WorldWideScience

Sample records for gene family reveals

  1. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  2. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  3. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  4. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  5. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  6. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  7. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  8. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  9. Genetic analysis of Chinese families reveals a novel truncation allele of the retinitis pigmentosa GTPase regulator gene

    Directory of Open Access Journals (Sweden)

    Fang Hu

    2014-10-01

    Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.

  10. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  11. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Repeat-associated plasticity in the Helicobacter pylori RD gene family.

    Science.gov (United States)

    Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

    2009-11-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

  13. Knock-down of transcript abundance of a family of Kunitz proteinase inhibitor genes in white clover (Trifolium repens) reveals a redundancy and diversity of gene function.

    Science.gov (United States)

    Islam, Afsana; Leung, Susanna; Burgess, Elisabeth P J; Laing, William A; Richardson, Kim A; Hofmann, Rainer W; Dijkwel, Paul P; McManus, Michael T

    2015-12-01

    The transcriptional regulation of four phylogenetically distinct members of a family of Kunitz proteinase inhibitor (KPI) genes isolated from white clover (Trifolium repens; designated Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5) has been investigated to determine their wider functional role. The four genes displayed differential transcription during seed germination, and in different tissues of the mature plant, and transcription was also ontogenetically regulated. Heterologous over-expression of Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5 in Nicotiana tabacum retarded larval growth of the herbivore Spodoptera litura, and an increase in the transcription of the pathogenesis-related genes PR1 and PR4 was observed in the Tr-KPI1 and Tr-KPI4 over-expressing lines. RNA interference (RNAi) knock-down lines in white clover displayed significantly altered vegetative growth phenotypes with inhibition of shoot growth and a stimulation of root growth, while knock-down of Tr-KPI1, Tr-KPI2 and Tr-KPI5 transcript abundance also retarded larval growth of S. litura. Examination of these RNAi lines revealed constitutive stress-associated phenotypes as well as altered transcription of cellular signalling genes. These results reveal a functional redundancy across members of the KPI gene family. Further, the regulation of transcription of at least one member of the family, Tr-KPI2, may occupy a central role in the maintenance of a cellular homeostasis. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  14. Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza

    OpenAIRE

    Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

    2017-01-01

    Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially exp...

  15. Draft genome sequence of Streptomyces coelicoflavus ZG0656 reveals the putative biosynthetic gene cluster of acarviostatin family α-amylase inhibitors.

    Science.gov (United States)

    Guo, X; Geng, P; Bai, F; Bai, G; Sun, T; Li, X; Shi, L; Zhong, Q

    2012-08-01

    The aims of this study are to obtain the draft genome sequence of Streptomyces coelicoflavus ZG0656, which produces novel acarviostatin family α-amylase inhibitors, and then to reveal the putative acarviostatin-related gene cluster and the biosynthetic pathway. The draft genome sequence of S. coelicoflavus ZG0656 was generated using a shotgun approach employing a combination of 454 and Solexa sequencing technologies. Genome analysis revealed a putative gene cluster for acarviostatin biosynthesis, termed sct-cluster. The cluster contains 13 acarviostatin synthetic genes, six transporter genes, four starch degrading or transglycosylation enzyme genes and two regulator genes. On the basis of bioinformatic analysis, we proposed a putative biosynthetic pathway of acarviostatins. The intracellular steps produce a structural core, acarviostatin I00-7-P, and the extracellular assemblies lead to diverse acarviostatin end products. The draft genome sequence of S. coelicoflavus ZG0656 revealed the putative biosynthetic gene cluster of acarviostatins and a putative pathway of acarviostatin production. To our knowledge, S. coelicoflavus ZG0656 is the first strain in this species for which a genome sequence has been reported. The analysis of sct-cluster provided important insights into the biosynthesis of acarviostatins. This work will be a platform for producing novel variants and yield improvement. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  16. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  17. Homozygosity mapping reveals new nonsense mutation in the FAM161A gene causing autosomal recessive retinitis pigmentosa in a Palestinian family.

    Science.gov (United States)

    Zobor, Ditta; Balousha, Ghassan; Baumann, Britta; Wissinger, Bernd

    2014-01-01

    Retinitis pigmentosa (RP) is a heterogenous group of inherited retinal degenerations caused by mutations in at least 45 genes. Recently, the FAM161A gene was identified as the causative gene for RP28, an autosomal recessive form of RP. We performed a clinical and molecular genetic study of a consanguineous Palestinian family with two three siblings affected with retinitis pigmentosa. DNA samples were collected from the index patient, his father, his affected sister, and two non-affected brothers. DNA sample from the index was subjected to high resolution genome-wide SNP array. Assuming identity-by-descent in this consanguineous family we applied homozygosity mapping to identify disease causing genes. The index patient reported night blindness since the age of 20 years, followed by moderate disease progression with decrease of peripheral vision, the development of photophobia and later on reduced central vision. At the age of 40 his visual acuity was counting fingers (CF) for both eyes, color discrimination was not possible and his visual fields were severely constricted. Funduscopic examination revealed a typical appearance of advanced RP with optic disc pallor, narrowed retinal vessels, bone-spicule like pigmentary changes in the mid-periphery and atrophic changes in the macula. His younger affected brother (37 years) was reported with overall milder symptoms, while the youngest sister (21 years) reported problems only with night vision. Applying high-density SNP arrays we identified several homozygous genomic regions one of which included the recently identified FAM161A gene mutated in RP28-linked autosomal recessive RP. Sequencing analysis revealed the presence of a novel homozygous nonsense mutation, c.1003C>T/p.R335X in the index patient and the affected sister. We identified an RP28-linked RP family in the Palestinian population caused by a novel nonsense mutation in FAM161A. RP in this family shows a typical disease onset with moderate to rapid progression

  18. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  19. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  20. Transcriptome-wide survey of mouse CNS-derived cells reveals monoallelic expression within novel gene families.

    Directory of Open Access Journals (Sweden)

    Sierra M Li

    Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.

  1. Comparative genomic analysis of the Lipase3 gene family in five plant species reveals distinct evolutionary origins.

    Science.gov (United States)

    Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan

    2018-04-01

    Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.

  2. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    International Nuclear Information System (INIS)

    Vanderslice, P.; Ballinger, S.M.; Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H.

    1990-01-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the ∼1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family

  3. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  4. Evolution, functional differentiation, and co-expression of the RLK gene family revealed in Jilin ginseng, Panax ginseng C.A. Meyer.

    Science.gov (United States)

    Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping

    2018-02-21

    Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.

  5. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

    Science.gov (United States)

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-11-01

    Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  6. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

    Directory of Open Access Journals (Sweden)

    Xiaoyan Huang

    2017-01-01

    Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  7. Screening for large genomic rearrangements in the FANCA gene reveals extensive deletion in a Finnish breast cancer family.

    Science.gov (United States)

    Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri

    2011-03-28

    A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  8. Genome-wide Comparative Analyses Reveal the Dynamic Evolution of Nucleotide-Binding Leucine-Rich Repeat Gene Family among Solanaceae Plants

    Directory of Open Access Journals (Sweden)

    Eunyoung Seo

    2016-08-01

    Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.

  9. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  10. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  11. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  12. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  13. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    Science.gov (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  14. Comparative genomic analysis of SET domain family reveals the origin, expansion, and putative function of the arthropod-specific SmydA genes as histone modifiers in insects.

    Science.gov (United States)

    Jiang, Feng; Liu, Qing; Wang, Yanli; Zhang, Jie; Wang, Huimin; Song, Tianqi; Yang, Meiling; Wang, Xianhui; Kang, Le

    2017-06-01

    The SET domain is an evolutionarily conserved motif present in histone lysine methyltransferases, which are important in the regulation of chromatin and gene expression in animals. In this study, we searched for SET domain-containing genes (SET genes) in all of the 147 arthropod genomes sequenced at the time of carrying out this experiment to understand the evolutionary history by which SET domains have evolved in insects. Phylogenetic and ancestral state reconstruction analysis revealed an arthropod-specific SET gene family, named SmydA, that is ancestral to arthropod animals and specifically diversified during insect evolution. Considering that pseudogenization is the most probable fate of the new emerging gene copies, we provided experimental and evolutionary evidence to demonstrate their essential functions. Fluorescence in situ hybridization analysis and in vitro methyltransferase activity assays showed that the SmydA-2 gene was transcriptionally active and retained the original histone methylation activity. Expression knockdown by RNA interference significantly increased mortality, implying that the SmydA genes may be essential for insect survival. We further showed predominantly strong purifying selection on the SmydA gene family and a potential association between the regulation of gene expression and insect phenotypic plasticity by transcriptome analysis. Overall, these data suggest that the SmydA gene family retains essential functions that may possibly define novel regulatory pathways in insects. This work provides insights into the roles of lineage-specific domain duplication in insect evolution. © The Authors 2017. Published by Oxford University Press.

  15. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  16. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  17. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  18. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  19. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  20. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  1. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  2. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  3. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Directory of Open Access Journals (Sweden)

    Preeti Arya

    Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  4. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Science.gov (United States)

    Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K

    2014-01-01

    Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  5. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

  6. A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

    Directory of Open Access Journals (Sweden)

    Hewitt Jane E

    2010-11-01

    Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

  7. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  8. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  9. Whole Exome Sequencing Reveals Genetic Predisposition in a Large Family with Retinitis Pigmentosa

    Directory of Open Access Journals (Sweden)

    Juan Wu

    2014-01-01

    Full Text Available Next-generation sequencing has become more widely used to reveal genetic defect in monogenic disorders. Retinitis pigmentosa (RP, the leading cause of hereditary blindness worldwide, has been attributed to more than 67 disease-causing genes. Due to the extreme genetic heterogeneity, using general molecular screening alone is inadequate for identifying genetic predispositions in susceptible individuals. In order to identify underlying mutation rapidly, we utilized next-generation sequencing in a four-generation Chinese family with RP. Two affected patients and an unaffected sibling were subjected to whole exome sequencing. Through bioinformatics analysis and direct sequencing confirmation, we identified p.R135W transition in the rhodopsin gene. The mutation was subsequently confirmed to cosegregate with the disease in the family. In this study, our results suggest that whole exome sequencing is a robust method in diagnosing familial hereditary disease.

  10. Genomic characterisation of Wongabel virus reveals novel genes within the Rhabdoviridae.

    Science.gov (United States)

    Gubala, Aneta J; Proll, David F; Barnard, Ross T; Cowled, Chris J; Crameri, Sandra G; Hyatt, Alex D; Boyle, David B

    2008-06-20

    Viruses belonging to the family Rhabdoviridae infect a variety of different hosts, including insects, vertebrates and plants. Currently, there are approximately 200 ICTV-recognised rhabdoviruses isolated around the world. However, the majority remain poorly characterised and only a fraction have been definitively assigned to genera. The genomic and transcriptional complexity displayed by several of the characterised rhabdoviruses indicates large diversity and complexity within this family. To enable an improved taxonomic understanding of this family, it is necessary to gain further information about the poorly characterised members of this family. Here we present the complete genome sequence and predicted transcription strategy of Wongabel virus (WONV), a previously uncharacterised rhabdovirus isolated from biting midges (Culicoides austropalpalis) collected in northern Queensland, Australia. The 13,196 nucleotide genome of WONV encodes five typical rhabdovirus genes N, P, M, G and L. In addition, the WONV genome contains three genes located between the P and M genes (U1, U2, U3) and two open reading frames overlapping with the N and G genes (U4, U5). These five additional genes and their putative protein products appear to be novel, and their functions are unknown. Predictive analysis of the U5 gene product revealed characteristics typical of viroporins, and indicated structural similarities with the alpha-1 protein (putative viroporin) of viruses in the genus Ephemerovirus. Phylogenetic analyses of the N and G proteins of WONV indicated closest similarity with the avian-associated Flanders virus; however, the genomes of these two viruses are significantly diverged. WONV displays a novel and unique genome structure that has not previously been described for any animal rhabdovirus.

  11. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  12. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  13. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  14. Homozygosity mapping and targeted sanger sequencing reveal genetic defects underlying inherited retinal disease in families from pakistan.

    Directory of Open Access Journals (Sweden)

    Maleeha Maria

    Full Text Available Homozygosity mapping has facilitated the identification of the genetic causes underlying inherited diseases, particularly in consanguineous families with multiple affected individuals. This knowledge has also resulted in a mutation dataset that can be used in a cost and time effective manner to screen frequent population-specific genetic variations associated with diseases such as inherited retinal disease (IRD.We genetically screened 13 families from a cohort of 81 Pakistani IRD families diagnosed with Leber congenital amaurosis (LCA, retinitis pigmentosa (RP, congenital stationary night blindness (CSNB, or cone dystrophy (CD. We employed genome-wide single nucleotide polymorphism (SNP array analysis to identify homozygous regions shared by affected individuals and performed Sanger sequencing of IRD-associated genes located in the sizeable homozygous regions. In addition, based on population specific mutation data we performed targeted Sanger sequencing (TSS of frequent variants in AIPL1, CEP290, CRB1, GUCY2D, LCA5, RPGRIP1 and TULP1, in probands from 28 LCA families.Homozygosity mapping and Sanger sequencing of IRD-associated genes revealed the underlying mutations in 10 families. TSS revealed causative variants in three families. In these 13 families four novel mutations were identified in CNGA1, CNGB1, GUCY2D, and RPGRIP1.Homozygosity mapping and TSS revealed the underlying genetic cause in 13 IRD families, which is useful for genetic counseling as well as therapeutic interventions that are likely to become available in the near future.

  15. [Genome-wide identification and expression analysis of the WRKY gene family in peach].

    Science.gov (United States)

    Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long

    2016-03-01

    The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

  16. Lineage-specific evolution of the vertebrate Otopetrin gene family revealed by comparative genomic analyses

    Directory of Open Access Journals (Sweden)

    Ryan Joseph F

    2011-01-01

    Full Text Available Abstract Background Mutations in the Otopetrin 1 gene (Otop1 in mice and fish produce an unusual bilateral vestibular pathology that involves the absence of otoconia without hearing impairment. The encoded protein, Otop1, is the only functionally characterized member of the Otopetrin Domain Protein (ODP family; the extended sequence and structural preservation of ODP proteins in metazoans suggest a conserved functional role. Here, we use the tools of sequence- and cytogenetic-based comparative genomics to study the Otop1 and the Otop2-Otop3 genes and to establish their genomic context in 25 vertebrates. We extend our evolutionary study to include the gene mutated in Usher syndrome (USH subtype 1G (Ush1g, both because of the head-to-tail clustering of Ush1g with Otop2 and because Otop1 and Ush1g mutations result in inner ear phenotypes. Results We established that OTOP1 is the boundary gene of an inversion polymorphism on human chromosome 4p16 that originated in the common human-chimpanzee lineage more than 6 million years ago. Other lineage-specific evolutionary events included a three-fold expansion of the Otop genes in Xenopus tropicalis and of Ush1g in teleostei fish. The tight physical linkage between Otop2 and Ush1g is conserved in all vertebrates. To further understand the functional organization of the Ushg1-Otop2 locus, we deduced a putative map of binding sites for CCCTC-binding factor (CTCF, a mammalian insulator transcription factor, from genome-wide chromatin immunoprecipitation-sequencing (ChIP-seq data in mouse and human embryonic stem (ES cells combined with detection of CTCF-binding motifs. Conclusions The results presented here clarify the evolutionary history of the vertebrate Otop and Ush1g families, and establish a framework for studying the possible interaction(s of Ush1g and Otop in developmental pathways.

  17. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  19. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  20. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  1. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  2. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

  3. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

    OpenAIRE

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-01-01

    Purpose: Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing bas...

  4. Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

    Science.gov (United States)

    Shastry, B S; Trese, M T

    2000-01-01

    Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

  5. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families.

    Science.gov (United States)

    Traverso, Lucila; Lavore, Andrés; Sierra, Ivana; Palacio, Victorio; Martinez-Barnetche, Jesús; Latorre-Estivalis, José Manuel; Mougabure-Cueto, Gaston; Francini, Flavio; Lorenzo, Marcelo G; Rodríguez, Mario Henry; Ons, Sheila; Rivera-Pomar, Rolando V

    2017-02-01

    Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs), Cytochromes P450 (CYPs) and Carboxyl/Cholinesterases (CCEs). Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease. The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms on the high

  6. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families.

    Directory of Open Access Journals (Sweden)

    Lucila Traverso

    2017-02-01

    Full Text Available Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs, Cytochromes P450 (CYPs and Carboxyl/Cholinesterases (CCEs. Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease.The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms

  7. Genome-wide characterization of the WRKY gene family in radish (Raphanus sativus L.) reveals its critical functions under different abiotic stresses.

    Science.gov (United States)

    Karanja, Bernard Kinuthia; Fan, Lianxue; Xu, Liang; Wang, Yan; Zhu, Xianwen; Tang, Mingjia; Wang, Ronghua; Zhang, Fei; Muleke, Everlyne M'mbone; Liu, Liwang

    2017-11-01

    The radish WRKY gene family was genome-widely identified and played critical roles in response to multiple abiotic stresses. The WRKY is among the largest transcription factors (TFs) associated with multiple biological activities for plant survival, including control response mechanisms against abiotic stresses such as heat, salinity, and heavy metals. Radish is an important root vegetable crop and therefore characterization and expression pattern investigation of WRKY transcription factors in radish is imperative. In the present study, 126 putative WRKY genes were retrieved from radish genome database. Protein sequence and annotation scrutiny confirmed that RsWRKY proteins possessed highly conserved domains and zinc finger motif. Based on phylogenetic analysis results, RsWRKYs candidate genes were divided into three groups (Group I, II and III) with the number 31, 74, and 20, respectively. Additionally, gene structure analysis revealed that intron-exon patterns of the WRKY genes are highly conserved in radish. Linkage map analysis indicated that RsWRKY genes were distributed with varying densities over nine linkage groups. Further, RT-qPCR analysis illustrated the significant variation of 36 RsWRKY genes under one or more abiotic stress treatments, implicating that they might be stress-responsive genes. In total, 126 WRKY TFs were identified from the R. sativus genome wherein, 35 of them showed abiotic stress-induced expression patterns. These results provide a genome-wide characterization of RsWRKY TFs and baseline for further functional dissection and molecular evolution investigation, specifically for improving abiotic stress resistances with an ultimate goal of increasing yield and quality of radish.

  8. Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon

    Directory of Open Access Journals (Sweden)

    Qing XU

    2018-01-01

    Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis

  9. Genome-Wide Identification and Expression Profiling of ATP-Binding Cassette (ABC) Transporter Gene Family in Pineapple (Ananas comosus (L.) Merr.) Reveal the Role of AcABCG38 in Pollen Development.

    Science.gov (United States)

    Chen, Piaojuan; Li, Yi; Zhao, Lihua; Hou, Zhimin; Yan, Maokai; Hu, Bingyan; Liu, Yanhui; Azam, Syed Muhammad; Zhang, Ziyan; Rahman, Zia Ur; Liu, Liping; Qin, Yuan

    2017-01-01

    Pineapple ( Ananas comosus L .) cultivation commonly relies on asexual reproduction which is easily impeded by many factors in agriculture production. Sexual reproduction might be a novel approach to improve the pineapple planting. However, genes controlling pineapple sexual reproduction are still remain elusive. In different organisms a conserved superfamily proteins known as ATP binding cassette (ABC) participate in various biological processes. Whereas, till today the ABC gene family has not been identified in pineapple. Here 100 ABC genes were identified in the pineapple genome and grouped into eight subfamilies (5 ABCAs , 20 ABCB s, 16 ABCCs , 2 ABCDs , one ABCEs , 5 ABCFs , 42 ABCGs and 9 ABCIs ). Gene expression profiling revealed the dynamic expression pattern of ABC gene family in various tissues and different developmental stages. AcABCA5, AcABCB6, AcABCC4 , AcABCC7 , AcABCC9 , AcABCG26 , AcABCG38 and AcABCG42 exhibited preferential expression in ovule and stamen. Over-expression of AcABCG38 in the Arabidopsis double mutant abcg1-2abcg16-2 partially restored its pollen abortion defects, indicating that AcABCG38 plays important roles in pollen development. Our study on ABC gene family in pineapple provides useful information for developing sexual pineapple plantation which could be utilized to improve pineapple agricultural production.

  10. Genome-wide characterization of pectin methyl esterase genes reveals members differentially expressed in tolerant and susceptible wheats in response to Fusarium graminearum.

    Science.gov (United States)

    Zega, Alessandra; D'Ovidio, Renato

    2016-11-01

    Pectin methyl esterase (PME) genes code for enzymes that are involved in structural modifications of the plant cell wall during plant growth and development. They are also involved in plant-pathogen interaction. PME genes belong to a multigene family and in this study we report the first comprehensive analysis of the PME gene family in bread wheat (Triticum aestivum L.). Like in other species, the members of the TaPME family are dispersed throughout the genome and their encoded products retain the typical structural features of PMEs. qRT-PCR analysis showed variation in the expression pattern of TaPME genes in different tissues and revealed that these genes are mainly expressed in flowering spikes. In our attempt to identify putative TaPME genes involved in wheat defense, we revealed a strong variation in the expression of the TaPME following Fusarium graminearum infection, the causal agent of Fusarium head blight (FHB). Particularly interesting was the finding that the expression profile of some PME genes was markedly different between the FHB-resistant wheat cultivar Sumai3 and the FHB-susceptible cultivar Bobwhite, suggesting a possible involvement of these PME genes in FHB resistance. Moreover, the expression analysis of the TaPME genes during F. graminearum progression within the spike revealed those genes that responded more promptly to pathogen invasion. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  11. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  12. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Science.gov (United States)

    Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

    2013-01-01

    As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  13. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  14. The SWEET gene family in Hevea brasiliensis - its evolution and expression compared with four other plant species.

    Science.gov (United States)

    Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong

    2017-12-01

    SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.

  15. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  16. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  17. Direct sequencing of FAH gene in Pakistani tyrosinemia type 1 families reveals a novel mutation.

    Science.gov (United States)

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Afzal, Sibtain; Bhinder, Munir A; Ullah, Ihsan; Cheema, Huma Arshad; Ramzan, Khushnooda; Shehzad, Wasim

    2016-03-01

    Hereditary tyrosinemia type 1 (HT1) is a rare inborn error of tyrosine catabolism with a worldwide prevalence of one out of 100,000 live births. HT1 is clinically characterized by hepatic and renal dysfunction resulting from the deficiency of fumarylacetoacetate hydrolase (FAH) enzyme, caused by recessive mutations in the FAH gene. We present here the first report on identification of FAH mutations in HT1 patients from Pakistan with a novel one. Three Pakistani families, each having one child affected with HT1, were enrolled over a period of 1.5 years. Two of the affected children had died as they were presented late with acute form. All regions of the FAH gene spanning exons and splicing sites were amplified by polymerase chain reaction (PCR) and mutation analysis was carried out by direct sequencing. Results of sequencing were confirmed by restriction fragment length polymorphism (PCR-RFLP) analysis. Three different FAH mutations, one in each family, were found to co-segregate with the disease phenotype. Two of these FAH mutations have been known (c.192G>T and c.1062+5G>A [IVS12+5G>A]), while c.67T>C (p.Ser23Pro) was a novel mutation. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. Most of the HT1 patients die before they present to hospitals in Pakistan, as is indicated by enrollment of only three families in 1.5 years. Most of those with late clinical presentation do not survive due to delayed diagnosis followed by untimely treatment. This tragic condition advocates the establishment of expanded newborn screening program for HT1 within Pakistan.

  18. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Directory of Open Access Journals (Sweden)

    Joachim W Bargsten

    Full Text Available As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes. The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  19. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi

    2007-01-01

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated

  20. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  1. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  2. Systematic Identification, Evolution and Expression Analysis of the Zea mays PHT1 Gene Family Reveals Several New Members Involved in Root Colonization by Arbuscular Mycorrhizal Fungi.

    Science.gov (United States)

    Liu, Fang; Xu, Yunjian; Jiang, Huanhuan; Jiang, Chaosheng; Du, Yibin; Gong, Cheng; Wang, Wei; Zhu, Suwen; Han, Guomin; Cheng, Beijiu

    2016-06-13

    The Phosphate Transporter1 (PHT1) family of genes plays pivotal roles in the uptake of inorganic phosphate from soils. However, there is no comprehensive report on the PHT1 family in Zea mays based on the whole genome. In the present study, a total of 13 putative PHT1 genes (ZmPHT1;1 to 13) were identified in the inbred line B73 genome by bioinformatics methods. Then, their function was investigated by a yeast PHO84 mutant complementary experiment and qRT-PCR. Thirteen ZmPHT1 genes distributed on six chromosomes (1, 2, 5, 7, 8 and 10) were divided into two paralogues (Class A and Class B). ZmPHT1;1/ZmPHT1;9 and ZmPHT1;9/ZmPHT1;13 are produced from recent segmental duplication events. ZmPHT1;1/ZmPHT1;13 and ZmPHT1;8/ZmPHT1;10 are produced from early segmental duplication events. All 13 putative ZmPHT1s can completely or partly complement the yeast Pi-uptake mutant, and they were obviously induced in maize under low Pi conditions, except for ZmPHT1;1 (p < 0.01), indicating that the overwhelming majority of ZmPHT1 genes can respond to a low Pi condition. ZmPHT1;2, ZmPHT1;4, ZmPHT1;6, ZmPHT1;7, ZmPHT1;9 and ZmPHT1;11 were up-regulated by arbuscular mycorrhizal fungi (AMF), implying that these genes might participate in mediating Pi absorption and/or transport. Analysis of the promoters revealed that the MYCS and P1BS element are widely distributed on the region of different AMF-inducible ZmPHT1 promoters. In light of the above results, five of 13 ZmPHT1 genes were newly-identified AMF-inducible high-affinity phosphate transporters in the maize genome. Our results will lay a foundation for better understanding the PHT1 family evolution and the molecular mechanisms of inorganic phosphate transport under AMF inoculation.

  3. Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.

    Science.gov (United States)

    Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan

    2015-09-08

    WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought

  4. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  5. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  6. Isolation of Hox cluster genes from insects reveals an accelerated sequence evolution rate.

    Directory of Open Access Journals (Sweden)

    Heike Hadrys

    Full Text Available Among gene families it is the Hox genes and among metazoan animals it is the insects (Hexapoda that have attracted particular attention for studying the evolution of development. Surprisingly though, no Hox genes have been isolated from 26 out of 35 insect orders yet, and the existing sequences derive mainly from only two orders (61% from Hymenoptera and 22% from Diptera. We have designed insect specific primers and isolated 37 new partial homeobox sequences of Hox cluster genes (lab, pb, Hox3, ftz, Antp, Scr, abd-a, Abd-B, Dfd, and Ubx from six insect orders, which are crucial to insect phylogenetics. These new gene sequences provide a first step towards comparative Hox gene studies in insects. Furthermore, comparative distance analyses of homeobox sequences reveal a correlation between gene divergence rate and species radiation success with insects showing the highest rate of homeobox sequence evolution.

  7. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  8. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Directory of Open Access Journals (Sweden)

    Ogunjumo Oluwasanmi

    2004-06-01

    Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.

  9. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Science.gov (United States)

    Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A

    2004-01-01

    Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903

  10. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    Directory of Open Access Journals (Sweden)

    Benech Philippe

    2009-08-01

    Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

  11. Diversifying Selection in the Wheat Stem Rust Fungus Acts Predominantly on Pathogen-Associated Gene Families and Reveals Candidate Effectors

    Directory of Open Access Journals (Sweden)

    Jana eSperschneider

    2014-09-01

    Full Text Available Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defence proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialised gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control.

  12. Driving south: a multi-gene phylogeny of the brown algal family Fucaceae reveals relationships and recent drivers of a marine radiation

    Directory of Open Access Journals (Sweden)

    Cánovas Fernando G

    2011-12-01

    Full Text Available Abstract Background Understanding the processes driving speciation in marine ecosystems remained a challenge until recently, due to the unclear nature of dispersal boundaries. However, recent evidence for marine adaptive radiations and ecological speciation, as well as previously undetected patterns of cryptic speciation is overturning this view. Here, we use multi-gene phylogenetics to infer the family-level evolutionary history of Fucaceae (intertidal brown algae of the northern Pacific and Atlantic in order to investigate recent and unique patterns of radiative speciation in the genus Fucus in the Atlantic, in contrast with the mainly monospecific extant genera. Results We developed a set of markers from 13 protein coding genes based on polymorphic cDNA from EST libraries, which provided novel resolution allowing estimation of ancestral character states and a detailed reconstruction of the recent radiative history. Phylogenetic reconstructions yielded similar topologies and revealed four independent trans-Arctic colonization events by Fucaceae lineages, two of which also involved transitions from hermaphroditism to dioecy associated with Atlantic invasions. More recently, reversion of dioecious ancestral lineages towards hermaphroditism has occurred in the genus Fucus, particularly coinciding with colonization of more extreme habitats. Novel lineages in the genus Fucus were also revealed in association with southern habitats. These most recent speciation events occurred during the Pleistocene glaciations and coincided with a shift towards selfing mating systems, generally southward shifts in distribution, and invasion of novel habitats. Conclusions Diversification of the family occurred in the Late-Mid Miocene, with at least four independent trans-Artic lineage crossings coincident with two reproductive mode transitions. The genus Fucus arose in the Pliocene but radiated within a relatively short time frame about 2.5 million years ago

  13. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  14. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

    Science.gov (United States)

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

    2009-11-01

    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  15. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  16. Understanding familial and non-familial renal cell cancer

    NARCIS (Netherlands)

    Bodmer, Daniëlle; van den Hurk, Wilhelmina; van Groningen, Jan J. M.; Eleveld, Marc J.; Martens, Gerard J. M.; Weterman, Marian A. J.; van Kessel, Ad Geurts

    2002-01-01

    Molecular genetic analysis of familial and non-familial cases of conventional renal cell carcinoma (RCC) revealed a critical role(s) for multiple genes on human chromosome 3. For some of these genes, e.g. VHL, such a role has been firmly established, whereas for others, definite confirmation is

  17. Understanding familial and non-familial renal cell cancer.

    NARCIS (Netherlands)

    Bodmer, D.; Hurk, W.H. van den; Groningen, J.J.M. van; Eleveld, M.J.; Martens, G.J.M.; Weterman, M.A.J.; Geurts van Kessel, A.H.M.

    2002-01-01

    Molecular genetic analysis of familial and non-familial cases of conventional renal cell carcinoma (RCC) revealed a critical role(s) for multiple genes on human chromosome 3. For some of these genes, e.g. VHL, such a role has been firmly established, whereas for others, definite confirmation is

  18. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  19. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  20. Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity

    Science.gov (United States)

    Schoggins, John W.; MacDuff, Donna A.; Imanaka, Naoko; Gainey, Maria D.; Shrestha, Bimmi; Eitson, Jennifer L.; Mar, Katrina B.; Richardson, R. Blake; Ratushny, Alexander V.; Litvak, Vladimir; Dabelic, Rea; Manicassamy, Balaji; Aitchison, John D.; Aderem, Alan; Elliott, Richard M.; García-Sastre, Adolfo; Racaniello, Vincent; Snijder, Eric J.; Yokoyama, Wayne M.; Diamond, Michael S.; Virgin, Herbert W.; Rice, Charles M.

    2014-01-01

    The type I interferon (IFN) response protects cells from viral infection by inducing hundreds of interferon-stimulated genes (ISGs), some of which encode direct antiviral effectors. Recent screening studies have begun to catalogue ISGs with antiviral activity against several RNA and DNA viruses. However, antiviral ISG specificity across multiple distinct classes of viruses remains largely unexplored. Here we used an ectopic expression assay to screen a library of more than 350 human ISGs for effects on 14 viruses representing 7 families and 11 genera. We show that 47 genes inhibit one or more viruses, and 25 genes enhance virus infectivity. Comparative analysis reveals that the screened ISGs target positive-sense single-stranded RNA viruses more effectively than negative-sense single-stranded RNA viruses. Gene clustering highlights the cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS, also known as MB21D1) as a gene whose expression also broadly inhibits several RNA viruses. In vitro, lentiviral delivery of enzymatically active cGAS triggers a STING-dependent, IRF3-mediated antiviral program that functions independently of canonical IFN/STAT1 signalling. In vivo, genetic ablation of murine cGAS reveals its requirement in the antiviral response to two DNA viruses, and an unappreciated contribution to the innate control of an RNA virus. These studies uncover new paradigms for the preferential specificity of IFN-mediated antiviral pathways spanning several virus families.

  1. Exome sequencing in Jewish and Arab patients with rhabdomyolysis reveals single-gene etiology in 43% of cases.

    Science.gov (United States)

    Vivante, Asaf; Ityel, Hadas; Pode-Shakked, Ben; Chen, Jing; Shril, Shirlee; van der Ven, Amelie T; Mann, Nina; Schmidt, Johanna Magdalena; Segel, Reeval; Aran, Adi; Zeharia, Avraham; Staretz-Chacham, Orna; Bar-Yosef, Omer; Raas-Rothschild, Annick; Landau, Yuval E; Lifton, Richard P; Anikster, Yair; Hildebrandt, Friedhelm

    2017-12-01

    Rhabdomyolysis is a clinical emergency that may cause acute kidney injury (AKI). It can be acquired or due to monogenic mutations. Around 60 different rare monogenic forms of rhabdomyolysis have been reported to date. In the clinical setting, identifying the underlying molecular diagnosis is challenging due to nonspecific presentation, the high number of causative genes, and current lack of data on the prevalence of monogenic forms. We employed whole exome sequencing (WES) to reveal the percentage of rhabdomyolysis cases explained by single-gene (monogenic) mutations in one of 58 candidate genes. We investigated a cohort of 21 unrelated families with rhabdomyolysis, in whom no underlying etiology had been previously established. Using WES, we identified causative mutations in candidate genes in nine of the 21 families (43%). We detected disease-causing mutations in eight of 58 candidate genes, grouped into the following categories: (1) disorders of fatty acid metabolism (CPT2), (2) disorders of glycogen metabolism (PFKM and PGAM2), (3) disorders of abnormal skeletal muscle relaxation and contraction (CACNA1S, MYH3, RYR1 and SCN4A), and (4) disorders of purine metabolism (AHCY). Our findings demonstrate a very high detection rate for monogenic etiologies using WES and reveal broad genetic heterogeneity for rhabdomyolysis. These results highlight the importance of molecular genetic diagnostics for establishing an etiologic diagnosis. Because these patients are at risk for recurrent episodes of rhabdomyolysis and subsequent risk for AKI, WES allows adequate prophylaxis and treatment for these patients and their family members and enables a personalized medicine approach.

  2. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  3. Clinical Variability in a Family with an Ectodermal Dysplasia Syndrome and a Nonsense Mutation in the TP63 Gene.

    Science.gov (United States)

    Eisenkraft, Arik; Pode-Shakked, Ben; Goldstein, Nurit; Shpirer, Zvi; van Bokhoven, Hans; Anikster, Yair

    2015-01-01

    Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish descent, in which the index patient presented with a persistent scalp skin lesion, dystrophic nails and light thin hair. Further evaluation revealed over 10 affected individuals in the kindred, over four generations, exhibiting varying degrees of ectodermal involvement. Analysis of the TP63 gene from four of the patients and from two healthy individuals of the same family was performed. Gene sequencing of the patients revealed a nonsense mutation leading to a premature termination codon (PTC) (p.Gln16X). The same mutation was found in all tested affected individuals in the family, but gave rise to marked phenotypic variability with minor clinical manifestations in some individuals, underscoring the clinical heterogeneity associated with the recently described PTC-causing mutations.

  4. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  5. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  6. Multilocus analysis reveals three candidate genes for Chinese migraine susceptibility.

    Science.gov (United States)

    An, X-K; Fang, J; Yu, Z-Z; Lin, Q; Lu, C-X; Qu, H-L; Ma, Q-L

    2017-08-01

    Several genome-wide association studies (GWASs) in Caucasian populations have identified 12 loci that are significantly associated with migraine. More evidence suggests that serotonin receptors are also involved in migraine pathophysiology. In the present study, a case-control study was conducted in a cohort of 581 migraine cases and 533 ethnically matched controls among a Chinese population. Eighteen polymorphisms from serotonin receptors and GWASs were selected, and genotyping was performed using a Sequenom MALDI-TOF mass spectrometry iPLEX platform. The genotypic and allelic distributions of MEF2D rs2274316 and ASTN2 rs6478241 were significantly different between migraine patients and controls. Univariate and multivariate analysis revealed significant associations of polymorphisms in the MEF2D and ASTN2 genes with migraine susceptibility. MEF2D, PRDM16 and ASTN2 were also found to be associated with migraine without aura (MO) and migraine with family history. And, MEF2D and ASTN2 also served as genetic risk factors for the migraine without family history. The generalized multifactor dimensionality reduction analysis identified that MEF2D and HTR2E constituted the two-factor interaction model. Our study suggests that the MEF2D, PRDM16 and ASTN2 genes from GWAS are associated with migraine susceptibility, especially MO, among Chinese patients. It appears that there is no association with serotonin receptor related genes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  9. Genome-wide identification and expression profiling of tomato Hsp20 gene family in response to biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    jiahong yu

    2016-08-01

    Full Text Available The Hsp20 genes are involved in the response of plants to environment stresses including heat shock and also play a vital role in plant growth and development. They represent the most abundant small heat shock proteins (sHsps in plants, but little is known about this family in tomato (Solanum lycopersicum, an important vegetable crop in the world. Here, we characterized heat shock protein 20 (SlHsp20 gene family in tomato through integration of gene structure, chromosome location, phylogenetic relationship and expression profile. Using bioinformatics-based methods, we identified at least 42 putative SlHsp20 genes in tomato. Sequence analysis revealed that most of SlHsp20 genes possessed no intron or a relatively short intron in length. Chromosome mapping indicated that inter-arm and intra-chromosome duplication events contributed remarkably to the expansion of SlHsp20 genes. Phylogentic tree of Hsp20 genes from tomato and other plant species revealed that SlHsp20 genes were grouped into 13 subfamilies, indicating that these genes may have a common ancestor that generated diverse subfamilies prior to the mono-dicot split. In addition, expression analysis using RNA-seq in various tissues and developmental stages of cultivated tomato and the wild relative Solanum pimpinellifolium revealed that most of these genes (83% were expressed in at least one stage from at least one genotype. Out of 42 genes, 4 genes were expressed constitutively in almost all the tissues analyzed, implying that these genes might have specific housekeeping function in tomato cell under normal growth conditions. Two SlHsp20 genes displayed differential expression levels between cultivated tomato and S. pimpinellifolium in vegetative (leaf and root and reproductive organs (floral bud and flower, suggesting inter-species diversification for functional specialization during the process of domestication. Based on genome-wide microarray analysis, we showed that the transcript

  10. Genome-Wide Identification and Expression Profiling of Tomato Hsp20 Gene Family in Response to Biotic and Abiotic Stresses.

    Science.gov (United States)

    Yu, Jiahong; Cheng, Yuan; Feng, Kun; Ruan, Meiying; Ye, Qingjing; Wang, Rongqing; Li, Zhimiao; Zhou, Guozhi; Yao, Zhuping; Yang, Yuejian; Wan, Hongjian

    2016-01-01

    The Hsp20 genes are involved in the response of plants to environment stresses including heat shock and also play a vital role in plant growth and development. They represent the most abundant small heat shock proteins (sHsps) in plants, but little is known about this family in tomato (Solanum lycopersicum), an important vegetable crop in the world. Here, we characterized heat shock protein 20 (SlHsp20) gene family in tomato through integration of gene structure, chromosome location, phylogenetic relationship, and expression profile. Using bioinformatics-based methods, we identified at least 42 putative SlHsp20 genes in tomato. Sequence analysis revealed that most of SlHsp20 genes possessed no intron or a relatively short intron in length. Chromosome mapping indicated that inter-arm and intra-chromosome duplication events contributed remarkably to the expansion of SlHsp20 genes. Phylogentic tree of Hsp20 genes from tomato and other plant species revealed that SlHsp20 genes were grouped into 13 subfamilies, indicating that these genes may have a common ancestor that generated diverse subfamilies prior to the mono-dicot split. In addition, expression analysis using RNA-seq in various tissues and developmental stages of cultivated tomato and the wild relative Solanum pimpinellifolium revealed that most of these genes (83%) were expressed in at least one stage from at least one genotype. Out of 42 genes, 4 genes were expressed constitutively in almost all the tissues analyzed, implying that these genes might have specific housekeeping function in tomato cell under normal growth conditions. Two SlHsp20 genes displayed differential expression levels between cultivated tomato and S. pimpinellifolium in vegetative (leaf and root) and reproductive organs (floral bud and flower), suggesting inter-species diversification for functional specialization during the process of domestication. Based on genome-wide microarray analysis, we showed that the transcript levels of SlHsp20

  11. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  12. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  13. Global gene expression analysis of the zoonotic parasite Trichinella spiralis revealed novel genes in host parasite interaction.

    Directory of Open Access Journals (Sweden)

    Xiaolei Liu

    Full Text Available BACKGROUND: Trichinellosis is a typical food-borne zoonotic disease which is epidemic worldwide and the nematode Trichinella spiralis is the main pathogen. The life cycle of T. spiralis contains three developmental stages, i.e. adult worms, new borne larva (new borne L1 larva and muscular larva (infective L1 larva. Stage-specific gene expression in the parasites has been investigated with various immunological and cDNA cloning approaches, whereas the genome-wide transcriptome and expression features of the parasite have been largely unknown. The availability of the genome sequence information of T. spiralis has made it possible to deeply dissect parasite biology in association with global gene expression and pathogenesis. METHODOLOGY AND PRINCIPAL FINDINGS: In this study, we analyzed the global gene expression patterns in the three developmental stages of T. spiralis using digital gene expression (DGE analysis. Almost 15 million sequence tags were generated with the Illumina RNA-seq technology, producing expression data for more than 9,000 genes, covering 65% of the genome. The transcriptome analysis revealed thousands of differentially expressed genes within the genome, and importantly, a panel of genes encoding functional proteins associated with parasite invasion and immuno-modulation were identified. More than 45% of the genes were found to be transcribed from both strands, indicating the importance of RNA-mediated gene regulation in the development of the parasite. Further, based on gene ontological analysis, over 3000 genes were functionally categorized and biological pathways in the three life cycle stage were elucidated. CONCLUSIONS AND SIGNIFICANCE: The global transcriptome of T. spiralis in three developmental stages has been profiled, and most gene activity in the genome was found to be developmentally regulated. Many metabolic and biological pathways have been revealed. The findings of the differential expression of several protein

  14. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  15. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  16. Phylogenetic analysis of ferlin genes reveals ancient eukaryotic origins

    Directory of Open Access Journals (Sweden)

    Lek Monkol

    2010-07-01

    Full Text Available Abstract Background The ferlin gene family possesses a rare and identifying feature consisting of multiple tandem C2 domains and a C-terminal transmembrane domain. Much currently remains unknown about the fundamental function of this gene family, however, mutations in its two most well-characterised members, dysferlin and otoferlin, have been implicated in human disease. The availability of genome sequences from a wide range of species makes it possible to explore the evolution of the ferlin family, providing contextual insight into characteristic features that define the ferlin gene family in its present form in humans. Results Ferlin genes were detected from all species of representative phyla, with two ferlin subgroups partitioned within the ferlin phylogenetic tree based on the presence or absence of a DysF domain. Invertebrates generally possessed two ferlin genes (one with DysF and one without, with six ferlin genes in most vertebrates (three DysF, three non-DysF. Expansion of the ferlin gene family is evident between the divergence of lamprey (jawless vertebrates and shark (cartilaginous fish. Common to almost all ferlins is an N-terminal C2-FerI-C2 sandwich, a FerB motif, and two C-terminal C2 domains (C2E and C2F adjacent to the transmembrane domain. Preservation of these structural elements throughout eukaryotic evolution suggests a fundamental role of these motifs for ferlin function. In contrast, DysF, C2DE, and FerA are optional, giving rise to subtle differences in domain topologies of ferlin genes. Despite conservation of multiple C2 domains in all ferlins, the C-terminal C2 domains (C2E and C2F displayed higher sequence conservation and greater conservation of putative calcium binding residues across paralogs and orthologs. Interestingly, the two most studied non-mammalian ferlins (Fer-1 and Misfire in model organisms C. elegans and D. melanogaster, present as outgroups in the phylogenetic analysis, with results suggesting

  17. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  18. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  19. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  20. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  1. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  2. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  3. Genome-wide analysis of WRKY gene family in the sesame genome and identification of the WRKY genes involved in responses to abiotic stresses.

    Science.gov (United States)

    Li, Donghua; Liu, Pan; Yu, Jingyin; Wang, Linhai; Dossa, Komivi; Zhang, Yanxin; Zhou, Rong; Wei, Xin; Zhang, Xiurong

    2017-09-11

    Sesame (Sesamum indicum L.) is one of the world's most important oil crops. However, it is susceptible to abiotic stresses in general, and to waterlogging and drought stresses in particular. The molecular mechanisms of abiotic stress tolerance in sesame have not yet been elucidated. The WRKY domain transcription factors play significant roles in plant growth, development, and responses to stresses. However, little is known about the number, location, structure, molecular phylogenetics, and expression of the WRKY genes in sesame. We performed a comprehensive study of the WRKY gene family in sesame and identified 71 SiWRKYs. In total, 65 of these genes were mapped to 15 linkage groups within the sesame genome. A phylogenetic analysis was performed using a related species (Arabidopsis thaliana) to investigate the evolution of the sesame WRKY genes. Tissue expression profiles of the WRKY genes demonstrated that six SiWRKY genes were highly expressed in all organs, suggesting that these genes may be important for plant growth and organ development in sesame. Analysis of the SiWRKY gene expression patterns revealed that 33 and 26 SiWRKYs respond strongly to waterlogging and drought stresses, respectively. Changes in the expression of 12 SiWRKY genes were observed at different times after the waterlogging and drought treatments had begun, demonstrating that sesame gene expression patterns vary in response to abiotic stresses. In this study, we analyzed the WRKY family of transcription factors encoded by the sesame genome. Insight was gained into the classification, evolution, and function of the SiWRKY genes, revealing their putative roles in a variety of tissues. Responses to abiotic stresses in different sesame cultivars were also investigated. The results of our study provide a better understanding of the structures and functions of sesame WRKY genes and suggest that manipulating these WRKYs could enhance resistance to waterlogging and drought.

  4. Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.

    Directory of Open Access Journals (Sweden)

    Giselle Sek Suan Nah

    Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.

  5. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    Science.gov (United States)

    Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

    2016-01-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

  6. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  7. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  8. Early stages of functional diversification in the Rab GTPase gene family revealed by genomic and localization studies in Paramecium species.

    Science.gov (United States)

    Bright, Lydia J; Gout, Jean-Francois; Lynch, Michael

    2017-04-15

    New gene functions arise within existing gene families as a result of gene duplication and subsequent diversification. To gain insight into the steps that led to the functional diversification of paralogues, we tracked duplicate retention patterns, expression-level divergence, and subcellular markers of functional diversification in the Rab GTPase gene family in three Paramecium aurelia species. After whole-genome duplication, Rab GTPase duplicates are more highly retained than other genes in the genome but appear to be diverging more rapidly in expression levels, consistent with early steps in functional diversification. However, by localizing specific Rab proteins in Paramecium cells, we found that paralogues from the two most recent whole-genome duplications had virtually identical localization patterns, and that less closely related paralogues showed evidence of both conservation and diversification. The functionally conserved paralogues appear to target to compartments associated with both endocytic and phagocytic recycling functions, confirming evolutionary and functional links between the two pathways in a divergent eukaryotic lineage. Because the functionally diversifying paralogues are still closely related to and derived from a clade of functionally conserved Rab11 genes, we were able to pinpoint three specific amino acid residues that may be driving the change in the localization and thus the function in these proteins. © 2017 Bright et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  9. Family-based Association Analyses of Imputed Genotypes Reveal Genome-Wide Significant Association of Alzheimer’s disease with OSBPL6, PTPRG and PDCL3

    Science.gov (United States)

    Herold, Christine; Hooli, Basavaraj V.; Mullin, Kristina; Liu, Tian; Roehr, Johannes T; Mattheisen, Manuel; Parrado, Antonio R.; Bertram, Lars; Lange, Christoph; Tanzi, Rudolph E.

    2015-01-01

    The genetic basis of Alzheimer's disease (AD) is complex and heterogeneous. Over 200 highly penetrant pathogenic variants in the genes APP, PSEN1 and PSEN2 cause a subset of early-onset familial Alzheimer's disease (EOFAD). On the other hand, susceptibility to late-onset forms of AD (LOAD) is indisputably associated to the ε4 allele in the gene APOE, and more recently to variants in more than two-dozen additional genes identified in the large-scale genome-wide association studies (GWAS) and meta-analyses reports. Taken together however, although the heritability in AD is estimated to be as high as 80%, a large proportion of the underlying genetic factors still remain to be elucidated. In this study we performed a systematic family-based genome-wide association and meta-analysis on close to 15 million imputed variants from three large collections of AD families (~3,500 subjects from 1,070 families). Using a multivariate phenotype combining affection status and onset age, meta-analysis of the association results revealed three single nucleotide polymorphisms (SNPs) that achieved genome-wide significance for association with AD risk: rs7609954 in the gene PTPRG (P-value = 3.98·10−08), rs1347297 in the gene OSBPL6 (P-value = 4.53·10−08), and rs1513625 near PDCL3 (P-value = 4.28·10−08). In addition, rs72953347 in OSBPL6 (P-value = 6.36·10−07) and two SNPs in the gene CDKAL1 showed marginally significant association with LOAD (rs10456232, P-value: 4.76·10−07; rs62400067, P-value: 3.54·10−07). In summary, family-based GWAS meta-analysis of imputed SNPs revealed novel genomic variants in (or near) PTPRG, OSBPL6, and PDCL3 that influence risk for AD with genome-wide significance. PMID:26830138

  10. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  11. Almost 2% of Spanish breast cancer families are associated to germline pathogenic mutations in the ATM gene.

    Science.gov (United States)

    Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A

    2017-02-01

    There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.

  12. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  13. Genome-wide analysis of the potato Hsp20 gene family: identification, genomic organization and expression profiles in response to heat stress.

    Science.gov (United States)

    Zhao, Peng; Wang, Dongdong; Wang, Ruoqiu; Kong, Nana; Zhang, Chao; Yang, Chenghui; Wu, Wentao; Ma, Haoli; Chen, Qin

    2018-01-18

    Heat shock proteins (Hsps) are essential components in plant tolerance mechanism under various abiotic stresses. Hsp20 is the major family of heat shock proteins, but little of Hsp20 family is known in potato (Solanum tuberosum), which is an important vegetable crop that is thermosensitive. To reveal the mechanisms of potato Hsp20s coping with abiotic stresses, analyses of the potato Hsp20 gene family were conducted using bioinformatics-based methods. In total, 48 putative potato Hsp20 genes (StHsp20s) were identified and named according to their chromosomal locations. A sequence analysis revealed that most StHsp20 genes (89.6%) possessed no, or only one, intron. A phylogenetic analysis indicated that all of the StHsp20 genes, except 10, were grouped into 12 subfamilies. The 48 StHsp20 genes were randomly distributed on 12 chromosomes. Nineteen tandem duplicated StHsp20s and one pair of segmental duplicated genes (StHsp20-15 and StHsp20-48) were identified. A cis-element analysis inferred that StHsp20s, except for StHsp20-41, possessed at least one stress response cis-element. A heatmap of the StHsp20 gene family showed that the genes, except for StHsp20-2 and StHsp20-45, were expressed in various tissues and organs. Real-time quantitative PCR was used to detect the expression level of StHsp20 genes and demonstrated that the genes responded to multiple abiotic stresses, such as heat, salt or drought stress. The relative expression levels of 14 StHsp20 genes (StHsp20-4, 6, 7, 9, 20, 21, 33, 34, 35, 37, 41, 43, 44 and 46) were significantly up-regulated (more than 100-fold) under heat stress. These results provide valuable information for clarifying the evolutionary relationship of the StHsp20 family and in aiding functional characterization of StHsp20 genes in further research.

  14. Neurexin gene family variants as risk factors for autism spectrum disorder.

    Science.gov (United States)

    Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran

    2018-01-01

    Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  15. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  16. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  17. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  18. Transmission of the PabI family of restriction DNA glycosylase genes: mobility and long-term inheritance.

    Science.gov (United States)

    Kojima, Kenji K; Kobayashi, Ichizo

    2015-10-19

    R.PabI is an exceptional restriction enzyme that functions as a DNA glycosylase. The enzyme excises an unmethylated base from its recognition sequence to generate apurinic/apyrimidinic (AP) sites, and also displays AP lyase activity, cleaving the DNA backbone at the AP site to generate the 3'-phospho alpha, beta-unsaturated aldehyde end in addition to the 5'-phosphate end. The resulting ends are difficult to religate with DNA ligase. The enzyme was originally isolated in Pyrococcus, a hyperthermophilic archaeon, and additional homologs subsequently identified in the epsilon class of the Gram-negative bacterial phylum Proteobacteria, such as Helicobacter pylori. Systematic analysis of R.PabI homologs and their neighboring genes in sequenced genomes revealed co-occurrence of R.PabI with M.PabI homolog methyltransferase genes. R.PabI and M.PabI homolog genes are occasionally found at corresponding (orthologous) loci in different species, such as Helicobacter pylori, Helicobacter acinonychis and Helicobacter cetorum, indicating long-term maintenance of the gene pair. One R.PabI and M.PabI homolog gene pair is observed immediately after the GMP synthase gene in both Campylobacter and Helicobacter, representing orthologs beyond genera. The mobility of the PabI family of restriction-modification (RM) system between genomes is evident upon comparison of genomes of sibling strains/species. Analysis of R.PabI and M.PabI homologs in H. pylori revealed an insertion of integrative and conjugative elements (ICE), and replacement with a gene of unknown function that may specify a membrane-associated toxin (hrgC). In view of the similarity of HrgC with toxins in type I toxin-antitoxin systems, we addressed the biological significance of this substitution. Our data indicate that replacement with hrgC occurred in the common ancestor of hspAmerind and hspEAsia. Subsequently, H. pylori with and without hrgC were intermixed at this locus, leading to complex distribution of hrgC in East

  19. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, andexpression analysis

    Directory of Open Access Journals (Sweden)

    Glen Peter

    2009-12-01

    Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig

  1. Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

    Science.gov (United States)

    Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

    2016-07-01

    Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    Science.gov (United States)

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  3. Heterologous expression and transcript analysis of gibberellin biosynthetic genes of grasses reveals novel functionality in the GA3ox family.

    Science.gov (United States)

    Pearce, Stephen; Huttly, Alison K; Prosser, Ian M; Li, Yi-dan; Vaughan, Simon P; Gallova, Barbora; Patil, Archana; Coghill, Jane A; Dubcovsky, Jorge; Hedden, Peter; Phillips, Andrew L

    2015-06-05

    The gibberellin (GA) pathway plays a central role in the regulation of plant development, with the 2-oxoglutarate-dependent dioxygenases (2-ODDs: GA20ox, GA3ox, GA2ox) that catalyse the later steps in the biosynthetic pathway of particularly importance in regulating bioactive GA levels. Although GA has important impacts on crop yield and quality, our understanding of the regulation of GA biosynthesis during wheat and barley development remains limited. In this study we identified or assembled genes encoding the GA 2-ODDs of wheat, barley and Brachypodium distachyon and characterised the wheat genes by heterologous expression and transcript analysis. The wheat, barley and Brachypodium genomes each contain orthologous copies of the GA20ox, GA3ox and GA2ox genes identified in rice, with the exception of OsGA3ox1 and OsGA2ox5 which are absent in these species. Some additional paralogs of 2-ODD genes were identified: notably, a novel gene in the wheat B genome related to GA3ox2 was shown to encode a GA 1-oxidase, named as TaGA1ox-B1. This enzyme is likely to be responsible for the abundant 1β-hydroxylated GAs present in developing wheat grains. We also identified a related gene in barley, located in a syntenic position to TaGA1ox-B1, that encodes a GA 3,18-dihydroxylase which similarly accounts for the accumulation of unusual GAs in barley grains. Transcript analysis showed that some paralogs of the different classes of 2-ODD were expressed mainly in a single tissue or at specific developmental stages. In particular, TaGA20ox3, TaGA1ox1, TaGA3ox3 and TaGA2ox7 were predominantly expressed in developing grain. More detailed analysis of grain-specific gene expression showed that while the transcripts of biosynthetic genes were most abundant in the endosperm, genes encoding inactivation and signalling components were more highly expressed in the seed coat and pericarp. The comprehensive expression and functional characterisation of the multigene families encoding the 2-ODD

  4. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  5. Genome-wide identification and expression analysis of the CIPK gene family in cassava

    Directory of Open Access Journals (Sweden)

    Wei eHu

    2015-10-01

    Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.

  6. Genomic analysis of primordial dwarfism reveals novel disease genes.

    Science.gov (United States)

    Shaheen, Ranad; Faqeih, Eissa; Ansari, Shinu; Abdel-Salam, Ghada; Al-Hassnan, Zuhair N; Al-Shidi, Tarfa; Alomar, Rana; Sogaty, Sameera; Alkuraya, Fowzan S

    2014-02-01

    Primordial dwarfism (PD) is a disease in which severely impaired fetal growth persists throughout postnatal development and results in stunted adult size. The condition is highly heterogeneous clinically, but the use of certain phenotypic aspects such as head circumference and facial appearance has proven helpful in defining clinical subgroups. In this study, we present the results of clinical and genomic characterization of 16 new patients in whom a broad definition of PD was used (e.g., 3M syndrome was included). We report a novel PD syndrome with distinct facies in two unrelated patients, each with a different homozygous truncating mutation in CRIPT. Our analysis also reveals, in addition to mutations in known PD disease genes, the first instance of biallelic truncating BRCA2 mutation causing PD with normal bone marrow analysis. In addition, we have identified a novel locus for Seckel syndrome based on a consanguineous multiplex family and identified a homozygous truncating mutation in DNA2 as the likely cause. An additional novel PD disease candidate gene XRCC4 was identified by autozygome/exome analysis, and the knockout mouse phenotype is highly compatible with PD. Thus, we add a number of novel genes to the growing list of PD-linked genes, including one which we show to be linked to a novel PD syndrome with a distinct facial appearance. PD is extremely heterogeneous genetically and clinically, and genomic tools are often required to reach a molecular diagnosis.

  7. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  8. Understanding familial and non-familial renal cell cancer.

    Science.gov (United States)

    Bodmer, Daniëlle; van den Hurk, Wilhelmina; van Groningen, Jan J M; Eleveld, Marc J; Martens, Gerard J M; Weterman, Marian A J; van Kessel, Ad Geurts

    2002-10-01

    Molecular genetic analysis of familial and non-familial cases of conventional renal cell carcinoma (RCC) revealed a critical role(s) for multiple genes on human chromosome 3. For some of these genes, e.g. VHL, such a role has been firmly established, whereas for others, definite confirmation is still pending. Additionally, a novel role for constitutional chromosome 3 translocations as risk factors for conventional RCC development is rapidly emerging. Also, several candidate loci have been mapped to other chromosomes in both familial and non-familial RCCs of distinct histologic subtypes. The MET gene on chromosome 7, for example, was found to be involved in both forms of papillary RCC. A PRCC-TFE3 fusion gene is typically encountered in t(X;1)-positive non-familial papillary RCCs and results in abrogation of the cell cycle mitotic spindle checkpoint in a dominant-negative fashion, thus leading to RCC. Together, these data turn human RCC into a model system in which different aspects of both familial and non-familial syndromes may act as novel paradigms for cancer development.

  9. Genome-wide analysis of the sox family in the calcareous sponge Sycon ciliatum: multiple genes with unique expression patterns

    Directory of Open Access Journals (Sweden)

    Fortunato Sofia

    2012-07-01

    Full Text Available Abstract Background Sox genes are HMG-domain containing transcription factors with important roles in developmental processes in animals; many of them appear to have conserved functions among eumetazoans. Demosponges have fewer Sox genes than eumetazoans, but their roles remain unclear. The aim of this study is to gain insight into the early evolutionary history of the Sox gene family by identification and expression analysis of Sox genes in the calcareous sponge Sycon ciliatum. Methods Calcaronean Sox related sequences were retrieved by searching recently generated genomic and transcriptome sequence resources and analyzed using variety of phylogenetic methods and identification of conserved motifs. Expression was studied by whole mount in situ hybridization. Results We have identified seven Sox genes and four Sox-related genes in the complete genome of Sycon ciliatum. Phylogenetic and conserved motif analyses showed that five of Sycon Sox genes represent groups B, C, E, and F present in cnidarians and bilaterians. Two additional genes are classified as Sox genes but cannot be assigned to specific subfamilies, and four genes are more similar to Sox genes than to other HMG-containing genes. Thus, the repertoire of Sox genes is larger in this representative of calcareous sponges than in the demosponge Amphimedon queenslandica. It remains unclear whether this is due to the expansion of the gene family in Sycon or a secondary reduction in the Amphimedon genome. In situ hybridization of Sycon Sox genes revealed a variety of expression patterns during embryogenesis and in specific cell types of adult sponges. Conclusions In this study, we describe a large family of Sox genes in Sycon ciliatum with dynamic expression patterns, indicating that Sox genes are regulators in development and cell type determination in sponges, as observed in higher animals. The revealed differences between demosponge and calcisponge Sox genes repertoire highlight the need to

  10. Gene Structures, Evolution, Classification and Expression Profiles of the Aquaporin Gene Family in Castor Bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Zhi Zou

    Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.

  11. A Novel WT1 Gene Mutation in a Three-Generation Family with Progressive Isolated Focal Segmental Glomerulosclerosis

    Science.gov (United States)

    Caridi, Gianluca; Malaventura, Cristina; Dagnino, Monica; Leonardi, Emanuela; Artifoni, Lina; Ghiggeri, Gian Marco; Tosatto, Silvio C.E.; Murer, Luisa

    2010-01-01

    Background and objectives: Wilms tumor-suppressor gene-1 (WT1) plays a key role in kidney development and function. WT1 mutations usually occur in exons 8 and 9 and are associated with Denys-Drash, or in intron 9 and are associated with Frasier syndrome. However, overlapping clinical and molecular features have been reported. Few familial cases have been described, with intrafamilial variability. Sporadic cases of WT1 mutations in isolated diffuse mesangial sclerosis or focal segmental glomerulosclerosis have also been reported. Design, setting, participants, & measurements: Molecular analysis of WT1 exons 8 and 9 was carried out in five members on three generations of a family with late-onset isolated proteinuria. The effect of the detected amino acid substitution on WT1 protein's structure was studied by bioinformatics tools. Results: Three family members reached end-stage renal disease in full adulthood. None had genital abnormalities or Wilms tumor. Histologic analysis in two subjects revealed focal segmental glomerulosclerosis. The novel sequence variant c.1208G>A in WT1 exon 9 was identified in all of the affected members of the family. Conclusions: The lack of Wilms tumor or other related phenotypes suggests the expansion of WT1 gene analysis in patients with focal segmental glomerulosclerosis, regardless of age or presence of typical Denys-Drash or Frasier syndrome clinical features. Structural analysis of the mutated protein revealed that the mutation hampers zinc finger-DNA interactions, impairing target gene transcription. This finding opens up new issues about WT1 function in the maintenance of the complex gene network that regulates normal podocyte function. PMID:20150449

  12. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  13. Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza.

    Science.gov (United States)

    Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

    2017-03-17

    Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.

  14. Gene organization in rice revealed by full-length cDNA mapping and gene expression analysis through microarray.

    Directory of Open Access Journals (Sweden)

    Kouji Satoh

    Full Text Available Rice (Oryza sativa L. is a model organism for the functional genomics of monocotyledonous plants since the genome size is considerably smaller than those of other monocotyledonous plants. Although highly accurate genome sequences of indica and japonica rice are available, additional resources such as full-length complementary DNA (FL-cDNA sequences are also indispensable for comprehensive analyses of gene structure and function. We cross-referenced 28.5K individual loci in the rice genome defined by mapping of 578K FL-cDNA clones with the 56K loci predicted in the TIGR genome assembly. Based on the annotation status and the presence of corresponding cDNA clones, genes were classified into 23K annotated expressed (AE genes, 33K annotated non-expressed (ANE genes, and 5.5K non-annotated expressed (NAE genes. We developed a 60mer oligo-array for analysis of gene expression from each locus. Analysis of gene structures and expression levels revealed that the general features of gene structure and expression of NAE and ANE genes were considerably different from those of AE genes. The results also suggested that the cloning efficiency of rice FL-cDNA is associated with the transcription activity of the corresponding genetic locus, although other factors may also have an effect. Comparison of the coverage of FL-cDNA among gene families suggested that FL-cDNA from genes encoding rice- or eukaryote-specific domains, and those involved in regulatory functions were difficult to produce in bacterial cells. Collectively, these results indicate that rice genes can be divided into distinct groups based on transcription activity and gene structure, and that the coverage bias of FL-cDNA clones exists due to the incompatibility of certain eukaryotic genes in bacteria.

  15. Analysis of four achaete-scute homologs in Bombyx mori reveals new viewpoints of the evolution and functions of this gene family

    OpenAIRE

    Zhou, Qingxiang; Zhang, Tianyi; Xu, Weihua; Yu, Linlin; Yi, Yongzhu; Zhang, Zhifang

    2008-01-01

    Abstract Background achaete-scute complexe (AS-C) has been widely studied at genetic, developmental and evolutional levels. Genes of this family encode proteins containing a highly conserved bHLH domain, which take part in the regulation of the development of central nervous system and peripheral nervous system. Many AS-C homologs have been isolated from various vertebrates and invertebrates. Also, AS-C genes are duplicated during the evolution of Diptera. Functions besides neural development...

  16. Genome-Wide Identification, Phylogenetic and Expression Analyses of the Ubiquitin-Conjugating Enzyme Gene Family in Maize

    Science.gov (United States)

    Jue, Dengwei; Sang, Xuelian; Lu, Shengqiao; Dong, Chen; Zhao, Qiufang; Chen, Hongliang; Jia, Liqiang

    2015-01-01

    Background Ubiquitination is a post-translation modification where ubiquitin is attached to a substrate. Ubiquitin-conjugating enzymes (E2s) play a major role in the ubiquitin transfer pathway, as well as a variety of functions in plant biological processes. To date, no genome-wide characterization of this gene family has been conducted in maize (Zea mays). Methodology/Principal Findings In the present study, a total of 75 putative ZmUBC genes have been identified and located in the maize genome. Phylogenetic analysis revealed that ZmUBC proteins could be divided into 15 subfamilies, which include 13 ubiquitin-conjugating enzymes (ZmE2s) and two independent ubiquitin-conjugating enzyme variant (UEV) groups. The predicted ZmUBC genes were distributed across 10 chromosomes at different densities. In addition, analysis of exon-intron junctions and sequence motifs in each candidate gene has revealed high levels of conservation within and between phylogenetic groups. Tissue expression analysis indicated that most ZmUBC genes were expressed in at least one of the tissues, indicating that these are involved in various physiological and developmental processes in maize. Moreover, expression profile analyses of ZmUBC genes under different stress treatments (4°C, 20% PEG6000, and 200 mM NaCl) and various expression patterns indicated that these may play crucial roles in the response of plants to stress. Conclusions Genome-wide identification, chromosome organization, gene structure, evolutionary and expression analyses of ZmUBC genes have facilitated in the characterization of this gene family, as well as determined its potential involvement in growth, development, and stress responses. This study provides valuable information for better understanding the classification and putative functions of the UBC-encoding genes of maize. PMID:26606743

  17. Targeted Enrichment of Large Gene Families for Phylogenetic Inference: Phylogeny and Molecular Evolution of Photosynthesis Genes in the Portullugo Clade (Caryophyllales).

    Science.gov (United States)

    Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J

    2018-05-01

    Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.

  18. Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dong, Chun-Juan; Shang, Qing-Mao

    2013-07-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.

  19. Genome-wide identification and tissue-specific expression analysis of nucleotide binding site-leucine rich repeat gene family in Cicer arietinum (kabuli chickpea).

    Science.gov (United States)

    Sharma, Ranu; Rawat, Vimal; Suresh, C G

    2017-12-01

    The nucleotide binding site-leucine rich repeat (NBS-LRR) proteins play an important role in the defense mechanisms against pathogens. Using bioinformatics approach, we identified and annotated 104 NBS-LRR genes in chickpea. Phylogenetic analysis points to their diversification into two families namely TIR-NBS-LRR and non-TIR-NBS-LRR. Gene architecture revealed intron gain/loss events in this resistance gene family during their independent evolution into two families. Comparative genomics analysis elucidated its evolutionary relationship with other fabaceae species. Around 50% NBS-LRRs reside in macro-syntenic blocks underlining positional conservation along with sequence conservation of NBS-LRR genes in chickpea. Transcriptome sequencing data provided evidence for their transcription and tissue-specific expression. Four cis -regulatory elements namely WBOX, DRE, CBF, and GCC boxes, that commonly occur in resistance genes, were present in the promoter regions of these genes. Further, the findings will provide a strong background to use candidate disease resistance NBS-encoding genes and identify their specific roles in chickpea.

  20. Transcriptome analysis of WRKY gene family in Oryza officinalis Wall ex Watt and WRKY genes involved in responses to Xanthomonas oryzae pv. oryzae stress.

    Science.gov (United States)

    Jiang, Chunmiao; Shen, Qingxi J; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan

    2017-01-01

    Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, pWRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight.

  1. Genome-wide analysis of the expansin gene superfamily reveals grapevine-specific structural and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Silvia Dal Santo

    Full Text Available BACKGROUND: Expansins are proteins that loosen plant cell walls in a pH-dependent manner, probably by increasing the relative movement among polymers thus causing irreversible expansion. The expansin superfamily (EXP comprises four distinct families: expansin A (EXPA, expansin B (EXPB, expansin-like A (EXLA and expansin-like B (EXLB. There is experimental evidence that EXPA and EXPB proteins are required for cell expansion and developmental processes involving cell wall modification, whereas the exact functions of EXLA and EXLB remain unclear. The complete grapevine (Vitis vinifera genome sequence has allowed the characterization of many gene families, but an exhaustive genome-wide analysis of expansin gene expression has not been attempted thus far. METHODOLOGY/PRINCIPAL FINDINGS: We identified 29 EXP superfamily genes in the grapevine genome, representing all four EXP families. Members of the same EXP family shared the same exon-intron structure, and phylogenetic analysis confirmed a closer relationship between EXP genes from woody species, i.e. grapevine and poplar (Populus trichocarpa, compared to those from Arabidopsis thaliana and rice (Oryza sativa. We also identified grapevine-specific duplication events involving the EXLB family. Global gene expression analysis confirmed a strong correlation among EXP genes expressed in mature and green/vegetative samples, respectively, as reported for other gene families in the recently-published grapevine gene expression atlas. We also observed the specific co-expression of EXLB genes in woody organs, and the involvement of certain grapevine EXP genes in berry development and post-harvest withering. CONCLUSION: Our comprehensive analysis of the grapevine EXP superfamily confirmed and extended current knowledge about the structural and functional characteristics of this gene family, and also identified properties that are currently unique to grapevine expansin genes. Our data provide a model for the

  2. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  3. XPC gene mutations in families with xeroderma pigmentosum from Pakistan; prevalent founder effect.

    Science.gov (United States)

    Ijaz, Ambreen; Basit, Sulman; Gul, Ajab; Batool, Lilas; Hussain, Abrar; Afzal, Sibtain; Ramzan, Khushnooda; Ahmad, Jamil; Wali, Abdul

    2018-03-23

    Xeroderma pigmentosum (XP) is a rare autosomal recessive skin disorder characterized by hyperpigmentation, premature skin aging, ocular and cutaneous photosensitivity, and increased risk of skin carcinoma. We investigated seven consanguineous XP families with nine patients from Pakistan. All the Patients exhibited typical clinical symptoms of XP since first year of life. Whole genome SNP genotyping identified a 14 Mb autozygous region segregating with the disease phenotype on chromosome 3p25.1. DNA sequencing of XPC gene revealed a founder homozygous splice site mutation (c.2251-1G>C) in patients from six families (A-F) and a homozygous nonsense mutation (c.1399C>T; p.Gln467*) in patients of family G. This is the first report of XPC mutations, underlying XP phenotype, in Pakistani population. © 2018 Japanese Teratology Society.

  4. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  5. Genome-wide identification and expression analysis of MAPK and MAPKK gene family in Malus domestica.

    Science.gov (United States)

    Zhang, Shizhong; Xu, Ruirui; Luo, Xiaocui; Jiang, Zesheng; Shu, Huairui

    2013-12-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, which are composed of three classes of hierarchically organized protein kinases, namely MAPKKKs, MAPKKs, and MAPKs. Although genome-wide analysis of this family has been carried out in some species, little is known about MAPK and MAPKK genes in apple (Malus domestica). In this study, a total of 26 putative apple MAPK genes (MdMPKs) and 9 putative apple MAPKK genes (MdMKKs) have been identified and located within the apple genome. Phylogenetic analysis revealed that MdMAPKs and MdMAPKKs could be divided into 4 subfamilies (groups A, B, C and D), respectively. The predicted MdMAPKs and MdMAPKKs were distributed across 13 out of 17 chromosomes with different densities. In addition, analysis of exon-intron junctions and of intron phase inside the predicted coding region of each candidate gene has revealed high levels of conservation within and between phylogenetic groups. According to the microarray and expressed sequence tag (EST) analysis, the different expression patterns indicate that they may play different roles during fruit development and rootstock-scion interaction process. Moreover, MAPK and MAPKK genes were performed expression profile analyses in different tissues (root, stem, leaf, flower and fruit), and all of the selected genes were expressed in at least one of the tissues tested, indicating that the MAPKs and MAPKKs are involved in various aspects of physiological and developmental processes of apple. To our knowledge, this is the first report of a genome-wide analysis of the apple MAPK and MAPKK gene family. This study provides valuable information for understanding the classification and putative functions of the MAPK signal in apple. © 2013.

  6. Synthesis, antimicrobial activity and gene structure of a novel member of the dermaseptin B family.

    Science.gov (United States)

    Fleury, Y; Vouille, V; Beven, L; Amiche, M; Wróblewski, H; Delfour, A; Nicolas, P

    1998-03-09

    Dermaseptins are a family of cationic (Lys-rich) antimicrobial peptides that are abundant in the skin secretions of the arboreal frogs Phyllomedusa bicolor and P. sauvagii. In vitro, these peptides are microbicidal against a wide variety of microorganisms including Gram-positive and Gram-negative bacteria, yeasts, protozoa and fungi. To date, 6 dermaseptin B mature peptides, 24-34 residues long, 2 dermaseptin B cDNAs and 2 gene sequences have been identified in P. bicolor. To assess dermaseptin related genes further, we screened a P. bicolor genomic library with 32P-labeled cDNAs coding either for prepro-dermaseptins B1 or B2 (adenoregulin). A gene sequence was identified that coded a novel dermaseptin B, termed Drg3, which exhibits 23-42% amino acids identities with other members of the family. Analysis of the cDNAs coding precursors for several opioid and antimicrobial peptides originating from the skin of various amphibian species revealed that the 25-residue preproregion of these preproforms are all encoded by conserved nucleotides encompassed by the first coding exon of the Drg3 gene. Synthetic dermaseptin Drg3 exhibited a bactericidal activity towards several species of mollicutes (wall-less eubacteria), firmicutes (Gram-positive eubacteria), and gracilicutes (Gram-negative eubacteria), with minimal inhibitory concentrations (MICs) ranging from 6.25 to 100 microM. Experiments performed on Acholeplasma laidlawii cells revealed that this peptide is membranotropic and that if efficiently depolarizes the plasma membrane.

  7. Microevolution of Virulence-Related Genes in Helicobacter pylori Familial Infection.

    Directory of Open Access Journals (Sweden)

    Yoshikazu Furuta

    Full Text Available Helicobacter pylori, a bacterial pathogen that can infect human stomach causing gastritis, ulcers and cancer, is known to have a high degree of genome/epigenome diversity as the result of mutation and recombination. The bacteria often infect in childhood and persist for the life of the host. One of the reasons of the rapid evolution of H. pylori is that it changes its genome drastically for adaptation to a new host. To investigate microevolution and adaptation of the H. pylori genome, we undertook whole genome sequencing of the same or very similar sequence type in multi-locus sequence typing (MLST with seven genes in members of the same family consisting of parents and children in Japan. Detection of nucleotide substitutions revealed likely transmission pathways involving children. Nonsynonymous (amino acid changing mutations were found in virulence-related genes (cag genes, vacA, hcpDX, tnfα, ggt, htrA and the collagenase gene, outer membrane protein (OMP genes and other cell surface-related protein genes, signal transduction genes and restriction-modification genes. We reconstructed various pathways by which H. pylori can adapt to a new human host, and our results raised the possibility that the mutational changes in virulence-related genes have a role in adaptation to a child host. Changes in restriction-modification genes might remodel the methylome and transcriptome to help adaptation. This study has provided insights into H. pylori transmission and virulence and has implications for basic research as well as clinical practice.

  8. Genome-Wide Characterization and Expression Profiling of the AUXIN RESPONSE FACTOR (ARF) Gene Family in Eucalyptus grandis

    Science.gov (United States)

    Yu, Hong; Soler, Marçal; Mila, Isabelle; San Clemente, Hélène; Savelli, Bruno; Dunand, Christophe; Paiva, Jorge A. P.; Myburg, Alexander A.; Bouzayen, Mondher; Grima-Pettenati, Jacqueline; Cassan-Wang, Hua

    2014-01-01

    Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF) are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation. PMID:25269088

  9. Genome-wide characterization and expression profiling of the AUXIN RESPONSE FACTOR (ARF gene family in Eucalyptus grandis.

    Directory of Open Access Journals (Sweden)

    Hong Yu

    Full Text Available Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation.

  10. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in the silkworm, Bombyx mori.

    Science.gov (United States)

    Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou

    2012-07-01

    The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.

  11. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  12. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  13. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  14. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  15. Whole-exome sequencing of a rare case of familial childhood acute lymphoblastic leukemia reveals putative predisposing mutations in Fanconi anemia genes.

    Science.gov (United States)

    Spinella, Jean-François; Healy, Jasmine; Saillour, Virginie; Richer, Chantal; Cassart, Pauline; Ouimet, Manon; Sinnett, Daniel

    2015-07-23

    Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. While the multi-step model of pediatric leukemogenesis suggests interplay between constitutional and somatic genomes, the role of inherited genetic variability remains largely undescribed. Nonsyndromic familial ALL, although extremely rare, provides the ideal setting to study inherited contributions to ALL. Toward this goal, we sequenced the exomes of a childhood ALL family consisting of mother, father and two non-twinned siblings diagnosed with concordant pre-B hyperdiploid ALL and previously shown to have inherited a rare form of PRDM9, a histone H3 methyltransferase involved in crossing-over at recombination hotspots and Holliday junctions. We postulated that inheritance of additional rare disadvantaging variants in predisposing cancer genes could affect genomic stability and lead to increased risk of hyperdiploid ALL within this family. Whole exomes were captured using Agilent's SureSelect kit and sequenced on the Life Technologies SOLiD System. We applied a data reduction strategy to identify candidate variants shared by both affected siblings. Under a recessive disease model, we focused on rare non-synonymous or frame-shift variants in leukemia predisposing pathways. Though the family was nonsyndromic, we identified a combination of rare variants in Fanconi anemia (FA) genes FANCP/SLX4 (compound heterozygote - rs137976282/rs79842542) and FANCA (rs61753269) and a rare homozygous variant in the Holliday junction resolvase GEN1 (rs16981869). These variants, predicted to affect protein function, were previously identified in familial breast cancer cases. Based on our in-house database of 369 childhood ALL exomes, the sibs were the only patients to carry this particularly rare combination and only a single hyperdiploid patient was heterozygote at both FANCP/SLX4 positions, while no FANCA variant allele carriers were identified. FANCA is the most commonly mutated gene in FA and is essential for

  16. Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins

    Directory of Open Access Journals (Sweden)

    Davey Jennifer C

    2007-12-01

    Full Text Available Abstract Background Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Results Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT. The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. Conclusion The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for

  17. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

    Science.gov (United States)

    Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

    2012-04-01

    Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

  18. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  19. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  20. Genome-wide identification and characterization of WRKY gene family in peanut

    Directory of Open Access Journals (Sweden)

    Hui eSong

    2016-04-01

    Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  1. Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun

    2016-01-01

    WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  2. Diversity of bacteria and glycosyl hydrolase family 48 genes in cellulolytic consortia enriched from thermophilic biocompost.

    Science.gov (United States)

    Izquierdo, Javier A; Sizova, Maria V; Lynd, Lee R

    2010-06-01

    The enrichment from nature of novel microbial communities with high cellulolytic activity is useful in the identification of novel organisms and novel functions that enhance the fundamental understanding of microbial cellulose degradation. In this work we identify predominant organisms in three cellulolytic enrichment cultures with thermophilic compost as an inoculum. Community structure based on 16S rRNA gene clone libraries featured extensive representation of clostridia from cluster III, with minor representation of clostridial clusters I and XIV and a novel Lutispora species cluster. Our studies reveal different levels of 16S rRNA gene diversity, ranging from 3 to 18 operational taxonomic units (OTUs), as well as variability in community membership across the three enrichment cultures. By comparison, glycosyl hydrolase family 48 (GHF48) diversity analyses revealed a narrower breadth of novel clostridial genes associated with cultured and uncultured cellulose degraders. The novel GHF48 genes identified in this study were related to the novel clostridia Clostridium straminisolvens and Clostridium clariflavum, with one cluster sharing as little as 73% sequence similarity with the closest known relative. In all, 14 new GHF48 gene sequences were added to the known diversity of 35 genes from cultured species.

  3. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  4. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  5. Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.

    Science.gov (United States)

    Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang

    2015-06-30

    Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.

  6. Gene family expansions and contractions are associated with host range in plant pathogens of the genus Colletotrichum.

    Science.gov (United States)

    Baroncelli, Riccardo; Amby, Daniel Buchvaldt; Zapparata, Antonio; Sarrocco, Sabrina; Vannacci, Giovanni; Le Floch, Gaétan; Harrison, Richard J; Holub, Eric; Sukno, Serenella A; Sreenivasaprasad, Surapareddy; Thon, Michael R

    2016-08-05

    Many species belonging to the genus Colletotrichum cause anthracnose disease on a wide range of plant species. In addition to their economic impact, the genus Colletotrichum is a useful model for the study of the evolution of host specificity, speciation and reproductive behaviors. Genome projects of Colletotrichum species have already opened a new era for studying the evolution of pathogenesis in fungi. We sequenced and annotated the genomes of four strains in the Colletotrichum acutatum species complex (CAsc), a clade of broad host range pathogens within the genus. The four CAsc proteomes and secretomes along with those representing an additional 13 species (six Colletotrichum spp. and seven other Sordariomycetes) were classified into protein families using a variety of tools. Hierarchical clustering of gene family and functional domain assignments, and phylogenetic analyses revealed lineage specific losses of carbohydrate-active enzymes (CAZymes) and proteases encoding genes in Colletotrichum species that have narrow host range as well as duplications of these families in the CAsc. We also found a lineage specific expansion of necrosis and ethylene-inducing peptide 1 (Nep1)-like protein (NLPs) families within the CAsc. This study illustrates the plasticity of Colletotrichum genomes, and shows that major changes in host range are associated with relatively recent changes in gene content.

  7. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  8. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  9. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  10. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  11. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  12. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  13. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  14. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    with microtubule-associated proteins. CTT residues overwhelming comprise the co-evolving residues between Drosophila alpha 2 and beta 3 tubulin proteins, indicating CTT specializations can be mediated at the level of the tubulin dimer. Gene duplications post-dating separation of the insect orders are unevenly distributed, most often appearing in major alpha 1 and minor beta 2 clades. More than 40 introns are found in tubulins. Their distribution among tubulins reveals that insertion and deletion events are common, surprising given their potential for disrupting tubulin coding sequence. Compensatory evolution is found in Drosophila beta 2 tubulin cis-regulation, and reveals selective pressures acting to maintain testis expression without the use of previously identified testis cis-regulatory elements. Conclusion Tubulins have stringent structure/function relationships, indicated by strong purifying selection, the loss of many gene duplication products, alpha-beta co-evolution in the tubulin dimer, and compensatory evolution in beta 2 tubulin cis-regulation. They evolve through gene duplication, subfunctionalization in expression domain and divergence of duplication products, largely in CTT residues that mediate interactions with other proteins. This has resulted in the tissue-specific minor insect isoforms, and in particular the highly diverse α3, α4, and β2 reproductive tissue-specific tubulin isoforms, illustrating that even a highly conserved protein family can participate in the adaptive process and respond to sexual selection.

  15. Molecular analysis of the NDP gene in two families with Norrie disease.

    Science.gov (United States)

    Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

    2005-04-01

    To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

  16. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  17. Comparative genomics of four closely related Clostridium perfringens bacteriophages reveals variable evolution among core genes with therapeutic potential

    Directory of Open Access Journals (Sweden)

    Siragusa Gregory R

    2011-06-01

    Full Text Available Abstract Background Because biotechnological uses of bacteriophage gene products as alternatives to conventional antibiotics will require a thorough understanding of their genomic context, we sequenced and analyzed the genomes of four closely related phages isolated from Clostridium perfringens, an important agricultural and human pathogen. Results Phage whole-genome tetra-nucleotide signatures and proteomic tree topologies correlated closely with host phylogeny. Comparisons of our phage genomes to 26 others revealed three shared COGs; of particular interest within this core genome was an endolysin (PF01520, an N-acetylmuramoyl-L-alanine amidase and a holin (PF04531. Comparative analyses of the evolutionary history and genomic context of these common phage proteins revealed two important results: 1 strongly significant host-specific sequence variation within the endolysin, and 2 a protein domain architecture apparently unique to our phage genomes in which the endolysin is located upstream of its associated holin. Endolysin sequences from our phages were one of two very distinct genotypes distinguished by variability within the putative enzymatically-active domain. The shared or core genome was comprised of genes with multiple sequence types belonging to five pfam families, and genes belonging to 12 pfam families, including the holin genes, which were nearly identical. Conclusions Significant genomic diversity exists even among closely-related bacteriophages. Holins and endolysins represent conserved functions across divergent phage genomes and, as we demonstrate here, endolysins can have significant variability and host-specificity even among closely-related genomes. Endolysins in our phage genomes may be subject to different selective pressures than the rest of the genome. These findings may have important implications for potential biotechnological applications of phage gene products.

  18. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  19. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  20. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  1. Genome-wide identification and functional analysis of the TIFY gene family in response to drought in cotton.

    Science.gov (United States)

    Zhao, Ge; Song, Yun; Wang, Caixiang; Butt, Hamama Islam; Wang, Qianhua; Zhang, Chaojun; Yang, Zuoren; Liu, Zhao; Chen, Eryong; Zhang, Xueyan; Li, Fuguang

    2016-12-01

    Jasmonates control many aspects of plant biological processes. They are important for regulating plant responses to various biotic and abiotic stresses, including drought, which is one of the most serious threats to sustainable agricultural production. However, little is known regarding how jasmonate ZIM-domain (JAZ) proteins mediate jasmonic acid signals to improve stress tolerance in cotton. This represents the first comprehensive comparative study of TIFY transcription factors in both diploid A, D and tetraploid AD cotton species. In this study, we identified 21 TIFY family members in the genome of Gossypium arboretum, 28 members from Gossypium raimondii and 50 TIFY genes in Gossypium hirsutum. The phylogenetic analyses indicated the TIFY gene family could be divided into the following four subfamilies: TIFY, PPD, ZML, and JAZ subfamilies. The cotton TIFY genes have expanded through tandem duplications and segmental duplications compared with other plant species. Gene expression profile revealed temporal and tissue specificities for TIFY genes under simulated drought conditions in Gossypium arboretum. The JAZ subfamily members were the most highly expressed genes, suggesting that they have a vital role in responses to drought stress. Over-expression of GaJAZ5 gene decreased water loss, stomatal openings, and the accumulation of H 2 O 2 in Arabidopsis thaliana. Additionally, the results of drought tolerance assays suggested that this subfamily might be involved in increasing drought tolerance. Our study provides new data regarding the genome-wide analysis of TIFY gene families and their important roles in drought tolerance in cotton species. These data may form the basis of future studies regarding the relationship between drought and jasmonic acid.

  2. Revealing gene action for production characteristics by inbreeding ...

    African Journals Online (AJOL)

    Revealing gene action for production characteristics by inbreeding, based on a long-term selection ... The gene action involved in the expression of production characters was investigated, using the effect of the theoretical inbreeding ..... and predicted selection responses for growth, fat and lean traits in mice. J. Anim. Sci.

  3. Analysis of four achaete-scute homologs in Bombyx mori reveals new viewpoints of the evolution and functions of this gene family.

    Science.gov (United States)

    Zhou, Qingxiang; Zhang, Tianyi; Xu, Weihua; Yu, Linlin; Yi, Yongzhu; Zhang, Zhifang

    2008-03-06

    achaete-scute complexe (AS-C) has been widely studied at genetic, developmental and evolutional levels. Genes of this family encode proteins containing a highly conserved bHLH domain, which take part in the regulation of the development of central nervous system and peripheral nervous system. Many AS-C homologs have been isolated from various vertebrates and invertebrates. Also, AS-C genes are duplicated during the evolution of Diptera. Functions besides neural development controlling have also been found in Drosophila AS-C genes. We cloned four achaete-scute homologs (ASH) from the lepidopteran model organism Bombyx mori, including three proneural genes and one neural precursor gene. Proteins encoded by them contained the characteristic bHLH domain and the three proneural ones were also found to have the C-terminal conserved motif. These genes regulated promoter activity through the Class A E-boxes in vitro. Though both Bm-ASH and Drosophila AS-C have four members, they are not in one by one corresponding relationships. Results of RT-PCR and real-time PCR showed that Bm-ASH genes were expressed in different larval tissues, and had well-regulated expressional profiles during the development of embryo and wing/wing disc. There are four achaete-scute homologs in Bombyx mori, the second insect having four AS-C genes so far, and these genes have multiple functions in silkworm life cycle. AS-C gene duplication in insects occurs after or parallel to, but not before the taxonomic order formation during evolution.

  4. Evolution of the vertebrate claudin gene family: insights from a basal vertebrate, the sea lamprey.

    Science.gov (United States)

    Mukendi, Christian; Dean, Nicholas; Lala, Rushil; Smith, Jeramiah; Bronner, Marianne E; Nikitina, Natalya V

    2016-01-01

    Claudins are major constituents of tight junctions, contributing both to their intercellular sealing and selective permeability properties. While claudins and claudin-like molecules are present in some invertebrates, the association of claudins with tight junctions has been conclusively documented only in vertebrates. Here we report the sequencing, phylogenetic analysis and comprehensive spatiotemporal expression analysis of the entire claudin gene family in the basal extant vertebrate, the sea lamprey. Our results demonstrate that clear orthologues to about half of all mammalian claudins are present in the lamprey, suggesting that at least one round of whole genome duplication contributed to the diversification of this gene family. Expression analysis revealed that claudins are expressed in discrete and specific domains, many of which represent vertebrate-specific innovations, such as in cranial ectodermal placodes and the neural crest; whereas others represent structures characteristic of chordates, e.g. pronephros, notochord, somites, endostyle and pharyngeal arches. By comparing the embryonic expression of claudins in the lamprey to that of other vertebrates, we found that ancestral expression patterns were often preserved in higher vertebrates. Morpholino mediated loss of Cldn3b demonstrated a functional role for this protein in placode and pharyngeal arch morphogenesis. Taken together, our data provide novel insights into the origins and evolution of the claudin gene family and the significance of claudin proteins in the evolution of vertebrates.

  5. Truncating mutation in the NHS gene: phenotypic heterogeneity of Nance-Horan syndrome in an asian Indian family.

    Science.gov (United States)

    Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy

    2005-01-01

    A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.

  6. Exome sequencing reveals VCP mutations as a cause of familial ALS

    OpenAIRE

    Johnson, Janel O.; Mandrioli, Jessica; Benatar, Michael; Abramzon, Yevgeniya; Van Deerlin, Vivianna M.; Trojanowski, John Q.; Gibbs, J Raphael; Brunetti, Maura; Gronka, Susan; Wuu, Joanne; Ding, Jinhui; McCluskey, Leo; Martinez-Lage, Maria; Falcone, Dana; Hernandez, Dena G.

    2010-01-01

    Using exome sequencing, we identified a p.R191Q amino acid change in the valosin-containing protein (VCP) gene in an Italian family with autosomal dominantly inherited amyotrophic lateral sclerosis (ALS). Mutations in VCP have previously been identified in families with Inclusion Body Myopathy, Paget’s disease and Frontotemporal Dementia (IBMPFD). Screening of VCP in a cohort of 210 familial ALS cases and 78 autopsy-proven ALS cases identified four additional mutations including a p.R155H mut...

  7. Identification a novel MYOC gene mutation in a Chinese family with juvenile-onset open angle glaucoma.

    Science.gov (United States)

    Zhao, Xin; Yang, Chaoshan; Tong, Yi; Zhang, Xiaohui; Xu, Liang; Li, Yang

    2010-08-25

    To describe the clinical and genetic findings in one Chinese family with juvenile-onset open angle glaucoma (JOAG). One family was examined clinically and a follow-up took place 5 years later. After informed consent was obtained, genomic DNA was extracted from the venous blood of all participants. Linkage analysis was performed with three microsatellite markers around the MYOC gene (D1S196, D1S2815, and D1S218) in the family. Mutation screening of all coding exons of MYOC was performed by direct sequencing of PCR-amplified DNA fragments and restriction fragment length polymorphism (RFLP) analysis. Bioinformatics analysis by the Garnier-Osguthorpe-Robson (GOR) method predicted the effects of variants detected on secondary structures of the MYOC protein. Clinical examination and pedigree analysis revealed a three- generation family with seven members diagnosed with JOAG, three with ocular hypertension, and five normal individuals. Through genotyping, the pedigree showed a linkage to the MYOC on chromosome 1q24-25. Mutation screening of MYOC in this family revealed an A-->T transition at position 1348 (p. N450Y) of the cDNA sequence. This missense mutation co-segregated with the disease phenotype of the family, but was not found in 100 normal controls. Secondary structure prediction of the p.N450Y by the GOR method revealed the replacement of a coil with a beta sheet at the amino acid 447. Early onset JOAG, with incomplete penetrance, is consistent with a novel mutation in MYOC. The finding provides pre-symptomatic molecular diagnosis for the members of this family and is useful for further genetic consultation.

  8. A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family.

    Science.gov (United States)

    Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H

    2016-12-15

    PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Whole-Exome Sequencing Reveals Clinically Relevant Variants in Family Affected with Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Jiaxiu Zhou

    2016-10-01

    Full Text Available Chromosomal microarray (CMA has been suggested as a first tier clinical diagnostic test for ASD. High-throughput sequencing (HTS has associated hundreds of genes associated with ASD. Whole Exome Sequencing (WES was used in combination with CMA to identify clinically-relevant ASD variants. In prior work, a trio-based (father, mother, and proband WGS (Whole Genome Sequencing was used to reveal clinically-relevant de novo, or inherited, rare variants in half (16 / 32 of the ASD families in which all probands had normal, or VOUS (Variant of Uncertain Clinical Significance, CMA results. In this study, after CMA screening chromosome structural abnormalities of a proband affected with ASD, a WES was performed on the patient and parents. Some rare de novo, and inherited, variants were detected using trio-based bioinformatics analysis. ASD variants were ranked by SFARI Gene score, HPO (human phenotype ontology, protein function damage, and manual searching PubMed. Sanger sequencing was used to validated some candidate variants in family members. A de novo homozygous mutation in SPG11 (p.C209F, two inherited, compound-heterozygote mutations in SCN9A (p.Q10R and p.R1893H and BEST1 (p.A135V and p.A297V were confirmed. Heterozygous mutations in TSC1 (p.S487C and SHANK2 (p.Arg569His inherited from mother were also confirmed.

  10. RNA deep sequencing reveals novel candidate genes and polymorphisms in boar testis and liver tissues with divergent androstenone levels.

    Directory of Open Access Journals (Sweden)

    Asep Gunawan

    Full Text Available Boar taint is an unpleasant smell and taste of pork meat derived from some entire male pigs. The main causes of boar taint are the two compounds androstenone (5α-androst-16-en-3-one and skatole (3-methylindole. It is crucial to understand the genetic mechanism of boar taint to select pigs for lower androstenone levels and thus reduce boar taint. The aim of the present study was to investigate transcriptome differences in boar testis and liver tissues with divergent androstenone levels using RNA deep sequencing (RNA-Seq. The total number of reads produced for each testis and liver sample ranged from 13,221,550 to 33,206,723 and 12,755,487 to 46,050,468, respectively. In testis samples 46 genes were differentially regulated whereas 25 genes showed differential expression in the liver. The fold change values ranged from -4.68 to 2.90 in testis samples and -2.86 to 3.89 in liver samples. Differentially regulated genes in high androstenone testis and liver samples were enriched in metabolic processes such as lipid metabolism, small molecule biochemistry and molecular transport. This study provides evidence for transcriptome profile and gene polymorphisms of boars with divergent androstenone level using RNA-Seq technology. Digital gene expression analysis identified candidate genes in flavin monooxygenease family, cytochrome P450 family and hydroxysteroid dehydrogenase family. Moreover, polymorphism and association analysis revealed mutation in IRG6, MX1, IFIT2, CYP7A1, FMO5 and KRT18 genes could be potential candidate markers for androstenone levels in boars. Further studies are required for proving the role of candidate genes to be used in genomic selection against boar taint in pig breeding programs.

  11. Exome sequences of multiplex, multigenerational families reveal schizophrenia risk loci with potential implications for neurocognitive performance.

    Science.gov (United States)

    Kos, Mark Z; Carless, Melanie A; Peralta, Juan; Curran, Joanne E; Quillen, Ellen E; Almeida, Marcio; Blackburn, August; Blondell, Lucy; Roalf, David R; Pogue-Geile, Michael F; Gur, Ruben C; Göring, Harald H H; Nimgaonkar, Vishwajit L; Gur, Raquel E; Almasy, Laura

    2017-12-01

    Schizophrenia is a serious mental illness, involving disruptions in thought and behavior, with a worldwide prevalence of about one percent. Although highly heritable, much of the genetic liability of schizophrenia is yet to be explained. We searched for susceptibility loci in multiplex, multigenerational families affected by schizophrenia, targeting protein-altering variation with in silico predicted functional effects. Exome sequencing was performed on 136 samples from eight European-American families, including 23 individuals diagnosed with schizophrenia or schizoaffective disorder. In total, 11,878 non-synonymous variants from 6,396 genes were tested for their association with schizophrenia spectrum disorders. Pathway enrichment analyses were conducted on gene-based test results, protein-protein interaction (PPI) networks, and epistatic effects. Using a significance threshold of FDR < 0.1, association was detected for rs10941112 (p = 2.1 × 10 -5 ; q-value = 0.073) in AMACR, a gene involved in fatty acid metabolism and previously implicated in schizophrenia, with significant cis effects on gene expression (p = 5.5 × 10 -4 ), including brain tissue data from the Genotype-Tissue Expression project (minimum p = 6.0 × 10 -5 ). A second SNP, rs10378 located in TMEM176A, also shows risk effects in the exome data (p = 2.8 × 10 -5 ; q-value = 0.073). PPIs among our top gene-based association results (p < 0.05; n = 359 genes) reveal significant enrichment of genes involved in NCAM-mediated neurite outgrowth (p = 3.0 × 10 -5 ), while exome-wide SNP-SNP interaction effects for rs10941112 and rs10378 indicate a potential role for kinase-mediated signaling involved in memory and learning. In conclusion, these association results implicate AMACR and TMEM176A in schizophrenia risk, whose effects may be modulated by genes involved in synaptic plasticity and neurocognitive performance. © 2017 Wiley Periodicals, Inc.

  12. Structure, evolution and functional inference on the Mildew Locus O (MLO) gene family in three cultivated Cucurbitaceae spp.

    Science.gov (United States)

    Iovieno, Paolo; Andolfo, Giuseppe; Schiavulli, Adalgisa; Catalano, Domenico; Ricciardi, Luigi; Frusciante, Luigi; Ercolano, Maria Raffaella; Pavan, Stefano

    2015-12-29

    The powdery mildew disease affects thousands of plant species and arguably represents the major fungal threat for many Cucurbitaceae crops, including melon (Cucumis melo L.), watermelon (Citrullus lanatus L.) and zucchini (Cucurbita pepo L.). Several studies revealed that specific members of the Mildew Locus O (MLO) gene family act as powdery mildew susceptibility factors. Indeed, their inactivation, as the result of gene knock-out or knock-down, is associated with a peculiar form of resistance, referred to as mlo resistance. We exploited recently available genomic information to provide a comprehensive overview of the MLO gene family in Cucurbitaceae. We report the identification of 16 MLO homologs in C. melo, 14 in C. lanatus and 18 in C. pepo genomes. Bioinformatic treatment of data allowed phylogenetic inference and the prediction of several ortholog pairs and groups. Comparison with functionally characterized MLO genes and, in C. lanatus, gene expression analysis, resulted in the detection of candidate powdery mildew susceptibility factors. We identified a series of conserved amino acid residues and motifs that are likely to play a major role for the function of MLO proteins. Finally, we performed a codon-based evolutionary analysis indicating a general high level of purifying selection in the three Cucurbitaceae MLO gene families, and the occurrence of regions under diversifying selection in candidate susceptibility factors. Results of this study may help to address further biological questions concerning the evolution and function of MLO genes. Moreover, data reported here could be conveniently used by breeding research, aiming to select powdery mildew resistant cultivars in Cucurbitaceae.

  13. A novel heterozygous mutation in the Indian hedgehog gene (IHH) is associated with brachydactyly type A1 in a Chinese family.

    Science.gov (United States)

    Liu, Mugen; Wang, Xu; Cai, Zhou; Tang, Zhaohui; Cao, Kangsheng; Liang, Bo; Ren, Xiang; Liu, Jing Yu; Wang, Qing K

    2006-01-01

    Brachydactyly type A1 (BDA1) is caused by mutations in the Indian hedgehog gene, IHH, on chromosome 2q35-36. In this study, a large five-generation Chinese family with BDA1 was identified and characterized. All affected family members demonstrated significant homogeneous phenotype and some unique clinical features different from those associated with the reported BDA1 mutations in IHH. Linkage analysis showed that the BDA1 gene in the family was linked to marker D2S126 close to IHH with a LOD score of 4.74 at a recombination fraction of 0. DNA sequence analysis revealed a heterozygous C to T transition at nucleotide 461 of IHH, resulting in a novel T154I substitution. The T154I mutation co-segregated with all affected individuals in the family, and was not present in normal family members or 200 normal controls. These results expand the spectrum of clinical phenotype associated with IHH mutations.

  14. Familial adult spinal muscular atrophy associated with the VAPB gene: report of 42 cases in Brazil

    Directory of Open Access Journals (Sweden)

    Victor Kosac

    2013-10-01

    Full Text Available Familial spinal muscular atrophy (FSMA associated with the vesicle-associated membrane protein-associated protein B (VAPB gene is a rare autosomal dominant disease with late onset and slow progression. We studied 10 of 42 patients from 5 families by taking clinical histories and performing physical exams, electrophysiological studies, and genetic tests. All patients presented late onset disease with slow progression characterized by fasciculations, proximal weakness, amyotrophy, and hypoactive deep tendon reflex, except two who exhibited brisk reflex. Two patients showed tongue fasciculations and respiratory insufficiency. Electrophysiological studies revealed patterns of lower motor neuron disease, and genetic testing identified a P56S mutation of the VAPB gene. Although it is a rare motor neuron disease, FSMA with this mutation might be much more prevalent in Brazil than expected, and many cases may be undiagnosed. Genetic exams should be performed whenever it is suspected in Brazil.

  15. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  16. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  17. Analysis of four achaete-scute homologs in Bombyx mori reveals new viewpoints of the evolution and functions of this gene family

    Directory of Open Access Journals (Sweden)

    Yi Yongzhu

    2008-03-01

    Full Text Available Abstract Background achaete-scute complexe (AS-C has been widely studied at genetic, developmental and evolutional levels. Genes of this family encode proteins containing a highly conserved bHLH domain, which take part in the regulation of the development of central nervous system and peripheral nervous system. Many AS-C homologs have been isolated from various vertebrates and invertebrates. Also, AS-C genes are duplicated during the evolution of Diptera. Functions besides neural development controlling have also been found in Drosophila AS-C genes. Results We cloned four achaete-scute homologs (ASH from the lepidopteran model organism Bombyx mori, including three proneural genes and one neural precursor gene. Proteins encoded by them contained the characteristic bHLH domain and the three proneural ones were also found to have the C-terminal conserved motif. These genes regulated promoter activity through the Class A E-boxes in vitro. Though both Bm-ASH and Drosophila AS-C have four members, they are not in one by one corresponding relationships. Results of RT-PCR and real-time PCR showed that Bm-ASH genes were expressed in different larval tissues, and had well-regulated expressional profiles during the development of embryo and wing/wing disc. Conclusion There are four achaete-scute homologs in Bombyx mori, the second insect having four AS-C genes so far, and these genes have multiple functions in silkworm life cycle. AS-C gene duplication in insects occurs after or parallel to, but not before the taxonomic order formation during evolution.

  18. Disruption of the APC gene by t(5;7) translocation in a Turcot family.

    Science.gov (United States)

    Sahnane, Nora; Bernasconi, Barbara; Carnevali, Ileana; Furlan, Daniela; Viel, Alessandra; Sessa, Fausto; Tibiletti, Maria Grazia

    2016-03-01

    Turcot syndrome (TS) refers to the combination of colorectal polyps and primary tumours of the central nervous system. TS is a heterogeneous genetic condition due to APC and/or mismatch repair germline mutations. When APC is involved the vast majority of mutations are truncating, but in approximately 20%-30% of patients with familial polyposis no germline mutation can be found. A 30-year-old Caucasian woman with a positive pedigree for TS was referred to our Genetic Counselling Service. She was negative for APC and MUTYH but showed a reciprocal balanced translocation t(5;7)(q22;p15) at chromosome analysis. FISH analysis using specific BAC probes demonstrated that 5q22 breakpoint disrupted the APC gene. Transcript analysis by MLPA and digital PCR revealed that the cytogenetic rearrangement involving the 3' end of the APC gene caused a defective expression of a truncated transcript. This result allowed cytogenetic analysis to be offered to all the other family members and segregation analysis clearly demonstrated that all the carriers were affected, whereas non-carriers did not have the polyposis. A cytogenetic approach permitted the identification of the mutation-causing disease in this family, and the segregation analysis together with the transcript study supported the pathogenetic role of this mutation. Karyotype analysis was used as a predictive test in all members of this family. This family suggests that clinically positive TS and FAP cases, which test negative with standard molecular analysis, could be easily and cost-effectively resolved by a classical and molecular cytogenetic approach. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Characterization of a rare variant (c.2635-2A>G) of the MSH2 gene in a family with Lynch syndrome.

    Science.gov (United States)

    Cariola, Filomena; Disciglio, Vittoria; Valentini, Anna M; Lotesoriere, Claudio; Fasano, Candida; Forte, Giovanna; Russo, Luciana; Di Carlo, Antonio; Guglielmi, Floranna; Manghisi, Andrea; Lolli, Ivan; Caruso, Maria L; Simone, Cristiano

    2018-04-01

    Lynch syndrome is caused by germline mutations in one of the mismatch repair genes ( MLH1, MSH2, MSH6, and PMS2) or in the EPCAM gene. Lynch syndrome is defined on the basis of clinical, pathological, and genetic findings. Accordingly, the identification of predisposing genes allows for accurate risk assessment and tailored screening protocols. Here, we report a family case with three family members manifesting the Lynch syndrome phenotype, all of which harbor the rare variant c.2635-2A>G affecting the splice site consensus sequence of intron 15 of the MSH2 gene. This mutation was previously described only in one family with Lynch syndrome, in which mismatch repair protein expression in tumor tissues was not assessed. In this study, we report for the first time the molecular characterization of the MSH2 c.2635-2A>G variant through in silico prediction analysis, microsatellite instability, and mismatch repair protein expression experiments on tumor tissues of Lynch syndrome patients. The potential effect of the splice site variant was revealed by three splicing prediction bioinformatics tools, which suggested the generation of a new cryptic splicing site. The potential pathogenic role of this variant was also revealed by the presence of microsatellite instability and the absence of MSH2/MSH6 heterodimer protein expression in the tumor cells of cancer tissues of the affected family members. We provide compelling evidence in favor of the pathogenic role of the MSH2 variant c.2635-2A>G, which could induce an alteration of the canonical splice site and consequently an aberrant form of the protein product (MSH2).

  20. A Knockout Screen of ApiAP2 Genes Reveals Networks of Interacting Transcriptional Regulators Controlling the Plasmodium Life Cycle.

    Science.gov (United States)

    Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver

    2017-01-11

    A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Computational integration of homolog and pathway gene module expression reveals general stemness signatures.

    Directory of Open Access Journals (Sweden)

    Martina Koeva

    Full Text Available The stemness hypothesis states that all stem cells use common mechanisms to regulate self-renewal and multi-lineage potential. However, gene expression meta-analyses at the single gene level have failed to identify a significant number of genes selectively expressed by a broad range of stem cell types. We hypothesized that stemness may be regulated by modules of homologs. While the expression of any single gene within a module may vary from one stem cell type to the next, it is possible that the expression of the module as a whole is required so that the expression of different, yet functionally-synonymous, homologs is needed in different stem cells. Thus, we developed a computational method to test for stem cell-specific gene expression patterns from a comprehensive collection of 49 murine datasets covering 12 different stem cell types. We identified 40 individual genes and 224 stemness modules with reproducible and specific up-regulation across multiple stem cell types. The stemness modules included families regulating chromatin remodeling, DNA repair, and Wnt signaling. Strikingly, the majority of modules represent evolutionarily related homologs. Moreover, a score based on the discovered modules could accurately distinguish stem cell-like populations from other cell types in both normal and cancer tissues. This scoring system revealed that both mouse and human metastatic populations exhibit higher stemness indices than non-metastatic populations, providing further evidence for a stem cell-driven component underlying the transformation to metastatic disease.

  2. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  3. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  4. The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization.

    Directory of Open Access Journals (Sweden)

    Qian Yan

    Full Text Available Basic/helix-loop-helix (bHLH proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum, a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062 showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus.

  5. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  6. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

    Science.gov (United States)

    Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

    2013-01-01

    Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

  7. Cross-species transcriptomic approach reveals genes in hamster implantation sites.

    Science.gov (United States)

    Lei, Wei; Herington, Jennifer; Galindo, Cristi L; Ding, Tianbing; Brown, Naoko; Reese, Jeff; Paria, Bibhash C

    2014-12-01

    The mouse model has greatly contributed to understanding molecular mechanisms involved in the regulation of progesterone (P4) plus estrogen (E)-dependent blastocyst implantation process. However, little is known about contributory molecular mechanisms of the P4-only-dependent blastocyst implantation process that occurs in species such as hamsters, guineapigs, rabbits, pigs, rhesus monkeys, and perhaps humans. We used the hamster as a model of P4-only-dependent blastocyst implantation and carried out cross-species microarray (CSM) analyses to reveal differentially expressed genes at the blastocyst implantation site (BIS), in order to advance the understanding of molecular mechanisms of implantation. Upregulation of 112 genes and downregulation of 77 genes at the BIS were identified using a mouse microarray platform, while use of the human microarray revealed 62 up- and 38 down-regulated genes at the BIS. Excitingly, a sizable number of genes (30 up- and 11 down-regulated genes) were identified as a shared pool by both CSMs. Real-time RT-PCR and in situ hybridization validated the expression patterns of several up- and down-regulated genes identified by both CSMs at the hamster and mouse BIS to demonstrate the merit of CSM findings across species, in addition to revealing genes specific to hamsters. Functional annotation analysis found that genes involved in the spliceosome, proteasome, and ubiquination pathways are enriched at the hamster BIS, while genes associated with tight junction, SAPK/JNK signaling, and PPARα/RXRα signalings are repressed at the BIS. Overall, this study provides a pool of genes and evidence of their participation in up- and down-regulated cellular functions/pathways at the hamster BIS. © 2014 Society for Reproduction and Fertility.

  8. Genome-Wide Identification of the PHD-Finger Family Genes and Their Responses to Environmental Stresses in Oryza sativa L.

    Science.gov (United States)

    Sun, Mingzhe; Yang, Junkai; Cui, Na; Zhu, Yanming

    2017-01-01

    The PHD-finger family has been demonstrated to be involved in regulating plant growth and development. However, little information is given for its role in environmental stress responses. Here, we identified a total of 59 PHD family genes in the rice genome. These OsPHDs genes were located on eleven chromosomes and synteny analysis only revealed nine duplicated pairs within the rice PHD family. Phylogenetic analysis of all OsPHDs and PHDs from other species revealed that they could be grouped into two major clusters. Furthermore, OsPHDs were clustered into eight groups and members from different groups displayed a great divergence in terms of gene structure, functional domains and conserved motifs. We also found that with the exception of OsPHD6, all OsPHDs were expressed in at least one of the ten tested tissues and OsPHDs from certain groups were expressed in specific tissues. Moreover, our results also uncovered differential responses of OsPHDs expression to environmental stresses, including ABA (abscisic acid), water deficit, cold and high Cd. By using quantitative real-time PCR, we further confirmed the differential expression of OsPHDs under these stresses. OsPHD1/7/8/13/33 were differentially expressed under water deficit and Cd stresses, while OsPHD5/17 showed altered expression under water deficit and cold stresses. Moreover, OsPHD3/44/28 displayed differential expression under ABA and Cd stresses. In conclusion, our results provide valuable information on the rice PHD family in plant responses to environmental stress, which will be helpful for further characterizing their biological roles in responding to environmental stresses.

  9. Genome-wide analysis of gene expression in primate taste buds reveals links to diverse processes.

    Directory of Open Access Journals (Sweden)

    Peter Hevezi

    Full Text Available Efforts to unravel the mechanisms underlying taste sensation (gustation have largely focused on rodents. Here we present the first comprehensive characterization of gene expression in primate taste buds. Our findings reveal unique new insights into the biology of taste buds. We generated a taste bud gene expression database using laser capture microdissection (LCM procured fungiform (FG and circumvallate (CV taste buds from primates. We also used LCM to collect the top and bottom portions of CV taste buds. Affymetrix genome wide arrays were used to analyze gene expression in all samples. Known taste receptors are preferentially expressed in the top portion of taste buds. Genes associated with the cell cycle and stem cells are preferentially expressed in the bottom portion of taste buds, suggesting that precursor cells are located there. Several chemokines including CXCL14 and CXCL8 are among the highest expressed genes in taste buds, indicating that immune system related processes are active in taste buds. Several genes expressed specifically in endocrine glands including growth hormone releasing hormone and its receptor are also strongly expressed in taste buds, suggesting a link between metabolism and taste. Cell type-specific expression of transcription factors and signaling molecules involved in cell fate, including KIT, reveals the taste bud as an active site of cell regeneration, differentiation, and development. IKBKAP, a gene mutated in familial dysautonomia, a disease that results in loss of taste buds, is expressed in taste cells that communicate with afferent nerve fibers via synaptic transmission. This database highlights the power of LCM coupled with transcriptional profiling to dissect the molecular composition of normal tissues, represents the most comprehensive molecular analysis of primate taste buds to date, and provides a foundation for further studies in diverse aspects of taste biology.

  10. Genome-wide comparative analysis of papain-like cysteine protease family genes in castor bean and physic nut.

    Science.gov (United States)

    Zou, Zhi; Huang, Qixing; Xie, Guishui; Yang, Lifu

    2018-01-10

    Papain-like cysteine proteases (PLCPs) are a class of proteolytic enzymes involved in many plant processes. Compared with the extensive research in Arabidopsis thaliana, little is known in castor bean (Ricinus communis) and physic nut (Jatropha curcas), two Euphorbiaceous plants without any recent whole-genome duplication. In this study, a total of 26 or 23 PLCP genes were identified from the genomes of castor bean and physic nut respectively, which can be divided into nine subfamilies based on the phylogenetic analysis: RD21, CEP, XCP, XBCP3, THI, SAG12, RD19, ALP and CTB. Although most of them harbor orthologs in Arabidopsis, several members in subfamilies RD21, CEP, XBCP3 and SAG12 form new groups or subgroups as observed in other species, suggesting specific gene loss occurred in Arabidopsis. Recent gene duplicates were also identified in these two species, but they are limited to the SAG12 subfamily and were all derived from local duplication. Expression profiling revealed diverse patterns of different family members over various tissues. Furthermore, the evolution characteristics of PLCP genes were also compared and discussed. Our findings provide a useful reference to characterize PLCP genes and investigate the family evolution in Euphorbiaceae and species beyond.

  11. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  12. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Science.gov (United States)

    Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  13. Comprehensive analysis of the soybean (Glycine max GmLAX auxin transporter gene family

    Directory of Open Access Journals (Sweden)

    Chenglin eChai

    2016-03-01

    Full Text Available The phytohormone auxin plays a critical role in regulation of plant growth and development as well as plant responses to abiotic stresses. This is mainly achieved through its uneven distribution in plants via a polar auxin transport process. Auxin transporters are major players in polar auxin transport. The AUXIN RESISTANT 1 ⁄ LIKE AUX1 (AUX⁄LAX auxin influx carriers belong to the amino acid permease family of proton-driven transporters and function in the uptake of indole-3-acetic acid (IAA. In this study, genome-wide comprehensive analysis of the soybean AUX⁄LAX (GmLAX gene family, including phylogenic relationships, chromosome localization, and gene structure, were carried out. A total of 15 GmLAX genes, including seven duplicated gene pairs, were identified in the soybean genome. They were distributed on 10 chromosomes. Despite their higher percentage identities at the protein level, GmLAXs exhibited versatile tissue-specific expression patterns, indicating coordinated functioning during plant growth and development. Most GmLAXs were responsive to drought and dehydration stresses and auxin and abscisic acid (ABA stimuli, in a tissue- and/or time point- sensitive mode. Several GmLAX members were involved in responding to salt stress. Sequence analysis revealed that promoters of GmLAXs contained different combinations of stress-related cis-regulatory elements. These studies suggest that the soybean GmLAXs were under control of a very complex regulatory network, responding to various internal and external signals. This study helps to identity candidate GmLAXs for further analysis of their roles in soybean development and adaption to adverse environments.

  14. Identification and in silico analysis of the Citrus HSP70 molecular chaperone gene family

    Directory of Open Access Journals (Sweden)

    Luciano G. Fietto

    2007-01-01

    Full Text Available The completion of the genome sequencing of the Arabidopsis thaliana model system provided a powerful molecular tool for comparative analysis of gene families present in the genome of economically relevant plant species. In this investigation, we used the sequences of the Arabidopsis Hsp70 gene family to identify and annotate the Citrus Hsp70 genes represented in the CitEST database. Based on sequence comparison analysis, we identified 18 clusters that were further divided into 5 subgroups encoding four mitochondrial mtHsp70s, three plastid csHsp70s, one ER luminal Hsp70 BiP, two HSP110/SSE-related proteins and eight cytosolic Hsp/Hsc70s. We also analyzed the expression profile by digital Northern of each Hsp70 transcript in different organs and in response to stress conditions. The EST database revealed a distinct population distribution of Hsp70 ESTs among isoforms and across the organs surveyed. The Hsp70-5 isoform was highly expressed in seeds, whereas BiP, mitochondrial and plastid HSp70 mRNAs displayed a similar expression profile in the organs analyzed, and were predominantly represented in flowers. Distinct Hsp70 mRNAs were also differentially expressed during Xylella infection and Citrus tristeza viral infection as well as during water deficit. This in silico study sets the groundwork for future investigations to fully characterize functionally the Citrus Hsp70 family and underscores the relevance of Hsp70s in response to abiotic and biotic stresses in Citrus.

  15. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  16. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  17. Genome-wide analysis of the Solanum tuberosum (potato) trehalose-6-phosphate synthase (TPS) gene family: evolution and differential expression during development and stress.

    Science.gov (United States)

    Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang

    2017-12-01

    Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.

  18. Genome-Wide Identification of the Target Genes of AP2-O, a Plasmodium AP2-Family Transcription Factor.

    Directory of Open Access Journals (Sweden)

    Izumi Kaneko

    2015-05-01

    Full Text Available Stage-specific transcription is a fundamental biological process in the life cycle of the Plasmodium parasite. Proteins containing the AP2 DNA-binding domain are responsible for stage-specific transcriptional regulation and belong to the only known family of transcription factors in Plasmodium parasites. Comprehensive identification of their target genes will advance our understanding of the molecular basis of stage-specific transcriptional regulation and stage-specific parasite development. AP2-O is an AP2 family transcription factor that is expressed in the mosquito midgut-invading stage, called the ookinete, and is essential for normal morphogenesis of this stage. In this study, we identified the genome-wide target genes of AP2-O by chromatin immunoprecipitation-sequencing and elucidate how this AP2 family transcription factor contributes to the formation of this motile stage. The analysis revealed that AP2-O binds specifically to the upstream genomic regions of more than 500 genes, suggesting that approximately 10% of the parasite genome is directly regulated by AP2-O. These genes are involved in distinct biological processes such as morphogenesis, locomotion, midgut penetration, protection against mosquito immunity and preparation for subsequent oocyst development. This direct and global regulation by AP2-O provides a model for gene regulation in Plasmodium parasites and may explain how these parasites manage to control their complex life cycle using a small number of sequence-specific AP2 transcription factors.

  19. Phylogenetic analysis of members of the Phycodnaviridae virus family, using amplified fragments of the major capsid protein gene.

    Science.gov (United States)

    Larsen, J B; Larsen, A; Bratbak, G; Sandaa, R-A

    2008-05-01

    Algal viruses are considered ecologically important by affecting host population dynamics and nutrient flow in aquatic food webs. Members of the family Phycodnaviridae are also interesting due to their extraordinary genome size. Few algal viruses in the Phycodnaviridae family have been sequenced, and those that have been have few genes in common and low gene homology. It has hence been difficult to design general PCR primers that allow further studies of their ecology and diversity. In this study, we screened the nine type I core genes of the nucleocytoplasmic large DNA viruses for sequences suitable for designing a general set of primers. Sequence comparison between members of the Phycodnaviridae family, including three partly sequenced viruses infecting the prymnesiophyte Pyramimonas orientalis and the haptophytes Phaeocystis pouchetii and Chrysochromulina ericina (Pyramimonas orientalis virus 01B [PoV-01B], Phaeocystis pouchetii virus 01 [PpV-01], and Chrysochromulina ericina virus 01B [CeV-01B], respectively), revealed eight conserved regions in the major capsid protein (MCP). Two of these regions also showed conservation at the nucleotide level, and this allowed us to design degenerate PCR primers. The primers produced 347- to 518-bp amplicons when applied to lysates from algal viruses kept in culture and from natural viral communities. The aim of this work was to use the MCP as a proxy to infer phylogenetic relationships and genetic diversity among members of the Phycodnaviridae family and to determine the occurrence and diversity of this gene in natural viral communities. The results support the current legitimate genera in the Phycodnaviridae based on alga host species. However, while placing the mimivirus in close proximity to the type species, PBCV-1, of Phycodnaviridae along with the three new viruses assigned to the family (PoV-01B, PpV-01, and CeV-01B), the results also indicate that the coccolithoviruses and phaeoviruses are more diverged from this

  20. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  1. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  2. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  3. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  4. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  5. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Directory of Open Access Journals (Sweden)

    Behzad Davarniya

    Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  6. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families

    Science.gov (United States)

    Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914

  7. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  8. The Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.: Bioinformatic Analysis and Expression Patterns

    Directory of Open Access Journals (Sweden)

    Yazhong eJin

    2016-05-01

    Full Text Available Alcohol dehydrogenases (ADH, encoded by multigene family in plants, play a critical role in plant growth, development, adaptation, fruit ripening and aroma production. Thirteen ADH genes were identified in melon genome, including 12 ADHs and one formaldehyde dehydrogenease (FDH, designated CmADH1-12 and CmFDH1, in which CmADH1 and CmADH2 have been isolated in Cantaloupe. ADH genes shared a lower identity with each other at the protein level and had different intron-exon structure at nucleotide level. No typical signal peptides were found in all CmADHs, and CmADH proteins might locate in the cytoplasm. The phylogenetic tree revealed that 13 ADH genes were divided into 3 groups respectively, namely long-, medium- and short-chain ADH subfamily, and CmADH1,3-11, which belongs to the medium-chain ADH subfamily, fell into 6 medium-chain ADH subgroups. CmADH12 may belong to the long-chain ADH subfamily, while CmFDH1 may be a Class III ADH and serve as an ancestral ADH in melon. Expression profiling revealed that CmADH1, CmADH2, CmADH10 and CmFDH1 were moderately or strongly expressed in different vegetative tissues and fruit at medium and late developmental stages, while CmADH8 and CmADH12 were highly expressed in fruit after 20 days. CmADH3 showed preferential expression in young tissues. CmADH4 only had slight expression in root. Promoter analysis revealed several motifs of CmADH genes involved in the gene expression modulated by various hormones, and the response pattern of CmADH genes to ABA, IAA and ethylene were different. These CmADHs were divided into ethylene-sensitive and –insensitive groups, and the functions of CmADHs were discussed.

  9. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  10. Expression Profiling Reveals Genes Involved in the Regulation of Wool Follicle Bulb Regression and Regeneration in Sheep

    Directory of Open Access Journals (Sweden)

    Guangbin Liu

    2015-04-01

    Full Text Available Wool is an important material in textile manufacturing. In order to investigate the intrinsic factors that regulate wool follicle cycling and wool fiber properties, Illumina sequencing was performed on wool follicle bulb samples from the middle anagen, catagen and late telogen/early anagen phases. In total, 13,898 genes were identified. KRTs and KRTAPs are the most highly expressed gene families in wool follicle bulb. In addition, 438 and 203 genes were identified to be differentially expressed in wool follicle bulb samples from the middle anagen phase compared to the catagen phase and the samples from the catagen phase compared to the late telogen/early anagen phase, respectively. Finally, our data revealed that two groups of genes presenting distinct expression patterns during the phase transformation may have important roles for wool follicle bulb regression and regeneration. In conclusion, our results demonstrated the gene expression patterns in the wool follicle bulb and add new data towards an understanding of the mechanisms involved in wool fiber growth in sheep.

  11. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.

    Science.gov (United States)

    He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan

    2012-07-01

    WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.

  12. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  13. Insight into pattern of codon biasness and nucleotide base usage in serotonin receptor gene family from different mammalian species.

    Science.gov (United States)

    Dass, J Febin Prabhu; Sudandiradoss, C

    2012-07-15

    5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium

    KAUST Repository

    Rao, Pavitra N.

    2016-06-14

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also present earlier in the Alveolata in the free-living, non-parasitophorous, photosynthetic chromerids, Chromera and Vitrella. In P. falciparum and P. berghei blood stage parasites the transcripts of all nine cpw-wpc genes have been detected in gametocytes. RNA immunoprecipitation followed by reverse transcriptase-PCR reveals all P. berghei cpw-wpc transcripts to be bound by the translational repressors DOZI and CITH, and thus are likely under translational control prior to transmission from the rodent host to the mosquito vector in P. berghei. The GFP tagging of two endogenous P. berghei genes confirmed translational silencing in the gametocyte and translation in ookinetes. Establishing a luciferase transgene assay we show that the 3′ untranslated region of PF3D7_1331400 controls protein expression of this reporter in P. falciparum gametocytes. Our analyses suggest that cpw-wpc genes are translationally silenced in gametocytes across Plasmodium spp. and activated during ookinete formation and thus may have a role in transmission to the mosquito.

  15. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium

    KAUST Repository

    Rao, Pavitra N.; Santos, Jorge M.; Pain, Arnab; Templeton, Thomas J.; Mair, Gunnar R.

    2016-01-01

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also present earlier in the Alveolata in the free-living, non-parasitophorous, photosynthetic chromerids, Chromera and Vitrella. In P. falciparum and P. berghei blood stage parasites the transcripts of all nine cpw-wpc genes have been detected in gametocytes. RNA immunoprecipitation followed by reverse transcriptase-PCR reveals all P. berghei cpw-wpc transcripts to be bound by the translational repressors DOZI and CITH, and thus are likely under translational control prior to transmission from the rodent host to the mosquito vector in P. berghei. The GFP tagging of two endogenous P. berghei genes confirmed translational silencing in the gametocyte and translation in ookinetes. Establishing a luciferase transgene assay we show that the 3′ untranslated region of PF3D7_1331400 controls protein expression of this reporter in P. falciparum gametocytes. Our analyses suggest that cpw-wpc genes are translationally silenced in gametocytes across Plasmodium spp. and activated during ookinete formation and thus may have a role in transmission to the mosquito.

  16. Sequence of the non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase from Nicotiana plumbaginifolia and phylogenetic origin of the gene family.

    Science.gov (United States)

    Habenicht, A; Quesada, A; Cerff, R

    1997-10-01

    A cDNA-library has been constructed from Nicotiana plumbaginifolia seedlings, and the non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GapN, EC 1.2.1.9) was isolated by plaque hybridization using the cDNA from pea as a heterologous probe. The cDNA comprises the entire GapN coding region. A putative polyadenylation signal is identified. Phylogenetic analysis based on the deduced amino acid sequences revealed that the GapN gene family represents a separate ancient branch within the aldehyde dehydrogenase superfamily. It can be shown that the GapN gene family and other distinct branches of the superfamily have its phylogenetic origin before the separation of primary life-forms. This further demonstrates that already very early in evolution, a broad diversification of the aldehyde dehydrogenases led to the formation of the superfamily.

  17. The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

    Directory of Open Access Journals (Sweden)

    Iva Tomalova

    Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

  18. Intrafamilial variability of the ocular phenotype in a Polish family with a missense mutation (A63D) in the Norrie disease gene.

    Science.gov (United States)

    Zaremba, J; Feil, S; Juszko, J; Myga, W; van Duijnhoven, G; Berger, W

    1998-09-01

    To describe the phenotypic variability in a Polish Norrie disease (ND) family associated with the missense mutation A63D. A patient with spared vision from a Polish ND family underwent detailed ophthalmological examinations including slit-lamp biomicroscopy, ultrasound (USG), angiography, Goldmann kinetic visual field, and electroretinography (ERG). Mutation screening was carried out using the single-strand conformation polymorphism (SSCP) technique and subsequent DNA sequencing of the coding part of the ND gene. A mutation was detected (exon 3, A63D) in a large Polish family with 12 affected males, all but one presenting with classical ND symptoms. In one male, partially preserved vision was observed up to 40 years of age (distance acuity of the right eye 1/50 and left eye 2/50). Slit-lamp examination revealed remnants of a persistent primary vitreous and hyaloid artery. Upon angiography, the retina was vascularized within the posterior pole but not in the periphery. The ERG revealed pathological changes characteristic for chorioretinal degenerations. Within one family, individuals with identical sequence alterations in the ND gene can show remarkable phenotypic variability of the ocular symptoms. These findings indicate the involvement of additional factors (epigenetic or genetic) in ocular pathogenesis of ND.

  19. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  20. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  1. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    Science.gov (United States)

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  2. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    Directory of Open Access Journals (Sweden)

    Jan Futas

    Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

  3. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    Science.gov (United States)

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  4. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  5. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  6. IGSF9 Family Proteins

    DEFF Research Database (Denmark)

    Hansen, Maria; Walmod, Peter Schledermann

    2013-01-01

    The Drosophila protein Turtle and the vertebrate proteins immunoglobulin superfamily (IgSF), member 9 (IGSF9/Dasm1) and IGSF9B are members of an evolutionarily ancient protein family. A bioinformatics analysis of the protein family revealed that invertebrates contain only a single IGSF9 family gene......, the longest isoforms of the proteins have the same general organization as the neural cell adhesion molecule family of cell adhesion molecule proteins, and like this family of proteins, IGSF9 family members are expressed in the nervous system. A review of the literature revealed that Drosophila Turtle...... facilitates homophilic cell adhesion. Moreover, IGSF9 family proteins have been implicated in the outgrowth and branching of neurites, axon guidance, synapse maturation, self-avoidance, and tiling. However, despite the few published studies on IGSF9 family proteins, reports on the functions of both Turtle...

  7. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  8. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  9. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.

    Science.gov (United States)

    Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G

    2015-07-14

    Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.

  10. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Science.gov (United States)

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  11. The ABC gene family in arthropods: comparative genomics and role in insecticide transport and resistance.

    Science.gov (United States)

    Dermauw, Wannes; Van Leeuwen, Thomas

    2014-02-01

    About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority of ABC proteins function as primary-active transporters that bind and hydrolyze ATP while transporting a large diversity of substrates across lipid membranes. Although extremely well studied in vertebrates for their role in drug resistance, less is known about the role of this family in the transport of endogenous and exogenous substances in arthropods. The ABC families of five insect species, a crustacean and a chelicerate have been annotated in some detail. We conducted a thorough phylogenetic analysis of the seven arthropod and human ABC protein subfamilies, to infer orthologous relationships that might suggest conserved function. Most orthologous relationships were found in the ABCB half transporter, ABCD, ABCE and ABCF subfamilies, but specific expansions within species and lineages are frequently observed and discussed. We next surveyed the role of ABC transporters in the transport of xenobiotics/plant allelochemicals and their involvement in insecticide resistance. The involvement of ABC transporters in xenobiotic resistance in arthropods is historically not well documented, but an increasing number of studies using unbiased differential gene expression analysis now points to their importance. We give an overview of methods that can be used to link ABC transporters to resistance. ABC proteins have also recently been implicated in the mode of action and resistance to Bt toxins in Lepidoptera. Given the enormous interest in Bt toxicology in transgenic crops, such findings will provide an impetus to further reveal the role of ABC transporters in arthropods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Characterization of the lipoxygenase (LOX) gene family in the Chinese white pear (Pyrus bretschneideri) and comparison with other members of the Rosaceae.

    Science.gov (United States)

    Li, Meng; Li, Leiting; Dunwell, Jim M; Qiao, Xin; Liu, Xing; Zhang, Shaoling

    2014-06-07

    Lipoxygenases (LOXs), a type of non-haem iron-containing dioxygenase, are ubiquitous enzymes in plants and participate in the formation of fruit aroma which is a very important aspect of fruit quality. Amongst the various aroma volatiles, saturated and unsaturated alcohols and aldehydes provide the characteristic aroma of the fruit. These compounds are formed from unsaturated fatty acids through oxidation, pyrolysis and reduction steps. This biosynthetic pathway involves at least four enzymes, including LOX, the enzyme responsible for lipid oxidation. Although some studies have been conducted on the LOX gene family in several species including Arabidopsis, soybean, cucumber and apple, there is no information from pear; and the evolutionary history of this gene family in the Rosaceae is still not resolved. In this study we identified 107 LOX homologous genes from five Rosaceous species (Pyrus bretschneideri, Malus × domestica, Fragaria vesca, Prunus mume and Prunus persica); 23 of these sequences were from pear. By using structure analysis, phylogenic analysis and collinearity analysis, we identified variation in gene structure and revealed the phylogenetic evolutionary relationship of this gene family. Expression of certain pear LOX genes during fruit development was verified by analysis of transcriptome data. 23 LOX genes were identified in pear and these genes were found to have undergone a duplication 30-45 MYA; most of these 23 genes are functional. Specific gene duplication was found on chromosome4 in the pear genome. Useful information was provided for future research on the evolutionary history and transgenic research on LOX genes.

  13. A large and functionally diverse family of Fad2 genes in safflower (Carthamus tinctorius L.

    Directory of Open Access Journals (Sweden)

    Cao Shijiang

    2013-01-01

    Full Text Available Abstract Background The application and nutritional value of vegetable oil is highly dependent on its fatty acid composition, especially the relative proportion of its two major fatty acids, i.e oleic acid and linoleic acid. Microsomal oleoyl phosphatidylcholine desaturase encoded by FAD2 gene is known to introduce a double bond at the Δ12 position of an oleic acid on phosphatidylcholine and convert it to linoleic acid. The known plant FAD2 enzymes are encoded by small gene families consisting of 1-4 members. In addition to the classic oleate Δ12-desaturation activity, functional variants of FAD2 that are capable of undertaking additional or alternative acyl modifications have also been reported in a limited number of plant species. In this study, our objective was to identify FAD2 genes from safflower and analyse their differential expression profile and potentially diversified functionality. Results We report here the characterization and functional expression of an exceptionally large FAD2 gene family from safflower, and the temporal and spatial expression profiles of these genes as revealed through Real-Time quantitative PCR. The diversified functionalities of some of the safflower FAD2 gene family members were demonstrated by ectopic expression in yeast and transient expression in Nicotiana benthamiana leaves. CtFAD2-1 and CtFAD2-10 were demonstrated to be oleate desaturases specifically expressed in developing seeds and flower head, respectively, while CtFAD2-2 appears to have relatively low oleate desaturation activity throughout the plant. CtFAD2-5 and CtFAD2-8 are specifically expressed in root tissues, while CtFAD2-3, 4, 6, 7 are mostly expressed in the cotyledons and hypocotyls in young safflower seedlings. CtFAD2-9 was found to encode a novel desaturase operating on C16:1 substrate. CtFAD2-11 is a tri-functional enzyme able to introduce a carbon double bond in either cis or trans configuration, or a carbon triple (acetylenic bond

  14. Genome-wide identification and expression profiling reveal tissue-specific expression and differentially-regulated genes involved in gibberellin metabolism between Williams banana and its dwarf mutant.

    Science.gov (United States)

    Chen, Jingjing; Xie, Jianghui; Duan, Yajie; Hu, Huigang; Hu, Yulin; Li, Weiming

    2016-05-27

    Dwarfism is one of the most valuable traits in banana breeding because semi-dwarf cultivars show good resistance to damage by wind and rain. Moreover, these cultivars present advantages of convenient cultivation, management, and so on. We obtained a dwarf mutant '8818-1' through EMS (ethyl methane sulphonate) mutagenesis of Williams banana 8818 (Musa spp. AAA group). Our research have shown that gibberellins (GAs) content in 8818-1 false stems was significantly lower than that in its parent 8818 and the dwarf type of 8818-1 could be restored by application of exogenous GA3. Although GA exerts important impacts on the 8818-1 dwarf type, our understanding of the regulation of GA metabolism during banana dwarf mutant development remains limited. Genome-wide screening revealed 36 candidate GA metabolism genes were systematically identified for the first time; these genes included 3 MaCPS, 2 MaKS, 1 MaKO, 2 MaKAO, 10 MaGA20ox, 4 MaGA3ox, and 14 MaGA2ox genes. Phylogenetic tree and conserved protein domain analyses showed sequence conservation and divergence. GA metabolism genes exhibited tissue-specific expression patterns. Early GA biosynthesis genes were constitutively expressed but presented differential regulation in different tissues in Williams banana. GA oxidase family genes were mainly transcribed in young fruits, thus suggesting that young fruits were the most active tissue involved in GA metabolism, followed by leaves, bracts, and finally approximately mature fruits. Expression patterns between 8818 and 8818-1 revealed that MaGA20ox4, MaGA20ox5, and MaGA20ox7 of the MaGA20ox gene family and MaGA2ox7, MaGA2ox12, and MaGA2ox14 of the MaGA2ox gene family exhibited significant differential expression and high-expression levels in false stems. These genes are likely to be responsible for the regulation of GAs content in 8818-1 false stems. Overall, phylogenetic evolution, tissue specificity and differential expression analyses of GA metabolism genes can provide a

  15. [Genome-wide identification, phylogenetic analysis and expression profiling of the WOX family genes in Solanum lycopersicum].

    Science.gov (United States)

    Li, Xiao-xu; Liu, Cheng; Li, Wei; Zhang, Zeng-lin; Gao, Xiao-ming; Zhou, Hui; Guo, Yong-feng

    2016-05-01

    Members of the plant-specific WOX transcription factor family have been reported to play important roles in cell to cell communication as well as other physiological and developmental processes. In this study, ten members of the WOX transcription factor family were identified in Solanum lycopersicum with HMMER. Neighbor-joining phylogenetic tree, maximum-likelihood tree and Bayesian-inference tree were constructed and similar topologies were shown using the protein sequences of the homeodomain. Phylogenetic study revealed that the 25 WOX family members from Arabidopsis and tomato fall into three clades and nine subfamilies. The patterns of exon-intron structures and organization of conserved domains in Arabidopsis and tomato were consistent based on the phylogenetic results. Transcriptome analysis showed that the expression patterns of SlWOXs were different in different tissue types. Gene Ontology (GO) analysis suggested that, as transcription factors, the SlWOX family members could be involved in a number of biological processes including cell to cell communication and tissue development. Our results are useful for future studies on WOX family members in tomato and other plant species.

  16. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  17. Characterization of the Carbohydrate Binding Module 18 gene family in the amphibian pathogen Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Liu, Peng; Stajich, Jason E

    2015-04-01

    Batrachochytrium dendrobatidis (Bd) is the causative agent of chytridiomycosis responsible for worldwide decline in amphibian populations. Previous analysis of the Bd genome revealed a unique expansion of the carbohydrate-binding module family 18 (CBM18) predicted to be a sub-class of chitin recognition domains. CBM expansions have been linked to the evolution of pathogenicity in a variety of fungal species by protecting the fungus from the host. Based on phylogenetic analysis and presence of additional protein domains, the gene family can be classified into 3 classes: Tyrosinase-, Deacetylase-, and Lectin-like. Examination of the mRNA expression levels from sporangia and zoospores of nine of the cbm18 genes found that the Lectin-like genes had the highest expression while the Tyrosinase-like genes showed little expression, especially in zoospores. Heterologous expression of GFP-tagged copies of four CBM18 genes in Saccharomyces cerevisiae demonstrated that two copies containing secretion signal peptides are trafficked to the cell boundary. The Lectin-like genes cbm18-ll1 and cbm18-ll2 co-localized with the chitinous cell boundaries visualized by staining with calcofluor white. In vitro assays of the full length and single domain copies from CBM18-LL1 demonstrated chitin binding and no binding to cellulose or xylan. Expressed CBM18 domain proteins were demonstrated to protect the fungus, Trichoderma reeseii, in vitro against hydrolysis from exogenously added chitinase, likely by binding and limiting exposure of fungal chitin. These results demonstrate that cbm18 genes can play a role in fungal defense and expansion of their copy number may be an important pathogenicity factor of this emerging infectious disease of amphibians. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Attenuated familial adenomatous polyposis and Muir-Torre syndrome linked to compound biallelic constitutional MYH gene mutations.

    Science.gov (United States)

    Ponti, G; Ponz de Leon, M; Maffei, S; Pedroni, M; Losi, L; Di Gregorio, C; Gismondi, V; Scarselli, A; Benatti, P; Roncari, B; Seidenari, S; Pellacani, G; Varotti, C; Prete, E; Varesco, L; Roncucci, L

    2005-11-01

    Attenuated familial adenomatous polyposis and Muir-Torre syndrome linked to compound biallelic constitutional MYH gene mutations.Peculiar dermatologic manifestations are present in several heritable gastrointestinal disorders. Muir-Torre syndrome (MTS) is a genodermatosis whose peculiar feature is the presence of sebaceous gland tumors associated with visceral malignancies. We describe one patient in whom multiple sebaceous gland tumors were associated with early onset colon and thyroid cancers and attenuated polyposis coli. Her family history was positive for colonic adenomas. She had a daughter presenting with yellow papules in the forehead region developed in the late infancy. Skin and visceral neoplasms were tested for microsatellite instability and immunohistochemical status of mismatch repair (MMR), APC and MYH proteins. The proband colon and skin tumors were microsatellite stable and showed normal expression of MMR proteins. Cytoplasmic expression of MYH protein was revealed in colonic cancer cells. Compound heterozygosity due to biallelic mutations in MYH, R168H and 379delC, was identified in the proband. The 11-year-old daughter was carrier of the monoallelic constitutional mutation 379delC in the MYH gene; in the sister, the R168H MYH gene mutation was detected. This report presents an interesting case of association between MYH-associated polyposis and sebaceous gland tumors. These findings suggest that patients with MTS phenotype that include colonic polyposis should be screened for MYH gene mutations.

  19. CONFIRMATION OF X-LINKED INHERITANCE AND PROVISIONAL MAPPING OF THE KERATOSIS FOLLICULARIS SPINULOSA DECALVANS GENE ON XP IN A LARGE DUTCH FAMILY

    NARCIS (Netherlands)

    Oosterwijk, JC; NELEN, M; VANZANDVOORT, PM; VANOSCH, LDM; ORANJE, AP; WITTEBOLPOST, D; VANOOST, BA

    In a large Dutch family with keratosis follicularis spinulosa decalvans (KFSD, MIM 308800), DNA linkage analysis was performed in order to locate the gene. Pedigree analysis and lod score calculation confirmed X-linked inheritance and revealed significant linkage to DNA markers on Xp. A maximum lod

  20. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  1. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  2. Overlapping protective roles for glutathione transferase gene family members in chemical and oxidative stress response in Agrobacterium tumefaciens.

    Science.gov (United States)

    Skopelitou, Katholiki; Muleta, Abdi W; Pavli, Ourania; Skaracis, Georgios N; Flemetakis, Emmanouil; Papageorgiou, Anastassios C; Labrou, Nikolaos E

    2012-03-01

    In the present work, we describe the characterisation of the glutathione transferase (GST) gene family from Agrobacterium tumefaciens C58. A genome survey revealed the presence of eight GST-like proteins in A. tumefaciens (AtuGSTs). Comparison by multiple sequence alignment generated a dendrogram revealing the phylogenetic relationships of AtuGSTs-like proteins. The beta and theta classes identified in other bacterial species are represented by five members in A. tumefaciens C58. In addition, there are three "orphan" sequences that do not fit into any previously recognised GST classes. The eight GST-like genes were cloned, expressed in Escherichia coli and their substrate specificity was determined towards 17 different substrates. The results showed that AtuGSTs catalyse a broad range of reactions, with different members of the family exhibiting quite varied substrate specificity. The 3D structures of AtuGSTs were predicted using molecular modelling. The use of comparative sequence and structural analysis of the AtuGST isoenzymes allowed us to identify local sequence and structural characteristics between different GST isoenzymes and classes. Gene expression profiling was conducted under normal culture conditions as well as under abiotic stress conditions (addition of xenobiotics, osmotic stress and cold and heat shock) to induce and monitor early stress-response mechanisms. The results reveal the constitutive expression of GSTs in A. tumefaciens and a modulation of GST activity after treatments, indicating that AtuGSTs presumably participate in a wide range of functions, many of which are important in counteracting stress conditions. These functions may be relevant to maintaining cellular homeostasis as well as in the direct detoxification of toxic compounds.

  3. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  4. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  5. Interspecies introgressive hybridization in spiny frogs Quasipaa (Family Dicroglossidae) revealed by analyses on multiple mitochondrial and nuclear genes.

    Science.gov (United States)

    Zhang, Qi-Peng; Hu, Wen-Fang; Zhou, Ting-Ting; Kong, Shen-Shen; Liu, Zhi-Fang; Zheng, Rong-Quan

    2018-01-01

    Introgression may lead to discordant patterns of variation among loci and traits. For example, previous phylogeographic studies on the genus Quasipaa detected signs of genetic introgression from genetically and morphologically divergent Quasipaa shini or Quasipaa spinosa . In this study, we used mitochondrial and nuclear DNA sequence data to verify the widespread introgressive hybridization in the closely related species of the genus Quasipaa , evaluate the level of genetic diversity, and reveal the formation mechanism of introgressive hybridization. In Longsheng, Guangxi Province, signs of asymmetrical nuclear introgression were detected between Quasipaa boulengeri and Q. shini . Unidirectional mitochondrial introgression was revealed from Q. spinosa to Q. shini . By contrast, bidirectional mitochondrial gene introgression was detected between Q. spinosa and Q. shini in Lushan, Jiangxi Province. Our study also detected ancient hybridizations between a female Q. spinosa and a male Q. jiulongensis in Zhejiang Province. Analyses on mitochondrial and nuclear genes verified three candidate cryptic species in Q. spinosa , and a cryptic species may also exist in Q. boulengeri . However, no evidence of introgressive hybridization was found between Q. spinosa and Q. boulengeri . Quasipaa exilispinosa from all the sampling localities appeared to be deeply divergent from other communities. Our results suggest widespread introgressive hybridization in closely related species of Quasipaa and provide a fundamental basis for illumination of the forming mechanism of introgressive hybridization, classification of species, and biodiversity assessment in Quasipaa .

  6. WD-repeat instability and diversification of the Podospora anserina hnwd non-self recognition gene family.

    Science.gov (United States)

    Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu

    2010-05-06

    Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.

  7. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Science.gov (United States)

    Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan

    2018-01-01

    Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  8. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Directory of Open Access Journals (Sweden)

    Naoki Takata

    Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  9. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Directory of Open Access Journals (Sweden)

    Yan Liangzhen

    2012-11-01

    Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

  10. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  11. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  12. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  13. De novo transcriptome and small RNA analysis of two Chinese willow cultivars reveals stress response genes in Salix matsudana.

    Directory of Open Access Journals (Sweden)

    Guodong Rao

    Full Text Available Salix matsudana Koidz. is a deciduous, rapidly growing, and drought resistant tree and is one of the most widely distributed and commonly cultivated willow species in China. Currently little transcriptomic and small RNAomic data are available to reveal the genes involve in the stress resistant in S. matsudana. Here, we report the RNA-seq analysis results of both transcriptome and small RNAome data using Illumina deep sequencing of shoot tips from two willow variants(Salix. matsudana and Salix matsudana Koidz. cultivar 'Tortuosa'. De novo gene assembly was used to generate the consensus transcriptome and small RNAome, which contained 106,403 unique transcripts with an average length of 944 bp and a total length of 100.45 MB, and 166 known miRNAs representing 35 miRNA families. Comparison of transcriptomes and small RNAomes combined with quantitative real-time PCR from the two Salix libraries revealed a total of 292 different expressed genes(DEGs and 36 different expressed miRNAs (DEMs. Among the DEGs and DEMs, 196 genes and 24 miRNAs were up regulated, 96 genes and 12 miRNA were down regulated in S. matsudana. Functional analysis of DEGs and miRNA targets showed that many genes were involved in stress resistance in S. matsudana. Our global gene expression profiling presents a comprehensive view of the transcriptome and small RNAome which provide valuable information and sequence resources for uncovering the stress response genes in S. matsudana. Moreover the transcriptome and small RNAome data provide a basis for future study of genetic resistance in Salix.

  14. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  15. Genome-Wide Identification and Expression Analysis of the UGlcAE Gene Family in Tomato

    Directory of Open Access Journals (Sweden)

    Xing Ding

    2018-05-01

    Full Text Available The UGlcAE has the capability of interconverting UDP-d-galacturonic acid and UDP-d-glucuronic acid, and UDP-d-galacturonic acid is an activated precursor for the synthesis of pectins in plants. In this study, we identified nine UGlcAE protein-encoding genes in tomato. The nine UGlcAE genes that were distributed on eight chromosomes in tomato, and the corresponding proteins contained one or two trans-membrane domains. The phylogenetic analysis showed that SlUGlcAE genes could be divided into seven groups, designated UGlcAE1 to UGlcAE6, of which the UGlcAE2 were classified into two groups. Expression profile analysis revealed that the SlUGlcAE genes display diverse expression patterns in various tomato tissues. Selective pressure analysis indicated that all of the amino acid sites of SlUGlcAE proteins are undergoing purifying selection. Fifteen stress-, hormone-, and development-related elements were identified in the upstream regions (0.5 kb of these SlUGlcAE genes. Furthermore, we investigated the expression patterns of SlUGlcAE genes in response to three hormones (indole-3-acetic acid (IAA, gibberellin (GA, and salicylic acid (SA. We detected firmness, pectin contents, and expression levels of UGlcAE family genes during the development of tomato fruit. Here, we systematically summarize the general characteristics of the SlUGlcAE genes in tomato, which could provide a basis for further function studies of tomato UGlcAE genes.

  16. Gene expression profile analysis of Ligon lintless-1 (Li1) mutant reveals important genes and pathways in cotton leaf and fiber development.

    Science.gov (United States)

    Ding, Mingquan; Jiang, Yurong; Cao, Yuefen; Lin, Lifeng; He, Shae; Zhou, Wei; Rong, Junkang

    2014-02-10

    Ligon lintless-1 (Li1) is a monogenic dominant mutant of Gossypium hirsutum (upland cotton) with a phenotype of impaired vegetative growth and short lint fibers. Despite years of research involving genetic mapping and gene expression profile analysis of Li1 mutant ovule tissues, the gene remains uncloned and the underlying pathway of cotton fiber elongation is still unclear. In this study, we report the whole genome-level deep-sequencing analysis of leaf tissues of the Li1 mutant. Differentially expressed genes in leaf tissues of mutant versus wild-type (WT) plants are identified, and the underlying pathways and potential genes that control leaf and fiber development are inferred. The results show that transcription factors AS2, YABBY5, and KANDI-like are significantly differentially expressed in mutant tissues compared with WT ones. Interestingly, several fiber development-related genes are found in the downregulated gene list of the mutant leaf transcriptome. These genes include heat shock protein family, cytoskeleton arrangement, cell wall synthesis, energy, H2O2 metabolism-related genes, and WRKY transcription factors. This finding suggests that the genes are involved in leaf morphology determination and fiber elongation. The expression data are also compared with the previously published microarray data of Li1 ovule tissues. Comparative analysis of the ovule transcriptomes of Li1 and WT reveals that a number of pathways important for fiber elongation are enriched in the downregulated gene list at different fiber development stages (0, 6, 9, 12, 15, 18dpa). Differentially expressed genes identified in both leaf and fiber samples are aligned with cotton whole genome sequences and combined with the genetic fine mapping results to identify a list of candidate genes for Li1. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Genome-wide identification of Jatropha curcas aquaporin genes and the comparative analysis provides insights into the gene family expansion and evolution in Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Zhi eZou

    2016-03-01

    Full Text Available Aquaporins (AQPs are channel-forming integral membrane proteins that transport water and other small solutes across biological membranes. Despite the vital role of AQPs, to date, little is known in physic nut (Jatropha curcas L., Euphorbiaceae, an important non-edible oilseed crop with great potential for the production of biodiesel. In this study, 32 AQP genes were identified from the physic nut genome and the family number is relatively small in comparison to 51 in another Euphorbiaceae plant, rubber tree (Hevea brasiliensis Muell. Arg.. Based on the phylogenetic analysis, the JcAQPs were assigned to five subfamilies, i.e., 9 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 2 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs. Like rubber tree and other plant species, functional prediction based on the aromatic/arginine selectivity filter, Froger’s positions and specificity-determining positions showed a remarkable difference in substrate specificity among subfamilies of JcAQPs. Genome-wide comparative analysis revealed the specific expansion of PIP and TIP subfamilies in rubber tree and the specific gene loss of the XIP subfamily in physic nut. Furthermore, by analyzing deep transcriptome sequencing data, the expression evolution especially the expression divergence of duplicated HbAQP genes was also investigated and discussed. Results obtained from this study not only provide valuable information for future functional analysis and utilization of Jc/HbAQP genes, but also provide a useful reference to survey the gene family expansion and evolution in Euphorbiaceae plants and other plant species.

  18. Concerted evolution of sea anemone neurotoxin genes is revealed through analysis of the Nematostella vectensis genome.

    Science.gov (United States)

    Moran, Yehu; Weinberger, Hagar; Sullivan, James C; Reitzel, Adam M; Finnerty, John R; Gurevitz, Michael

    2008-04-01

    Gene families, which encode toxins, are found in many poisonous animals, yet there is limited understanding of their evolution at the nucleotide level. The release of the genome draft sequence for the sea anemone Nematostella vectensis enabled a comprehensive study of a gene family whose neurotoxin products affect voltage-gated sodium channels. All gene family members are clustered in a highly repetitive approximately 30-kb genomic region and encode a single toxin, Nv1. These genes exhibit extreme conservation at the nucleotide level which cannot be explained by purifying selection. This conservation greatly differs from the toxin gene families of other animals (e.g., snakes, scorpions, and cone snails), whose evolution was driven by diversifying selection, thereby generating a high degree of genetic diversity. The low nucleotide diversity at the Nv1 genes is reminiscent of that reported for DNA encoding ribosomal RNA (rDNA) and 2 hsp70 genes from Drosophila, which have evolved via concerted evolution. This evolutionary pattern was experimentally demonstrated in yeast rDNA and was shown to involve unequal crossing-over. Through sequence analysis of toxin genes from multiple N. vectensis populations and 2 other anemone species, Anemonia viridis and Actinia equina, we observed that the toxin genes for each sea anemone species are more similar to one another than to those of other species, suggesting they evolved by manner of concerted evolution. Furthermore, in 2 of the species (A. viridis and A. equina) we found genes that evolved under diversifying selection, suggesting that concerted evolution and accelerated evolution may occur simultaneously.

  19. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  20. Genome-Wide Identification, Evolutionary Analysis and Expression Profiles of LATERAL ORGAN BOUNDARIES DOMAIN Gene Family in Lotus japonicus and Medicago truncatula.

    Directory of Open Access Journals (Sweden)

    Tianquan Yang

    Full Text Available The LATERAL ORGAN BOUNDARIES DOMAIN (LBD gene family has been well-studied in Arabidopsis and play crucial roles in the diverse growth and development processes including establishment and maintenance of boundary of developmental lateral organs. In this study we identified and characterized 38 LBD genes in Lotus japonicus (LjLBD and 57 LBD genes in Medicago truncatula (MtLBD, both of which are model legume plants that have some specific development features absent in Arabidopsis. The phylogenetic relationships, their locations in the genome, genes structure and conserved motifs were examined. The results revealed that all LjLBD and MtLBD genes could be distinctly divided into two classes: Class I and II. The evolutionary analysis showed that Type I functional divergence with some significantly site-specific shifts may be the main force for the divergence between Class I and Class II. In addition, the expression patterns of LjLBD genes uncovered the diverse functions in plant development. Interestingly, we found that two LjLBD proteins that were highly expressed during compound leaf and pulvinus development, can interact via yeast two-hybrid assays. Taken together, our findings provide an evolutionary and genetic foundation in further understanding the molecular basis of LBD gene family in general, specifically in L. japonicus and M. truncatula.

  1. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  2. Gene expression profiling reveals new potential players of gonad differentiation in the chicken embryo.

    Directory of Open Access Journals (Sweden)

    Gwenn-Aël Carré

    Full Text Available BACKGROUND: In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s involved in gonad differentiation is still incomplete. METHODOLOGY/PRINCIPAL FINDINGS: With the aim of improving characterization of the molecular pathway(s involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. CONCLUSION/SIGNIFICANCE: This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors

  3. Gene Expression Profiling Reveals New Potential Players of Gonad Differentiation in the Chicken Embryo

    Science.gov (United States)

    Carré, Gwenn-Aël; Couty, Isabelle; Hennequet-Antier, Christelle; Govoroun, Marina S.

    2011-01-01

    Background In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s) involved in gonad differentiation is still incomplete. Methodology/Principal Findings With the aim of improving characterization of the molecular pathway(s) involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein) and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. Conclusion/Significance This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors of chicken gonad

  4. The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.

    Science.gov (United States)

    Vonk, Freek J; Casewell, Nicholas R; Henkel, Christiaan V; Heimberg, Alysha M; Jansen, Hans J; McCleary, Ryan J R; Kerkkamp, Harald M E; Vos, Rutger A; Guerreiro, Isabel; Calvete, Juan J; Wüster, Wolfgang; Woods, Anthony E; Logan, Jessica M; Harrison, Robert A; Castoe, Todd A; de Koning, A P Jason; Pollock, David D; Yandell, Mark; Calderon, Diego; Renjifo, Camila; Currier, Rachel B; Salgado, David; Pla, Davinia; Sanz, Libia; Hyder, Asad S; Ribeiro, José M C; Arntzen, Jan W; van den Thillart, Guido E E J M; Boetzer, Marten; Pirovano, Walter; Dirks, Ron P; Spaink, Herman P; Duboule, Denis; McGlinn, Edwina; Kini, R Manjunatha; Richardson, Michael K

    2013-12-17

    Snakes are limbless predators, and many species use venom to help overpower relatively large, agile prey. Snake venoms are complex protein mixtures encoded by several multilocus gene families that function synergistically to cause incapacitation. To examine venom evolution, we sequenced and interrogated the genome of a venomous snake, the king cobra (Ophiophagus hannah), and compared it, together with our unique transcriptome, microRNA, and proteome datasets from this species, with data from other vertebrates. In contrast to the platypus, the only other venomous vertebrate with a sequenced genome, we find that snake toxin genes evolve through several distinct co-option mechanisms and exhibit surprisingly variable levels of gene duplication and directional selection that correlate with their functional importance in prey capture. The enigmatic accessory venom gland shows a very different pattern of toxin gene expression from the main venom gland and seems to have recruited toxin-like lectin genes repeatedly for new nontoxic functions. In addition, tissue-specific microRNA analyses suggested the co-option of core genetic regulatory components of the venom secretory system from a pancreatic origin. Although the king cobra is limbless, we recovered coding sequences for all Hox genes involved in amniote limb development, with the exception of Hoxd12. Our results provide a unique view of the origin and evolution of snake venom and reveal multiple genome-level adaptive responses to natural selection in this complex biological weapon system. More generally, they provide insight into mechanisms of protein evolution under strong selection.

  5. Mouse Nkrp1-Clr gene cluster sequence and expression analyses reveal conservation of tissue-specific MHC-independent immunosurveillance.

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    Full Text Available The Nkrp1 (Klrb1-Clr (Clec2 genes encode a receptor-ligand system utilized by NK cells as an MHC-independent immunosurveillance strategy for innate immune responses. The related Ly49 family of MHC-I receptors displays extreme allelic polymorphism and haplotype plasticity. In contrast, previous BAC-mapping and aCGH studies in the mouse suggest the neighboring and related Nkrp1-Clr cluster is evolutionarily stable. To definitively compare the relative evolutionary rate of Nkrp1-Clr vs. Ly49 gene clusters, the Nkrp1-Clr gene clusters from two Ly49 haplotype-disparate inbred mouse strains, BALB/c and 129S6, were sequenced. Both Nkrp1-Clr gene cluster sequences are highly similar to the C57BL/6 reference sequence, displaying the same gene numbers and order, complete pseudogenes, and gene fragments. The Nkrp1-Clr clusters contain a strikingly dissimilar proportion of repetitive elements compared to the Ly49 clusters, suggesting that certain elements may be partly responsible for the highly disparate Ly49 vs. Nkrp1 evolutionary rate. Focused allelic polymorphisms were found within the Nkrp1b/d (Klrb1b, Nkrp1c (Klrb1c, and Clr-c (Clec2f genes, suggestive of possible immune selection. Cell-type specific transcription of Nkrp1-Clr genes in a large panel of tissues/organs was determined. Clr-b (Clec2d and Clr-g (Clec2i showed wide expression, while other Clr genes showed more tissue-specific expression patterns. In situ hybridization revealed specific expression of various members of the Clr family in leukocytes/hematopoietic cells of immune organs, various tissue-restricted epithelial cells (including intestinal, kidney tubular, lung, and corneal progenitor epithelial cells, as well as myocytes. In summary, the Nkrp1-Clr gene cluster appears to evolve more slowly relative to the related Ly49 cluster, and likely regulates innate immunosurveillance in a tissue-specific manner.

  6. A novel splice site mutation in the dentin sialophosphoprotein gene in a Chinese family with dentinogenesis imperfecta type II

    International Nuclear Information System (INIS)

    Wang Haoyang; Hou Yanning; Cui Yingxia; Huang Yufeng; Shi Yichao; Xia Xinyi; Lu Hongyong; Wang Yunhua; Li Xiaojun

    2009-01-01

    Twenty-four individuals were investigated that spanned six generations in a Chinese family affected with an apparently autosomal dominant form of dentinogenesis imperfecta type II (DGI-II, OMIM 125490). All affected individuals presented with typical, clinical and radiographic features of DGI-II, but without bilateral progressive high-frequency sensorineural hearing loss. To investigate the mutated molecule, a positional candidate approach was used to determine the mutated gene in this family. Genomic DNA was obtained from 24 affected individuals, 18 unaffected relatives of the family and 50 controls. Haplotype analysis was performed using leukocyte DNA for 6 short tandem repeat (STR) markers present in chromosome 4 (D4S1534, GATA62A11, DSPP, DMP1, SPP1 and D4S1563). In the critical region between D4S1534 and DMP1, the dentin sialophosphoprotein (DSPP) gene (OMIM *125485) was considered as the strongest candidate gene. The first four exons and exon/intron boundaries of the gene were analyzed using DNA from 24 affected individuals and 18 unaffected relatives of the same family. DNA sequencing revealed a heterozygous deletion mutation in intron 2 (at positions -3 to -25), which resulted in a frameshift mutation, that changed the acceptor site sequence from CAG to AAG (IVS2-3C→A) and may also have disrupted the branch point consensus sequence in intron 2. The mutation was found in the 24 affected individuals, but not in the 18 unaffected relatives and 50 controls. The deletion was identified by allele-specific sequencing and denaturing high-performance liquid chromatography (DHPLC) analysis. We conclude that the heterozygous deletion mutation contributed to the pathogenesis of DGI-II

  7. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  8. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  9. The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding.

    Science.gov (United States)

    Ayadi, M; Hanana, M; Kharrat, N; Merchaoui, H; Marzoug, R Ben; Lauvergeat, V; Rebaï, A; Mzid, R

    2016-10-01

    WRKY transcription factors belong to a large family of plant transcriptional regulators whose members have been reported to be involved in a wide range of biological roles including plant development, adaptation to environmental constraints and response to several diseases. However, little or poor information is available about WRKY's in Citrus. The recent release of completely assembled genomes sequences of Citrus sinensis and Citrus clementina and the availability of ESTs sequences from other citrus species allowed us to perform a genome survey for Citrus WRKY proteins. In the present study, we identified 100 WRKY members from C. sinensis (51), C. clementina (48) and Citrus unshiu (1), and analyzed their chromosomal distribution, gene structure, gene duplication, syntenic relation and phylogenetic analysis. A phylogenetic tree of 100 Citrus WRKY sequences with their orthologs from Arabidopsis has distinguished seven groups. The CsWRKY genes were distributed across all ten sweet orange chromosomes. A comprehensive approach and an integrative analysis of Citrus WRKY gene expression revealed variable profiles of expression within tissues and stress conditions indicating functional diversification. Thus, candidate Citrus WRKY genes have been proposed as potentially involved in fruit acidification, essential oil biosynthesis and abiotic/biotic stress tolerance. Our results provided essential prerequisites for further WRKY genes cloning and functional analysis with an aim of citrus crop improvement.

  10. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  11. A Genomic Survey of SCPP Family Genes in Fishes Provides Novel Insights into the Evolution of Fish Scales.

    Science.gov (United States)

    Lv, Yunyun; Kawasaki, Kazuhiko; Li, Jia; Li, Yanping; Bian, Chao; Huang, Yu; You, Xinxin; Shi, Qiong

    2017-11-16

    The family of secretory calcium-binding phosphoproteins (SCPPs) have been considered vital to skeletal tissue mineralization. However, most previous SCPP studies focused on phylogenetically distant animals but not on those closely related species. Here we provide novel insights into the coevolution of SCPP genes and fish scales in 10 species from Otophysi . According to their scale phenotypes, these fishes can be divided into three groups, i.e., scaled, sparsely scaled, and scaleless. We identified homologous SCPP genes in the genomes of these species and revealed an absence of some SCPP members in some genomes, suggesting an uneven evolutionary history of SCPP genes in fishes. In addition, most of these SCPP genes, with the exception of SPP1 , individually form one or two gene cluster(s) on each corresponding genome. Furthermore, we constructed phylogenetic trees using maximum likelihood method to estimate their evolution. The phylogenetic topology mostly supports two subclasses in some species, such as Cyprinus carpio , Sinocyclocheilus anshuiensis , S. grahamin , and S. rhinocerous , but not in the other examined fishes. By comparing the gene structures of recently reported candidate genes, SCPP1 and SCPP5 , for determining scale phenotypes, we found that the hypothesis is suitable for Astyanax mexicanus , but denied by S. anshuiensis , even though they are both sparsely scaled for cave adaptation. Thus, we conclude that, although different fish species display similar scale phenotypes, the underlying genetic changes however might be diverse. In summary, this paper accelerates the recognition of the SCPP family in teleosts for potential scale evolution.

  12. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  13. Genome-wide analysis of the GRAS gene family in Prunus mume.

    Science.gov (United States)

    Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

    2015-02-01

    Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

  14. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  15. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  16. A novel HSF4 gene mutation (p.R405X causing autosomal recessive congenital cataracts in a large consanguineous family from Pakistan

    Directory of Open Access Journals (Sweden)

    Cheema Abdul

    2008-11-01

    Full Text Available Abstract Background Hereditary cataracts are most frequently inherited as autosomal dominant traits, but can also be inherited in an autosomal recessive or X-linked fashion. To date, 12 loci for autosomal recessive cataracts have been mapped including a locus on chromosome 16q22 containing the disease-causing gene HSF4 (Genbank accession number NM_001040667. Here, we describe a family from Pakistan with the first nonsense mutation in HSF4 thus expanding the mutational spectrum of this heat shock transcription factor gene. Methods A large consanguineous Pakistani family with autosomal recessive cataracts was collected from Quetta. Genetic linkage analysis was performed for the common known autosomal recessive cataracts loci and linkage to a locus containing HSF4 (OMIM 602438 was found. All exons and adjacent splice sites of the heat shock transcription factor 4 gene (HSF4 were sequenced. A mutation-specific restriction enzyme digest (HphI was performed for all family members and unrelated controls. Results The disease phenotype perfectly co-segregated with markers flanking the known cataract gene HSF4, whereas other autosomal recessive loci were excluded. A maximum two-point LOD score with a Zmax = 5.6 at θ = 0 was obtained for D16S421. Direct sequencing of HSF4 revealed the nucleotide exchange c.1213C > T in this family predicting an arginine to stop codon exchange (p.R405X. Conclusion We identified the first nonsense mutation (p.R405X in exon 11 of HSF4 in a large consanguineous Pakistani family with autosomal recessive cataract.

  17. Evolution and diversification of the CYC/TB1 gene family in Asteraceae--a comparative study in Gerbera (Mutisieae) and sunflower (Heliantheae).

    Science.gov (United States)

    Tähtiharju, Sari; Rijpkema, Anneke S; Vetterli, Adrien; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula

    2012-04-01

    Plant-specific TCP domain transcription factors have been shown to regulate morphological novelties during plant evolution, including the complex architecture of the Asteraceae inflorescence that involves different types of flowers. We conducted comparative analysis of the CYCLOIDEA/TEOSINTE BRANCHED1 (CYC/TB1) gene family in Gerbera hybrida (gerbera) and Helianthus annuus (sunflower), two species that represent distant tribes within Asteraceae. Our data confirm that the CYC/TB1 gene family has expanded in Asteraceae, a condition that appears to be connected with the increased developmental complexity and evolutionary success of this large plant family. Phylogenetic analysis of the CYC/TB1 gene family revealed both shared and lineage-specific duplications in gerbera and sunflower, corresponding to the three gene lineages previously identified as specific to core eudicots: CYC1, CYC2, and CYC3. Expression analyses of early stages of flower primordia development indicated that especially within the CYC2 clade, with the greatest number of secondary gene duplications, gene expression patterns are conserved between the species and associated with flower and inflorescence development. All sunflower and gerbera CYC2 clade genes showed differential expression between developing flower types, being upregulated in marginal ray (and trans) flowers. One gene in gerbera (GhCYC3) and two in sunflower (HaCYC2d and HaCYC2c) were indicated to be strong candidates as regulators of ray flower identity, a function that is specific for Asteraceae. Our data further showed that other CYC2 clade genes are likely to have more specialized functions at the level of single flowers, including the late functions in floral reproductive organs that may be more conserved across plant families. The expression patterns of CYC1 and CYC3 clade genes showed more differences between the two species but still pointed to possible conserved functions during vegetative plant development. Pairwise protein

  18. Omega-3 fatty acid desaturase gene family from two ω-3 sources, Salvia hispanica and Perilla frutescens: Cloning, characterization and expression.

    Directory of Open Access Journals (Sweden)

    Yufei Xue

    Full Text Available Omega-3 fatty acid desaturase (ω-3 FAD, D15D is a key enzyme for α-linolenic acid (ALA biosynthesis. Both chia (Salvia hispanica and perilla (Perilla frutescens contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A tailing sites, and 7 introns. The 5'UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5'UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops.

  19. Omega-3 fatty acid desaturase gene family from two ω-3 sources, Salvia hispanica and Perilla frutescens: Cloning, characterization and expression

    Science.gov (United States)

    Xue, Yufei; Chen, Baojun; Win, Aung Naing; Fu, Chun; Lian, Jianping; Liu, Xue; Wang, Rui; Zhang, Xingcui

    2018-01-01

    Omega-3 fatty acid desaturase (ω-3 FAD, D15D) is a key enzyme for α-linolenic acid (ALA) biosynthesis. Both chia (Salvia hispanica) and perilla (Perilla frutescens) contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous) genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A) tailing sites, and 7 introns. The 5’UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5’UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops. PMID:29351555

  20. Repeat-Associated Plasticity in the Helicobacter pylori RD Gene Family▿ †

    Science.gov (United States)

    Shak, Joshua R.; Dick, Jonathan J.; Meinersmann, Richard J.; Perez-Perez, Guillermo I.; Blaser, Martin J.

    2009-01-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3′ region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5′ region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host. PMID:19749042

  1. NMD and microRNA expression profiling of the HPCX1 locus reveal MAGEC1 as a candidate prostate cancer predisposition gene

    International Nuclear Information System (INIS)

    Mattila, Henna; Schindler, Martin; Isotalo, Jarkko; Ikonen, Tarja; Vihinen, Mauno; Oja, Hannu; Tammela, Teuvo LJ; Wahlfors, Tiina; Schleutker, Johanna

    2011-01-01

    Several predisposition loci for hereditary prostate cancer (HPC) have been suggested, including HPCX1 at Xq27-q28, but due to the complex structure of the region, the susceptibility gene has not yet been identified. In this study, nonsense-mediated mRNA decay (NMD) inhibition was used for the discovery of truncating mutations. Six prostate cancer (PC) patients and their healthy brothers were selected from a group of HPCX1-linked families. Expression analyses were done using Agilent 44 K oligoarrays, and selected genes were screened for mutations by direct sequencing. In addition, microRNA expression levels in the lymphoblastic cells were analyzed to trace variants that might alter miRNA expression and explain partly an inherited genetic predisposion to PC. Seventeen genes were selected for resequencing based on the NMD array, but no truncating mutations were found. The most interesting variant was MAGEC1 p.Met1?. An association was seen between the variant and unselected PC (OR = 2.35, 95% CI = 1.10-5.02) and HPC (OR = 3.38, 95% CI = 1.10-10.40). miRNA analysis revealed altogether 29 miRNAs with altered expression between the PC cases and controls. miRNA target analysis revealed that 12 of them also had possible target sites in the MAGEC1 gene. These miRNAs were selected for validation process including four miRNAs located in the X chromosome. The expressions of 14 miRNAs were validated in families that contributed to the significant signal differences in Agilent arrays. Further functional studies are needed to fully understand the possible contribution of these miRNAs and MAGEC1 start codon variant to PC

  2. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  3. Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks.

    Science.gov (United States)

    Mai, Hans-Jörg; Pateyron, Stéphanie; Bauer, Petra

    2016-10-03

    FIT (FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR) is the central regulator of iron uptake in Arabidopsis thaliana roots. We performed transcriptome analyses of six day-old seedlings and roots of six week-old plants using wild type, a fit knock-out mutant and a FIT over-expression line grown under iron-sufficient or iron-deficient conditions. We compared genes regulated in a FIT-dependent manner depending on the developmental stage of the plants. We assembled a high likelihood dataset which we used to perform co-expression and functional analysis of the most stably iron deficiency-induced genes. 448 genes were found FIT-regulated. Out of these, 34 genes were robustly FIT-regulated in root and seedling samples and included 13 novel FIT-dependent genes. Three hundred thirty-one genes showed differential regulation in response to the presence and absence of FIT only in the root samples, while this was the case for 83 genes in the seedling samples. We assembled a virtual dataset of iron-regulated genes based on a total of 14 transcriptomic analyses of iron-deficient and iron-sufficient wild-type plants to pinpoint the best marker genes for iron deficiency and analyzed this dataset in depth. Co-expression analysis of this dataset revealed 13 distinct regulons part of which predominantly contained functionally related genes. We could enlarge the list of FIT-dependent genes and discriminate between genes that are robustly FIT-regulated in roots and seedlings or only in one of those. FIT-regulated genes were mostly induced, few of them were repressed by FIT. With the analysis of a virtual dataset we could filter out and pinpoint new candidates among the most reliable marker genes for iron deficiency. Moreover, co-expression and functional analysis of this virtual dataset revealed iron deficiency-induced and functionally distinct regulons.

  4. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  5. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  6. Whole genome sequencing reveals a novel deletion variant in the KIT gene in horses with white spotted coat colour phenotypes.

    Science.gov (United States)

    Dürig, N; Jude, R; Holl, H; Brooks, S A; Lafayette, C; Jagannathan, V; Leeb, T

    2017-08-01

    White spotting phenotypes in horses can range in severity from the common white markings up to completely white horses. EDNRB, KIT, MITF, PAX3 and TRPM1 represent known candidate genes for such phenotypes in horses. For the present study, we re-investigated a large horse family segregating a variable white spotting phenotype, for which conventional Sanger sequencing of the candidate genes' individual exons had failed to reveal the causative variant. We obtained whole genome sequence data from an affected horse and specifically searched for structural variants in the known candidate genes. This analysis revealed a heterozygous ~1.9-kb deletion spanning exons 10-13 of the KIT gene (chr3:77,740,239_77,742,136del1898insTATAT). In continuity with previously named equine KIT variants we propose to designate the newly identified deletion variant W22. We had access to 21 horses carrying the W22 allele. Four of them were compound heterozygous W20/W22 and had a completely white phenotype. Our data suggest that W22 represents a true null allele of the KIT gene, whereas the previously identified W20 leads to a partial loss of function. These findings will enable more precise genetic testing for depigmentation phenotypes in horses. © 2017 Stichting International Foundation for Animal Genetics.

  7. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    Directory of Open Access Journals (Sweden)

    Shamim Saleha

    2016-05-01

    Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  8. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype.

    Science.gov (United States)

    Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul

    2016-01-01

    To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  9. The Fanconi anemia family of genes and its correlation with breast cancer susceptibility and breast cancer features.

    Science.gov (United States)

    Barroso, E; Pita, G; Arias, J I; Menendez, P; Zamora, P; Blanco, M; Benitez, J; Ribas, G

    2009-12-01

    Fanconi anemia (FA) family of proteins participates in the DNA repair pathway by homologous recombination, and it is currently formed by 13 genes. Some of these proteins also confer susceptibility to hereditary breast and ovarian cancer (HBOC), since FANCD1 is the BRCA2 breast cancer susceptibility gene, and FANCN/PALB2 and FANCJ/BRIP1 explain 2% of non-BRCA1/2 HBOC families. Thus, there is an important connection between FA and BRCA pathways. In a previous case-control association study analysing FANCA, FANCD2 and FANCL, we reported an association between FANCD2 and sporadic breast cancer (BC) risk (OR = 1.35). In order to know whether variants in other FA genes could also be involved in this association, we have extended our study with the rest of FA genes and some others implicated in the BRCA pathway. We have also analyzed the correlation with survival, nodal metastasis and hormonal receptors (ER- and PR-). A total of 61 SNPs in ten FA genes (FANC-B, -C, -D1, -E, -F, -G, -I, -J, -M, -N) and five FA related genes (ATM, ATR, BRCA1, H2AX and USP1) were studied in a total of 547 consecutive and nonrelated sporadic BC cases and 552 unaffected controls from the Spanish population. Association analyses reported marginal statistically significant results with the minor allele of intronic SNPs in three genes: BRCA1, BRCA2/FANCD1, and ATM. Survival association with SNPs on FANCC and BRCA2/FANCD1 genes were also reported. Sub-group analyses revealed associations between SNPs on FANCI and ATM and nodal metastasis status and between FANCJ/BRIP1 and FANCN/PALB2 and PR- status.

  10. Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.

    Directory of Open Access Journals (Sweden)

    Juergen H Nett

    Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.

  11. Comprehensive Analysis of ETS Family Members in Melanoma by Fluorescence In Situ Hybridization Reveals Recurrent ETV1 Amplification

    Science.gov (United States)

    Mehra, Rohit; Dhanasekaran, Saravana M; Palanisamy, Nallasivam; Vats, Pankaj; Cao, Xuhong; Kim, Jung H; Kim, David SL; Johnson, Timothy; Fullen, Douglas R; Chinnaiyan, Arul M

    2013-01-01

    E26 transformation-specific (ETS) transcription factors are known to be involved in gene aberrations in various malignancies including prostate cancer; however, their role in melanoma oncogenesis has yet to be fully explored. We have completed a comprehensive fluorescence in situ hybridization (FISH)-based screen for all 27 members of the ETS transcription factor family on two melanoma tissue microarrays, representing 223 melanomas, 10 nevi, and 5 normal skin tissues. None of the melanoma cases demonstrated ETS fusions; however, 6 of 114 (5.3%) melanomas were amplified for ETV1 using a break-apart FISH probe. For the six positive cases, locus-controlled FISH probes revealed that two of six cases were amplified for the ETV1 region, whereas four cases showed copy gains of the entire chromosome 7. The remaining 26 ETS family members showed no chromosomal aberrations by FISH. Quantitative polymerase chain reaction showed an average 3.4-fold (P value = .00218) increased expression of ETV1 in melanomas, including the FISH ETV1-amplified cases, when compared to other malignancies (prostate, breast, and bladder carcinomas). These data suggest that a subset of melanomas overexpresses ETV1 and amplification of ETV1 may be one mechanism for achieving high gene expression. PMID:23908683

  12. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

  13. In silico genome-wide identification and characterization of the glutathione S-transferase gene family in Vigna radiata.

    Science.gov (United States)

    Vaish, Swati; Awasthi, Praveen; Tiwari, Siddharth; Tiwari, Shailesh Kumar; Gupta, Divya; Basantani, Mahesh Kumar

    2018-05-01

    Plant glutathione S-transferases (GSTs) are integral to normal plant metabolism and biotic and abiotic stress tolerance. The GST gene family has been characterized in diverse plant species using molecular biology and bioinformatics approaches. In the current study, in silico analysis identified 44 GSTs in Vigna radiata. Of the total 44 GSTs identified, chromosomal locations of 31 GSTs were confirmed. The pI value of GST proteins ranged from 5.10 to 9.40. The predicted molecular weights ranged from 13.12 to 50 kDa. Subcellular localization analysis revealed that all GSTs were predominantly localized in the cytoplasm. The active site amino acids were confirmed to be serine in tau, phi, theta, zeta, and TCHQD; cysteine in lambda, DHAR, and omega; and tyrosine in EF1G. The gene architecture conformed to the two-exon/one-intron and three-exon/two-intron organization in the case of tau and phi classes, respectively. MEME analysis identified 10 significantly conserved motifs with the width of 8-50 amino acids. The motifs identified were either specific to a specific GST class or were shared by multiple GST classes. The results of the current study will be of potential importance in the characterization of the GST gene family in V. radiata, an economically important leguminous crop.

  14. A novel mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail ectodermal dysplasia (ECTD9) in a Pakistani family.

    Science.gov (United States)

    Khan, Anwar Kamal; Muhammad, Noor; Aziz, Abdul; Khan, Sher Alam; Shah, Khadim; Nasir, Abdul; Khan, Muzammil Ahmad; Khan, Saadullah

    2017-04-12

    Pure hair and nail ectodermal dysplasia (PHNED) is a congenital disorder of hair abnormalities and nail dysplasia. Both autosomal recessive and dominant inheritance fashion of PHNED occurs. In literature, to date, five different forms of PHNED have been reported at molecular level, having three genes known and two loci with no gene yet. In this study, a four generations consanguineous family of Pakistani origin with autosomal recessive PHNED was investigated. Affected members exhibited PHNED phenotypes with involvement of complete hair loss and nail dysplasia. To screen for mutation in the genes (HOXC13, KRT74, KRT85), its coding exons and exons-intron boundaries were sequenced. The 3D models of normal and mutated HOXC13 were predicted by using homology modeling. Through investigating the family to known loci, the family was mapped to ectodermal dysplasia 9 (ECTD9) loci with genetic address of 12q13.13. Mutation screening revealed a novel missense mutation (c.929A > C; p.Asn310Thr) in homeobox DNA binding domain of HOXC13 gene in affected members of the family. Due to mutation, loss of hydrogen bonding and difference in potential energy occurs, which may resulting in alteration of protein function. This is the first mutation reported in homeodomain, while 5 th mutation reported in HOXC13 gene causing PHNED.

  15. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  16. Comparative Analysis of WUSCHEL-Related Homeobox Genes Revealed Their Parent-of-Origin and Cell Type-Specific Expression Pattern During Early Embryogenesis in Tobacco

    Directory of Open Access Journals (Sweden)

    Xuemei Zhou

    2018-03-01

    Full Text Available WUSCHEL-related homeobox (WOX gene is a plant-specific clade of homeobox transcription factors. Increasing evidences reveal that WOXs play critical roles in early embryogenesis, which involves zygote development, initiation of zygote division, and apical or basal cell lineage establishment. However, how WOXs regulate these developmental events remains largely unknown, and even detailed expression pattern in gametes and early proembryos is not yet available. Here, 13 WOX family genes were identified in Nicotiana tabacum genome. Comparative analysis of 13 WOX family genes with their homologs in Arabidopsis thaliana reveals relatively conserved expression pattern of WUS and WOX5 in shoot/root apical meristem. Whereas variations were also found, e.g., lacking homolog of WOX8 (a marker for suspensor cell in tobacco genome and the expression of WOX2/WOX9 in both apical cell and basal cell. Transient transcriptional activity analysis revealed that WOXs in WUS clade have repressive activities for their target's transcription, whereas WOXs in ancient and intermediate clade have activation activities, giving a molecular basis for the phylogenetic classification of tobacco WOXs into three major clades. Expression pattern analysis revealed that some WOXs (e.g., WOX 13a expressed in both male and female gametes and some WOXs (e.g., WOX 11 and WOX 13b displayed the characteristics of parent-of-origin genes. Interestingly, some WOXs (e.g., WOX2 and WOX9, which are essential for early embryo patterning, were de novo transcribed in zygote, indicating relevant mechanism for embryo pattern formation is only established in zygote right after fertilization and not carried in by gametes. We also found that most WOXs displayed a stage-specific and cell type-specific expression pattern. Taken together, this work provides a detailed landscape of WOXs in tobacco during fertilization and early embryogenesis, which will facilitate the understanding of their specific roles

  17. Extracting gene expression patterns and identifying co-expressed genes from microarray data reveals biologically responsive processes

    Directory of Open Access Journals (Sweden)

    Paules Richard S

    2007-11-01

    Full Text Available Abstract Background A common observation in the analysis of gene expression data is that many genes display similarity in their expression patterns and therefore appear to be co-regulated. However, the variation associated with microarray data and the complexity of the experimental designs make the acquisition of co-expressed genes a challenge. We developed a novel method for Extracting microarray gene expression Patterns and Identifying co-expressed Genes, designated as EPIG. The approach utilizes the underlying structure of gene expression data to extract patterns and identify co-expressed genes that are responsive to experimental conditions. Results Through evaluation of the correlations among profiles, the magnitude of variation in gene expression profiles, and profile signal-to-noise ratio's, EPIG extracts a set of patterns representing co-expressed genes. The method is shown to work well with a simulated data set and microarray data obtained from time-series studies of dauer recovery and L1 starvation in C. elegans and after ultraviolet (UV or ionizing radiation (IR-induced DNA damage in diploid human fibroblasts. With the simulated data set, EPIG extracted the appropriate number of patterns which were more stable and homogeneous than the set of patterns that were determined using the CLICK or CAST clustering algorithms. However, CLICK performed better than EPIG and CAST with respect to the average correlation between clusters/patterns of the simulated data. With real biological data, EPIG extracted more dauer-specific patterns than CLICK. Furthermore, analysis of the IR/UV data revealed 18 unique patterns and 2661 genes out of approximately 17,000 that were identified as significantly expressed and categorized to the patterns by EPIG. The time-dependent patterns displayed similar and dissimilar responses between IR and UV treatments. Gene Ontology analysis applied to each pattern-related subset of co-expressed genes revealed underlying

  18. Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato.

    Science.gov (United States)

    Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther

    2013-04-01

    Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.

  19. Comparative mapping reveals similar linkage of functional genes to ...

    Indian Academy of Sciences (India)

    genes between O. sativa and B. napus may have consistent function and control similar traits, which may be ..... acea chromosomes reveals islands of conserved organization. ... 1998 Conserved structure and function of the Arabidopsis flow-.

  20. A systems level approach reveals new gene regulatory modules in the developing ear

    OpenAIRE

    Chen, Jingchen; Tambalo, Monica; Barembaum, Meyer; Ranganathan, Ramya; Simões-Costa, Marcos; Bronner, Marianne E.; Streit, Andrea

    2017-01-01

    The inner ear is a complex vertebrate sense organ, yet it arises from a simple epithelium, the otic placode. Specification towards otic fate requires diverse signals and transcriptional inputs that act sequentially and/or in parallel. Using the chick embryo, we uncover novel genes in the gene regulatory network underlying otic commitment and reveal dynamic changes in gene expression. Functional analysis of selected transcription factors reveals the genetic hierarchy underlying the transition ...

  1. Transcriptome analysis reveals key differentially expressed genes involved in wheat grain development

    Directory of Open Access Journals (Sweden)

    Yonglong Yu

    2016-04-01

    Full Text Available Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20 during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further information about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.

  2. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    Directory of Open Access Journals (Sweden)

    Shuchi eSmita

    2015-12-01

    Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  3. Genome-Wide Identification, Evolution and Expression Analysis of the Grape (Vitis vinifera L. Zinc Finger-Homeodomain Gene Family

    Directory of Open Access Journals (Sweden)

    Hao Wang

    2014-04-01

    Full Text Available Plant zinc finger-homeodomain (ZHD genes encode a family of transcription factors that have been demonstrated to play an important role in the regulation of plant growth and development. In this study, we identified a total of 13 ZHD genes (VvZHD in the grape genome that were further classified into at least seven groups. Genome synteny analysis revealed that a number of VvZHD genes were present in the corresponding syntenic blocks of Arabidopsis, indicating that they arose before the divergence of these two species. Gene expression analysis showed that the identified VvZHD genes displayed distinct spatiotemporal expression patterns, and were differentially regulated under various stress conditions and hormone treatments, suggesting that the grape VvZHDs might be also involved in plant response to a variety of biotic and abiotic insults. Our work provides insightful information and knowledge about the ZHD genes in grape, which provides a framework for further characterization of their roles in regulation of stress tolerance as well as other aspects of grape productivity.

  4. A compendium of transcription factor and Transcriptionally active protein coding gene families in cowpea (Vigna unguiculata L.).

    Science.gov (United States)

    Misra, Vikram A; Wang, Yu; Timko, Michael P

    2017-11-22

    Cowpea (Vigna unguiculata (L.) Walp.) is the most important food and forage legume in the semi-arid tropics of sub-Saharan Africa where approximately 80% of worldwide production takes place primarily on low-input, subsistence farm sites. Among the major goals of cowpea breeding and improvement programs are the rapid manipulation of agronomic traits for seed size and quality and improved resistance to abiotic and biotic stresses to enhance productivity. Knowing the suite of transcription factors (TFs) and transcriptionally active proteins (TAPs) that control various critical plant cellular processes would contribute tremendously to these improvement aims. We used a computational approach that employed three different predictive pipelines to data mine the cowpea genome and identified over 4400 genes representing 136 different TF and TAP families. We compare the information content of cowpea to two evolutionarily close species common bean (Phaseolus vulgaris), and soybean (Glycine max) to gauge the relative informational content. Our data indicate that correcting for genome size cowpea has fewer TF and TAP genes than common bean (4408 / 5291) and soybean (4408/ 11,065). Members of the GROWTH-REGULATING FACTOR (GRF) and Auxin/indole-3-acetic acid (Aux/IAA) gene families appear to be over-represented in the genome relative to common bean and soybean, whereas members of the MADS (Minichromosome maintenance deficient 1 (MCM1), AGAMOUS, DEFICIENS, and serum response factor (SRF)) and C2C2-YABBY appear to be under-represented. Analysis of the AP2-EREBP APETALA2-Ethylene Responsive Element Binding Protein (AP2-EREBP), NAC (NAM (no apical meristem), ATAF1, 2 (Arabidopsis transcription activation factor), CUC (cup-shaped cotyledon)), and WRKY families, known to be important in defense signaling, revealed changes and phylogenetic rearrangements relative to common bean and soybean that suggest these groups may have evolved different functions. The availability of detailed

  5. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Directory of Open Access Journals (Sweden)

    Jansen Rodrigo Pereira Santos

    Full Text Available Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN. Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  6. Genome-wide characterization, evolution, and expression analysis of the leucine-rich repeat receptor-like protein kinase (LRR-RLK) gene family in Rosaceae genomes.

    Science.gov (United States)

    Sun, Jiangmei; Li, Leiting; Wang, Peng; Zhang, Shaoling; Wu, Juyou

    2017-10-10

    Leucine-rich repeat receptor-like protein kinase (LRR-RLK) is the largest gene family of receptor-like protein kinases (RLKs) and actively participates in regulating the growth, development, signal transduction, immunity, and stress responses of plants. However, the patterns of LRR-RLK gene family evolution in the five main Rosaceae species for which genome sequences are available have not yet been reported. In this study, we performed a comprehensive analysis of LRR-RLK genes for five Rosaceae species: Fragaria vesca (strawberry), Malus domestica (apple), Pyrus bretschneideri (Chinese white pear), Prunus mume (mei), and Prunus persica (peach), which contained 201, 244, 427, 267, and 258 LRR-RLK genes, respectively. All LRR-RLK genes were further grouped into 23 subfamilies based on the hidden Markov models approach. RLK-Pelle_LRR-XII-1, RLK-Pelle_LRR-XI-1, and RLK-Pelle_LRR-III were the three largest subfamilies. Synteny analysis indicated that there were 236 tandem duplicated genes in the five Rosaceae species, among which subfamilies XII-1 (82 genes) and XI-1 (80 genes) comprised 68.6%. Our results indicate that tandem duplication made a large contribution to the expansion of the subfamilies. The gene expression, tissue-specific expression, and subcellular localization data revealed that LRR-RLK genes were differentially expressed in various organs and tissues, and the largest subfamily XI-1 was highly expressed in all five Rosaceae species, suggesting that LRR-RLKs play important roles in each stage of plant growth and development. Taken together, our results provide an overview of the LRR-RLK family in Rosaceae genomes and the basis for further functional studies.

  7. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  8. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  9. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    Science.gov (United States)

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  10. Genome-wide identification and characterization of the bHLH gene family in tomato.

    Science.gov (United States)

    Sun, Hua; Fan, Hua-Jie; Ling, Hong-Qing

    2015-01-22

    The basic helix-loop-helix (bHLH) proteins are a large superfamily of transcription factors, and play a central role in a wide range of metabolic, physiological, and developmental processes in higher organisms. Tomato is an important vegetable crop, and its genome sequence has been published recently. However, the bHLH gene family of tomato has not been systematically identified and characterized yet. In this study, we identified 159 bHLH protein-encoding genes (SlbHLH) in tomato genome and analyzed their structures. Although bHLH domains were conserved among the bHLH proteins between tomato and Arabidopsis, the intron sequences and distribution of tomato bHLH genes were extremely different compared with Arabidopsis. The gene duplication analysis showed that 58.5% and 6.3% of SlbHLH genes belonged to low-stringency and high-stringency duplication, respectively, indicating that the SlbHLH genes are mainly generated via short low-stringency region duplication in tomato. Subsequently, we classified the SlbHLH genes into 21 subfamilies by phylogenetic tree analysis, and predicted their possible functions by comparison with their homologous genes of Arabidopsis. Moreover, the expression profile analysis of SlbHLH genes from 10 different tissues showed that 21 SlbHLH genes exhibited tissue-specific expression. Further, we identified that 11 SlbHLH genes were associated with fruit development and ripening (eight of them associated with young fruit development and three with fruit ripening). The evolutionary analysis revealed that 92% SlbHLH genes might be evolved from ancestor(s) originated from early land plant, and 8% from algae. In this work, we systematically identified SlbHLHs by analyzing the tomato genome sequence using a set of bioinformatics approaches, and characterized their chromosomal distribution, gene structures, duplication, phylogenetic relationship and expression profiles, as well predicted their possible biological functions via comparative analysis

  11. Molecular Characterization, Evolution, and Expression Profiling of the Dirigent (DIR Family Genes in Chinese White Pear (Pyrus bretschneideri

    Directory of Open Access Journals (Sweden)

    Xi Cheng

    2018-04-01

    Full Text Available Stone cells content and size are the key factors determining the internal quality of the pear fruit. Synthesis of lignin and thickening of secondary cell wall are the keys to the development of stone cells. The polymerization of monolignols and secondary cell wall formation requires the participation of dirigent proteins (DIRs. In recent years, DIR family have been studied in higher plants, but lack of comprehensive study in the pear DIR (PbDIR family. This study focuses on the identification and analysis of PbDIR family for the first time. We identified 35 PbDIRs from the pear genome, 89% of which are intronless genes. Phylogenetic tree and chromosome localization analysis showed that 35 PbDIRs were divided into four subfamilies (DIR-a, -b/d, -e, and -g and irregularly distributed among 10 chromosomes. In addition, we identified 29, 26, and 14 DIRs from the other three Rosids (peach, Mei, and grape, respectively. Interspecies microsynteny analysis revealed the collinear gene pairs between pear and peach are the most. Temporal expression analysis showed that the expression changes of seven PbDIRs (DIR-a subfamily: PbDIR4 and PbDIR5; DIR-b/d subfamily: PbDIR11; DIR-g subfamily: PbDIR19; DIR-e subfamily: PbDIR23, 25 and 26 in fruits were consistent with the changes of fruit lignin and stone cells contents. In addition, the subfamily of PbDIRs in fruits showed significant responses after treatment with ABA, SA, and MeJA. According to the protein tertiary structure, key amino acid residues and expression patterns analysis found that PbDIR4 might be involved in the metabolism of lignin and related to stone cells contents in pear fruits. In this study, we systematically analyzed the structure, evolution, function and expression of PbDIR family, which not only confirmed the characteristics of PbDIR family, but also laid the foundation for revealing the role of DIR in pear stone cell development and lignin polymerization.

  12. Isolation of MA-ACS Gene Family and Expression Study of MA-ACS1 Gene in Musa acuminata Cultivar Pisang Ambon Lumut

    Directory of Open Access Journals (Sweden)

    LISTYA UTAMI KARMAWAN

    2009-03-01

    Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.

  13. The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system

    Science.gov (United States)

    Vonk, Freek J.; Casewell, Nicholas R.; Henkel, Christiaan V.; Heimberg, Alysha M.; Jansen, Hans J.; McCleary, Ryan J. R.; Kerkkamp, Harald M. E.; Vos, Rutger A.; Guerreiro, Isabel; Calvete, Juan J.; Wüster, Wolfgang; Woods, Anthony E.; Logan, Jessica M.; Harrison, Robert A.; Castoe, Todd A.; de Koning, A. P. Jason; Pollock, David D.; Yandell, Mark; Calderon, Diego; Renjifo, Camila; Currier, Rachel B.; Salgado, David; Pla, Davinia; Sanz, Libia; Hyder, Asad S.; Ribeiro, José M. C.; Arntzen, Jan W.; van den Thillart, Guido E. E. J. M.; Boetzer, Marten; Pirovano, Walter; Dirks, Ron P.; Spaink, Herman P.; Duboule, Denis; McGlinn, Edwina; Kini, R. Manjunatha; Richardson, Michael K.

    2013-01-01

    Snakes are limbless predators, and many species use venom to help overpower relatively large, agile prey. Snake venoms are complex protein mixtures encoded by several multilocus gene families that function synergistically to cause incapacitation. To examine venom evolution, we sequenced and interrogated the genome of a venomous snake, the king cobra (Ophiophagus hannah), and compared it, together with our unique transcriptome, microRNA, and proteome datasets from this species, with data from other vertebrates. In contrast to the platypus, the only other venomous vertebrate with a sequenced genome, we find that snake toxin genes evolve through several distinct co-option mechanisms and exhibit surprisingly variable levels of gene duplication and directional selection that correlate with their functional importance in prey capture. The enigmatic accessory venom gland shows a very different pattern of toxin gene expression from the main venom gland and seems to have recruited toxin-like lectin genes repeatedly for new nontoxic functions. In addition, tissue-specific microRNA analyses suggested the co-option of core genetic regulatory components of the venom secretory system from a pancreatic origin. Although the king cobra is limbless, we recovered coding sequences for all Hox genes involved in amniote limb development, with the exception of Hoxd12. Our results provide a unique view of the origin and evolution of snake venom and reveal multiple genome-level adaptive responses to natural selection in this complex biological weapon system. More generally, they provide insight into mechanisms of protein evolution under strong selection. PMID:24297900

  14. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  15. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  16. Molecular evolution of the polyamine oxidase gene family in Metazoa

    Directory of Open Access Journals (Sweden)

    Polticelli Fabio

    2012-06-01

    Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

  17. Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

    Science.gov (United States)

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

    2013-02-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

  18. Loss of heterozygosity on chromosome 11q13 in two families with acromegaly/gigantism is independent of mutations of the multiple endocrine neoplasia type I gene.

    Science.gov (United States)

    Gadelha, M R; Prezant, T R; Une, K N; Glick, R P; Moskal, S F; Vaisman, M; Melmed, S; Kineman, R D; Frohman, L A

    1999-01-01

    Familial acromegaly/gigantism occurring in the absence of multiple endocrine neoplasia type I (MEN-1) or the Carney complex has been reported in 18 families since the biochemical diagnosis of GH excess became available, and the genetic defect is unknown. In the present study we examined 2 unrelated families with isolated acromegaly/gigantism. In family A, 3 of 4 siblings were affected, with ages at diagnosis of 19, 21, and 23 yr. In family B, 5 of 13 siblings exhibited the phenotype and were diagnosed at 13, 15, 17, 17, and 24 yr of age. All 8 affected patients had elevated basal GH levels associated with high insulin-like growth factor I levels and/or nonsuppressible serum GH levels during an oral glucose tolerance test. GHRH levels were normal in affected members of family A. An invasive macroadenoma was found in 6 subjects, and a microadenoma was found in 1 subject from family B. The sequence of the GHRH receptor complementary DNA in 1 tumor from family A was normal. There was no history of consanguinity in either family, and the past medical history and laboratory results excluded MEN-1 and the Carney complex in all affected and unaffected screened subjects. Five of 8 subjects have undergone pituitary surgery to date, and paraffin-embedded pituitary blocks were available for analysis. Loss of heterozygosity on chromosome 11q13 was studied by comparing microsatellite polymorphisms of leukocyte and tumor DNA using PYGM (centromeric) and D11S527 (telomeric), markers closely linked to the MEN-1 tumor suppressor gene. All tumors exhibited a loss of heterozygosity at both markers. Sequencing of the MEN-1 gene revealed no germline mutations in either family, nor was a somatic mutation found in tumor DNA from one subject in family A. The integrity of the MEN-1 gene in this subject was further supported by demonstration of the presence of MEN-1 messenger ribonucleic acid, as assessed by RT-PCR. These data indicate that loss of heterozygosity in these affected family

  19. Genome-wide identification and expression analysis of the mitogen-activated protein kinase gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yan Yan

    2016-08-01

    Full Text Available Mitogen-activated protein kinases (MAPKs play central roles in plant developmental processes, hormone signaling transduction, and responses to abiotic stress. However, no data are currently available about the MAPK family in cassava, an important tropical crop. Herein, 21 MeMAPK genes were identified from cassava. Phylogenetic analysis indicated that MeMAPKs could be classified into four subfamilies. Gene structure analysis demonstrated that the number of introns in MeMAPK genes ranged from 1 to 10, suggesting large variation among cassava MAPK genes. Conserved motif analysis indicated that all MeMAPKs had typical protein kinase domains. Transcriptomic analysis suggested that MeMAPK genes showed differential expression patterns in distinct tissues and in response to drought stress between wild subspecies and cultivated varieties. Interaction networks and co-expression analyses revealed that crucial pathways controlled by MeMAPK networks may be involved in the differential response to drought stress in different accessions of cassava. Expression of nine selected MAPK genes showed that these genes could comprehensively respond to osmotic, salt, cold, oxidative stressors, and abscisic acid (ABA signaling. These findings yield new insights into the transcriptional control of MAPK gene expression, provide an improved understanding of abiotic stress responses and signaling transduction in cassava, and lead to potential applications in the genetic improvement of cassava cultivars.

  20. Molecular study of the perforin gene in familial hematological malignancies

    Directory of Open Access Journals (Sweden)

    El Abed Rim

    2011-09-01

    Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

  1. In silico characterization and transcriptomic analysis of nif family genes from Anabaena sp. PCC7120.

    Science.gov (United States)

    Singh, Shilpi; Shrivastava, Alok Kumar

    2017-10-01

    In silico approaches in conjunction with morphology, nitrogenase activity, and qRT-PCR explore the impact of selected abiotic stressor such as arsenic, salt, cadmium, copper, and butachlor on nitrogen fixing (nif family) genes of diazotrophic cyanobacterium Anabaena sp. PCC7120. A total of 19 nif genes are present within the Anabaena genome that is involved in the process of nitrogen fixation. Docking studies revealed the interaction between these nif gene-encoded proteins and the selected abiotic stressors which were further validated through decreased heterocyst frequency, fragmentation of filaments, and downregulation of nitrogenase activity under these stresses indicating towards their toxic impact on nitrogen fixation potential of filamentous cyanobacterium Anabaena sp. PCC7120. Another appealing finding of this study is even though having similar binding energy and similar interacting residues between arsenic/salt and copper/cadmium to nif-encoded proteins, arsenic and cadmium are more toxic than salt and copper for nitrogenase activity of Anabaena which is crucial for growth and yield of rice paddy and soil reclamation.

  2. Gene Coexpression Analysis Reveals Complex Metabolism of the Monoterpene Alcohol Linalool in Arabidopsis Flowers[W][OPEN

    Science.gov (United States)

    Ginglinger, Jean-François; Boachon, Benoit; Höfer, René; Paetz, Christian; Köllner, Tobias G.; Miesch, Laurence; Lugan, Raphael; Baltenweck, Raymonde; Mutterer, Jérôme; Ullmann, Pascaline; Beran, Franziska; Claudel, Patricia; Verstappen, Francel; Fischer, Marc J.C.; Karst, Francis; Bouwmeester, Harro; Miesch, Michel; Schneider, Bernd; Gershenzon, Jonathan; Ehlting, Jürgen; Werck-Reichhart, Danièle

    2013-01-01

    The cytochrome P450 family encompasses the largest family of enzymes in plant metabolism, and the functions of many of its members in Arabidopsis thaliana are still unknown. Gene coexpression analysis pointed to two P450s that were coexpressed with two monoterpene synthases in flowers and were thus predicted to be involved in monoterpenoid metabolism. We show that all four selected genes, the two terpene synthases (TPS10 and TPS14) and the two cytochrome P450s (CYP71B31 and CYP76C3), are simultaneously expressed at anthesis, mainly in upper anther filaments and in petals. Upon transient expression in Nicotiana benthamiana, the TPS enzymes colocalize in vesicular structures associated with the plastid surface, whereas the P450 proteins were detected in the endoplasmic reticulum. Whether they were expressed in Saccharomyces cerevisiae or in N. benthamiana, the TPS enzymes formed two different enantiomers of linalool: (−)-(R)-linalool for TPS10 and (+)-(S)-linalool for TPS14. Both P450 enzymes metabolize the two linalool enantiomers to form different but overlapping sets of hydroxylated or epoxidized products. These oxygenated products are not emitted into the floral headspace, but accumulate in floral tissues as further converted or conjugated metabolites. This work reveals complex linalool metabolism in Arabidopsis flowers, the ecological role of which remains to be determined. PMID:24285789

  3. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

  4. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  5. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

     768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  6. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  7. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  8. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  9. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  10. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  11. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  12. Digital Gene Expression Analysis Based on De Novo Transcriptome Assembly Reveals New Genes Associated with Floral Organ Differentiation of the Orchid Plant Cymbidium ensifolium.

    Directory of Open Access Journals (Sweden)

    Fengxi Yang

    Full Text Available Cymbidium ensifolium belongs to the genus Cymbidium of the orchid family. Owing to its spectacular flower morphology, C. ensifolium has considerable ecological and cultural value. However, limited genetic data is available for this non-model plant, and the molecular mechanism underlying floral organ identity is still poorly understood. In this study, we characterize the floral transcriptome of C. ensifolium and present, for the first time, extensive sequence and transcript abundance data of individual floral organs. After sequencing, over 10 Gb clean sequence data were generated and assembled into 111,892 unigenes with an average length of 932.03 base pairs, including 1,227 clusters and 110,665 singletons. Assembled sequences were annotated with gene descriptions, gene ontology, clusters of orthologous group terms, the Kyoto Encyclopedia of Genes and Genomes, and the plant transcription factor database. From these annotations, 131 flowering-associated unigenes, 61 CONSTANS-LIKE (COL unigenes and 90 floral homeotic genes were identified. In addition, four digital gene expression libraries were constructed for the sepal, petal, labellum and gynostemium, and 1,058 genes corresponding to individual floral organ development were identified. Among them, eight MADS-box genes were further investigated by full-length cDNA sequence analysis and expression validation, which revealed two APETALA1/AGL9-like MADS-box genes preferentially expressed in the sepal and petal, two AGAMOUS-like genes particularly restricted to the gynostemium, and four DEF-like genes distinctively expressed in different floral organs. The spatial expression of these genes varied distinctly in different floral mutant corresponding to different floral morphogenesis, which validated the specialized roles of them in floral patterning and further supported the effectiveness of our in silico analysis. This dataset generated in our study provides new insights into the molecular mechanisms

  13. Molecular characterization of edestin gene family in Cannabis sativa L.

    Science.gov (United States)

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  14. Insights into the evolution and diversification of the AT-hook Motif Nuclear Localized gene family in land plants.

    Science.gov (United States)

    Zhao, Jianfei; Favero, David S; Qiu, Jiwen; Roalson, Eric H; Neff, Michael M

    2014-10-14

    Members of the ancient land-plant-specific transcription factor AT-Hook Motif Nuclear Localized (AHL) gene family regulate various biological processes. However, the relationships among the AHL genes, as well as their evolutionary history, still remain unexplored. We analyzed over 500 AHL genes from 19 land plant species, ranging from the early diverging Physcomitrella patens and Selaginella to a variety of monocot and dicot flowering plants. We classified the AHL proteins into three types (Type-I/-II/-III) based on the number and composition of their functional domains, the AT-hook motif(s) and PPC domain. We further inferred their phylogenies via Bayesian inference analysis and predicted gene gain/loss events throughout their diversification. Our analyses suggested that the AHL gene family emerged in embryophytes and further evolved into two distinct clades, with Type-I AHLs forming one clade (Clade-A), and the other two types together diversifying in another (Clade-B). The two AHL clades likely diverged before the separation of Physcomitrella patens from the vascular plant lineage. In angiosperms, Clade-A AHLs expanded into 5 subfamilies; while, the ones in Clade-B expanded into 4 subfamilies. Examination of their expression patterns suggests that the AHLs within each clade share similar expression patterns with each other; however, AHLs in one monophyletic clade exhibit distinct expression patterns from the ones in the other clade. Over-expression of a Glycine max AHL PPC domain in Arabidopsis thaliana recapitulates the phenotype observed when over-expressing its Arabidopsis thaliana counterpart. This result suggests that the AHL genes from different land plant species may share conserved functions in regulating plant growth and development. Our study further suggests that such functional conservation may be due to conserved physical interactions among the PPC domains of AHL proteins. Our analyses reveal a possible evolutionary scenario for the AHL gene family

  15. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  16. GDNF gene is associated with tourette syndrome in a family study.

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo

    2015-07-01

    Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

  17. GDNF Gene Is Associated With Tourette Syndrome in a Family Study

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

    2016-01-01

    Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

  18. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  19. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  20. Genome-Wide Analysis of the AP2/ERF Transcription Factors Family and the Expression Patterns of DREB Genes in Moso Bamboo (Phyllostachys edulis.

    Directory of Open Access Journals (Sweden)

    Huili Wu

    Full Text Available The AP2/ERF transcription factor family, one of the largest families unique to plants, performs a significant role in terms of regulation of growth and development, and responses to biotic and abiotic stresses. Moso bamboo (Phyllostachys edulis is a fast-growing non-timber forest species with the highest ecological, economic and social values of all bamboos in Asia. The draft genome of moso bamboo and the available genomes of other plants provide great opportunities to research global information on the AP2/ERF family in moso bamboo. In total, 116 AP2/ERF transcription factors were identified in moso bamboo. The phylogeny analyses indicated that the 116 AP2/ERF genes could be divided into three subfamilies: AP2, RAV and ERF; and the ERF subfamily genes were divided into 11 groups. The gene structures, exons/introns and conserved motifs of the PeAP2/ERF genes were analyzed. Analysis of the evolutionary patterns and divergence showed the PeAP2/ERF genes underwent a large-scale event around 15 million years ago (MYA and the division time of AP2/ERF family genes between rice and moso bamboo was 15-23 MYA. We surveyed the putative promoter regions of the PeDREBs and showed that largely stress-related cis-elements existed in these genes. Further analysis of expression patterns of PeDREBs revealed that the most were strongly induced by drought, low-temperature and/or high salinity stresses in roots and, in contrast, most PeDREB genes had negative functions in leaves under the same respective stresses. In this study there were two main interesting points: there were fewer members of the PeDREB subfamily in moso bamboo than in other plants and there were differences in DREB gene expression profiles between leaves and roots triggered in response to abiotic stress. The information produced from this study may be valuable in overcoming challenges in cultivating moso bamboo.

  1. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  2. Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.

    Science.gov (United States)

    Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin

    2018-03-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.

  3. A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

    Science.gov (United States)

    He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

    2017-08-23

    The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

  4. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  5. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  6. KIR And HLA Haplotype Analysis in a Family Lacking The KIR 2DL1-2DP1 Genes

    Directory of Open Access Journals (Sweden)

    Vojvodić Svetlana

    2015-06-01

    Full Text Available The killer cell immunoglobulin-like receptor (KIR gene cluster exhibits extensive allelic and haplotypic diversity that is observed as presence/absence of genes, resulting in expansion and contraction of KIR haplotypes and by allelic variation of individual KIR genes. We report a case of KIR pseudogene 2DP1 and 2DL1 gene absence in members of one family with the children suffering from acute myelogenous leukemia (AML. Killer cell immunoglo-bulin-like receptor low resolution genotyping was performed by the polymerase chain reaction (PCR-sequencespecific primers (SSP/sequence-specific oligonucleotide (SSO method and haplotype assignment was done by gene content analysis. Both parents and the maternal grandfather, shared the same Cen-B2 KIR haplotype, containing KIR 3DL3, -2DS2, -2DL2 and -3DP1 genes. The second haplotype in the KIR genotype of the mother and grandfather was Tel-A1 with KIR 2DL4 (normal and deleted variant, -3DL1, -22 bp deletion variant of the 2DS4 gene and -3DL2, while the second haplotype in the KIR genotype of the father was Tel-B1 with 2DL4 (normal variant, -3DS1, -2DL5, -2DS5, -2DS1 and 3DL2 genes. Haplotype analysis in all three offsprings revealed that the children inherited the Cen-B2 haplotype with the same gene content but two of the children inherited a deleted variant of the 2DL4 gene, while the third child inherited a normal one. The second haplotype of all three offspring contained KIR 2DL4, -2DL5, -2DS1, -2DS4 (del 22bp variant, -2DS5, -3DL1 and -3DL2 genes, which was the basis of the assumption that there is a hybrid haplotype and that the present 3DL1 gene is a variant of the 3DS1 gene. Due to consanguinity among the ancestors, the results of KIR segregation analysis showed the existence of a very rare KIR genotype in the offspring. The family who is the subject of this case is even more interesting because the father was 10/10 human leukocyte antigen (HLA-matched to his daughter, all members of the family have

  7. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.

    Directory of Open Access Journals (Sweden)

    Tomoko Matsuda

    Full Text Available The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp and 28S (the 5' end of 646-743 bp rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp. As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  8. Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

    Directory of Open Access Journals (Sweden)

    Srivastava Satish

    2003-07-01

    Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

  9. Ixodes scapularis tick serine proteinase inhibitor (serpin gene family; annotation and transcriptional analysis

    Directory of Open Access Journals (Sweden)

    Chalaire Katelyn C

    2009-05-01

    Full Text Available Abstract Background Serine proteinase inhibitors (Serpins are a large superfamily of structurally related, but functionally diverse proteins that control essential proteolytic pathways in most branches of life. Given their importance in the biology of many organisms, the concept that ticks might utilize serpins to evade host defenses and immunizing against or disrupting their functions as targets for tick control is an appealing option. Results A sequence homology search strategy has allowed us to identify at least 45 tick serpin genes in the Ixodes scapularis genome that are structurally segregated into 32 intronless and 13 intron-containing genes. Nine of the intron-containing serpins occur in a cluster of 11 genes that span 170 kb of DNA sequence. Based on consensus amino acid residues in the reactive center loop (RCL and signal peptide scanning, 93% are putatively inhibitory while 82% are putatively extracellular. Among the 11 different amino acid residues that are predicted at the P1 sites, 16 sequences possess basic amino acid (R/K residues. Temporal and spatial expression analyses revealed that 40 of the 45 serpins are differentially expressed in salivary glands (SG and/or midguts (MG of unfed and partially fed ticks. Ten of the 38 serpin genes were expressed from six to 24 hrs of feeding while six and fives genes each are predominantly or exclusively expressed in either MG and SG respectively. Conclusion Given the diversity among tick species, sizes of tick serpin families are likely to be variable. However this study provides insight on the potential sizes of serpin protein families in ticks. Ticks must overcome inflammation, complement activation and blood coagulation to complete feeding. Since these pathways are regulated by serpins that have basic residues at their P1 sites, we speculate that I. scapularis may utilize some of the serpins reported in this study to manipulate host defense. We have discussed our data in the context of

  10. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  11. AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families

    International Nuclear Information System (INIS)

    Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen

    2007-01-01

    Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population

  12. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    Science.gov (United States)

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  13. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  14. Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

    Directory of Open Access Journals (Sweden)

    Shewmaker Christine K

    2010-10-01

    Full Text Available Abstract Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD 2 and fatty acid elongase (FAE 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general

  15. Titin is a candidate gene for stroke volume response to endurance training: the HERITAGE Family Study.

    Science.gov (United States)

    Rankinen, Tuomo; Rice, Treva; Boudreau, Anik; Leon, Arthur S; Skinner, James S; Wilmore, Jack H; Rao, D C; Bouchard, Claude

    2003-09-29

    A genome-wide linkage scan for endurance training-induced changes in submaximal exercise stroke volume (DeltaSV50) in the HERITAGE Family Study revealed two chromosomal regions (2q31-q32 and 10p11.2) with at least suggestive evidence of linkage among white families. Here we report a further characterization of the quantitative trait locus (QTL) in chromosome 2q31 and provide evidence that titin (TTN) is likely a candidate gene involved. The original linkage was detected with two markers (D2S335 and D2S1391), and the QTL covered approximately 25 million base pairs (Mb). We added 12 microsatellite markers resulting in an average marker density of one marker per 2.3 Mb. The evidence of linkage increased from P = 0.006 to P = 0.0002 and 0.00002 in the multi- and single-point analyses, respectively. The strongest evidence of linkage was seen with two markers in and near the TTN gene. Transmission/disequilibrium test (TDT) with the same marker set provided evidence for association with one of the TTN markers (D2S385; P = 0.004). TTN is a major contributor to the elasticity of cardiomyocytes and a key regulator of the Frank-Starling mechanism. Since TTN is the largest gene in the human genome, the challenge is to identify the DNA sequence variants contributing to the interindividual differences in cardiac adaptation to endurance training.

  16. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts.

    Science.gov (United States)

    Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T

    2015-11-27

    Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Antennal and Abdominal Transcriptomes Reveal Chemosensory Genes in the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Wu, Zhongzhen; Zhang, He; Bin, Shuying; Chen, Lei; Han, Qunxin; Lin, Jintian

    2016-01-01

    The Asian citrus psyllid, Diaphorina citri is the principal vector of the highly destructive citrus disease called Huanglongbing (HLB) or citrus greening, which is a major threat to citrus cultivation worldwide. More effective pest control strategies against this pest entail the identification of potential chemosensory proteins that could be used in the development of attractants or repellents. However, the molecular basis of olfaction in the Asian citrus psyllid is not completely understood. Therefore, we performed this study to analyze the antennal and abdominal transcriptome of the Asian citrus psyllid. We identified a large number of transcripts belonging to nine chemoreception-related gene families and compared their expression in male and female adult antennae and terminal abdomen. In total, 9 odorant binding proteins (OBPs), 12 chemosensory proteins (CSPs), 46 odorant receptors (ORs), 20 gustatory receptors (GRs), 35 ionotropic receptors (IRs), 4 sensory neuron membrane proteins (SNMPs) and 4 different gene families encoding odorant-degrading enzymes (ODEs): 80 cytochrome P450s (CYPs), 12 esterase (ESTs), and 5 aldehyde dehydrogenases (ADE) were annotated in the D. citri antennal and abdominal transcriptomes. Our results revealed that a large proportion of chemosensory genes exhibited no distinct differences in their expression patterns in the antennae and terminal abdominal tissues. Notably, RNA sequencing (RNA-seq) data and quantitative real time-PCR (qPCR) analyses showed that 4 DictOBPs, 4 DictCSPs, 4 DictIRs, 1 DictSNMP, and 2 DictCYPs were upregulated in the antennae relative to that in terminal abdominal tissues. Furthermore, 2 DictOBPs (DictOBP8 and DictOBP9), 2 DictCSPs (DictOBP8 and DictOBP12), 4 DictIRs (DictIR3, DictIR6, DictIR10, and DictIR35), and 1 DictCYP (DictCYP57) were expressed at higher levels in the male antennae than in the female antennae. Our study provides the first insights into the molecular basis of chemoreception in this insect

  18. Antennal and Abdominal Transcriptomes Reveal Chemosensory Genes in the Asian Citrus Psyllid, Diaphorina citri.

    Directory of Open Access Journals (Sweden)

    Zhongzhen Wu

    Full Text Available The Asian citrus psyllid, Diaphorina citri is the principal vector of the highly destructive citrus disease called Huanglongbing (HLB or citrus greening, which is a major threat to citrus cultivation worldwide. More effective pest control strategies against this pest entail the identification of potential chemosensory proteins that could be used in the development of attractants or repellents. However, the molecular basis of olfaction in the Asian citrus psyllid is not completely understood. Therefore, we performed this study to analyze the antennal and abdominal transcriptome of the Asian citrus psyllid. We identified a large number of transcripts belonging to nine chemoreception-related gene families and compared their expression in male and female adult antennae and terminal abdomen. In total, 9 odorant binding proteins (OBPs, 12 chemosensory proteins (CSPs, 46 odorant receptors (ORs, 20 gustatory receptors (GRs, 35 ionotropic receptors (IRs, 4 sensory neuron membrane proteins (SNMPs and 4 different gene families encoding odorant-degrading enzymes (ODEs: 80 cytochrome P450s (CYPs, 12 esterase (ESTs, and 5 aldehyde dehydrogenases (ADE were annotated in the D. citri antennal and abdominal transcriptomes. Our results revealed that a large proportion of chemosensory genes exhibited no distinct differences in their expression patterns in the antennae and terminal abdominal tissues. Notably, RNA sequencing (RNA-seq data and quantitative real time-PCR (qPCR analyses showed that 4 DictOBPs, 4 DictCSPs, 4 DictIRs, 1 DictSNMP, and 2 DictCYPs were upregulated in the antennae relative to that in terminal abdominal tissues. Furthermore, 2 DictOBPs (DictOBP8 and DictOBP9, 2 DictCSPs (DictOBP8 and DictOBP12, 4 DictIRs (DictIR3, DictIR6, DictIR10, and DictIR35, and 1 DictCYP (DictCYP57 were expressed at higher levels in the male antennae than in the female antennae. Our study provides the first insights into the molecular basis of chemoreception in this

  19. Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.

    Science.gov (United States)

    Mackenzie, Bryan; Erickson, Jeffrey D

    2004-02-01

    The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.

  20. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    International Nuclear Information System (INIS)

    Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.

    2015-01-01

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  1. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medici