating protein of 12 kD), its associated receptor triggering receptor expressed by myeloid cells 2 (TREM-2), and the downstream protein tyrosine kinase Syk is required for the cytokine-induced formation of giant cells and that overexpression of DAP12 potentiates macrophage fusion. We also present evidence that DAP12 is a general macrophage fusion regulator and is involved in modulating the expression of several macrophage-associated genes, including those encoding known mediators of macrophage fusion, such as DC-STAMP and Cadherin 1. Thus, DAP12 is involved in programming of macrophages through the regulation of gene and protein expression to induce a fusion-competent state. PMID:18957693

  19. Transcriptomic Profiling and Functional Characterization of Fusion Genes in Recurrent Ovarian Cancer

    Science.gov (United States)

    2017-09-01

    late lesion (Figure 1A). 152 fusions were predicted to produce an in-frame, chimeric protein—48 being acquired in late disease and 55 being...recurrence, fusions of particular interest included an acquired WNT2-CTTNBP2 in case OVCA_04, which retained a Wnt signaling peptide in the N-terminal

  20. The interaction of combined effects of the BDNF and PRKCG genes and negative life events in major depressive disorder.

    Science.gov (United States)

    Yang, Chunxia; Sun, Ning; Liu, Zhifen; Li, Xinrong; Xu, Yong; Zhang, Kerang

    2016-03-30

    Major depressive disorder (MDD) is a mental disorder that results from complex interplay between multiple and partially overlapping sets of susceptibility genes and environmental factors. The brain derived neurotrophic factor (BDNF) and Protein kinase C gamma type (PRKCG) are logical candidate genes in MDD. Among diverse environmental factors, negative life events have been suggested to exert a crucial impact on brain development. In the present study, we hypothesized that interactions between genetic variants in BDNF and PRKCG and negative life events may play an important role in the development of MDD. We recruited a total of 406 patients with MDD and 391 age- and gender-matched control subjects. Gene-environment interactions were analyzed using generalized multifactor dimensionality reduction (GMDR). Under a dominant model, we observed a significant three-way interaction among BDNF rs6265, PRKCG rs3745406, and negative life events. The gene-environment combination of PRKCG rs3745406 C allele, BDNF rs6265 G allele and high level of negative life events (C-G-HN) was significantly associated with MDD (OR, 5.97; 95% CI, 2.71-13.15). To our knowledge, this is the first report of evidence that the BDNF-PRKCG interaction may modify the relationship between negative life events and MDD in the Chinese population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. Lister vaccine strain of vaccinia virus armed with the endostatin-angiostatin fusion gene: an oncolytic virus superior to dl1520 (ONYX-015) for human head and neck cancer.

    Science.gov (United States)

    Tysome, James R; Wang, Pengju; Alusi, Ghassan; Briat, Arnaud; Gangeswaran, Rathi; Wang, Jiwei; Bhakta, Vipul; Fodor, Istvan; Lemoine, Nick R; Wang, Yaohe

    2011-09-01

    Oncolytic viral therapy represents a promising strategy for the treatment of head and neck squamous cell carcinoma (HNSCC), with dl1520 (ONYX-015) the most widely used oncolytic adenovirus in clinical trials. This study aimed to determine the effectiveness of the Lister vaccine strain of vaccinia virus as well as a vaccinia virus armed with the endostatin-angiostatin fusion gene (VVhEA) as a novel therapy for HNSCC and to compare them with dl1520. The potency and replication of the Lister strain and VVhEA and the expression and function of the fusion protein were determined in human HNSCC cells in vitro and in vivo. Finally, the efficacy of VVhEA was compared with dl1520 in vivo in a human HNSCC model. The Lister vaccine strain of vaccinia virus was more effective than the adenovirus against all HNSCC cell lines tested in vitro. Although the potency of VVhEA was attenuated in vitro, the expression and function of the endostatin-angiostatin fusion protein was confirmed in HNSCC models both in vitro and in vivo. This novel vaccinia virus (VVhEA) demonstrated superior antitumor potency in vivo compared with both dl1520 and the control vaccinia virus. This study suggests that the Lister strain vaccinia virus armed with an endostatin-angiostatin fusion gene may be a potential therapeutic agent for HNSCC.

  2. Diagnosis of extraskeletal myxoid chondrosarcoma in the thigh using EWSR1-NR4A3 gene fusion: a case report.

    Science.gov (United States)

    Kobayashi, Hiroki; Kikuta, Kazutaka; Sekita, Tetsuya; Susa, Michiro; Nishimoto, Kazumasa; Sasaki, Aya; Kameyama, Kaori; Sugita, Shintaro; Hasegawa, Tadashi; Nakamura, Masaya; Matsumoto, Morio; Morioka, Hideo

    2016-11-10

    Extraskeletal myxoid chondrosarcoma is a rare soft tissue sarcoma that has unusual ultrastructural and molecular features. However, unlike other soft tissue sarcomas, it does not have specific clinical symptoms or radiological features, which can make its diagnosis difficult. Nevertheless, extraskeletal myxoid chondrosarcoma has a rare gene fusion (EWSR1-NR4A3) that is useful for making a differential diagnosis. A 43-year-old Japanese man presented with a soft tissue mass in his right thigh. A physical examination and radiography revealed a large soft tissue mass. During magnetic resonance imaging, the mass exhibited isointensity on T1-weighted images and high intensity on T2-weighted images, as well as gadolinium enhancement at the side edge of the partition structure. Thus, we considered a possible diagnosis of a malignant myxoid soft tissue tumor, such as myxoid liposarcoma, myxofibrosarcoma, or metastatic carcinomas, including myoepithelial tumor and neuroendocrine tumor, and performed an incisional biopsy to make a definitive diagnosis. The pathological findings revealed a lobulated tumor with a myxoid structure and atypical spindle-shaped cells that created eosinophilic cord-like forms. Immunohistochemistry revealed that the tumor was positive for S-100 and negative for synaptophysin, chromogranin A, and pan keratin (AE1/AE3). The percentage of Ki-67 was 10 % in the hot spot area. Based on these clinicopathological findings, we initially considered the possibility of a myxoid liposarcoma, although we did not observe any lipoblasts. Therefore, we considered the possibility of an extraskeletal myxoid chondrosarcoma. As this tumor is very rare, we searched for the EWSR1-NR4A3 gene fusion using fluorescence in situ hybridization, which confirmed the diagnosis of extraskeletal myxoid chondrosarcoma. Positron emission tomography-computed tomography did not identify any obvious metastases, and we performed radical resection of our patient's vastus medialis and

  3. Fusion rings and fusion ideals

    DEFF Research Database (Denmark)

    Andersen, Troels Bak

    by the so-called fusion ideals. The fusion rings of Wess-Zumino-Witten models have been widely studied and are well understood in terms of precise combinatorial descriptions and explicit generating sets of the fusion ideals. They also appear in another, more general, setting via tilting modules for quantum......This dissertation investigates fusion rings, which are Grothendieck groups of rigid, monoidal, semisimple, abelian categories. Special interest is in rational fusion rings, i.e., fusion rings which admit a finite basis, for as commutative rings they may be presented as quotients of polynomial rings...

  4. Spatial focalization of pheromone/MAPK signaling triggers commitment to cell–cell fusion

    Science.gov (United States)

    Merlini, Laura

    2016-01-01

    Cell fusion is universal in eukaryotes for fertilization and development, but what signals this process is unknown. Here, we show in Schizosaccharomyces pombe that fusion does not require a dedicated signal but is triggered by spatial focalization of the same pheromone–GPCR (G-protein-coupled receptor)–MAPK signaling cascade that drives earlier mating events. Autocrine cells expressing the receptor for their own pheromone trigger fusion attempts independently of cell–cell contact by concentrating pheromone release at the fusion focus, a dynamic actin aster underlying the secretion of cell wall hydrolases. Pheromone receptor and MAPK cascade are similarly enriched at the fusion focus, concomitant with fusion commitment in wild-type mating pairs. This focalization promotes cell fusion by immobilizing the fusion focus, thus driving local cell wall dissolution. We propose that fusion commitment is imposed by a local increase in MAPK concentration at the fusion focus, driven by a positive feedback between fusion focus formation and focalization of pheromone release and perception. PMID:27798845

  5. Window of cold nuclear fusion and biased-pulse electrolysis experiment

    International Nuclear Information System (INIS)

    Takahashi, Akito; Jida, Toshiyuki; Maekawa, Fujio; Sugimoto, Hisashi; Yoshida, Shigeo

    1989-01-01

    Based on the electron screening effect and the excitation of deuteron harmonic oscillators in palladium lattice, theoretical aspects are given to explain the cold fusion phenomena and the possibility of nuclear heating. A narrow window is proposed to meet ≅ 10 watts per cubic centimeter for the nuclear heating, by the hypothetical excitation-screening model. A relatively wide window is feasible to meet a few fusion events per second per cc under the non-stationary conditions of deuteron-charging and discharging. For stationary lattice conditions, the probability of cold fusion is not feasible at all. To confirm the cold fusion phenomena, a heavy water electrolysis experiment was carried out using biased-pulse-electrolytic currents, expecting the enhancement of cold fusion events under charging and discharging of deuterons. For the neutron detection, a cross-checking system between a recoil-proton scintillation detector and a 3 He thermal neutron detector was employed to see coincident time-patterns of neutron emission from an electrolysis cell. To check the energy of emitted neutrons, pulse height spectrum of the recoil-proton detector was monitored. Up to the D-charging time of 300 hr, neutron yields of 1-2 n/s/cc were obtained for time-intervals of 60-200 hr. From the recoil-proton spectra, it was confirmed that 2.45 MeV neutrons by the D(d, n) 3 He fusion branch were emitted. The observed time-patterns of neutron emission suggest the existence of cold fusion under the charging and discharging conditions. (orig.)

  6. PAX-FOXO1 Fusion Status Drives Unfavorable Outcome for Children With Rhabdomyosarcoma: A Children’s Oncology Group Report

    Science.gov (United States)

    Skapek, Stephen X.; Anderson, James; Barr, Frederic G.; Bridge, Julia A.; Gastier-Foster, Julie M.; Parham, David M.; Rudzinski, Erin R.; Triche, Timothy; Hawkins, Douglas S.

    2015-01-01

    Background Rhabdomyosarcoma (RMS) is divided into two major histological subtypes: alveolar (ARMS) and embryonal (ERMS), with most ARMS expressing one of two oncogenic genes fusing PAX3 or PAX7 with FOXO1 (P3F and P7F, respectively). The Children’s Oncology Group (COG) carried out a multi-institutional clinical trial to evaluate the prognostic value of PAX-FOXO1 fusion status. Methods Study participants were treated on COG protocol D9803 for intermediate risk ARMS or ERMS using multi-agent chemotherapy, radiotherapy, and surgery. Central diagnostic pathology review and molecular testing for fusion genes were carried out on prospectively collected specimens. Event-free (EFS) and overall survival (OS) at 5 years were correlated with histological subtype and PAX-FOXO1 status. Results Of 616 eligible D9803 enrollees, 434 cases had adequate clinical, molecular, and pathology data for definitive classification as ERMS, ARMS P3F+ or P7F+, or ARMSn (without detectable fusion). EFS was worse for those with ARMS P3F+ (54%) and P7F+ (65%) than those with ERMS (77%; P < 0.001). EFS for ARMSn and ERMS were not statistically different (90% vs. 77%, P = 0.15). ARMS P3F+had poorer OS (64%) than ARMS P7F+ (87%), ARMSn (89%), and ERMS (82%; P = 0.006). Conclusions ARMSn has an outcome similar to ERMS and superior EFS compared to ARMS with either P3F or P7F, when given therapy designed for children with intermediate risk RMS. This prospective analysis supports incorporation of PAX-FOXO1 fusion status into risk stratification and treatment allocation. PMID:23526739

  7. Epithelioid fibrous histiocytoma: molecular characterization of ALK fusion partners in 23 cases.

    Science.gov (United States)

    Dickson, Brendan C; Swanson, David; Charames, George S; Fletcher, Christopher Dm; Hornick, Jason L

    2018-05-01

    Epithelioid fibrous histiocytoma is a rare and distinctive cutaneous neoplasm. Most cases harbor ALK rearrangement and show ALK overexpression, which distinguish this neoplasm from conventional cutaneous fibrous histiocytoma and variants. SQSTM1 and VCL have previously been shown to partner with ALK in one case each of epithelioid fibrous histiocytoma. The purpose of this study was to examine a large cohort of epithelioid fibrous histiocytomas by next-generation sequencing to characterize the nature and prevalence of ALK fusion partners. A retrospective archival review was performed to identify cases of epithelioid fibrous histiocytoma (2012-2016). Immunohistochemistry was performed to confirm ALK expression. Targeted next-generation sequencing was applied on RNA extracted from formalin-fixed paraffin-embedded tissue to identify the fusion partners. Twenty-three cases fulfilled inclusion criteria. The mean patient age was 39 years (range, 8-74), there was no sex predilection, and >75% of cases involved the lower extremities. The most common gene fusions were SQSTM1-ALK (N=12; 52%) and VCL-ALK (N=7; 30%); the other four cases harbored novel fusion partners (DCTN1, ETV6, PPFIBP1, and SPECC1L). The pattern of ALK immunoreactivity was usually granular cytoplasmic (N=12; 52%) or granular cytoplasmic and nuclear (N=10; 43%); the case containing an ETV6 fusion partner showed nuclear staining alone. There was no apparent relationship between tumor morphology and the ALK fusion partner. In summary, SQSTM1 and VCL are the most common ALK fusion partners in epithelioid fibrous histiocytoma; DCTN1, ETV6, PPFIBP1, and SPECC1L represent rare fusion partners. The proteins encoded by these genes play diverse roles in scaffolding, cell adhesion, signaling, and transcription (among others) without clear commonalities. These findings expand the oncogenic promiscuity of many of these ALK fusion genes, which drive neoplasia in tumors of diverse lineages with widely varied clinical

  8. Expression, purification and characterization of a phyAm-phyCs fusion phytase*

    Science.gov (United States)

    Zou, Li-kou; Wang, Hong-ning; Pan, Xin; Tian, Guo-bao; Xie, Zi-wen; Wu, Qi; Chen, Hui; Xie, Tao; Yang, Zhi-rong

    2008-01-01

    The phyAm gene encoding acid phytase and optimized neutral phytase phyCs gene were inserted into expression vector pPIC9K in correct orientation and transformed into Pichia pastoris in order to expand the pH profile of phytase and decrease the cost of production. The fusion phytase phyAm-phyCs gene was successfully overexpressed in P. pastoris as an active and extracellular phytase. The yield of total extracellular fusion phytase activity is (25.4±0.53) U/ml at the flask scale and (159.1±2.92) U/ml for high cell-density fermentation, respectively. Purified fusion phytase exhibits an optimal temperature at 55 °C and an optimal pH at 5.5~6.0 and its relative activity remains at a relatively high level of above 70% in the range of pH 2.0 to 7.0. About 51% to 63% of its original activity remains after incubation at 75 °C to 95 °C for 10 min. Due to heavy glycosylation, the expressed fusion phytase shows a broad and diffuse band in SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). After deglycosylation by endoglycosidase H (EndoHf), the enzyme has an apparent molecular size of 95 kDa. The characterization of the fusion phytase was compared with those of phyCs and phyAm. PMID:18600783

  9. Construction and prokaryotic expression of the fusion gene PRRSV ...

    African Journals Online (AJOL)

    ajl4

    2013-07-24

    Jul 24, 2013 ... The fusion expressing plasmid pET32-GP5-Hsp70 was constructed and expressed in ... 2004). Hsps, expressed by prokaryotes and eukaryotes and their action as molecular ..... Facts, thoughts, and dreams. Shock. 12(4): ...

  10. TMPRSS2-ERG -specific transcriptional modulation is associated with prostate cancer biomarkers and TGF-β signaling

    International Nuclear Information System (INIS)

    Brase, Jan C; Sirma, Hüseyin; Sauter, Guido; Simon, Ronald; Schlomm, Thorsten; Beißbarth, Tim; Korf, Ulrike; Kuner, Ruprecht; Sültmann, Holger; Johannes, Marc; Mannsperger, Heiko; Fälth, Maria; Metzger, Jennifer; Kacprzyk, Lukasz A; Andrasiuk, Tatjana; Gade, Stephan; Meister, Michael

    2011-01-01

    TMPRSS2-ERG gene fusions occur in about 50% of all prostate cancer cases and represent promising markers for molecular subtyping. Although TMPRSS2-ERG fusion seems to be a critical event in prostate cancer, the precise functional role in cancer development and progression is still unclear. We studied large-scale gene expression profiles in 47 prostate tumor tissue samples and in 48 normal prostate tissue samples taken from the non-suspect area of clinical low-risk tumors using Affymetrix GeneChip Exon 1.0 ST microarrays. Comparison of gene expression levels among TMPRSS2-ERG fusion-positive and negative tumors as well as benign samples demonstrated a distinct transcriptional program induced by the gene fusion event. Well-known biomarkers for prostate cancer detection like CRISP3 were found to be associated with the gene fusion status. WNT and TGF-β/BMP signaling pathways were significantly associated with genes upregulated in TMPRSS2-ERG fusion-positive tumors. The TMPRSS2-ERG gene fusion results in the modulation of transcriptional patterns and cellular pathways with potential consequences for prostate cancer progression. Well-known biomarkers for prostate cancer detection were found to be associated with the gene fusion. Our results suggest that the fusion status should be considered in retrospective and future studies to assess biomarkers for prostate cancer detection, progression and targeted therapy

  11. Warming up to cold fusion

    International Nuclear Information System (INIS)

    Storms, E.

    1994-01-01

    The idea that tabletop equipment at room temperature could produce nuclear fusion was widely rejected five years ago by the scientific community. Nevertheless, recent results from numerous labs show that a novel phenomena of some kind may indeed be occurring, though theorist are still groping for an explanation. Many aspects of the cold fusion effect are now reproducible if known procedures are used. Palladium, when reacted with enough deuterium, apparently converts to a special condition of matter in which various nuclear reactions--including deuterium-deuterium fusion--can occur despite the repulsive force of the two positive charged nuclei. These reactions can be made to proceed rapidly enough to produce measurable heat. Scientist have published several dozen models, ranging from highly analytical approaches to pictorial representations, to explain these events. Most theories address only the problem of overcoming the coulombic barrier--how it is possible for nuclei to overcome their natural repulsion for each other without an infusion of massive amounts of energy from the outside. None of the proposed explanations accounts for the full range of experimental observations. Nevertheless a workable theory is crucial if we ever hope to apply cold fusion

  12. Characterization of a structural intermediate of flavivirus membrane fusion.

    Directory of Open Access Journals (Sweden)

    Karin Stiasny

    2007-02-01

    Full Text Available Viral membrane fusion proceeds through a sequence of steps that are driven by triggered conformational changes of viral envelope glycoproteins, so-called fusion proteins. Although high-resolution structural snapshots of viral fusion proteins in their prefusion and postfusion conformations are available, it has been difficult to define intermediate structures of the fusion pathway because of their transient nature. Flaviviruses possess a class II viral fusion protein (E mediating fusion at acidic pH that is converted from a dimer to a trimer with a hairpin-like structure during the fusion process. Here we show for tick-borne encephalitis virus that exposure of virions to alkaline instead of acidic pH traps the particles in an intermediate conformation in which the E dimers dissociate and interact with target membranes via the fusion peptide without proceeding to the merger of the membranes. Further treatment to low pH, however, leads to fusion, suggesting that these monomers correspond to an as-yet-elusive intermediate required to convert the prefusion dimer into the postfusion trimer. Thus, the use of nonphysiological conditions allows a dissection of the flavivirus fusion process and the identification of two separate steps, in which membrane insertion of multiple copies of E monomers precedes the formation of hairpin-like trimers. This sequence of events provides important new insights for understanding the dynamic process of viral membrane fusion.

  13. Trends in fusion reactor safety research

    International Nuclear Information System (INIS)

    Herring, J.S.; Holland, D.F.; Piet, S.J.

    1991-01-01

    Fusion has the potential to be an attractive energy source. From the safety and environmental perspective, fusion must avoid concerns about catastrophic accidents and unsolvable waste disposal. In addition, fusion must achieve an acceptable level of risk from operational accidents that result in public exposure and economic loss. Finally, fusion reactors must control routine radioactive effluent, particularly tritium. Major progress in achieving this potential rests on development of low-activation materials or alternative fuels. The safety and performance of various material choices and fuels for commercial fusion reactors can be investigated relatively inexpensively through reactor design studies. These studies bring together experts in a wide range of backgrounds and force the group to either agree on a reactor design or identify areas for further study. Fusion reactors will be complex with distributed radioactive inventories. The next generation of experiments will be critical in demonstrating that acceptable levels of safe operation can be achieved. These machines will use materials which are available today and for which a large database exists (e.g. for 316 stainless steel). Researchers have developed a good understanding of the risks associated with operation of these devices. Specifically, consequences from coolant system failures, loss of vacuum events, tritium releases, and liquid metal reactions have been studied. Recent studies go beyond next step designs and investigate commercial reactor concerns including tritium release and liquid metal reactions. 18 refs

  14. Low energy incomplete fusion and its relevance to the synthesis of super heavy elements

    Directory of Open Access Journals (Sweden)

    Yadav Abhishek

    2015-01-01

    Full Text Available To study the presence of incomplete fusion at energies around the Coulomb-barrier and to understand its dependence on various entrance-channel parameters, the incomplete fusion fractions have been deduced (i from excitation function measurements for 18O,13,12C+159Tb, and (ii from forward recoil range measurements for 12C+159Tb systems, at low energies (<7MeV/A. The data have been analyzed within the framework of compound nucleus decay, which suggests the production of xn/pxn-channels via complete fusion, as these are found to be well reproduced by PACE4 predictions, while, a significant enhancement in the excitation functions of α-emitting channels has been observed over the theoretical ones, which has been attributed due to the incomplete fusion processes. Further, the incomplete fusion events observed in case of forward recoil ranges have been explained on the basis of the breakup fusion model, where these events may be attributed to the fusion of 8Be and/or 4He from 12C projectile to the target nucleus. For better insight into the underlying dynamics, the deduced fractions of incomplete fusion have been compared with other nearby systems as a function of various entrance channel parameters. The incomplete fusion has been found to be sensitive to the projectile’s energy and alpha-Q-value of the projectile.

  15. Reactor prospects of muon-catalyzed fusion of deuterium and tritium concentrated in transition metals

    International Nuclear Information System (INIS)

    Stacey, W.M. Jr.

    1989-01-01

    It is conjectured that the number of fusion events catalyzed by a single muon is orders of magnitude greater for deuterium and tritium concentrated in a transition metal than in gaseous form and that the recent observation of 2.5-MeV neutrons from a D 2 O electrolytic cell with palladium and titanium cathodes can thereby be interpreted in terms of cosmic muon-catalyzed deuterium-deuterium fusion. This suggests a new fusion reactor reactor consisting of deuterium and tritium concentrated in transition metal fuel elements in a fusion core that surrounds an accelerator-produced muon source. The feasibility of net energy production in such a reactor is established in terms of requirements on the number of fusion events catalyzed per muon. The technological implications for a power reactor based on this concept are examined. The potential of such a concept as a neutron source for materials testing and tritium and plutonium production is briefly discussed

  16. Nuclear fusion during yeast mating occurs by a three-step pathway.

    Science.gov (United States)

    Melloy, Patricia; Shen, Shu; White, Erin; McIntosh, J Richard; Rose, Mark D

    2007-11-19

    In Saccharomyces cerevisiae, mating culminates in nuclear fusion to produce a diploid zygote. Two models for nuclear fusion have been proposed: a one-step model in which the outer and inner nuclear membranes and the spindle pole bodies (SPBs) fuse simultaneously and a three-step model in which the three events occur separately. To differentiate between these models, we used electron tomography and time-lapse light microscopy of early stage wild-type zygotes. We observe two distinct SPBs in approximately 80% of zygotes that contain fused nuclei, whereas we only see fused or partially fused SPBs in zygotes in which the site of nuclear envelope (NE) fusion is already dilated. This demonstrates that SPB fusion occurs after NE fusion. Time-lapse microscopy of zygotes containing fluorescent protein tags that localize to either the NE lumen or the nucleoplasm demonstrates that outer membrane fusion precedes inner membrane fusion. We conclude that nuclear fusion occurs by a three-step pathway.

  17. An optimized hydrogen target for muon catalyzed fusion

    Energy Technology Data Exchange (ETDEWEB)

    Gheisari, R., E-mail: gheisari@pgu.ac.i [Physics Department, Persian Gulf University, Bushehr 75169 (Iran, Islamic Republic of)

    2011-04-01

    This paper deals with the optimization of the processes involved in muon catalyzed fusion. Muon catalyzed fusion ({mu}CF) is studied in all layers of the solid hydrogen structure H/0.1%T+D{sub 2}+HD. The layer H/T acts as an emitter source of energetic t{mu} atoms, due to the so-called Ramsauer-Townsend effect. These t{mu} atoms are slowed down in the second layer (degrader) and are forced to take place nuclear fusion in HD. The degrader affects time evolution of t{mu} atomic beam. This effect has not been considered until now in {mu}CF-multilayered targets. Due to muon cycling and this effect, considerable reactions occur in the degrader. In our calculations, it is shown that the fusion yield equals 180{+-}1.5. It is possible to separate events that overlap in time.

  18. Cell surface expression system for the display of heterologous gene products using chimeric flagellin fusions of bacillus halodurans isolate

    CSIR Research Space (South Africa)

    Du Plessis, A

    2006-10-01

    Full Text Available system for the display of heterologous gene products using chimeric flagellin fusions of a Bacillus halodurans isolate Slide 2 © CSIR 2006 www.csir.co.za Bacillus halodurans Alk 36 xrhombus Ability to over-produce cell... for functionality of the His-tag for metal binding. Slide 13 © CSIR 2006 www.csir.co.za PAGE gel showing over-production of chimeric poly-His flagellin proteins 66.2 kDa 45.0 kDa 31.0 kDa 1. LMW ladder 2. NC3 3. NHisC3 4. NC6 5...

  19. Nuclear Fusion Effects Induced in Intense Laser-Generated Plasmas

    Directory of Open Access Journals (Sweden)

    Lorenzo Torrisi

    2013-01-01

    Full Text Available Deutered polyethylene (CD2n thin and thick targets were irradiated in high vacuum by infrared laser pulses at 1015W/cm2 intensity. The high laser energy transferred to the polymer generates plasma, expanding in vacuum at supersonic velocity, accelerating hydrogen and carbon ions. Deuterium ions at kinetic energies above 4 MeV have been measured by using ion collectors and SiC detectors in time-of-flight configuration. At these energies the deuterium–deuterium collisions may induce over threshold fusion effects, in agreement with the high D-D cross-section valuesaround 3 MeV energy. At the first instants of the plasma generation, during which high temperature, density and ionacceleration occur, the D-D fusions occur as confirmed by the detection of mono-energetic protonsand neutrons with a kinetic energy of 3.0 MeV and 2.5 MeV, respectively, produced by the nuclear reaction. The number of fusion events depends strongly on the experimental set-up, i.e. on the laser parameters (intensity, wavelength, focal spot dimension, target conditions (thickness, chemical composition, absorption coefficient, presence of secondary targets and used geometry (incidence angle, laser spot, secondary target positions.A number of D-D fusion events of the order of 106÷7 per laser shot has been measured.

  20. Recent adaptive events in human brain revealed by meta-analysis of positively selected genes.

    Directory of Open Access Journals (Sweden)

    Yue Huang

    Full Text Available BACKGROUND AND OBJECTIVES: Analysis of positively-selected genes can help us understand how human evolved, especially the evolution of highly developed cognitive functions. However, previous works have reached conflicting conclusions regarding whether human neuronal genes are over-represented among genes under positive selection. METHODS AND RESULTS: We divided positively-selected genes into four groups according to the identification approaches, compiling a comprehensive list from 27 previous studies. We showed that genes that are highly expressed in the central nervous system are enriched in recent positive selection events in human history identified by intra-species genomic scan, especially in brain regions related to cognitive functions. This pattern holds when different datasets, parameters and analysis pipelines were used. Functional category enrichment analysis supported these findings, showing that synapse-related functions are enriched in genes under recent positive selection. In contrast, immune-related functions, for instance, are enriched in genes under ancient positive selection revealed by inter-species coding region comparison. We further demonstrated that most of these patterns still hold even after controlling for genomic characteristics that might bias genome-wide identification of positively-selected genes including gene length, gene density, GC composition, and intensity of negative selection. CONCLUSION: Our rigorous analysis resolved previous conflicting conclusions and revealed recent adaptation of human brain functions.

  1. Safety analysis and environmental effects of fusion concepts

    International Nuclear Information System (INIS)

    Anon.

    1976-01-01

    Fusion reactor concepts have been analyzed to determine the probable interactions with the environment and the resultant environmental effects. Two research projects on tritium oxidation in the atmosphere and carbon-14 formation in fusion reactors are briefly described. A study and report were completed, investigating the potential public safety impact of accidents in fusion power plants. After reviewing the existing information on conceptual fusion reactor designs, PNL identified areas of safety concern, making recommendations on how development of safety information might be best accomplished. Inventories of potentially dispersible toxic materials were classified, and general conclusions were made about their relative importance. The report specifies energy sources with a potential to initiate or propagate an accident. An important product of the study was an assessment logic developed to identify potential accident scenarios that could lead to the release of contaminants to the environment. Though the limited amount of fusion design information allows only a general assessment of accident-initiating events, the logic provides a method for making more detailed safety analyses as more design information becomes available. The same logic was used to identify technological areas where an R and D investment would enhance the technical bases for fusion designs as well as the understanding of safety implications in fusion systems

  2. Mitochondrial Fusion Proteins and Human Diseases

    Directory of Open Access Journals (Sweden)

    Michela Ranieri

    2013-01-01

    Full Text Available Mitochondria are highly dynamic, complex organelles that continuously alter their shape, ranging between two opposite processes, fission and fusion, in response to several stimuli and the metabolic demands of the cell. Alterations in mitochondrial dynamics due to mutations in proteins involved in the fusion-fission machinery represent an important pathogenic mechanism of human diseases. The most relevant proteins involved in the mitochondrial fusion process are three GTPase dynamin-like proteins: mitofusin 1 (MFN1 and 2 (MFN2, located in the outer mitochondrial membrane, and optic atrophy protein 1 (OPA1, in the inner membrane. An expanding number of degenerative disorders are associated with mutations in the genes encoding MFN2 and OPA1, including Charcot-Marie-Tooth disease type 2A and autosomal dominant optic atrophy. While these disorders can still be considered rare, defective mitochondrial dynamics seem to play a significant role in the molecular and cellular pathogenesis of more common neurodegenerative diseases, for example, Alzheimer’s and Parkinson’s diseases. This review provides an overview of the basic molecular mechanisms involved in mitochondrial fusion and focuses on the alteration in mitochondrial DNA amount resulting from impairment of mitochondrial dynamics. We also review the literature describing the main disorders associated with the disruption of mitochondrial fusion.

  3. TFG-MET fusion in an infantile spindle cell sarcoma with neural features.

    Science.gov (United States)

    Flucke, Uta; van Noesel, Max M; Wijnen, Marc; Zhang, Lei; Chen, Chun-Liang; Sung, Yun-Shao; Antonescu, Cristina R

    2017-09-01

    An increasing number of congenital and infantile sarcomas displaying a primitive, monomorphic spindle cell phenotype have been characterized to harbor recurrent gene fusions, including infantile fibrosarcoma and congenital spindle cell rhabdomyosarcoma. Here, we report an unusual spindle cell sarcoma presenting as a large and infiltrative pelvic soft tissue mass in a 4-month-old girl, which revealed a novel TFG-MET gene fusion by whole transcriptome RNA sequencing. The tumor resembled the morphology of an infantile fibrosarcoma with both fascicular and patternless growth, however, it expressed strong S100 protein immunoreactivity, while lacking SOX10 staining and retaining H3K27me3 expression. Although this immunoprofile suggested partial neural/neuroectodermal differentiation, overall features were unusual and did not fit into any known tumor types (cellular schwannoma, MPNST), raising the possibility of a novel pathologic entity. The TFG-MET gene fusion expands the genetic spectrum implicated in the pathogenesis of congenital spindle cell sarcomas, with yet another example of kinase oncogenic activation through chromosomal translocation. The discovery of this new fusion is significant since the resulting MET activation can potentially be inhibited by targeted therapy, as MET inhibitors are presently available in clinical trials. © 2017 Wiley Periodicals, Inc.

  4. Data fusion in cyber security: first order entity extraction from common cyber data

    Science.gov (United States)

    Giacobe, Nicklaus A.

    2012-06-01

    The Joint Directors of Labs Data Fusion Process Model (JDL Model) provides a framework for how to handle sensor data to develop higher levels of inference in a complex environment. Beginning from a call to leverage data fusion techniques in intrusion detection, there have been a number of advances in the use of data fusion algorithms in this subdomain of cyber security. While it is tempting to jump directly to situation-level or threat-level refinement (levels 2 and 3) for more exciting inferences, a proper fusion process starts with lower levels of fusion in order to provide a basis for the higher fusion levels. The process begins with first order entity extraction, or the identification of important entities represented in the sensor data stream. Current cyber security operational tools and their associated data are explored for potential exploitation, identifying the first order entities that exist in the data and the properties of these entities that are described by the data. Cyber events that are represented in the data stream are added to the first order entities as their properties. This work explores typical cyber security data and the inferences that can be made at the lower fusion levels (0 and 1) with simple metrics. Depending on the types of events that are expected by the analyst, these relatively simple metrics can provide insight on their own, or could be used in fusion algorithms as a basis for higher levels of inference.

  5. Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia

    Directory of Open Access Journals (Sweden)

    Berhanu Ayalew

    2010-08-01

    Full Text Available Abstract Background Newcastle disease (ND, caused by Newcastle disease virus (NDV, is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. Results The coding region of eleven NDV isolates fusion (F gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia, Ch/2000 (China, local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. Conclusions The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

  6. Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia.

    Science.gov (United States)

    Berhanu, Ayalew; Ideris, Aini; Omar, Abdul R; Bejo, Mohd Hair

    2010-08-08

    Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. The coding region of eleven NDV isolates fusion (F) gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN) gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia), Ch/2000 (China), local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

  7. Lack of a synergistic effect of a non-viral ALS gene therapy based on BDNF and a TTC fusion molecule

    Directory of Open Access Journals (Sweden)

    Navarro Xavier

    2011-03-01

    Full Text Available Abstract Background Amyotrophic lateral sclerosis (ALS is one of the most devastating neurodegenerative diseases. Neurotrophic factors have been widely tested to counteract neurodegenerative conditions, despite their unspecific neuronal access. The non-toxic C-terminal fragment of the tetanus toxin (TTC heavy chain has been studied not only as a carrier molecule to the CNS but also as a neuroprotective agent. Because the neurotrophic effects of BDNF have been demonstrated in vitro and in vivo, the question addressed in this work is whether a fusion molecule of BDNF-TTC may have a synergistic effect and enhance the neuroprotective properties of TTC alone in a mouse model of ALS. Methods Recombinant plasmid constructs (pCMV-TTC and pCMV-BDNF-TTC were injected into the quadriceps femoris and triceps brachialis muscles of SOD1G93A transgenic mice at 8 weeks of age. The hanging wire and rotarod tests were performed to assess motor coordination, strength and balance. Electrophysiological tests, morphological assays of spinal cord sections of L2 and L4 segments, and gene and protein expression analyses were performed. The Kaplan-Meier survival analysis test was used for comparisons of survival. Multiple comparisons of data were analyzed using a one-way analysis of variance (ANOVA. Results Treatment with the fusion-molecule BDNF-TTC and with TTC alone significantly delayed the onset of symptoms and functional deficits of SOD1G93A mice. Muscle innervation was partially preserved with these treatments, and the number of surviving motoneurons in L2 spinal cord segment was increased particularly by the fusion protein induction. Inhibition of pro-apoptotic protein targets (caspase-3 and Bax and significant phosphorylation of Akt and ERK were also found in the spinal cord of treated mice. Conclusions Significant improvements in behavioral and electrophysiological results, motoneuron survival and anti-apoptotic/survival-activated pathways were observed with

  8. Cytogenetic mapping of the Muller F element genes in Drosophila willistoni group.

    Science.gov (United States)

    Pita, Sebastián; Panzera, Yanina; Lúcia da Silva Valente, Vera; de Melo, Zilpa das Graças Silva; Garcia, Carolina; Garcia, Ana Cristina Lauer; Montes, Martín Alejandro; Rohde, Claudia

    2014-10-01

    Comparative genomics in Drosophila began in 1940, when Muller stated that the ancestral haploid karyotype of this genus is constituted by five acrocentric chromosomes and one dot chromosome, named A to F elements. In some species of the willistoni group such as Drosophila willistoni and D. insularis, the F element, instead of a dot chromosome, has been incorporated into the E element, forming chromosome III (E + F fusion). The aim of this study was to investigate the scope of the E + F fusion in the willistoni group, evaluating six other species. Fluorescent in situ hybridization was used to locate two genes of the F element previously studied-cubitus interruptus (ci) and eyeless (ey)-in species of the willistoni and bocainensis subgroups. Moreover, polytene chromosome photomaps corresponding to the F element (basal portion of chromosome III) were constructed for each species studied. In D. willistoni, D. paulistorum and D. equinoxialis, the ci gene was located in subSectction 78B and the ey gene in 78C. In D. tropicalis, ci was located in subSection 76B and ey in 76C. In species of the bocainensis subgroup, ci and ey were localized, respectively, at subsections 76B and 76C in D. nebulosa and D. capricorni, and 76A and 76C in D. fumipennis. Despite the differences in the subsection numbers, all species showed the same position for ci and ey. The results confirm the synteny of E + F fusion in willistoni and bocainensis subgroups, and allow estimating the occurrence of this event at 15 Mya, at least.

  9. Safety considerations in next step fusion design and beyond

    International Nuclear Information System (INIS)

    Holland, D.F.

    1990-01-01

    Recent U.S. and international design studies provide insights into the potential safety and environmental advantages of fusion as well as the development needed to realize this potential. We in the Fusion Safety Program at EG ampersand G Idaho have analyzed the Compact Ignition Tokamak (CIT), the International Thermonuclear Engineering Reactor (ITER), and the Advanced Reactor Innovative Engineering Study (ARIES). I have reviewed these three designs to determine issues related to meeting the safety and the environmental goals that guide fusion development in the U.S. The paper lists safety and environmental issues that are generic to fusion and approaches to favorably resolve each issue. The technical developments that have the highest potential of contributing to improving the safety and environmental attractiveness of fusion are identified and discussed. These developments are in the areas of low-activation materials, plasma- facing components, and plasma physics relating to off-normal plasma events and tritium burn-up. 8 refs., 7 tabs

  10. Thought-action fusion in individuals with OCD symptoms.

    Science.gov (United States)

    Amir, N; Freshman, M; Ramsey, B; Neary, E; Brigidi, B

    2001-07-01

    Rachman (Rachman, S. (1993). Obsessions, responsibility, and guilt. Behaviour Research and Therapy, 31, 149-154) suggested that patients with OCD may interpret thoughts as having special importance, thus experiencing thought-action fusion (TAF). Shafran, Thordarson and Rachman (Shafran, R., Thordarson, D. S. & Rachman, S. (1996). Thought-action fusion in obsessive compulsive disorder. Journal of Anxiety Disorders, 710, 379-391) developed a questionnaire (TAF) and found that obsessives scored higher than non-obsessives on the measure. In the current study, we modified the TAF to include a scale that assessed the "likelihood of events happening to others" as well as ratings of the responsibility and cost for having these thoughts. Replicating previous findings, we found that individuals with OC symptoms gave higher ratings to the likelihood of negative events happening as a result of their negative thoughts. Individuals with OC symptoms also rated the likelihood that they would prevent harm by their positive thoughts higher than did individuals without OC symptoms. These results suggest that the role of thought-action fusion in OCs may extend to exaggerated beliefs about thoughts regarding the reduction of harm.

  11. Targeted Gene Replacement in Fungal Pathogens via Agrobacterium tumefaciens- Mediated Transformation

    DEFF Research Database (Denmark)

    Frandsen, Rasmus John Normand; Frandsen, Mette; Giese, Nanna Henriette

    2012-01-01

    -step cloning strategies for construction of vectors for Agrobacterium tumefaciens-mediated transformation (ATMT). Targeted genome modifications require integration by a homologous double crossover event, which is achieved by placing target sequences on either side of a selection marker gene in the vector....... Protocols are given for two single-step vector construction techniques. The In-Fusion cloning technique is independent of compatible restriction enzyme sites in the vector and the fragment to be cloned. The method can be directly applied to any vector of choice and it is possible to carry out four fragment...... cloning without the need for subcloning. The cloning efficiency is not always as high as desired, but it still presents an efficient alternative to restriction enzyme and ligase-based cloning systems. The USER technology offers a higher four fragment cloning efficiency than In-Fusion, but depends...

  12. Differential transactivation by orphan nuclear receptor NOR1 and its fusion gene product EWS/NOR1: possible involvement of poly(ADP-ribose) polymerase I, PARP-1.

    Science.gov (United States)

    Ohkura, Naganari; Nagamura, Yuko; Tsukada, Toshihiko

    2008-10-15

    In extraskeletal myxoid chondrosarcoma, a chromosomal translocation creates a gene fusion between EWS and an orphan nuclear receptor, NOR1. The resulting fusion protein EWS/NOR1 has been believed to lead to malignant transformation by functioning as a transactivator for NOR1-target genes. By comparing the gene expression profiles of NOR1- and EWS/NOR1-overexpressing cells, we found that they largely shared up-regulated genes, but no significant correlation was observed with respect to the transactivation levels of each gene. In addition, the proteins associated with NOR1 and EWS/NOR1 were mostly the same in these cells. The results suggest that these proteins differentially transactivate overlapping target genes through a similar transcriptional machinery. To clarify the mechanisms underlying the transcriptional divergence between NOR1 and EWS/NOR1, we searched for alternatively associated proteins, and identified poly(ADP-ribose) polymerase I (PARP-1) as an NOR1-specific binding protein. Consistent with its binding properties, PARP-1 acted as a transcriptional repressor of NOR1, but not EWS/NOR1, in a luciferase reporter assay employing PARP-1(-/-) fibroblasts. Interestingly, suppressive activity of PARP-1 was observed in a DNA response element-specific manner, and in a subtype-specific manner toward the NR4A family (Nur77, Nurr1, and NOR1), suggesting that PARP-1 plays a role in the diversity of transcriptional regulation mediated by the NR4A family in normal cells. Altogether, our findings suggest that NOR1 and EWS/NOR1 regulate overlapping target genes differently by utilizing associated proteins, including PARP-1; and that EWS/NOR1 may acquire oncogenic activities by avoiding (or gaining) transcription factor-specific modulation by the associated proteins. (c) 2008 Wiley-Liss, Inc.

  13. Gene fusions AHRR-NCOA2, NCOA2-ETV4, ETV4-AHRR, P4HA2-TBCK, and TBCK-P4HA2 resulting from the translocations t(5;8;17)(p15;q13;q21) and t(4;5)(q24;q31) in a soft tissue angiofibroma.

    Science.gov (United States)

    Panagopoulos, Ioannis; Gorunova, Ludmila; Viset, Trond; Heim, Sverre

    2016-11-01

    We present an angiofibroma of soft tissue with the karyotype 46,XY,t(4;5)(q24;q31),t(5;8;17)(p15;q13;q21)[8]/46,XY,t(1;14)(p31;q32)[2]/46,XY[3]. RNA‑sequencing showed that the t(4;5)(q24;q31) resulted in recombination of the genes TBCK on 4q24 and P4HA2 on 5q31.1 with generation of an in‑frame TBCK‑P4HA2 and the reciprocal but out‑of‑frame P4HA2‑TBCK fusion transcripts. The putative TBCK‑P4HA2 protein would contain the kinase, the rhodanese‑like domain, and the Tre‑2/Bub2/Cdc16 (TBC) domains of TBCK together with the P4HA2 protein which is a component of the prolyl 4‑hydroxylase. The t(5;8;17)(p15;q13;q21) three‑way chromosomal translocation targeted AHRR (on 5p15), NCOA2 (on 8q13), and ETV4 (on 17q21) generating the in‑frame fusions AHRR‑NCOA2 and NCOA2‑ETV4 as well as an out‑of‑frame ETV4‑AHRR transcript. In the AHRR‑NCOA2 protein, the C‑terminal part of AHRR is replaced by the C‑terminal part of NCOA2 which contains two activation domains. The NCOA2‑ETV4 protein would contain the helix‑loop‑helix, PAS_9 and PAS_11, CITED domains, the SRC‑1 domain of NCOA2 and the ETS DNA‑binding domain of ETV4. No fusion gene corresponding to t(1;14)(p31;q32) was found. Our findings indicate that, in spite of the recurrence of AHRR‑NCOA2 in angiofibroma of soft tissue, additional genetic events (or fusion genes) might be required for the development of this tumor.

  14. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  15. Bridge-Induced Translocation between NUP145 and TOP2 Yeast Genes Models the Genetic Fusion between the Human Orthologs Associated With Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Valentina Tosato

    2017-09-01

    Full Text Available In mammalian organisms liquid tumors such as acute myeloid leukemia (AML are related to spontaneous chromosomal translocations ensuing in gene fusions. We previously developed a system named bridge-induced translocation (BIT that allows linking together two different chromosomes exploiting the strong endogenous homologous recombination system of the yeast Saccharomyces cerevisiae. The BIT system generates a heterogeneous population of cells with different aneuploidies and severe aberrant phenotypes reminiscent of a cancerogenic transformation. In this work, thanks to a complex pop-out methodology of the marker used for the selection of translocants, we succeeded by BIT technology to precisely reproduce in yeast the peculiar chromosome translocation that has been associated with AML, characterized by the fusion between the human genes NUP98 and TOP2B. To shed light on the origin of the DNA fragility within NUP98, an extensive analysis of the curvature, bending, thermostability, and B-Z transition aptitude of the breakpoint region of NUP98 and of its yeast ortholog NUP145 has been performed. On this basis, a DNA cassette carrying homologous tails to the two genes was amplified by PCR and allowed the targeted fusion between NUP145 and TOP2, leading to reproduce the chimeric transcript in a diploid strain of S. cerevisiae. The resulting translocated yeast obtained through BIT appears characterized by abnormal spherical bodies of nearly 500 nm of diameter, absence of external membrane and defined cytoplasmic localization. Since Nup98 is a well-known regulator of the post-transcriptional modification of P53 target genes, and P53 mutations are occasionally reported in AML, this translocant yeast strain can be used as a model to test the constitutive expression of human P53. Although the abnormal phenotype of the translocant yeast was never rescued by its expression, an exogenous P53 was recognized to confer increased vitality to the translocants, in

  16. Jamb and jamc are essential for vertebrate myocyte fusion.

    Directory of Open Access Journals (Sweden)

    Gareth T Powell

    2011-12-01

    Full Text Available Cellular fusion is required in the development of several tissues, including skeletal muscle. In vertebrates, this process is poorly understood and lacks an in vivo-validated cell surface heterophilic receptor pair that is necessary for fusion. Identification of essential cell surface interactions between fusing cells is an important step in elucidating the molecular mechanism of cellular fusion. We show here that the zebrafish orthologues of JAM-B and JAM-C receptors are essential for fusion of myocyte precursors to form syncytial muscle fibres. Both jamb and jamc are dynamically co-expressed in developing muscles and encode receptors that physically interact. Heritable mutations in either gene prevent myocyte fusion in vivo, resulting in an overabundance of mononuclear, but otherwise overtly normal, functional fast-twitch muscle fibres. Transplantation experiments show that the Jamb and Jamc receptors must interact between neighbouring cells (in trans for fusion to occur. We also show that jamc is ectopically expressed in prdm1a mutant slow muscle precursors, which inappropriately fuse with other myocytes, suggesting that control of myocyte fusion through regulation of jamc expression has important implications for the growth and patterning of muscles. Our discovery of a receptor-ligand pair critical for fusion in vivo has important implications for understanding the molecular mechanisms responsible for myocyte fusion and its regulation in vertebrate myogenesis.

  17. In silico prediction of horizontal gene transfer events in Lactobacillus bulgaricus and Streptococcus thermophilus reveals protocooperation in yogurt manufacturing.

    Science.gov (United States)

    Liu, Mengjin; Siezen, Roland J; Nauta, Arjen

    2009-06-01

    Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions.

  18. Oral cancer/endothelial cell fusion experiences nuclear fusion and acquisition of enhanced survival potential.

    Science.gov (United States)

    Song, Kai; Song, Yong; Zhao, Xiao-Ping; Shen, Hui; Wang, Meng; Yan, Ting-Lin; Liu, Ke; Shang, Zheng-Jun

    2014-10-15

    Most previous studies have linked cancer-macrophage fusion with tumor progression and metastasis. However, the characteristics of hybrid cells derived from oral cancer and endothelial cells and their involvement in cancer remained unknown. Double-immunofluorescent staining and fluorescent in situ hybridization (FISH) were performed to confirm spontaneous cell fusion between eGFP-labeled human umbilical vein endothelial cells (HUVECs) and RFP-labeled SCC9, and to detect the expression of vementin and cytokeratin 18 in the hybrids. The property of chemo-resistance of such hybrids was examined by TUNEL assay. The hybrid cells in xenografted tumor were identified by FISH and GFP/RFP dual-immunofluoresence staining. We showed that SCC9 cells spontaneously fused with cocultured endothelial cells, and the resultant hybrid cells maintained the division and proliferation activity after re-plating and thawing. Such hybrids expressed markers of both parental cells and became more resistant to chemotherapeutic drug cisplatin as compared to the parental SCC9 cells. Our in vivo data indicated that the hybrid cells contributed to tumor composition by using of immunostaining and FISH analysis, even though the hybrid cells and SCC9 cells were mixed with 1:10,000, according to the FACS data. Our study suggested that the fusion events between oral cancer and endothelial cells undergo nuclear fusion and acquire a new property of drug resistance and consequently enhanced survival potential. These experimental findings provide further supportive evidence for the theory that cell fusion is involved in cancer progression. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Fusion peptides from oncogenic chimeric proteins as putative specific biomarkers of cancer.

    Science.gov (United States)

    Conlon, Kevin P; Basrur, Venkatesha; Rolland, Delphine; Wolfe, Thomas; Nesvizhskii, Alexey I; MacCoss, Michael J; Lim, Megan S; Elenitoba-Johnson, Kojo S J

    2013-10-01

    Chromosomal translocations encoding chimeric fusion proteins constitute one of the most common mechanisms underlying oncogenic transformation in human cancer. Fusion peptides resulting from such oncogenic chimeric fusions, though unique to specific cancer subtypes, are unexplored as cancer biomarkers. Here we show, using an approach termed fusion peptide multiple reaction monitoring mass spectrometry, the direct identification of different cancer-specific fusion peptides arising from protein chimeras that are generated from the juxtaposition of heterologous genes fused by recurrent chromosomal translocations. Using fusion peptide multiple reaction monitoring mass spectrometry in a clinically relevant scenario, we demonstrate the specific, sensitive, and unambiguous detection of a specific diagnostic fusion peptide in clinical samples of anaplastic large cell lymphoma, but not in a diverse array of benign lymph nodes or other forms of primary malignant lymphomas and cancer-derived cell lines. Our studies highlight the utility of fusion peptides as cancer biomarkers and carry broad implications for the use of protein biomarkers in cancer detection and monitoring.

  20. Recombination between Homeologous Chromosomes in Lager Yeasts leads to Loss of Function of the Hybrid GPH1 Gene.

    OpenAIRE

    BOND, URSULA

    2009-01-01

    PUBLISHED Yeasts used in the production of lagers contain complex allopolyploid genomes, resulting from the fusion of two different yeast species closely related to Saccharomyces cerevisiae and Saccharomyces bayanus. Recombination between the homoeologous chromosomes has generated a number of hybrid chromosomes. These recombination events provide potential for adaptive evolution through the loss or gain of gene function. We have examined the genotypic and phenotypic effects of one of the c...

  1. Genetically controlled fusion, exocytosis and fission of artificial vesicles-a roadmap

    DEFF Research Database (Denmark)

    Bönzli, Eva; Hadorn, Maik; de Lucrezia, Davide

    2011-01-01

    were shown to fuse if a special class of viral proteins, termed fusogenic peptides, were added to the external medium (Nomura et al. 2004). In the present work, we intend to develop genetically controlled fusion, fission and exocytosis of vesicles by the synthesis of peptides within vesicles. First, we...... enclosed synthesized peptides in vesicles to induce in a next step fusion of adjacent vesicles, fission and exocytosis of nested vesicles. Second, we will replace the peptides by an enclosed cell-free expression system to internally synthesize fusion peptides. To control the gene expression, different...

  2. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  3. Nuclear localization and transactivating capacities of the papillary renal cell carcinoma-associated TFE3 and PRCC (fusion) proteins

    NARCIS (Netherlands)

    Weterman, M. A. J.; van Groningen, J. J.; Jansen, A.; van Kessel, A. G.

    2000-01-01

    The papillary renal cell carcinoma-associated t(X;1)(p11;q21) leads to fusion of the transcription factor TFE3 gene on the X-chromosome to a novel gene, PRCC, on chromosome 1. As a result, two putative fusion proteins are formed: PRCCTFE3, which contains all known domains for DNA binding,

  4. Imaging of dihydrofolate reductase fusion gene expression in xenografts of human liver metastases of colorectal cancer in living rats

    Energy Technology Data Exchange (ETDEWEB)

    Mayer-Kuckuk, Philipp; Bertino, Joseph R.; Banerjee, Debabrata [Molecular Pharmacology and Therapeutics Program, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); The Cancer Institute of New Jersey, Robert Wood Johnson Medical School/UMDNJ, 195 Little Albany Street, NJ 08903, New Brunswick (United States); Doubrovin, Mikhail; Blasberg, Ronald; Tjuvajev, Juri Gelovani [Department of Neurooncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Gusani, Niraj J.; Fong, Yuman [Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Gade, Terence; Koutcher, Jason A. [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Balatoni, Julius; Finn, Ronald [Radiochemistry/Cyclotron Core Facility, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Akhurst, Tim; Larson, Steven [Nuclear Medicine Service, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

    2003-09-01

    Radionuclide imaging has been demonstrated to be feasible to monitor transgene expression in vivo. We hypothesized that a potential application of this technique is to non-invasively detect in deep tissue, such as cancer cells metastatic to the liver, a specific molecular response following systemic drug treatment. Utilizing human colon adenocarcinoma cells derived from a patient's liver lesion we first developed a nude rat xenograft model for colorectal cancer metastatic to the liver. Expression of a dihydrofolate reductase-herpes simplex virus 1 thymidine kinase fusion (DHFR-HSV1 TK) transgene in the hepatic tumors was monitored in individual animals using the tracer [{sup 124}I]2'-fluoro-2'-deoxy-5-iodouracil-{beta}-d-arabinofuranoside (FIAU) and a small animal micro positron emission tomograph (microPET), while groups of rats were imaged using the tracer [{sup 131}I]FIAU and a clinical gamma camera. Growth of the human metastatic colorectal cancer cells in the rat liver was detected using magnetic resonance imaging and confirmed by surgical inspection. Single as well as multiple lesions of different sizes and sites were observed in the liver of the animals. Next, using a subset of rats bearing hepatic tumors, which were retrovirally bulk transduced to express the DHFR-HSV1 TK transgene, we imaged the fusion protein expression in the hepatic tumor of living rats using the tracer [{sup 124}I]FIAU and a microPET. The observed deep tissue signals were highly specific for the tumors expressing the DHFR-HSV1 TK fusion protein compared with parental untransduced tumors and other tissues as determined by gamma counting of tissue samples. A subsequent study used the tracer [{sup 131}I]FIAU and a gamma camera to monitor two groups of transduced hepatic tumor-bearing rats. Prior to imaging, one group was treated with trimetrexate to exploit DHFR-mediated upregulation of the fusion gene product. Imaging in the living animal as well as subsequent gamma

  5. Introduction of transformed chloroplasts from tobacco into petunia by asymmetric cell fusion.

    Science.gov (United States)

    Sigeno, Asako; Hayashi, Sugane; Terachi, Toru; Yamagishi, Hiroshi

    2009-11-01

    Plastid engineering technique has been established only in Nicotiana tabacum, and the widespread application is severely limited so far. In order to exploit a method to transfer the genetically transformed plastomes already obtained in tobacco into other plant species, somatic cell fusion was conducted between a plastome transformant of tobacco and a cultivar of petunia (Petunia hybrida). A tobacco strain whose plastids had been transformed with aadA (a streptomycin/spectinomycin adenylyltransferase gene) and mdar [a gene for monodehydroascorbate reductase (MDAR)] and a petunia variety, 'Telstar', were used as cell fusion partners. An efficient regeneration system from the protoplasts of both the parents, and effectiveness of selection for the aadA gene with spectinomycin were established before the cell fusion. In addition, the influence of UV irradiation on the callus development from the protoplasts and shoot regeneration of tobacco was investigated. Protoplasts were cultured after cell fusion treatment with polyethylene glycol, and asymmetric somatic cybrids were selected using the aadA gene as a marker. Although many shoots of tobacco that had escaped the UV irradiation regenerated, several shoots possessing the morphology of petunia and the resistance to spectinomycin were obtained. Molecular analyses of the petunia type regenerants demonstrated that they had the nuclear and mitochondrial genomes derived from petunia besides the chloroplasts of tobacco transformed with aadA and mdar. Furthermore, it was ascertained that mdar was transcribed in the somatic cybrids. The results indicate the success in intergeneric transfer of transformed plastids of tobacco into petunia.

  6. Autophagy contributes to regulation of nuclear dynamics during vegetative growth and hyphal fusion in Fusarium oxysporum.

    Science.gov (United States)

    Corral-Ramos, Cristina; Roca, M Gabriela; Di Pietro, Antonio; Roncero, M Isabel G; Ruiz-Roldán, Carmen

    2015-01-01

    In the fungal pathogen Fusarium oxysporum, vegetative hyphal fusion triggers nuclear mitotic division in the invading hypha followed by migration of a nucleus into the receptor hypha and degradation of the resident nucleus. Here we examined the role of autophagy in fusion-induced nuclear degradation. A search of the F. oxysporum genome database for autophagy pathway components identified putative orthologs of 16 core autophagy-related (ATG) genes in yeast, including the ubiquitin-like protein Atg8, which is required for the formation of autophagosomal membranes. F. oxysporum Foatg8Δ mutants were generated in a strain harboring H1-cherry fluorescent protein (ChFP)-labeled nuclei to facilitate analysis of nuclear dynamics. The Foatg8Δ mutants did not show MDC-positive staining in contrast to the wild type and the FoATG8-complemented (cFoATG8) strain, suggesting that FoAtg8 is required for autophagy in F. oxysporum. The Foatg8Δ strains displayed reduced rates of hyphal growth, conidiation, and fusion, and were significantly attenuated in virulence on tomato plants and in the nonvertebrate animal host Galleria mellonella. In contrast to wild-type hyphae, which are almost exclusively composed of uninucleated hyphal compartments, the hyphae of the Foatg8Δ mutants contained a significant fraction of hyphal compartments with 2 or more nuclei. The increase in the number of nuclei per hyphal compartment was particularly evident after hyphal fusion events. Time-lapse microscopy analyses revealed abnormal mitotic patterns during vegetative growth in the Foatg8Δ mutants. Our results suggest that autophagy mediates nuclear degradation after hyphal fusion and has a general function in the control of nuclear distribution in F. oxysporum.

  7. Combined use of expression and CGH arrays pinpoints novel candidate genes in Ewing sarcoma family of tumors

    International Nuclear Information System (INIS)

    Savola, Suvi; Knuutila, Sakari; Klami, Arto; Tripathi, Abhishek; Niini, Tarja; Serra, Massimo; Picci, Piero; Kaski, Samuel; Zambelli, Diana; Scotlandi, Katia

    2009-01-01

    Ewing sarcoma family of tumors (ESFT), characterized by t(11;22)(q24;q12), is one of the most common tumors of bone in children and young adults. In addition to EWS/FLI1 gene fusion, copy number changes are known to be significant for the underlying neoplastic development of ESFT and for patient outcome. Our genome-wide high-resolution analysis aspired to pinpoint genomic regions of highest interest and possible target genes in these areas. Array comparative genomic hybridization (CGH) and expression arrays were used to screen for copy number alterations and expression changes in ESFT patient samples. A total of 31 ESFT samples were analyzed by aCGH and in 16 patients DNA and RNA level data, created by expression arrays, was integrated. Time of the follow-up of these patients was 5–192 months. Clinical outcome was statistically evaluated by Kaplan-Meier/Logrank methods and RT-PCR was applied on 42 patient samples to study the gene of the highest interest. Copy number changes were detected in 87% of the cases. The most recurrent copy number changes were gains at 1q, 2, 8, and 12, and losses at 9p and 16q. Cumulative event free survival (ESFT) and overall survival (OS) were significantly better (P < 0.05) for primary tumors with three or less copy number changes than for tumors with higher number of copy number aberrations. In three samples copy number imbalances were detected in chromosomes 11 and 22 affecting the FLI1 and EWSR1 loci, suggesting that an unbalanced t(11;22) and subsequent duplication of the derivative chromosome harboring fusion gene is a common event in ESFT. Further, amplifications on chromosomes 20 and 22 seen in one patient sample suggest a novel translocation type between EWSR1 and an unidentified fusion partner at 20q. In total 20 novel ESFT associated putative oncogenes and tumor suppressor genes were found in the integration analysis of array CGH and expression data. Quantitative RT-PCR to study the expression levels of the most interesting

  8. Gene design, fusion technology and TEV cleavage conditions influence the purification of oxidized disulphide-rich venom peptides in Escherichia coli.

    Science.gov (United States)

    Sequeira, Ana Filipa; Turchetto, Jeremy; Saez, Natalie J; Peysson, Fanny; Ramond, Laurie; Duhoo, Yoan; Blémont, Marilyne; Fernandes, Vânia O; Gama, Luís T; Ferreira, Luís M A; Guerreiro, Catarina I P I; Gilles, Nicolas; Darbon, Hervé; Fontes, Carlos M G A; Vincentelli, Renaud

    2017-01-17

    Animal venoms are large, complex libraries of bioactive, disulphide-rich peptides. These peptides, and their novel biological activities, are of increasing pharmacological and therapeutic importance. However, recombinant expression of venom peptides in Escherichia coli remains difficult due to the significant number of cysteine residues requiring effective post-translational processing. There is also an urgent need to develop high-throughput recombinant protocols applicable to the production of reticulated peptides to enable efficient screening of their drug potential. Here, a comprehensive study was developed to investigate how synthetic gene design, choice of fusion tag, compartment of expression, tag removal conditions and protease recognition site affect levels of solubility of oxidized venom peptides produced in E. coli. The data revealed that expression of venom peptides imposes significant pressure on cysteine codon selection. DsbC was the best fusion tag for venom peptide expression, in particular when the fusion was directed to the bacterial periplasm. While the redox activity of DsbC was not essential to maximize expression of recombinant fusion proteins, redox activity did lead to higher levels of correctly folded target peptides. With the exception of proline, the canonical TEV protease recognition site tolerated all other residues at its C-terminus, confirming that no non-native residues, which might affect activity, need to be incorporated at the N-terminus of recombinant peptides for tag removal. This study reveals that E. coli is a convenient heterologous host for the expression of soluble and functional venom peptides. Using the optimal construct design, a large and diverse range of animal venom peptides were produced in the µM scale. These results open up new possibilities for the high-throughput production of recombinant disulphide-rich peptides in E. coli.

  9. Hemi-fused structure mediates and controls fusion and fission in live cells.

    Science.gov (United States)

    Zhao, Wei-Dong; Hamid, Edaeni; Shin, Wonchul; Wen, Peter J; Krystofiak, Evan S; Villarreal, Seth A; Chiang, Hsueh-Cheng; Kachar, Bechara; Wu, Ling-Gang

    2016-06-23

    Membrane fusion and fission are vital for eukaryotic life. For three decades, it has been proposed that fusion is mediated by fusion between the proximal leaflets of two bilayers (hemi-fusion) to produce a hemi-fused structure, followed by fusion between the distal leaflets, whereas fission is via hemi-fission, which also produces a hemi-fused structure, followed by full fission. This hypothesis remained unsupported owing to the lack of observation of hemi-fusion or hemi-fission in live cells. A competing fusion hypothesis involving protein-lined pore formation has also been proposed. Here we report the observation of a hemi-fused Ω-shaped structure in live neuroendocrine chromaffin cells and pancreatic β-cells, visualized using confocal and super-resolution stimulated emission depletion microscopy. This structure is generated from fusion pore opening or closure (fission) at the plasma membrane. Unexpectedly, the transition to full fusion or fission is determined by competition between fusion and calcium/dynamin-dependent fission mechanisms, and is notably slow (seconds to tens of seconds) in a substantial fraction of the events. These results provide key missing evidence in support of the hemi-fusion and hemi-fission hypothesis in live cells, and reveal the hemi-fused intermediate as a key structure controlling fusion and fission, as fusion and fission mechanisms compete to determine the transition to fusion or fission.

  10. Frequent gene conversion events between the X and Y homologous chromosomal regions in primates

    Directory of Open Access Journals (Sweden)

    Hirai Hirohisa

    2010-07-01

    Full Text Available Abstract Background Mammalian sex-chromosomes originated from a pair of autosomes. A step-wise cessation of recombination is necessary for the proper maintenance of sex-determination and, consequently, generates a four strata structure on the X chromosome. Each stratum shows a specific per-site nucleotide sequence difference (p-distance between the X and Y chromosomes, depending on the time of recombination arrest. Stratum 4 covers the distal half of the human X chromosome short arm and the p-distance of the stratum is ~10%, on average. However, a 100-kb region, which includes KALX and VCX, in the middle of stratum 4 shows a significantly lower p-distance (1-5%, suggesting frequent sequence exchanges or gene conversions between the X and Y chromosomes in humans. To examine the evolutionary mechanism for this low p-distance region, sequences of a corresponding region including KALX/Y from seven species of non-human primates were analyzed. Results Phylogenetic analysis of this low p-distance region in humans and non-human primate species revealed that gene conversion like events have taken place at least ten times after the divergence of New World monkeys and Catarrhini (i.e., Old World monkeys and hominoids. A KALY-converted KALX allele in white-handed gibbons also suggests a possible recent gene conversion between the X and Y chromosomes. In these primate sequences, the proximal boundary of this low p-distance region is located in a LINE element shared between the X and Y chromosomes, suggesting the involvement of this element in frequent gene conversions. Together with a palindrome on the Y chromosome, a segmental palindrome structure on the X chromosome at the distal boundary near VCX, in humans and chimpanzees, may mediate frequent sequence exchanges between X and Y chromosomes. Conclusion Gene conversion events between the X and Y homologous regions have been suggested, mainly in humans. Here, we found frequent gene conversions in the

  11. C-reactive protein gene C1444T polymorphism and risk of recurrent ischemic events in patients with symptomatic intracranial atherostenoses.

    Science.gov (United States)

    Arenillas, Juan F; Massot, Andreu; Alvarez-Sabín, Jose; Fernandez-Cadenas, Israel; del Rio-Espinola, Albert; Chacon, Pilar; Quintana, Manuel; Molina, Carlos A; Rovira, Alex; Montaner, Joan

    2009-01-01

    High levels of C-reactive protein (CRP) are associated with an increased risk of further ischemic events in patients with symptomatic intracranial atherosclerotic disease (ICAD). It remains unknown to which extent this increased risk might be genetically predetermined. We aimed to investigate the relationship between a common genetic polymorphism of the CRP gene and the risk of recurrent ischemic events in symptomatic ICAD patients. We studied 75 consecutive patients with a first-ever cerebral ischemic event attributable to symptomatic ICAD. Blood samples were drawn 3 months after the qualifying event. Genomic DNA was isolated and the C1444T single nucleotide polymorphism (SNP) of the CRP gene was determined. The blood concentration of CRP was also measured. Patients underwent long-term clinical follow-up to detect the occurrence of further major ischemic events. During a median follow-up time of 23 months, 18 patients (24%) suffered a major ischemic event (10 ischemic strokes, 3 transient ischemic attacks and 5 myocardial infarctions). Raised CRP levels at baseline (p = 0.02) and the presence of the T allele within the CRP C1444T SNP were associated with a higher risk of recurrent ischemic events (p = 0.02). Kaplan-Meier and multivariable Cox regression analyses adjusted for age, sex, vascular risk factors and CRP level identified that the presence of the T allele in the studied polymorphism predicted the occurrence of further ischemic events (hazard ratio 3.6, 95% confidence interval 1.2-11.1; p = 0.025). The presence of the T allele within the CRP gene C1444T polymorphism may be associated with a higher risk of further ischemic events in symptomatic ICAD patients. (c) 2009 S. Karger AG, Basel.

  12. Disentangling complete and incomplete fusion for 9Be+187Re system at near barrier energies

    International Nuclear Information System (INIS)

    Kharab, Rajesh; Chahal, Rajiv; Rajiv Kumar

    2015-01-01

    The breakup of projectile before fusion leads to some unusual fusion mechanisms like incomplete fusion (ICF) and sequential complete fusion (SCF). Experimentally, it is not possible to separate SCF events from direct complete fusion (DCF). However, the complete fusion and incomplete fusion can be measured separately. Theoretically it is very difficult to calculate the complete and incomplete fusion cross section separately using different models. Very recently A. Diaz-Torres has developed a computer code platypus based on classical dynamical model wherein the complete and incomplete fusion cross sections are calculated separately. But this model is found to work very well at energies above the barrier energy. Here we have attempted to extrapolate the results of the code platypus by using simple Wong's formula in conjunction with the energy dependent Woods-Saxon potential (EDWSP) in the below barrier energy region

  13. Atomic and plasma-material interaction data for fusion. Vol.1

    International Nuclear Information System (INIS)

    1991-01-01

    The International Atomic Energy Agency, through its Atomic and Molecular Data Unit, coordinates a wide spectrum of programmes for the compilation, evaluation, and generation of atomic, molecular, and plasma-wall interaction data for fusion research. The present, first, volume of Atomic and Plasma-Material Interaction Data for Fusion, contains extended versions of the reviews presented at the IAEA Advisory Group Meeting on Particle-Surface Interaction Data for Fusion, held 19-21 April 1989 at the IAEA Headquarters in Vienna, The plasma-wall interaction processes covered here are those considered most important for the operational performance of magnetic confinement fusion reactors. In addition to processes due to particle impact under normal operation, plasma-wall interaction effects due to off-normal plasma events (disruptions, electron runaway bombardment) are covered, and a summary of the status of data information on these processes is given from the point of view of magnetic fusion reactor design. Refs, figs and tabs

  14. CONTEXT-CAPTURE MULTI-VALUED DECISION FUSION WITH FAULT TOLERANT CAPABILITY FOR WIRELESS SENSOR NETWORKS

    OpenAIRE

    Jun Wu; Shigeru Shimamoto

    2011-01-01

    Wireless sensor networks (WSNs) are usually utilized to perform decision fusion of event detection. Current decision fusion schemes are based on binary valued decision and do not consider bursty contextcapture. However, bursty context and multi-valued data are important characteristics of WSNs. One on hand, the local decisions from sensors usually have bursty and contextual characteristics. Fusion center must capture the bursty context information from the sensors. On the other hand, in pract...

  15. SET-NUP214 fusion in acute myeloid leukemia- and T-cell acute lymphoblastic leukemia-derived cell lines

    Directory of Open Access Journals (Sweden)

    Zaborski Margarete

    2009-01-01

    Full Text Available Abstract Background SET-NUP214 fusion resulting from a recurrent cryptic deletion, del(9(q34.11q34.13 has recently been described in T-cell acute lymphoblastic leukemia (T-ALL and in one case of acute myeloid leukemia (AML. The fusion protein appears to promote elevated expression of HOXA cluster genes in T-ALL and may contribute to the pathogenesis of the disease. We screened a panel of ALL and AML cell lines for SET-NUP214 expression to find model systems that might help to elucidate the cellular function of this fusion gene. Results Of 141 human leukemia/lymphoma cell lines tested, only the T-ALL cell line LOUCY and the AML cell line MEGAL expressed the SET(TAF-Iβ-NUP214 fusion gene transcript. RT-PCR analysis specifically recognizing the alternative first exons of the two TAF-I isoforms revealed that the cell lines also expressed TAF-Iα-NUP214 mRNA. Results of fluorescence in situ hybridization (FISH and array-based copy number analysis were both consistent with del(9(q34.11q34.13 as described. Quantitative genomic PCR also confirmed loss of genomic material between SET and NUP214 in both cell lines. Genomic sequencing localized the breakpoints of the SET gene to regions downstream of the stop codon and to NUP214 intron 17/18 in both LOUCY and MEGAL cells. Both cell lines expressed the 140 kDa SET-NUP214 fusion protein. Conclusion Cell lines LOUCY and MEGAL express the recently described SET-NUP214 fusion gene. Of special note is that the formation of the SET exon 7/NUP214 exon 18 gene transcript requires alternative splicing as the SET breakpoint is located downstream of the stop codon in exon 8. The cell lines are promising model systems for SET-NUP214 studies and should facilitate investigating cellular functions of the the SET-NUP214 protein.

  16. FOXO1 is a direct target of EWS-Fli1 oncogenic fusion protein in Ewing's sarcoma cells

    International Nuclear Information System (INIS)

    Yang, Liu; Hu, Hsien-Ming; Zielinska-Kwiatkowska, Anna; Chansky, Howard A.

    2010-01-01

    Research highlights: → Inducible and reversible siRNA knockdown of an oncogenic fusion protein such as EWS-Fli1 is feasible and more advantageous than other siRNA methods. → The tumor suppressor gene FOXO1 is a new EWS-Fli1 target. → While trans-activators are known for the FOXO1 gene, there has been no report on negative regulators of FOXO1 transcription. → This study provides first evidence that the EWS-Fli1 oncogenic fusion protein can function as a transcriptional repressor of the FOXO1 gene. -- Abstract: Ewing's family tumors are characterized by a specific t(11;22) chromosomal translocation that results in the formation of EWS-Fli1 oncogenic fusion protein. To investigate the effects of EWS-Fli1 on gene expression, we carried out DNA microarray analysis after specific knockdown of EWS-Fli1 through transfection of synthetic siRNAs. EWS-Fli1 knockdown increased expression of genes such as DKK1 and p57 that are known to be repressed by EWS-Fli1 fusion protein. Among other potential EWS-Fli1 targets identified by our microarray analysis, we have focused on the FOXO1 gene since it encodes a potential tumor suppressor and has not been previously reported in Ewing's cells. To better understand how EWS-Fli1 affects FOXO1 expression, we have established a doxycycline-inducible siRNA system to achieve stable and reversible knockdown of EWS-Fli1 in Ewing's sarcoma cells. Here we show that FOXO1 expression in Ewing's cells has an inverse relationship with EWS-Fli1 protein level, and FOXO1 promoter activity is increased after doxycycline-induced EWS-Fli1 knockdown. In addition, we have found that direct binding of EWS-Fli1 to FOXO1 promoter is attenuated after doxycycline-induced siRNA knockdown of the fusion protein. Together, these results suggest that suppression of FOXO1 function by EWS-Fli1 fusion protein may contribute to cellular transformation in Ewing's family tumors.

  17. 2nd Karlsruhe International Summer School on Fusion Technologies

    International Nuclear Information System (INIS)

    Bahm, W.; Stycz, K.

    2008-01-01

    For the second time, the Karlsruhe Research enter together with European research institutions and industries invited young scientists and engineers to its ''International Summer School on Fusion Technologies.'' Fifty participants from all over Europe attended the lectures by 35 experts preesenting contributions from their areas of competence. Ten young scientists from India and another 10 from China were connected to the events by video link. Physics student Kornelia Stycz describes her impressions as a participant in the ''2 nd International Summer School on Fusion Technologies.'' (orig.)

  18. Different sets of ER-resident J-proteins regulate distinct polar nuclear-membrane fusion events in Arabidopsis thaliana.

    Science.gov (United States)

    Maruyama, Daisuke; Yamamoto, Masaya; Endo, Toshiya; Nishikawa, Shuh-ichi

    2014-11-01

    Angiosperm female gametophytes contain a central cell with two polar nuclei. In many species, including Arabidopsis thaliana, the polar nuclei fuse during female gametogenesis. We previously showed that BiP, an Hsp70 in the endoplasmic reticulum (ER), was essential for membrane fusion during female gametogenesis. Hsp70 function requires partner proteins for full activity. J-domain containing proteins (J-proteins) are the major Hsp70 functional partners. A. thaliana ER contains three soluble J-proteins, AtERdj3A, AtERdj3B, and AtP58(IPK). Here, we analyzed mutants of these proteins and determined that double-mutant ovules lacking AtP58(IPK) and AtERdj3A or AtERdj3B were defective in polar nuclear fusion. Electron microscopy analysis identified that polar nuclei were in close contact, but no membrane fusion occurred in mutant ovules lacking AtP58(IPK) and AtERdj3A. The polar nuclear outer membrane appeared to be connected via the ER remaining at the inner unfused membrane in mutant ovules lacking AtP58(IPK) and AtERdj3B. These results indicate that ER-resident J-proteins, AtP58(IPK)/AtERdj3A and AtP58(IPK)/AtERdj3B, function at distinct steps of polar nuclear-membrane fusion. Similar to the bip1 bip2 double mutant female gametophytes, the aterdj3a atp58(ipk) double mutant female gametophytes defective in fusion of the outer polar nuclear membrane displayed aberrant endosperm proliferation after fertilization with wild-type pollen. However, endosperm proliferated normally after fertilization of the aterdj3b atp58(ipk) double mutant female gametophytes defective in fusion of the inner membrane. Our results indicate that the polar nuclear fusion defect itself does not cause an endosperm proliferation defect. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  19. In Silico Prediction of Horizontal Gene Transfer Events in Lactobacillus bulgaricus and Streptococcus thermophilus Reveals Protocooperation in Yogurt Manufacturing▿ †

    Science.gov (United States)

    Liu, Mengjin; Siezen, Roland J.; Nauta, Arjen

    2009-01-01

    Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions. PMID:19395564

  20. Fusion energy

    International Nuclear Information System (INIS)

    Gross, R.A.

    1984-01-01

    This textbook covers the physics and technology upon which future fusion power reactors will be based. It reviews the history of fusion, reaction physics, plasma physics, heating, and confinement. Descriptions of commercial plants and design concepts are included. Topics covered include: fusion reactions and fuel resources; reaction rates; ignition, and confinement; basic plasma directory; Tokamak confinement physics; fusion technology; STARFIRE: A commercial Tokamak fusion power plant. MARS: A tandem-mirror fusion power plant; and other fusion reactor concepts

  1. Three Cell Fusions during Double Fertilization.

    Science.gov (United States)

    Sprunck, Stefanie; Dresselhaus, Thomas

    2015-05-07

    Fertilization of both egg and central cell is a major distinguishing feature of flowering plants. Now, Maruyama et al. report a third cell fusion event between the persistent synergid and the fertilized central cell shortly after double fertilization in Arabidopsis. This causes rapid dilution of pollen tube attractant(s), preventing polytubey. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Cryogenic system operating experience review for fusion applications

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    1992-01-01

    This report presents a review of cryogenic system operating experiences, from particle accelerator, fusion experiment, space research, and other applications. Safety relevant operating experiences and accident information are discussed. Quantitative order-of-magnitude estimates of cryogenic component failure rates and accident initiating event frequencies are presented for use in risk assessment, reliability, and availability studies. Safety concerns with cryogenic systems are discussed, including ozone formation, effects of spills, and modeling spill behavior. This information should be useful to fusion system designers and safety analysts, such as the team working on the International Thermonuclear Experimental Reactor design

  3. Dynamic assembly of brambleberry mediates nuclear envelope fusion during early development.

    Science.gov (United States)

    Abrams, Elliott W; Zhang, Hong; Marlow, Florence L; Kapp, Lee; Lu, Sumei; Mullins, Mary C

    2012-08-03

    To accommodate the large cells following zygote formation, early blastomeres employ modified cell divisions. Karyomeres are one such modification, mitotic intermediates wherein individual chromatin masses are surrounded by nuclear envelope; the karyomeres then fuse to form a single mononucleus. We identified brambleberry, a maternal-effect zebrafish mutant that disrupts karyomere fusion, resulting in formation of multiple micronuclei. As karyomeres form, Brambleberry protein localizes to the nuclear envelope, with prominent puncta evident near karyomere-karyomere interfaces corresponding to membrane fusion sites. brambleberry corresponds to an unannotated gene with similarity to Kar5p, a protein that participates in nuclear fusion in yeast. We also demonstrate that Brambleberry is required for pronuclear fusion following fertilization in zebrafish. Our studies provide insight into the machinery required for karyomere fusion and suggest that specialized proteins are necessary for proper nuclear division in large dividing blastomeres. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Fire protection system operating experience review for fusion applications

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    1995-12-01

    This report presents a review of fire protection system operating experiences from particle accelerator, fusion experiment, and other applications. Safety relevant operating experiences and accident information are discussed. Quantitative order-of-magnitude estimates of fire protection system component failure rates and fire accident initiating event frequencies are presented for use in risk assessment, reliability, and availability studies. Safety concerns with these systems are discussed, including spurious operation. This information should be useful to fusion system designers and safety analysts, such as the team working on the Engineering Design Activities for the International Thermonuclear Experimental Reactor

  5. Fire protection system operating experience review for fusion applications

    Energy Technology Data Exchange (ETDEWEB)

    Cadwallader, L.C.

    1995-12-01

    This report presents a review of fire protection system operating experiences from particle accelerator, fusion experiment, and other applications. Safety relevant operating experiences and accident information are discussed. Quantitative order-of-magnitude estimates of fire protection system component failure rates and fire accident initiating event frequencies are presented for use in risk assessment, reliability, and availability studies. Safety concerns with these systems are discussed, including spurious operation. This information should be useful to fusion system designers and safety analysts, such as the team working on the Engineering Design Activities for the International Thermonuclear Experimental Reactor.

  6. Black hole fusion in the extreme mass ratio limit

    Science.gov (United States)

    Emparan, Roberto; Martínez, Marina; Zilhão, Miguel

    2018-02-01

    We present a simple, general, and accurate construction of the event horizons for the fusion of two neutral, rotating black holes with arbitrary orientation and values of their spins, in the extreme mass ratio limit where one black hole is much larger than the other. We compute several parameters that characterize the fusion and investigate their dependence on the black hole spin and orientation axis. We also exhibit and study the appearance of transient toroidal topology of the horizon. An earlier conjecture about universal critical exponents before and after an axisymmetric pinch is proven.

  7. C-E1 fusion protein synthesized by rubella virus DI RNAs maintained during serial passage

    International Nuclear Information System (INIS)

    Tzeng, W.-P.; Frey, Teryl K.

    2006-01-01

    Rubella virus (RUB) replicons are derivatives of the RUB infectious cDNA clone that retain the nonstructural open reading frame (NS-ORF) that encodes the replicase proteins but not the structural protein ORF (SP-ORF) that encodes the virion proteins. RUB defective interfering (DI) RNAs contain deletions within the SP-ORF and thus resemble replicons. DI RNAs often retain the 5' end of the capsid protein (C) gene that has been shown to modulate virus-specific RNA synthesis. However, when replicons either with or without the C gene were passaged serially in the presence of wt RUB as a source of the virion proteins, it was found that neither replicon was maintained and DI RNAs were generated. The majority DI RNA species contained in-frame deletions in the SP-ORF leading to a fusion between the 5' end of the C gene and the 3' end of the E1 glycoprotein gene. DI infectious cDNA clones were constructed and transcripts from these DI infectious cDNA clones were maintained during serial passage with wt RUB. The C-E1 fusion protein encoded by the DI RNAs was synthesized and was required for maintenance of the DI RNA during serial passage. This is the first report of a functional novel gene product resulting from deletion during DI RNA generation. Thus far, the role of the C-E1 fusion protein in maintenance of DI RNAs during serial passage remained elusive as it was found that the fusion protein diminished rather than enhanced DI RNA synthesis and was not incorporated into virus particles

  8. Fusion reactors and the environment

    International Nuclear Information System (INIS)

    Wrixon, A.D.

    1976-01-01

    A summary is given of the report of a study group set up in 1971 by the Director of the UKAEA Culham Laboratory to investigate environmental and safety aspects of future commercial fusion reactors (1975, Carruthers, R., Dunster, H.J., Smith, R.D., Watson, C.J.H., and Mitchell, J.T.D., Culham Study Group Report on Fusion Reactors and the Environment, CLM-R148, HMSO, London). This report was originally issued in 1973 under limited distribution, but has only recently been made available for open circulation. Deuterium/tritium fusion is thought to be the most likely reaction to be used in the first generation of reactors. Estimates were made of the local and world-wide population hazards from the release of tritium, both under normal operating conditions and in the event of an accident. One serious type of accident would be a lithium metal fire in the blanket region of the reactor. The use of a fusible lithium salt (FLIBE), eliminating the lithium fire risk, is considered but the report concentrates on lithium metal in the blanket region. The main hazards to operating staff arise both from tritium and from neutron activation of the construction materials. Remote servicing of the reactor structure will be essential, but radioactive waste management seems less onerous than for fission reactors. Meaningful comparison of the overall hazards associated with fusion and fission power programmes is not yet possible. The study group emphasized the need for more data to aid the safety assessments, and the need for such assessments to keep pace with fusion power station design. (U.K.)

  9. Application of optical tweezers and excimer laser to study protoplast fusion

    Science.gov (United States)

    Kantawang, Titirat; Samipak, Sompid; Limtrakul, Jumras; Chattham, Nattaporn

    2015-07-01

    Protoplast fusion is a physical phenomenon that two protoplasts come in contact and fuse together. Doing so, it is possible to combine specific genes from one protoplast to another during fusion such as drought resistance and disease resistance. There are a few possible methods to induce protoplast fusion, for example, electrofusion and chemical fusion. In this study, chemical fusion was performed with laser applied as an external force to enhance rate of fusion and observed under a microscope. Optical tweezers (1064 nm with 100X objective N.A. 1.3) and excimer laser (308 nm LMU-40X-UVB objective) were set with a Nikon Ti-U inverted microscope. Samples were prepared by soaking in hypertonic solution in order to induce cell plasmolysis. Elodea Canadensis and Allium cepa plasmolysed leaves were cut and observed under microscope. Concentration of solution was varied to induce difference turgor pressures on protoplasts pushing at cell wall. Free protoplasts in solution were trapped by optical tweezers to study the effect of Polyethylene glycol (PEG) solution. PEG was diluted by Ca+ solution during the process to induced protoplast cell contact and fusion. Possibility of protoplast fusion by excimer laser was investigated and found possible. Here we report a novel tool for plant cell fusion using excimer laser. Plant growth after cell fusion is currently conducted.

  10. Bringing functions together with fusion enzymes--from nature's inventions to biotechnological applications.

    Science.gov (United States)

    Elleuche, Skander

    2015-02-01

    It is a mammoth task to develop a modular protein toolbox enabling the production of posttranslational organized multifunctional enzymes that catalyze reactions in complex pathways. However, nature has always guided scientists to mimic evolutionary inventions in the laboratory and, nowadays, versatile methods have been established to experimentally connect enzymatic activities with multiple advantages. Among the oldest known natural examples is the linkage of two or more juxtaposed proteins catalyzing consecutive, non-consecutive, or opposing reactions by a native peptide bond. There are multiple reasons for the artificial construction of such fusion enzymes including improved catalytic activities, enabled substrate channelling by proximity of biocatalysts, higher stabilities, and cheaper production processes. To produce fused proteins, it is either possible to genetically fuse coding open reading frames or to connect proteins in a posttranslational process. Molecular biology techniques that have been established for the production of end-to-end or insertional fusions include overlap extension polymerase chain reaction, cloning, and recombination approaches. Depending on their flexibility and applicability, these methods offer various advantages to produce fusion genes in high throughput, different orientations, and including linker sequences to maximize the flexibility and performance of fusion partners. In this review, practical techniques to fuse genes are highlighted, enzymatic parameters to choose adequate enzymes for fusion approaches are summarized, and examples with biotechnological relevance are presented including a focus on plant biomass-degrading glycosyl hydrolases.

  11. Safety issues for superconducting fusion magnets

    International Nuclear Information System (INIS)

    Hsieh, S.Y.; Reich, M.; Powell, J.R.

    1978-01-01

    Safety issues for future superconducting fusion magnet systems are examined. It is found that safety and failure experience with existing superconducting magnets is not very applicable to predictions as to the safety and reliability of fusion magnets. Such predictions will have to depend on analysis and judgement for many years to come, rather than on accumulated experience. A number of generic potential structural, thermal-hydraulic, and electrical safety problems are identified and analyzed. Prevention of quenches and non-uniform temperature distributions, if quenches should occur, is of great importance, since such events can trigger processes which lead to magnet damage or failure. Engineered safety features will be necessary for fusion magnets. Two of these, an energy dispersion system and external coil containment, appear capable of reducing the probability of coil disruption to very low levels. However, they do not prevent loss of function accidents which are of economic concern. Elaborate detector, temperature equalization, and energy removal systems will be required to minimize the chances of loss of function accidents

  12. Advances in study of reporter gene imaging for monitoring gene therapy

    International Nuclear Information System (INIS)

    Mu Chuanjie; Zhou Jiwen

    2003-01-01

    To evaluate the efficiency of gene therapy, it is requisite to monitor localization and expression of the therapeutic gene in vivo. Monitoring expression of reporter gene using radionuclide reporter gene technique is the best method. Adenoviral vectors expressing reporter gene are constructed using gene fusion, bicistronic, double promoter or bidirectional transcriptional recombination techniques, and transferred into target cells and tissues, then injected radiolabeled reporter probes which couple to the reporter genes. The reporter genes can be imaged invasively, repeatedly, quantitatively with γ-camera, PET and SPECT. Recently, several reporter gene and reporter probe systems have been used in studies of gene therapy. The part of them has been used for clinic trials

  13. Safety analysis of fusion reactors pertaining to nuclear incidents and accidents. Final report

    International Nuclear Information System (INIS)

    Raeder, J.; Weller, A.; Wolf, R.; Jin, X.; Boccaccini, L.V.; Stieglitz, R.; Carloni, D.; Pistner, C.; Herb, J.

    2013-11-01

    The BfS gave the projekt partners IPP, KIT, Oeko-Institut e. V., and GRS the order to carry out a literature study on the topic of safety of fusion power plants regarding nuclear incidents and accidents. In the framework of this study the actual status of science and technology of the safety concept of fusion power plants should be determined and the applicability of the nuclear safety regulations hitherto developed for nuclear power plants checked. For future commercial fusion power plants today only conceptional designs exist. The most advanced conceptual study for a future fusion power plant is the European Power Plant Conceptual Study (PPCS) from the year 2005, which is based on the tokamak principle. In this study also fundamental aspects of the safety concept of nuclear fusion are treated. Hereby several different conceptual approaches are discussed, which differ among others also in the lay-out approaches relevant for the safety of a facility like for instance the choice of the breeding concept or the materials for the blanket/divertor structure and the coolants. The safety concept of nuclear fusion is oriented on safety concepts for facilities with radioactive inventory. It is based on the concept of tiered safety levels. In order to check whether for the nuclear fusion a safety concept comparable with the nuclear fission at all is necessary, in a first step it was considered, which consequences are possible at a postulated release o large parts of the radioactive inventory of a fusion power plant. Such a worst-case scenario was compared with a corresponding, postulated release of large parts of the radioactive inventory of a nuclear power plant. As scale hereby served the radiological criterion, at the transgression of which in the environment of the facility an evacuation would be necessary. In a next step the transferability of the safety concept of the tiered safety levels of nuclear technology to the fusion was checked. Beside events transferable from

  14. Are Fusion Transcripts in Relapsed/Metastatic Head and Neck Cancer Patients Predictive of Response to Anti-EGFR Therapies?

    Directory of Open Access Journals (Sweden)

    Paolo Bossi

    2017-01-01

    Full Text Available Prediction of benefit from combined chemotherapy and the antiepidermal growth factor receptor cetuximab is a not yet solved question in head and neck squamous cell carcinoma (HNSCC. In a selected series of 14 long progression-free survival (PFS and 26 short PFS patients by whole gene and microRNA expression analysis, we developed a model potentially predictive of cetuximab sensitivity. To better decipher the “omics” profile of our patients, we detected transcript fusions by RNA-seq through a Pan-Cancer panel targeting 1385 cancer genes. Twenty-seven different fusion transcripts, involving mRNA and long noncoding RNA (lncRNA, were identified. The majority of fusions (81% were intrachromosomal, and 24 patients (60% harbor at least one of them. The presence/absence of fusions and the presence of more than one fusion were not related to outcome, while the lncRNA-containing fusions resulted enriched in long PFS patients (P=0.0027. The CD274-PDCD1LG2 fusion was present in 7/14 short PFS patients harboring fusions and was absent in long PFS patients (P=0.0188. Among the short PFS patients, those harboring this fusion had the worst outcome (P=0.0172 and increased K-RAS activation (P=0.00147. The associations between HNSCC patient’s outcome following cetuximab treatment and lncRNA-containing fusions or the CD274-PDCD1LG2 fusion deserve validation in prospective clinical trials.

  15. Safety analysis and evaluation of the next fusion device

    International Nuclear Information System (INIS)

    Kobayashi, Shigetada; Honda, Tsutomu; Ohmura, Hiroshi; Kawai, Masayoshi; Shimizu, Takeshi; Yamaoka, Mitsuaki; Nakahara, Katsuhiko; Seki, Yasushi.

    1988-12-01

    As a part of safety evaluation, a probabilistic risk assessment (PRA) has been attempted for the Next Fusion Device system. Among the various events related to safety, a number of representative events have been selected for assessment, from the events in normal operation state, repair and maintenance state and accidental state. In the first chapter, in order to conduct the probabilistic risk assessment of the whole Fusion Experimental Reactor (FER), the data base required for the analysis was investigated in 1.1, the results on the failure mode and effects analysis (FMEA), accident sequence, radioactive inventory leakage flow path, event tree analysis (ETA) and fault tree analysis (FTA) were summarized in 1.2 to 1.5, respectively. Based on these results, accident initiating events were evaluated in 1.6, and overall risk was assessed in 1.7 and the tasks for the future were summarized in 1.8. It is important to analyze and evaluate various events during normal operations, repair and maintenance and accidents. However, due to the large uncertainties in the modeling of phenomena or the data base, there are many events for which realistic analyses are difficult. Three such events were selected and studied in chapter two. In 2.1, the temperature rise in the reactor structure after the Loss-of-Coolant-Accident caused by the decay heat under various heat removal conditions were investigated. In 2.2, the radiation dose of personnel during repair and maintenance period caused by the release of activated dust were estimated. Lastly, in 2.3 tritium behavior in the stainless steel first wall and graphite armour were studied. (author)

  16. Quantitative measurement of binocular color fusion limit for non-spectral colors.

    Science.gov (United States)

    Jung, Yong Ju; Sohn, Hosik; Lee, Seong-il; Ro, Yong Man; Park, Hyun Wook

    2011-04-11

    Human perception becomes difficult in the event of binocular color fusion when the color difference presented for the left and right eyes exceeds a certain threshold value, known as the binocular color fusion limit. This paper discusses the binocular color fusion limit for non-spectral colors within the color gamut of a conventional LCD 3DTV. We performed experiments to measure the color fusion limit for eight chromaticity points sampled from the CIE 1976 chromaticity diagram. A total of 2480 trials were recorded for a single observer. By analyzing the results, the color fusion limit was quantified by ellipses in the chromaticity diagram. The semi-minor axis of the ellipses ranges from 0.0415 to 0.0923 in terms of the Euclidean distance in the u'v´ chromaticity diagram and the semi-major axis ranges from 0.0640 to 0.1560. These eight ellipses are drawn on the chromaticity diagram. © 2011 Optical Society of America

  17. High-level SUMO-mediated fusion expression of ABP-dHC-cecropin A from multiple joined genes in Escherichia coli.

    Science.gov (United States)

    Zhang, Jiaxin; Movahedi, Ali; Wei, Zhiheng; Sang, Ming; Wu, Xiaolong; Wang, Mengyang; Wei, Hui; Pan, Huixin; Yin, Tongming; Zhuge, Qiang

    2016-09-15

    The antimicrobial peptide ABP-dHC-cecropin A is a small cationic peptide with potent activity against a wide range of bacterial species. Evidence of antifungal activity has also been suggested; however, evaluation of this peptide has been limited due to the low expression of cecropin proteins in Escherichia coli. To improve the expression level of ABP-dHC-cecropin A in E. coli, tandem repeats of the ABP-dHC-cecropin A gene were constructed and expressed as fusion proteins (SUMO-nABP-dHC-cecropin, n = 1, 2, 3, 4) via pSUMO-nABP-dHC-cecropin A vectors (n = 1, 2, 3, 4). Comparison of the expression levels of soluble SUMO-nABP-dHC-cecropin A fusion proteins (n = 1, 2, 3, 4) suggested that BL21 (DE3)/pSUMO-3ABP-dHC-cecropin A is an ideal recombinant strain for ABP-dHC-cecropin A production. Under the selected conditions of cultivation and isopropylthiogalactoside (IPTG) induction, the expression level of ABP-dHC-cecropin A was as high as 65 mg/L, with ∼21.3% of the fusion protein in soluble form. By large-scale fermentation, protein production reached nearly 300 mg/L, which is the highest yield of ABP-dHC-cecropin A reported to date. In antibacterial experiments, the efficacy was approximately the same as that of synthetic ABP-dHC-cecropin A. This method provides a novel and effective means of producing large amounts of ABP-dHC-cecropin A. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. `Full fusion' is not ineluctable during vesicular exocytosis of neurotransmitters by endocrine cells

    Science.gov (United States)

    Oleinick, Alexander; Svir, Irina; Amatore, Christian

    2017-01-01

    Vesicular exocytosis is an essential and ubiquitous process in neurons and endocrine cells by which neurotransmitters are released in synaptic clefts or extracellular fluids. It involves the fusion of a vesicle loaded with chemical messengers with the cell membrane through a nanometric fusion pore. In endocrine cells, unless it closes after some flickering (`Kiss-and-Run' events), this initial pore is supposed to expand exponentially, leading to a full integration of the vesicle membrane into the cell membrane-a stage called `full fusion'. We report here a compact analytical formulation that allows precise measurements of the fusion pore expansion extent and rate to be extracted from individual amperometric spike time courses. These data definitively establish that, during release of catecholamines, fusion pores enlarge at most to approximately one-fifth of the radius of their parent vesicle, hence ruling out the ineluctability of `full fusion'.

  19. Fusion

    CERN Document Server

    Mahaffey, James A

    2012-01-01

    As energy problems of the world grow, work toward fusion power continues at a greater pace than ever before. The topic of fusion is one that is often met with the most recognition and interest in the nuclear power arena. Written in clear and jargon-free prose, Fusion explores the big bang of creation to the blackout death of worn-out stars. A brief history of fusion research, beginning with the first tentative theories in the early 20th century, is also discussed, as well as the race for fusion power. This brand-new, full-color resource examines the various programs currently being funded or p

  20. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  1. Stereochemical inversion of (S)-reticuline by a cytochrome P450 fusion in opium poppy.

    Science.gov (United States)

    Farrow, Scott C; Hagel, Jillian M; Beaudoin, Guillaume A W; Burns, Darcy C; Facchini, Peter J

    2015-09-01

    The gateway to morphine biosynthesis in opium poppy (Papaver somniferum) is the stereochemical inversion of (S)-reticuline since the enzyme yielding the first committed intermediate salutaridine is specific for (R)-reticuline. A fusion between a cytochrome P450 (CYP) and an aldo-keto reductase (AKR) catalyzes the S-to-R epimerization of reticuline via 1,2-dehydroreticuline. The reticuline epimerase (REPI) fusion was detected in opium poppy and in Papaver bracteatum, which accumulates thebaine. In contrast, orthologs encoding independent CYP and AKR enzymes catalyzing the respective synthesis and reduction of 1,2-dehydroreticuline were isolated from Papaver rhoeas, which does not accumulate morphinan alkaloids. An ancestral relationship between these enzymes is supported by a conservation of introns in the gene fusions and independent orthologs. Suppression of REPI transcripts using virus-induced gene silencing in opium poppy reduced levels of (R)-reticuline and morphinan alkaloids and increased the overall abundance of (S)-reticuline and its O-methylated derivatives. Discovery of REPI completes the isolation of genes responsible for known steps of morphine biosynthesis.

  2. CD36 is required for myoblast fusion during myogenic differentiation

    International Nuclear Information System (INIS)

    Park, Seung-Yoon; Yun, Youngeun; Kim, In-San

    2012-01-01

    Highlights: ► CD36 expression was induced during myogenic differentiation. ► CD36 expression was localized in multinucleated myotubes. ► The expression of myogenic markers is attenuated in CD36 knockdown C2C12 cells. ► Knockdown of CD36 significantly inhibited myotube formation during differentiation. -- Abstract: Recently, CD36 has been found to be involved in the cytokine-induced fusion of macrophage. Myoblast fusion to form multinucleated myotubes is required for myogenesis and muscle regeneration. Because a search of gene expression database revealed the attenuation of CD36 expression in the muscles of muscular dystrophy patients, the possibility that CD36 could be required for myoblast fusion was investigated. CD36 expression was markedly up-regulated during myoblast differentiation and localized in multinucleated myotubes. Knockdown of endogenous CD36 significantly decreased the expression of myogenic markers as well as myotube formation. These results support the notion that CD36 plays an important role in cell fusion during myogenic differentiation. Our finding will aid the elucidation of the common mechanism governing cell-to-cell fusion in various fusion models.

  3. CD36 is required for myoblast fusion during myogenic differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Park, Seung-Yoon [Department of Biochemistry, College of Medicine, Dongguk University and Medical Institute of Dongguk University, Gyeongju 780-714 (Korea, Republic of); Yun, Youngeun [Department of Biochemistry and Cell Biology, Cell and Matrix Research Institute, School of Medicine, Kyungpook National University, Daegu 700-422 (Korea, Republic of); Kim, In-San, E-mail: iskim@knu.ac.kr [Department of Biochemistry and Cell Biology, Cell and Matrix Research Institute, School of Medicine, Kyungpook National University, Daegu 700-422 (Korea, Republic of); Biomedical Research Institute, Korea Institute Science and Technology, Seoul (Korea, Republic of)

    2012-11-02

    Highlights: Black-Right-Pointing-Pointer CD36 expression was induced during myogenic differentiation. Black-Right-Pointing-Pointer CD36 expression was localized in multinucleated myotubes. Black-Right-Pointing-Pointer The expression of myogenic markers is attenuated in CD36 knockdown C2C12 cells. Black-Right-Pointing-Pointer Knockdown of CD36 significantly inhibited myotube formation during differentiation. -- Abstract: Recently, CD36 has been found to be involved in the cytokine-induced fusion of macrophage. Myoblast fusion to form multinucleated myotubes is required for myogenesis and muscle regeneration. Because a search of gene expression database revealed the attenuation of CD36 expression in the muscles of muscular dystrophy patients, the possibility that CD36 could be required for myoblast fusion was investigated. CD36 expression was markedly up-regulated during myoblast differentiation and localized in multinucleated myotubes. Knockdown of endogenous CD36 significantly decreased the expression of myogenic markers as well as myotube formation. These results support the notion that CD36 plays an important role in cell fusion during myogenic differentiation. Our finding will aid the elucidation of the common mechanism governing cell-to-cell fusion in various fusion models.

  4. Exercise-Induced Rhabdomyolysis and Stress-Induced Malignant Hyperthermia Events, Association with Malignant Hyperthermia Susceptibility, and RYR1 Gene Sequence Variations

    Directory of Open Access Journals (Sweden)

    Antonella Carsana

    2013-01-01

    Full Text Available Exertional rhabdomyolysis (ER and stress-induced malignant hyperthermia (MH events are syndromes that primarily afflict military recruits in basic training and athletes. Events similar to those occurring in ER and in stress-induced MH events are triggered after exposure to anesthetic agents in MH-susceptible (MHS patients. MH is an autosomal dominant hypermetabolic condition that occurs in genetically predisposed subjects during general anesthesia, induced by commonly used volatile anesthetics and/or the neuromuscular blocking agent succinylcholine. Triggering agents cause an altered intracellular calcium regulation. Mutations in RYR1 gene have been found in about 70% of MH families. The RYR1 gene encodes the skeletal muscle calcium release channel of the sarcoplasmic reticulum, commonly known as ryanodine receptor type 1 (RYR1. The present work reviews the documented cases of ER or of stress-induced MH events in which RYR1 sequence variations, associated or possibly associated to MHS status, have been identified.

  5. Influence of rhTPO/GM-CSF fusion protein on hemopoiesis in mice irradiated with 60Co γ-rays

    International Nuclear Information System (INIS)

    Cao Hua; Ge Zhongliang; Zhang Qunwei; Liu Xiuzhen

    1999-01-01

    Objective: To find a new biological therapy for secondary hematopoietic failure including anemia, infection and hemorrhage after administration of chemotherapeutic drugs etc. Methods: hGM-CSF gene was ligated with hTPO gene isolated from human fetal liver mRNA and a new fusion protein rh TPO/GM-CSF obtained. Results: The new fusion protein could promote recovery of peripheral WBC and PLT of 5.0 Gy irradiated mice. BFU-E, CFU-Meg and CFU-GM in bone marrow of mice after irradiation recovered significantly by treatment with rhTPO/GM-CSF fusion protein for 10 days. Conclusion: These results suggest that the new fusion protein has the biological activity of both hTPO and hGM-CSF simultaneously and can stimulate the proliferation of megakaryocytes and granulocyte progenitors

  6. Lineage fusion in Galápagos giant tortoises.

    Science.gov (United States)

    Garrick, Ryan C; Benavides, Edgar; Russello, Michael A; Hyseni, Chaz; Edwards, Danielle L; Gibbs, James P; Tapia, Washington; Ciofi, Claudio; Caccone, Adalgisa

    2014-11-01

    Although many classic radiations on islands are thought to be the result of repeated lineage splitting, the role of past fusion is rarely known because during these events, purebreds are rapidly replaced by a swarm of admixed individuals. Here, we capture lineage fusion in action in a Galápagos giant tortoise species, Chelonoidis becki, from Wolf Volcano (Isabela Island). The long generation time of Galápagos tortoises and dense sampling (841 individuals) of genetic and demographic data were integral in detecting and characterizing this phenomenon. In C. becki, we identified two genetically distinct, morphologically cryptic lineages. Historical reconstructions show that they colonized Wolf Volcano from Santiago Island in two temporally separated events, the first estimated to have occurred ~199 000 years ago. Following arrival of the second wave of colonists, both lineages coexisted for approximately ~53 000 years. Within that time, they began fusing back together, as microsatellite data reveal widespread introgressive hybridization. Interestingly, greater mate selectivity seems to be exhibited by purebred females of one of the lineages. Forward-in-time simulations predict rapid extinction of the early arriving lineage. This study provides a rare example of reticulate evolution in action and underscores the power of population genetics for understanding the past, present and future consequences of evolutionary phenomena associated with lineage fusion. © 2014 John Wiley & Sons Ltd.

  7. Inertial Confinement Fusion R and D and Nuclear Proliferation

    International Nuclear Information System (INIS)

    Goldston, Robert J.

    2011-01-01

    In a few months, or a few years, the National Ignition Facility (NIF) at the Lawrence Livermore National Laboratory may achieve fusion gain using 192 powerful lasers to generate x-rays that will compress and heat a small target containing isotopes of hydrogen. This event would mark a major milestone after decades of research on inertial confinement fusion (ICF). It might also mark the beginning of an accelerated global effort to harness fusion energy based on this science and technology. Unlike magnetic confinement fusion (ITER, 2011), in which hot fusion fuel is confined continuously by strong magnetic fields, inertial confinement fusion involves repetitive fusion explosions, taking advantage of some aspects of the science learned from the design and testing of hydrogen bombs. The NIF was built primarily because of the information it would provide on weapons physics, helping the United States to steward its stockpile of nuclear weapons without further underground testing. The U.S. National Academies' National Research Council is now hosting a study to assess the prospects for energy from inertial confinement fusion. While this study has a classified sub-panel on target physics, it has not been charged with examining the potential nuclear proliferation risks associated with ICF R and D. We argue here that this question urgently requires direct and transparent examination, so that means to mitigate risks can be assessed, and the potential residual risks can be balanced against the potential benefits, now being assessed by the NRC. This concern is not new (Holdren, 1978), but its urgency is now higher than ever before.

  8. Muon nuclear fusion and low temperature nuclear fusion

    International Nuclear Information System (INIS)

    Nagamine, Kanetada

    1990-01-01

    Low temperature (or normal temperature) nuclear fusion is one of the phenomena causing nuclear fusion without requiring high temperature. In thermal nuclear fusion, the Coulomb barrier is overcome with the help of thermal energy, but in the low temperature nuclear fusion, the Coulomb barrier is neutralized by the introduction of the particles having larger mass than electrons and negative charges, at this time, if two nuclei can approach to the distance of 10 -13 cm in the neutral state, the occurrence of nuclear fusion reaction is expected. As the mass of the particles is heavier, the neutral region is smaller, and nuclear fusion is easy to occur. The particles to meet this purpose are the electrons within substances and muons. The research on muon nuclear fusion became suddenly active in the latter half of 1970s, the cause of which was the discovery of the fact that the formation of muons occurs resonantly rapidly in D-T and D-D systems. Muons are the unstable elementary particles having the life of 2.2 μs, and they can have positive and negative charges. In the muon catalyzed fusion, the muons with negative charge take part. The principle of the muon catalyzed fusion, its present status and future perspective, and the present status of low temperature nuclear fusion are reported. (K.I.)

  9. Data for human cell spheroid model of embryonic tissue fusion in vitro.

    Data.gov (United States)

    U.S. Environmental Protection Agency — Epithelial-mesenchymal interactions drive embryonic fusion events during development and upon perturbation can result in birth defects. Cleft palate and neural tube...

  10. Fusion or Fission: The Destiny of Mitochondria In Traumatic Brain Injury of Different Severities.

    Science.gov (United States)

    Di Pietro, Valentina; Lazzarino, Giacomo; Amorini, Angela Maria; Signoretti, Stefano; Hill, Lisa J; Porto, Edoardo; Tavazzi, Barbara; Lazzarino, Giuseppe; Belli, Antonio

    2017-08-23

    Mitochondrial dynamics are regulated by a complex system of proteins representing the mitochondrial quality control (MQC). MQC balances antagonistic forces of fusion and fission determining mitochondrial and cell fates. In several neurological disorders, dysfunctional mitochondria show significant changes in gene and protein expression of the MQC and contribute to the pathophysiological mechanisms of cell damage. In this study, we evaluated the main gene and protein expression involved in the MQC in rats receiving traumatic brain injury (TBI) of different severities. At 6, 24, 48 and 120 hours after mild TBI (mTBI) or severe TBI (sTBI), gene and protein expressions of fusion and fission were measured in brain tissue homogenates. Compared to intact brain controls, results showed that genes and proteins inducing fusion or fission were upregulated and downregulated, respectively, in mTBI, but downregulated and upregulated, respectively, in sTBI. In particular, OPA1, regulating inner membrane dynamics, cristae remodelling, oxidative phosphorylation, was post-translationally cleaved generating differential amounts of long and short OPA1 in mTBI and sTBI. Corroborated by data referring to citrate synthase, these results confirm the transitory (mTBI) or permanent (sTBI) mitochondrial dysfunction, enhancing MQC importance to maintain cell functions and indicating in OPA1 an attractive potential therapeutic target for TBI.

  11. Mechanistic perspective of mitochondrial fusion: tubulation vs. fragmentation.

    Science.gov (United States)

    Escobar-Henriques, Mafalda; Anton, Fabian

    2013-01-01

    Mitochondrial fusion is a fundamental process driven by dynamin related GTPase proteins (DRPs), in contrast to the general SNARE-dependence of most cellular fusion events. The DRPs Mfn1/Mfn2/Fzo1 and OPA1/Mgm1 are the key effectors for fusion of the mitochondrial outer and inner membranes, respectively. In order to promote fusion, these two DRPs require post-translational modifications and proteolysis. OPA1/Mgm1 undergoes partial proteolytic processing, which results in a combination between short and long isoforms. In turn, ubiquitylation of mitofusins, after oligomerization and GTP hydrolysis, promotes and positively regulates mitochondrial fusion. In contrast, under conditions of mitochondrial dysfunction, negative regulation by proteolysis on these DRPs results in mitochondrial fragmentation. This occurs by complete processing of OPA1 and via ubiquitylation and degradation of mitofusins. Mitochondrial fragmentation contributes to the elimination of damaged mitochondria by mitophagy, and may play a protective role against Parkinson's disease. Moreover, a link of Mfn2 to Alzheimer's disease is emerging and mutations in Mfn2 or OPA1 cause Charcot-Marie-Tooth type 2A neuropathy or autosomal-dominant optic atrophy. Here, we summarize our current understanding on the molecular mechanisms promoting or inhibiting fusion of mitochondrial membranes, which is essential for cellular survival and disease control. This article is part of a Special Issue entitled: Mitochondrial dynamics and physiology. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Association between insurance status and patient safety in the lumbar spine fusion population.

    Science.gov (United States)

    Tanenbaum, Joseph E; Alentado, Vincent J; Miller, Jacob A; Lubelski, Daniel; Benzel, Edward C; Mroz, Thomas E

    2017-03-01

    Lumbar fusion is a common and costly procedure in the United States. Reimbursement for surgical procedures is increasingly tied to care quality and patient safety as part of value-based reimbursement programs. The incidence of adverse quality events among lumbar fusion patients is unknown using the definition of care quality (patient safety indicators [PSI]) used by the Centers for Medicare and Medicaid Services (CMS). The association between insurance status and the incidence of PSI is similarly unknown in lumbar fusion patients. This study sought to determine the incidence of PSI in patients undergoing inpatient lumbar fusion and to quantify the association between primary payer status and PSI in this population. A retrospective cohort study was carried out. The sample comprised all adult patients aged 18 years and older who were included in the Nationwide Inpatient Sample (NIS) that underwent lumbar fusion from 1998 to 2011. The incidence of one or more PSI, a validated and widely used metric of inpatient health-care quality and patient safety, was the primary outcome variable. The NIS data were examined for all cases of inpatient lumbar fusion from 1998 to 2011. The incidence of adverse patient safety events (PSI) was determined using publicly available lists of the International Classification of Diseases, Ninth Revision, Clinical Modification diagnosis codes. Logistic regression models were used to determine the association between primary payer status (Medicaid and self-pay relative to private insurance) and the incidence of PSI. A total of 539,172 adult lumbar fusion procedures were recorded in the NIS from 1998 to 2011. Patients were excluded from the secondary analysis if "other" or "missing" was listed for primary insurance status. The national incidence of PSI was calculated to be 2,445 per 100,000 patient years of observation, or approximately 2.5%. In a secondary analysis, after adjusting for patient demographics and hospital characteristics, Medicaid

  13. Fusion technology: The Iter fusion experiment

    International Nuclear Information System (INIS)

    Dietz, K.J.

    1994-01-01

    Plans for the Iter international fusion experiment, in which the European Union, Japan, Canada, Russia, Sweden, Switzerland, and the USA cooperate, were begun in 1985, and construction work started in early 1994. These activities serve for the preparation of the design and construction documents for a research reactor in which a stable fusion plasma is to be generated. This is to be the basis for the construction of a fusion reactor for electricity generation. Preparatory work was performed in the Tokamak experiments with JET and TFTR. The fusion power of 1.5 GW will be attained, thus enabling Iter to keep a deuterium-tritium plasma burning. (orig.) [de

  14. Membrane cholesterol regulates lysosome-plasma membrane fusion events and modulates Trypanosoma cruzi invasion of host cells.

    Directory of Open Access Journals (Sweden)

    Bárbara Hissa

    Full Text Available BACKGROUND: Trypomastigotes of Trypanosoma cruzi are able to invade several types of non-phagocytic cells through a lysosomal dependent mechanism. It has been shown that, during invasion, parasites trigger host cell lysosome exocytosis, which initially occurs at the parasite-host contact site. Acid sphingomyelinase released from lysosomes then induces endocytosis and parasite internalization. Lysosomes continue to fuse with the newly formed parasitophorous vacuole until the parasite is completely enclosed by lysosomal membrane, a process indispensable for a stable infection. Previous work has shown that host membrane cholesterol is also important for the T. cruzi invasion process in both professional (macrophages and non-professional (epithelial phagocytic cells. However, the mechanism by which cholesterol-enriched microdomains participate in this process has remained unclear. METHODOLOGY/PRINCIPAL FINDING: In the present work we show that cardiomyocytes treated with MβCD, a drug able to sequester cholesterol from cell membranes, leads to a 50% reduction in invasion by T. cruzi trypomastigotes, as well as a decrease in the number of recently internalized parasites co-localizing with lysosomal markers. Cholesterol depletion from host membranes was accompanied by a decrease in the labeling of host membrane lipid rafts, as well as excessive lysosome exocytic events during the earlier stages of treatment. Precocious lysosomal exocytosis in MβCD treated cells led to a change in lysosomal distribution, with a reduction in the number of these organelles at the cell periphery, and probably compromises the intracellular pool of lysosomes necessary for T. cruzi invasion. CONCLUSION/SIGNIFICANCE: Based on these results, we propose that cholesterol depletion leads to unregulated exocytic events, reducing lysosome availability at the cell cortex and consequently compromise T. cruzi entry into host cells. The results also suggest that two different pools of

  15. Fusion Physics

    Energy Technology Data Exchange (ETDEWEB)

    Kikuchi, Mitsuru; Lackner, Karl; Tran, Minh Quang [eds.

    2012-09-15

    Recreating the energy production process of the Sun - nuclear fusion - on Earth in a controlled fashion is one of the greatest challenges of this century. If achieved at affordable costs, energy supply security would be greatly enhanced and environmental degradation from fossil fuels greatly diminished. Fusion Physics describes the last fifty years or so of physics and research in innovative technologies to achieve controlled thermonuclear fusion for energy production. The International Atomic Energy Agency (IAEA) has been involved since its establishment in 1957 in fusion research. It has been the driving force behind the biennial conferences on Plasma Physics and Controlled Thermonuclear Fusion, today known as the Fusion Energy Conference. Hosted by several Member States, this biennial conference provides a global forum for exchange of the latest achievements in fusion research against the backdrop of the requirements for a net energy producing fusion device and, eventually, a fusion power plant. The scientific and technological knowledge compiled during this series of conferences, as well as by the IAEA Nuclear Fusion journal, is immense and will surely continue to grow in the future. It has led to the establishment of the International Thermonuclear Experimental Reactor (ITER), which represents the biggest experiment in energy production ever envisaged by humankind.

  16. Fault-tolerant Sensor Fusion for Marine Navigation

    DEFF Research Database (Denmark)

    Blanke, Mogens

    2006-01-01

    Reliability of navigation data are critical for steering and manoeuvring control, and in particular so at high speed or in critical phases of a mission. Should faults occur, faulty instruments need be autonomously isolated and faulty information discarded. This paper designs a navigation solution...... where essential navigation information is provided even with multiple faults in instrumentation. The paper proposes a provable correct implementation through auto-generated state-event logics in a supervisory part of the algorithms. Test results from naval vessels document the performance and shows...... events where the fault-tolerant sensor fusion provided uninterrupted navigation data despite temporal instrument defects...

  17. Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

    Science.gov (United States)

    Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila

    2017-05-08

    In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Characterization of the fusion core in zebrafish endogenous retroviral envelope protein

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Jian [State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, Hubei 430072 (China); State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei 430071 (China); Zhang, Huaidong [CAS Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei 430071 (China); Gong, Rui, E-mail: gongr@wh.iov.cn [CAS Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei 430071 (China); Xiao, Gengfu, E-mail: xiaogf@wh.iov.cn [State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, Hubei 430072 (China); State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei 430071 (China)

    2015-05-08

    Zebrafish endogenous retrovirus (ZFERV) is the unique endogenous retrovirus in zebrafish, as yet, containing intact open reading frames of its envelope protein gene in zebrafish genome. Similarly, several envelope proteins of endogenous retroviruses in human and other mammalian animal genomes (such as syncytin-1 and 2 in human, syncytin-A and B in mouse) were identified and shown to be functional in induction of cell–cell fusion involved in placental development. ZFERV envelope protein (Env) gene appears to be also functional in vivo because it is expressible. After sequence alignment, we found ZFERV Env shares similar structural profiles with syncytin and other type I viral envelopes, especially in the regions of N- and C-terminal heptad repeats (NHR and CHR) which were crucial for membrane fusion. We expressed the regions of N + C protein in the ZFERV Env (residues 459–567, including predicted NHR and CHR) to characterize the fusion core structure. We found N + C protein could form a stable coiled-coil trimer that consists of three helical NHR regions forming a central trimeric core, and three helical CHR regions packing into the grooves on the surface of the central core. The structural characterization of the fusion core revealed the possible mechanism of fusion mediated by ZFERV Env. These results gave comprehensive explanation of how the ancient virus infects the zebrafish and integrates into the genome million years ago, and showed a rational clue for discovery of physiological significance (e.g., medicate cell–cell fusion). - Highlights: • ZFERV Env shares similar structural profiles with syncytin and other type I viral envelopes. • The fusion core of ZFERV Env forms stable coiled-coil trimer including three NHRs and three CHRs. • The structural mechanism of viral entry mediated by ZFERV Env is disclosed. • The results are helpful for further discovery of physiological function of ZFERV Env in zebrafish.

  19. EMP Fusion

    OpenAIRE

    KUNTAY, Isık

    2010-01-01

    This paper introduces a novel fusion scheme, called EMP Fusion, which has the promise of achieving breakeven and realizing commercial fusion power. The method is based on harnessing the power of an electromagnetic pulse generated by the now well-developed flux compression technology. The electromagnetic pulse acts as a means of both heating up the plasma and confining the plasma, eliminating intermediate steps. The EMP Fusion device is simpler compared to other fusion devices and this reduces...

  20. Vegetative hyphal fusion and subsequent nuclear behavior in Epichloë grass endophytes.

    Science.gov (United States)

    Shoji, Jun-Ya; Charlton, Nikki D; Yi, Mihwa; Young, Carolyn A; Craven, Kelly D

    2015-01-01

    Epichloë species (including the former genus Neotyphodium) are fungal symbionts of many agronomically important forage grasses, and provide their grass hosts with protection from a wide range of biotic and abiotic stresses. Epichloë species include many interspecific hybrids with allodiploid-like genomes, which may provide the potential for combined traits or recombination to generate new traits. Though circumstantial evidence suggests that such interspecific hybrids might have arisen from nuclear fusion events following vegetative hyphal fusion between different Epichloë strains, this hypothesis has not been addressed empirically. Here, we investigated vegetative hyphal fusion and subsequent nuclear behavior in Epichloë species. A majority of Epichloë strains, especially those having a sexual stage, underwent self vegetative hyphal fusion. Vegetative fusion also occurred between two hyphae from different Epichloë strains. Though Epichloë spp. are uninucleate fungi, hyphal fusion resulted in two nuclei stably sharing the same cytoplasm, which might ultimately lead to nuclear fusion. In addition, protoplast fusion experiments gave rise to uninucleate putative hybrids, which apparently had two markers, one from each parent within the same nucleus. These results are consistent with the notion that interspecific hybrids arise from vegetative hyphal fusion. However, we also discuss additional factors, such as post-hybridization selection, that may be important to explain the recognized prevalence of hybrids in Epichloë species.

  1. Mimivirus reveals Mre11/Rad50 fusion proteins with a sporadic distribution in eukaryotes, bacteria, viruses and plasmids

    Directory of Open Access Journals (Sweden)

    Ogata Hiroyuki

    2011-09-01

    Full Text Available Abstract Background The Mre11/Rad50 complex and the homologous SbcD/SbcC complex in bacteria play crucial roles in the metabolism of DNA double-strand breaks, including DNA repair, genome replication, homologous recombination and non-homologous end-joining in cellular life forms and viruses. Here we investigated the amino acid sequence of the Mimivirus R555 gene product, originally annotated as a Rad50 homolog, and later shown to have close homologs in marine microbial metagenomes. Results Our bioinformatics analysis revealed that R555 protein sequence is constituted from the fusion of an N-terminal Mre11-like domain with a C-terminal Rad50-like domain. A systematic database search revealed twelve additional cases of Mre11/Rad50 (or SbcD/SbcC fusions in a wide variety of unrelated organisms including unicellular and multicellular eukaryotes, the megaplasmid of a bacterium associated to deep-sea hydrothermal vents (Deferribacter desulfuricans and the plasmid of Clostridium kluyveri. We also showed that R555 homologs are abundant in the metagenomes from different aquatic environments and that they most likely belong to aquatic viruses. The observed phyletic distribution of these fusion proteins suggests their recurrent creation and lateral gene transfers across organisms. Conclusions The existence of the fused version of protein sequences is consistent with known functional interactions between Mre11 and Rad50, and the gene fusion probably enhanced the opportunity for lateral transfer. The abundance of the Mre11/Rad50 fusion genes in viral metagenomes and their sporadic phyletic distribution in cellular organisms suggest that viruses, plasmids and transposons played a crucial role in the formation of the fusion proteins and their propagation into cellular genomes.

  2. Oncogenic activation of FOXR1 by 11q23 intrachromosomal deletion-fusions in neuroblastoma

    NARCIS (Netherlands)

    Santo, E. E.; Ebus, M. E.; Koster, J.; Schulte, J. H.; Lakeman, A.; van Sluis, P.; Vermeulen, J.; Gisselsson, D.; Øra, I.; Lindner, S.; Buckley, P. G.; Stallings, R. L.; Vandesompele, J.; Eggert, A.; Caron, H. N.; Versteeg, R.; Molenaar, J. J.

    2012-01-01

    Neuroblastoma tumors frequently show loss of heterozygosity of chromosome 11q with a shortest region of overlap in the 11q23 region. These deletions are thought to cause inactivation of tumor suppressor genes leading to haploinsufficiency. Alternatively, micro-deletions could lead to gene fusion

  3. Site-specific modification of genome with cell-permeable Cre fusion protein in preimplantation mouse embryo

    International Nuclear Information System (INIS)

    Kim, Kyoungmi; Kim, Hwain; Lee, Daekee

    2009-01-01

    Site-specific recombination (SSR) by Cre recombinase and its target sequence, loxP, is a valuable tool in genetic analysis of gene function. Recently, several studies reported successful application of Cre fusion protein containing protein transduction peptide for inducing gene modification in various mammalian cells including ES cell as well as in the whole animal. In this study, we show that a short incubation of preimplantation mouse embryos with purified cell-permeable Cre fusion protein results in efficient SSR. X-Gal staining of preimplantation embryos, heterozygous for Gtrosa26 tm1Sor , revealed that treatment of 1-cell or 2-cell embryos with 3 μM of Cre fusion protein for 2 h leads to Cre-mediated excision in 70-85% of embryos. We have examined the effect of the concentration of the Cre fusion protein and the duration of the treatment on embryonic development, established a condition for full term development and survival to adulthood, and demonstrated the germ line transmission of excised Gtrosa26 allele. Potential applications and advantages of the highly efficient technique described here are discussed.

  4. A genome-wide immunodetection screen in S. cerevisiae uncovers novel genes involved in lysosomal vacuole function and morphology.

    Directory of Open Access Journals (Sweden)

    Florante Ricarte

    Full Text Available Vacuoles of yeast Saccharomyces cerevisiae are functionally analogous to mammalian lysosomes. Both are cellular organelles responsible for macromolecular degradation, ion/pH homeostasis, and stress survival. We hypothesized that undefined gene functions remain at post-endosomal stage of vacuolar events and performed a genome-wide screen directed at such functions at the late endosome and vacuole interface - ENV genes. The immunodetection screen was designed to identify mutants that internally accumulate precursor form of the vacuolar hydrolase carboxypeptidase Y (CPY. Here, we report the uncovering and initial characterizations of twelve ENV genes. The small size of the collection and the lack of genes previously identified with vacuolar events are suggestive of the intended exclusive functional interface of the screen. Most notably, the collection includes four novel genes ENV7, ENV9, ENV10, and ENV11, and three genes previously linked to mitochondrial processes - MAM3, PCP1, PPE1. In all env mutants, vesicular trafficking stages were undisturbed in live cells as assessed by invertase and active α-factor secretion, as well as by localization of the endocytic fluorescent marker FM4-64 to the vacuole. Several mutants exhibit defects in stress survival functions associated with vacuoles. Confocal fluorescence microscopy revealed the collection to be significantly enriched in vacuolar morphologies suggestive of fusion and fission defects. These include the unique phenotype of lumenal vesicles within vacuoles in the novel env9Δ mutant and severely fragmented vacuoles upon deletion of GET4, a gene recently implicated in tail anchored membrane protein insertion. Thus, our results establish new gene functions in vacuolar function and morphology, and suggest a link between vacuolar and mitochondrial events.

  5. Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

    DEFF Research Database (Denmark)

    Liu, Yilan; Chen, Jinjin; Thygesen, Anders

    2018-01-01

    Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

  6. Interaction between serotonin transporter gene variants and life events predicts response to antidepressants in the GENDEP project

    DEFF Research Database (Denmark)

    Keers, R.; Uher, R.; Huezo-Diaz, P.

    2011-01-01

    , and several polymorphisms in the serotonin transporter gene (SLC6A4) have been genotyped including the serotonin transporter-linked polymorphic region (5-HTTLPR). Stressful life events were shown to predict a significantly better response to escitalopram but had no effect on response to nortriptyline...

  7. Broad target cell selectivity of Kaposi's sarcoma-associated herpesvirus glycoprotein-mediated cell fusion and virion entry

    International Nuclear Information System (INIS)

    Kaleeba, Johnan A.R.; Berger, Edward A.

    2006-01-01

    The molecular mechanism of Kaposi's sarcoma-associated herpesvirus (KSHV, human herpesvirus 8) entry is poorly understood. We tested a broad variety of cell types of diverse species and tissue origin for their ability to function as targets in a quantitative reporter gene assay for KSHV-glycoprotein-mediated cell fusion. Several human, non-human primate, and rabbit cell lines were efficient targets, whereas rodent and all human lymphoblastoid cell lines were weak targets. Parallel findings were obtained with a virion entry assay using a recombinant KSHV encoding a reporter gene. No correlation was observed between target cell activity and surface expression of α3β1 integrin, a proposed KSHV receptor. We hypothesize that target cell permissiveness in both the cell fusion and virion entry assays reflects the presence of a putative KSHV fusion-entry receptor

  8. Thermal resistivity of tungsten grades under fusion relevant conditions

    Energy Technology Data Exchange (ETDEWEB)

    Wirtz, M.; Linke, J.; Pintsuk, G. [Forschungszentrum Juelich (Germany). EURATOM Association

    2010-05-15

    Controlled nuclear fusion on earth is a very promising but also a very challenging task. Fusion devices like ITER and DEMO are major steps on the way of solving the energy problems of the future. However, the realisation of such thermonuclear fusion reactors still needs high efforts in many areas of research. One of the most critical issues is the field of in - vessel materials and components and in particular the plasma facing material (PFM). This not only has to be compatible to the heat sink material being able to withstand thermal fatigue loading conditions during steady state heat loading (up to 20 MW/m{sup 2}) but also has to withstand extreme thermal loads during transient events. The latter are divided into normal and off normal events, such as plasma disruptions or vertical displacement events (VDEs), resulting in irreversible damage of the material. Therefore they have to be avoided in future fusion devices by an improved plasma control. In contrast, edge localized modes (ELMs) occur during normal operation and are the result of complex plasma configuration. In the next step experiment ITER they are generated with a frequency of {>=} 1 Hz and a duration of 200 - 500 {mu}s depositing energies of {<=} 1 MJ/m{sup 2}. One of the most promising materials for the application as PFM in particular in the divertor region is tungsten. Its main advantages are a high thermal conductivity, a high melting temperature, a low tritium inventory and a low erosion rate. However there are some drawbacks like a high ductile to brittle transitions temperature (DBTT), its high atomic number Z and the remarkable neutron irradiation induced activation and degradation of its mechanical properties. The main aim of future R and D will be to understand the mechanisms of thermal induced damages and subsequently to minimize these types of damages. Therefore various tungsten grades have to be tested under fusion relevant conditions, e.g. by electron, ion or plasma beam exposure; the

  9. Thermonuclear fusion

    International Nuclear Information System (INIS)

    Weisse, J.

    2000-01-01

    This document takes stock of the two ways of thermonuclear fusion research explored today: magnetic confinement fusion and inertial confinement fusion. The basic physical principles are recalled first: fundamental nuclear reactions, high temperatures, elementary properties of plasmas, ignition criterion, magnetic confinement (charged particle in a uniform magnetic field, confinement and Tokamak principle, heating of magnetized plasmas (ohmic, neutral particles, high frequency waves, other heating means), results obtained so far (scale laws and extrapolation of performances, tritium experiments, ITER project), inertial fusion (hot spot ignition, instabilities, results (Centurion-Halite program, laser experiments). The second part presents the fusion reactor and its associated technologies: principle (tritium production, heat source, neutron protection, tritium generation, materials), magnetic fusion (superconducting magnets, divertor (role, principle, realization), inertial fusion (energy vector, laser adaptation, particle beams, reaction chamber, stresses, chamber concepts (dry and wet walls, liquid walls), targets (fabrication, injection and pointing)). The third chapter concerns the socio-economic aspects of thermonuclear fusion: safety (normal operation and accidents, wastes), costs (costs structure and elementary comparison, ecological impact and external costs). (J.S.)

  10. Vacuum system operating experience review for fusion applications

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    1994-03-01

    This report presents a review of vacuum system operating experiences from particle accelerator, fusion experiment, space simulation chamber, and other applications. Safety relevant operating experiences and accident information are discussed. Quantitative order-of-magnitude estimates of vacuum system component failure rates and accident initiating event frequencies are presented for use in risk assessment, reliability, and availability studies. Safety concerns with vacuum systems are discussed, including personnel safety, foreign material intrusion, and factors relevant to vacuum systems being the primary confinement boundary for tritium and activated dusts. This information should be useful to fusion system designers and safety analysts, such as the team working on the Engineering Design Activities for the International Thermonuclear Experimental Reactor

  11. Fusion of EML4 and ALK is associated with development of lung adenocarcinomas lacking EGFR and KRAS mutations and is correlated with ALK expression

    Directory of Open Access Journals (Sweden)

    Zhang Xuchao

    2010-07-01

    Full Text Available Abstract Background The anaplastic lymphoma kinase (ALK gene is frequently involved in translocations that lead to gene fusions in a variety of human malignancies, including lymphoma and lung cancer. Fusion partners of ALK include NPM, EML4, TPM3, ATIC, TFG, CARS, and CLTC. Characterization of ALK fusion patterns and their resulting clinicopathological profiles could be of great benefit in better understanding the biology of lung cancer. Results RACE-coupled PCR sequencing was used to assess ALK fusions in a cohort of 103 non-small cell lung carcinoma (NSCLC patients. Within this cohort, the EML4-ALK fusion gene was identified in 12 tumors (11.6%. Further analysis revealed that EML4-ALK was present at a frequency of 16.13% (10/62 in patients with adenocarcinomas, 19.23% (10/52 in never-smokers, and 42.80% (9/21 in patients with adenocarcinomas lacking EGFR and KRAS mutations. The EML4-ALK fusion was associated with non-smokers (P = 0.03, younger age of onset (P = 0.03, and adenocarcinomas without EGFR/KRAS mutations (P = 0.04. A trend towards improved survival was observed for patients with the EML4-ALK fusion, although it was not statistically significant (P = 0.20. Concurrent deletion in EGFR exon 19 and fusion of EML4-ALK was identified for the first time in a Chinese female patient with an adenocarcinoma. Analysis of ALK expression revealed that ALK mRNA levels were higher in tumors positive for the EML-ALK fusion than in negative tumors (normalized intensity of 21.99 vs. 0.45, respectively; P = 0.0018. However, expression of EML4 did not differ between the groups. Conclusions The EML4-ALK fusion gene was present at a high frequency in Chinese NSCLC patients, particularly in those with adenocarcinomas lacking EGFR/KRAS mutations. The EML4-ALK fusion appears to be tightly associated with ALK mRNA expression levels. RACE-coupled PCR sequencing is a highly sensitive method that could be used clinically for the identification of EML4-ALK

  12. Transfer of the Fusarium resistant gene from Solanum integrifolium into S. melongena by asymmetric fusion

    International Nuclear Information System (INIS)

    Akamatsu, T.; Yoshida, M.; Shiga, T.

    1990-01-01

    Full text: In order to transfer the Fusarium resistant gene from the wild species into eggplants, asymmetric fusions were done between Solanum integrifolium and S. melongena. Protoplasts of S. melongena were isolated from hypocotyIes, and protoplasts of S. integrifolium were isolated from young leaves. Protoplasts of S. integrifolium were irradiated by soft x-rays (40-60kR), and fused with protoplasts of S. melongena by electric pulses. Fused protoplasts were cultured using TM-2 basal medium supplemented with 2,4-D (0.5 mg/l), NAA (0.35mg/l), and BA (2mg/l). After 30 days, calli of 1-2 mm in diameter were subcultured on agar medium supplemented with IAA (0.2mg/l) and Zeatin (4mg/l). After 15-30 days, shoots were regenerated from green calli. Regenerated plants were transplanted to the greenhouse and 382 plants were inoculated with Fusarium oxysporum. Thirty-two plants were resistant or tolerant, their chromosome numbers varied in the range of 35-42 (S. integrifolium, S. melongena 2n=2x=24). (author)

  13. Fusion neutronics

    CERN Document Server

    Wu, Yican

    2017-01-01

    This book provides a systematic and comprehensive introduction to fusion neutronics, covering all key topics from the fundamental theories and methodologies, as well as a wide range of fusion system designs and experiments. It is the first-ever book focusing on the subject of fusion neutronics research. Compared with other nuclear devices such as fission reactors and accelerators, fusion systems are normally characterized by their complex geometry and nuclear physics, which entail new challenges for neutronics such as complicated modeling, deep penetration, low simulation efficiency, multi-physics coupling, etc. The book focuses on the neutronics characteristics of fusion systems and introduces a series of theories and methodologies that were developed to address the challenges of fusion neutronics, and which have since been widely applied all over the world. Further, it introduces readers to neutronics design’s unique principles and procedures, experimental methodologies and technologies for fusion systems...

  14. The equine herpesvirus-1 IR3 gene that lies antisense to the sole immediate-early (IE) gene is trans-activated by the IE protein, and is poorly expressed to a protein

    International Nuclear Information System (INIS)

    Ahn, Byung Chul; Breitenbach, Jonathan E.; Kim, Seong K.; O'Callaghan, Dennis J.

    2007-01-01

    The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5'untranslated region (UTR), a 285 base pair open reading frame (ORF), and a poly adenylation (A) signal [Holden, V.R., Harty, R.N., Yalamanchili, R.R., O'Callaghan, D.J., 1992. The IR3 gene of equine herpesvirus type 1: a unique gene regulated by sequences within the intron of the immediate-early gene. DNA Seq. 3, 143-152]. Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed

  15. Efficient Knock-in of a Point Mutation in Porcine Fibroblasts Using the CRISPR/Cas9-GMNN Fusion Gene.

    Science.gov (United States)

    Gerlach, Max; Kraft, Theresia; Brenner, Bernhard; Petersen, Björn; Niemann, Heiner; Montag, Judith

    2018-06-13

    During CRISPR/Cas9 mediated genome editing, site-specific double strand breaks are introduced and repaired either unspecific by non-homologous end joining (NHEJ) or sequence dependent by homology directed repair (HDR). Whereas NHEJ-based generation of gene knock-out is widely performed, the HDR-based knock-in of specific mutations remains a bottleneck. Especially in primary cell lines that are essential for the generation of cell culture and animal models of inherited human diseases, knock-in efficacy is insufficient and needs significant improvement. Here, we tested two different approaches to increase the knock-in frequency of a specific point mutation into the MYH7 -gene in porcine fetal fibroblasts. We added a small molecule inhibitor of NHEJ, SCR7 (5,6-bis((E)-benzylideneamino)-2-mercaptopyrimidin-4-ol), during genome editing and screened cell cultures for the point mutation. However, this approach did not yield increased knock-in rates. In an alternative approach, we fused humanized Cas9 (hCas9) to the N-terminal peptide of the Geminin gene ( GMNN ). The fusion protein is degraded in NHEJ-dominated cell cycle phases, which should increase HDR-rates. Using hCas9- GMNN and point mutation-specific real time PCR screening, we found a two-fold increase in genome edited cell cultures. This increase of HDR by hCas9- GMNN provides a promising way to enrich specific knock-in in porcine fibroblast cultures for somatic cloning approaches.

  16. High Level Information Fusion (HLIF) with nested fusion loops

    Science.gov (United States)

    Woodley, Robert; Gosnell, Michael; Fischer, Amber

    2013-05-01

    Situation modeling and threat prediction require higher levels of data fusion in order to provide actionable information. Beyond the sensor data and sources the analyst has access to, the use of out-sourced and re-sourced data is becoming common. Through the years, some common frameworks have emerged for dealing with information fusion—perhaps the most ubiquitous being the JDL Data Fusion Group and their initial 4-level data fusion model. Since these initial developments, numerous models of information fusion have emerged, hoping to better capture the human-centric process of data analyses within a machine-centric framework. 21st Century Systems, Inc. has developed Fusion with Uncertainty Reasoning using Nested Assessment Characterizer Elements (FURNACE) to address challenges of high level information fusion and handle bias, ambiguity, and uncertainty (BAU) for Situation Modeling, Threat Modeling, and Threat Prediction. It combines JDL fusion levels with nested fusion loops and state-of-the-art data reasoning. Initial research has shown that FURNACE is able to reduce BAU and improve the fusion process by allowing high level information fusion (HLIF) to affect lower levels without the double counting of information or other biasing issues. The initial FURNACE project was focused on the underlying algorithms to produce a fusion system able to handle BAU and repurposed data in a cohesive manner. FURNACE supports analyst's efforts to develop situation models, threat models, and threat predictions to increase situational awareness of the battlespace. FURNACE will not only revolutionize the military intelligence realm, but also benefit the larger homeland defense, law enforcement, and business intelligence markets.

  17. Resource checking and event handling within the W7-X segment control framework

    International Nuclear Information System (INIS)

    Laqua, Heike; Bluhm, Torsten; Heimann, Peter; Hennig, Christine; Kroiss, Hugo; Krom, Jon G.; Kühner, Georg; Lewerentz, Marc; Maier, Josef; Schacht, Jörg; Spring, Anett; Werner, Andreas; Zilker, Manfred

    2012-01-01

    Highlights: ► Support for steady state fusion experiments. ► Off-normal event handling. ► Plasma event driven control. - Abstract: ITER, Wendelstein 7-X, LHD, and TORE SUPRA are experimental facilities designed to lead the way to steady state fusion devices. These experiments require strategies to sustain a discharge in case of unforeseen events, e.g. heat overloads of plasma facing components or the failure of a plasma heating source. A recovery strategy is needed to get the discharge back for physics exploitation. For this purpose the W7-X segment control framework provides means for automated event detection along with options to formulate and initiate a recovery strategy. Besides handling of failures and degradation there are events that represent a desired plasma physical effect. An example for this kind of event is a transition to from Low to High-Confinement mode. These events indicate that a certain plasma state is reached and scientific examination can be altered thus enabling event-driven multiple experiments per discharge. Examples of both kinds of events will be presented and compared to other approaches in the community.

  18. Point mutations in EBV gH that abrogate or differentially affect B cell and epithelial cell fusion

    International Nuclear Information System (INIS)

    Wu Liguo; Hutt-Fletcher, Lindsey M.

    2007-01-01

    Cell fusion mediated by Epstein-Barr virus requires three conserved glycoproteins, gB and gHgL, but activation is cell type specific. B cell fusion requires interaction between MHC class II and a fourth virus glycoprotein, gp42, which complexes non-covalently with gHgL. Epithelial cell fusion requires interaction between gHgL and a novel epithelial cell coreceptor and is blocked by excess gp42. We show here that gp42 interacts directly with gH and that point mutations in the region of gH recognized by an antibody that differentially inhibits epithelial and B cell fusion significantly impact both the core fusion machinery and cell-specific events. Substitution of alanine for glycine at residue 594 completely abrogates fusion with either B cells or epithelial cells. Substitution of alanine for glutamic acid at residue 595 reduces fusion with epithelial cells, greatly enhances fusion with B cells and allows low levels of B cell fusion even in the absence of gL

  19. Muon-catalyzed fusion: A new direction in fusion research

    International Nuclear Information System (INIS)

    Jones, S.E.

    1986-01-01

    In four years of intensive research, muon-catalyzed fusion has been raised from the level of a scientific curiosity to a potential means of achieving clean fusion energy. This novel approach to fusion is based on the fact that a sub-atomic particle known as a ''muon'' can induce numerous energy-releasing fusion reactions without the need for high temperatures or plasmas. Thus, the muon serves as a catalyst to facilitate production for fusion energy. The success of the research effort stems from the recent discovery of resonances in the reaction cycle which make the muon-induced fusion process extremely efficient. Prior estimates were pessimistic in that only one fusion per muon was expected. In that case energy balance would be impossible since energy must be invested to generate the muons. However, recent work has gone approximately half-way to energy balance and further improvements are being worked on. There has been little time to assess the full implications of these discoveries. However, various ways to use muon-catalyzed fusion for electrical power production are now being explored

  20. Muon-catalyzed fusion: a new direction in fusion research

    International Nuclear Information System (INIS)

    Jones, S.E.

    1986-01-01

    In four years of intensive research, muon-catalyzed fusion has been raised from the level of a scientific curiosity to a potential means of achieving clean fusion energy. This novel approach to fusion is based on the fact that a sub-atomic particle known as a ''muon'' can induce numerous energy-releasing fusion reactions without the need for high temperatures or plasmas. Thus, the muon serves as a catalyst to facilitate production for fusion energy. The success of the research effort stems from the recent discovery of resonances in the reaction cycle which make the muon-induced fusion process extremely efficient. Prior estimates were pessimistic in that only one fusion per muon was expected. In that case energy balance would be impossible since energy must be invested to generate the muons. However, recent work has gone approximately half-way to energy balance and further improvements are being worked on. There has been little time to assess the full implications of these discoveries. However, various ways to use muon-catalyzed fusion for electrical power production are now being explored

  1. Nuclear fusion and genome encounter during yeast zygote formation.

    Science.gov (United States)

    Tartakoff, Alan Michael; Jaiswal, Purnima

    2009-06-01

    When haploid cells of Saccharomyces cerevisiae are crossed, parental nuclei congress and fuse with each other. To investigate underlying mechanisms, we have developed assays that evaluate the impact of drugs and mutations. Nuclear congression is inhibited by drugs that perturb the actin and tubulin cytoskeletons. Nuclear envelope (NE) fusion consists of at least five steps in which preliminary modifications are followed by controlled flux of first outer and then inner membrane proteins, all before visible dilation of the waist of the nucleus or coalescence of the parental spindle pole bodies. Flux of nuclear pore complexes occurs after dilation. Karyogamy requires both the Sec18p/NSF ATPase and ER/NE luminal homeostasis. After fusion, chromosome tethering keeps tagged parental genomes separate from each other. The process of NE fusion and evidence of genome independence in yeast provide a prototype for understanding related events in higher eukaryotes.

  2. Fusion breeder

    International Nuclear Information System (INIS)

    Moir, R.W.

    1982-01-01

    The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outline specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs

  3. Engineering human cell spheroids to model embryonic tissue fusion in vitro.

    Science.gov (United States)

    Epithelial-mesenchymal interactions drive embryonic fusion events during development and upon perturbation can result in birth defects. Cleft palate and neural tube defects can result from genetic defects or environmental exposures during development, yet very little is known abo...

  4. A fusion-inhibiting peptide against Rift Valley fever virus inhibits multiple, diverse viruses.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    Full Text Available For enveloped viruses, fusion of the viral envelope with a cellular membrane is critical for a productive infection to occur. This fusion process is mediated by at least three classes of fusion proteins (Class I, II, and III based on the protein sequence and structure. For Rift Valley fever virus (RVFV, the glycoprotein Gc (Class II fusion protein mediates this fusion event following entry into the endocytic pathway, allowing the viral genome access to the cell cytoplasm. Here, we show that peptides analogous to the RVFV Gc stem region inhibited RVFV infectivity in cell culture by inhibiting the fusion process. Further, we show that infectivity can be inhibited for diverse, unrelated RNA viruses that have Class I (Ebola virus, Class II (Andes virus, or Class III (vesicular stomatitis virus fusion proteins using this single peptide. Our findings are consistent with an inhibition mechanism similar to that proposed for stem peptide fusion inhibitors of dengue virus in which the RVFV inhibitory peptide first binds to both the virion and cell membranes, allowing it to traffic with the virus into the endocytic pathway. Upon acidification and rearrangement of Gc, the peptide is then able to specifically bind to Gc and prevent fusion of the viral and endocytic membranes, thus inhibiting viral infection. These results could provide novel insights into conserved features among the three classes of viral fusion proteins and offer direction for the future development of broadly active fusion inhibitors.

  5. Achievement of solid-state plasma fusion ('Cold-Fusion')

    International Nuclear Information System (INIS)

    Arata, Yoshiaki; Zhang, Yue-Chang

    1995-01-01

    Using a 'QMS' (Quadrupole Mass Spectrometer), the authors detected a significantly large amount (10 20 -10 21 [cm -3 ]) of helium ( 2 4 He), which was concluded to have been produced by a deuterium nuclear reaction within a host solid. These results were found to be fully repeatable and supported the authors' proposition that solid state plasma fusion ('Cold Fusion') can be generated in energetic deuterium Strongly Coupled Plasma ('SC-plasma'). This fusion reaction is thought to be sustained by localized 'Latticequake' in a solid-state media with the deuterium density equivalent to that of the host solid. While exploring this basic proposition, the characteristic differences when compared with ultra high temperature-state plasma fusion ('Hot Fusion') are clarified. In general, the most essential reaction product in both types of the deuterium plasma fusion is considered to be helium, irrespective of the 'well-known and/or unknown reactions', which is stored within the solid-state medium in abundance as a 'Residual Product', but which generally can not enter into nor be released from host-solid at a room temperature. Even measuring instruments with relatively poor sensitivity should be able to easily detect such residual helium. An absence of residual helium means that no nuclear fusion reaction has occurred, whereas its presence provides crucial evidence that nuclear fusion has, in fact, occurred in the solid. (author)

  6. Fusion Implementation

    International Nuclear Information System (INIS)

    Schmidt, J.A.

    2002-01-01

    If a fusion DEMO reactor can be brought into operation during the first half of this century, fusion power production can have a significant impact on carbon dioxide production during the latter half of the century. An assessment of fusion implementation scenarios shows that the resource demands and waste production associated with these scenarios are manageable factors. If fusion is implemented during the latter half of this century it will be one element of a portfolio of (hopefully) carbon dioxide limiting sources of electrical power. It is time to assess the regional implications of fusion power implementation. An important attribute of fusion power is the wide range of possible regions of the country, or countries in the world, where power plants can be located. Unlike most renewable energy options, fusion energy will function within a local distribution system and not require costly, and difficult, long distance transmission systems. For example, the East Coast of the United States is a prime candidate for fusion power deployment by virtue of its distance from renewable energy sources. As fossil fuels become less and less available as an energy option, the transmission of energy across bodies of water will become very expensive. On a global scale, fusion power will be particularly attractive for regions separated from sources of renewable energy by oceans

  7. Fusion: introduction

    International Nuclear Information System (INIS)

    Decreton, M.

    2006-01-01

    The article gives an overview and introduction to the activities of SCK-CEN's research programme on fusion. The decision to construct the ITER international nuclear fusion experiment in Cadarache is highlighted. A summary of the Belgian contributions to fusion research is given with particular emphasis on studies of radiation effects on diagnostics systems, radiation effects on remote handling sensing systems, fusion waste management and socio-economic studies

  8. Design and Analysis of a Data Fusion Scheme in Mobile Wireless Sensor Networks Based on Multi-Protocol Mobile Agents.

    Science.gov (United States)

    Wu, Chunxue; Wu, Wenliang; Wan, Caihua; Bekkering, Ernst; Xiong, Naixue

    2017-11-03

    Sensors are increasingly used in mobile environments with wireless network connections. Multiple sensor types measure distinct aspects of the same event. Their measurements are then combined to produce integrated, reliable results. As the number of sensors in networks increases, low energy requirements and changing network connections complicate event detection and measurement. We present a data fusion scheme for use in mobile wireless sensor networks with high energy efficiency and low network delays, that still produces reliable results. In the first phase, we used a network simulation where mobile agents dynamically select the next hop migration node based on the stability parameter of the link, and perform the data fusion at the migration node. Agents use the fusion results to decide if it should return the fusion results to the processing center or continue to collect more data. In the second phase. The feasibility of data fusion at the node level is confirmed by an experimental design where fused data from color sensors show near-identical results to actual physical temperatures. These results are potentially important for new large-scale sensor network applications.

  9. Fusion power production from TFTR plasmas fueled with deuterium and tritium

    International Nuclear Information System (INIS)

    Strachan, J.D.; Adler, H.; Alling, P.

    1994-03-01

    Peak fusion power production of 6.2 ± 0.4 MW has been achieved in TFTR plasmas heated by deuterium and tritium neutral beams at a total power of 29.5 MW. These plasmas have an inferred central fusion alpha particle density of 1.2 x 10 17 m -3 without the appearance of either disruptive MHD events or detectable changes in Alfven wave activity. The measured loss rate of energetic alpha particles agreed with the approximately 5% losses expected from alpha particles which are born on unconfined orbits

  10. Transfer of Chinese hamster DNA repair gene(s) into repair-deficient human cells (Xeroderma pigmentosum)

    International Nuclear Information System (INIS)

    Karentz, D.; Cleaver, J.E.

    1985-01-01

    Transfer of repair genes by DNA transfection into repair-deficient Xeroderma pigmentosum (XP) cells has thus far been unsuccessful, presenting an obstacle to cloning XP genes. The authors chose an indirect route to transfer repair genes in chromosome fragments. DNA repair-competent (UV resistant) hybrid cell lines were established by PEG-mediated fusions of DNA repair-deficient (UV sensitive) human fibroblasts (XP12RO) with wild type Chinese hamster (CHO) cells (AA8). CHO cells were exposed to 5 Krad X-rays prior to fusions, predisposing hybrid cells to lose CHO chromosome fragments preferentially. Repair-competent hybrids were selected by periodic exposures to UV light. Secondary and tertiary hybrid cell lines were developed by fusion of X-irradiated hybrids to XP12RO. The hybrid cell lines exhibit resistance to UV that is comparable to that of CHO cells and they are proficient at repair replication after UV exposure. Whole cell DNA-DNA hybridizations indicate that the hybrids have greater homology to CHO DNA than is evident between XP12RO and CHO. These observations indicate that CHO DNA sequences which can function in repair of UV-damaged DNA in human cells have been transferred into the genome of the repair-deficient XP12RO cells

  11. Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

    Science.gov (United States)

    Flynn, Christopher M; Schmidt-Dannert, Claudia

    2018-06-01

    The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

  12. DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Kenyon, C.J.; Walker, G.C.

    1988-05-01

    Operon fusions in Escherichia coli were obtained that showed increased beta-galactosidase expression in response to treatment with the DNA-damaging agent mitomycin C. These fusions were generated by using the Mud(ApR, lac) vector to insert the lactose structural genes randomly into the bacterial chromosome. Induction of beta-galactosidase in these strains, which carried fusions of lac to these din (damage-inducible) loci, was (i) triggered by UV light as well as by mitomycin C and (ii) abolished by either a recA- or a lexA- mutation. Similar characteristics of induction were observed when the lactose genes were fused to a prophage lambda promoter by using Mud(ApR, lac). These results indicate that E. coli contains a set of genes that, like prophage lambda genes, are expressed in response to DNA-damaging agents and regulated by the recA and lexA gene products. These din genes map at five bacterial loci. One din::Mud(ApR, lac) insertion results in a UV-sensitive phenotype and may be within the uvrA transcriptional unit.

  13. Fusion--fission hybrid concepts for laser-induced fusion

    International Nuclear Information System (INIS)

    Maniscalco, J.

    1976-01-01

    Fusion-fission hybrid concepts are viewed as subcritical fission reactors driven and controlled by high-energy neutrons from a laser-induced fusion reactor. Blanket designs encompassing a substantial portion of the spectrum of different fission reactor technologies are analyzed and compared by calculating their fissile-breeding and fusion-energy-multiplying characteristics. With a large number of different fission technologies to choose from, it is essential to identify more promising hybrid concepts that can then be subjected to in-depth studies that treat the engineering safety, and economic requirements as well as the neutronic aspects. In the course of neutronically analyzing and comparing several fission blanket concepts, this work has demonstrated that fusion-fission hybrids can be designed to meet a broad spectrum of fissile-breeding and fusion-energy-multiplying requirements. The neutronic results should prove to be extremely useful in formulating the technical scope of future studies concerned with evaluating the technical and economic feasibility of hybrid concepts for laser-induced fusion

  14. Recent fusion research in the National Institute for Fusion Science

    International Nuclear Information System (INIS)

    Komori, Akio; Sakakibara, Satoru; Sagara, Akio; Horiuchi, Ritoku; Yamada, Hiroshi; Takeiri, Yasuhiko

    2011-01-01

    The National Institute for Fusion Science (NIFS), which was established in 1989, promotes academic approaches toward the exploration of fusion science for steady-state helical reactor and realizes the establishment of a comprehensive understanding of toroidal plasmas as an inter-university research organization and a key center of worldwide fusion research. The Large Helical Device (LHD) Project, the Numerical Simulation Science Project, and the Fusion Engineering Project are organized for early realization of net current free fusion reactor, and their recent activities are described in this paper. The LHD has been producing high-performance plasmas comparable to those of large tokamaks, and several new findings with regard to plasma physics have been obtained. The numerical simulation science project contributes understanding and systemization of the physical mechanisms of plasma confinement in fusion plasmas and explores complexity science of a plasma for realization of the numerical test reactor. In the fusion engineering project, the design of the helical fusion reactor has progressed based on the development of superconducting coils, the blanket, fusion materials and tritium handling. (author)

  15. Viral membrane fusion

    International Nuclear Information System (INIS)

    Harrison, Stephen C.

    2015-01-01

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism

  16. Viral membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, Stephen C., E-mail: harrison@crystal.harvard.edu

    2015-05-15

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.

  17. Hybrid Fusion for Biometrics: Combining Score-level and Decision-level Fusion

    NARCIS (Netherlands)

    Tao, Q.; Veldhuis, Raymond N.J.

    2008-01-01

    A general framework of fusion at decision level, which works on ROCs instead of matching scores, is investigated. Under this framework, we further propose a hybrid fusion method, which combines the score-level and decision-level fusions, taking advantage of both fusion modes. The hybrid fusion

  18. Morphogenesis in sea urchin embryos: linking cellular events to gene regulatory network states

    Science.gov (United States)

    Lyons, Deidre; Kaltenbach, Stacy; McClay, David R.

    2013-01-01

    Gastrulation in the sea urchin begins with ingression of the primary mesenchyme cells (PMCs) at the vegetal pole of the embryo. After entering the blastocoel the PMCs migrate, form a syncitium, and synthesize the skeleton of the embryo. Several hours after the PMCs ingress the vegetal plate buckles to initiate invagination of the archenteron. That morphogenetic process occurs in several steps. The non-skeletogenic cells produce the initial inbending of the vegetal plate. Endoderm cells then rearrange and extend the length of the gut across the blastocoel to a target near the animal pole. Finally, cells that will form part of the midgut and hindgut are added to complete gastrulation. Later, the stomodeum invaginates from the oral ectoderm and fuses with the foregut to complete the archenteron. In advance of, and during these morphogenetic events an increasingly complex gene regulatory network controls the specification and the cell biological events that conduct the gastrulation movements. PMID:23801438

  19. Imaging Characteristics in ALK Fusion-Positive Lung Adenocarcinomas by Using HRCT

    Science.gov (United States)

    Okumura, Sakae; Kuroda, Hiroaki; Uehara, Hirofumi; Mun, Mingyon; Takeuchi, Kengo; Nakagawa, Ken

    2014-01-01

    Objectives: We aimed to identify high-resolution computed tomography (HRCT) features useful to distinguish the anaplastic lymphoma kinase gene (ALK) fusion-positive and negative lung adenocarcinomas. Methods: We included 236 surgically resected adenocarcinoma lesions, which included 27 consecutive ALK fusion-positive (AP) lesions, 115 epidermal growth factor receptor mutation-positive lesions, and 94 double-negative lesions. HRCT parameters including size, air bronchograms, pleural indentation, spiculation, and tumor disappearance rate (TDR) were compared. In addition, prevalence of small lesions (≤20 mm) and solid lesions (TDR ≤20%) were compared. Results: AP lesions were significantly smaller and had lower TDR (%) than ALK fusion-negative (AN) lesions (tumor diameter: 20.7 mm ± 14.1 mm vs. 27.4 mm ± 13.8 mm, respectively, p 20 mm (n = 7, 25.9%) showed a solid pattern. Among all small lesions, AP lesions had lower TDR and more frequent spiculation than AN lesions (p 20 mm lesions may be ALK fusion-negative. PMID:24899136

  20. Integrated assessment of thermal hydraulic processes in W7-X fusion experimental facility

    Energy Technology Data Exchange (ETDEWEB)

    Kaliatka, T., E-mail: tadas.kaliatka@lei.lt; Uspuras, E.; Kaliatka, A.

    2017-02-15

    Highlights: • The model of Ingress of Coolant Event experiment facility was developed using the RELAP5 code. • Calculation results were compared with Ingress of Coolant Event experiment data. • Using gained experience, the numerical model of Wendelstein 7-X facility was developed. • Performed analysis approved pressure increase protection system for LOCA event. - Abstract: Energy received from the nuclear fusion reaction is one of the most promising options for generating large amounts of carbon-free energy in the future. However, physical and technical problems existing in this technology are complicated. Several experimental nuclear fusion devices around the world have already been constructed, and several are under construction. However, the processes in the cooling system of the in-vessel components, vacuum vessel and pressure increase protection system of nuclear fusion devices are not widely studied. The largest amount of radioactive materials is concentrated in the vacuum vessel of the fusion device. Vacuum vessel is designed for the vacuum conditions inside the vessel. Rupture of the in-vessel components of the cooling system pipe may lead to a sharp pressure increase and possible damage of the vacuum vessel. To prevent the overpressure, the pressure increase protection system should be designed and implemented. Therefore, systematic and detailed experimental and numerical studies, regarding the thermal-hydraulic processes in cooling system, vacuum vessel and pressure increase protection system, are important and relevant. In this article, the numerical investigation of thermal-hydraulic processes in cooling systems of in-vessel components, vacuum vessels and pressure increase protection system of fusion devices is presented. Using the experience gained from the modelling of “Ingress of Coolant Event” experimental facilities, the numerical model of Wendelstein 7-X (W7-X) experimental fusion device was developed. The integrated analysis of the

  1. Characterization of a Cellulomonas fimi exoglucanase/xylanase-endoglucanase gene fusion which improves microbial degradation of cellulosic biomass.

    Science.gov (United States)

    Duedu, Kwabena O; French, Christopher E

    2016-11-01

    Effective degradation of cellulose requires multiple classes of enzyme working together. However, naturally occurring cellulases with multiple catalytic domains seem to be rather rare in known cellulose-degrading organisms. A fusion protein made from Cellulomonas fimi exo- and endo- glucanases, Cex and CenA which improves breakdown of cellulose is described. A homologous carbohydrate binding module (CBM-2) present in both glucanases was fused to give a fusion protein CxnA. CxnA or unfused constructs (Cex+CenA, Cex, or CenA) were expressed in Escherichia coli and Citrobacter freundii. The latter recombinant strains were cultured at the expense of cellulose filter paper. The expressed CxnA had both exo- and endo- glucanase activities. It was also exported to the supernatant as were the non-fused proteins. In addition, the hybrid CBM from the fusion could bind to microcrystalline cellulose. Growth of C. freundii expressing CxnA was superior to that of cells expressing the unfused proteins. Physical degradation of filter paper was also faster with the cells expressing fusion protein than the other constructs. Our results show that fusion proteins with multiple catalytic domains can improve the efficiency of cellulose degradation. Such fusion proteins could potentially substitute cloning of multiple enzymes as well as improving product yields. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. The Role of the PAX8/PPARγ Fusion Oncogene in Thyroid Cancer

    Directory of Open Access Journals (Sweden)

    Kimberly A. Placzkowski

    2008-01-01

    Full Text Available Thyroid cancer is uncommon and exhibits relatively low mortality rates. However, a subset of patients experience inexorable growth, metastatic spread, and mortality. Unfortunately, for these patients, there have been few significant advances in treatment during the last 50 years. While substantial advances have been made in recent years about the molecular genetic events underlying papillary thyroid cancer, the more aggressive follicular thyroid cancer remains poorly understood. The recent discovery of the PAX8/PPARγ translocation in follicular thyroid carcinoma has promoted progress in the role of PPARγ as a tumor suppressor and potential therapeutic target. The PAX8/PPARγ fusion gene appears to be an oncogene. It is most often expressed in follicular carcinomas and exerts a dominant-negative effect on wild-type PPARγ, and stimulates transcription of PAX8-responsive promoters. PPARγ agonists have shown promising results in vitro, although very few studies have been conducted to assess the clinical impact of these agents.

  3. Nuclear X-ray emission after fusion of heavy ions

    Energy Technology Data Exchange (ETDEWEB)

    Berner, Christian; Muecher, Dennis; Gernhaeuser, Roman; Faestermann, Thomas [Technische Universitaet Muenchen, Lehrstuhl E12 (Germany); Henning, Walter [Technische Universitaet Muenchen, Lehrstuhl E12 (Germany); Argonne National Laboratory (United States); Morita, Kosuke; Morimoto, Kouji; Kaji, Daija [RIKEN, Research Group for Superheavy Elements (Japan)

    2015-07-01

    The goal is to establish in-beam K-X-ray spectroscopy as a sensitive tool to identify super heavy elements (SHEs) produced in fusion reactions via their proton number. SHEs, formed after cold or hot fusion, are usually identified via the alpha-decay products, which have to be connected to well-known elements. In case of hot fusion, the daughter nuclei quickly undergo spontaneous fission, so that the identification of the produced SHEs is difficult. Using the hot fusion approach in our first test experiments, the resultant products will be analysed by the gas-filled GARIS separator at the RILAC facility at RIKEN. As the X-ray detector is required to have superior energy and timing resolution to best identify the rare events at highest masses and to supress random coincidences as sufficient as possible, we chose a thin and planar geometry, which also reduces the damage caused by fast neutrons. We show first measurements using the MINIBALL Ge array at Munich. Additionally we report on our feasibility studies and on first tests using the new detector at high count rates together with a powerful DAQ system and transistor reset preamplifiers.

  4. Peaceful fusion

    Energy Technology Data Exchange (ETDEWEB)

    Englert, Matthias [IANUS, TU Darmstadt (Germany)

    2014-07-01

    Like other intense neutron sources fusion reactors have in principle a potential to be used for military purposes. Although the use of fissile material is usually not considered when thinking of fusion reactors (except in fusion-fission hybrid concepts) quantitative estimates about the possible production potential of future commercial fusion reactor concepts show that significant amounts of weapon grade fissile materials could be produced even with very limited amounts of source materials. In this talk detailed burnup calculations with VESTA and MCMATH using an MCNP model of the PPCS-A will be presented. We compare different irradiation positions and the isotopic vectors of the plutonium bred in different blankets of the reactor wall with the liquid lead-lithium alloy replaced by uranium. The technical, regulatory and policy challenges to manage the proliferation risks of fusion power will be addressed as well. Some of these challenges would benefit if addressed at an early stage of the research and development process. Hence, research on fusion reactor safeguards should start as early as possible and accompany the current research on experimental fusion reactors.

  5. Cold fusion, Alchemist's dream

    International Nuclear Information System (INIS)

    Clayton, E.D.

    1989-09-01

    In this report the following topics relating to cold fusion are discussed: muon catalysed cold fusion; piezonuclear fusion; sundry explanations pertaining to cold fusion; cosmic ray muon catalysed cold fusion; vibrational mechanisms in excited states of D 2 molecules; barrier penetration probabilities within the hydrogenated metal lattice/piezonuclear fusion; branching ratios of D 2 fusion at low energies; fusion of deuterons into 4 He; secondary D+T fusion within the hydrogenated metal lattice; 3 He to 4 He ratio within the metal lattice; shock induced fusion; and anomalously high isotopic ratios of 3 He/ 4 He

  6. Progress of nuclear fusion research and review on development of fusion reactors

    International Nuclear Information System (INIS)

    1976-01-01

    Set up in October 1971, the ad hoc Committee on Survey of Nuclear Fusion Reactors has worked on overall fusion reactor aspects and definition of the future problems under four working groups of core, nuclear heat, materials and system. The presect volume is intended to provide reference materials in the field of fusion reactor engineering, prepared by members of the committee. Contents are broadly the following: concept of the nuclear fusion reactor, fusion core engineering, fusion reactor blanket engineering, fusion reactor materials engineering, and system problems in development of fusion reactors. (Mori, K.)

  7. Fusion power: the transition from fundamental science to fusion reactor engineering

    International Nuclear Information System (INIS)

    Post, R.F.

    1975-01-01

    The historical development of fusion research is outlined. The basics of fusion power along with fuel cost and advantages of fusion are discussed. Some quantitative requirements for fusion power are described. (MOW)

  8. Fusion Canada

    International Nuclear Information System (INIS)

    1987-07-01

    This first issue of a quarterly newsletter announces the startup of the Tokamak de Varennes, describes Canada's national fusion program, and outlines the Canadian Fusion Fuels Technology Program. A map gives the location of the eleven principal fusion centres in Canada. (L.L.)

  9. PRM1 and KAR5 function in cell-cell fusion and karyogamy to drive distinct bisexual and unisexual cycles in the Cryptococcus pathogenic species complex.

    Directory of Open Access Journals (Sweden)

    Ci Fu

    2017-11-01

    Full Text Available Sexual reproduction is critical for successful evolution of eukaryotic organisms in adaptation to changing environments. In the opportunistic human fungal pathogens, the Cryptococcus pathogenic species complex, C. neoformans primarily undergoes bisexual reproduction, while C. deneoformans undergoes both unisexual and bisexual reproduction. During both unisexual and bisexual cycles, a common set of genetic circuits regulates a yeast-to-hyphal morphological transition, that produces either monokaryotic or dikaryotic hyphae. As such, both the unisexual and bisexual cycles can generate genotypic and phenotypic diversity de novo. Despite the similarities between these two cycles, genetic and morphological differences exist, such as the absence of an opposite mating-type partner and monokaryotic instead of dikaryotic hyphae during C. deneoformans unisexual cycle. To better understand the similarities and differences between these modes of sexual reproduction, we focused on two cellular processes involved in sexual reproduction: cell-cell fusion and karyogamy. We identified orthologs of the plasma membrane fusion protein Prm1 and the nuclear membrane fusion protein Kar5 in both Cryptococcus species, and demonstrated their conserved roles in cell fusion and karyogamy during C. deneoformans α-α unisexual reproduction and C. deneoformans and C. neoformans a-α bisexual reproduction. Notably, karyogamy occurs inside the basidum during bisexual reproduction in C. neoformans, but often occurs earlier following cell fusion during bisexual reproduction in C. deneoformans. Characterization of these two genes also showed that cell fusion is dispensable for solo unisexual reproduction in C. deneoformans. The blastospores produced along hyphae during C. deneoformans unisexual reproduction are diploid, suggesting that diploidization occurs early during hyphal development, possibly through either an endoreplication pathway or cell fusion-independent karyogamy

  10. Canada's Fusion Program

    International Nuclear Information System (INIS)

    Jackson, D. P.

    1990-01-01

    Canada's fusion strategy is based on developing specialized technologies in well-defined areas and supplying these technologies to international fusion projects. Two areas are specially emphasized in Canada: engineered fusion system technologies, and specific magnetic confinement and materials studies. The Canadian Fusion Fuels Technology Project focuses on the first of these areas. It tritium and fusion reactor fuel systems, remote maintenance and related safety studies. In the second area, the Centre Canadian de fusion magnetique operates the Tokamak de Varennes, the main magnetic fusion device in Canada. Both projects are partnerships linking the Government of Canada, represented by Atomic Energy of Canada Limited, and provincial governments, electrical utilities, universities and industry. Canada's program has extensive international links, through which it collaborates with the major world fusion programs, including participation in the International Thermonuclear Experimental Reactor project

  11. Atomic fusion, Gerrard atomic fusion

    International Nuclear Information System (INIS)

    Gerrard, T.H.

    1980-01-01

    In the approach to atomic fusion described here the heat produced in a fusion reaction, which is induced in a chamber by the interaction of laser beams and U.H.F. electromagnetic beams with atom streams, is transferred to a heat exchanger for electricity generation by a coolant flowing through a jacket surrounding the chamber. (U.K.)

  12. Novel cancer gene variants and gene fusions of triple-negative breast cancers (TNBCs) reveal their molecular diversity conserved in the patient-derived xenograft (PDX) model.

    Science.gov (United States)

    Jung, Jaeyun; Jang, Kiwon; Ju, Jung Min; Lee, Eunji; Lee, Jong Won; Kim, Hee Jung; Kim, Jisun; Lee, Sae Byul; Ko, Beom Seok; Son, Byung Ho; Lee, Hee Jin; Gong, Gyungyup; Ahn, Sei Yeon; Choi, Jung Kyoon; Singh, Shree Ram; Chang, Suhwan

    2018-04-20

    Despite the improved 5-year survival rate of breast cancer, triple-negative breast cancer (TNBC) remains a challenge due to lack of effective targeted therapy and higher recurrence and metastasis than other subtypes. To identify novel druggable targets and to understand its unique biology, we tried to implement 24 patient-derived xenografts (PDXs) of TNBC. The overall success rate of PDX implantation was 45%, much higher than estrogen receptor (ER)-positive cases. Immunohistochemical analysis revealed conserved ER/PR/Her2 negativity (with two exceptions) between the original and PDX tumors. Genomic analysis of 10 primary tumor-PDX pairs with Ion AmpliSeq CCP revealed high degree of variant conservation (85.0% to 96.9%) between primary and PDXs. Further analysis showed 44 rare variants with a predicted high impact in 36 genes including Trp53, Pten, Notch1, and Col1a1. Among them, we confirmed frequent Notch1 variant. Furthermore, RNA-seq analysis of 24 PDXs revealed 594 gene fusions, of which 163 were in-frame, including AZGP1-GJC3 and NF1-AARSD1. Finally, western blot analysis of oncogenic signaling proteins supporting molecular diversity of TNBC PDXs. Overall, our report provides a molecular basis for the usefulness of the TNBC PDX model in preclinical study. Copyright © 2018. Published by Elsevier B.V.

  13. Office of Fusion Energy Sciences. A ten-year perspective (2015-2025)

    Energy Technology Data Exchange (ETDEWEB)

    None

    2015-12-01

    The vision described here builds on the present U.S. activities in fusion plasma and materials science relevant to the energy goal and extends plasma science at the frontier of discovery. The plan is founded on recommendations made by the National Academies, a number of recent studies by the Fusion Energy Sciences Advisory Committee (FESAC), and the Administration’s views on the greatest opportunities for U.S. scientific leadership.This report highlights five areas of critical importance for the U.S. fusion energy sciences enterprise over the next decade: 1) Massively parallel computing with the goal of validated whole-fusion-device modeling will enable a transformation in predictive power, which is required to minimize risk in future fusion energy development steps; 2) Materials science as it relates to plasma and fusion sciences will provide the scientific foundations for greatly improved plasma confinement and heat exhaust; 3) Research in the prediction and control of transient events that can be deleterious to toroidal fusion plasma confinement will provide greater confidence in machine designs and operation with stable plasmas; 4) Continued stewardship of discovery in plasma science that is not expressly driven by the energy goal will address frontier science issues underpinning great mysteries of the visible universe and help attract and retain a new generation of plasma/fusion science leaders; 5) FES user facilities will be kept world-leading through robust operations support and regular upgrades. Finally, we will continue leveraging resources among agencies and institutions and strengthening our partnerships with international research facilities.

  14. Cryptic chromosome 9q34 deletion generates TAF-Ialpha/CAN and TAF-Ibeta/CAN fusion transcripts in acute myeloid leukemia.

    Science.gov (United States)

    Rosati, Roberto; La Starza, Roberta; Barba, Gianluca; Gorello, Paolo; Pierini, Valentina; Matteucci, Caterina; Roti, Giovanni; Crescenzi, Barbara; Aloisi, Teresa; Aversa, Franco; Martelli, Massimo Fabrizio; Mecucci, Cristina

    2007-02-01

    In hematologic malignancies chromosome aberrations generating fusion genes include cryptic deletions. In a patient with acute myeloid leukemia and normal karyo-type we discovered a new cryptic 9q34 deletion and here report the cytogenetic and molecular findings. The 9q34 deletion extends 2.5 megabases and juxtaposes the 5' TAF-I to the 3' CAN producing a TAF-I/CAN fusion gene. TAF-I/CAN transcribes into two fusion proteins bearing either TAF-Ialpha or TAF-Ibeta moieties. We set up molecular assays to monitor the chimeric TAF-Ialpha/CAN and TAF-Ibeta/CAN transcripts which, after hematopoietic stem cell transplantation from an HLA-identical sibling, were no longer detected.

  15. Temperature distributions in a Tokamak vacuum vessel of fusion reactor after the loss-of-vacuum-events occurred

    International Nuclear Information System (INIS)

    Takase, K.; Kunugi, T.; Shibata, M.; Seki, Y.

    1998-01-01

    If a loss-of-vacuum-event (LOVA) occurred in a fusion reactor, buoyancy-driven exchange flows would occur at breaches of a vacuum vessel (VV) due to the temperature difference between the inside and outside of the VV. The exchange flows may bring mixtures of activated materials and tritium in the VV to the outside through the breaches, and remove decay heat from the plasma-facing components of the VV. Therefore, the LOVA experiments were carried out under the condition that one or two breaches was opened and that the VV was heated to a maximum 200 C, using a small-scaled LOVA experimental apparatus. Air and helium gas were provided as working fluids. Fluid and wall temperature distributions in the VV were measured and the flow patterns in the VV were estimated by using these temperature distributions. It was found that: (1) the exchange mass in the VV depended on the breach positions; (2) the exchange flow at the single breach case became a counter-current flow when the breach was at the roof of the VV and a stratified flow when it was at the side wall; (3) and that at the double breach case, a one-way flow between two breaches was formed. (orig.)

  16. The emerging pathogenic and therapeutic importance of the anaplastic lymphoma kinase gene.

    LENUS (Irish Health Repository)

    Kelleher, Fergal C

    2012-02-01

    The anaplastic lymphoma kinase gene (ALK) is a gene on chromosome 2p23 that has expression restricted to the brain, testis and small intestine but is not expressed in normal lymphoid tissue. It has similarity to the insulin receptor subfamily of kinases and is emerging as having increased pathologic and potential therapeutic importance in malignant disease. This gene was originally established as being implicated in the pathogenesis of rare diseases including inflammatory myofibroblastic tumour (IMT) and ALK-positive anaplastic large cell lymphoma, which is a subtype of non-Hodgkin\\'s lymphoma. Recently the number of diseases in which ALK is implicated in their pathogenesis has increased. In 2007, an inversion of chromosome 2 involving ALK and a fusion partner gene in a subset of non-small cell lung cancer was discovered. In 2008, publications emerged implicating ALK in familial and sporadic cases of neuroblastoma, a childhood cancer of the sympatho-adrenal system. Chromosomal abnormalities involving ALK are translocations, amplifications or mutations. Chromosomal translocations are the longest recognised ALK genetic abnormality. When translocations occur a fusion gene is created between ALK and a gene partner. This has been described in ALK-positive anaplastic large cell lymphoma in which ALK is fused to NPM (nucleolar protein gene) and in non-small cell lung cancer where ALK is fused to EML4 (Echinoderm microtubule-associated protein 4). The most frequently described partner genes in inflammatory myofibroblastic tumour are tropomyosin 3\\/4 (TMP3\\/4), however in IMTs a diversity of ALK fusion partners have been found, with the ability to homodimerise a common characteristic. Point mutations and amplification of the ALK gene occur in the childhood cancer neuroblastoma. Therapeutic targeting of ALK fusion genes using tyrosine kinase inhibition, vaccination using an ALK specific antigen and treatment using viral vectors for RNAi are emerging potential therapeutic

  17. Fusion reactor safety

    International Nuclear Information System (INIS)

    1987-12-01

    Nuclear fusion could soon become a viable energy source. Work in plasma physics, fusion technology and fusion safety is progressing rapidly in a number of Member States and international collaboration continues on work aiming at the demonstration of fusion power generation. Safety of fusion reactors and technological and radiological aspects of waste management are important aspects in the development and design of fusion machines. In order to provide an international forum to review and discuss the status and the progress made since 1983 in programmes related to operational safety aspects of fusion reactors, their waste management and decommissioning concepts, the IAEA had organized the Technical Committee on ''Fusion Reactor Safety'' in Culham, 3-7 November 1986. All presentations of this meeting were divided into four sessions: 1. Statements on National-International Fusion Safety Programmes (5 papers); 2. Operation and System Safety (15 papers); 3. Waste Management and Decommissioning (5 papers); 4. Environmental Impacts (6 papers). A separate abstract was prepared for each of these 31 papers. Refs, figs, tabs

  18. Expression of human gamma-globin genes in human erythroleukemia (K562) cells.

    Science.gov (United States)

    Donovan-Peluso, M; Acuto, S; Swanson, M; Dobkin, C; Bank, A

    1987-12-15

    K562 cells express embryonic (epsilon) and fetal (gamma) globins and hemoglobins but not adult (beta) globin. To define the cis acting regulatory elements involved in the discrimination between gamma and beta genes, we have constructed chimeric genes composed of portions of gamma and beta and evaluated their expression in stable K562 transfectants. A gamma beta fusion gene containing gamma 5' sequences to the EcoRI site in exon 3 and beta sequences 3' is expressed at 10-40% that of the endogenous gamma level. In 50% of the lines, this fusion gene appropriately increases its expression in response to hemin, an inducer of endogenous globin gene expression in K562 cells. In contrast, a beta gamma fusion gene, containing beta sequences 5' to the EcoRI site in exon 3 and gamma sequences 3', is neither expressed nor correctly initiated. A beta gene containing gamma-intervening sequence (IVS) 2 accumulates an mRNA transcript when analyzed with a 3' beta probe. However, no correctly initiated beta mRNA is observed. A gamma gene with beta-IVS 2 is only inducible in one of six expressing clones. All the results are consistent with the presence of stage-specific trans acting factors in K562 cells that stimulate expression of gamma genes and suggest a significant role for gamma-IVS 2 in gamma gene expression.

  19. Fusion systems engineering

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    Research during this report period has covered the following areas: (1) fusion reactor systems studies, (2) development of blanket processing technology for fusion reactors, (3) safety studies of fusion concepts, (4) MACKLIB-IV, a new library of nuclear response functions, (5) energy storage and power supply requirements for commercial fusion reactors, (6) blanket/shield design evaluation for commercial fusion reactors, and (7) cross section measurements, evaluations, and techniques

  20. Aspirin exposure reveals novel genes associated with platelet function and cardiovascular events.

    Science.gov (United States)

    Voora, Deepak; Cyr, Derek; Lucas, Joseph; Chi, Jen-Tsan; Dungan, Jennifer; McCaffrey, Timothy A; Katz, Richard; Newby, L Kristin; Kraus, William E; Becker, Richard C; Ortel, Thomas L; Ginsburg, Geoffrey S

    2013-10-01

    The aim of this study was to develop ribonucleic acid (RNA) profiles that could serve as novel biomarkers for the response to aspirin. Aspirin reduces death and myocardial infarction (MI), suggesting that aspirin interacts with biological pathways that may underlie these events. Aspirin was administered, followed by whole-blood RNA microarray profiling, in a discovery cohort of healthy volunteers (HV1) (n = 50) and 2 validation cohorts of healthy volunteers (HV2) (n = 53) and outpatient cardiology patients (OPC) (n = 25). Platelet function was assessed using the platelet function score (PFS) in HV1 and HV2 and the VerifyNow Aspirin Test (Accumetrics, Inc., San Diego, California) in OPC. Bayesian sparse factor analysis identified sets of coexpressed transcripts, which were examined for associations with PFS in HV1 and validated in HV2 and OPC. Proteomic analysis confirmed the association of validated transcripts in platelet proteins. Validated gene sets were tested for association with death or MI in 2 patient cohorts (n = 587 total) from RNA samples collected at cardiac catheterization. A set of 60 coexpressed genes named the "aspirin response signature" (ARS) was associated with PFS in HV1 (r = -0.31, p = 0.03), HV2 (r = -0.34, Bonferroni p = 0.03), and OPC (p = 0.046). Corresponding proteins for the 17 ARS genes were identified in the platelet proteome, of which 6 were associated with PFS. The ARS was associated with death or MI in both patient cohorts (odds ratio: 1.2 [p = 0.01]; hazard ratio: 1.5 [p = 0.001]), independent of cardiovascular risk factors. Compared with traditional risk factors, reclassification (net reclassification index = 31% to 37%, p ≤ 0.0002) was improved by including the ARS or 1 of its genes, ITGA2B. RNA profiles of platelet-specific genes are novel biomarkers for identifying patients who do not respond adequately to aspirin and who are at risk for death or MI. Copyright © 2013 American College of Cardiology Foundation. Published by

  1. TALE-PvuII fusion proteins--novel tools for gene targeting.

    Science.gov (United States)

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity.

  2. Acute hypoxia stress induced abundant differential expression genes and alternative splicing events in heart of tilapia.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Li, Bi Jun; Gu, Xiao Hui; Lin, Hao Ran

    2018-01-10

    Hypoxia is one of the critical environmental stressors for fish in aquatic environments. Although accumulating evidences indicate that gene expression is regulated by hypoxia stress in fish, how genes undergoing differential gene expression and/or alternative splicing (AS) in response to hypoxia stress in heart are not well understood. Using RNA-seq, we surveyed and detected 289 differential expressed genes (DEG) and 103 genes that undergo differential usage of exons and splice junctions events (DUES) in heart of a hypoxia tolerant fish, Nile tilapia, Oreochromis niloticus following 12h hypoxic treatment. The spatio-temporal expression analysis validated the significant association of differential exon usages in two randomly selected DUES genes (fam162a and ndrg2) in 5 tissues (heart, liver, brain, gill and spleen) sampled at three time points (6h, 12h, and 24h) under acute hypoxia treatment. Functional analysis significantly associated the differential expressed genes with the categories related to energy conservation, protein synthesis and immune response. Different enrichment categories were found between the DEG and DUES dataset. The Isomerase activity, Oxidoreductase activity, Glycolysis and Oxidative stress process were significantly enriched for the DEG gene dataset, but the Structural constituent of ribosome and Structural molecule activity, Ribosomal protein and RNA binding protein were significantly enriched only for the DUES genes. Our comparative transcriptomic analysis reveals abundant stress responsive genes and their differential regulation function in the heart tissues of Nile tilapia under acute hypoxia stress. Our findings will facilitate future investigation on transcriptome complexity and AS regulation during hypoxia stress in fish. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. The Long way Towards Inertial Fusion Energy (lirpp Vol. 13)

    Science.gov (United States)

    Velarde, Guillermo

    2016-10-01

    In 1955 the first Geneva Conference was held in which two important events took place. Firstly, the announcement by President Eisenhower of the Program Atoms for Peace declassifying the information concerning nuclear fission reactors. Secondly, it was forecast that due to the research made on stellerators and magnetic mirrors, the first demo fusion facility would be in operation within ten years. This forecasting, as all of us know today, was a mistake. Forty years afterwards, we can say that probably the first Demo Reactor will be operative in some years more and I sincerely hope that it will be based on the inertial fusion concept...

  4. TFG-MET fusion in an infantile spindle cell sarcoma with neural features

    NARCIS (Netherlands)

    Flucke, U.E.; Noesel, M.M. van; Wijnen, M.; Zhang, L.; Chen, C.L.; Sung, Y.S.; Antonescu, C.R.

    2017-01-01

    An increasing number of congenital and infantile sarcomas displaying a primitive, monomorphic spindle cell phenotype have been characterized to harbor recurrent gene fusions, including infantile fibrosarcoma and congenital spindle cell rhabdomyosarcoma. Here, we report an unusual spindle cell

  5. 1988 failure rate screening data for fusion reliability and risk analysis

    International Nuclear Information System (INIS)

    Cadwallader, L.C.; Piet, S.J.

    1988-01-01

    This document contains failure rate screening data for application to fusion components. The screening values are generally fission or aerospace industry failure rate estimates that can be extrapolated for use by fusion system designers, reliability engineers and risk analysts. Failure rate estimates for tritium-bearing systems, liquid metal-cooled systems, gas-cooled systems, water-cooled systems and containment systems are given. Preliminary system availability estimates and selected initiating event frequency estimates are presented. This first edition document is valuable to design and safety analysis for the Compact Ignition Tokamak and the International Thermonuclear Experimental Reactor. 20 refs., 28 tabs

  6. Heavy ion fusion: Prospects and status

    International Nuclear Information System (INIS)

    Herrmannsfeldt, W.B.

    1995-01-01

    Key events in the Heavy Ion Fusion (HIF) field are usually marked by the dates for the International Symposium series which began in 1976 at the Claremont Hotel, and most recently in the eleventh meeting in the series at the Princeton Plasma Physics Laboratory in September 1995. The main purpose of this talk will be to review the status of HIF as it was presented at Princeton, and also to try to deduce something about the prospects for HIF in particular, and fusion in general, from the world and US political scene. The status of the field is largely, though not entirely, expressed through presentations from the two leading HIF efforts: (1) The US program is primarily concerned with applying induction linac technology for HIF drivers; (2) The European program, centered at GSI, Darmstadt, but including several other laboratories, is primarily directed towards the rf linac approach using storage rings for energy compression

  7. Regulatory aspects of fusion power-lessons from fission plants

    International Nuclear Information System (INIS)

    Natalizio, A.; Brunnader, H.; Sood, S.K.

    1993-01-01

    Experience from fission reactors has shown the regulatory process for licensing a nuclear facility to be legalistic, lengthy, unpredictable, and costly. This experience also indicates that much of the regulatory debate is focused on safety margins, that is, the smaller the safety margins the bigger the regulatory debate and the greater the amount of proof required to satisfy the regulatory. Such experience suggests that caution and prudence guide the development of a regulatory regime for fusion reactors. Fusion has intrinsic safety and environmental advantages over fission, which should alleviate significantly, or even eliminate, the regulatory problems associated with fission. The absence of a criticality concern and the absence of fission products preclude a Chernobyl type accident from occurring in a fusion reactor. Although in a fusion reactor there are large inventories of radioactive products that can be mobilized, the total quantity is orders of magnitude smaller than in fission power reactors. The bulk of the radioactivity in a fusion reactor is either activation products in steel structures, or tritium fuel supplies safely stored in the form of a metal tritide in storage beds. The quantity of tritium that can be mobilized under accident conditions is much less than ten million curies. This compares very favorably with a fission product inventory greater than ten billion curies in a fission power reactor. Furthermore, in a fission reactor, all of the reactivity is contained in a steel vessel that is pressurized to about 150 atmospheres, whereas in a fusion reactor, the inventory of radioactive material is dispersed in different areas of the plant, such that it is improbable that a single event could give rise to the release of the entire inventory to the environment. With such significant intrinsic safety advantages there is no a priori need to make fusion requirements/regulations more demanding and more stringent than fission

  8. Design and Analysis of a Data Fusion Scheme in Mobile Wireless Sensor Networks Based on Multi-Protocol Mobile Agents

    Directory of Open Access Journals (Sweden)

    Chunxue Wu

    2017-11-01

    Full Text Available Sensors are increasingly used in mobile environments with wireless network connections. Multiple sensor types measure distinct aspects of the same event. Their measurements are then combined to produce integrated, reliable results. As the number of sensors in networks increases, low energy requirements and changing network connections complicate event detection and measurement. We present a data fusion scheme for use in mobile wireless sensor networks with high energy efficiency and low network delays, that still produces reliable results. In the first phase, we used a network simulation where mobile agents dynamically select the next hop migration node based on the stability parameter of the link, and perform the data fusion at the migration node. Agents use the fusion results to decide if it should return the fusion results to the processing center or continue to collect more data. In the second phase. The feasibility of data fusion at the node level is confirmed by an experimental design where fused data from color sensors show near-identical results to actual physical temperatures. These results are potentially important for new large-scale sensor network applications.

  9. Gene expression profiling of porcine skeletal muscle in the early recovery phase following acute physical activity

    DEFF Research Database (Denmark)

    Hansen, Jeanette; Conley, Lene; Hedegaard, Jakob

    2012-01-01

    Acute physical activity elicits changes in gene expression in skeletal muscles to promote metabolic changes and to repair exercise-induced muscle injuries. In the present time-course study, pigs were submitted to an acute bout of treadmill running until near exhaustion to determine the impact...... associated with proteolytic events, such as the muscle-specific E3 ubiquitin ligase atrogin-1, were significantly upregulated, suggesting that protein breakdown, prevention of protein aggregation and stabilization of unfolded proteins are important processes for restoration of cellular homeostasis. We also...... detected an upregulation of genes that are associated with muscle cell proliferation and differentiation, including MUSTN1, ASB5 and CSRP3, possibly reflecting activation, differentiation and fusion of satellite cells to facilitate repair of muscle damage. In addition, exercise increased expression...

  10. Barriers to fusion

    International Nuclear Information System (INIS)

    Berriman, A.C.; Butt, R.D.; Dasgupta, M.; Hinde, D.J.; Morton, C.R.; Newton, J.O.

    1999-01-01

    The fusion barrier is formed by the combination of the repulsive Coulomb and attractive nuclear forces. Recent research at the Australian National University has shown that when heavy nuclei collide, instead of a single fusion barrier, there is a set of fusion barriers. These arise due to intrinsic properties of the interacting nuclei such deformation, rotations and vibrations. Thus the range of barrier energies depends on the properties of both nuclei. The transfer of matter between nuclei, forming a neck, can also affect the fusion process. High precision data have been used to determine fusion barrier distributions for many nuclear reactions, leading to new insights into the fusion process

  11. Nuclear elastic scattering effects on fusion product transport in the FRM

    International Nuclear Information System (INIS)

    DeVeaux, J.C.; Greenspan, E.; Miley, G.H.

    1981-01-01

    Large energy transfer (LET) events such as nuclear elastic scatterng (NES) are shown to have significant effects on fusion product transport in the field-reversed mirror. The method used and preliminary results obtained from the study on NES effects on f/sub p/ orbits are described

  12. Fusion systems engineering

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    Summaries of research are included for each of the following topics: (1) fusion reactor systems studies, (2) development of blanket processing technology for fusion reactors, (3) safety studies of fusion concepts, (4) the MACK/MACKLIB system for nuclear response functions, and (5) energy storage and power supply systems for fusion reactors

  13. Nuclear dynamics during germination, conidiation, and hyphal fusion of Fusarium oxysporum.

    Science.gov (United States)

    Ruiz-Roldán, M Carmen; Köhli, Michael; Roncero, M Isabel G; Philippsen, Peter; Di Pietro, Antonio; Espeso, Eduardo A

    2010-08-01

    In many fungal pathogens, infection is initiated by conidial germination. Subsequent stages involve germ tube elongation, conidiation, and vegetative hyphal fusion (anastomosis). Here, we used live-cell fluorescence to study the dynamics of green fluorescent protein (GFP)- and cherry fluorescent protein (ChFP)-labeled nuclei in the plant pathogen Fusarium oxysporum. Hyphae of F. oxysporum have uninucleated cells and exhibit an acropetal nuclear pedigree, where only the nucleus in the apical compartment is mitotically active. In contrast, conidiation follows a basopetal pattern, whereby mononucleated microconidia are generated by repeated mitotic cycles of the subapical nucleus in the phialide, followed by septation and cell abscission. Vegetative hyphal fusion is preceded by directed growth of the fusion hypha toward the receptor hypha and followed by a series of postfusion nuclear events, including mitosis of the apical nucleus of the fusion hypha, migration of a daughter nucleus into the receptor hypha, and degradation of the resident nucleus. These previously unreported patterns of nuclear dynamics in F. oxysporum could be intimately related to its pathogenic lifestyle.

  14. Purification of CD47-streptavidin fusion protein from bacterial lysate using biotin-agarose affinity chromatography.

    Science.gov (United States)

    Salehi, Nasrin; Peng, Ching-An

    2016-07-08

    CD47 is a widely expressed transmembrane glycoprotein that modulates the activity of a plethora of immune cells via its extracellular domain. Therefore, CD47 plays important roles in the regulation of immune responses and may serve as targets for the development of immunotherapeutic agents. To make sure CD47 functionality is intact under the process of protein conjugation, CD47-streptavidin fusion protein was expressed and purified because it can easily bind to biotin-tagged materials via the unique biotin-streptavidin affinity. In this study, gene sequences of CD47 extracellular domain (CD47ECD) and core streptavidin (coreSA) with a total 834 bp were inserted into pET20b plasmid to construct recombinant plasmid encoding CD47-SA fusion gene. After bacteria transformation, the CD47-SA fusion protein was expressed by isopropyl-β-d-thiogalactopyranoside (IPTG) induction. The collected bacteria lysate was loaded on biotinylated agarose to proceed the purification of CD47-SA fusion protein. Due to the unexpected high affinity between biotin and coreSA, standard washing and elution approaches (e.g., varying pH, using biotin, and applying guanidine hydrochloride) reported for biotin-streptavidin affinity chromatography were not able to separate the target fusion protein. Instead, using low concentration of the non-ionic detergent Triton X-100 followed with alkaline buffer could efficiently weaken the binding between biotin and coreSA, thereby eluting out CD47-SA fusion protein from the biotin agarose column. The purified CD47-SA fusion protein was further characterized by molecular biology methods and its antiphagocytic functionality was confirmed by the phagocytosis assay. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:949-958, 2016. © 2016 American Institute of Chemical Engineers.

  15. Fusion energy 2000. Fusion energy 1998 (2001 Edition). Proceedings

    International Nuclear Information System (INIS)

    2001-01-01

    This CD-ROM contains the Proceedings of 18th International Conference on Fusion Energy. It also contains an updated version of the Fusion Energy Conference 1998 Proceedings (38 additional papers included) as well as information on how to use this CD-ROM. The 18th International Atomic Energy Agency Fusion Energy Conference (FEC-2000) was held in Sorrento, Italy, 4-10 October 2000. 573 participants from over thirty countries and three international organizations took part in this Conference. The Conference was organized by the IAEA in co-operation with the Italian National Agency for New Technology, Energy and Environment (ENEA). Around 400 papers were presented in 22 oral and 8 poster sessions on magnetic confinement experiments, inertial fusion energy, plasma heating and current drive, ITER engineering design activities, magnetic confinement theory, innovative concepts, fusion technology, and safety and environment aspects. The 17th International Atomic Energy Agency (IAEA) Fusion Energy Conference was held in Yokohama, Japan, 19-24 October 1999. This 6-day conference, which was attended by 835 participants from over 30 countries and two international organizations, was organized by the IAEA in co-operation with the Japan Atomic Energy Research Institute (JAERI). More than 360 papers plus 5 summary talks were presented in 23 oral and 8 poster sessions on magnetic confinement and experiments, inertial fusion energy, plasma heating and current drive, ITER engineering design activities, magnetic confinement theory, innovative concepts and fusion technology

  16. Fusion technology 1992

    International Nuclear Information System (INIS)

    Ferro, C.; Gasparatto, M.; Knoepfel, H.

    1993-01-01

    The aim of the biennial series of symposia on the title subject, organized by the European Fusion Laboratories, is the exchange of information on the design, construction and operation of fusion experiments and on the technology being developed for the next step devices and fusion reactors. The coverage of the volume includes the technological aspects of fusion reactors in relation to new developments, this forming a guideline for the definition of future work. These proceedings comprise three volumes and contain both the invited lectures and contributed papers presented at the symposium which was attended by 569 participants from around the globe. The 343 papers, including 12 invited papers, characterize the increasing interest of industry in the fusion programme, giving a broad and current overview on the progress and trends fusion technology is experiencing now, as well as indicating the future for fusion devices

  17. Expression of hybrid fusion protein (Cry1Ac::ASAL) in transgenic rice plants imparts resistance against multiple insect pests.

    Science.gov (United States)

    Boddupally, Dayakar; Tamirisa, Srinath; Gundra, Sivakrishna Rao; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2018-05-31

    To evolve rice varieties resistant to different groups of insect pests a fusion gene, comprising DI and DII domains of Bt Cry1Ac and carbohydrate binding domain of garlic lectin (ASAL), was constructed. Transgenic rice lines were generated and evaluated to assess the efficacy of Cry1Ac::ASAL fusion protein against three major pests, viz., yellow stem borer (YSB), leaf folder (LF) and brown planthopper (BPH). Molecular analyses of transgenic plants revealed stable integration and expression of the fusion gene. In planta insect bioassays on transgenics disclosed enhanced levels of resistance compared to the control plants. High insect mortality of YSB, LF and BPH was observed on transgenics compared to that of control plants. Furthermore, honeydew assays revealed significant decreases in the feeding ability of BPH on transgenic plants as compared to the controls. Ligand blot analysis, using BPH insects fed on cry1Ac::asal transgenic rice plants, revealed a modified receptor protein-binding pattern owing to its ability to bind to additional receptors in insects. The overall results authenticate that Cry1Ac::ASAL protein is endowed with remarkable entomotoxic effects against major lepidopteran and hemipteran insects. As such, the fusion gene appears promising and can be introduced into various other crops to control multiple insect pests.

  18. Comprehensive ab initio simulations of turbulence in ITER-relevant fusion plasmas

    International Nuclear Information System (INIS)

    Jenko, Frank

    2014-01-01

    The astonishing improvements achieved in supercomputing capabilities over the past two decades have allowed groundbreaking new insights into the physics of plasma turbulence. Even though much has been learned already, fundamental challenges related to predicting the performance of future fusion reactors still remain. In particular, today's fusion experiments routinely achieve a transition to a high-confinement mode (H-mode) with a strong transport barrier at the plasma boundary. Understanding the formation conditions of this barrier and its characteristic size and height are crucial to predicting the efficiency of future fusion reactors, but a fully consistent numerical treatment has still been lacking up to now. A main challenge in the treatment of such barriers is their extreme profile variation, implying their susceptibility to finite-size effects. Global simulation capabilities such as demonstrated within the framework of the present project are thus essential in order to understand the dynamics of the edge transport barrier. Both present and future projects employing the GENE code will build on the experience established within this SuperMUC project and tackle this challenging issue. Another increasingly important field relates to turbulence studies in stellarators, which represent an alternative machine design for future fusion applications. With its newly developed capability of studying turbulence in stellarator geometry (i.e. retaining magnetic geometry variations within a magnetic surface), the GENE code is uniquely suited for this problem. With the new German stellarator experiment Wendelstein 7-X nearing completion, existing predictions already made with GENE for stellarator turbulence will be put to the test, and possibilities for validation will emerge. Due to the complex magnetic geometry, stellarator turbulence simulations have extreme computational requirements and will thus continue to challenge the available supercomputing capabilities also in

  19. Inertial fusion energy; L'energie de fusion inertielle

    Energy Technology Data Exchange (ETDEWEB)

    Decroisette, M.; Andre, M.; Bayer, C.; Juraszek, D. [CEA Bruyeres-le-Chatel, Dir. des Systemes d' Information (CEA/DIF), 91 (France); Le Garrec, B. [CEA Centre d' Etudes Scientifiques et Techniques d' Aquitaine, 33 - Le Barp (France); Deutsch, C. [Paris-11 Univ., 91 - Orsay (France); Migus, A. [Institut d' Optique Centre scientifique, 91 - Orsay (France)

    2005-07-01

    We first recall the scientific basis of inertial fusion and then describe a generic fusion reactor with the different components: the driver, the fusion chamber, the material treatment unit, the target factory and the turbines. We analyse the options proposed at the present time for the driver and for target irradiation scheme giving the state of art for each approach. We conclude by the presentation of LMJ (laser Megajoule) and NIF (national ignition facility) projects. These facilities aim to demonstrate the feasibility of laboratory DT ignition, first step toward Inertial Fusion Energy. (authors)

  20. Fusion Power Deployment

    International Nuclear Information System (INIS)

    Schmidt, J.A.; Ogden, J.M.

    2002-01-01

    Fusion power plants could be part of a future portfolio of non-carbon dioxide producing energy supplies such as wind, solar, biomass, advanced fission power, and fossil energy with carbon dioxide sequestration. In this paper, we discuss key issues that could impact fusion energy deployment during the last half of this century. These include geographic issues such as resource availability, scale issues, energy storage requirements, and waste issues. The resource needs and waste production associated with fusion deployment in the U.S. should not pose serious problems. One important feature of fusion power is the fact that a fusion power plant should be locatable within most local or regional electrical distribution systems. For this reason, fusion power plants should not increase the burden of long distance power transmission to our distribution system. In contrast to fusion power, regional factors could play an important role in the deployment of renewable resources such as wind, solar and biomass or fossil energy with CO2 sequestration. We examine the role of these regional factors and their implications for fusion power deployment

  1. Accelerated rogue waves generated by soliton fusion at the advanced stage of supercontinuum formation in photonic-crystal fibers.

    Science.gov (United States)

    Driben, Rodislav; Babushkin, Ihar

    2012-12-15

    Soliton fusion is a fascinating and delicate phenomenon that manifests itself in optical fibers in case of interaction between copropagating solitons with small temporal and wavelength separation. We show that the mechanism of acceleration of a trailing soliton by dispersive waves radiated from the preceding one provides necessary conditions for soliton fusion at the advanced stage of supercontinuum generation in photonic-crystal fibers. As a result of fusion, large-intensity robust light structures arise and propagate over significant distances. In the presence of small random noise the delicate condition for the effective fusion between solitons can easily be broken, making the fusion-induced giant waves a rare statistical event. Thus oblong-shaped giant accelerated waves become excellent candidates for optical rogue waves.

  2. Laser fusion overview

    International Nuclear Information System (INIS)

    Nuckolls, J.

    1976-01-01

    Because of recent breakthroughs in the target area, and in the glass laser area, the scientific feasibility of laser fusion--and of inertial fusion--may be demonstrated in the early 1980's. Then the development in that time period of a suitable laser (or storage ring or other driving source) would make possible an operational inertial fusion reactor in this century. These are roughly the same time scales as projected by the Tokamak magnetic confinement approach. It thus appears that the 15-20 year earlier start by magnetic confinement fusion may be overcome. Because inertial confinement has been demonstrated, and inertial fusion reactors may operate on smaller scales than Tokamaks, laser fusion may have important technical and economic advantages

  3. Magnet operating experience review for fusion applications

    International Nuclear Information System (INIS)

    Cadwallader, L.C.

    1991-11-01

    This report presents a review of magnet operating experiences for normal-conducting and superconducting magnets from fusion, particle accelerator, medical technology, and magnetohydrodynamics research areas. Safety relevant magnet operating experiences are presented to provide feedback on field performance of existing designs and to point out the operational safety concerns. Quantitative estimates of magnet component failure rates and accident event frequencies are also presented, based on field experience and on performance of similar components in other industries

  4. Nuclear fusion induced by x rays in a crystal

    Science.gov (United States)

    Belyaev, V. B.; Miller, M. B.; Otto, J.; Rakityansky, S. A.

    2016-03-01

    The nuclei that constitute a crystalline lattice oscillate relative to each other with a very low energy that is not sufficient to penetrate through the Coulomb barriers separating them. An additional energy, which is needed to tunnel through the barrier and fuse, can be supplied by external electromagnetic waves (x rays or synchrotron radiation). Exposing the solid compound LiD (lithium deuteride) to x rays for the duration of 111 h, we detect 88 events of nuclear fusion d +6Li→8Be* . Our theoretical estimate agrees with what we observed. One possible application of the phenomenon we found is in measurements of the rates of various nuclear reactions (not necessarily fusion) at extremely low energies inaccessible in accelerator experiments.

  5. Experiences with a Barista Robot, FusionBot

    Science.gov (United States)

    Limbu, Dilip Kumar; Tan, Yeow Kee; Wong, Chern Yuen; Jiang, Ridong; Wu, Hengxin; Li, Liyuan; Kah, Eng Hoe; Yu, Xinguo; Li, Dong; Li, Haizhou

    In this paper, we describe the implemented service robot, called FusionBot. The goal of this research is to explore and demonstrate the utility of an interactive service robot in a smart home environment, thereby improving the quality of human life. The robot has four main features: 1) speech recognition, 2) object recognition, 3) object grabbing and fetching and 4) communication with a smart coffee machine. Its software architecture employs a multimodal dialogue system that integrates different components, including spoken dialog system, vision understanding, navigation and smart device gateway. In the experiments conducted during the TechFest 2008 event, the FusionBot successfully demonstrated that it could autonomously serve coffee to visitors on their request. Preliminary survey results indicate that the robot has potential to not only aid in the general robotics but also contribute towards the long term goal of intelligent service robotics in smart home environment.

  6. Membrane fusion

    DEFF Research Database (Denmark)

    Bendix, Pól Martin

    2015-01-01

    At Stanford University, Boxer lab, I worked on membrane fusion of small unilamellar lipid vesicles to flat membranes tethered to glass surfaces. This geometry closely resembles biological systems in which liposomes fuse to plasma membranes. The fusion mechanism was studied using DNA zippering...... between complementary strands linked to the two apposing membranes closely mimicking the zippering mechanism of SNARE fusion complexes....

  7. Direct Visualization of Ebola Virus Fusion Triggering in the Endocytic Pathway

    Directory of Open Access Journals (Sweden)

    Jennifer S. Spence

    2016-02-01

    Full Text Available Ebola virus (EBOV makes extensive and intricate use of host factors in the cellular endosomal/lysosomal pathway to release its genome into the cytoplasm and initiate infection. Following viral internalization into endosomes, host cysteine proteases cleave the EBOV fusion glycoprotein (GP to unmask the binding site for its intracellular receptor, the cholesterol transporter Niemann-Pick C1 (NPC1. GP-NPC1 interaction is required for viral entry. Despite these and other recent discoveries, late events in EBOV entry following GP-NPC1 binding and culminating in GP-catalyzed fusion between viral and cellular lipid bilayers remain enigmatic. A mechanistic understanding of EBOV membrane fusion has been hampered by the failure of previous efforts to reconstitute fusion in vitro or at the cell surface. This report describes an assay to monitor initial steps directly in EBOV membrane fusion—triggering of GP and virus-cell lipid mixing—by single virions in live cells. Fusogenic triggering of GP occurs predominantly in Rab7-positive (Rab7+ endosomes, absolutely requires interaction between proteolytically primed GP and NPC1, and is blocked by key GP-specific neutralizing antibodies with therapeutic potential. Unexpectedly, cysteine protease inhibitors do not inhibit lipid mixing by virions bearing precleaved GP, even though they completely block cytoplasmic entry by these viruses, as shown previously. These results point to distinct cellular requirements for different steps in EBOV membrane fusion and suggest a model in which host cysteine proteases are dispensable for GP fusion triggering after NPC1 binding but are required for the formation of fusion pores that permit genome delivery.

  8. Information fusion for the Gray Zone

    Science.gov (United States)

    Fenstermacher, Laurie

    2016-05-01

    United States Special Operations Command (SOCOM) recently published a white paper describing the "Gray Zone", security challenges characterized by "ambiguity about the nature of the conflict, opacity of the parties involved…competitive interactions among and within state and non-state actors that fall between the traditional war and peace duality."1 Ambiguity and related uncertainty about actors, situations, relationships, and intent require new approaches to information collection, processing and fusion. General Votel, the current SOCOM commander, during a recent speech on "Operating in the Gray Zone" emphasized that it would be important to get left of the next crises and stated emphatically, "to do that we must understand the Human Domain."2 This understanding of the human domain must come from making meaning based on different perspectives, including the "emic" or first person/participant and "etic" or third person/observer perspectives. Much of the information currently collected and processed is etic. Incorporation and fusion with the emic perspective enables forecasting of behaviors/events and provides context for etic information (e.g., video).3 Gray zone challenges are perspective-dependent; for example, the conflict in Ukraine is interpreted quite differently by Russia, the US and Ukraine. Russia views it as war, necessitating aggressive action, the US views it as a security issue best dealt with by economic sanctions and diplomacy and the Ukraine views it as a threat to its sovereignty.4 General Otto in the Air Force ISR 2023 vision document stated that Air Force ISR is needed to anticipate strategic surprise.5 Anticipatory analysis enabling getting left of a crisis inherently requires a greater focus on information sources that elucidate the human environment as well as new methods that elucidate not only the "who's" and "what's", but the "how's and "why's," extracting features and/or patterns and subtle cues useful for forecasting behaviors and

  9. Disposal of activated fusion wall materials

    International Nuclear Information System (INIS)

    Blink, J.A.; Dorn, D.W.; Maninger, R.C.

    1983-08-01

    We have used NRC's low-level waste disposal regulation (10CFR61) to classify activated fusion reactor structural materials. The limits set by the NRC in 10CFR61 will require extremely expensive steels with degraded properties, even when the limits are adjusted to give credit for use of an expensive hot waste disposal facility. Both the expense and the poorer properties could have a negative impact on reactor safety, thus subverting the overall goals of the NRC family of regulations. Following this initial study, we have examined the methodology used by the NRC to set waste concentration limits. For a long-lived gamma emitter like 94 Nb, direct gamma dose to an intruding home builder dominates the limit setting process. Of all the tests applied to the waste, the controlling test which sets the lowest limit ignores all the engineered intrusion barriers which are themselves required by the same regulation. If even a small fraction of the barriers remain intact (an extremely likely event), the 94 Nb limit could be increased from the 0.2 Ci/m 3 in 10CFR61 to 1100 Ci/m 3 without exceeding the limits set for personnel exposure. Similarly, cautious application of the 10CFR61 methodology to other radioisotopes of interest to fusion designers will result in limits which are more in line with the unique nature of fusion energy

  10. Fusion genes with ALK as recurrent partner in ependymoma-like gliomas

    DEFF Research Database (Denmark)

    Olsen, Thale Kristin; Panagopoulos, Ioannis; Meling, Torstein R

    2015-01-01

    , we identified the 2 first ever reported ALK rearrangements in CNS tumors. Such rearrangements may represent the hallmark of a new entity of pediatric glioma characterized by both ependymal and astrocytic features. Our findings are of particular importance because crizotinib, a selective ALK inhibitor......, has demonstrated effect in patients with lung cancer harboring ALK rearrangements. Thus, ALK emerges as an interesting therapeutic target in patients with ependymal tumors carrying ALK fusions....

  11. Vacuum engineering for fusion research and fusion reactors

    International Nuclear Information System (INIS)

    Pittenger, L.C.

    1976-01-01

    The following topics are described: (1) surface pumping by cryogenic condensation, (2) operation of large condensing cryopumps, (3) pumping for large fusion experiments, and (4) vacuum technology for fusion reactors

  12. Detection of association and fusion of giant vesicles using a fluorescence-activated cell sorter.

    Science.gov (United States)

    Sunami, Takeshi; Caschera, Filippo; Morita, Yuuki; Toyota, Taro; Nishimura, Kazuya; Matsuura, Tomoaki; Suzuki, Hiroaki; Hanczyc, Martin M; Yomo, Tetsuya

    2010-10-05

    We have developed a method to evaluate the fusion process of giant vesicles using a fluorescence-activated cell sorter (FACS). Three fluorescent markers and FACS technology were used to evaluate the extent of association and fusion of giant vesicles. Two fluorescent markers encapsulated in different vesicle populations were used as association markers; when these vesicles associate, the two independent markers should be observed simultaneously in a single detection event. The quenched fluorescent marker and the dequencher, which were encapsulated in separate vesicle populations, were used as the fusion marker. When the internal aqueous solutions mix, the quenched marker is liberated by the dequencher and emits the third fluorescent signal. Although populations of pure POPC vesicles showed no detectable association or fusion, the same populations, oppositely charged by the exogenous addition of charged amphiphiles, showed up to 50% association and 30% fusion upon population analysis of 100,000 giant vesicles. Although a substantial fraction of the vesicles associated in response to a small amount of the charged amphiphiles (5% mole fraction compared to POPC alone), a larger amount of the charged amphiphiles (25%) was needed to induce vesicle fusion. The present methodology also revealed that the association and fusion of giant vesicles was dependent on size, with larger giant vesicles associating and fusing more frequently.

  13. Junction region of EWS-FLI1 fusion protein has a dominant negative effect in Ewing's sarcoma in vitro.

    Science.gov (United States)

    Jully, Babu; Vijayalakshmi, Ramshankar; Gopal, Gopisetty; Sabitha, Kesavan; Rajkumar, Thangarajan

    2012-11-12

    Ewing's sarcoma is a malignancy characterized by a specific 11:22 chromosomal translocation which generates a novel EWS-FLI1 fusion protein functioning as an aberrant transcription factor. In the present study, we have further characterized the junction region of the EWS-FLI1 fusion protein. In-silico model of EWS-FLI1 fusion protein was analysed for ligand binding sites, and a putative region (amino acid (aa) 251-343 of the type 1 fusion protein) in the vicinity of the fusion junction was cloned and expressed using bacterial expression. The recombinant protein was characterized by Circular Dichroism (CD). We then expressed aa 251-280 ectopically in Ewing's sarcoma cell-line and its effect on cell proliferation, tumorigenicity and expression of EWS-FLI1 target genes were analysed. Our modelling analysis indicated that Junction region (aa 251-343) encompasses potential ligand biding sites in the EWS-FLI1 protein and when expressed in bacteria was present as soluble form. Ectopically expressing this region in Ewing's sarcoma cells inhibited tumorigenicity, and EWS-FLI1 target genes indicating a dominant negative biological effect. Junction region can be exploited further as target for drug development in future to specifically target EWS-FLI1 in Ewing's Sarcoma.

  14. Oncogenic Activation of Fibroblast Growth Factor Receptor-3 and RAS Genes as Non-Overlapping Mutual Exclusive Events in Urinary Bladder Cancer.

    Science.gov (United States)

    Pandith, Arshad A; Hussain, Aashaq; Khan, Mosin S; Shah, Zafar A; Wani, M Saleem; Siddiqi, Mushtaq A

    2016-01-01

    Urinary bladder cancer is a common malignancy in the West and ranks as the 7th most common cancer in our region of Kashmir, India. FGFR3 mutations are frequent in superficial urothelial carcinoma (UC) differing from the RAS gene mutational pattern. The aim of this study was to analyze the frequency and association of FGFR3 and RAS gene mutations in UC cases. Paired tumor and adjacent normal tissue specimens of 65 consecutive UC patients were examined. DNA preparations were evaluated for the occurrence of FGFR3 and RAS gene mutations by PCR-SCCP and DNA sequencing. Somatic point mutations of FGFR3 were identified in 32.3% (21 of 65). The pattern and distribution were significantly associated with low grade/stage (<0.05). The overall mutations in exon 1 and 2 in all the forms of RAS genes aggregated to 21.5% and showed no association with any clinic-pathological parameters. In total, 53.8% (35 of 65) of the tumors studied had mutations in either a RAS or FGFR3 gene, but these were totally mutually exclusive in and none of the samples showed both the mutational events in mutually exclusive RAS and FGFR3. We conclude that RAS and FGFR3 mutations in UC are mutually exclusive and non-overlapping events which reflect activation of oncogenic pathways through different elements.

  15. Nuclear fusion

    International Nuclear Information System (INIS)

    Al-zaelic, M.M.

    2013-01-01

    Nuclear fusion can be relied on to solve the global energy crisis if the process of limiting the heat produced by the fusion reaction (Plasma) is successful. Currently scientists are progressively working on this aspect whereas there are two methods to limit the heat produced by fusion reaction, the two methods are auto-restriction using laser beam and magnetic restriction through the use of magnetic fields and research is carried out to improve these two methods. It is expected that at the end of this century the nuclear fusion energy will play a vital role in overcoming the global energy crisis and for these reasons, acquiring energy through the use of nuclear fusion reactors is one of the most urge nt demands of all mankind at this time. The conclusion given is that the source of fuel for energy production is readily available and inexpensive ( hydrogen atoms) and whole process is free of risks and hazards, especially to general health and the environment . Nuclear fusion importance lies in the fact that energy produced by the process is estimated to be about four to five times the energy produced by nuclear fission. (author)

  16. Circumferential fusion improves outcome in comparison with instrumented posterolateral fusion

    DEFF Research Database (Denmark)

    Videbaek, Tina S; Christensen, Finn B; Soegaard, Rikke

    2006-01-01

    with respect to all four DPQ categories: daily activities, work/leisure, anxiety/depression, and social interest. The Oswestry Disability Index supported these results (P ...STUDY DESIGN: Prospective randomized clinical study with a 5- to 9-year follow-up period. OBJECTIVE: The aim of the present study was to analyze the long-term outcome with respect to functional disability, pain, and general health of patients treated by means of circumferential lumbar fusion...... in comparison with those treated by means of instrumented posterolateral lumbar fusion. SUMMARY OF BACKGROUND DATA: Circumferential fusion has become a common procedure in lumbar spinal fusion both as a primary and salvage procedure. However, the claimed advantages of circumferential fusion over conventional...

  17. Incomplete fusion studies

    International Nuclear Information System (INIS)

    Singh, B.P.

    2011-01-01

    In order to study the incomplete fusion reaction dynamics at energies ≅ 4-7 MeV/nucleon, several experiments have been carried out using accelerator facilities available in India. The measurements presented here cover a wide range of projectile-target combinations and enhance significantly our knowledge about incomplete fusion reaction dynamics. Here, the three sets of measurements have been presented; (i) excitation functions, (ii) forward recoil range distributions and (iii) the spin distributions. The first evidence of these reactions has been obtained from the measurement and analysis of excitation functions for xn/αxn/2αxn-channels. The measured excitation functions have been analyzed within the framework of compound nucleus model. The results obtained indicate the occurrence of fusion incompleteness at low beam energies. However, in order to determine the relative contribution of complete and incomplete fusion reaction processes, the recoil range distributions of the heavy residues have also been measured and analyzed within the framework of breakup fusion model which confirmed the fusion incompleteness in several heavy ion reactions involving α-emitting reaction channels. Further, in order to study the role of l-values in these reactions the spin distributions of the residues populated in case of complete and incomplete channels have been measured and are found to be distinctly different. The analysis of the data on spin distribution measurements indicate that the mean values of driving input angular momenta associated with direct-α-emitting (incomplete fusion) channels are higher than that observed for fusion-evaporation xn or α-emitting (complete fusion) channels, and is found to increase with direct α-multiplicity in the forward cone. One of the important conclusions drawn in the present work is that, there is significant incomplete fusion contribution even at energies slightly above the barrier. Further, the projectile structure has been found to

  18. Remodeling of the notochord during development of vertebral fusions in Atlantic salmon (Salmo salar).

    Science.gov (United States)

    Ytteborg, Elisabeth; Torgersen, Jacob Seilø; Pedersen, Mona E; Baeverfjord, Grete; Hannesson, Kirsten O; Takle, Harald

    2010-12-01

    Histological characterization of spinal fusions in Atlantic salmon (Salmo salar) has demonstrated shape alterations of vertebral body endplates, a reduced intervertebral space, and replacement of intervertebral cells by ectopic bone. However, the significance of the notochord during the fusion process has not been addressed. We have therefore investigated structural and cellular events in the notochord during the development of vertebral fusions. In order to induce vertebral fusions, Atlantic salmon were exposed to elevated temperatures from fertilization until they attained a size of 15g. Based on results from radiography, intermediate and terminal stages of the fusion process were investigated by immunohistochemistry and real-time quantitative polymerase chain reaction. Examination of structural extracellular matrix proteins such as Perlecan, Aggrecan, Elastin, and Laminin revealed reduced activity and reorganization at early stages in the pathology. Staining for elastic fibers visualized a thinner elastic membrane surrounding the notochord of developing fusions, and immunohistochemistry for Perlecan showed that the notochordal sheath was stretched during fusion. These findings in the outer notochord correlated with the loss of Aggrecan- and Substance-P-positive signals and the further loss of vacuoles from the chordocytes in the central notochord. At more progressed stages of fusion, chordocytes condensed, and the expression of Aggrecan and Substance P reappeared. The hyperdense regions seem to be of importance for the formation of notochordal tissue into bone. Thus, the remodeling of notochord integrity by reduced elasticity, structural alterations, and cellular changes is probably involved in the development of vertebral fusions.

  19. Magnetic fusion energy. Progress report, January--June 1976

    International Nuclear Information System (INIS)

    Doran, D.G.; Yoshikawa, H.H.

    1976-01-01

    Brief descriptions are given of progress in the Irradiation Effects Analysis and Mechanical Performance of Magnetic Fusion Energy (MFE) Materials programs and in related programs. The objective of the Irradiation Effects Analysis program is the correlation of effects produced in neutron and charged particle irradiations in order to apply them to fusion reactor environments. Low energy displacement cascades--of intrinsic interest and the least understood component of high energy cascades--are being simulated by computer codes of the dynamical (D), quasi-dynamical (Q-D), and binary collision (BC) types. Fair agreement has been found between D and Q-D for low index focused replacement sequences; substantial differences appeared for a 250 eV high index event. The objective of the Mechanical Performance of MFE Materials program is to establish the effects of fusion reactor irradiation environments on the mechanical properties of candidate first wall materials. A Precision Torsional Creep Apparatus is being developed to permit accelerator studies of irradiation creep and behavior under cyclic conditions. This apparatus has demonstrated the required strain sensitivity, stress control, and thermal stability for long term thermal testing, and that it can be used for cyclic testing

  20. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  1. Macrophage fusion is controlled by the cytoplasmic protein tyrosine phosphatase PTP-PEST/PTPN12.

    Science.gov (United States)

    Rhee, Inmoo; Davidson, Dominique; Souza, Cleiton Martins; Vacher, Jean; Veillette, André

    2013-06-01

    Macrophages can undergo cell-cell fusion, leading to the formation of multinucleated giant cells and osteoclasts. This process is believed to promote the proteolytic activity of macrophages toward pathogens, foreign bodies, and extracellular matrices. Here, we examined the role of PTP-PEST (PTPN12), a cytoplasmic protein tyrosine phosphatase, in macrophage fusion. Using a macrophage-targeted PTP-PEST-deficient mouse, we determined that PTP-PEST was not needed for macrophage differentiation or cytokine production. However, it was necessary for interleukin-4-induced macrophage fusion into multinucleated giant cells in vitro. It was also needed for macrophage fusion following implantation of a foreign body in vivo. Moreover, in the RAW264.7 macrophage cell line, PTP-PEST was required for receptor activator of nuclear factor kappa-B ligand (RANKL)-triggered macrophage fusion into osteoclasts. PTP-PEST had no impact on expression of fusion mediators such as β-integrins, E-cadherin, and CD47, which enable macrophages to become fusion competent. However, it was needed for polarization of macrophages, migration induced by the chemokine CC chemokine ligand 2 (CCL2), and integrin-induced spreading, three key events in the fusion process. PTP-PEST deficiency resulted in specific hyperphosphorylation of the protein tyrosine kinase Pyk2 and the adaptor paxillin. Moreover, a fusion defect was induced upon treatment of normal macrophages with a Pyk2 inhibitor. Together, these data argue that macrophage fusion is critically dependent on PTP-PEST. This function is seemingly due to the ability of PTP-PEST to control phosphorylation of Pyk2 and paxillin, thereby regulating cell polarization, migration, and spreading.

  2. Transcriptomic events involved in melon mature-fruit abscission comprise the sequential induction of cell-wall degrading genes coupled to a stimulation of endo and exocytosis.

    Directory of Open Access Journals (Sweden)

    Jorge Corbacho

    Full Text Available Mature-fruit abscission (MFA in fleshy-fruit is a genetically controlled process with mechanisms that, contrary to immature-fruit abscission, has not been fully characterized. Here, we use pyrosequencing to characterize the transcriptomes of melon abscission zone (AZ at three stages during AZ-cell separation in order to understand MFA control at an early stage of AZ-activation.The results show that by early induction of MFA, the melon AZ exhibits major gene induction, while by late induction of MFA, melon AZ shows major gene repression. Although some genes displayed similar regulation in both early and late induction of abscission, such as EXT1-EXT4, EGase1, IAA2, ERF1, AP2D15, FLC, MADS2, ERAF17, SAP5 and SCL13 genes, the majority had different expression patterns. This implies that time-specific events occur during MFA, and emphasizes the value of characterizing multiple time-specific abscission transcriptomes. Analysis of gene-expression from these AZs reveal that a sequential induction of cell-wall-degrading genes is associated with the upregulation of genes involved in endo and exocytosis, and a shift in plant-hormone metabolism and signaling genes during MFA. This is accompanied by transcriptional activity of small-GTPases and synthaxins together with tubulins, dynamins, V-type ATPases and kinesin-like proteins potentially involved in MFA signaling. Early events are potentially controlled by down-regulation of MADS-box, AP2/ERF and Aux/IAA transcription-factors, and up-regulation of homeobox, zinc finger, bZIP, and WRKY transcription-factors, while late events may be controlled by up-regulation of MYB transcription-factors.Overall, the data provide a comprehensive view on MFA in fleshy-fruit, identifying candidate genes and pathways associated with early induction of MFA. Our comprehensive gene-expression profile will be very useful for elucidating gene regulatory networks of the MFA in fleshy-fruit.

  3. 1+1 = 3: a fusion of 2 enzymes in the methionine salvage pathway of Tetrahymena thermophila creates a trifunctional enzyme that catalyzes 3 steps in the pathway.

    Directory of Open Access Journals (Sweden)

    Hannah M W Salim

    2009-10-01

    Full Text Available The methionine salvage pathway is responsible for regenerating methionine from its derivative, methylthioadenosine. The complete set of enzymes of the methionine pathway has been previously described in bacteria. Despite its importance, the pathway has only been fully described in one eukaryotic organism, yeast. Here we use a computational approach to identify the enzymes of the methionine salvage pathway in another eukaryote, Tetrahymena thermophila. In this organism, the pathway has two fused genes, MTNAK and MTNBD. Each of these fusions involves two different genes whose products catalyze two different single steps of the pathway in other organisms. One of the fusion proteins, mtnBD, is formed by enzymes that catalyze non-consecutive steps in the pathway, mtnB and mtnD. Interestingly the gene that codes for the intervening enzyme in the pathway, mtnC, is missing from the genome of Tetrahymena. We used complementation tests in yeast to show that the fusion of mtnB and mtnD from Tetrahymena is able to do in one step what yeast does in three, since it can rescue yeast knockouts of mtnB, mtnC, or mtnD. Fusion genes have proved to be very useful in aiding phylogenetic reconstructions and in the functional characterization of genes. Our results highlight another characteristic of fusion proteins, namely that these proteins can serve as biochemical shortcuts, allowing organisms to completely bypass steps in biochemical pathways.

  4. Investigating effect of fusion gene therapy by MR diffusion-weighted imaging in a rat C6 glioma model

    International Nuclear Information System (INIS)

    Shen Huicong; Dai Jianping; Wei Xinhua; Wang Jianjiao; Li Shaowu; Ma Jun; Ai Lin; Liu Fengsheng; Chai Qi; Zhao Weijiang; Gao Peiyi

    2008-01-01

    Objective: To evaluate the use of diffusion-weighted imaging (DWI) for early detection of tumor response to Angiostatin-Endostatin (Statin-AE) fusion gene therapy in a rat C6 glioma model. Methods: Fifty male wistar rats with C6 tumor cells implanted into the striatum were examined by a 3.0T MR scanner, then the rats bearing tumors were divided into two groups, treatment group and control group. Rats in the treatment group received 107 plaque forming unit (pfu) recombinant herps simplex viral (R-HSV) mediated Statin-AE fusion gene therapy on day 7, and then the tumors were conformed on MRI. Conventional MR and DWI examination were acquired on 1, 2, 3 weeks after implantation with a 5-inch surface coil. Two (1 w), eight (2 w) and all the residual rats (3 w) of each group were sacrificed to perform the histopathological examination after each MRI examination. Pretreatment and post treatment tumor volumes and apparent diffusion coefficient (ADC) values were calculated. Bank sum test and t test were employed for statistical analysis. Results: On MRI, 43 rats demonstrated tumors on day 7 with a successful rate of 86%. On week 2, the tumor volumes of the controls and treatment group were 90. 6 and 91.64 mm 3 , with no significant difference (Z=-0.14, P>0.05). On week 3, the tumor volumes of the controls and treatment group were 156.64 and 29.64 mm 3 , and a significant difference was observed (Z=-3.45, P -3 and (0.99 ± 0.08) x 10 -3 mm 2 /s, and the values of the tumor peripheral parts of the two groups were (1.00 ± 0.25) x 10 -3 and (0.83 ± 0.12) x 10 -3 mm 2 /s, the ADC values of both tumor centers and peripheral parts of the treatment group were significantly higher than those of the control group (t=-0.82 and -0.46, P -3 and (0.99 ± 0.09) x 10 -3 mm 2 /s, and the values of the tumor peripheral parts of the two groups were (0.81±0.19) x 10 -3 and (0.78±0.11) x 10 -3 mm 2 /s, there were no statistical difference between the two groups (t=0.82, and -0.46, P<0

  5. Membranes linked by trans-SNARE complexes require lipids prone to non-bilayer structure for progression to fusion.

    Science.gov (United States)

    Zick, Michael; Stroupe, Christopher; Orr, Amy; Douville, Deborah; Wickner, William T

    2014-01-01

    Like other intracellular fusion events, the homotypic fusion of yeast vacuoles requires a Rab GTPase, a large Rab effector complex, SNARE proteins which can form a 4-helical bundle, and the SNARE disassembly chaperones Sec17p and Sec18p. In addition to these proteins, specific vacuole lipids are required for efficient fusion in vivo and with the purified organelle. Reconstitution of vacuole fusion with all purified components reveals that high SNARE levels can mask the requirement for a complex mixture of vacuole lipids. At lower, more physiological SNARE levels, neutral lipids with small headgroups that tend to form non-bilayer structures (phosphatidylethanolamine, diacylglycerol, and ergosterol) are essential. Membranes without these three lipids can dock and complete trans-SNARE pairing but cannot rearrange their lipids for fusion. DOI: http://dx.doi.org/10.7554/eLife.01879.001.

  6. Progress in fusion technology in the U.S. magnetic fusion program

    International Nuclear Information System (INIS)

    Dowling, R.J.; Beard, D.S.; Haas, G.M.; Stone, P.M.; George, T.V.

    1987-01-01

    In this paper the authors discuss the major technological achievements that have taken place during the past few years in the U.S. magnetic fusion program which have contributed to the global efforts. The goal has been to establish the scientific and technological base required for fusion energy. To reach this goal the fusion RandD program is focused on four key technical issues: determine the optimum configuration of magnetic confinement systems; determine the properties of burning plasmas; develop materials for fusion systems; and establish the nuclear technology of fusion systems. The objective of the fusion technology efforts has been to develop advanced technologies and provide the necessary support for research of these four issues. This support is provided in a variety of areas such as: high vacuum technology, large magnetic field generation by superconducting and copper coils, high voltage and high current power supplies, electromagnetic wave and particle beam heating systems, plasma fueling, tritium breeding and handling, remote maintenance, energy recovery. The U.S. Fusion Technology Program provides major support or has the primary responsibility in each of the four key technical issues of fusion, as described in the Magnetic Fusion Program Plan of February 1985. This paper has summarized the Technology Program in terms of its activities and progress since the Proceedings of the SOFT Conference in 1984

  7. Construction of a fusion gene containing hepatitis B virus L gene ...

    African Journals Online (AJOL)

    Jane

    2011-10-05

    Oct 5, 2011 ... the successful construction of a recombinant yeast expression vector containing gene coding L protein and Ag85B ..... the production of memory T cells, promote cytokine secretion and ... Dual DNA vaccination of rainbow trout.

  8. FuzzyFusion: an application architecture for multisource information fusion

    Science.gov (United States)

    Fox, Kevin L.; Henning, Ronda R.

    2009-04-01

    The correlation of information from disparate sources has long been an issue in data fusion research. Traditional data fusion addresses the correlation of information from sources as diverse as single-purpose sensors to all-source multi-media information. Information system vulnerability information is similar in its diversity of sources and content, and in the desire to draw a meaningful conclusion, namely, the security posture of the system under inspection. FuzzyFusionTM, A data fusion model that is being applied to the computer network operations domain is presented. This model has been successfully prototyped in an applied research environment and represents a next generation assurance tool for system and network security.

  9. Gene expression response to EWS–FLI1 in mouse embryonic cartilage

    Directory of Open Access Journals (Sweden)

    Miwa Tanaka

    2014-12-01

    Full Text Available Ewing's sarcoma is a rare bone tumor that affects children and adolescents. We have recently succeeded to induce Ewing's sarcoma-like small round cell tumor in mice by expression of EWS–ETS fusion genes in murine embryonic osteochondrogenic progenitors. The Ewing's sarcoma precursors are enriched in embryonic superficial zone (eSZ cells of long bone. To get insights into the mechanisms of Ewing's sarcoma development, gene expression profiles between EWS–FLI1-sensitive eSZ cells and EWS–FLI1-resistant embryonic growth plate (eGP cells were compared using DNA microarrays. Gene expression of eSZ and eGP cells (total, 30 samples was evaluated with or without EWS–FLI1 expression 0, 8 or 48 h after gene transduction. Our data provide useful information for gene expression responses to fusion oncogenes in human sarcoma.

  10. Fusion technology development: role of fusion facility upgrades and fission test reactors

    International Nuclear Information System (INIS)

    Hsu, P.Y.; Deis, G.A.; Longhurst, G.R.; Miller, L.G.; Schmunk, R.E.

    1983-01-01

    The near term national fusion program is unlikely to follow the aggressive logic of the Fusion Engineering Act of 1980. Faced with level budgets, a large, new fusion facility with an engineering thrust is unlikely in the near future. Within the fusion community the idea of upgrading the existing machines (TFTR, MFTF-B) is being considered to partially mitigate the lack of a design data base to ready the nation to launch an aggressive, mission-oriented fusion program with the goal of power production. This paper examines the cost/benefit issues of using fusion upgrades to develop the technology data base which will be required to support the design and construction of the next generation of fusion machines. The extent of usefulness of the nation's fission test reactors will be examined vis-a-vis the mission of the fusion upgrades. The authors show that while fission neutrons will provide a useful test environment in terms of bulk heating and tritium breeding on a submodule scale, they can play only a supporting role in designing the integrated whole modules and systems to be used in a nuclear fusion machine

  11. Fusion technology development: role of fusion facility upgrades and fission test reactors

    International Nuclear Information System (INIS)

    Hsu, P.Y.; Deis, G.A.; Miller, L.G.; Longhurst, G.R.; Schmunk, R.E.

    1983-01-01

    The near term national fusion program is unlikely to follow the aggressive logic of the Fusion Engineering Act of 1980. Faced with level budgets, a large, new fusion facility with an engineering thrust is unlikely in the near future. Within the fusion community the idea of upgrading the existing machines (TFTR, MFTF-B) is being considered to partially mitigate the lack of a design data base to ready the nation to launch an aggressive, mission-oriented fusion program with the goal of power production. This paper examines the cost/benefit issues of using fusion upgrades to develop the technology data base which will be required to support the design and construction of the next generation of fusion machines. The extent of usefulness of the nation's fission test reactors will be examined vis-a-vis the mission of the fusion upgrades. We will show that while fission neutrons will provide a useful test environment in terms of bulk heating and tritium breeding on a submodule scale, they can play only a supporting role in designing the integrated whole modules and systems to be used in a nuclear fusion machine

  12. Development of ammonium bifluoride fusion method for rapid dissolution of trinitite samples and analysis by ICP-MS

    International Nuclear Information System (INIS)

    Hubley, Nickolas; Brown IV, J.W.N.; Guthrie, James; Brockman, J.D.; Robertson, J.D.; University of Missouri, Columbia, MO

    2016-01-01

    Field deployable dissolution techniques are needed to decrease response time following a nuclear event. This study tested the capability of NH 4 HF 2 fusion to dissolve trinitite. Dissolution of trinitite by NH 4 HF 2 fusion was compared to conventional microwave digestion. Following digestion, trace elements were measured using ICPMS. This work demonstrates that low temperature fusion with NH 4 HF 2 is capable of dissolving trinitite samples. The low purity of the NH 4 HF 2 resulted in a higher limit of detection for several elements when compared to microwave digestion with high purity acids. (author)

  13. The Asia 2 specific signal peptide region and other domains in fusion protein genes characterized Asia 1 and Asia 2 canine distemper viruses

    Science.gov (United States)

    Sultan, Serageldeen; Charoenvisal, Nataya; Lan, Nguyen Thi; Yamaguchi, Ryoji; Maeda, Ken; Kai, Kazushige

    2009-01-01

    Background Although the presence of Asia 2 group of canine distemper virus (CDV) was known by the sequencing and phylogenetic analysis of hemagglutinin (H) gene, the fusion (F) protein gene sequence of Asia 2 group had not been identified. So, the sequence analysis of F gene was carried out to elucidate the genotypic varaitons among Asian isolates. Results The phylogenetic analysis of F and H gene sequences from fourteen CDV isolates obtained from diseased dogs in Japan and Thailand indicated that the F genes had a new initiation codon and extra 27 nucleotides upstream of the usual open reading frame (ORF) and the F proteins had extra 9 amino acids at the N-terminal position only in Asia 2 isolates. On the contrary, the Asia 1 isolates had three extra putative N-glycosylation sites (two sites in the signal peptide region and one site in the F1 region) except for two strains of Th12 and Ac96I (two sites in signal peptide region) adding to four putative N-glycosylation sites that were conserved among all Asian isolates and Onderstepoort strain. In addition to this difference in N-glycosylation sites, the signal peptide region had a great diversity between Asia 1 and Asia 2 isolates. Also, characteristic amino acids were detected for some strains. Conclusion Asia 2 isolates were distinguished from other CDV lineages by the extra 27 nucleotide sequence. The signal peptide region of F gene gives a remarkable differentiation between Asia 1 and Asia 2 isolates. Strains Th12 and Ac96I were differentiated from other Asia 1 strains by the F protein glycosylation sites. PMID:19807927

  14. Monitoring and Hardware Management for Critical Fusion Plasma Instrumentation

    Directory of Open Access Journals (Sweden)

    Carvalho Paulo F.

    2018-01-01

    Full Text Available Controlled nuclear fusion aims to obtain energy by particles collision confined inside a nuclear reactor (Tokamak. These ionized particles, heavier isotopes of hydrogen, are the main elements inside of plasma that is kept at high temperatures (millions of Celsius degrees. Due to high temperatures and magnetic confinement, plasma is exposed to several sources of instabilities which require a set of procedures by the control and data acquisition systems throughout fusion experiments processes. Control and data acquisition systems often used in nuclear fusion experiments are based on the Advanced Telecommunication Computer Architecture (AdvancedTCA® standard introduced by the Peripheral Component Interconnect Industrial Manufacturers Group (PICMG®, to meet the demands of telecommunications that require large amount of data (TB transportation at high transfer rates (Gb/s, to ensure high availability including features such as reliability, serviceability and redundancy. For efficient plasma control, systems are required to collect large amounts of data, process it, store for later analysis, make critical decisions in real time and provide status reports either from the experience itself or the electronic instrumentation involved. Moreover, systems should also ensure the correct handling of detected anomalies and identified faults, notify the system operator of occurred events, decisions taken to acknowledge and implemented changes. Therefore, for everything to work in compliance with specifications it is required that the instrumentation includes hardware management and monitoring mechanisms for both hardware and software. These mechanisms should check the system status by reading sensors, manage events, update inventory databases with hardware system components in use and maintenance, store collected information, update firmware and installed software modules, configure and handle alarms to detect possible system failures and prevent emergency

  15. Monitoring and Hardware Management for Critical Fusion Plasma Instrumentation

    Science.gov (United States)

    Carvalho, Paulo F.; Santos, Bruno; Correia, Miguel; Combo, Álvaro M.; Rodrigues, AntÓnio P.; Pereira, Rita C.; Fernandes, Ana; Cruz, Nuno; Sousa, Jorge; Carvalho, Bernardo B.; Batista, AntÓnio J. N.; Correia, Carlos M. B. A.; Gonçalves, Bruno

    2018-01-01

    Controlled nuclear fusion aims to obtain energy by particles collision confined inside a nuclear reactor (Tokamak). These ionized particles, heavier isotopes of hydrogen, are the main elements inside of plasma that is kept at high temperatures (millions of Celsius degrees). Due to high temperatures and magnetic confinement, plasma is exposed to several sources of instabilities which require a set of procedures by the control and data acquisition systems throughout fusion experiments processes. Control and data acquisition systems often used in nuclear fusion experiments are based on the Advanced Telecommunication Computer Architecture (AdvancedTCA®) standard introduced by the Peripheral Component Interconnect Industrial Manufacturers Group (PICMG®), to meet the demands of telecommunications that require large amount of data (TB) transportation at high transfer rates (Gb/s), to ensure high availability including features such as reliability, serviceability and redundancy. For efficient plasma control, systems are required to collect large amounts of data, process it, store for later analysis, make critical decisions in real time and provide status reports either from the experience itself or the electronic instrumentation involved. Moreover, systems should also ensure the correct handling of detected anomalies and identified faults, notify the system operator of occurred events, decisions taken to acknowledge and implemented changes. Therefore, for everything to work in compliance with specifications it is required that the instrumentation includes hardware management and monitoring mechanisms for both hardware and software. These mechanisms should check the system status by reading sensors, manage events, update inventory databases with hardware system components in use and maintenance, store collected information, update firmware and installed software modules, configure and handle alarms to detect possible system failures and prevent emergency scenarios

  16. A mature and fusogenic form of the Nipah virus fusion protein requires proteolytic processing by cathepsin L

    International Nuclear Information System (INIS)

    Pager, Cara Theresia; Craft, Willie Warren; Patch, Jared; Dutch, Rebecca Ellis

    2006-01-01

    The Nipah virus fusion (F) protein is proteolytically processed to F 1 + F 2 subunits. We demonstrate here that cathepsin L is involved in this important maturation event. Cathepsin inhibitors ablated cleavage of Nipah F. Proteolytic processing of Nipah F and fusion activity was dramatically reduced in cathepsin L shRNA-expressing Vero cells. Additionally, Nipah virus F-mediated fusion was inhibited in cathepsin L-deficient cells, but coexpression of cathepsin L restored fusion activity. Both purified cathepsin L and B could cleave immunopurified Nipah F protein, but only cathepsin L produced products of the correct size. Our results suggest that endosomal cathepsins can cleave Nipah F, but that cathepsin L specifically converts Nipah F to a mature and fusogenic form

  17. Building the US National Fusion Grid: results from the National Fusion Collaboratory Project

    International Nuclear Information System (INIS)

    Schissel, D.P.; Burruss, J.R.; Finkelstein, A.; Flanagan, S.M.; Foster, I.T.; Fredian, T.W.; Greenwald, M.J.; Johnson, C.R.; Keahey, K.; Klasky, S.A.; Li, K.; McCune, D.C.; Papka, M.; Peng, Q.; Randerson, L.; Sanderson, A.; Stillerman, J.; Stevens, R.; Thompson, M.R.; Wallace, G.

    2004-01-01

    The US National Fusion Collaboratory Project is developing a persistent infrastructure to enable scientific collaboration for all aspects of magnetic fusion research. The project is creating a robust, user-friendly collaborative software environment and making it available to more than 1000 fusion scientists in 40 institutions who perform magnetic fusion research in the United States. In particular, the project is developing and deploying a national Fusion Energy Sciences Grid (FusionGrid) that is a system for secure sharing of computation, visualization, and data resources over the Internet. The FusionGrid goal is to allow scientists at remote sites to fully participate in experimental and computational activities as if they were working at a common site thereby creating a virtual organization of the US fusion community. The project is funded by the USDOE Office of Science, Scientific Discovery through Advanced Computing (SciDAC) Program and unites fusion and computer science researchers to directly address these challenges

  18. Evaluation of EML4-ALK Fusion Proteins in Non–Small Cell Lung Cancer Using Small Molecule Inhibitors

    Directory of Open Access Journals (Sweden)

    Yongjun Li

    2011-01-01

    Full Text Available The echinoderm microtubule–associated protein-like 4–anaplastic lymphoma kinase (EML4-ALK fusion gene resulting from an inversion within chromosome 2p occurs in approximately 5% of non–small cell lung cancer and is mu-tually exclusive with Ras and EGFR mutations. In this study, we have used a potent and selective ALK small molecule inhibitor, NPV-TAE684, to assess the oncogenic role of EML4-ALK in non–small cell lung cancer (NSCLC. We show here that TAE684 inhibits proliferation and induces cell cycle arrest, apoptosis, and tumor regression in two NSCLC models that harbor EML4-ALK fusions. TAE684 inhibits EML4-ALK activation and its downstream signaling including ERK, AKT, and STAT3. We used microarray analysis to carry out targeted pathway studies of gene expression changes in H2228 NSCLC xenograft model after TAE684 treatment and identified a gene signature of EML4-ALK inhibition. The gene signature represents 1210 known human genes, and the top biologic processes represented by these genes are cell cycle, DNA synthesis, cell proliferation, and cell death. We also compared the effect of TAE684 with PF2341066, a c-Met and ALK small molecule inhibitor currently in clinical trial in cancers harboring ALK fusions, and demonstrated that TAE684 is a much more potent inhibitor of EML4-ALK. Our data demonstrate that EML4-ALK plays an important role in the pathogenesis of a subset of NSCLC and provides insight into the mech-anism of EML4-ALK inhibition by a small molecule inhibitor.

  19. Fusion fuel and renewables

    International Nuclear Information System (INIS)

    Entler, Slavomir

    2015-01-01

    It is shown that fusion fuel meets all aspects applied when defining renewables. A table of definitions of renewables is presented. The sections of the paper are as follows: An industrial renewable source; Nuclear fusion; Current situation in research; Definitions of renewable sources; Energy concept of nuclear fusion; Fusion fuel; Natural energy flow; Environmental impacts; Fusion fuel assessment; Sustainable power; and Energy mix from renewables. (P.A.)

  20. Towards nuclear fusion reactors

    International Nuclear Information System (INIS)

    1993-11-01

    The results of nuclear fusion researches in JAERI are summarized. In this report, following themes are collected: the concept of fusion reactor (including ITER), fusion reactor safety, plasma confinement, fusion reactor equipment, and so on. Includes glossary. (J.P.N.)

  1. The relationship between religion and thought-action fusion: use of an in vivo paradigm.

    Science.gov (United States)

    Berman, Noah C; Abramowitz, Jonathan S; Pardue, Caleb M; Wheaton, Michael G

    2010-07-01

    Research has demonstrated that higher levels of religiosity are positively correlated with thought-action fusion (TAF), a set of cognitive biases found to be associated with obsessive-compulsive symptoms. However, previous studies have exclusively relied on a nomothetic approach to measuring TAF using a single self-report instrument, the thought-action fusion scale. The current study examined the relationship between religiosity and TAF using an in vivo behaviorally-based assessment in which participants thought about and wrote down thoughts of negative events involving loved ones. Forty-three highly religious Protestant Christians were compared to 30 Atheists/Agnostics on their in vivo ratings of anxiety, estimates of likelihood, and moral wrongness related to the negative thoughts. Results indicated that compared to the non-religious participants, those who were highly religious believed that writing and thinking about the negative events was more morally wrong and increased the likelihood of the event. Results are discussed in terms of the potential relationship between certain religious teachings and TAF-related beliefs about the importance, significance, and influence of thoughts. Copyright 2010 Elsevier Ltd. All rights reserved.

  2. Junction region of EWS-FLI1 fusion protein has a dominant negative effect in Ewing’s Sarcoma in vitro

    International Nuclear Information System (INIS)

    Jully, Babu; Vijayalakshmi, Ramshankar; Gopal, Gopisetty; Sabitha, Kesavan; Rajkumar, Thangarajan

    2012-01-01

    Ewing’s sarcoma is a malignancy characterized by a specific 11:22 chromosomal translocation which generates a novel EWS-FLI1 fusion protein functioning as an aberrant transcription factor. In the present study, we have further characterized the junction region of the EWS-FLI1 fusion protein. In-silico model of EWS-FLI1 fusion protein was analysed for ligand binding sites, and a putative region (amino acid (aa) 251–343 of the type 1 fusion protein) in the vicinity of the fusion junction was cloned and expressed using bacterial expression. The recombinant protein was characterized by Circular Dichroism (CD). We then expressed aa 251–280 ectopically in Ewing’s sarcoma cell-line and its effect on cell proliferation, tumorigenicity and expression of EWS-FLI1 target genes were analysed. Our modelling analysis indicated that Junction region (aa 251–343) encompasses potential ligand biding sites in the EWS-FLI1 protein and when expressed in bacteria was present as soluble form. Ectopically expressing this region in Ewing’s sarcoma cells inhibited tumorigenicity, and EWS-FLI1 target genes indicating a dominant negative biological effect. Junction region can be exploited further as target for drug development in future to specifically target EWS-FLI1 in Ewing’s Sarcoma

  3. Nuclear fusion: Pursuing the Soft [Symposium on fusion technology] option

    International Nuclear Information System (INIS)

    Kenward, M.

    1991-01-01

    Fusion research has come a long way since the fusion community held the first Symposium on fusion technology (Soft) in Britain 30 years ago. Some of the recent achievements of the Jet project are reported from this year's symposium, the 16th in the series, held in London at the beginning of September. (author)

  4. Development of novel prime-boost strategies based on a tri-gene fusion recombinant L. tarentolae vaccine against experimental murine visceral leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Noushin Saljoughian

    Full Text Available Visceral leishmaniasis (VL is a vector-borne disease affecting humans and domestic animals that constitutes a serious public health problem in many countries. Although many antigens have been examined so far as protein- or DNA-based vaccines, none of them conferred complete long-term protection. The use of the lizard non-pathogenic to humans Leishmania (L. tarentolae species as a live vaccine vector to deliver specific Leishmania antigens is a recent approach that needs to be explored further. In this study, we evaluated the effectiveness of live vaccination in protecting BALB/c mice against L. infantum infection using prime-boost regimens, namely Live/Live and DNA/Live. As a live vaccine, we used recombinant L. tarentolae expressing the L. donovani A2 antigen along with cysteine proteinases (CPA and CPB without its unusual C-terminal extension (CPB(-CTE as a tri-fusion gene. For DNA priming, the tri-fusion gene was encoded in pcDNA formulated with cationic solid lipid nanoparticles (cSLN acting as an adjuvant. At different time points post-challenge, parasite burden and histopathological changes as well as humoral and cellular immune responses were assessed. Our results showed that immunization with both prime-boost A2-CPA-CPB(-CTE-recombinant L. tarentolae protects BALB/c mice against L. infantum challenge. This protective immunity is associated with a Th1-type immune response due to high levels of IFN-γ production prior and after challenge and with lower levels of IL-10 production after challenge, leading to a significantly higher IFN-γ/IL-10 ratio compared to the control groups. Moreover, this immunization elicited high IgG1 and IgG2a humoral immune responses. Protection in mice was also correlated with a high nitric oxide production and low parasite burden. Altogether, these results indicate the promise of the A2-CPA-CPB(-CTE-recombinant L. tarentolae as a safe live vaccine candidate against VL.

  5. Feature-Fusion Guidelines for Image-Based Multi-Modal Biometric Fusion

    Directory of Open Access Journals (Sweden)

    Dane Brown

    2017-07-01

    Full Text Available The feature level, unlike the match score level, lacks multi-modal fusion guidelines. This work demonstrates a new approach for improved image-based biometric feature-fusion. The approach extracts and combines the face, fingerprint and palmprint at the feature level for improved human identification accuracy. Feature-fusion guidelines, proposed in our recent work, are extended by adding a new face segmentation method and the support vector machine classifier. The new face segmentation method improves the face identification equal error rate (EER by 10%. The support vector machine classifier combined with the new feature selection approach, proposed in our recent work, outperforms other classifiers when using a single training sample. Feature-fusion guidelines take the form of strengths and weaknesses as observed in the applied feature processing modules during preliminary experiments. The guidelines are used to implement an effective biometric fusion system at the feature level, using a novel feature-fusion methodology, reducing the EER of two groups of three datasets namely: SDUMLA face, SDUMLA fingerprint and IITD palmprint; MUCT Face, MCYT Fingerprint and CASIA Palmprint.

  6. The fusion-fission hybrid

    International Nuclear Information System (INIS)

    Teller, E.

    1985-01-01

    As the history of the development of fusion energy shows, a sustained controlled fusion reaction is much more difficult to produce than rapid uncontrolled release of fusion energy. Currently, the ''magnetic bottle'' technique shows sufficient progress that it might applied for the commercial fuel production of /sup 233/U, suitable for use in fission reactors, by developing a fusion-fission hybrid. Such a device would consist of a fusion chamber core surrounded by a region containing cladded uranium pellets cooled by helium, with lithium salts also present to produce tritium to refuel the fusion process. Successful development of this hybrid might be possible within 10 y, and would provide both experience and funds for further development of controlled fusion energy

  7. Fusion power

    International Nuclear Information System (INIS)

    Hancox, R.

    1981-01-01

    The principles of fusion power, and its advantages and disadvantages, are outlined. Present research programmes and future plans directed towards the development of a fusion power reactor, are summarized. (U.K.)

  8. Distributed Pedestrian Detection Alerts Based on Data Fusion with Accurate Localization

    Directory of Open Access Journals (Sweden)

    Arturo de la Escalera

    2013-09-01

    Full Text Available Among Advanced Driver Assistance Systems (ADAS pedestrian detection is a common issue due to the vulnerability of pedestrians in the event of accidents. In the present work, a novel approach for pedestrian detection based on data fusion is presented. Data fusion helps to overcome the limitations inherent to each detection system (computer vision and laser scanner and provides accurate and trustable tracking of any pedestrian movement. The application is complemented by an efficient communication protocol, able to alert vehicles in the surroundings by a fast and reliable communication. The combination of a powerful location, based on a GPS with inertial measurement, and accurate obstacle localization based on data fusion has allowed locating the detected pedestrians with high accuracy. Tests proved the viability of the detection system and the efficiency of the communication, even at long distances. By the use of the alert communication, dangerous situations such as occlusions or misdetections can be avoided.

  9. Distributed pedestrian detection alerts based on data fusion with accurate localization.

    Science.gov (United States)

    García, Fernando; Jiménez, Felipe; Anaya, José Javier; Armingol, José María; Naranjo, José Eugenio; de la Escalera, Arturo

    2013-09-04

    Among Advanced Driver Assistance Systems (ADAS) pedestrian detection is a common issue due to the vulnerability of pedestrians in the event of accidents. In the present work, a novel approach for pedestrian detection based on data fusion is presented. Data fusion helps to overcome the limitations inherent to each detection system (computer vision and laser scanner) and provides accurate and trustable tracking of any pedestrian movement. The application is complemented by an efficient communication protocol, able to alert vehicles in the surroundings by a fast and reliable communication. The combination of a powerful location, based on a GPS with inertial measurement, and accurate obstacle localization based on data fusion has allowed locating the detected pedestrians with high accuracy. Tests proved the viability of the detection system and the efficiency of the communication, even at long distances. By the use of the alert communication, dangerous situations such as occlusions or misdetections can be avoided.

  10. TALE-PvuII Fusion Proteins – Novel Tools for Gene Targeting

    Science.gov (United States)

    Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity. PMID:24349308

  11. Lipid droplets fusion in adipocyte differentiated 3T3-L1 cells: A Monte Carlo simulation

    Energy Technology Data Exchange (ETDEWEB)

    Boschi, Federico, E-mail: federico.boschi@univr.it [Department of Neurological and Movement Sciences, University of Verona, Strada Le Grazie 8, 37134 Verona (Italy); Department of Computer Science, University of Verona, Strada Le Grazie 15, 37134 Verona (Italy); Rizzatti, Vanni; Zamboni, Mauro [Department of Medicine, Geriatric Section, University of Verona, Piazzale Stefani 1, 37126 Verona (Italy); Sbarbati, Andrea [Department of Neurological and Movement Sciences, University of Verona, Strada Le Grazie 8, 37134 Verona (Italy)

    2014-02-15

    Several human worldwide diseases like obesity, type 2 diabetes, hepatic steatosis, atherosclerosis and other metabolic pathologies are related to the excessive accumulation of lipids in cells. Lipids accumulate in spherical cellular inclusions called lipid droplets (LDs) whose sizes range from fraction to one hundred of micrometers in adipocytes. It has been suggested that LDs can grow in size due to a fusion process by which a larger LD is obtained with spherical shape and volume equal to the sum of the progenitors’ ones. In this study, the size distribution of two populations of LDs was analyzed in immature and mature (5-days differentiated) 3T3-L1 adipocytes (first and second populations, respectively) after Oil Red O staining. A Monte Carlo simulation of interaction between LDs has been developed in order to quantify the size distribution and the number of fusion events needed to obtain the distribution of the second population size starting from the first one. Four models are presented here based on different kinds of interaction: a surface weighted interaction (R2 Model), a volume weighted interaction (R3 Model), a random interaction (Random model) and an interaction related to the place where the LDs are born (Nearest Model). The last two models mimic quite well the behavior found in the experimental data. This work represents a first step in developing numerical simulations of the LDs growth process. Due to the complex phenomena involving LDs (absorption, growth through additional neutral lipid deposition in existing droplets, de novo formation and catabolism) the study focuses on the fusion process. The results suggest that, to obtain the observed size distribution, a number of fusion events comparable with the number of LDs themselves is needed. Moreover the MC approach results a powerful tool for investigating the LDs growth process. Highlights: • We evaluated the role of the fusion process in the synthesis of the lipid droplets. • We compared the

  12. Lipid droplets fusion in adipocyte differentiated 3T3-L1 cells: A Monte Carlo simulation

    International Nuclear Information System (INIS)

    Boschi, Federico; Rizzatti, Vanni; Zamboni, Mauro; Sbarbati, Andrea

    2014-01-01

    Several human worldwide diseases like obesity, type 2 diabetes, hepatic steatosis, atherosclerosis and other metabolic pathologies are related to the excessive accumulation of lipids in cells. Lipids accumulate in spherical cellular inclusions called lipid droplets (LDs) whose sizes range from fraction to one hundred of micrometers in adipocytes. It has been suggested that LDs can grow in size due to a fusion process by which a larger LD is obtained with spherical shape and volume equal to the sum of the progenitors’ ones. In this study, the size distribution of two populations of LDs was analyzed in immature and mature (5-days differentiated) 3T3-L1 adipocytes (first and second populations, respectively) after Oil Red O staining. A Monte Carlo simulation of interaction between LDs has been developed in order to quantify the size distribution and the number of fusion events needed to obtain the distribution of the second population size starting from the first one. Four models are presented here based on different kinds of interaction: a surface weighted interaction (R2 Model), a volume weighted interaction (R3 Model), a random interaction (Random model) and an interaction related to the place where the LDs are born (Nearest Model). The last two models mimic quite well the behavior found in the experimental data. This work represents a first step in developing numerical simulations of the LDs growth process. Due to the complex phenomena involving LDs (absorption, growth through additional neutral lipid deposition in existing droplets, de novo formation and catabolism) the study focuses on the fusion process. The results suggest that, to obtain the observed size distribution, a number of fusion events comparable with the number of LDs themselves is needed. Moreover the MC approach results a powerful tool for investigating the LDs growth process. Highlights: • We evaluated the role of the fusion process in the synthesis of the lipid droplets. • We compared the

  13. Recycling fusion materials

    International Nuclear Information System (INIS)

    Ooms, L.

    2005-01-01

    The inherent safety and environmental advantages of fusion power in comparison with other energy sources play an important role in the public acceptance. No waste burden for future generations is therefore one of the main arguments to decide for fusion power. The waste issue has thus been studied in several documents and the final conclusion of which it is stated that there is no permanent disposal waste needed if recycling is applied. But recycling of fusion reactor materials is far to be obvious regarding mostly the very high specific activity of the materials to be handled, the types of materials and the presence of tritium. The main objective of research performed by SCK-CEN is to study the possible ways of recycling fusion materials and analyse the challenges of the materials management from fusion reactors, based on current practices used in fission reactors and the requirements for the manufacture of fusion equipment

  14. Properties of the ion-ion hybrid resonator in fusion plasmas

    International Nuclear Information System (INIS)

    Morales, George J.

    2015-01-01

    The project developed theoretical and numerical descriptions of the properties of ion-ion hybrid Alfvn resonators that are expected to arise in the operation of a fusion reactor. The methodology and theoretical concepts were successfully compared to observations made in basic experiments in the LAPD device at UCLA. An assessment was made of the excitation of resonator modes by energetic alpha particles for burning plasma conditions expected in the ITER device. The broader impacts included the generation of basic insight useful to magnetic fusion and space science researchers, defining new avenues for exploration in basic laboratory experiments, establishing broader contacts between experimentalists and theoreticians, completion of a Ph.D. dissertation, and promotion of interest in science through community outreach events and classroom instruction.

  15. Nuclear Fusion prize laudation Nuclear Fusion prize laudation

    Science.gov (United States)

    Burkart, W.

    2011-01-01

    Clean energy in abundance will be of critical importance to the pursuit of world peace and development. As part of the IAEA's activities to facilitate the dissemination of fusion related science and technology, the journal Nuclear Fusion is intended to contribute to the realization of such energy from fusion. In 2010, we celebrated the 50th anniversary of the IAEA journal. The excellence of research published in the journal is attested to by its high citation index. The IAEA recognizes excellence by means of an annual prize awarded to the authors of papers judged to have made the greatest impact. On the occasion of the 2010 IAEA Fusion Energy Conference in Daejeon, Republic of Korea at the welcome dinner hosted by the city of Daejeon, we celebrated the achievements of the 2009 and 2010 Nuclear Fusion prize winners. Steve Sabbagh, from the Department of Applied Physics and Applied Mathematics, Columbia University, New York is the winner of the 2009 award for his paper: 'Resistive wall stabilized operation in rotating high beta NSTX plasmas' [1]. This is a landmark paper which reports record parameters of beta in a large spherical torus plasma and presents a thorough investigation of the physics of resistive wall mode (RWM) instability. The paper makes a significant contribution to the critical topic of RWM stabilization. John Rice, from the Plasma Science and Fusion Center, MIT, Cambridge is the winner of the 2010 award for his paper: 'Inter-machine comparison of intrinsic toroidal rotation in tokamaks' [2]. The 2010 award is for a seminal paper that analyzes results across a range of machines in order to develop a universal scaling that can be used to predict intrinsic rotation. This paper has already triggered a wealth of experimental and theoretical work. I congratulate both authors and their colleagues on these exceptional papers. W. Burkart Deputy Director General Department of Nuclear Sciences and Applications International Atomic Energy Agency, Vienna

  16. Controlled fusion and plasma physics

    International Nuclear Information System (INIS)

    1994-07-01

    40 papers are presented at this 21. conference on controlled fusion and plasma physics (JET). Titles are: effects of sawtooth crashes on beams ions and fusion product tritons; beta limits in H-modes and VH-modes; impurity induced neutralization of MeV energy protons in JET plasmas; lost α particle diagnostic for high-yield D-T fusion plasmas; 15-MeV proton emission from ICRF-heated plasmas; pulse compression radar reflectometry for density measurements; gamma-ray emission profile measurements during ICRH discharges; the new JET phase ICRH array; simulation of triton burn-up; parametric dependencies of JET electron temperature profiles; detached divertor plasmas; excitation of global Alfven Eigenmodes by RF heating; mechanisms of toroidal rotation; effect of shear in the radial electric field on confinement; plasma transport properties at the L-H transition; numerical study of plasma detachment conditions in JET divertor plasmas; the SOL width and the MHD interchange instability; non linear magnetic reconnection in low collisionality plasmas; topology and slowing down of high energy ion orbits; sawtooth crashes at high beta; fusion performances and alpha heating in future JET D-T plasmas; a stable route to high-beta plasmas with non-monotonic q-profiles; theory of propagation of changes to confinement; spatial distribution of gamma emissivity and fast ions during ICRF heating; multi-camera soft X-ray diagnostic; radiation phenomena and particle fluxes in the X-event; local measurement of transport parameters for laser injected trace impurities; impurity transport of high performance discharges; negative snakes and negative shear; neural-network charge exchange analysis; ion temperature anisotropy in helium neutral beam fuelling; impurity line emission due to thermal charge exchange in edge plasmas; control of convection by fuelling and pumping; VH mode accessibility and global H-mode properties; ion cyclotron emission by spontaneous emission; LHCD/ICRH synergy

  17. Physiological levels of diacylglycerols in phospholipid membranes induce membrane fusion and stabilize inverted phases

    International Nuclear Information System (INIS)

    Siegel, D.P.; Banschbach, J.; Alford, D.; Ellens, H.; Lis, L.J.; Quinn, P.J.; Yeagle, P.L.; Bentz, J.

    1989-01-01

    In a previous paper, it was shown that liposome fusion rates are substantially enhanced under the same conditions which induce isotropic 31 P NMR resonances in multilamellar dispersions of the same lipid. Both of these phenomena occur within the same temperature interval, ΔT I , below the L α /H II phase transition temperature, T H . T H and ΔT I can be extremely sensitive to the lipid composition. The present work shows that 2 mol % of diacylglycerols like those produced by the phosphatidylinositol cycle in vivo can lower T H , ΔT I , and the temperature for fast membrane fusion by 15-20 degree C. N-Monomethylated dioleoylphosphatidylethanolamine is used as a model system. These results show that physiological levels of diacylglycerols can substantially increase the susceptibility of phospholipid membranes to fusion. This suggests that, in addition to their role in protein kinase C activation, diacylglycerols could play a more direct role in the fusion event during stimulus-exocytosis coupling in vivo

  18. Demountable toroidal fusion core facility for physics optimization and fusion engineering

    International Nuclear Information System (INIS)

    Bogart, S.L.; Wagner, C.E.; Krall, N.A.; Dalessandro, J.A.; Weggel, C.F.; Lund, K.O.; Sedehi, S.

    1986-01-01

    Following a successful compact ignition tokamak (CIT) experiment, a fusion facility will be required for physics optimization (POF) and fusion engineering research (FERF). The POF will address issues such as high-beta operation, current drive, impurity control, and will test geometric and configurational variations such as the spherical torus or the reversed-field pinch (RFP). The FERF will be designed to accumulate rapidly a large neutron dose in prototypical fusion subsystems exposed to radiation. Both facilities will require low-cost replacement cores and rapid replacement times. The Demountable Toroidal Fusion Core (DTFC) facility is designed to fulfill these requirements. It would be a cost-effective stepping stone between the CIT and a demonstration fusion reactor

  19. Some fusion perspectives

    International Nuclear Information System (INIS)

    McNally, J.R. Jr.

    1977-01-01

    Some of the concepts of nuclear fusion reactions, advanced fusion fuels, environmental impacts, etc., are explored using the following general outline: I. Principles of Fusion (Nuclear Fuels and Reactions, Lawson Condition, n tau vs T, Nuclear Burn Characteristics); II. Magnetic Mirror Possibilities (the Ion Layer and Electron Layer, Exponential Build-up at MeV energies, Lorentz trapping at GeV energies); III. Pellet Fuel Fusion Prospects (Advanced Pellet Fuel Fusion Prospects, Burn Characteristics and Applications, Excitation-heating Prospects for Runaway Ion Temperatures). Inasmuch as the outline is very skeletal, a significant research and development effort may be in order to evaluate these prospects in more detail and hopefully ''harness the H-bomb'' for peaceful applications, the author concludes. 28 references

  20. Phosphomimetic mutation of cysteine string protein-α increases the rate of regulated exocytosis by modulating fusion pore dynamics in PC12 cells.

    Directory of Open Access Journals (Sweden)

    Ning Chiang

    Full Text Available BACKGROUND: Cysteine string protein-α (CSPα is a chaperone to ensure protein folding. Loss of CSPα function associates with many neurological diseases. However, its function in modulating regulated exocytosis remains elusive. Although cspα-knockouts exhibit impaired synaptic transmission, overexpression of CSPα in neuroendocrine cells inhibits secretion. These seemingly conflicting results lead to a hypothesis that CSPα may undergo a modification that switches its function in regulating neurotransmitter and hormone secretion. Previous studies implied that CSPα undergoes phosphorylation at Ser10 that may influence exocytosis by altering fusion pore dynamics. However, direct evidence is missing up to date. METHODOLOGY/PRINCIPAL FINDINGS: Using amperometry, we investigated how phosphorylation at Ser10 of CSPα (CSPα-Ser10 modulates regulated exocytosis and if this modulation involves regulating a specific kinetic step of fusion pore dynamics. The real-time exocytosis of single vesicles was detected in PC12 cells overexpressing control vector, wild-type CSPα (WT, the CSPα phosphodeficient mutant (S10A, or the CSPα phosphomimetic mutants (S10D and S10E. The shapes of amperometric signals were used to distinguish the full-fusion events (i.e., prespike feet followed by spikes and the kiss-and-run events (i.e., square-shaped flickers. We found that the secretion rate was significantly increased in cells overexpressing S10D or S10E compared to WT or S10A. Further analysis showed that overexpression of S10D or S10E prolonged fusion pore lifetime compared to WT or S10A. The fraction of kiss-and-run events was significantly lower but the frequency of full-fusion events was higher in cells overexpressing S10D or S10E compared to WT or S10A. Advanced kinetic analysis suggests that overexpression of S10D or S10E may stabilize open fusion pores mainly by inhibiting them from closing. CONCLUSIONS/SIGNIFICANCE: CSPα may modulate fusion pore dynamics

  1. Extension of relational event algebra to a general decision making setting

    Energy Technology Data Exchange (ETDEWEB)

    Goodman, I.R.; Kramer, G.F.

    1996-12-31

    Relational Event Algebra (REA) is a new mathematical tool which provides an explicit algebraic reconstruction of events (appropriately designated as relational events) when initially only the formal probability values of such events are given as functions of known contributing event probabilities. In turn, once such relational events are obtained, one can then determine the probability of any finite logical combination, and in particular, various probabilistic distance measures among the events. A basic application of REA is to test hypotheses for the similarity of distinct models attempting to describe the same events such as in data fusion and combination of evidence. This paper considers new motivation for the use of REA, as well as a more general decision-making framework where system performance and redundancy / consistency tradeoffs are considered.

  2. Confinement inertial fusion. Power reactors of nuclear fusion by lasers

    International Nuclear Information System (INIS)

    Velarde, G.; Ahnert, C.; Aragones, J.M.; Leira, G; Martinez-Val, J.M.

    1980-01-01

    The energy crisis and the need of the nuclear fusion energy are analized. The nuclear processes in the laser interation with the ablator material are studied, as well as the thermohydrodinamic processes in the implossion, and the neutronics of the fusion. The fusion reactor components are described and the economic and social impact of its introduction in the future energetic strategies.(author)

  3. Magnetic fusion reactor economics

    International Nuclear Information System (INIS)

    Krakowski, R.A.

    1995-01-01

    An almost primordial trend in the conversion and use of energy is an increased complexity and cost of conversion systems designed to utilize cheaper and more-abundant fuels; this trend is exemplified by the progression fossil fission → fusion. The present projections of the latter indicate that capital costs of the fusion ''burner'' far exceed any commensurate savings associated with the cheapest and most-abundant of fuels. These projections suggest competitive fusion power only if internal costs associate with the use of fossil or fission fuels emerge to make them either uneconomic, unacceptable, or both with respect to expensive fusion systems. This ''implementation-by-default'' plan for fusion is re-examined by identifying in general terms fusion power-plant embodiments that might compete favorably under conditions where internal costs (both economic and environmental) of fossil and/or fission are not as great as is needed to justify the contemporary vision for fusion power. Competitive fusion power in this context will require a significant broadening of an overly focused program to explore the physics and simbiotic technologies leading to more compact, simplified, and efficient plasma-confinement configurations that reside at the heart of an attractive fusion power plant

  4. Industry's role in inertial fusion

    International Nuclear Information System (INIS)

    Glass, A.J.

    1983-01-01

    This paper is an address to the Tenth Symposium on Fusion Engineering. The speaker first addressed the subject of industry's role in inertial fusion three years earlier in 1980, outlining programs that included participation in the Shiva construction project, and the industrial participants' program set up in the laser fusion program to bring industrial scientists and engineers into the laboratory to work on laser fusion. The speaker is now the president of KMS Fusion, Inc., the primary industrial participant in the inertial fusion program. The outlook for fusion energy and the attitude of the federal government toward the fusion program is discussed

  5. Spatiotemporal dynamics of membrane remodeling and fusion proteins during endocytic transport.

    Science.gov (United States)

    Arlt, Henning; Auffarth, Kathrin; Kurre, Rainer; Lisse, Dominik; Piehler, Jacob; Ungermann, Christian

    2015-04-01

    Organelles of the endolysosomal system undergo multiple fission and fusion events to combine sorting of selected proteins to the vacuole with endosomal recycling. This sorting requires a consecutive remodeling of the organelle surface in the course of endosomal maturation. Here we dissect the remodeling and fusion machinery on endosomes during the process of endocytosis. We traced selected GFP-tagged endosomal proteins relative to exogenously added fluorescently labeled α-factor on its way from the plasma membrane to the vacuole. Our data reveal that the machinery of endosomal fusion and ESCRT proteins has similar temporal localization on endosomes, whereas they precede the retromer cargo recognition complex. Neither deletion of retromer nor the fusion machinery with the vacuole affects this maturation process, although the kinetics seems to be delayed due to ESCRT deletion. Of importance, in strains lacking the active Rab7-like Ypt7 or the vacuolar SNARE fusion machinery, α-factor still proceeds to late endosomes with the same kinetics. This indicates that endosomal maturation is mainly controlled by the early endosomal fusion and remodeling machinery but not the downstream Rab Ypt7 or the SNARE machinery. Our data thus provide important further understanding of endosomal biogenesis in the context of cargo sorting. © 2015 Arlt et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  6. Review of fusion synfuels

    International Nuclear Information System (INIS)

    Fillo, J.A.

    1980-01-01

    Thermonuclear fusion offers an inexhaustible source of energy for the production of hydrogen from water. Depending on design, electric generation efficiencies of approx. 40 to 60% and hydrogen production efficiencies by high-temperature electrolysis of approx. 50 to 65% are projected for fusion reactors using high-temperatures blankets. Fusion/coal symbiotic systems appear economically promising for the first generation of commercial fusion synfuels plants. Coal production requirements and the environmental effects of large-scale coal usage would be greatly reduced by a fusion/coal system. In the long term, there could be a gradual transition to an inexhaustible energy system based solely on fusion

  7. Fusion Canada issue 28

    International Nuclear Information System (INIS)

    1995-06-01

    A short bulletin from the National Fusion Program highlighting in this issue the Canada - US fusion meeting in Montreal, fusion breeder work in Chile, new management at CFFTP, fast electrons in tokamaks: new data from TdeV, a program review of CCFM and Velikhov to address Montreal fusion meeting. 1 fig

  8. Structural and functional studies of FKHR-PAX3, a reciprocal fusion gene of the t(2;13 chromosomal translocation in alveolar rhabdomyosarcoma.

    Directory of Open Access Journals (Sweden)

    Qiande Hu

    Full Text Available Alveolar rhabdomyosarcoma (ARMS is an aggressive pediatric cancer of skeletal muscle. More than 70% of ARMS tumors carry balanced t(2;13 chromosomal translocation that leads to the production of two novel fusion genes, PAX3-FKHR and FKHR-PAX3. While the PAX3-FKHR gene has been intensely studied, the reciprocal FKHR-PAX3 gene has rarely been described. We report here the cloning and functional characterization of the FKHR-PAX3 gene as the first step towards a better understanding of its potential impact on ARMS biology. From RH30 ARMS cells, we detected and isolated three versions of FKHR-PAX3 cDNAs whose C-terminal sequences corresponded to PAX3c, PAX3d, and PAX3e isoforms. Unlike the nuclear-specific localization of PAX3-FKHR, the reciprocal FKHR-PAX3 proteins stayed predominantly in the cytoplasm. FKHR-PAX3 potently inhibited myogenesis in both non-transformed myoblast cells and ARMS cells. We showed that FKHR-PAX3 was not a classic oncogene but could act as a facilitator in oncogenic pathways by stabilizing PAX3-FKHR expression, enhancing cell proliferation, clonogenicity, anchorage-independent growth, and matrix adhesion in vitro, and accelerating the onset of tumor formation in xenograft mouse model in vivo. In addition to these pro-oncogenic behaviors, FKHR-PAX3 also negatively affected cell migration and invasion in vitro and lung metastasis in vivo. Taken together, these functional characteristics suggested that FKHR-PAX3 might have a critical role in the early stage of ARMS development.

  9. The transcription factor Ste12 mediates the regulatory role of the Tmk1 MAP kinase in mycoparasitism and vegetative hyphal fusion in the filamentous fungus Trichoderma atroviride.

    Directory of Open Access Journals (Sweden)

    Sabine Gruber

    Full Text Available Mycoparasitic species of the fungal genus Trichoderma are potent antagonists able to combat plant pathogenic fungi by direct parasitism. An essential step in this mycoparasitic fungus-fungus interaction is the detection of the fungal host followed by activation of molecular weapons in the mycoparasite by host-derived signals. The Trichoderma atroviride MAP kinase Tmk1, a homolog of yeast Fus3/Kss1, plays an essential role in regulating the mycoparasitic host attack, aerial hyphae formation and conidiation. However, the transcription factors acting downstream of Tmk1 are hitherto unknown. Here we analyzed the functions of the T. atroviride Ste12 transcription factor whose orthologue in yeast is targeted by the Fus3 and Kss1 MAP kinases. Deletion of the ste12 gene in T. atroviride not only resulted in reduced mycoparasitic overgrowth and lysis of host fungi but also led to loss of hyphal avoidance in the colony periphery and a severe reduction in conidial anastomosis tube formation and vegetative hyphal fusion events. The transcription of several orthologues of Neurospora crassa hyphal fusion genes was reduced upon ste12 deletion; however, the Δste12 mutant showed enhanced expression of mycoparasitism-relevant chitinolytic and proteolytic enzymes and of the cell wall integrity MAP kinase Tmk2. Based on the comparative analyses of Δste12 and Δtmk1 mutants, an essential role of the Ste12 transcriptional regulator in mediating outcomes of the Tmk1 MAPK pathway such as regulation of the mycoparasitic activity, hyphal fusion and carbon source-dependent vegetative growth is suggested. Aerial hyphae formation and conidiation, in contrast, were found to be independent of Ste12.

  10. Unexpected heterogeneity of BCR-ABL fusion mRNA detected by polymerase chain reaction in Philadelphia chromosome-positive acute lymphoblastic leukemia

    International Nuclear Information System (INIS)

    Hooberman, A.L.; Carrino, J.J.; Leibowitz, D.; Rowley, J.D.; Le Beau, M.M.; Arlin, Z.A.; Westbrook, C.A.

    1989-01-01

    The Philadelphia (Ph 1 ) chromosome results in a fusion of portions of the BCR gene from chromosome 22 and the ABL gene from chromosome 9, producing a chimeric BCR-ABL mRNA and protein. In lymphoblastic leukemias, there are two molecular subtypes of the Ph 1 chromosome, one with a rearrangement of the breakpoint cluster region (bcr) of the BCR gene, producing the same 8.5-kilobase BCR-ABL fusion mRNA seen in chronic myelogenous leukemia (CML), and the other, without a bcr rearrangement, producing a 7.0-kilobase BCR-ABL fusion mRNA that is seen only in acute lymphoblastic leukemia (ALL). The authors studied the molecular subtype of the Ph 1 chromosome in 11 cases of Ph 1 -positive ALL, including 2 with a previous diagnosis of CML, using a sensitive method to analyze the mRNA species based on the polymerase chain reaction (PCR). They observed unexpected heterogeneity in BCR-ABL mRNA in this population. They conclude that the PCR gives additional information about the Ph 1 chromosome gene products that cannot be obtained by genomic analysis, but that it cannot be used as the sole means of detection of this chromosomal abnormality in ALL because of the high incidence of false negative results

  11. Economics of fusion research

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    1977-10-15

    This report provides the results of a study of methods of economic analysis applied to the evaluation of fusion research. The study recognizes that a hierarchy of economic analyses of research programs exists: standard benefit-cost analysis, expected value of R and D information, and expected utility analysis. It is shown that standard benefit-cost analysis, as commonly applied to research programs, is inadequate for the evaluation of a high technology research effort such as fusion research. A methodology for performing an expected value analysis is developed and demonstrated and an overview of an approach to perform an expected utility analysis of fusion research is presented. In addition, a potential benefit of fusion research, not previously identified, is discussed and rough estimates of its magnitude are presented. This benefit deals with the effect of a fusion research program on optimal fossil fuel consumption patterns. The results of this study indicate that it is both appropriate and possible to perform an expected value analysis of fusion research in order to assess the economics of a fusion research program. The results indicate further that the major area of benefits of fusion research is likely due to the impact of a fusion research program on optimal fossil fuel consumption patterns and it is recommended that this benefit be included in future assessments of fusion research economics.

  12. Economics of fusion research

    International Nuclear Information System (INIS)

    1977-01-01

    This report provides the results of a study of methods of economic analysis applied to the evaluation of fusion research. The study recognizes that a hierarchy of economic analyses of research programs exists: standard benefit-cost analysis, expected value of R and D information, and expected utility analysis. It is shown that standard benefit-cost analysis, as commonly applied to research programs, is inadequate for the evaluation of a high technology research effort such as fusion research. A methodology for performing an expected value analysis is developed and demonstrated and an overview of an approach to perform an expected utility analysis of fusion research is presented. In addition, a potential benefit of fusion research, not previously identified, is discussed and rough estimates of its magnitude are presented. This benefit deals with the effect of a fusion research program on optimal fossil fuel consumption patterns. The results of this study indicate that it is both appropriate and possible to perform an expected value analysis of fusion research in order to assess the economics of a fusion research program. The results indicate further that the major area of benefits of fusion research is likely due to the impact of a fusion research program on optimal fossil fuel consumption patterns and it is recommended that this benefit be included in future assessments of fusion research economics

  13. Inertial fusion energy

    International Nuclear Information System (INIS)

    Decroisette, M.; Andre, M.; Bayer, C.; Juraszek, D.; Le Garrec, B.; Deutsch, C.; Migus, A.

    2005-01-01

    We first recall the scientific basis of inertial fusion and then describe a generic fusion reactor with the different components: the driver, the fusion chamber, the material treatment unit, the target factory and the turbines. We analyse the options proposed at the present time for the driver and for target irradiation scheme giving the state of art for each approach. We conclude by the presentation of LMJ (laser Megajoule) and NIF (national ignition facility) projects. These facilities aim to demonstrate the feasibility of laboratory DT ignition, first step toward Inertial Fusion Energy. (authors)

  14. Identification of new alternative splice events in the TCIRG1 gene in different human tissues

    International Nuclear Information System (INIS)

    Smirnova, Anna S.; Morgun, Andrey; Shulzhenko, Natalia; Silva, Ismael D.C.G.; Gerbase-DeLima, Maria

    2005-01-01

    Two transcript variants (TV) of the T cell immune regulator gene 1 (TCIRG1) have already been characterized. TV1 encodes a subunit of the osteoclast vacuolar proton pump and TV2 encodes a T cell inhibitory receptor. Based on the search in dbEST, we validated by RT-PCR six new alternative splice events in TCIRG1 in most of the 28 human tissues studied. In addition, we observed that transcripts using the TV1 transcription start site and two splice forms previously described in a patient with infantile malignant osteopetrosis are also expressed in various tissues of healthy individuals. Studies of these nine splice forms in cytoplasmic RNA of peripheral blood mononuclear cells showed that at least six of them could be efficiently exported from the nucleus. Since various products with nearly ubiquitous tissue distribution are generated from TCIRG1, this gene may be involved in other processes besides immune response and bone resorption

  15. Fusion in the energy system

    DEFF Research Database (Denmark)

    Fusion energy is the fundamental energy source of the Universe, as the energy of the Sun and the stars are produced by fusion of e.g. hydrogen to helium. Fusion energy research is a strongly international endeavor aiming at realizing fusion energy production in power plants on Earth. Reaching...... of integration into the future electricity system and socio-economic studies of fusion energy will be presented, referring to the programme of Socio-Economic Research on Fusion (SERF) under the European Fusion Energy Agreement (EFDA)....

  16. Nuclear Fusion Award 2009 speech Nuclear Fusion Award 2009 speech

    Science.gov (United States)

    Sabbagh, Steven Anthony

    2011-01-01

    This is an exceptional moment in my career, and so I want to thank all of my teachers, colleagues and mentors who have made this possible. From my co-authors and myself, many thanks to the International Atomic Energy Agency, IOP Publishing, the Nuclear Fusion journal team, and the selection committee for the great honor of receiving this award. Also gratitude to Kikuchi-sensei, not only for the inventive and visionary creation of this award, but also for being a key mentor dating back to his efforts in producing high neutron output in JT-60U. It was also a great honor to receive the award directly from IAEA Deputy Director General Burkart during the 23rd IAEA Fusion Energy Conference in Daejeon. Receiving the award at this venue is particularly exciting as Daejeon is home to the new, next-generation KSTAR tokamak device that will lead key magnetic fusion research areas going forward. I would also like to thank the mayor of Daejeon, Dr Yum Hong-Chul, and all of the meeting organizers for giving us all a truly spectacular and singular welcoming event during which the award was presented. The research leading to the award would not have been possible without the support of the US Department of Energy, and I thank the Department for the continued funding of this research. Special mention must be made to a valuable co-author who is no longer with us, Professor A. Bondeson, who was a significant pioneer in resistive wall mode (RWM) research. I would like to thank my wife, Mary, for her infinite patience and encouragement. Finally, I would like to personally thank all of you that have approached and congratulated me directly. There are no units to measure how important your words have been in this regard. When notified that our paper had been shortlisted for the 2009 Nuclear Fusion Award, my co-authors responded echoing how I felt—honored to be included in such a fine collection of research by colleagues. It was unfathomable—would this paper follow the brilliant work

  17. Membrane fusion and exocytosis.

    Science.gov (United States)

    Jahn, R; Südhof, T C

    1999-01-01

    Membrane fusion involves the merger of two phospholipid bilayers in an aqueous environment. In artificial lipid bilayers, fusion proceeds by means of defined transition states, including hourglass-shaped intermediates in which the proximal leaflets of the fusing membranes are merged whereas the distal leaflets are separate (fusion stalk), followed by the reversible opening of small aqueous fusion pores. Fusion of biological membranes requires the action of specific fusion proteins. Best understood are the viral fusion proteins that are responsible for merging the viral with the host cell membrane during infection. These proteins undergo spontaneous and dramatic conformational changes upon activation. In the case of the paradigmatic fusion proteins of the influenza virus and of the human immunodeficiency virus, an amphiphilic fusion peptide is inserted into the target membrane. The protein then reorients itself, thus forcing the fusing membranes together and inducing lipid mixing. Fusion of intracellular membranes in eukaryotic cells involves several protein families including SNAREs, Rab proteins, and Sec1/Munc-18 related proteins (SM-proteins). SNAREs form a novel superfamily of small and mostly membrane-anchored proteins that share a common motif of about 60 amino acids (SNARE motif). SNAREs reversibly assemble into tightly packed helical bundles, the core complexes. Assembly is thought to pull the fusing membranes closely together, thus inducing fusion. SM-proteins comprise a family of soluble proteins that bind to certain types of SNAREs and prevent the formation of core complexes. Rab proteins are GTPases that undergo highly regulated GTP-GDP cycles. In their GTP form, they interact with specific proteins, the effector proteins. Recent evidence suggests that Rab proteins function in the initial membrane contact connecting the fusing membranes but are not involved in the fusion reaction itself.

  18. Compact fusion reactors

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    Fusion research is currently to a large extent focused on tokamak (ITER) and inertial confinement (NIF) research. In addition to these large international or national efforts there are private companies performing fusion research using much smaller devices than ITER or NIF. The attempt to achieve fusion energy production through relatively small and compact devices compared to tokamaks decreases the costs and building time of the reactors and this has allowed some private companies to enter the field, like EMC2, General Fusion, Helion Energy, Lawrenceville Plasma Physics and Lockheed Martin. Some of these companies are trying to demonstrate net energy production within the next few years. If they are successful their next step is to attempt to commercialize their technology. In this presentation an overview of compact fusion reactor concepts is given.

  19. Security of nuclear materials using fusion multi sensor wavelett

    International Nuclear Information System (INIS)

    Djoko Hari Nugroho

    2010-01-01

    Security of a nuclear material in an installation is determined by how far the installation is to assure that nuclear material remains at a predetermined location. This paper observed a preliminary design on nuclear material tracking system in the installation for decision making support based on multi sensor fusion that is reliable and accurate to ensure that the nuclear material remains inside the control area. Capability on decision making in the Management Information System is represented by an understanding of perception in the third level of abstraction. The second level will be achieved with the support of image analysis and organizing data. The first level of abstraction is constructed by merger between several CCD camera sensors distributed in a building in a data fusion representation. Data fusion is processed based on Wavelett approach. Simulation utilizing Matlab programming shows that Wavelett fuses multi information from sensors as well. Hope that when the nuclear material out of control regions which have been predetermined before, there will arise a warning alarm and a message in the Management Information System display. Thus the nuclear material movement time event can be obtained and tracked as well. (author)

  20. Fusion research activities in China

    International Nuclear Information System (INIS)

    Deng Xiwen

    1998-01-01

    The fusion program in China has been executed in most areas of magnetic confinement fusion for more than 30 years. Basing on the situation of the power supply requirements of China, the fusion program is becoming an important and vital component of the nuclear power program in China. This paper reviews the status of fusion research and next step plans in China. The motivation and goal of the Chinese fusion program is explained. Research and development on tokamak physics and engineering in the southwestern institute of physics (SWIP) and the institute of plasma physics of Academic Sinica (ASIPP) are introduced. A fusion breeder program and a pure fusion reactor design program have been supported by the state science and technology commission (SSTC) and the China national nuclear corporation (CNNC), respectively. Some features and progress of fusion reactor R and D activities are reviewed. Non fusion applications of plasma science are an important part of China fusion research; a brief introduction about this area is given. Finally, an introductional collaboration network on fusion research activities in China is reported. (orig.)

  1. The relationships between stressful life events during childhood and differentiation of self and intergenerational triangulation in adulthood.

    Science.gov (United States)

    Peleg, Ora

    2014-12-01

    This study examined the relationships between stressful life events in childhood and differentiation of self and intergenerational triangulation in adulthood. The sample included 217 students (173 females and 44 males) from a college in northern Israel. Participants completed the Hebrew versions of Life Events Checklist (LEC), Differentiation of Self Inventory-Revised (DSI-R) and intergenerational triangulation (INTRI). The main findings were that levels of stressful life events during childhood and adolescence among both genders were positively correlated with the levels of fusion with others and intergenerational triangulation. The levels of positive life events were negatively related to levels of emotional reactivity, emotional cut-off and intergenerational triangulation. Levels of stressful life events in females were positively correlated with emotional reactivity. Intergenerational triangulation was correlated with emotional reactivity, emotional cut-off, fusion with others and I-position. Findings suggest that families that experience higher levels of stressful life events may be at risk for higher levels of intergenerational triangulation and lower levels of differentiation of self. © 2014 International Union of Psychological Science.

  2. Construction of a fusion gene containing hepatitis B virus L gene ...

    African Journals Online (AJOL)

    The results of SDS-PAGE and Western blot showed that the recombinant protein was induced by methanol and stably expressed in P. pastoris, while it has specific reaction with the serum containing anti-HbsAg or anti-Ag85B. However, the successful construction of a recombinant yeast expression vector containing gene ...

  3. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

    Science.gov (United States)

    Boulila, Moncef

    2010-06-01

    To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

  4. Fusion protein is the main determinant of metapneumovirus host tropism.

    Science.gov (United States)

    de Graaf, Miranda; Schrauwen, Eefje J A; Herfst, Sander; van Amerongen, Geert; Osterhaus, Albert D M E; Fouchier, Ron A M

    2009-06-01

    Human metapneumovirus (HMPV) and avian metapneumovirus subgroup C (AMPV-C) infect humans and birds, respectively. This study confirmed the difference in host range in turkey poults, and analysed the contribution of the individual metapneumovirus genes to host range in an in vitro cell-culture model. Mammalian Vero-118 cells supported replication of both HMPV and AMPV-C in contrast to avian quail fibroblast (QT6) cells in which only AMPV-C replicated to high titres. Inoculation of Vero-118 and QT6 cells with recombinant HMPV in which genes were exchanged with those of AMPV-C revealed that the metapneumovirus fusion (F) protein is the main determinant for host tropism. Chimeric viruses in which polymerase complex proteins were exchanged between HMPV and AMPV-C replicated less efficiently compared with HMPV in QT6 cells. Using mini-genome systems, it was shown that exchanging these polymerase proteins resulted in reduced replication and transcription efficiency in QT6 cells. Examination of infected Vero-118 and QT6 cells revealed that viruses containing the F protein of AMPV-C yielded larger syncytia compared with viruses containing the HMPV F protein. Cell-content mixing assays revealed that the F protein of AMPV-C was more fusogenic compared with the F protein of HMPV, and that the F2 region is responsible for the difference observed between AMPV-C and HMPV F-promoted fusion in QT6 and Vero-118 cells. This study provides insight into the determinants of host tropism and membrane fusion of metapneumoviruses.

  5. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  6. Cold fusion

    International Nuclear Information System (INIS)

    Suh, Suk Yong; Sung, Ki Woong; Kang, Joo Sang; Lee, Jong Jik

    1995-02-01

    So called 'cold fusion phenomena' are not confirmed yet. Excess heat generation is very delicate one. Neutron generation is most reliable results, however, the records are erratic and the same results could not be repeated. So there is no reason to exclude the malfunction of testing instruments. The same arguments arise in recording 4 He, 3 He, 3 H, which are not rich in quantity basically. An experiment where plenty of 4 He were recorded is attached in appendix. The problem is that we are trying to search cold fusion which is permitted by nature or not. The famous tunneling effect in quantum mechanics will answer it, however, the most fusion rate is known to be negligible. The focus of this project is on the theme that how to increase that negligible fusion rate. 6 figs, 4 tabs, 1512 refs. (Author)

  7. Early events in the evolution of spider silk genes.

    Directory of Open Access Journals (Sweden)

    James Starrett

    Full Text Available Silk spinning is essential to spider ecology and has had a key role in the expansive diversification of spiders. Silk is composed primarily of proteins called spidroins, which are encoded by a multi-gene family. Spidroins have been studied extensively in the derived clade, Orbiculariae (orb-weavers, from the suborder Araneomorphae ('true spiders'. Orbicularians produce a suite of different silks, and underlying this repertoire is a history of duplication and spidroin gene divergence. A second class of silk proteins, Egg Case Proteins (ECPs, is known only from the orbicularian species, Lactrodectus hesperus (Western black widow. In L. hesperus, ECPs bond with tubuliform spidroins to form egg case silk fibers. Because most of the phylogenetic diversity of spiders has not been sampled for their silk genes, there is limited understanding of spidroin gene family history and the prevalence of ECPs. Silk genes have not been reported from the suborder Mesothelae (segmented spiders, which diverged from all other spiders >380 million years ago, and sampling from Mygalomorphae (tarantulas, trapdoor spiders and basal araneomorph lineages is sparse. In comparison to orbicularians, mesotheles and mygalomorphs have a simpler silk biology and thus are hypothesized to have less diversity of silk genes. Here, we present cDNAs synthesized from the silk glands of six mygalomorph species, a mesothele, and a non-orbicularian araneomorph, and uncover a surprisingly rich silk gene diversity. In particular, we find ECP homologs in the mesothele, suggesting that ECPs were present in the common ancestor of extant spiders, and originally were not specialized to complex with tubuliform spidroins. Furthermore, gene-tree/species-tree reconciliation analysis reveals that numerous spidroin gene duplications occurred after the split between Mesothelae and Opisthothelae (Mygalomorphae plus Araneomorphae. We use the spidroin gene tree to reconstruct the evolution of amino acid

  8. A DNA methylation microarray-based study identifies ERG as a gene commonly methylated in prostate cancer.

    Science.gov (United States)

    Schwartzman, Jacob; Mongoue-Tchokote, Solange; Gibbs, Angela; Gao, Lina; Corless, Christopher L; Jin, Jennifer; Zarour, Luai; Higano, Celestia; True, Lawrence D; Vessella, Robert L; Wilmot, Beth; Bottomly, Daniel; McWeeney, Shannon K; Bova, G Steven; Partin, Alan W; Mori, Motomi; Alumkal, Joshi

    2011-10-01

    DNA methylation of promoter regions is a common event in prostate cancer, one of the most common cancers in men worldwide. Because prior reports demonstrating that DNA methylation is important in prostate cancer studied a limited number of genes, we systematically quantified the DNA methylation status of 1505 CpG dinucleotides for 807 genes in 78 paraffin-embedded prostate cancer samples and three normal prostate samples. The ERG gene, commonly repressed in prostate cells in the absence of an oncogenic fusion to the TMPRSS2 gene, was one of the most commonly methylated genes, occurring in 74% of prostate cancer specimens. In an independent group of patient samples, we confirmed that ERG DNA methylation was common, occurring in 57% of specimens, and cancer-specific. The ERG promoter is marked by repressive chromatin marks mediated by polycomb proteins in both normal prostate cells and prostate cancer cells, which may explain ERG's predisposition to DNA methylation and the fact that tumors with ERG DNA methylation were more methylated, in general. These results demonstrate that bead arrays offer a high-throughput method to discover novel genes with promoter DNA methylation such as ERG, whose measurement may improve our ability to more accurately detect prostate cancer.

  9. Applications of Skyrme energy-density functional to fusion reactions spanning the fusion barriers

    International Nuclear Information System (INIS)

    Liu Min; Wang, Ning; Li Zhuxia; Wu Xizhen; Zhao Enguang

    2006-01-01

    The Skyrme energy density functional has been applied to the study of heavy-ion fusion reactions. The barriers for fusion reactions are calculated by the Skyrme energy density functional with proton and neutron density distributions determined by using restricted density variational (RDV) method within the same energy density functional together with semi-classical approach known as the extended semi-classical Thomas-Fermi method. Based on the fusion barrier obtained, we propose a parametrization of the empirical barrier distribution to take into account the multi-dimensional character of real barrier and then apply it to calculate the fusion excitation functions in terms of barrier penetration concept. A large number of measured fusion excitation functions spanning the fusion barriers can be reproduced well. The competition between suppression and enhancement effects on sub-barrier fusion caused by neutron-shell-closure and excess neutron effects is studied

  10. A novel pathogenic MYH3 mutation in a child with Sheldon-Hall syndrome and vertebral fusions.

    Science.gov (United States)

    Scala, Marcello; Accogli, Andrea; De Grandis, Elisa; Allegri, Anna; Bagowski, Christoph P; Shoukier, Moneef; Maghnie, Mohamad; Capra, Valeria

    2018-03-01

    Sheldon-Hall syndrome (SHS) is the most common of the distal arthrogryposes (DAs), a group of disorders characterized by congenital non-progressive contractures. Patients with SHS present with contractures of the limbs and a distinctive triangular facies with prominent nasolabial folds. Calcaneovalgus deformity is frequent, as well as camptodactyly and ulnar deviation. Causative mutations in at least four different genes have been reported (MYH3, TNNI2, TPM2, and TNNT3). MYH3 plays a pivotal role in fetal muscle development and mutations in this gene are associated with Freeman-Sheldon syndrome, distal arthrogryposis 8 (DA8), and autosomal dominant spondylocarpotarsal synostosis. The last two disorders are characterized by skeletal abnormalities, in particular bony fusions. The observation that MYH3 may be mutated in these syndromes has suggested the involvement of this gene in bone development. We report the case of a boy with a novel pathogenic MYH3 mutation, presenting with the classical clinical features of SHS in association with unilateral carpal bone fusion and multiple vertebral fusions. This distinctive phenotype has never been reported in the literature so far and expands the phenotypic spectrum of SHS, endorsing the clinical variability of patients with MYH3-related disorders. Our findings also support a role for MYH3 in both muscle and bone development, suggesting a phenotypic continuum in MYH3-related disorders. © 2018 Wiley Periodicals, Inc.

  11. Cold fusion research

    International Nuclear Information System (INIS)

    1989-11-01

    I am pleased to forward to you the Final Report of the Cold Fusion Panel. This report reviews the current status of cold fusion and includes major chapters on Calorimetry and Excess Heat, Fusion Products and Materials Characterization. In addition, the report makes a number of conclusions and recommendations, as requested by the Secretary of Energy

  12. Development of the Synarcual in the Elephant Sharks (Holocephali; Chondrichthyes: Implications for Vertebral Formation and Fusion.

    Directory of Open Access Journals (Sweden)

    Zerina Johanson

    Full Text Available The synarcual is a structure incorporating multiple elements of two or more anterior vertebrae of the axial skeleton, forming immediately posterior to the cranium. It has been convergently acquired in the fossil group 'Placodermi', in Chondrichthyes (Holocephali, Batoidea, within the teleost group Syngnathiformes, and to varying degrees in a range of mammalian taxa. In addition, cervical vertebral fusion presents as an abnormal pathology in a variety of human disorders. Vertebrae develop from axially arranged somites, so that fusion could result from a failure of somite segmentation early in development, or from later heterotopic development of intervertebral bone or cartilage. Examination of early developmental stages indicates that in the Batoidea and the 'Placodermi', individual vertebrae developed normally and only later become incorporated into the synarcual, implying regular somite segmentation and vertebral development. Here we show that in the holocephalan Callorhinchus milii, uniform and regular vertebral segmentation also occurs, with anterior individual vertebra developing separately with subsequent fusion into a synarcual. Vertebral elements forming directly behind the synarcual continue to be incorporated into the synarcual through growth. This appears to be a common pattern through the Vertebrata. Research into human disorders, presenting as cervical fusion at birth, focuses on gene misexpression studies in humans and other mammals such as the mouse. However, in chondrichthyans, vertebral fusion represents the normal morphology, moreover, taxa such Leucoraja (Batoidea and Callorhinchus (Holocephali are increasingly used as laboratory animals, and the Callorhinchus genome has been sequenced and is available for study. Our observations on synarcual development in three major groups of early jawed vertebrates indicate that fusion involves heterotopic cartilage and perichondral bone/mineralised cartilage developing outside the regular

  13. Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

    International Nuclear Information System (INIS)

    Rothenberg, M.; Hanson, M.R.

    1988-01-01

    A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

  14. Towards fusion power

    International Nuclear Information System (INIS)

    Venkataraman, G.

    1975-01-01

    An attempt has been made to present general but broad review of the recent developments in the field of plasma physics and its application to fusion power. The first chapter describes the fusion reactions and fusion power systems. The second chapter deals in detail with production and behaviour of plasma, screening, oscillations, instability, energy losses, temperature effects, etc. Magnetic confinements, including pinch systems, toroidal systems such as Tokamac and stellarator, minor machine, etc. are discussed in detail in chapter III. Laser produced plasma, laser implosion and problems associated with it and future prospects are explained in chapter IV. Chapter V is devoted entirely to the various aspects of hybrid systems. The last chapter throws light on problems of fusion technology, such as plasma heating, vacuum requirements, radiation damage, choice of materials, blanket problems, hazards of fusion reactions, etc. (K.B.)

  15. Utility of Intraoperative Neuromonitoring during Minimally Invasive Fusion of the Sacroiliac Joint.

    Science.gov (United States)

    Woods, Michael; Birkholz, Denise; MacBarb, Regina; Capobianco, Robyn; Woods, Adam

    2014-01-01

    Study Design. Retrospective case series. Objective. To document the clinical utility of intraoperative neuromonitoring during minimally invasive surgical sacroiliac joint fusion for patients diagnosed with sacroiliac joint dysfunction (as a direct result of sacroiliac joint disruptions or degenerative sacroiliitis) and determine stimulated electromyography thresholds reflective of favorable implant position. Summary of Background Data. Intraoperative neuromonitoring is a well-accepted adjunct to minimally invasive pedicle screw placement. The utility of intraoperative neuromonitoring during minimally invasive surgical sacroiliac joint fusion using a series of triangular, titanium porous plasma coated implants has not been evaluated. Methods. A medical chart review of consecutive patients treated with minimally invasive surgical sacroiliac joint fusion was undertaken at a single center. Baseline patient demographics and medical history, intraoperative electromyography thresholds, and perioperative adverse events were collected after obtaining IRB approval. Results. 111 implants were placed in 37 patients. Sensitivity of EMG was 80% and specificity was 97%. Intraoperative neuromonitoring potentially avoided neurologic sequelae as a result of improper positioning in 7% of implants. Conclusions. The results of this study suggest that intraoperative neuromonitoring may be a useful adjunct to minimally invasive surgical sacroiliac joint fusion in avoiding nerve injury during implant placement.

  16. Utility of Intraoperative Neuromonitoring during Minimally Invasive Fusion of the Sacroiliac Joint

    Directory of Open Access Journals (Sweden)

    Michael Woods

    2014-01-01

    Full Text Available Study Design. Retrospective case series. Objective. To document the clinical utility of intraoperative neuromonitoring during minimally invasive surgical sacroiliac joint fusion for patients diagnosed with sacroiliac joint dysfunction (as a direct result of sacroiliac joint disruptions or degenerative sacroiliitis and determine stimulated electromyography thresholds reflective of favorable implant position. Summary of Background Data. Intraoperative neuromonitoring is a well-accepted adjunct to minimally invasive pedicle screw placement. The utility of intraoperative neuromonitoring during minimally invasive surgical sacroiliac joint fusion using a series of triangular, titanium porous plasma coated implants has not been evaluated. Methods. A medical chart review of consecutive patients treated with minimally invasive surgical sacroiliac joint fusion was undertaken at a single center. Baseline patient demographics and medical history, intraoperative electromyography thresholds, and perioperative adverse events were collected after obtaining IRB approval. Results. 111 implants were placed in 37 patients. Sensitivity of EMG was 80% and specificity was 97%. Intraoperative neuromonitoring potentially avoided neurologic sequelae as a result of improper positioning in 7% of implants. Conclusions. The results of this study suggest that intraoperative neuromonitoring may be a useful adjunct to minimally invasive surgical sacroiliac joint fusion in avoiding nerve injury during implant placement.

  17. Connections between Transcription Downstream of Genes and cis-SAGe Chimeric RNA.

    Science.gov (United States)

    Chwalenia, Katarzyna; Qin, Fujun; Singh, Sandeep; Tangtrongstittikul, Panjapon; Li, Hui

    2017-11-22

    cis-Splicing between adjacent genes (cis-SAGe) is being recognized as one way to produce chimeric fusion RNAs. However, its detail mechanism is not clear. Recent study revealed induction of transcriptions downstream of genes (DoGs) under osmotic stress. Here, we investigated the influence of osmotic stress on cis-SAGe chimeric RNAs and their connection to DoGs. We found,the absence of induction of at least some cis-SAGe fusions and/or their corresponding DoGs at early time point(s). In fact, these DoGs and their cis-SAGe fusions are inversely correlated. This negative correlation was changed to positive at a later time point. These results suggest a direct competition between the two categories of transcripts when total pool of readthrough transcripts is limited at an early time point. At a later time point, DoGs and corresponding cis-SAGe fusions are both induced, indicating that total readthrough transcripts become more abundant. Finally, we observed overall enhancement of cis-SAGe chimeric RNAs in KCl-treated samples by RNA-Seq analysis.

  18. Rare codons effect on expression of recombinant gene cassette in Escherichia coli BL21(DE3

    Directory of Open Access Journals (Sweden)

    Aghil Esmaeili-Bandboni

    2017-11-01

    Full Text Available Objective: To demonstrate the sensitivity of expression of fusion genes to existence of a large number of rare codons in recombinant gene sequenced. Methods: Primers for amplification of cholera toxin B, Shiga toxin B and gfp genes were designed by Primer3 software and synthesized. All of these 3 genes were cloned. Then the genes were fused together by restriction sites and enzymatic method. Two linkers were used as a flexible bridge in connection of these genes. Results: Cloning and fusion of cholera toxin B, Shiga toxin B and gfp genes were done correctly. After that, expression of the recombinant gene construction was surveyed. Conclusions: According to what was seen, because of the accumulation of 12 rare codons of Shiga toxin B and 19 rare codons of cholera toxin B in this gene cassette, the expression of the recombinant gene cassette, in Escherichia coli BL21, failed.

  19. Heavy ion fusion

    International Nuclear Information System (INIS)

    Bangerter, R.O.

    1986-01-01

    This report on the International Symposium on Heavy Ion Fusion held May 27-29, 1986 summarizes the problems and achievements in the areas of targets, accelerators, focussing, reactor studies, and system studies. The symposium participants recognize that there are large uncertainties in Heavy Ion Fusion but many of them are also optimistic that HIF may ultimately be the best approach to fusion

  20. Cold fusion

    Energy Technology Data Exchange (ETDEWEB)

    Suh, Suk Yong; Sung, Ki Woong; Kang, Joo Sang; Lee, Jong Jik [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1995-02-01

    So called `cold fusion phenomena` are not confirmed yet. Excess heat generation is very delicate one. Neutron generation is most reliable results, however, the records are erratic and the same results could not be repeated. So there is no reason to exclude the malfunction of testing instruments. The same arguments arise in recording {sup 4}He, {sup 3}He, {sup 3}H, which are not rich in quantity basically. An experiment where plenty of {sup 4}He were recorded is attached in appendix. The problem is that we are trying to search cold fusion which is permitted by nature or not. The famous tunneling effect in quantum mechanics will answer it, however, the most fusion rate is known to be negligible. The focus of this project is on the theme that how to increase that negligible fusion rate. 6 figs, 4 tabs, 1512 refs. (Author).