WorldWideScience

Sample records for gene family reveals

  1. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  2. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  3. Phylogenomic analysis reveals dynamic evolutionary history of the Drosophila heterochromatin protein 1 (HP1 gene family.

    Directory of Open Access Journals (Sweden)

    Mia T Levine

    Full Text Available Heterochromatin is the gene-poor, satellite-rich eukaryotic genome compartment that supports many essential cellular processes. The functional diversity of proteins that bind and often epigenetically define heterochromatic DNA sequence reflects the diverse functions supported by this enigmatic genome compartment. Moreover, heterogeneous signatures of selection at chromosomal proteins often mirror the heterogeneity of evolutionary forces that act on heterochromatic DNA. To identify new such surrogates for dissecting heterochromatin function and evolution, we conducted a comprehensive phylogenomic analysis of the Heterochromatin Protein 1 gene family across 40 million years of Drosophila evolution. Our study expands this gene family from 5 genes to at least 26 genes, including several uncharacterized genes in Drosophila melanogaster. The 21 newly defined HP1s introduce unprecedented structural diversity, lineage-restriction, and germline-biased expression patterns into the HP1 family. We find little evidence of positive selection at these HP1 genes in both population genetic and molecular evolution analyses. Instead, we find that dynamic evolution occurs via prolific gene gains and losses. Despite this dynamic gene turnover, the number of HP1 genes is relatively constant across species. We propose that karyotype evolution drives at least some HP1 gene turnover. For example, the loss of the male germline-restricted HP1E in the obscura group coincides with one episode of dramatic karyotypic evolution, including the gain of a neo-Y in this lineage. This expanded compendium of ovary- and testis-restricted HP1 genes revealed by our study, together with correlated gain/loss dynamics and chromosome fission/fusion events, will guide functional analyses of novel roles supported by germline chromatin.

  4. Evolution of the RH gene family in vertebrates revealed by brown hagfish (Eptatretus atami) genome sequences.

    Science.gov (United States)

    Suzuki, Akinori; Komata, Hidero; Iwashita, Shogo; Seto, Shotaro; Ikeya, Hironobu; Tabata, Mitsutoshi; Kitano, Takashi

    2017-02-01

    In vertebrates, there are four major genes in the RH (Rhesus) gene family, RH, RHAG, RHBG, and RHCG. These genes are thought to have been formed by the two rounds of whole-genome duplication (2R-WGD) in the common ancestor of all vertebrates. In our previous work, where we analyzed details of the gene duplications process of this gene family, three nucleotide sequences belonging to this family were identified in Far Eastern brook lamprey (Lethenteron reissneri), and the phylogenetic positions of the genes were determined. Lampreys, along with hagfishes, are cyclostomata (jawless fishes), which is a sister group of gnathostomata (jawed vertebrates). Although those results suggested that one gene was orthologous to the gnathostome RHCG genes, we did not identify clear orthologues for other genes. In this study, therefore, we identified three novel cDNA sequences that belong to the RH gene family using de novo transcriptome analysis of another cyclostome: the brown hagfish (Eptatretus atami). We also determined the nucleotide sequences for the RHBG and RHCG genes in a red stingray (Dasyatis akajei), which belongs to the cartilaginous fishes. The phylogenetic tree showed that two brown hagfish genes, which were probably duplicated in the cyclostome lineage, formed a cluster with the gnathostome RHAG genes, whereas another brown hagfish gene formed a cluster with the gnathostome RHCG genes. We estimated that the RH genes had a higher evolutionary rate than the RHAG, RHBG, and RHCG genes. Interestingly, in the RHBG genes, only the bird lineage showed a higher rate of nonsynonymous substitutions. It is likely that this higher rate was caused by a state of relaxed functional constraints rather than positive selection nor by pseudogenization. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Phylogenetic analysis reveals dynamic evolution of the poly(A)-binding protein gene family in plants.

    Science.gov (United States)

    Gallie, Daniel R; Liu, Renyi

    2014-11-25

    The poly(A)-binding protein (PABP) binds the poly(A) tail of eukaryotic mRNAs and functions to maintain the integrity of the mRNA while promoting protein synthesis through its interaction with eukaryotic translation initiation factor (eIF) 4G and eIF4B. PABP is encoded by a single gene in yeast and marine algae but during plant evolution the PABP gene family expanded substantially, underwent sequence divergence into three subclasses, and acquired tissue-specificity in gene family member expression. Although such changes suggest functional specialization, the size of the family and its sequence divergence have complicated an understanding of which gene family members may be foundational and which may represent more recent expansions of the family to meet the specific needs of speciation. Here, we examine the evolution of the plant PABP gene family to provide insight into these aspects of the family that may yield clues into the function of individual family members. The PABP gene family had expanded to two members by the appearance of fresh water algae and four members in non-vascular plants. In lycophytes, the first sequence divergence yielding a specific class member occurs. The earliest members of the gene family share greatest similarity to those modern members whose expression is confined to reproductive tissues, suggesting that supporting reproductive-associated gene expression is the most conserved function of this family. A family member sharing similarity to modern vegetative-associated members first appears in gymnosperms. Further elaboration of the reproductive-associated and vegetative-associated members occurred during the evolution of flowering plants. Expansion of the plant PABP gene family began prior to the colonization of land. By the evolution of lycophytes, the first class member whose expression is confined to reproductive tissues in higher plants had appeared. A second class member whose expression is vegetative-associated appeared in

  6. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Research on evolutionary relationship and expression profiles of MATE-type gene family in maize .... To analyse the evolutionary relationships among the 49 ... sess 11 to 13 introns. Additionally, some close gene pairs were indeed distinct in intron–exon arrangements. For exam- ple, ZmMATE24 contained six introns, ...

  7. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families.

    Directory of Open Access Journals (Sweden)

    Lucila Traverso

    2017-02-01

    Full Text Available Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs, Cytochromes P450 (CYPs and Carboxyl/Cholinesterases (CCEs. Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease.The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms

  8. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  9. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Science.gov (United States)

    Guo, Yong; Qiu, Li-Juan

    2013-01-01

    The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  10. Genetic analysis of Chinese families reveals a novel truncation allele of the retinitis pigmentosa GTPase regulator gene

    Directory of Open Access Journals (Sweden)

    Fang Hu

    2014-10-01

    Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.

  11. Comparative Genome Analysis of Filamentous Fungi Reveals Gene Family Expansions Associated with Fungal Pathogenesis

    Science.gov (United States)

    Soanes, Darren M.; Alam, Intikhab; Cornell, Mike; Wong, Han Min; Hedeler, Cornelia; Paton, Norman W.; Rattray, Magnus; Hubbard, Simon J.; Oliver, Stephen G.; Talbot, Nicholas J.

    2008-01-01

    Fungi and oomycetes are the causal agents of many of the most serious diseases of plants. Here we report a detailed comparative analysis of the genome sequences of thirty-six species of fungi and oomycetes, including seven plant pathogenic species, that aims to explore the common genetic features associated with plant disease-causing species. The predicted translational products of each genome have been clustered into groups of potential orthologues using Markov Chain Clustering and the data integrated into the e-Fungi object-oriented data warehouse (http://www.e-fungi.org.uk/). Analysis of the species distribution of members of these clusters has identified proteins that are specific to filamentous fungal species and a group of proteins found only in plant pathogens. By comparing the gene inventories of filamentous, ascomycetous phytopathogenic and free-living species of fungi, we have identified a set of gene families that appear to have expanded during the evolution of phytopathogens and may therefore serve important roles in plant disease. We have also characterised the predicted set of secreted proteins encoded by each genome and identified a set of protein families which are significantly over-represented in the secretomes of plant pathogenic fungi, including putative effector proteins that might perturb host cell biology during plant infection. The results demonstrate the potential of comparative genome analysis for exploring the evolution of eukaryotic microbial pathogenesis. PMID:18523684

  12. Exome sequencing reveals novel rare variants in the ryanodine receptor and calcium channel genes in malignant hyperthermia families.

    Science.gov (United States)

    Kim, Jerry H; Jarvik, Gail P; Browning, Brian L; Rajagopalan, Ramakrishnan; Gordon, Adam S; Rieder, Mark J; Robertson, Peggy D; Nickerson, Deborah A; Fisher, Nickla A; Hopkins, Philip M

    2013-11-01

    About half of malignant hyperthermia (MH) cases are associated with skeletal muscle ryanodine receptor 1 (RYR1) and calcium channel, voltage-dependent, L type, α1S subunit (CACNA1S) gene mutations, leaving many with an unknown cause. The authors chose to apply a sequencing approach to uncover causal variants in unknown cases. Sequencing the exome, the protein-coding region of the genome, has power at low sample sizes and identified the cause of over a dozen Mendelian disorders. The authors considered four families with multiple MH cases lacking mutations in RYR1 and CACNA1S by Sanger sequencing of complementary DNA. Exome sequencing in two affecteds per family, chosen for maximum genetic distance, were compared. Variants were ranked by allele frequency, protein change, and measures of conservation among mammals to assess likelihood of causation. Finally, putative pathogenic mutations were genotyped in other family members to verify cosegregation with MH. Exome sequencing revealed one rare RYR1 nonsynonymous variant in each of three families (Asp1056His, Val2627Met, Val4234Leu), and one CACNA1S variant (Thr1009Lys) in the fourth family. These were not seen in variant databases or in our control population sample of 5,379 exomes. Follow-up sequencing in other family members verified cosegregation of alleles with MH. The authors found that using both exome sequencing and allele frequency data from large sequencing efforts may aid genetic diagnosis of MH. In a sample selected by the authors, this technique was more sensitive for variant detection in known genes than Sanger sequencing of complementary DNA, and allows for the possibility of novel gene discovery.

  13. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Multidrug and toxic compound extrusion (MATE) proteins are a group of secondary active transporters, which widely exist in all living organisms and play important role in the detoxication of endogenous secondary metabolites and exogenous agents. However, to date, no systematic and comprehensive study of this family is ...

  14. Expression profiling of the Arabidopsis ferric chelate reductase (FRO) gene family reveals differential regulation by iron and copper.

    Science.gov (United States)

    Mukherjee, Indrani; Campbell, Nathan H; Ash, Joshua S; Connolly, Erin L

    2006-05-01

    The Arabidopsis FRO2 gene encodes the iron deficiency-inducible ferric chelate reductase responsible for reduction of iron at the root surface; subsequent transport of iron across the plasma membrane is carried out by a ferrous iron transporter (IRT1). Genome annotation has identified seven additional FRO family members in the Arabidopsis genome. We used real-time RT-PCR to examine the expression of each FRO gene in different tissues and in response to iron and copper limitation. FRO2 and FRO5 are primarily expressed in roots while FRO8 is primarily expressed in shoots. FRO6 and FRO7 show high expression in all the green parts of the plant. FRO3 is expressed at high levels in roots and shoots, and expression of FRO3 is elevated in roots and shoots of iron-deficient plants. Interestingly, when plants are Cu-limited, the expression of FRO6 in shoot tissues is reduced. Expression of FRO3 is induced in roots and shoots by Cu-limitation. While it is known that FRO2 is expressed at high levels in the outer layers of iron-deficient roots, histochemical staining of FRO3-GUS plants revealed that FRO3 is predominantly expressed in the vascular cylinder of roots. Together our results suggest that FRO family members function in metal ion homeostasis in a variety of locations in the plant.

  15. Heterologous expression and transcript analysis of gibberellin biosynthetic genes of grasses reveals novel functionality in the GA3ox family.

    Science.gov (United States)

    Pearce, Stephen; Huttly, Alison K; Prosser, Ian M; Li, Yi-dan; Vaughan, Simon P; Gallova, Barbora; Patil, Archana; Coghill, Jane A; Dubcovsky, Jorge; Hedden, Peter; Phillips, Andrew L

    2015-06-05

    The gibberellin (GA) pathway plays a central role in the regulation of plant development, with the 2-oxoglutarate-dependent dioxygenases (2-ODDs: GA20ox, GA3ox, GA2ox) that catalyse the later steps in the biosynthetic pathway of particularly importance in regulating bioactive GA levels. Although GA has important impacts on crop yield and quality, our understanding of the regulation of GA biosynthesis during wheat and barley development remains limited. In this study we identified or assembled genes encoding the GA 2-ODDs of wheat, barley and Brachypodium distachyon and characterised the wheat genes by heterologous expression and transcript analysis. The wheat, barley and Brachypodium genomes each contain orthologous copies of the GA20ox, GA3ox and GA2ox genes identified in rice, with the exception of OsGA3ox1 and OsGA2ox5 which are absent in these species. Some additional paralogs of 2-ODD genes were identified: notably, a novel gene in the wheat B genome related to GA3ox2 was shown to encode a GA 1-oxidase, named as TaGA1ox-B1. This enzyme is likely to be responsible for the abundant 1β-hydroxylated GAs present in developing wheat grains. We also identified a related gene in barley, located in a syntenic position to TaGA1ox-B1, that encodes a GA 3,18-dihydroxylase which similarly accounts for the accumulation of unusual GAs in barley grains. Transcript analysis showed that some paralogs of the different classes of 2-ODD were expressed mainly in a single tissue or at specific developmental stages. In particular, TaGA20ox3, TaGA1ox1, TaGA3ox3 and TaGA2ox7 were predominantly expressed in developing grain. More detailed analysis of grain-specific gene expression showed that while the transcripts of biosynthetic genes were most abundant in the endosperm, genes encoding inactivation and signalling components were more highly expressed in the seed coat and pericarp. The comprehensive expression and functional characterisation of the multigene families encoding the 2-ODD

  16. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    Science.gov (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  17. Comparative genomic analysis of the Lipase3 gene family in five plant species reveals distinct evolutionary origins.

    Science.gov (United States)

    Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan

    2018-04-01

    Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.

  18. Transcriptome-wide survey of mouse CNS-derived cells reveals monoallelic expression within novel gene families.

    Directory of Open Access Journals (Sweden)

    Sierra M Li

    Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.

  19. A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

    Directory of Open Access Journals (Sweden)

    Hewitt Jane E

    2010-11-01

    Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

  20. Comparative genomics of the family Vibrionaceae reveals the wide distribution of genes encoding virulence-associated proteins

    Directory of Open Access Journals (Sweden)

    Cai Hong

    2010-06-01

    Full Text Available Abstract Background Species of the family Vibrionaceae are ubiquitous in marine environments. Several of these species are important pathogens of humans and marine species. Evidence indicates that genetic exchange plays an important role in the emergence of new pathogenic strains within this family. Data from the sequenced genomes of strains in this family could show how the genes encoded by all these strains, known as the pangenome, are distributed. Information about the core, accessory and panproteome of this family can show how, for example, genes encoding virulence-associated proteins are distributed and help us understand how virulence emerges. Results We deduced the complete set of orthologs for eleven strains from this family. The core proteome consists of 1,882 orthologous groups, which is 28% of the 6,629 orthologous groups in this family. There were 4,411 accessory orthologous groups (i.e., proteins that occurred in from 2 to 10 proteomes and 5,584 unique proteins (encoded once on only one of the eleven genomes. Proteins that have been associated with virulence in V. cholerae were widely distributed across the eleven genomes, but the majority was found only on the genomes of the two V. cholerae strains examined. Conclusions The proteomes are reflective of the differing evolutionary trajectories followed by different strains to similar phenotypes. The composition of the proteomes supports the notion that genetic exchange among species of the Vibrionaceae is widespread and that this exchange aids these species in adapting to their environments.

  1. Comparative genomic analysis of SET domain family reveals the origin, expansion, and putative function of the arthropod-specific SmydA genes as histone modifiers in insects

    Science.gov (United States)

    Jiang, Feng; Liu, Qing; Wang, Yanli; Zhang, Jie; Wang, Huimin; Song, Tianqi; Yang, Meiling

    2017-01-01

    Abstract The SET domain is an evolutionarily conserved motif present in histone lysine methyltransferases, which are important in the regulation of chromatin and gene expression in animals. In this study, we searched for SET domain–containing genes (SET genes) in all of the 147 arthropod genomes sequenced at the time of carrying out this experiment to understand the evolutionary history by which SET domains have evolved in insects. Phylogenetic and ancestral state reconstruction analysis revealed an arthropod-specific SET gene family, named SmydA, that is ancestral to arthropod animals and specifically diversified during insect evolution. Considering that pseudogenization is the most probable fate of the new emerging gene copies, we provided experimental and evolutionary evidence to demonstrate their essential functions. Fluorescence in situ hybridization analysis and in vitro methyltransferase activity assays showed that the SmydA-2 gene was transcriptionally active and retained the original histone methylation activity. Expression knockdown by RNA interference significantly increased mortality, implying that the SmydA genes may be essential for insect survival. We further showed predominantly strong purifying selection on the SmydA gene family and a potential association between the regulation of gene expression and insect phenotypic plasticity by transcriptome analysis. Overall, these data suggest that the SmydA gene family retains essential functions that may possibly define novel regulatory pathways in insects. This work provides insights into the roles of lineage-specific domain duplication in insect evolution. PMID:28444351

  2. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Directory of Open Access Journals (Sweden)

    Joachim W Bargsten

    Full Text Available As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes. The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  3. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Science.gov (United States)

    Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

    2013-01-01

    As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  4. Revisiting the phosphatidylethanolamine-binding protein (PEBP) gene family reveals cryptic FLOWERING LOCUS T gene homologs in gymnosperms and sheds new light on functional evolution.

    Science.gov (United States)

    Liu, Yan-Yan; Yang, Ke-Zhen; Wei, Xiao-Xin; Wang, Xiao-Quan

    2016-11-01

    Angiosperms and gymnosperms are two major groups of extant seed plants. It has been suggested that gymnosperms lack FLOWERING LOCUS T (FT), a key integrator at the core of flowering pathways in angiosperms. Taking advantage of newly released gymnosperm genomes, we revisited the evolutionary history of the plant phosphatidylethanolamine-binding protein (PEBP) gene family through phylogenetic reconstruction. Expression patterns in three gymnosperm taxa and heterologous expression in Arabidopsis were studied to investigate the functions of gymnosperm FT-like and TERMINAL FLOWER 1 (TFL1)-like genes. Phylogenetic reconstruction suggests that an ancient gene duplication predating the divergence of seed plants gave rise to the FT and TFL1 genes. Expression patterns indicate that gymnosperm TFL1-like genes play a role in the reproductive development process, while GymFT1 and GymFT2, the FT-like genes resulting from a duplication event in the common ancestor of gymnosperms, function in both growth rhythm and sexual development pathways. When expressed in Arabidopsis, both spruce FT-like and TFL1-like genes repressed flowering. Our study demonstrates that gymnosperms do have FT-like and TFL1-like genes. Frequent gene and genome duplications contributed significantly to the expansion of the plant PEBP gene family. The expression patterns of gymnosperm PEBP genes provide novel insight into the functional evolution of this gene family. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  5. Diversifying selection in the wheat stem rust fungus acts predominantly on pathogen-associated gene families and reveals candidate effectors

    OpenAIRE

    Sperschneider, Jana; Ying, Hua; Dodds, Peter N.; Gardiner, Donald M.; Upadhyaya, Narayana M.; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.

    2014-01-01

    Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with targe...

  6. High-resolution survey in familial Parkinson disease genes reveals multiple independent copy number variation events in PARK2.

    Science.gov (United States)

    Wang, Liyong; Nuytemans, Karen; Bademci, Guney; Jauregui, Cherylyn; Martin, Eden R; Scott, William K; Vance, Jeffery M; Zuchner, Stephan

    2013-08-01

    A high density comparative genomic hybridization array was designed to evaluate CNVs in the genomic region of six familial PD genes in 181 PD cases and 67 controls. No CNV was found in PARK7, ATP13A2, PINK1, and LRRK2. Intronic-only CNVs were found in SNCA and PARK2 but were not associated with PD risk. A whole-gene duplication of SNCA was found in one case. The allele frequency of PARK2 exonic CNV is significantly higher in cases than in controls (P = 0.02), higher in early-onset (AAO ≤ 40) than in late-onset cases (P = 0.001), and higher in familial than in sporadic cases (P = 0.005). Except for single exon 2 duplications, all PARK2 exonic CNVs have different breakpoints, even when the same exon(s) were involved. In conclusion, except for SNCA and PARK2, CNVs are not a major contributing mechanism for the familial PD genes examined. The majority of PARK2 exonic CNVs are not recurrent. © 2013 WILEY PERIODICALS, INC.

  7. Early stages of functional diversification in the Rab GTPase gene family revealed by genomic and localization studies in Paramecium species.

    Science.gov (United States)

    Bright, Lydia J; Gout, Jean-Francois; Lynch, Michael

    2017-04-15

    New gene functions arise within existing gene families as a result of gene duplication and subsequent diversification. To gain insight into the steps that led to the functional diversification of paralogues, we tracked duplicate retention patterns, expression-level divergence, and subcellular markers of functional diversification in the Rab GTPase gene family in three Paramecium aurelia species. After whole-genome duplication, Rab GTPase duplicates are more highly retained than other genes in the genome but appear to be diverging more rapidly in expression levels, consistent with early steps in functional diversification. However, by localizing specific Rab proteins in Paramecium cells, we found that paralogues from the two most recent whole-genome duplications had virtually identical localization patterns, and that less closely related paralogues showed evidence of both conservation and diversification. The functionally conserved paralogues appear to target to compartments associated with both endocytic and phagocytic recycling functions, confirming evolutionary and functional links between the two pathways in a divergent eukaryotic lineage. Because the functionally diversifying paralogues are still closely related to and derived from a clade of functionally conserved Rab11 genes, we were able to pinpoint three specific amino acid residues that may be driving the change in the localization and thus the function in these proteins. © 2017 Bright et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  8. Diversifying selection in the wheat stem rust fungus acts predominantly on pathogen-associated gene families and reveals candidate effectors.

    Science.gov (United States)

    Sperschneider, Jana; Ying, Hua; Dodds, Peter N; Gardiner, Donald M; Upadhyaya, Narayana M; Singh, Karam B; Manners, John M; Taylor, Jennifer M

    2014-01-01

    Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defense proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialized gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control.

  9. Diversifying Selection in the Wheat Stem Rust Fungus Acts Predominantly on Pathogen-Associated Gene Families and Reveals Candidate Effectors

    Directory of Open Access Journals (Sweden)

    Jana eSperschneider

    2014-09-01

    Full Text Available Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defence proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialised gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control.

  10. Draft genome sequence of Streptomyces coelicoflavus ZG0656 reveals the putative biosynthetic gene cluster of acarviostatin family α-amylase inhibitors.

    Science.gov (United States)

    Guo, X; Geng, P; Bai, F; Bai, G; Sun, T; Li, X; Shi, L; Zhong, Q

    2012-08-01

    The aims of this study are to obtain the draft genome sequence of Streptomyces coelicoflavus ZG0656, which produces novel acarviostatin family α-amylase inhibitors, and then to reveal the putative acarviostatin-related gene cluster and the biosynthetic pathway. The draft genome sequence of S. coelicoflavus ZG0656 was generated using a shotgun approach employing a combination of 454 and Solexa sequencing technologies. Genome analysis revealed a putative gene cluster for acarviostatin biosynthesis, termed sct-cluster. The cluster contains 13 acarviostatin synthetic genes, six transporter genes, four starch degrading or transglycosylation enzyme genes and two regulator genes. On the basis of bioinformatic analysis, we proposed a putative biosynthetic pathway of acarviostatins. The intracellular steps produce a structural core, acarviostatin I00-7-P, and the extracellular assemblies lead to diverse acarviostatin end products. The draft genome sequence of S. coelicoflavus ZG0656 revealed the putative biosynthetic gene cluster of acarviostatins and a putative pathway of acarviostatin production. To our knowledge, S. coelicoflavus ZG0656 is the first strain in this species for which a genome sequence has been reported. The analysis of sct-cluster provided important insights into the biosynthesis of acarviostatins. This work will be a platform for producing novel variants and yield improvement. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  11. Exome sequencing revealed PMM2 gene mutations in a French-Canadian family with congenital atrophy of the cerebellum.

    Science.gov (United States)

    Noreau, Anne; Beauchemin, Philippe; Dionne-Laporte, Alexandre; Dion, Patrick A; Rouleau, Guy A; Dupré, Nicolas

    2014-01-01

    Two affected and one unaffected siblings from a French-Canadian family were evaluated in our neurogenetic clinic. The oldest brother had intentional and postural hand tremor while his youngest sister presented mild ataxia, a similar hand tremor and global developmental delay. Brain MRIs of the two affected family members further revealed a significant cerebellar atrophy. For this study we conducted a whole exome sequencing (WES) investigation using genomic DNA prepared from the affected brother and sister, alongside DNA prepared from their unaffected mother, and identified two mutations previously reported to cause a rare disorder known as Congenital Disorder of Glycosylation, type Ia (CDG1A) (OMIM #212065). This study emphasizes how the diagnosis of patients presenting a mild tremor phenotype associated with cerebellar atrophy may benefit from WES in establishing genetic defects associated with their conditions.

  12. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  13. Whole Exome Sequencing Reveals Homozygous Mutations in RAI1, OTOF, and SLC26A4 Genes Associated with Nonsyndromic Hearing Loss in Altaian Families (South Siberia.

    Directory of Open Access Journals (Sweden)

    Alexander Y Сhurbanov

    Full Text Available Hearing loss (HL is one of the most common sensorineural disorders and several dozen genes contribute to its pathogenesis. Establishing a genetic diagnosis of HL is of great importance for clinical evaluation of deaf patients and for estimating recurrence risks for their families. Efforts to identify genes responsible for HL have been challenged by high genetic heterogeneity and different ethnic-specific prevalence of inherited deafness. Here we present the utility of whole exome sequencing (WES for identifying candidate causal variants for previously unexplained nonsyndromic HL of seven patients from four unrelated Altaian families (the Altai Republic, South Siberia. The WES analysis revealed homozygous missense mutations in three genes associated with HL. Mutation c.2168A>G (SLC26A4 was found in one family, a novel mutation c.1111G>C (OTOF was revealed in another family, and mutation c.5254G>A (RAI1 was found in two families. Sanger sequencing was applied for screening of identified variants in an ethnically diverse cohort of other patients with HL (n = 116 and in Altaian controls (n = 120. Identified variants were found only in patients of Altaian ethnicity (n = 93. Several lines of evidences support the association of homozygosity for discovered variants c.5254G>A (RAI1, c.1111C>G (OTOF, and c.2168A>G (SLC26A4 with HL in Altaian patients. Local prevalence of identified variants implies possible founder effect in significant number of HL cases in indigenous population of the Altai region. Notably, this is the first reported instance of patients with RAI1 missense mutation whose HL is not accompanied by specific traits typical for Smith-Magenis syndrome. Presumed association of RAI1 gene variant c.5254G>A with isolated HL needs to be proved by further experimental studies.

  14. Interspecies introgressive hybridization in spiny frogsQuasipaa(Family Dicroglossidae) revealed by analyses on multiple mitochondrial and nuclear genes.

    Science.gov (United States)

    Zhang, Qi-Peng; Hu, Wen-Fang; Zhou, Ting-Ting; Kong, Shen-Shen; Liu, Zhi-Fang; Zheng, Rong-Quan

    2018-01-01

    Introgression may lead to discordant patterns of variation among loci and traits. For example, previous phylogeographic studies on the genus Quasipaa detected signs of genetic introgression from genetically and morphologically divergent Quasipaa shini or Quasipaa spinosa . In this study, we used mitochondrial and nuclear DNA sequence data to verify the widespread introgressive hybridization in the closely related species of the genus Quasipaa , evaluate the level of genetic diversity, and reveal the formation mechanism of introgressive hybridization. In Longsheng, Guangxi Province, signs of asymmetrical nuclear introgression were detected between Quasipaa boulengeri and Q. shini . Unidirectional mitochondrial introgression was revealed from Q. spinosa to Q. shini . By contrast, bidirectional mitochondrial gene introgression was detected between Q. spinosa and Q. shini in Lushan, Jiangxi Province. Our study also detected ancient hybridizations between a female Q. spinosa and a male Q. jiulongensis in Zhejiang Province. Analyses on mitochondrial and nuclear genes verified three candidate cryptic species in Q. spinosa , and a cryptic species may also exist in Q. boulengeri . However, no evidence of introgressive hybridization was found between Q. spinosa and Q. boulengeri . Quasipaa exilispinosa from all the sampling localities appeared to be deeply divergent from other communities. Our results suggest widespread introgressive hybridization in closely related species of Quasipaa and provide a fundamental basis for illumination of the forming mechanism of introgressive hybridization, classification of species, and biodiversity assessment in Quasipaa .

  15. Systematic Identification, Evolution and Expression Analysis of the Zea mays PHT1 Gene Family Reveals Several New Members Involved in Root Colonization by Arbuscular Mycorrhizal Fungi.

    Science.gov (United States)

    Liu, Fang; Xu, Yunjian; Jiang, Huanhuan; Jiang, Chaosheng; Du, Yibin; Gong, Cheng; Wang, Wei; Zhu, Suwen; Han, Guomin; Cheng, Beijiu

    2016-06-13

    The Phosphate Transporter1 (PHT1) family of genes plays pivotal roles in the uptake of inorganic phosphate from soils. However, there is no comprehensive report on the PHT1 family in Zea mays based on the whole genome. In the present study, a total of 13 putative PHT1 genes (ZmPHT1;1 to 13) were identified in the inbred line B73 genome by bioinformatics methods. Then, their function was investigated by a yeast PHO84 mutant complementary experiment and qRT-PCR. Thirteen ZmPHT1 genes distributed on six chromosomes (1, 2, 5, 7, 8 and 10) were divided into two paralogues (Class A and Class B). ZmPHT1;1/ZmPHT1;9 and ZmPHT1;9/ZmPHT1;13 are produced from recent segmental duplication events. ZmPHT1;1/ZmPHT1;13 and ZmPHT1;8/ZmPHT1;10 are produced from early segmental duplication events. All 13 putative ZmPHT1s can completely or partly complement the yeast Pi-uptake mutant, and they were obviously induced in maize under low Pi conditions, except for ZmPHT1;1 (p mycorrhizal fungi (AMF), implying that these genes might participate in mediating Pi absorption and/or transport. Analysis of the promoters revealed that the MYCS and P1BS element are widely distributed on the region of different AMF-inducible ZmPHT1 promoters. In light of the above results, five of 13 ZmPHT1 genes were newly-identified AMF-inducible high-affinity phosphate transporters in the maize genome. Our results will lay a foundation for better understanding the PHT1 family evolution and the molecular mechanisms of inorganic phosphate transport under AMF inoculation.

  16. Systematic mutagenesis of all predicted gntR genes in Xanthomonas campestris pv. campestris reveals a GntR family transcriptional regulator controlling hypersensitive response and virulence.

    Science.gov (United States)

    An, Shi-Qi; Lu, Guang-Tao; Su, Hui-Zhao; Li, Rui-Fang; He, Yong-Qiang; Jiang, Bo-Le; Tang, Dong-Jie; Tang, Ji-Liang

    2011-09-01

    The GntR family is one of the most abundant and widely distributed groups of helix-turn-helix transcriptional regulators in bacteria. Six open reading frames in the genome of the plant pathogen Xanthomonas campestris pv. campestris were predicted to encode GntR regulators. All six of the predicted GntR-encoding genes were individually mutagenized and mutants from five of them were successfully obtained. Plant disease response assays revealed that one, whose product belongs to the YtrA subfamily and has been named HpaR1, is involved in the hypersensitive response (HR) and virulence. Electrophoretic mobility shift assays and in vitro transcription assays revealed that HpaR1 could repress its own transcription level through binding to its promoter sequence, indicating an autoregulatory feedback inhibition mechanism for HpaR1 expression. Promoter-gusA reporter and reverse-transcription polymerase chain reaction analyses revealed that HpaR1 positively and negatively affects the expression of HR and pathogenicity (hrp) genes in host plant and standard media, respectively. Constitutive expression of the key hrp regulator, hrpG, in the hpaR1 mutant could bypass the requirement of HpaR1 for the induction of wild-type HR, suggesting that HpaR1 regulates the expression of hrp genes that encode the type III secretion system via hrpG.

  17. Genome-Wide Comparative Analyses Reveal the Dynamic Evolution of Nucleotide-Binding Leucine-Rich Repeat Gene Family among Solanaceae Plants

    Science.gov (United States)

    Seo, Eunyoung; Kim, Seungill; Yeom, Seon-In; Choi, Doil

    2016-01-01

    Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR) immune receptors are known play critical roles in effector-triggered immunity (ETI) plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analysis and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL) subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analysis of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding. PMID:27559340

  18. Genome-wide Comparative Analyses Reveal the Dynamic Evolution of Nucleotide-Binding Leucine-Rich Repeat Gene Family among Solanaceae Plants

    Directory of Open Access Journals (Sweden)

    Eunyoung Seo

    2016-08-01

    Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.

  19. Genome-Wide Comparative Analyses Reveal the Dynamic Evolution of Nucleotide-Binding Leucine-Rich Repeat Gene Family among Solanaceae Plants.

    Science.gov (United States)

    Seo, Eunyoung; Kim, Seungill; Yeom, Seon-In; Choi, Doil

    2016-01-01

    Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR) immune receptors are known play critical roles in effector-triggered immunity (ETI) plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analysis and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL) subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analysis of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.

  20. Analysis of MADS-Box Gene Family Reveals Conservation in Floral Organ ABCDE Model of Moso Bamboo (Phyllostachys edulis).

    Science.gov (United States)

    Cheng, Zhanchao; Ge, Wei; Li, Long; Hou, Dan; Ma, Yanjun; Liu, Jun; Bai, Qingsong; Li, Xueping; Mu, Shaohua; Gao, Jian

    2017-01-01

    Mini chromosome maintenance 1, agamous, deficiens, and serum response factor (MADS)-box genes are transcription factors which play fundamental roles in flower development and regulation of floral organ identity. However, till date, identification and functions of MADS-box genes remain largely unclear in Phyllostachys edulis . In view of this, we performed a whole-genome survey and identified 34 MADS-box genes in P. edulis , and based on phylogeny, they were classified as MIKC C , MIKC ∗ , Mα, and Mβ. The detailed analysis about gene structure and motifs, phylogenetic classification, comparison of gene divergence and duplication are provided. Interestingly, expression patterns for most genes were found similar to those of Arabidopsis and rice, indicating that the well-established ABCDE model can be applied to P. edulis . Moreover, we overexpressed PheMADS15 , an AP1 -like gene, in Arabidopsis , and found that the transgenic plants have early flowering phenotype, suggesting that PheMADS15 might be a regulator of flowering transition in P. edulis . Taken together, this study provides not only insightful comprehension but also useful information for understanding the functions of MADS-box genes in P. edulis .

  1. Analysis of MADS-Box Gene Family Reveals Conservation in Floral Organ ABCDE Model of Moso Bamboo (Phyllostachys edulis

    Directory of Open Access Journals (Sweden)

    Zhanchao Cheng

    2017-05-01

    Full Text Available Mini chromosome maintenance 1, agamous, deficiens, and serum response factor (MADS-box genes are transcription factors which play fundamental roles in flower development and regulation of floral organ identity. However, till date, identification and functions of MADS-box genes remain largely unclear in Phyllostachys edulis. In view of this, we performed a whole-genome survey and identified 34 MADS-box genes in P. edulis, and based on phylogeny, they were classified as MIKCC, MIKC∗, Mα, and Mβ. The detailed analysis about gene structure and motifs, phylogenetic classification, comparison of gene divergence and duplication are provided. Interestingly, expression patterns for most genes were found similar to those of Arabidopsis and rice, indicating that the well-established ABCDE model can be applied to P. edulis. Moreover, we overexpressed PheMADS15, an AP1-like gene, in Arabidopsis, and found that the transgenic plants have early flowering phenotype, suggesting that PheMADS15 might be a regulator of flowering transition in P. edulis. Taken together, this study provides not only insightful comprehension but also useful information for understanding the functions of MADS-box genes in P. edulis.

  2. Systematic Analysis of Hsf Family Genes in the Brassica napus Genome Reveals Novel Responses to Heat, Drought and High CO2 Stresses

    Directory of Open Access Journals (Sweden)

    Xiaoyi Zhu

    2017-07-01

    Full Text Available Drought and heat stress are major causes of lost plant crop yield. In the future, high levels of CO2, in combination of other abiotic stress factors, will become a novel source of stress. Little is known of the mechanisms involved in the acclimation responses of plants to this combination of abiotic stress factors, though it has been demonstrated that heat shock transcription factors (Hsfs are involved in plant response to various abiotic stresses. In this study, we performed a genome-wide identification and a systematic analysis of genes in the Hsf gene family in Brassica napus. A total of 64 genes encoding Hsf proteins were identified and classified into 3 major classes: A, B and C. We found that, unlike in other eudicots, the A9 subclass is absent in rapeseed. Further gene structure analysis revealed a loss of the only intron in the DBD domain for BnaHsf63 and -64 within class C, which is evolutionarily conserved in all Hsf genes. Transcription profile results demonstrated that most BnaHsf family genes are upregulated by both drought and heat conditions, while some are responded to a high CO2 treatment. According to the combined RNA-seq and qRT-PCR analysis, the A1E/A4A/A7 subclasses were upregulated by both drought and heat treatments. Members in class C seemed to be predominantly induced only by drought. Among BnaHsf genes, the A2/A3/B2 subclasses were regulated by all three abiotic stresses. Members in A2/B2 subclasses were upregulated by drought and heat treatments, but were downregulated under high CO2 conditions. While the A3 subclass was upregulated by all the three abiotic stresses. Various stress-related cis-acting elements, enriched in promoter regions, were correlated with the transcriptional response of BnaHsfs to these abiotic stresses. Further study of these novel groups of multifunctional BnaHsf genes will improve our understanding of plant acclimation response to abiotic stresses, and may be useful for improving the abiotic

  3. Characterization of the split ends-like gene spenito reveals functional antagonism between SPOC family members during Drosophila eye development.

    Science.gov (United States)

    Jemc, Jennifer; Rebay, Ilaria

    2006-05-01

    The novel family of SPOC domain proteins is composed of broadly conserved nuclear factors that fall into two subclasses, termed large and small, based on protein size. Members of the large subgroup, which includes Drosophila SPEN and human SHARP, have been characterized as transcriptional corepressors acting downstream of a variety of essential cell signaling pathways, while those of the small subclass have remained largely unstudied. Since SPEN has been implicated in Drosophila eye development, and the small SPOC protein NITO is also expressed in the developing eye, we have used this context to perform a structure-function analysis of NITO and to examine the relationship between the two SPOC family subclasses. Our results demonstrate that the phenotypes obtained from overexpressing NITO share striking similarity to those associated with loss of spen. Dosage-sensitive genetic interactions further support a model of functional antagonism between NITO and SPEN during Drosophila eye development. These results suggest that large and small SPOC family proteins may have opposing functions in certain developmental contexts.

  4. Family-based linkage and association mapping reveals novel genes affecting Plum pox virus infection in Arabidopsis thaliana.

    Science.gov (United States)

    Pagny, Gaëlle; Paulstephenraj, Pauline S; Poque, Sylvain; Sicard, Ophélie; Cosson, Patrick; Eyquard, Jean-Philippe; Caballero, Mélodie; Chague, Aurélie; Gourdon, Germain; Negrel, Lise; Candresse, Thierry; Mariette, Stéphanie; Decroocq, Véronique

    2012-11-01

    Sharka is a devastating viral disease caused by the Plum pox virus (PPV) in stone fruit trees and few sources of resistance are known in its natural hosts. Since any knowledge gained from Arabidopsis on plant virus susceptibility factors is likely to be transferable to crop species, Arabidopsis's natural variation was searched for host factors essential for PPV infection. To locate regions of the genome associated with susceptibility to PPV, linkage analysis was performed on six biparental populations as well as on multiparental lines. To refine quantitative trait locus (QTL) mapping, a genome-wide association analysis was carried out using 147 Arabidopsis accessions. Evidence was found for linkage on chromosomes 1, 3 and 5 with restriction of PPV long-distance movement. The most relevant signals occurred within a region at the bottom of chromosome 3, which comprises seven RTM3-like TRAF domain-containing genes. Since the resistance mechanism analyzed here is recessive and the rtm3 knockout mutant is susceptible to PPV infection, it suggests that other gene(s) present in the small identified region encompassing RTM3 are necessary for PPV long-distance movement. In consequence, we report here the occurrence of host factor(s) that are indispensable for virus long-distance movement. © 2012 INRA. New Phytologist © 2012 New Phytologist Trust.

  5. Cathepsin Gene Family Reveals Transcriptome Patterns Related to the Infective Stages of the Salmon Louse Caligus rogercresseyi.

    Directory of Open Access Journals (Sweden)

    Waleska Maldonado-Aguayo

    Full Text Available Cathepsins are proteases involved in the ability of parasites to overcome and/or modulate host defenses so as to complete their own lifecycle. However, the mechanisms underlying this ability of cathepsins are still poorly understood. One excellent model for identifying and exploring the molecular functions of cathepsins is the marine ectoparasitic copepod Caligus rogercresseyi that currently affects the Chilean salmon industry. Using high-throughput transcriptome sequencing, 56 cathepsin-like sequences were found distributed in five cysteine protease groups (B, F, L, Z, and S as well as in an aspartic protease group (D. Ontogenic transcriptome analysis evidenced that L cathepsins were the most abundant during the lifecycle, while cathepsins B and K were mostly expressed in the larval stages and adult females, thus suggesting participation in the molting processes and embryonic development, respectively. Interestingly, a variety of cathepsins from groups Z, L, D, B, K, and S were upregulated in the infective stage of copepodid, corroborating the complexity of the processes involved in the parasitic success of this copepod. Putative functional roles of cathepsins were conjectured based on the differential expressions found and on roles previously described in other phylogenetically related species. Moreover, 140 single nucleotide polymorphisms (SNP were identified in transcripts annotated for cysteine and aspartic proteases located into untranslated regions, or the coding region. This study reports for the first time the presence of cathepsin-like genes and differential expressions throughout a copepod lifecycle. The identification of cathepsins together with functional validations represents a valuable strategy for pinpointing target molecules that could be used in the development of new delousing drugs or vaccines against C. rogercresseyi.

  6. Lineage-specific expansion of IFIT gene family: an insight into coevolution with IFN gene family.

    Directory of Open Access Journals (Sweden)

    Ying Liu

    Full Text Available In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system.

  7. Molecular phylogeny based on increased number of species and genes revealed more robust family-level systematics of the order Euryalida (Echinodermata: Ophiuroidea).

    Science.gov (United States)

    Okanishi, Masanori; Fujita, Toshihiko

    2013-12-01

    Previous molecular analysis of the order Euryalida (Echinodermata: Ophiuroidea), has identified three monophyletic families, the Euryalidae, Asteronychidae and Gorgonocephalidae. However, family-level relationships have remained unresolved due to inadequate taxon sampling and insufficient molecular markers. Here, we present a family-level revision of the Euryalida based on sequences from mitochondrial genes (16S rRNA and COI) and a nuclear gene (18S rRNA) from 83 euryalid ophiuroids. The monophyly of the three families, Euryalidae, Asteronychidae and Gorgonocephalidae is confirmed. The Euryalidae and Asteronychidae+Gorgonocephalidae are assigned to superfamilies, the Euryalidea and the Gorgonocephalidea, respectively. Three subclades within the family Gorgonocephalidae are identified and assigned to three subfamilies; Astrotominae includes Astrocrius, Astrohamma and Astrotoma, Astrothamninae (subfamily nov.) includes Astrothamnus and Astrothrombus with Gorgonocephalinae including the remaining genera. Morphological characters are consistent with the newly recognised superfamilies and subfamilies. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in the conifer picea abies reveals extensive conservation as well as dynamic patterns

    Science.gov (United States)

    2013-01-01

    Background Members of the WUSCHEL-RELATED HOMEOBOX (WOX) gene family have important functions during all stages of plant development and have been implicated in the development of morphological novelties during evolution. Most studies have examined the function of these genes in angiosperms and very little is known from other plant species. Results In this study we examine the presence and expression of WOX genes in the conifer Picea abies. We have cloned 11 WOX genes from both mRNA and genomic DNA and examined their phylogenetic relationship to WOX genes from other species as well as their expression during somatic embryogenesis and in adult tissues. Conclusions Our study shows that all major radiations within the WOX gene family took place before the angiosperm-gymnosperm split and that there has been a recent expansion within the intermediate clade in the Pinaceae family. Furthermore, we show that the genes from the intermediate clade are preferentially expressed during embryo development in Picea abies. Our data also indicates that there are clear orthologs of both WUS and WOX5 present in the P. abies genome. PMID:23758772

  9. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  10. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

    Science.gov (United States)

    Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

  11. Deep RNA-Seq profile reveals biodiversity, plant-microbe interactions and a large family of NBS-LRR resistance genes in walnut (Juglans regia) tissues.

    Science.gov (United States)

    Chakraborty, Sandeep; Britton, Monica; Martínez-García, P J; Dandekar, Abhaya M

    2016-03-01

    Deep RNA-Seq profiling, a revolutionary method used for quantifying transcriptional levels, often includes non-specific transcripts from other co-existing organisms in spite of stringent protocols. Using the recently published walnut genome sequence as a filter, we present a broad analysis of the RNA-Seq derived transcriptome profiles obtained from twenty different tissues to extract the biodiversity and possible plant-microbe interactions in the walnut ecosystem in California. Since the residual nature of the transcripts being analyzed does not provide sufficient information to identify the exact strain, inferences made are constrained to the genus level. The presence of the pathogenic oomycete Phytophthora was detected in the root through the presence of a glyceraldehyde-3-phosphate dehydrogenase. Cryptococcus, the causal agent of cryptococcosis, was found in the catkins and vegetative buds, corroborating previous work indicating that the plant surface supported the sexual cycle of this human pathogen. The RNA-Seq profile revealed several species of the endophytic nitrogen fixing Actinobacteria. Another bacterial species implicated in aerobic biodegradation of methyl tert-butyl ether (Methylibium petroleiphilum) is also found in the root. RNA encoding proteins from the pea aphid were found in the leaves and vegetative buds, while a serine protease from mosquito with significant homology to a female reproductive tract protease from Drosophila mojavensis in the vegetative bud suggests egg-laying activities. The comprehensive analysis of RNA-seq data present also unraveled detailed, tissue-specific information of ~400 transcripts encoded by the largest family of resistance (R) genes (NBS-LRR), which possibly rationalizes the resistance of the specific walnut plant to the pathogens detected. Thus, we elucidate the biodiversity and possible plant-microbe interactions in several walnut (Juglans regia) tissues in California using deep RNA-Seq profiling.

  12. Comparative genomic analysis reveals independent expansion of a lineage-specific gene family in vertebrates: The class II cytokine receptors and their ligands in mammals and fish

    Directory of Open Access Journals (Sweden)

    Mogensen Knud

    2003-07-01

    Full Text Available Abstract Background The high degree of sequence conservation between coding regions in fish and mammals can be exploited to identify genes in mammalian genomes by comparison with the sequence of similar genes in fish. Conversely, experimentally characterized mammalian genes may be used to annotate fish genomes. However, gene families that escape this principle include the rapidly diverging cytokines that regulate the immune system, and their receptors. A classic example is the class II helical cytokines (HCII including type I, type II and lambda interferons, IL10 related cytokines (IL10, IL19, IL20, IL22, IL24 and IL26 and their receptors (HCRII. Despite the report of a near complete pufferfish (Takifugu rubripes genome sequence, these genes remain undescribed in fish. Results We have used an original strategy based both on conserved amino acid sequence and gene structure to identify HCII and HCRII in the genome of another pufferfish, Tetraodon nigroviridis that is amenable to laboratory experiments. The 15 genes that were identified are highly divergent and include a single interferon molecule, three IL10 related cytokines and their potential receptors together with two Tissue Factor (TF. Some of these genes form tandem clusters on the Tetraodon genome. Their expression pattern was determined in different tissues. Most importantly, Tetraodon interferon was identified and we show that the recombinant protein can induce antiviral MX gene expression in Tetraodon primary kidney cells. Similar results were obtained in Zebrafish which has 7 MX genes. Conclusion We propose a scheme for the evolution of HCII and their receptors during the radiation of bony vertebrates and suggest that the diversification that played an important role in the fine-tuning of the ancestral mechanism for host defense against infections probably followed different pathways in amniotes and fish.

  13. Identification and characterization of plant-specific NAC gene family in canola (Brassica napus L.) reveal novel members involved in cell death.

    Science.gov (United States)

    Wang, Boya; Guo, Xiaohua; Wang, Chen; Ma, Jieyu; Niu, Fangfang; Zhang, Hanfeng; Yang, Bo; Liang, Wanwan; Han, Feng; Jiang, Yuan-Qing

    2015-03-01

    NAC transcription factors are plant-specific and play important roles in plant development processes, response to biotic and abiotic cues and hormone signaling. However, to date, little is known about the NAC genes in canola (or oilseed rape, Brassica napus L.). In this study, a total of 60 NAC genes were identified from canola through a systematical analysis and mining of expressed sequence tags. Among these, the cDNA sequences of 41 NAC genes were successfully cloned. The translated protein sequences of canola NAC genes with the NAC genes from representative species were phylogenetically clustered into three major groups and multiple subgroups. The transcriptional activities of these BnaNAC proteins were assayed in yeast. In addition, by quantitative real-time RT-PCR, we further observed that some of these BnaNACs were regulated by different hormone stimuli or abiotic stresses. Interestingly, we successfully identified two novel BnaNACs, BnaNAC19 and BnaNAC82, which could elicit hypersensitive response-like cell death when expressed in Nicotiana benthamiana leaves, which was mediated by accumulation of reactive oxygen species. Overall, our work has laid a solid foundation for further characterization of this important NAC gene family in canola.

  14. Genetic analysis of loop sequences in the let-7 gene family reveal a relationship between loop evolution and multiple isomiRs.

    Directory of Open Access Journals (Sweden)

    Tingming Liang

    Full Text Available While mature miRNAs have been widely studied, the terminal loop sequences are rarely examined despite regulating both primary and mature miRNA functions. Herein, we attempted to understand the evolutionary pattern of loop sequences by analyzing loops in the let-7 gene family. Compared to the stable miRNA length distributions seen in most metazoans, higher metazoan species exhibit a longer length distribution. Examination of these loop sequence length distributions, in addition to phylogenetic tree construction, implicated loop sequences as the main evolutionary drivers in miRNA genes. Moreover, loops from relevant clustered miRNA gene families showed varying length distributions and higher levels of nucleotide divergence, even between homologous pre-miRNA loops. Furthermore, we found that specific nucleotides were dominantly distributed in the 5' and 3' terminal loop ends, which may contribute to the relatively precise cleavage that leads to a stable isomiR expression profile. Overall, this study provides further insight into miRNA processing and maturation and further enriches our understanding of miRNA biogenesis.

  15. Mutation analysis of the gene encoding Bruton`s tyrosine kinase in a family with a sporadic case of X-linked agammaglobulinemia reveals three female carriers

    Energy Technology Data Exchange (ETDEWEB)

    Hagemann, T.L.; Kwan, Sau-Ping [Rush Medical School, Chicago, IL (United States); Assa`ad, A.H. [Children`s Hospital Medical Center, Cincinnati, OH (United States)

    1995-11-06

    Bruton`s tyrosine kinase (Btk) has been identified as the protein responsible for the primary immunodeficiency X-linked agammaglobulinemia (XLA). We and others have cloned the gene for Btk and recently reported the genomic organization. Nineteen exons were positioned within the 37 kb gene. With the sequence data derived from our genomic map, we have designed a PCR based assay to directly identify mutations of the Btk gene in germline DNA of patients with XLA. In this report, the assay was used to analyze a family with a sporadic case of XLA to determine if other female relatives carry the disease. A four base-pair deletion was found in the DNA of the affected boy and was further traced through three generations. With the direct identification of the mutations responsible for XLA, we can now diagnose conclusively the disease and identify the immunologically normal female carriers. This same technique can easily be applied to prenatal diagnosis in families where the mutation can be identified. 34 refs., 3 figs.

  16. New Comparative Analysis Based on the Secondary Structure of SSU-rRNA Gene Reveals the Evolutionary Trend and the Family-Genus Characters of Mobilida (Ciliophora, Peritrichia).

    Science.gov (United States)

    Zhang, Yong; Zhao, Yuan-Jun; Wang, Qin; Tang, Fa-Hui

    2015-08-01

    In order to reveal the structural evolutionary trend of Mobilida ciliates, twenty-six SSU-rRNA sequences of mobilid species, including seven ones newly sequenced in the present work, were used for comparative phylogenic analysis based on the RNA secondary structure. The research results indicate that all the secondary structures except domains Helix 10, Helix 12, and Helix 37 could be regarded as the criterions in classification between the family Trichodinidae and Urceolariida, and four regions including Helix E10-1, Helix 29, Helix 43, and Helix 45-Helix 46 could be as criterions in classification between the genus Trichodinella and Trichodina in family Trichodinidae. After the analysis of common structural feature within the Mobilida, it was found that the secondary structure of V6 could prove the family Urceolariidae primitive status. This research has further suggested that the genus Trichodina could be divergent earlier than Trichodinella in the family Trichodinidae. In addition, the relationship between the secondary structure and topology of phylogenic tree that the branching order of most clades corresponds with the secondary structure of species within each clade of phylogenetic tree was first uncovered and discussed in the present study.

  17. Genome-Wide Identification and Expression Profiling of ATP-Binding Cassette (ABC Transporter Gene Family in Pineapple (Ananas comosus (L. Merr. Reveal the Role of AcABCG38 in Pollen Development

    Directory of Open Access Journals (Sweden)

    Piaojuan Chen

    2017-12-01

    Full Text Available Pineapple (Ananas comosus L. cultivation commonly relies on asexual reproduction which is easily impeded by many factors in agriculture production. Sexual reproduction might be a novel approach to improve the pineapple planting. However, genes controlling pineapple sexual reproduction are still remain elusive. In different organisms a conserved superfamily proteins known as ATP binding cassette (ABC participate in various biological processes. Whereas, till today the ABC gene family has not been identified in pineapple. Here 100 ABC genes were identified in the pineapple genome and grouped into eight subfamilies (5 ABCAs, 20 ABCBs, 16 ABCCs, 2 ABCDs, one ABCEs, 5 ABCFs, 42 ABCGs and 9 ABCIs. Gene expression profiling revealed the dynamic expression pattern of ABC gene family in various tissues and different developmental stages. AcABCA5, AcABCB6, AcABCC4, AcABCC7, AcABCC9, AcABCG26, AcABCG38 and AcABCG42 exhibited preferential expression in ovule and stamen. Over-expression of AcABCG38 in the Arabidopsis double mutant abcg1-2abcg16-2 partially restored its pollen abortion defects, indicating that AcABCG38 plays important roles in pollen development. Our study on ABC gene family in pineapple provides useful information for developing sexual pineapple plantation which could be utilized to improve pineapple agricultural production.

  18. Familial Dysautonomia (FD) Human Embryonic Stem Cell Derived PNS Neurons Reveal that Synaptic Vesicular and Neuronal Transport Genes Are Directly or Indirectly Affected by IKBKAP Downregulation.

    Science.gov (United States)

    Lefler, Sharon; Cohen, Malkiel A; Kantor, Gal; Cheishvili, David; Even, Aviel; Birger, Anastasya; Turetsky, Tikva; Gil, Yaniv; Even-Ram, Sharona; Aizenman, Einat; Bashir, Nibal; Maayan, Channa; Razin, Aharon; Reubinoff, Benjamim E; Weil, Miguel

    2015-01-01

    A splicing mutation in the IKBKAP gene causes Familial Dysautonomia (FD), affecting the IKAP protein expression levels and proper development and function of the peripheral nervous system (PNS). Here we found new molecular insights for the IKAP role and the impact of the FD mutation in the human PNS lineage by using a novel and unique human embryonic stem cell (hESC) line homozygous to the FD mutation originated by pre implantation genetic diagnosis (PGD) analysis. We found that IKBKAP downregulation during PNS differentiation affects normal migration in FD-hESC derived neural crest cells (NCC) while at later stages the PNS neurons show reduced intracellular colocalization between vesicular proteins and IKAP. Comparative wide transcriptome analysis of FD and WT hESC-derived neurons together with the analysis of human brains from FD and WT 12 weeks old embryos and experimental validation of the results confirmed that synaptic vesicular and neuronal transport genes are directly or indirectly affected by IKBKAP downregulation in FD neurons. Moreover we show that kinetin (a drug that corrects IKBKAP alternative splicing) promotes the recovery of IKAP expression and these IKAP functional associated genes identified in the study. Altogether, these results support the view that IKAP might be a vesicular like protein that might be involved in neuronal transport in hESC derived PNS neurons. This function seems to be mostly affected in FD-hESC derived PNS neurons probably reflecting some PNS neuronal dysfunction observed in FD.

  19. Familial Dysautonomia (FD Human Embryonic Stem Cell Derived PNS Neurons Reveal that Synaptic Vesicular and Neuronal Transport Genes Are Directly or Indirectly Affected by IKBKAP Downregulation.

    Directory of Open Access Journals (Sweden)

    Sharon Lefler

    Full Text Available A splicing mutation in the IKBKAP gene causes Familial Dysautonomia (FD, affecting the IKAP protein expression levels and proper development and function of the peripheral nervous system (PNS. Here we found new molecular insights for the IKAP role and the impact of the FD mutation in the human PNS lineage by using a novel and unique human embryonic stem cell (hESC line homozygous to the FD mutation originated by pre implantation genetic diagnosis (PGD analysis. We found that IKBKAP downregulation during PNS differentiation affects normal migration in FD-hESC derived neural crest cells (NCC while at later stages the PNS neurons show reduced intracellular colocalization between vesicular proteins and IKAP. Comparative wide transcriptome analysis of FD and WT hESC-derived neurons together with the analysis of human brains from FD and WT 12 weeks old embryos and experimental validation of the results confirmed that synaptic vesicular and neuronal transport genes are directly or indirectly affected by IKBKAP downregulation in FD neurons. Moreover we show that kinetin (a drug that corrects IKBKAP alternative splicing promotes the recovery of IKAP expression and these IKAP functional associated genes identified in the study. Altogether, these results support the view that IKAP might be a vesicular like protein that might be involved in neuronal transport in hESC derived PNS neurons. This function seems to be mostly affected in FD-hESC derived PNS neurons probably reflecting some PNS neuronal dysfunction observed in FD.

  20. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava

    Science.gov (United States)

    Han, Bingying; Fu, Lili; Zhang, Dan; He, Xiuquan; Chen, Qiang; Peng, Ming; Zhang, Jiaming

    2016-01-01

    normal conditions. MeTPS1 was then transformed into tobacco (Nicotiana benthamiana). Results indicated that transgenic tobacco lines accumulated significant level of trehalose and possessed improved drought stress tolerance. In conclusion, cassava accumulated significantly high amount of trehalose under normal conditions due to multiplied trehalose biosynthesis gene families and constant expression of the active MeTPS1 gene. High levels of trehalose subsequently contributed to high drought stress tolerance. PMID:27420056

  1. Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava

    Directory of Open Access Journals (Sweden)

    Bingying Han

    2016-07-01

    under normal conditions. MeTPS1 was then transformed into tobacco (Nicotiana benthamiana. Results indicated that transgenic tobacco lines accumulated significant level of trehalose and possessed improved drought stress tolerance. In conclusion, cassava accumulated significantly high amount of trehalose under normal conditions due to multiplied trehalose biosynthesis gene families and constant expression of the active MeTPS1 gene. High levels of trehalose subsequently contributed to high drought stress tolerance.

  2. OCTOPUS-LIKE 2, a novel player in Arabidopsis root and vascular development, reveals a key role for OCTOPUS family genes in root metaphloem sieve tube differentiation.

    Science.gov (United States)

    Ruiz Sola, M Aguila; Coiro, Mario; Crivelli, Simona; Zeeman, Samuel C; Schmidt Kjølner Hansen, Signe; Truernit, Elisabeth

    2017-12-01

    Protophloem and metaphloem sieve tubes are essential for transporting carbohydrates and signalling molecules towards sink tissues. OCTOPUS (OPS) was previously identified as an important regulator of protophloem differentiation in Arabidopsis roots. Here, we investigated the role of OCTOPUS-LIKE 2 (OPL2), a gene homologous to OPS. OPL2 expression patterns were analysed, and functional equivalence of OPS and OPL2 was tested. Mutant and double mutant phenotypes were investigated. OPS and OPL2 displayed overlapping expression patterns and a high degree of functional overlap. A mutation in OPL2 revealed redundant functions of OPS and OPL2 in developmental processes in which OPS was known to play a role, notably cotyledon vascular patterning and protophloem development. Moreover, we also uncovered redundant roles for OPS and OPL2 in leaf vascular patterning and, most interestingly, metaphloem sieve tube differentiation. Our results reveal a novel OPS-like protein that, together with OPS, is an important regulator of vascular patterning, root growth and phloem development. OPS and OPL2 are the first genes identified that play a role in metaphloem sieve tube differentiation. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  3. A Bioinformatics Analysis Reveals a Group of MocR Bacterial Transcriptional Regulators Linked to a Family of Genes Coding for Membrane Proteins

    Directory of Open Access Journals (Sweden)

    Teresa Milano

    2016-01-01

    Full Text Available The MocR bacterial transcriptional regulators are characterized by an N-terminal domain, 60 residues long on average, possessing the winged-helix-turn-helix (wHTH architecture responsible for DNA recognition and binding, linked to a large C-terminal domain (350 residues on average that is homologous to fold type-I pyridoxal 5′-phosphate (PLP dependent enzymes like aspartate aminotransferase (AAT. These regulators are involved in the expression of genes taking part in several metabolic pathways directly or indirectly connected to PLP chemistry, many of which are still uncharacterized. A bioinformatics analysis is here reported that studied the features of a distinct group of MocR regulators predicted to be functionally linked to a family of homologous genes coding for integral membrane proteins of unknown function. This group occurs mainly in the Actinobacteria and Gammaproteobacteria phyla. An analysis of the multiple sequence alignments of their wHTH and AAT domains suggested the presence of specificity-determining positions (SDPs. Mapping of SDPs onto a homology model of the AAT domain hinted at possible structural/functional roles in effector recognition. Likewise, SDPs in wHTH domain suggested the basis of specificity of Transcription Factor Binding Site recognition. The results reported represent a framework for rational design of experiments and for bioinformatics analysis of other MocR subgroups.

  4. Temporal and spatial expression of polygalacturonase gene family members reveals divergent regulation during fleshy fruit ripening and abscission in the monocot species oil palm.

    Science.gov (United States)

    Roongsattham, Peerapat; Morcillo, Fabienne; Jantasuriyarat, Chatchawan; Pizot, Maxime; Moussu, Steven; Jayaweera, Dasuni; Collin, Myriam; Gonzalez-Carranza, Zinnia H; Amblard, Philippe; Tregear, James W; Tragoonrung, Somvong; Verdeil, Jean-Luc; Tranbarger, Timothy J

    2012-08-25

    Cell separation that occurs during fleshy fruit abscission and dry fruit dehiscence facilitates seed dispersal, the final stage of plant reproductive development. While our understanding of the evolutionary context of cell separation is limited mainly to the eudicot model systems tomato and Arabidopsis, less is known about the mechanisms underlying fruit abscission in crop species, monocots in particular. The polygalacturonase (PG) multigene family encodes enzymes involved in the depolymerisation of pectin homogalacturonan within the primary cell wall and middle lamella. PG activity is commonly found in the separation layers during organ abscission and dehiscence, however, little is known about how this gene family has diverged since the separation of monocot and eudicots and the consequence of this divergence on the abscission process. The objective of the current study was to identify PGs responsible for the high activity previously observed in the abscission zone (AZ) during fruit shedding of the tropical monocot oil palm, and to analyze PG gene expression during oil palm fruit ripening and abscission. We identified 14 transcripts that encode PGs, all of which are expressed in the base of the oil palm fruit. The accumulation of five PG transcripts increase, four decrease and five do not change during ethylene treatments that induce cell separation. One PG transcript (EgPG4) is the most highly induced in the fruit base, with a 700-5000 fold increase during the ethylene treatment. In situ hybridization experiments indicate that the EgPG4 transcript increases preferentially in the AZ cell layers in the base of the fruit in response to ethylene prior to cell separation. The expression pattern of EgPG4 is consistent with the temporal and spatial requirements for cell separation to occur during oil palm fruit shedding. The sequence diversity of PGs and the complexity of their expression in the oil palm fruit tissues contrast with data from tomato, suggesting

  5. Genome Wide Identification and Expression Profiling of SWEET Genes Family Reveals Its Role During Plasmodiophora brassicae-Induced Formation of Clubroot in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Hong Li

    2018-02-01

    Full Text Available Plasmodiophora brassicae is a soil borne pathogen and the causal agent of clubroot, a devastating disease of Brassica crops. The pathogen lives inside roots, and hijacks nutrients from the host plants. It is suggested that clubroot galls created an additional nutrient sink in infected roots. However, the molecular mechanism underlying P. brassicae infection and sugar transport is unclear. Here, we analyzed sugar contents in leaves and roots before and after P. brassicae infection using a pair of Chinese cabbage near-isogenic lines (NILs, carrying either a clubroot resistant (CR or susceptible (CS allele at the CRb locus. P. brassicae infection caused significant increase of glucose and fructose contents in the root of CS-NIL compared to CR-NIL, suggesting that sugar translocation and P. brassicae growth are closely related. Among 32 B. rapa SWEET homologs, several BrSWEETs belonging to Clade I and III were significantly up-regulated, especially in CS-NIL upon P. brassicae infection. Moreover, Arabidopsis sweet11 mutant exhibited slower gall formation compared to the wild-type plants. Our studies suggest that P. brassicae infection probably triggers active sugar translocation between the sugar producing tissues and the clubbed tissues, and the SWEET family genes are involved in this process.

  6. Activity screening of environmental metagenomic libraries reveals novel carboxylesterase families

    Science.gov (United States)

    Popovic, Ana; Hai, Tran; Tchigvintsev, Anatoly; Hajighasemi, Mahbod; Nocek, Boguslaw; Khusnutdinova, Anna N.; Brown, Greg; Glinos, Julia; Flick, Robert; Skarina, Tatiana; Chernikova, Tatyana N.; Yim, Veronica; Brüls, Thomas; Paslier, Denis Le; Yakimov, Michail M.; Joachimiak, Andrzej; Ferrer, Manuel; Golyshina, Olga V.; Savchenko, Alexei; Golyshin, Peter N.; Yakunin, Alexander F.

    2017-01-01

    Metagenomics has made accessible an enormous reserve of global biochemical diversity. To tap into this vast resource of novel enzymes, we have screened over one million clones from metagenome DNA libraries derived from sixteen different environments for carboxylesterase activity and identified 714 positive hits. We have validated the esterase activity of 80 selected genes, which belong to 17 different protein families including unknown and cyclase-like proteins. Three metagenomic enzymes exhibited lipase activity, and seven proteins showed polyester depolymerization activity against polylactic acid and polycaprolactone. Detailed biochemical characterization of four new enzymes revealed their substrate preference, whereas their catalytic residues were identified using site-directed mutagenesis. The crystal structure of the metal-ion dependent esterase MGS0169 from the amidohydrolase superfamily revealed a novel active site with a bound unknown ligand. Thus, activity-centered metagenomics has revealed diverse enzymes and novel families of microbial carboxylesterases, whose activity could not have been predicted using bioinformatics tools. PMID:28272521

  7. The glutamine synthetase gene family in Populus

    Directory of Open Access Journals (Sweden)

    Cánovas Francisco M

    2011-08-01

    Full Text Available Abstract Background Glutamine synthetase (GS; EC: 6.3.1.2, L-glutamate: ammonia ligase ADP-forming is a key enzyme in ammonium assimilation and metabolism of higher plants. The current work was undertaken to develop a more comprehensive understanding of molecular and biochemical features of GS gene family in poplar, and to characterize the developmental regulation of GS expression in various tissues and at various times during the poplar perennial growth. Results The GS gene family consists of 8 different genes exhibiting all structural and regulatory elements consistent with their roles as functional genes. Our results indicate that the family members are organized in 4 groups of duplicated genes, 3 of which code for cytosolic GS isoforms (GS1 and 1 which codes for the choroplastic GS isoform (GS2. Our analysis shows that Populus trichocarpa is the first plant species in which it was observed the complete GS family duplicated. Detailed expression analyses have revealed specific spatial and seasonal patterns of GS expression in poplar. These data provide insights into the metabolic function of GS isoforms in poplar and pave the way for future functional studies. Conclusions Our data suggest that GS duplicates could have been retained in order to increase the amount of enzyme in a particular cell type. This possibility could contribute to the homeostasis of nitrogen metabolism in functions associated to changes in glutamine-derived metabolic products. The presence of duplicated GS genes in poplar could also contribute to diversification of the enzymatic properties for a particular GS isoform through the assembly of GS polypeptides into homo oligomeric and/or hetero oligomeric holoenzymes in specific cell types.

  8. Phylogenetic and comparative gene expression analysis of barley (Hordeum vulgare)WRKY transcription factor family reveals putatively retained functions betweenmonocots and dicots

    Energy Technology Data Exchange (ETDEWEB)

    Mangelsen, Elke; Kilian, Joachim; Berendzen, Kenneth W.; Kolukisaoglu, Uner; Harter, Klaus; Jansson, Christer; Wanke, Dierk

    2008-02-01

    WRKY proteins belong to the WRKY-GCM1 superfamily of zinc finger transcription factors that have been subject to a large plant-specific diversification. For the cereal crop barley (Hordeum vulgare), three different WRKY proteins have been characterized so far, as regulators in sucrose signaling, in pathogen defense, and in response to cold and drought, respectively. However, their phylogenetic relationship remained unresolved. In this study, we used the available sequence information to identify a minimum number of 45 barley WRKY transcription factor (HvWRKY) genes. According to their structural features the HvWRKY factors were classified into the previously defined polyphyletic WRKY subgroups 1 to 3. Furthermore, we could assign putative orthologs of the HvWRKY proteins in Arabidopsis and rice. While in most cases clades of orthologous proteins were formed within each group or subgroup, other clades were composed of paralogous proteins for the grasses and Arabidopsis only, which is indicative of specific gene radiation events. To gain insight into their putative functions, we examined expression profiles of WRKY genes from publicly available microarray data resources and found group specific expression patterns. While putative orthologs of the HvWRKY transcription factors have been inferred from phylogenetic sequence analysis, we performed a comparative expression analysis of WRKY genes in Arabidopsis and barley. Indeed, highly correlative expression profiles were found between some of the putative orthologs. HvWRKY genes have not only undergone radiation in monocot or dicot species, but exhibit evolutionary traits specific to grasses. HvWRKY proteins exhibited not only sequence similarities between orthologs with Arabidopsis, but also relatedness in their expression patterns. This correlative expression is indicative for a putative conserved function of related WRKY proteins in mono- and dicot species.

  9. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  10. Gene family matters: expanding the HGNC resource

    Directory of Open Access Journals (Sweden)

    Daugherty Louise C

    2012-07-01

    Full Text Available Abstract The HUGO Gene Nomenclature Committee (HGNC assigns approved gene symbols to human loci. There are currently over 33,000 approved gene symbols, the majority of which represent protein-coding genes, but we also name other locus types such as non-coding RNAs, pseudogenes and phenotypic loci. Where relevant, the HGNC organise these genes into gene families and groups. The HGNC website http://www.genenames.org/ is an online repository of HGNC-approved gene nomenclature and associated resources for human genes, and includes links to genomic, proteomic and phenotypic information. In addition to this, we also have dedicated gene family web pages and are currently expanding and generating more of these pages using data curated by the HGNC and from information derived from external resources that focus on particular gene families. Here, we review our current online resources with a particular focus on our gene family data, using it to highlight our new Gene Symbol Report and gene family data downloads.

  11. In silico analysis reveals widespread presence of three gene families, MAPK, MAPKK and MAPKKK, of the MAPK cascade from crop plants of Solanaceae in comparison to the distantly-related syntenic species from Rubiaceae, coffee

    Directory of Open Access Journals (Sweden)

    Hira Iftikhar

    2017-06-01

    Full Text Available Mitogen-activated protein kinases (MAPKs are an important family of genes which play roles in vital plant processes, and they also help in coping against various kinds of environmental stresses including abiotic as well as biotic factors. The advancement of genomics calls for the annotation, identification, and detailed processing of the essential gene families in plants in order to provide insights into the importance of their central roles as well as for providing the basis for making their growth vigorous even under stressed conditions and, ultimately, to benefit from them by foreseeing the potential threats to their growth. In the current study, MAPK, MAPKK, and MAPKKK families of the MAPK cascade were identified and reported from five different agriculturally and economically important crop species of the Solanaceae and Rubiaceae families based on conserved signature motifs aligned throughout the members of the families under this gene superfamily. Genes reported from the species after strict filtering were: 89, tomato; 108, potato; 63, eggplant; 79, pepper; 64, coffee. These MAPKs were found to be randomly distributed throughout the genome on the chromosomes of the respective species. Various characteristics of the identified genes were studied including gene structure, gene and coding sequence length, protein length, isoelectric point, molecular weight, and subcellular localization. Moreover, maximum likelihood test of phylogeny was conducted on the retrieved sequences for the three MAPK cascade families to determine their homologous relationships which were also analyzed quantitatively by heat plots.

  12. Genomics analysis of genes expressed reveals differential ...

    African Journals Online (AJOL)

    Genomics analysis of genes expressed reveals differential responses to low chronic nitrogen stress in maize. ... Most induced clones were largely involved in various metabolism processes including physiological process, organelle regulation of biological process, nutrient reservoir activity, transcription regulator activity and ...

  13. Review: the dominant flocculation genes of Saccharomyces cerevisiae constitute a new subtelomeric gene family.

    Science.gov (United States)

    Teunissen, A W; Steensma, H Y

    1995-09-15

    The quality of brewing strains is, in large part, determined by their flocculation properties. By classical genetics, several dominant, semidominant and recessive flocculation genes have been recognized. Recent results of experiments to localize the flocculation genes FLO5 and FLO8, combined with the in silicio analysis of the available sequence data of the yeast genome, have revealed that the flocculation genes belong to a family which comprises at least four genes and three pseudogenes. All members of this gene family are located near the end of chromosomes, just like the SUC, MEL and MAL genes, which are also important for good quality baking or brewing strains. Transcription of the flocculation genes is repressed by several regulatory genes. In addition, a number of genes have been found which cause cell aggregation upon disruption or overexpression in an as yet unknown manner. In total, 33 genes have been reported that are involved in flocculation or cell aggregation.

  14. Evolution of the mammalian lysozyme gene family

    Science.gov (United States)

    2011-01-01

    Background Lysozyme c (chicken-type lysozyme) has an important role in host defense, and has been extensively studied as a model in molecular biology, enzymology, protein chemistry, and crystallography. Traditionally, lysozyme c has been considered to be part of a small family that includes genes for two other proteins, lactalbumin, which is found only in mammals, and calcium-binding lysozyme, which is found in only a few species of birds and mammals. More recently, additional testes-expressed members of this family have been identified in human and mouse, suggesting that the mammalian lysozyme gene family is larger than previously known. Results Here we characterize the extent and diversity of the lysozyme gene family in the genomes of phylogenetically diverse mammals, and show that this family contains at least eight different genes that likely duplicated prior to the diversification of extant mammals. These duplicated genes have largely been maintained, both in intron-exon structure and in genomic context, throughout mammalian evolution. Conclusions The mammalian lysozyme gene family is much larger than previously appreciated and consists of at least eight distinct genes scattered around the genome. Since the lysozyme c and lactalbumin proteins have acquired very different functions during evolution, it is likely that many of the other members of the lysozyme-like family will also have diverse and unexpected biological properties. PMID:21676251

  15. Evolution of the mammalian lysozyme gene family

    Directory of Open Access Journals (Sweden)

    Biegel Jason M

    2011-06-01

    Full Text Available Abstract Background Lysozyme c (chicken-type lysozyme has an important role in host defense, and has been extensively studied as a model in molecular biology, enzymology, protein chemistry, and crystallography. Traditionally, lysozyme c has been considered to be part of a small family that includes genes for two other proteins, lactalbumin, which is found only in mammals, and calcium-binding lysozyme, which is found in only a few species of birds and mammals. More recently, additional testes-expressed members of this family have been identified in human and mouse, suggesting that the mammalian lysozyme gene family is larger than previously known. Results Here we characterize the extent and diversity of the lysozyme gene family in the genomes of phylogenetically diverse mammals, and show that this family contains at least eight different genes that likely duplicated prior to the diversification of extant mammals. These duplicated genes have largely been maintained, both in intron-exon structure and in genomic context, throughout mammalian evolution. Conclusions The mammalian lysozyme gene family is much larger than previously appreciated and consists of at least eight distinct genes scattered around the genome. Since the lysozyme c and lactalbumin proteins have acquired very different functions during evolution, it is likely that many of the other members of the lysozyme-like family will also have diverse and unexpected biological properties.

  16. When family drawings reveal vulnerabilities and resilience.

    Science.gov (United States)

    Ireland, Rachel; Weisbart, Cindy; Dubowitz, Howard; Rowe, Jeffrey; Stein, Martin T

    2010-04-01

    Sonia's mother was concerned about her 9-year old daughter's aggression, defiant behavior, and distractibility. When she was 4-years, she kicked her bother and he lost a tooth as a result of the trauma. At this time, her pediatrician was concerned about hyperactivity, impulsivity, and defiance of authority and recommended a psychological evaluation. Sonia's father refused an evaluation and responded by physically abusing his wife while demanding a transfer to a new physician. Sonia's mother left her husband at this time and moved away with Sonia. Spousal abuse occurred frequently before the separation, and Sonia may have been physically abused as well. Currently, Sonia is in third grade where she is underperforming in many areas. She enjoys drawing and reading, but struggles to sit quietly and stay on task. Her teacher reports frequent vocal and physical disruptions. Homework takes an inordinate amount of time to complete. She does not have a sustained friendship; her mother feels that this is because other kids do not like being bossed by Sonia. Her mother is concerned about Sonia's behavior especially the unremorseful disruptive behavior toward her younger brother and grandmother. Sonia was born after an uneventful full-term pregnancy without evidence of maternal smoking, drugs, alcohol, or medications. Motor and social developmental milestones were achieved at the appropriate time. Language milestones were achieved early; her mother recalls that Sonia learned to read at the age of 3 years. Sonia's medical history is significant for obesity, seasonal allergic rhinitis, and delayed sleep onset with prolonged awakenings associated with nightmares. Her mother reports that Sonia "worries about everything," including thoughts that her brother will turn into a monster. When an argument occurs at home, she "gets scared," bites her nails, and cries. Sonia currently lives with her mother, 2 younger brothers, step-father, and grandparents. Family history is significant for

  17. Evolution of the Vertebrate Resistin Gene Family.

    Directory of Open Access Journals (Sweden)

    Qingda Hu

    Full Text Available Resistin (encoded by Retn was previously identified in rodents as a hormone associated with diabetes; however human resistin is instead linked to inflammation. Resistin is a member of a small gene family that includes the resistin-like peptides (encoded by Retnl genes in mammals. Genomic searches of available genome sequences of diverse vertebrates and phylogenetic analyses were conducted to determine the size and origin of the resistin-like gene family. Genes encoding peptides similar to resistin were found in Mammalia, Sauria, Amphibia, and Actinistia (coelacanth, a lobe-finned fish, but not in Aves or fish from Actinopterygii, Chondrichthyes, or Agnatha. Retnl originated by duplication and transposition from Retn on the early mammalian lineage after divergence of the platypus, but before the placental and marsupial mammal divergence. The resistin-like gene family illustrates an instance where the locus of origin of duplicated genes can be identified, with Retn continuing to reside at this location. Mammalian species typically have a single copy Retn gene, but are much more variable in their numbers of Retnl genes, ranging from 0 to 9. Since Retn is located at the locus of origin, thus likely retained the ancestral expression pattern, largely maintained its copy number, and did not display accelerated evolution, we suggest that it is more likely to have maintained an ancestral function, while Retnl, which transposed to a new location, displays accelerated evolution, and shows greater variability in gene number, including gene loss, likely evolved new, but potentially lineage-specific, functions.

  18. When family drawings reveal vulnerabilities and resilience.

    Science.gov (United States)

    Ireland, Rachel; Weisbart, Cindy; Dubowitz, Howard; Rowe, Jeffrey; Stein, Martin T

    2009-10-01

    Sonia's mother was concerned about her 9-year old daughter's aggression, defiant behavior, and distractibility. When she was 4-years, she kicked her bother and he lost a tooth as a result of the trauma. At this time, her pediatrician was concerned about hyperactivity, impulsivity, and defiance of authority and recommended a psychological evaluation. Sonia's father refused an evaluation and responded by physically abusing his wife while demanding a transfer to a new physician. Sonia's mother left her husband at this time and moved away with Sonia. Spousal abuse occurred frequently before the separation, and Sonia may have been physically abused as well.Currently, Sonia is in third grade where she is underperforming in many areas. She enjoys drawing and reading, but struggles to sit quietly and stay on task. Her teacher reports frequent vocal and physical disruptions. Homework takes an inordinate amount of time to complete. She does not have a sustained friendship; her mother feels that this is because other kids do not like being bossed by Sonia. Her mother is concerned about Sonia's behavior especially the unremorseful disruptive behavior toward her younger brother and grandmother.Sonia was born after an uneventful full-term pregnancy without evidence of maternal smoking, drugs, alcohol, or medications. Motor and social developmental milestones were achieved at the appropriate time. Language milestones were achieved early; her mother recalls that Sonia learned to read at the age of 3 years.Sonia's medical history is significant for obesity, seasonal allergic rhinitis, and delayed sleep onset with prolonged awakenings associated with nightmares. Her mother reports that Sonia "worries about everything," including thoughts that her brother will turn into a monster. When an argument occurs at home, she "gets scared," bites her nails, and cries. Sonia currently lives with her mother, 2 younger brothers, step-father, and grandparents. Family history is significant for

  19. The CK1 gene family: expression patterning in zebrafish development

    Directory of Open Access Journals (Sweden)

    AMELINA ALBORNOZ

    2007-01-01

    Full Text Available Protein kinase CK1 is a ser/thr protein kinase family which has been identified in the cytosol cell fraction, associated with membranes as well as in the nucleus. Several isoforms of this gene family have been described in various organisms: CK1á, CK1ß, CK1δ, CK1å and CK1γ. Over the last decade, several members of this family have been involved in development processes related to wnt and sonic hedgehog signalling pathways. However, there is no detailed temporal information on the CK1 family in embryonic stages, even though orthologous genes have been described in several different vertebrate species. In this study, we describe for the first time the cloning and detailed expression pattern of five CK1 zebrafish genes. Sequence analysis revealed that zebrafish CK1 proteins are highly homologous to other vertebrate orthologues. Zebrafish CK1 genes are expressed throughout development in common and different territories. All the genes studied in development show maternal and zygotic expression with the exception of CK1å. This last gene presents only a zygotic component of expression. In early stages of development CK1 genes are ubiquitously expressed with the exception of CK1å. In later stages the five CK1 genes are expressed in the brain but not in the same way. This observation probably implicates the CK1 family genes in different and also in redundant functions. This is the first time that a detailed comparison of the expression of CK1 family genes is directly assessed in a vertebrate system throughout development

  20. Genetic recombination at the human RH locus: A family study of the red-cell Evans phenotype reveals a transfer of exons 2-6 from the RHD to the RHCE gene

    Energy Technology Data Exchange (ETDEWEB)

    Huang, C.H.; Chen, Y.; Reid, M. [Lindsley F. Kimball Research Inst., New York, NY (United States); Ghosh, S.

    1996-10-01

    The human RH locus appears to consist of two structural genes, D and CE, which map on the short arm p34-36 of chromosome 1 and specify a most complex system of blood-group genetic polymorphisms. Here we describe a family study of the Evans (also known as {open_quotes}D..{open_quotes}) phenotype, a codominant trait associated with both qualitative and quantitative changes in D-antigen expression. A cataract-causing mutation was also inherited in this family and was apparently cotransmitted with Evans, suggesting a chromosomal linkage of these two otherwise unrelated traits. Southern blot analysis and allele-specific PCR showed the linkage of Evans with a SphI RFLP marker and the presence of a hybrid gene in the RH locus. To delineate the pattern of gene expression, the composition and structure of Rh-polypeptide transcripts were characterized by reverse transcriptase-PCR and nucleotide sequencing. This resulted in the identification of a novel Rh transcript expressed only in the Evans-positive erythroid cells. Sequence analysis showed that the transcript maintained a normal open reading frame but occurred as a CE-D-CE composite in which exons 2-6 of the CE gene were replaced by the homologous counterpart of the D gene. This hybrid gene was predicted to encode a CE-D-CE fusion protein whose surface expression correlates with the Evans phenotype. The mode and consequence of such a recombination event suggest the occurrence, in the RH locus, of a segmental DNA transfer via the mechanism of gene conversion. 31 refs., 6 figs., 1 tab.

  1. Unique Features of Germline Variation in Five Egyptian Familial Breast Cancer Families Revealed by Exome Sequencing.

    Directory of Open Access Journals (Sweden)

    Yeong C Kim

    Full Text Available Genetic predisposition increases the risk of familial breast cancer. Recent studies indicate that genetic predisposition for familial breast cancer can be ethnic-specific. However, current knowledge of genetic predisposition for the disease is predominantly derived from Western populations. Using this existing information as the sole reference to judge the predisposition in non-Western populations is not adequate and can potentially lead to misdiagnosis. Efforts are required to collect genetic predisposition from non-Western populations. The Egyptian population has high genetic variations in reflecting its divergent ethnic origins, and incident rate of familial breast cancer in Egypt is also higher than the rate in many other populations. Using whole exome sequencing, we investigated genetic predisposition in five Egyptian familial breast cancer families. No pathogenic variants in BRCA1, BRCA2 and other classical breast cancer-predisposition genes were present in these five families. Comparison of the genetic variants with those in Caucasian familial breast cancer showed that variants in the Egyptian families were more variable and heterogeneous than the variants in Caucasian families. Multiple damaging variants in genes of different functional categories were identified either in a single family or shared between families. Our study demonstrates that genetic predisposition in Egyptian breast cancer families may differ from those in other disease populations, and supports a comprehensive screening of local disease families to determine the genetic predisposition in Egyptian familial breast cancer.

  2. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  3. Genome-Wide Characterization and Expression Profiles of the Superoxide Dismutase Gene Family in Gossypium

    Directory of Open Access Journals (Sweden)

    Jingbo Zhang

    2016-01-01

    Full Text Available Superoxide dismutase (SOD as a group of significant and ubiquitous enzymes plays a critical function in plant growth and development. Previously this gene family has been investigated in Arabidopsis and rice; it has not yet been characterized in cotton. In our study, it was the first time for us to perform a genome-wide analysis of SOD gene family in cotton. Our results showed that 10 genes of SOD gene family were identified in Gossypium arboreum and Gossypium raimondii, including 6 Cu-Zn-SODs, 2 Fe-SODs, and 2 Mn-SODs. The chromosomal distribution analysis revealed that SOD genes are distributed across 7 chromosomes in Gossypium arboreum and 8 chromosomes in Gossypium raimondii. Segmental duplication is predominant duplication event and major contributor for expansion of SOD gene family. Gene structure and protein structure analysis showed that SOD genes have conserved exon/intron arrangement and motif composition. Microarray-based expression analysis revealed that SOD genes have important function in abiotic stress. Moreover, the tissue-specific expression profile reveals the functional divergence of SOD genes in different organs development of cotton. Taken together, this study has imparted new insights into the putative functions of SOD gene family in cotton. Findings of the present investigation could help in understanding the role of SOD gene family in various aspects of the life cycle of cotton.

  4. Identification and analysis of glutathione S-transferase gene family in sweet potato reveal divergent GST-mediated networks in aboveground and underground tissues in response to abiotic stresses.

    Science.gov (United States)

    Ding, Na; Wang, Aimin; Zhang, Xiaojun; Wu, Yunxiang; Wang, Ruyuan; Cui, Huihui; Huang, Rulin; Luo, Yonghai

    2017-11-28

    Sweet potato, a hexaploid species lacking a reference genome, is one of the most important crops in many developing countries, where abiotic stresses are a primary cause of reduction of crop yield. Glutathione S-transferases (GSTs) are multifunctional enzymes that play important roles in oxidative stress tolerance and cellular detoxification. A total of 42 putative full-length GST genes were identified from two local transcriptome databases and validated by molecular cloning and Sanger sequencing. Sequence and intraspecific phylogenetic analyses revealed extensive differentiation in their coding sequences and divided them into eight subfamilies. Interspecific phylogenetic and comparative analyses indicated that most examined GST paralogs might originate and diverge before the speciation of sweet potato. Results from large-scale RNA-seq and quantitative real-time PCR experiments exhibited extensive variation in gene-expression profiles across different tissues and varieties, which implied strong evolutionary divergence in their gene-expression regulation. Moreover, we performed five manipulated stress experiments and uncovered highly divergent stress-response patterns of sweet potato GST genes in aboveground and underground tissues. Our study identified a large number of sweet potato GST genes, systematically investigated their evolutionary diversification, and provides new insights into the GST-mediated stress-response mechanisms in this worldwide crop.

  5. Seven New Complete Plastome Sequences Reveal Rampant Independent Loss of the ndh Gene Family across Orchids and Associated Instability of the Inverted Repeat/Small Single-Copy Region Boundaries.

    Directory of Open Access Journals (Sweden)

    Hyoung Tae Kim

    Full Text Available Earlier research has revealed that the ndh loci have been pseudogenized, truncated, or deleted from most orchid plastomes sequenced to date, including in all available plastomes of the two most species-rich subfamilies, Orchidoideae and Epidendroideae. This study sought to resolve deeper-level phylogenetic relationships among major orchid groups and to refine the history of gene loss in the ndh loci across orchids. The complete plastomes of seven orchids, Oncidium sphacelatum (Epidendroideae, Masdevallia coccinea (Epidendroideae, Sobralia callosa (Epidendroideae, Sobralia aff. bouchei (Epidendroideae, Elleanthus sodiroi (Epidendroideae, Paphiopedilum armeniacum (Cypripedioideae, and Phragmipedium longifolium (Cypripedioideae were sequenced and analyzed in conjunction with all other available orchid and monocot plastomes. Most ndh loci were found to be pseudogenized or lost in Oncidium, Paphiopedilum and Phragmipedium, but surprisingly, all ndh loci were found to retain full, intact reading frames in Sobralia, Elleanthus and Masdevallia. Character mapping suggests that the ndh genes were present in the common ancestor of orchids but have experienced independent, significant losses at least eight times across four subfamilies. In addition, ndhF gene loss was correlated with shifts in the position of the junction of the inverted repeat (IR and small single-copy (SSC regions. The Orchidaceae have unprecedented levels of homoplasy in ndh gene presence/absence, which may be correlated in part with the unusual life history of orchids. These results also suggest that ndhF plays a role in IR/SSC junction stability.

  6. Seven New Complete Plastome Sequences Reveal Rampant Independent Loss of the ndh Gene Family across Orchids and Associated Instability of the Inverted Repeat/Small Single-Copy Region Boundaries.

    Science.gov (United States)

    Kim, Hyoung Tae; Kim, Jung Sung; Moore, Michael J; Neubig, Kurt M; Williams, Norris H; Whitten, W Mark; Kim, Joo-Hwan

    2015-01-01

    Earlier research has revealed that the ndh loci have been pseudogenized, truncated, or deleted from most orchid plastomes sequenced to date, including in all available plastomes of the two most species-rich subfamilies, Orchidoideae and Epidendroideae. This study sought to resolve deeper-level phylogenetic relationships among major orchid groups and to refine the history of gene loss in the ndh loci across orchids. The complete plastomes of seven orchids, Oncidium sphacelatum (Epidendroideae), Masdevallia coccinea (Epidendroideae), Sobralia callosa (Epidendroideae), Sobralia aff. bouchei (Epidendroideae), Elleanthus sodiroi (Epidendroideae), Paphiopedilum armeniacum (Cypripedioideae), and Phragmipedium longifolium (Cypripedioideae) were sequenced and analyzed in conjunction with all other available orchid and monocot plastomes. Most ndh loci were found to be pseudogenized or lost in Oncidium, Paphiopedilum and Phragmipedium, but surprisingly, all ndh loci were found to retain full, intact reading frames in Sobralia, Elleanthus and Masdevallia. Character mapping suggests that the ndh genes were present in the common ancestor of orchids but have experienced independent, significant losses at least eight times across four subfamilies. In addition, ndhF gene loss was correlated with shifts in the position of the junction of the inverted repeat (IR) and small single-copy (SSC) regions. The Orchidaceae have unprecedented levels of homoplasy in ndh gene presence/absence, which may be correlated in part with the unusual life history of orchids. These results also suggest that ndhF plays a role in IR/SSC junction stability.

  7. Identifying Coevolving Partners from Paralogous Gene Families

    Directory of Open Access Journals (Sweden)

    Chen-Hsiang Yeang

    2008-01-01

    Full Text Available Many methods have been developed to detect coevolution from aligned sequences. However, all the existing methods require a one-to-one mapping of candidate coevolving partners (nucleotides, amino acids a priori. When two families of sequences have distinct duplication and loss histories, finding the one-to-one mapping of coevolving partners can be computationally involved. We propose an algorithm to identify the coevolving partners from two families of sequences with distinct phylogenetic trees. The algorithm maps each gene tree to a reference species tree, and builds a joint state of sequence composition and assignments of coevolving partners for each species tree node. By applying dynamic programming on the joint states, the optimal assignments can be identified. Time complexity is quadratic to the size of the species tree, and space complexity is exponential to the maximum number of gene tree nodes mapped to the same species tree node. Analysis on both simulated data and Pfam protein domain sequences demonstrates that the paralog coevolution algorithm picks up the coevolving partners with 60%–88% accuracy. This algorithm extends phylogeny-based coevolutionary models and make them applicable to a wide range of problems such as predicting protein-protein, protein-DNA and DNA-RNA interactions of two distinct families of sequences.

  8. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  9. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  10. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  11. Comparative mapping reveals similar linkage of functional genes to ...

    Indian Academy of Sciences (India)

    logous genes and QTL of yield-related traits by silico map- ping and population mapping in O. sativa. Our results revealed that B. napus and O. sativa shared homologous se- quences of genes with similar functions, as well as consistent linkage relationships between genes and agronomic traits. Materials and methods.

  12. The SUPERMAN gene family in Populus: nucleotide diversity and gene expression in a dioecious plant.

    Science.gov (United States)

    Song, Yuepeng; Ma, Kaifeng; Ci, Dong; Tian, Xueyuan; Zhang, Zhiyi; Zhang, Deqiang

    2013-08-01

    SUP gene family expression and regulation patterns reported in dioecious woody plant. Phylogenetic and nucleotide diversity analysis indicated PtoSUP1 is highly conserved and has undergone strong purifying selection. The molecular basis of SUPERMAN (SUP) regulation during floral development in monoecious plants has been extensively studied, but little is known of the SUP gene family in dioecious woody plants. In this study, we systematically examined the diversification of the SUP gene family in Populus, integrating genomic organization, expression, and phylogeny data. SUP family members showed sex-specific expression throughout flower development. Transcript profiling of rare gynomonoecious poplar flowers revealed that a significant reduction in PtoSUP1 mRNA might be important for stamen development in gynomonoecious poplar flowers. We found that the coding regions of Populus SUP genes are very highly conserved and that synonymous sites in exon regions have undergone strong purifying selection during SUP evolution in Populus. These results indicate that SUP genes play an important role in floral development of dioecious plants. Expression analysis of SUP suggested possible regulatory mechanisms for gynomonoecious poplar flower development. These findings provide an important insight into the mechanisms of the evolution of SUP function and may help enable engineered regulation of flower development for breeding improved tree varieties.

  13. Comprehensive analyses of the annexin gene family in wheat.

    Science.gov (United States)

    Xu, Lei; Tang, Yimiao; Gao, Shiqing; Su, Shichao; Hong, Lin; Wang, Weiwei; Fang, Zhaofeng; Li, Xueyin; Ma, Jinxiu; Quan, Wei; Sun, Hui; Li, Xia; Wang, Yongbo; Liao, Xiangzheng; Gao, Jiangang; Zhang, Fengting; Li, Lei; Zhao, Changping

    2016-05-28

    Annexins are an evolutionarily conserved multigene family of calcium-dependent phospholipid binding proteins that play important roles in stress resistance and plant development. They have been relatively well characterized in model plants Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa), but nothing has been reported in hexaploid bread wheat (Triticum aestivum) and barely (Hordeum vulgare), which are the two most economically important plants. Based on available genomic and transcriptomic data, 25 and 11 putative annexin genes were found through in silico analysis in wheat and barley, respectively. Additionally, eight and 11 annexin genes were identified from the draft genome sequences of Triticum urartu and Aegilops tauschii, progenitor for the A and D genome of wheat, respectively. By phylogenetic analysis, annexins in these four species together with other monocots and eudicots were classified into six different orthologous groups. Pi values of each of Ann1-12 genes among T. aestivum, T. urartu, A. tauschii and H. vulgare species was very low, with the exception of Ann2 and Ann5 genes. Ann2 gene has been under positive selection, but Ann6 and Ann7 have been under purifying selection among the four species in their evolutionary histories. The nucleotide diversities of Ann1-12 genes in the four species were 0.52065, 0.59239, 0.60691 and 0.53421, respectively. No selective pressure was operated on annexin genes in the same species. Gene expression patterns obtained by real-time PCR and re-analyzing the public microarray data revealed differential temporal and spatial regulation of annexin genes in wheat under different abiotic stress conditions such as salinity, drought, cold and abscisic acid. Among those genes, TaAnn10 is specifically expressed in the anther but fails to be induced by low temperature in thermosensitive genic male sterile lines, suggesting that specific down-regulation of TaAnn10 is associated with conditional male sterility in wheat

  14. Functional characterization of two new members of the caffeoyl CoA O-methyltransferase-like gene family from Vanilla planifolia reveals a new class of plastid-localized O-methyltransferases.

    Science.gov (United States)

    Widiez, Thomas; Hartman, Thomas G; Dudai, Nativ; Yan, Qing; Lawton, Michael; Havkin-Frenkel, Daphna; Belanger, Faith C

    2011-08-01

    Caffeoyl CoA O-methyltransferases (OMTs) have been characterized from numerous plant species and have been demonstrated to be involved in lignin biosynthesis. Higher plant species are known to have additional caffeoyl CoA OMT-like genes, which have not been well characterized. Here, we identified two new caffeoyl CoA OMT-like genes by screening a cDNA library from specialized hair cells of pods of the orchid Vanilla planifolia. Characterization of the corresponding two enzymes, designated Vp-OMT4 and Vp-OMT5, revealed that in vitro both enzymes preferred as a substrate the flavone tricetin, yet their sequences and phylogenetic relationships to other enzymes are distinct from each other. Quantitative analysis of gene expression indicated a dramatic tissue-specific expression pattern for Vp-OMT4, which was highly expressed in the hair cells of the developing pod, the likely location of vanillin biosynthesis. Although Vp-OMT4 had a lower activity with the proposed vanillin precursor, 3,4-dihydroxybenzaldehyde, than with tricetin, the tissue specificity of expression suggests it may be a candidate for an enzyme involved in vanillin biosynthesis. In contrast, the Vp-OMT5 gene was mainly expressed in leaf tissue and only marginally expressed in pod hair cells. Phylogenetic analysis suggests Vp-OMT5 evolved from a cyanobacterial enzyme and it clustered within a clade in which the sequences from eukaryotic species had predicted chloroplast transit peptides. Transient expression of a GFP-fusion in tobacco demonstrated that Vp-OMT5 was localized in the plastids. This is the first flavonoid OMT demonstrated to be targeted to the plastids.

  15. Whole Exome Sequencing Reveals Genetic Predisposition in a Large Family with Retinitis Pigmentosa

    Directory of Open Access Journals (Sweden)

    Juan Wu

    2014-01-01

    Full Text Available Next-generation sequencing has become more widely used to reveal genetic defect in monogenic disorders. Retinitis pigmentosa (RP, the leading cause of hereditary blindness worldwide, has been attributed to more than 67 disease-causing genes. Due to the extreme genetic heterogeneity, using general molecular screening alone is inadequate for identifying genetic predispositions in susceptible individuals. In order to identify underlying mutation rapidly, we utilized next-generation sequencing in a four-generation Chinese family with RP. Two affected patients and an unaffected sibling were subjected to whole exome sequencing. Through bioinformatics analysis and direct sequencing confirmation, we identified p.R135W transition in the rhodopsin gene. The mutation was subsequently confirmed to cosegregate with the disease in the family. In this study, our results suggest that whole exome sequencing is a robust method in diagnosing familial hereditary disease.

  16. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  17. Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

    Science.gov (United States)

    Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

    2014-05-09

    The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. The Nitrate Transporter (NRT) Gene Family in Poplar

    Science.gov (United States)

    Bai, Hua; Euring, Dejuan; Volmer, Katharina; Janz, Dennis; Polle, Andrea

    2013-01-01

    Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT), which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens) showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth. PMID:23977227

  19. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  20. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi

    2007-01-01

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated

  1. Revealing gene action for production characteristics by inbreeding ...

    African Journals Online (AJOL)

    Revealing gene action for production characteristics by inbreeding, based on a long-term selection ... The gene action involved in the expression of production characters was investigated, using the effect of the theoretical inbreeding ..... and predicted selection responses for growth, fat and lean traits in mice. J. Anim. Sci.

  2. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  3. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  4. Characterization of the caleosin gene family in the Triticeae.

    Science.gov (United States)

    Khalil, Hala Badr; Brunetti, Sabrina C; Pham, Uyen Minh; Maret, Deborah; Laroche, André; Gulick, Patrick J

    2014-03-27

    The caleosin genes encode proteins with a single conserved EF hand calcium-binding domain and comprise small gene families found in a wide range of plant species. Some members of the gene family have been shown to be upregulated by environmental stresses including low water availability and high salinity. Caleosin 3 from wheat has been shown to interact with the α-subunit of the heterotrimeric G proteins, and to act as a GTPase activating protein (GAP). This study characterizes the size and diversity of the gene family in wheat and related species and characterizes the differential tissue-specific expression of members of the gene family. A total of 34 gene family members that belong to eleven paralogous groups of caleosins were identified in the hexaploid bread wheat, T. aestivum. Each group was represented by three homeologous copies of the gene located on corresponding homeologous chromosomes, except the caleosin 10, which has four gene copies. Ten gene family members were identified in diploid barley, Hordeum vulgare, and in rye, Secale cereale, seven in Brachypodium distachyon, and six in rice, Oryza sativa. The analysis of gene expression was assayed in triticale and rye by RNA-Seq analysis of 454 sequence sets and members of the gene family were found to have diverse patterns of gene expression in the different tissues that were sampled in rye and in triticale, the hybrid hexaploid species derived from wheat and rye. Expression of the gene family in wheat and barley was also previously determined by microarray analysis, and changes in expression during development and in response to environmental stresses are presented. The caleosin gene family had a greater degree of expansion in the Triticeae than in the other monocot species, Brachypodium and rice. The prior implication of one member of the gene family in the stress response and heterotrimeric G protein signaling, points to the potential importance of the caleosin gene family. The complexity of the

  5. Impact of gene family evolutionary histories on phylogenetic species tree inference by gene tree parsimony.

    Science.gov (United States)

    Shi, Tao

    2016-03-01

    Complicated history of gene duplication and loss brings challenge to molecular phylogenetic inference, especially in deep phylogenies. However, phylogenomic approaches, such as gene tree parsimony (GTP), show advantage over some other approaches in its ability to use gene families with duplications. GTP searches the 'optimal' species tree by minimizing the total cost of biological events such as duplications, but accuracy of GTP and phylogenetic signal in the context of different gene families with distinct histories of duplication and loss are unclear. To evaluate how different evolutionary properties of different gene families can impact on species tree inference, 3900 gene families from seven angiosperms encompassing a wide range of gene content, lineage-specific expansions and contractions were analyzed. It was found that the gene content and total duplication number in a gene family strongly influence species tree inference accuracy, with the highest accuracy achieved at either very low or very high gene content (or duplication number) and lowest accuracy centered in intermediate gene content (or duplication number), as the relationship can fit a binomial regression. Besides, for gene families of similar level of average gene content, those with relatively higher lineage-specific expansion or duplication rates tend to show lower accuracy. Additional correlation tests support that high accuracy for those gene families with large gene content may rely on abundant ancestral copies to provide many subtrees to resolve conflicts, whereas high accuracy for single or low copy gene families are just subject to sequence substitution per se. Very low accuracy reached by gene families of intermediate gene content or duplication number can be due to insufficient subtrees to resolve the conflicts from loss of alternative copies. As these evolutionary properties can significantly influence species tree accuracy, I discussed the potential weighting of the duplication cost by

  6. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    Science.gov (United States)

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  7. Homozygosity mapping and targeted sanger sequencing reveal genetic defects underlying inherited retinal disease in families from pakistan.

    Directory of Open Access Journals (Sweden)

    Maleeha Maria

    Full Text Available Homozygosity mapping has facilitated the identification of the genetic causes underlying inherited diseases, particularly in consanguineous families with multiple affected individuals. This knowledge has also resulted in a mutation dataset that can be used in a cost and time effective manner to screen frequent population-specific genetic variations associated with diseases such as inherited retinal disease (IRD.We genetically screened 13 families from a cohort of 81 Pakistani IRD families diagnosed with Leber congenital amaurosis (LCA, retinitis pigmentosa (RP, congenital stationary night blindness (CSNB, or cone dystrophy (CD. We employed genome-wide single nucleotide polymorphism (SNP array analysis to identify homozygous regions shared by affected individuals and performed Sanger sequencing of IRD-associated genes located in the sizeable homozygous regions. In addition, based on population specific mutation data we performed targeted Sanger sequencing (TSS of frequent variants in AIPL1, CEP290, CRB1, GUCY2D, LCA5, RPGRIP1 and TULP1, in probands from 28 LCA families.Homozygosity mapping and Sanger sequencing of IRD-associated genes revealed the underlying mutations in 10 families. TSS revealed causative variants in three families. In these 13 families four novel mutations were identified in CNGA1, CNGB1, GUCY2D, and RPGRIP1.Homozygosity mapping and TSS revealed the underlying genetic cause in 13 IRD families, which is useful for genetic counseling as well as therapeutic interventions that are likely to become available in the near future.

  8. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  9. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions.

    Science.gov (United States)

    Barrey, Eric; Mucher, Elodie; Jeansoule, Nicolas; Larcher, Thibaut; Guigand, Lydie; Herszberg, Bérénice; Chaffaux, Stéphane; Guérin, Gérard; Mata, Xavier; Benech, Philippe; Canale, Marielle; Alibert, Olivier; Maltere, Péguy; Gidrol, Xavier

    2009-08-07

    Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM). It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA) and 5 heterozygous (GA) PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses.Gene expression analysis revealed 129 genes significantly modulated (p < 0.05). The following genes were up-regulated over 2 fold: IL18, CTSS, LUM, CD44, FN1, GST01. The most down-regulated genes were the following: mitochondrial tRNA, SLC2A2, PRKCalpha, VEGFalpha. Data mining analysis showed that protein synthesis, apoptosis, cellular movement, growth and proliferation were the main cellular functions significantly associated with the modulated genes (p < 0.05). Several up-regulated genes, especially IL18, revealed a severe muscular inflammation in PSSM muscles. The up-regulation of glycogen synthase kinase-3 (GSK3beta) under its active form could be responsible for glycogen synthase (GYS1) inhibition and hypoxia-inducible factor (HIF1alpha

  10. Bioinformatic analysis of the neprilysin (M13 family of peptidases reveals complex evolutionary and functional relationships

    Directory of Open Access Journals (Sweden)

    Pinney John W

    2008-01-01

    Full Text Available Abstract Background The neprilysin (M13 family of endopeptidases are zinc-metalloenzymes, the majority of which are type II integral membrane proteins. The best characterised of this family is neprilysin, which has important roles in inactivating signalling peptides involved in modulating neuronal activity, blood pressure and the immune system. Other family members include the endothelin converting enzymes (ECE-1 and ECE-2, which are responsible for the final step in the synthesis of potent vasoconstrictor endothelins. The ECEs, as well as neprilysin, are considered valuable therapeutic targets for treating cardiovascular disease. Other members of the M13 family have not been functionally characterised, but are also likely to have biological roles regulating peptide signalling. The recent sequencing of animal genomes has greatly increased the number of M13 family members in protein databases, information which can be used to reveal evolutionary relationships and to gain insight into conserved biological roles. Results The phylogenetic analysis successfully resolved vertebrate M13 peptidases into seven classes, one of which appears to be specific to mammals, and insect genes into five functional classes and a series of expansions, which may include inactive peptidases. Nematode genes primarily resolved into groups containing no other taxa, bar the two nematode genes associated with Drosophila DmeNEP1 and DmeNEP4. This analysis reconstructed only one relationship between chordate and invertebrate clusters, that of the ECE sub-group and the DmeNEP3 related genes. Analysis of amino acid utilisation in the active site of M13 peptidases reveals a basis for their biochemical properties. A relatively invariant S1' subsite gives the majority of M13 peptidases their strong preference for hydrophobic residues in P1' position. The greater variation in the S2' subsite may be instrumental in determining the specificity of M13 peptidases for their substrates

  11. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    ... our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways ...

  12. Distinct functions of Egr gene family members in cognitive processes

    Directory of Open Access Journals (Sweden)

    Roseline Poirier

    2008-07-01

    Full Text Available The different gene members of the Egr family of transcriptional regulators have often been considered to have related functions in brain, based on their co-expression in many cell-types and structures, the relatively high homology of the translated proteins and their ability to bind to the same consensus DNA binding sequence. Recent research, however, suggest this might not be the case. In this review, we focus on the current understanding of the functional roles of the different Egr family members in learning and memory. We briefly outline evidence from mutant mice that Egr1 is required specifically for the consolidation of long-term memory, while Egr3 is primarily essential for short-term memory. We also review our own recent findings from newly generated forebrain-specific conditional Egr2 mutant mice, which revealed that Egr2, as opposed to Egr1 and Egr3, is dispensable for several forms of learning and memory and on the contrary can act as an inhibitory constraint for certain cognitive functions. The studies reviewed here highlight the fact that Egr family members may have different, and in certain circumstances antagonistic functions in the adult brain.

  13. Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins

    Directory of Open Access Journals (Sweden)

    Davey Jennifer C

    2007-12-01

    Full Text Available Abstract Background Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Results Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT. The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. Conclusion The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for

  14. Genome-wide analysis of Aux/IAA and ARF gene families in Populus trichocarpa

    Energy Technology Data Exchange (ETDEWEB)

    Kalluri, Udaya C [ORNL; DiFazio, Stephen P [West Virginia University; Brunner, A. [Virginia Polytechnic Institute and State University (Virginia Tech); Tuskan, Gerald A [ORNL

    2007-01-01

    Auxin/Indole-3-Acetic Acid (Aux/IAA) and Auxin Response Factor (ARF) transcription factors are key regulators of auxin responses in plants. A total of 35 Aux/IAA and 39 ARF genes were identified in the Populus genome. Comparative phylogenetic analysis revealed that the subgroups PoptrARF2, 6, 9 and 16 and PoptrIAA3, 16, 27 and 29 have differentially expanded in Populus relative to Arabidopsis. Activator ARFs were found to be two fold-overrepresented in the Populus genome. PoptrIAA and PoptrARF gene families appear to have expanded due to high segmental and low tandem duplication events. Furthermore, expression studies showed that genes in the expanded PoptrIAA3 subgroup display differential expression. The gene-family analysis reported here will be useful in conducting future functional genomics studies to understand how the molecular roles of these large gene families translate into a diversity of biologically meaningful auxin effects.

  15. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    Directory of Open Access Journals (Sweden)

    Benech Philippe

    2009-08-01

    Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

  16. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  17. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  18. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  19. The KIT gene in familial mastocytosis

    OpenAIRE

    Tourlaki, Athanasia

    2013-01-01

    Familial cutaneous mastocytosis is an exceptional condition of unknown etiology. In this study we report the largest series of patients with familial cutaneous mastocytosis without other manifestations (18 affected subjects from seven unrelated families), and we investigate the role of germ-line KIT mutations in the pathogenesis of the disease. The mean age at onset was 5.4 years (range from birth to 22 years), and the clinical behavior was variable over a mean follow up period of 15.1 years ...

  20. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  1. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  2. Identification of metalloprotease gene families in sugarcane

    Directory of Open Access Journals (Sweden)

    O.H.P. Ramos

    2001-12-01

    Full Text Available Metalloproteases play a key role in many physiological processes in mammals such as cell migration, tissue remodeling and processing of growth factors. They have also been identified as important factors in the patho-physiology of a number of human diseases, including cancer and hypertension. Many bacterial pathogens rely on proteases in order to infect the host. Several classes of metalloproteases have been described in humans, bacteria, snake venoms and insects. However, the presence and characterization of plant metalloproteases have rarely been described in the literature. In our research, we searched the sugarcane expressed sequence tag (SUCEST DNA library in order to identify, by homology with sequences deposited in other databases, metalloprotease gene families expressed under different conditions. Protein sequences from Arabidopsis thaliana and Glycine max were used to search the SUCEST data bank. Conserved regions corresponding to different metalloprotease domains and sequence motifs were identified in the reads to characterize each group of enzymes. At least four classes of sugarcane metalloproteases have been identified, i.e. matrix metalloproteases, zincins, inverzincins, and ATP-dependent metalloproteases. Each enzyme class was analyzed for its expression in different conditions and tissues.Metaloproteases exercem papéis importantes em muitos processos fisiológicos em mamíferos tais como migração celular, remodelamento tecidual e processamento de fatores de crescimento. Estas enzimas estão envolvidas também na pato-fisiologia de um grande número de doenças humanas como hipertensão e câncer. Muitas bactérias patogênicas dependem de proteases para infectar o hospedeiro. Diversas classes de metaloproteases foram descritas em seres humanos, bactérias, venenos de serpentes e insetos. No entanto, a presença e a caracterização de metaloproteases em plantas estão pouco descritas na literatura. Neste trabalho, foi

  3. Characterization of two CYP77 gene family members related to ...

    Indian Academy of Sciences (India)

    [Yue Y., Peng H., Sun J., Yang Z., Yang H., Liu G. and Hu H. 2016 Characterization of two CYP77 gene family members related to development of ornamental ... of the largest families in plants, participate in numerous reac- tions of the plant ... real-time quantitative polymerase chain reaction (RT-qPCR), indicating that they ...

  4. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  5. Genes but not genomes reveal bacterial domestication of Lactococcus lactis.

    Directory of Open Access Journals (Sweden)

    Delphine Passerini

    Full Text Available BACKGROUND: The population structure and diversity of Lactococcus lactis subsp. lactis, a major industrial bacterium involved in milk fermentation, was determined at both gene and genome level. Seventy-six lactococcal isolates of various origins were studied by different genotyping methods and thirty-six strains displaying unique macrorestriction fingerprints were analyzed by a new multilocus sequence typing (MLST scheme. This gene-based analysis was compared to genomic characteristics determined by pulsed-field gel electrophoresis (PFGE. METHODOLOGY/PRINCIPAL FINDINGS: The MLST analysis revealed that L. lactis subsp. lactis is essentially clonal with infrequent intra- and intergenic recombination; also, despite its taxonomical classification as a subspecies, it displays a genetic diversity as substantial as that within several other bacterial species. Genome-based analysis revealed a genome size variability of 20%, a value typical of bacteria inhabiting different ecological niches, and that suggests a large pan-genome for this subspecies. However, the genomic characteristics (macrorestriction pattern, genome or chromosome size, plasmid content did not correlate to the MLST-based phylogeny, with strains from the same sequence type (ST differing by up to 230 kb in genome size. CONCLUSION/SIGNIFICANCE: The gene-based phylogeny was not fully consistent with the traditional classification into dairy and non-dairy strains but supported a new classification based on ecological separation between "environmental" strains, the main contributors to the genetic diversity within the subspecies, and "domesticated" strains, subject to recent genetic bottlenecks. Comparison between gene- and genome-based analyses revealed little relationship between core and dispensable genome phylogenies, indicating that clonal diversification and phenotypic variability of the "domesticated" strains essentially arose through substantial genomic flux within the dispensable

  6. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  7. Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation

    Science.gov (United States)

    Li, Tao; Zhang, Zhao-jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-nan; Liu, Hong-yan; Wang, Hong-dan; Wu, Dong; Lou, Gui-yu; Wang, Xin; Zhang, Chao-yang; Liao, Shi-xiu

    2017-01-01

    Abstract Background: Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. Methods: First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. Results: MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. Conclusion: The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. PMID:29390271

  8. Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation: A case report.

    Science.gov (United States)

    Li, Tao; Zhang, Zhao-Jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-Nan; Liu, Hong-Yan; Wang, Hong-Dan; Wu, Dong; Lou, Gui-Yu; Wang, Xin; Zhang, Chao-Yang; Liao, Shi-Xiu

    2017-12-01

    Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  9. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  10. Analysis of SSH library of rice variety Aganni reveals candidate gall midge resistance genes.

    Science.gov (United States)

    Divya, Dhanasekar; Singh, Y Tunginba; Nair, Suresh; Bentur, J S

    2016-03-01

    The Asian rice gall midge, Orseolia oryzae, is a serious insect pest causing extensive yield loss. Interaction between the gall midge and rice genotypes is known to be on a gene-for-gene basis. Here, we report molecular basis of HR- (hypersensitive reaction-negative) type of resistance in Aganni (an indica rice variety possessing gall midge resistance gene Gm8) through the construction and analysis of a suppressive subtraction hybridization (SSH) cDNA library. In all, 2,800 positive clones were sequenced and analyzed. The high-quality ESTs were assembled into 448 non-redundant gene sequences. Homology search with the NCBI databases, using BlastX and BlastN, revealed that 73% of the clones showed homology to genes with known function and majority of ESTs belonged to the gene ontology category 'biological process'. Validation of 27 putative candidate gall midge resistance genes through real-time PCR, following gall midge infestation, in contrasting parents and their derived pre-NILs (near isogenic lines) revealed induction of specific genes related to defense and metabolism. Interestingly, four genes, belonging to families of leucine-rich repeat (LRR), heat shock protein (HSP), pathogenesis related protein (PR), and NAC domain-containing protein, implicated in conferring HR+ type of resistance, were found to be up-regulated in Aganni. Two of the reactive oxygen intermediates (ROI)-scavenging-enzyme-coding genes Cytosolic Ascorbate Peroxidase1, 2 (OsAPx1 and OsAPx2) were found up-regulated in Aganni in incompatible interaction possibly suppressing HR. We suggest that Aganni has a deviant form of inducible, salicylic acid (SA)-mediated resistance but without HR.

  11. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  12. History of a prolific family: the Hes/Hey-related genes of the annelid Platynereis.

    Science.gov (United States)

    Gazave, Eve; Guillou, Aurélien; Balavoine, Guillaume

    2014-01-01

    The Hes superfamily or Hes/Hey-related genes encompass a variety of metazoan-specific bHLH genes, with somewhat fuzzy phylogenetic relationships. Hes superfamily members are involved in a variety of major developmental mechanisms in metazoans, notably in neurogenesis and segmentation processes, in which they often act as direct effector genes of the Notch signaling pathway. We have investigated the molecular and functional evolution of the Hes superfamily in metazoans using the lophotrochozoan Platynereis dumerilii as model. Our phylogenetic analyses of more than 200 Metazoan Hes/Hey-related genes revealed the presence of five families, three of them (Hes, Hey and Helt) being pan-metazoan. Those families were likely composed of a unique representative in the last common metazoan ancestor. The evolution of the Hes family was shaped by many independent lineage specific tandem duplication events. The expression patterns of 13 of the 15 Hes/Hey-related genes in Platynereis indicate a broad functional diversification. Nevertheless, a majority of these genes are involved in two crucial developmental processes in annelids: neurogenesis and segmentation, resembling functions highlighted in other animal models. Combining phylogenetic and expression data, our study suggests an unusual evolutionary history for the Hes superfamily. An ancestral multifunctional annelid Hes gene may have undergone multiples rounds of duplication-degeneration-complementation processes in the lineage leading to Platynereis, each gene copies ensuring their maintenance in the genome by subfunctionalisation. Similar but independent waves of duplications are at the origin of the multiplicity of Hes genes in other metazoan lineages.

  13. CRISPR loci reveal networks of gene exchange in archaea

    Directory of Open Access Journals (Sweden)

    Brodt Avital

    2011-12-01

    Full Text Available Abstract Background CRISPR (Clustered, Regularly, Interspaced, Short, Palindromic Repeats loci provide prokaryotes with an adaptive immunity against viruses and other mobile genetic elements. CRISPR arrays can be transcribed and processed into small crRNA molecules, which are then used by the cell to target the foreign nucleic acid. Since spacers are accumulated by active CRISPR/Cas systems, the sequences of these spacers provide a record of the past "infection history" of the organism. Results Here we analyzed all currently known spacers present in archaeal genomes and identified their source by DNA similarity. While nearly 50% of archaeal spacers matched mobile genetic elements, such as plasmids or viruses, several others matched chromosomal genes of other organisms, primarily other archaea. Thus, networks of gene exchange between archaeal species were revealed by the spacer analysis, including many cases of inter-genus and inter-species gene transfer events. Spacers that recognize viral sequences tend to be located further away from the leader sequence, implying that there exists a selective pressure for their retention. Conclusions CRISPR spacers provide direct evidence for extensive gene exchange in archaea, especially within genera, and support the current dogma where the primary role of the CRISPR/Cas system is anti-viral and anti-plasmid defense. Open peer review This article was reviewed by: Profs. W. Ford Doolittle, John van der Oost, Christa Schleper (nominated by board member Prof. J Peter Gogarten

  14. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  15. High polymorphism in big defensin gene expression reveals presence-absence gene variability (PAV) in the oyster Crassostrea gigas.

    Science.gov (United States)

    Rosa, Rafael D; Alonso, Pascal; Santini, Adrien; Vergnes, Agnès; Bachère, Evelyne

    2015-04-01

    We report here the first evidence in an invertebrate, the oyster Crassostrea gigas, of a phenomenon of Presence-Absence Variation (PAV) affecting immune-related genes. We previously evidenced an extraordinary interindividual variability in the basal mRNA abundances of oyster immune genes including those coding for a family of antimicrobial peptides, the big defensins (Cg-BigDef). Cg-BigDef is a diverse family composed of three members: Cg-BigDef1 to -3. Here, we show that besides a high polymorphism in Cg-BigDef mRNA expression, not all individual oysters express simultaneously the three Cg-BigDefs. Moreover, in numerous individuals, no expression of Cg-BigDefs could be detected. Further investigation at the genomic level revealed that in individuals in which the transcription of one or all Cg-BigDefs was absent the corresponding Cg-bigdef gene was missing. In our experiments, no correlation was found between Cg-bigdef PAV and oyster capacity to survive Vibrio infections. The discovery of P-A immune genes in oysters leads to reconsider the role that the immune system plays in the individual adaptation to survive environmental, biotic and abiotic stresses. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. The Echinococcus granulosus antigen B gene family comprises at least 10 unique genes in five subclasses which are differentially expressed.

    Science.gov (United States)

    Zhang, Wenbao; Li, Jun; Jones, Malcolm K; Zhang, Zhuangzhi; Zhao, Li; Blair, David; McManus, Donald Peter

    2010-08-10

    Antigen B (EgAgB) is a major protein produced by the metacestode cyst of Echinococcus granulosus, the causative agent of cystic hydatid disease. This protein has been shown to play an important role in modulating host immune responses, although its precise biological function still remains unknown. It is generally accepted that EgAgB is comprised of a gene family of five subfamilies which are highly polymorphic, but the actual number of genes present is unknown. Based on published sequences for the family, we designed specific primers for each subfamily and used PCR to amplify them from genomic DNA isolated from individual mature adult worms (MAW) taken from an experimentally infected dog in China and individual larval protoscoleces (PSC) excised from a single hydatid cyst taken from an Australian kangaroo. We then used real-time PCR to measure expression of each of the genes comprising the five EgAgB subfamilies in all life-cycle stages including the oncosphere (ONC). Based on sequence alignment analysis, we found that the EgAgB gene family comprises at least ten unique genes. Each of the genes was identical in both larval and adult E. granulosus isolates collected from two geographical areas (different continents). DNA alignment comparisons with EgAgB sequences deposited in GenBank databases showed that each gene in the gene family is highly conserved within E. granulosus, which contradicts previous studies claiming significant variation and polymorphism in EgAgB. Quantitative PCR analysis revealed that the genes were differentially expressed in different life-cycle stages of E. granulosus with EgAgB3 expressed predominantly in all stages. These findings are fundamental for determining the expression and the biological function of antigen B.

  17. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  18. Multiple lineage specific expansions within the guanylyl cyclase gene family

    Directory of Open Access Journals (Sweden)

    O'Halloran Damien M

    2006-03-01

    , which have occurred within the GC gene family during metazoan evolution. Our phylogenetic analyses reveal that the rGC and sGC multi-domain proteins evolved early in eumetazoan evolution. Subsequent gene duplications, tissue specific expression patterns and lineage specific expansions resulted in the evolution of new networks of interaction and new biological functions associated with the maintenance of organismal complexity and homeostasis.

  19. Novel candidate genes important for asthma and hypertension comorbidity revealed from associative gene networks.

    Science.gov (United States)

    Saik, Olga V; Demenkov, Pavel S; Ivanisenko, Timofey V; Bragina, Elena Yu; Freidin, Maxim B; Goncharova, Irina A; Dosenko, Victor E; Zolotareva, Olga I; Hofestaedt, Ralf; Lavrik, Inna N; Rogaev, Evgeny I; Ivanisenko, Vladimir A

    2018-02-13

    Hypertension and bronchial asthma are a major issue for people's health. As of 2014, approximately one billion adults, or ~ 22% of the world population, have had hypertension. As of 2011, 235-330 million people globally have been affected by asthma and approximately 250,000-345,000 people have died each year from the disease. The development of the effective treatment therapies against these diseases is complicated by their comorbidity features. This is often a major problem in diagnosis and their treatment. Hence, in this study the bioinformatical methodology for the analysis of the comorbidity of these two diseases have been developed. As such, the search for candidate genes related to the comorbid conditions of asthma and hypertension can help in elucidating the molecular mechanisms underlying the comorbid condition of these two diseases, and can also be useful for genotyping and identifying new drug targets. Using ANDSystem, the reconstruction and analysis of gene networks associated with asthma and hypertension was carried out. The gene network of asthma included 755 genes/proteins and 62,603 interactions, while the gene network of hypertension - 713 genes/proteins and 45,479 interactions. Two hundred and five genes/proteins and 9638 interactions were shared between asthma and hypertension. An approach for ranking genes implicated in the comorbid condition of two diseases was proposed. The approach is based on nine criteria for ranking genes by their importance, including standard methods of gene prioritization (Endeavor, ToppGene) as well as original criteria that take into account the characteristics of an associative gene network and the presence of known polymorphisms in the analysed genes. According to the proposed approach, the genes IL10, TLR4, and CAT had the highest priority in the development of comorbidity of these two diseases. Additionally, it was revealed that the list of top genes is enriched with apoptotic genes and genes involved in

  20. A novel gene mutation in a family with X-linked retinoschisis.

    Science.gov (United States)

    Lai, Yu-Hung; Huang, Shun-Ping; Chen, Shee-Ping; Hu, Pei-Shin; Lin, Shu-Fung; Sheu, Min-Muh; Wang, Hwei-Zu; Tsai, Rong Kung

    2015-09-01

    To describe the clinical characteristics of a Taiwanese family with X-linked retinoschisis (XLRS) and to investigate the molecular genetics of a novel mutation in the retinoschisin 1 (RS1) gene. A total of 15 participants in this XLRS family were analyzed. Complete ophthalmic examinations and fundus photography were performed on 15 family members. These tests identified five affected males and two female carriers. Blood samples were collected, and genomic DNA was extracted. Best-corrected visual acuity, optical coherence tomography (OCT), electroretinogram (ERG), and direct DNA sequence analysis of the RS1 gene were performed on 15 family members. Five affected males, with visual acuity ranging from 0.2 to 0.7, had macular schisis and abnormal retinal pigment epithelium pigmentation. The mixed scotopic ERG "b" wave was more reduced than the "a" wave. OCT revealed typical microcystic schisis cavities within the macula area. Direct DNA sequence analysis revealed a single base pair deletion, 97delT, in all the affected individuals. This deletion resulted in a frameshift mutation of the RS1 gene, causing protein truncation. The affected males in this family showed moderately decreased visual acuity and dysfunction in both cone cells and phototransduction. We identified a novel RS1 (97delT) mutation in a Taiwanese family with XLRS. This finding expands the RS1 mutation spectrum and may help to further understand the molecular pathogenesis of XLRS. Copyright © 2014. Published by Elsevier B.V.

  1. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  2. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  3. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. An EST-based analysis identifies new genes and reveals distinctive gene expression features of Coffea arabica and Coffea canephora

    Directory of Open Access Journals (Sweden)

    Colombo Carlos A

    2011-02-01

    Full Text Available Abstract Background Coffee is one of the world's most important crops; it is consumed worldwide and plays a significant role in the economy of producing countries. Coffea arabica and C. canephora are responsible for 70 and 30% of commercial production, respectively. C. arabica is an allotetraploid from a recent hybridization of the diploid species, C. canephora and C. eugenioides. C. arabica has lower genetic diversity and results in a higher quality beverage than C. canephora. Research initiatives have been launched to produce genomic and transcriptomic data about Coffea spp. as a strategy to improve breeding efficiency. Results Assembling the expressed sequence tags (ESTs of C. arabica and C. canephora produced by the Brazilian Coffee Genome Project and the Nestlé-Cornell Consortium revealed 32,007 clusters of C. arabica and 16,665 clusters of C. canephora. We detected different GC3 profiles between these species that are related to their genome structure and mating system. BLAST analysis revealed similarities between coffee and grape (Vitis vinifera genes. Using KA/KS analysis, we identified coffee genes under purifying and positive selection. Protein domain and gene ontology analyses suggested differences between Coffea spp. data, mainly in relation to complex sugar synthases and nucleotide binding proteins. OrthoMCL was used to identify specific and prevalent coffee protein families when compared to five other plant species. Among the interesting families annotated are new cystatins, glycine-rich proteins and RALF-like peptides. Hierarchical clustering was used to independently group C. arabica and C. canephora expression clusters according to expression data extracted from EST libraries, resulting in the identification of differentially expressed genes. Based on these results, we emphasize gene annotation and discuss plant defenses, abiotic stress and cup quality-related functional categories. Conclusion We present the first comprehensive

  5. Novel mutations including deletions of the entire OFD1 gene in 30 families with type 1 orofaciodigital syndrome

    DEFF Research Database (Denmark)

    Bisschoff, Izak J; Zeschnigk, Christine; Horn, Denise

    2013-01-01

    have studied 55 sporadic and six familial cases of suspected OFD1. Comprehensive mutation analysis in OFD1 revealed mutations in 37 female patients from 30 families; 22 mutations have not been previously described including two heterozygous deletions spanning OFD1 and neighbouring genes. Analysis...

  6. Genome-wide identification and expression profiling of auxin response factor (ARF gene family in maize

    Directory of Open Access Journals (Sweden)

    Zhang Yirong

    2011-04-01

    Full Text Available Abstract Background Auxin signaling is vital for plant growth and development, and plays important role in apical dominance, tropic response, lateral root formation, vascular differentiation, embryo patterning and shoot elongation. Auxin Response Factors (ARFs are the transcription factors that regulate the expression of auxin responsive genes. The ARF genes are represented by a large multigene family in plants. The first draft of full maize genome assembly has recently been released, however, to our knowledge, the ARF gene family from maize (ZmARF genes has not been characterized in detail. Results In this study, 31 maize (Zea mays L. genes that encode ARF proteins were identified in maize genome. It was shown that maize ARF genes fall into related sister pairs and chromosomal mapping revealed that duplication of ZmARFs was associated with the chromosomal block duplications. As expected, duplication of some ZmARFs showed a conserved intron/exon structure, whereas some others were more divergent, suggesting the possibility of functional diversification for these genes. Out of these 31 ZmARF genes, 14 possess auxin-responsive element in their promoter region, among which 7 appear to show small or negligible response to exogenous auxin. The 18 ZmARF genes were predicted to be the potential targets of small RNAs. Transgenic analysis revealed that increased miR167 level could cause degradation of transcripts of six potential targets (ZmARF3, 9, 16, 18, 22 and 30. The expressions of maize ARF genes are responsive to exogenous auxin treatment. Dynamic expression patterns of ZmARF genes were observed in different stages of embryo development. Conclusions Maize ARF gene family is expanded (31 genes as compared to Arabidopsis (23 genes and rice (25 genes. The expression of these genes in maize is regulated by auxin and small RNAs. Dynamic expression patterns of ZmARF genes in embryo at different stages were detected which suggest that maize ARF genes may

  7. High genetic abundance of Rpi-blb2/Mi-1.2/Cami gene family in Solanaceae.

    Science.gov (United States)

    Zhao, Lina; Zhang, Qijun; Gao, Rongchao; Yang, Sihai; Liu, Haoxuan; Zhang, Xiaohui

    2015-09-30

    Three NBS-LRR genes, Rpi-blb2, Mi-1.2, and Cami, constitute a very special plant resistance gene family. These genes confer resistance against 4 distantly related pathogen species in 3 different Solanaceae hosts. To characterize this noted resistance, we conducted a series of studies on this gene family. First, homologs of this gene family were identified in the pepper, tomato and potato genomes. This revealed a large variation in copy number within this gene family among species and a great divergence was found both between and within species. To gain more information pertaining to gene resistance within this family, 121 LRR regions were cloned in 16 different wild/cultivated potato accessions. Again, frequent copy number variations and a high level of divergence between homolog were observed common among accessions. The divergence within species was so high that it reaches the level of divergence between species. Also, frequent frameshift mutations and abundant gene conversion events were identified in these LRR regions. Our findings suggest that this family harbors an unusually high level of genetic abundance, making it of particular interest. Together with other reported examples, our study also provides evidence that multi-resistance is a common trait in R gene families like this.

  8. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  9. A gene family expressing a host-protective antigen of Echinococcus granulosus.

    Science.gov (United States)

    Chow, C; Gauci, C G; Cowman, A F; Lightowlers, M W

    2001-11-01

    Echinococcus granulosus causes cystic hydatidosis in humans. A recombinant antigen vaccine has been developed, for use in the parasite's natural animal intermediate hosts, that may provide a new tool for control of hydatid disease transmission. The antigen, designated EG95, is encoded by a cDNA the features of which indicate it to be an incomplete copy of the associated mRNA. Characterisation of the gene(s) encoding the antigen was undertaken in order to enable subsequent study of genetic variability in the gene and associated protein in different parasite isolates. Southern hybridisation studies of E. granulosus genomic DNA probed with the eg95 cDNA revealed that the gene belonged to a gene family. DNA sequence analysis of cloned genomic fragments indicated that the gene family consists of at least seven members, one of which is a pseudogene. The gene having identity with the eg95 cDNA was cloned and sequenced, and the full length mRNA characterised. Genomic sequence and structure of the eg95 gene family members are highly conserved with respect to the gene encoding EG95. Four eg95-related genes are predicted to express an identical EG95 protein and all four were shown to be expressed in the oncosphere life-cycle stage. The full length EG95 protein has a predicted molecular mass of 16.9 kDa, secretory signal sequence, carboxy-terminal glycosylphosphatidylinositol hydrophobic anchor motif and a fibronectin type III domain. PCR amplification conditions were established which allow gene-specific characterisation of the eg95 gene in E. granulosus isolates from different host species and geographical locations.

  10. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  11. Computational integration of homolog and pathway gene module expression reveals general stemness signatures.

    Directory of Open Access Journals (Sweden)

    Martina Koeva

    Full Text Available The stemness hypothesis states that all stem cells use common mechanisms to regulate self-renewal and multi-lineage potential. However, gene expression meta-analyses at the single gene level have failed to identify a significant number of genes selectively expressed by a broad range of stem cell types. We hypothesized that stemness may be regulated by modules of homologs. While the expression of any single gene within a module may vary from one stem cell type to the next, it is possible that the expression of the module as a whole is required so that the expression of different, yet functionally-synonymous, homologs is needed in different stem cells. Thus, we developed a computational method to test for stem cell-specific gene expression patterns from a comprehensive collection of 49 murine datasets covering 12 different stem cell types. We identified 40 individual genes and 224 stemness modules with reproducible and specific up-regulation across multiple stem cell types. The stemness modules included families regulating chromatin remodeling, DNA repair, and Wnt signaling. Strikingly, the majority of modules represent evolutionarily related homologs. Moreover, a score based on the discovered modules could accurately distinguish stem cell-like populations from other cell types in both normal and cancer tissues. This scoring system revealed that both mouse and human metastatic populations exhibit higher stemness indices than non-metastatic populations, providing further evidence for a stem cell-driven component underlying the transformation to metastatic disease.

  12. The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system

    Science.gov (United States)

    Vonk, Freek J.; Casewell, Nicholas R.; Henkel, Christiaan V.; Heimberg, Alysha M.; Jansen, Hans J.; McCleary, Ryan J. R.; Kerkkamp, Harald M. E.; Vos, Rutger A.; Guerreiro, Isabel; Calvete, Juan J.; Wüster, Wolfgang; Woods, Anthony E.; Logan, Jessica M.; Harrison, Robert A.; Castoe, Todd A.; de Koning, A. P. Jason; Pollock, David D.; Yandell, Mark; Calderon, Diego; Renjifo, Camila; Currier, Rachel B.; Salgado, David; Pla, Davinia; Sanz, Libia; Hyder, Asad S.; Ribeiro, José M. C.; Arntzen, Jan W.; van den Thillart, Guido E. E. J. M.; Boetzer, Marten; Pirovano, Walter; Dirks, Ron P.; Spaink, Herman P.; Duboule, Denis; McGlinn, Edwina; Kini, R. Manjunatha; Richardson, Michael K.

    2013-01-01

    Snakes are limbless predators, and many species use venom to help overpower relatively large, agile prey. Snake venoms are complex protein mixtures encoded by several multilocus gene families that function synergistically to cause incapacitation. To examine venom evolution, we sequenced and interrogated the genome of a venomous snake, the king cobra (Ophiophagus hannah), and compared it, together with our unique transcriptome, microRNA, and proteome datasets from this species, with data from other vertebrates. In contrast to the platypus, the only other venomous vertebrate with a sequenced genome, we find that snake toxin genes evolve through several distinct co-option mechanisms and exhibit surprisingly variable levels of gene duplication and directional selection that correlate with their functional importance in prey capture. The enigmatic accessory venom gland shows a very different pattern of toxin gene expression from the main venom gland and seems to have recruited toxin-like lectin genes repeatedly for new nontoxic functions. In addition, tissue-specific microRNA analyses suggested the co-option of core genetic regulatory components of the venom secretory system from a pancreatic origin. Although the king cobra is limbless, we recovered coding sequences for all Hox genes involved in amniote limb development, with the exception of Hoxd12. Our results provide a unique view of the origin and evolution of snake venom and reveal multiple genome-level adaptive responses to natural selection in this complex biological weapon system. More generally, they provide insight into mechanisms of protein evolution under strong selection. PMID:24297900

  13. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Genome-wide identification and characterization of the Dof gene family in Medicago truncatula.

    Science.gov (United States)

    Shu, Y J; Song, L L; Zhang, J; Liu, Y; Guo, C H

    2015-09-09

    The DNA-binding one zinc finger (Dof) family is a classic plant-specific zinc-finger transcription factor family, which is involved in many important processes, including seed maturation and germination, plant growth and development, and light responses. Investigation of the Medicago truncatula genome revealed 42 putative Dof genes, each of which holds one Dof domain. These genes were classified into four groups based on phylogenetic analysis, which are similar to the groups reported for Arabidopsis and rice. Based on genome duplication analysis, it was found that the MtDof genes were distributed on all chromosomes and had expanded through tandem gene duplication and segmental duplication events. Two main duplication regions were identified, one from tandem duplication and another from segmental duplication. By analyzing high-throughput sequencing data from M. truncatula, we found that most of the MtDof genes showed specific expression patterns in different tissues. According to cis-regulatory element analysis, these MtDof genes are regulated by different cis-acting motifs, which are important for the functional divergence of the MtDof genes in different processes. Thus, using genome-wide identification, evolution, and expression pattern analysis of the Dof genes in M. truncatula, our study provides valuable information for understanding the potential function of the Dof genes in regulating the growth and development of M. truncatula.

  15. Genetic diversity of bitter taste receptor gene family in Sichuan ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 95; Issue 3. Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE ...

  16. Genomewide analysis of the chitinase gene family in Populus ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... Jiangsu Key Laboratory for Poplar Germplasm Enhancement and Variety Improvement,. Nanjing Forestry University, Nanjing 210037, People's Republic of China. [Jiang C., Huang R. F., Song J. L., Huang M. R. and Xu L. A. 2013 Genomewide analysis of the chitinase gene family in Populus trichocarpa.

  17. Domain combination of the vertebrate-like TLR gene family ...

    Indian Academy of Sciences (India)

    Domain combination of the vertebrate-like TLR gene family: implications for their origin and evolution. Baojun Wu, Tianxiao Huan, Jing Gong, Pin Zhou and Zengliang Bai. J. Genet. 90, 401–408. Figure 1. Unrooted NJ phylogenetic tree of P-Toll proteins from selected phyla based on TIR domains. The putative V-TIR protein.

  18. CCT family genes in cereal crops: A current overview

    Directory of Open Access Journals (Sweden)

    Yipu Li

    2017-12-01

    Full Text Available Control of flowering time is crucial for reproductive success of cereal crops, and has a significant impact on grain yield as well as adaptation to diverse environmental conditions. Plants integrate signals from both environmental cues and endogenous regulatory pathways to fine-tune flowering time. The CCT domain originally described to a 43-amino acid sequence at the C-terminus of three Arabidopsis proteins, namely CONSTANS (CO, CO-LIKE, and TIMING OF CAB1 (TOC1. The CCT domain-containing genes (CCT genes, which encode transcription co-factors, are the major genetic determinants that modulate flowering time, and this in turn enables plants to effectively expand their territory to take advantage of favorable habitats. Moreover, certain CCT genes have pleiotropic effects on morphological traits and confer resistance/tolerance to biotic/abiotic stresses. CCT genes can be classified into three families, namely COL (CONSTANS-like, PRR (Pseudo-response regulator, and CMF (CCT motif family, based on their non-CCT domains. During domestication, natural and artificial selection resulted in reduced nucleotide diversity of CCT genes in modern cultivated cereals than their wild types. Here, we review the features and functions of CCT genes in cereal crops and propose future research to focus on CCT genes and their utilization in crop breeding. Keywords: CCT domain, Flowering time, Photoperiod, Pleiotropy

  19. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs

    Science.gov (United States)

    2010-01-01

    Background Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Results Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. Conclusions We have uncovered major changes in gene

  20. Genome-wide analysis of gene expression in primate taste buds reveals links to diverse processes.

    Directory of Open Access Journals (Sweden)

    Peter Hevezi

    Full Text Available Efforts to unravel the mechanisms underlying taste sensation (gustation have largely focused on rodents. Here we present the first comprehensive characterization of gene expression in primate taste buds. Our findings reveal unique new insights into the biology of taste buds. We generated a taste bud gene expression database using laser capture microdissection (LCM procured fungiform (FG and circumvallate (CV taste buds from primates. We also used LCM to collect the top and bottom portions of CV taste buds. Affymetrix genome wide arrays were used to analyze gene expression in all samples. Known taste receptors are preferentially expressed in the top portion of taste buds. Genes associated with the cell cycle and stem cells are preferentially expressed in the bottom portion of taste buds, suggesting that precursor cells are located there. Several chemokines including CXCL14 and CXCL8 are among the highest expressed genes in taste buds, indicating that immune system related processes are active in taste buds. Several genes expressed specifically in endocrine glands including growth hormone releasing hormone and its receptor are also strongly expressed in taste buds, suggesting a link between metabolism and taste. Cell type-specific expression of transcription factors and signaling molecules involved in cell fate, including KIT, reveals the taste bud as an active site of cell regeneration, differentiation, and development. IKBKAP, a gene mutated in familial dysautonomia, a disease that results in loss of taste buds, is expressed in taste cells that communicate with afferent nerve fibers via synaptic transmission. This database highlights the power of LCM coupled with transcriptional profiling to dissect the molecular composition of normal tissues, represents the most comprehensive molecular analysis of primate taste buds to date, and provides a foundation for further studies in diverse aspects of taste biology.

  1. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  2. Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.

    Directory of Open Access Journals (Sweden)

    Giselle Sek Suan Nah

    Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.

  3. Sequence analysis of candidate genes in two Roma families with severe tooth agenesis

    Directory of Open Access Journals (Sweden)

    Gabriková Dana

    2016-01-01

    Full Text Available Selective tooth agenesis is the most common congenital disorder affecting the formation of dentition in humans. Both its forms (hypodontia and more severe oligodontia can be found either in isolated form and they can be associated with systemic condition (syndromic tooth agenesis. In addition to previously known genes (PAX9, MSX1 and AXIN2 mutations in EDA, EDARADD and WNT10 gene were recently found to be involved in isolated forms of tooth agenesis. The objective of this study was to characterize the phenotype of affected members in two large families of Roma origin segregating severe isolated tooth agenesis with very variable phenotype and to perform mutation analysis of seven genes with aim to find causal mutation. 26 family members were clinically examined and coding regions of seven genes (MSX1, PAX9, AXIN2, EDA, EDAR, EDARADD and WNT10A were sequenced. With exclusion of third molars, average number of missing teeth was 8.2 ± 4.9 in family 1 and 7.1 ± 2.3 in family 2. The most frequently missing teeth were maxillary lateral incisors and first premolars and mandibular central incisors. Sequencing revealed four potentially damaging variants (g.Ala40Gly in MSX1, g.Ala240Pro in PAX9, g.Pro50Ser in AXIN2 and g.Met9Ile in EDARADD; however, none of them was present in all affected family members. Variable phenotype in both families examined in this study is in favour of heterogeneous genetic cause of tooth agenesis in these families: possible interaction of several defected genes, sequence variants in regulatory regions and additional environmental factors is assumed.

  4. Global analysis of the MATE gene family of metabolite transporters in tomato.

    Science.gov (United States)

    Santos, Adolfo Luís Dos; Chaves-Silva, Samuel; Yang, Lina; Maia, Lucas Gontijo Silva; Chalfun-Júnior, Antonio; Sinharoy, Senjuti; Zhao, Jian; Benedito, Vagner Augusto

    2017-10-30

    Species in the Solanaceae family are known for producing plethora of specialized metabolites. In addition to biosynthesis pathways, a full comprehension of secondary metabolism must also take into account the transport and subcellular compartmentalization of substances. Here, we examined the MATE (Multidrug and Toxic Compound Extrusion, or Multi-Antimicrobial Extrusion) gene family in the tomato (Solanum lycopersicum) genome with the objective of better understanding the transport of secondary metabolites in this model species. MATE membrane effluxers encompass an ancient gene family of secondary transporters present in all kingdoms of life, but with a remarkable expansion in plants. They mediate the transport of primary and secondary metabolites using the proton motive force through several membrane systems of the cell. We identified 67 genes coding for MATE transporters in the tomato genome, 33 of which are expressed constitutively whereas 34 are expressed in specific cell types or environmental conditions. Synteny analyses revealed bona fide paralogs and Arabidopsis orthologs. Co-expression analysis between MATE and regulatory genes revealed 78 positive and 8 negative strong associations (ρ≥|0.8|). We found no evidence of MATE transporters belonging to known metabolic gene clusters in tomato. Altogether, our expression data, phylogenetic analyses, and synteny study provide strong evidence of functional homologies between MATE genes of tomato and Arabidopsis thaliana. Our co-expression study revealed potential transcriptional regulators of MATE genes that warrant further investigation. This work sets the stage for genome-wide functional analyses of MATE transporters in tomato and other Solanaceae species of economic relevance.

  5. TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Mutai Hideki

    2003-06-01

    Full Text Available Abstract Background Mutations in the transmembrane cochlear expressed gene 1 (TMC1 cause deafness in human and mouse. Mutations in two homologous genes, EVER1 and EVER2 increase the susceptibility to infection with certain human papillomaviruses resulting in high risk of skin carcinoma. Here we report that TMC1, EVER1 and EVER2 (now TMC6 and TMC8 belong to a larger novel gene family, which is named TMC for trans membrane channel-like gene family. Results Using a combination of iterative database searches and reverse transcriptase-polymerase chain reaction (RT-PCR experiments we assembled contigs for cDNA encoding human, murine, puffer fish, and invertebrate TMC proteins. TMC proteins of individual species can be grouped into three subfamilies A, B, and C. Vertebrates have eight TMC genes. The majority of murine TMC transcripts are expressed in most organs; some transcripts, however, in particular the three subfamily A members are rare and more restrictively expressed. Conclusion The eight vertebrate TMC genes are evolutionary conserved and encode proteins that form three subfamilies. Invertebrate TMC proteins can also be categorized into these three subfamilies. All TMC genes encode transmembrane proteins with intracellular amino- and carboxyl-termini and at least eight membrane-spanning domains. We speculate that the TMC proteins constitute a novel group of ion channels, transporters, or modifiers of such.

  6. Genome-Wide Identification, Characterization and Expression Analysis of the TCP Gene Family in Prunus mume.

    Science.gov (United States)

    Zhou, Yuzhen; Xu, Zongda; Zhao, Kai; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang

    2016-01-01

    TCP proteins, belonging to a plant-specific transcription factors family, are known to have great functions in plant development, especially flower and leaf development. However, there is little information about this gene family in Prunus mume, which is widely cultivated in China as an ornamental and fruit tree. Here a genome-wide analysis of TCP genes was performed to explore their evolution in P. mume. Nineteen PmTCPs were identified and three of them contained putative miR319 target sites. Phylogenetic and comprehensive bioinformatics analyses of these genes revealed that different types of TCP genes had undergone different evolutionary processes and the genes in the same clade had similar chromosomal location, gene structure, and conserved domains. Expression analysis of these PmTCPs indicated that there were diverse expression patterns among different clades. Most TCP genes were predominantly expressed in flower, leaf, and stem, and showed high expression levels in the different stages of flower bud differentiation, especially in petal formation stage and gametophyte development. Genes in TCP-P subfamily had main roles in both flower development and gametophyte development. The CIN genes in double petal cultivars might have key roles in the formation of petal, while they were correlated with gametophyte development in the single petal cultivar. The CYC/TB1 type genes were highly detected in the formation of petal and pistil. The less-complex flower types of P. mume might result from the fact that there were only two CYC type genes present in P. mume and a lack of CYC2 genes to control the identity of flower types. These results lay the foundation for further study on the functions of TCP genes during flower development.

  7. Identification and analysis of the germin-like gene family in soybean

    Directory of Open Access Journals (Sweden)

    Wang Xiang-Jing

    2010-11-01

    Full Text Available Abstract Background Germin and germin-like proteins constitute a ubiquitous family of plant proteins. A role of some family members in defense against pathogen attack had been proposed based on gene regulation studies and transgenic approaches. Soybean (G. max L. Merr. germin genes had not been characterized at the molecular and functional levels. Results In the present study, twenty-one germin gene members in soybean cultivar 'Maple Arrow' (partial resistance to Sclerotinia stem rot of soybean were identified by in silico identification and RACE method (GmGER 1 to GmGER 21. A genome-wide analyses of these germin-like protein genes using a bioinformatics approach showed that the genes located on chromosomes 8, 1, 15, 20, 16, 19, 7, 3 and 10, on which more disease-resistant genes were located on. Sequence comparison revealed that the genes encoded three germin-like domains. The phylogenetic relationships and functional diversity of the germin gene family of soybean were analyzed among diverse genera. The expression of the GmGER genes treated with exogenous IAA suggested that GmGER genes might be regulated by auxin. Transgenic tobacco that expressed the GmGER 9 gene exhibited high tolerance to the salt stress. In addition, the GmGER mRNA increased transiently at darkness and peaked at a time that corresponded approximately to the critical night length. The mRNA did not accumulate significantly under the constant light condition, and did not change greatly under the SD and LD treatments. Conclusions This study provides a complex overview of the GmGER genes in soybean. Phylogenetic analysis suggested that the germin and germin-like genes of the plant species that had been founded might be evolved by independent gene duplication events. The experiment indicated that germin genes exhibited diverse expression patterns during soybean development. The different time courses of the mRNAs accumulation of GmGER genes in soybean leaves appeared to have a

  8. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

  9. Gene expression of NOX family members and their clinical significance in hepatocellular carcinoma.

    Science.gov (United States)

    Eun, Hyuk Soo; Cho, Sang Yeon; Joo, Jong Seok; Kang, Sun Hyung; Moon, Hee Seok; Lee, Eaum Seok; Kim, Seok Hyun; Lee, Byung Seok

    2017-09-11

    Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase complex-derived reactive oxygen species (ROS) promote chronic liver inflammation and remodeling that can drive hepatocellular carcinoma development. The role of NOX expression in hepatocellular carcinoma (HCC) has been partially investigated; however, the clinical relevance of collective or individual NOX family member expression for HCC survival remains unclear. Here, we obtained NOX mRNA expression data for 377 HCC samples and 21 normal liver controls from the TCGA data portal and performed Kaplan-Meier survival, gene ontology functional enrichment, and gene set enrichment analyses. Although most NOX genes exhibited little change, some were significantly induced in HCC compared to that in normal controls. In addition, HCC survival analyses indicated better overall survival in patients with high NOX4 and DUOX1 expression, whereas patients with high NOX1/2/5 expression showed poor prognoses. Gene-neighbour and gene set enrichment analyses revealed that NOX1/2/5 were strongly correlated with genes associated with cancer cell survival and metastasis, whereas increased NOX4 and DUOX1 expression was associated with genes that inhibit tumour progression. On the basis of these data, NOX family gene expression analysis could be a predictor of survival and identify putative therapeutic targets in HCC.

  10. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  11. Molecular analysis of the VSX1 gene in familial keratoconus

    Science.gov (United States)

    Liskova, Petra; Ebenezer, Neil D.; Hysi, Pirro G.; Gwilliam, Rhian; El-Ashry, Mohamed F.; Moodaley, Lalitha C.; Hau, Scott; Twa, Michael; Tuft, Stephen J.; Bhatacharya, Shomi S.

    2017-01-01

    Purpose To evaluate the role of the visual system homeobox gene 1 (VSX1) in the pathogenesis of familial keratoconus. Methods Families with two or more individuals with keratoconus were recruited and their members examined. The coding region and intron-exon junctions of the VSX1 gene were sequenced in affected individuals. In cases where there were possible pathogenic changes, segregation within the pedigree was analyzed. Meta analysis of reports on an association of p.D144E change with keratoconus phenotype was performed. Results Probands from a panel of 85 apparently unrelated keratoconus families were included. Eleven sequence variants were observed, including the previously reported c.432C>G (p.D144E) change and two novel intronic single nucleotide polymorphisms. However, these three changes did not cosegregate with the disease phenotype. Conclusions We excluded the c.432C>G sequence alteration as the direct cause of the disease. Lack of possibly pathogenic VSX1 sequence variants in the familial panel suggests that involvement of this gene in the pathogenesis of keratoconus is likely to be confined to a small number of pedigrees, at least in the population studied. PMID:17960127

  12. Metagenomic analysis reveals that bacteriophages are reservoirs of antibiotic resistance genes.

    Science.gov (United States)

    Subirats, Jéssica; Sànchez-Melsió, Alexandre; Borrego, Carles M; Balcázar, José Luis; Simonet, Pascal

    2016-08-01

    A metagenomics approach was applied to explore the presence of antibiotic resistance genes (ARGs) in bacteriophages from hospital wastewater. Metagenomic analysis showed that most phage sequences affiliated to the order Caudovirales, comprising the tailed phage families Podoviridae, Siphoviridae and Myoviridae. Moreover, the relative abundance of ARGs in the phage DNA fraction (0.26%) was higher than in the bacterial DNA fraction (0.18%). These differences were particularly evident for genes encoding ATP-binding cassette (ABC) and resistance-nodulation-cell division (RND) proteins, phosphotransferases, β-lactamases and plasmid-mediated quinolone resistance. Analysis of assembled contigs also revealed that blaOXA-10, blaOXA-58 and blaOXA-24 genes belonging to class D β-lactamases as well as a novel blaTEM (98.9% sequence similarity to the blaTEM-1 gene) belonging to class A β-lactamases were detected in a higher proportion in phage DNA. Although preliminary, these findings corroborate the role of bacteriophages as reservoirs of resistance genes and thus highlight the necessity to include them in future studies on the emergence and spread of antibiotic resistance in the environment. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  13. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  14. Autosomal Dominant PTH Gene Signal Sequence Mutation in a Family With Familial Isolated Hypoparathyroidism.

    Science.gov (United States)

    Cinque, Luigia; Sparaneo, Angelo; Penta, Laura; Mencarelli, Amedea; Rogaia, Daniela; Esposito, Susanna; Fabrizio, Federico Pio; Baorda, Filomena; Verrotti, Alberto; Falorni, Alberto; Stangoni, Gabriela; Hendy, Geoffrey N; Guarnieri, Vito; Prontera, Paolo

    2017-11-01

    Familial isolated hypoparathyroidism (FIH) is a genetically heterogeneous disorder due to mutations of the calcium-sensing receptor (CASR), glial cells missing-2 (GCM2), guanine nucleotide binding protein α11 (GNA11), or parathyroid hormone (PTH) genes. Thus far, only four cases with homozygous and two cases with heterozygous mutations in the PTH gene have been reported. To clinically describe an FIH family and identify and characterize the causal gene mutation. Genomic DNA of the family members was subjected to CASR, GCM2, GNA11, and PTH gene mutational analysis. Functional assays were performed on the variant identified. Six subjects of a three-generation FIH family with three affected individuals having severe hypocalcemia and inappropriately low serum PTH. No mutations were detected in the CASR, GCM2, and GNA11 genes. A heterozygous variant that segregated with the disease was identified in PTH gene exon 2 (c.41T>A; p.M14K). This missense variant, in the hydrophobic core of the signal sequence, was predicted in silico to impair cleavage of preproPTH to proPTH. Functional assays in HEK293 cells demonstrated much greater retention intracellularly but impaired secretion into the medium of the M14K mutant relative to wild type. The addition of the pharmacological chaperone, 4-phenylbutyric acid, led to a reduction of cellular retention and increased accumulation in the cell medium of the M14K mutant. We report a heterozygous PTH mutation in an FIH family and demonstrate accumulation of the mutant intracellularly and its impaired secretion. An accurate genetic diagnosis in such hypoparathyroid patients is critical for appropriate treatment and genetic counseling. Copyright © 2017 Endocrine Society

  15. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  16. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  17. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  18. Genome wide in silico characterization of Dof gene families of pigeonpea (Cajanus cajan (L) Millsp.).

    Science.gov (United States)

    Malviya, N; Gupta, S; Singh, V K; Yadav, M K; Bisht, N C; Sarangi, B K; Yadav, D

    2015-02-01

    The DNA binding with One Finger (Dof) protein is a plant specific transcription factor involved in the regulation of wide range of processes. The analysis of whole genome sequence of pigeonpea has identified 38 putative Dof genes (CcDof) distributed on 8 chromosomes. A total of 17 out of 38 CcDof genes were found to be intronless. A comprehensive in silico characterization of CcDof gene family including the gene structure, chromosome location, protein motif, phylogeny, gene duplication and functional divergence has been attempted. The phylogenetic analysis resulted in 3 major clusters with closely related members in phylogenetic tree revealed common motif distribution. The in silico cis-regulatory element analysis revealed functional diversity with predominance of light responsive and stress responsive elements indicating the possibility of these CcDof genes to be associated with photoperiodic control and biotic and abiotic stress. The duplication pattern showed that tandem duplication is predominant over segmental duplication events. The comparative phylogenetic analysis of these Dof proteins along with 78 soybean, 36 Arabidopsis and 30 rice Dof proteins revealed 7 major clusters. Several groups of orthologs and paralogs were identified based on phylogenetic tree constructed. Our study provides useful information for functional characterization of CcDof genes.

  19. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  1. Gender in childhood obesity: family environment, hormones, and genes.

    Science.gov (United States)

    Wisniewski, Amy B; Chernausek, Steven D

    2009-01-01

    The prevalence of obesity among children in the United States represents a pool of latent morbidity. Though the prevalence of obesity has increased in both boys and girls, the causes and consequences differ between the sexes. Thus, interventions proposed to treat and prevent childhood obesity will need to account for these differences. This review examines gender differences in the presentation of obesity in children and describes environmental, hormonal, and genetic factors that contribute to observed gender differences. A search of peer-reviewed, published literature was performed with PubMed for articles published from January 1974 through October 2008. Search terms used were obesity, sex, gender, hormones, family environment, body composition, adiposity, and genes. Studies of children aged 0 to 18 years were included, and only articles published in English were reviewed for consideration. Articles that illustrated gender differences in either the presentation or underlying mechanisms of obesity in children were reviewed for content, and their bibliographies were used to identify other relevant literature. Gender differences in childhood obesity have been understudied partially because of how we define the categories of overweight and obesity. Close examination of studies revealed that gender differences were common, both before and during puberty. Boys and girls differ in body composition, patterns of weight gain, hormone biology, and the susceptibility to certain social, ethnic, genetic, and environmental factors. Our understanding of how gender differences in pediatric populations relate to the pathogenesis of obesity and the subsequent development of associated comorbid states is critical to developing and implementing both therapeutic and preventive interventions.

  2. Genome-wide analysis of the sox family in the calcareous sponge Sycon ciliatum: multiple genes with unique expression patterns

    Directory of Open Access Journals (Sweden)

    Fortunato Sofia

    2012-07-01

    Full Text Available Abstract Background Sox genes are HMG-domain containing transcription factors with important roles in developmental processes in animals; many of them appear to have conserved functions among eumetazoans. Demosponges have fewer Sox genes than eumetazoans, but their roles remain unclear. The aim of this study is to gain insight into the early evolutionary history of the Sox gene family by identification and expression analysis of Sox genes in the calcareous sponge Sycon ciliatum. Methods Calcaronean Sox related sequences were retrieved by searching recently generated genomic and transcriptome sequence resources and analyzed using variety of phylogenetic methods and identification of conserved motifs. Expression was studied by whole mount in situ hybridization. Results We have identified seven Sox genes and four Sox-related genes in the complete genome of Sycon ciliatum. Phylogenetic and conserved motif analyses showed that five of Sycon Sox genes represent groups B, C, E, and F present in cnidarians and bilaterians. Two additional genes are classified as Sox genes but cannot be assigned to specific subfamilies, and four genes are more similar to Sox genes than to other HMG-containing genes. Thus, the repertoire of Sox genes is larger in this representative of calcareous sponges than in the demosponge Amphimedon queenslandica. It remains unclear whether this is due to the expansion of the gene family in Sycon or a secondary reduction in the Amphimedon genome. In situ hybridization of Sycon Sox genes revealed a variety of expression patterns during embryogenesis and in specific cell types of adult sponges. Conclusions In this study, we describe a large family of Sox genes in Sycon ciliatum with dynamic expression patterns, indicating that Sox genes are regulators in development and cell type determination in sponges, as observed in higher animals. The revealed differences between demosponge and calcisponge Sox genes repertoire highlight the need to

  3. Comparative analysis of genome-wide Mlo gene family in Cajanus cajan and Phaseolus vulgaris.

    Science.gov (United States)

    Deshmukh, Reena; Singh, V K; Singh, B D

    2016-04-01

    The Mlo gene was discovered in barley because the mutant 'mlo' allele conferred broad-spectrum, non-race-specific resistance to powdery mildew caused by Blumeria graminis f. sp. hordei. The Mlo genes also play important roles in growth and development of plants, and in responses to biotic and abiotic stresses. The Mlo gene family has been characterized in several crop species, but only a single legume species, soybean (Glycine max L.), has been investigated so far. The present report describes in silico identification of 18 CcMlo and 20 PvMlo genes in the important legume crops Cajanus cajan (L.) Millsp. and Phaseolus vulgaris L., respectively. In silico analysis of gene organization, protein properties and conserved domains revealed that the C. cajan and P. vulgaris Mlo gene paralogs are more divergent from each other than from their orthologous pairs. The comparative phylogenetic analysis classified CcMlo and PvMlo genes into three major clades. A comparative analysis of CcMlo and PvMlo proteins with the G. max Mlo proteins indicated close association of one CcMlo, one PvMlo with two GmMlo genes, indicating that there was no further expansion of the Mlo gene family after the separation of these species. Thus, most of the diploid species of eudicots might be expected to contain 15-20 Mlo genes. The genes CcMlo12 and 14, and PvMlo11 and 12 are predicted to participate in powdery mildew resistance. If this prediction were verified, these genes could be targeted by TILLING or CRISPR to isolate powdery mildew resistant mutants.

  4. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  5. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae.

    Directory of Open Access Journals (Sweden)

    David Behringer

    Full Text Available Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.. A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2 are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings.

  6. Differential Gene Expression Reveals Candidate Genes for Drought Stress Response in Abies alba (Pinaceae).

    Science.gov (United States)

    Behringer, David; Zimmermann, Heike; Ziegenhagen, Birgit; Liepelt, Sascha

    2015-01-01

    Increasing drought periods as a result of global climate change pose a threat to many tree species by possibly outpacing their adaptive capabilities. Revealing the genetic basis of drought stress response is therefore implemental for future conservation strategies and risk assessment. Access to informative genomic regions is however challenging, especially for conifers, partially due to their large genomes, which puts constraints on the feasibility of whole genome scans. Candidate genes offer a valuable tool to reduce the complexity of the analysis and the amount of sequencing work and costs. For this study we combined an improved drought stress phenotyping of needles via a novel terahertz water monitoring technique with Massive Analysis of cDNA Ends to identify candidate genes for drought stress response in European silver fir (Abies alba Mill.). A pooled cDNA library was constructed from the cotyledons of six drought stressed and six well-watered silver fir seedlings, respectively. Differential expression analyses of these libraries revealed 296 candidate genes for drought stress response in silver fir (247 up- and 49 down-regulated) of which a subset was validated by RT-qPCR of the twelve individual cotyledons. A majority of these genes code for currently uncharacterized proteins and hint on new genomic resources to be explored in conifers. Furthermore, we could show that some traditional reference genes from model plant species (GAPDH and eIF4A2) are not suitable for differential analysis and we propose a new reference gene, TPC1, for drought stress expression profiling in needles of conifer seedlings.

  7. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  8. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  9. Signature gene expression reveals novel clues to the molecular mechanisms of dimorphic transition in Penicillium marneffei.

    Directory of Open Access Journals (Sweden)

    Ence Yang

    2014-10-01

    Full Text Available Systemic dimorphic fungi cause more than one million new infections each year, ranking them among the significant public health challenges currently encountered. Penicillium marneffei is a systemic dimorphic fungus endemic to Southeast Asia. The temperature-dependent dimorphic phase transition between mycelium and yeast is considered crucial for the pathogenicity and transmission of P. marneffei, but the underlying mechanisms are still poorly understood. Here, we re-sequenced P. marneffei strain PM1 using multiple sequencing platforms and assembled the genome using hybrid genome assembly. We determined gene expression levels using RNA sequencing at the mycelial and yeast phases of P. marneffei, as well as during phase transition. We classified 2,718 genes with variable expression across conditions into 14 distinct groups, each marked by a signature expression pattern implicated at a certain stage in the dimorphic life cycle. Genes with the same expression patterns tend to be clustered together on the genome, suggesting orchestrated regulations of the transcriptional activities of neighboring genes. Using qRT-PCR, we validated expression levels of all genes in one of clusters highly expressed during the yeast-to-mycelium transition. These included madsA, a gene encoding MADS-box transcription factor whose gene family is exclusively expanded in P. marneffei. Over-expression of madsA drove P. marneffei to undergo mycelial growth at 37°C, a condition that restricts the wild-type in the yeast phase. Furthermore, analyses of signature expression patterns suggested diverse roles of secreted proteins at different developmental stages and the potential importance of non-coding RNAs in mycelium-to-yeast transition. We also showed that RNA structural transition in response to temperature changes may be related to the control of thermal dimorphism. Together, our findings have revealed multiple molecular mechanisms that may underlie the dimorphic transition

  10. Characterization of the biocontrol activity of pseudomonas fluorescens strain X reveals novel genes regulated by glucose.

    Directory of Open Access Journals (Sweden)

    Gerasimos F Kremmydas

    Full Text Available Pseudomonas fluorescens strain X, a bacterial isolate from the rhizosphere of bean seedlings, has the ability to suppress damping-off caused by the oomycete Pythium ultimum. To determine the genes controlling the biocontrol activity of strain X, transposon mutagenesis, sequencing and complementation was performed. Results indicate that, biocontrol ability of this isolate is attributed to gcd gene encoding glucose dehydrogenase, genes encoding its co-enzyme pyrroloquinoline quinone (PQQ, and two genes (sup5 and sup6 which seem to be organized in a putative operon. This operon (named supX consists of five genes, one of which encodes a non-ribosomal peptide synthase. A unique binding site for a GntR-type transcriptional factor is localized upstream of the supX putative operon. Synteny comparison of the genes in supX revealed that they are common in the genus Pseudomonas, but with a low degree of similarity. supX shows high similarity only to the mangotoxin operon of Ps. syringae pv. syringae UMAF0158. Quantitative real-time PCR analysis indicated that transcription of supX is strongly reduced in the gcd and PQQ-minus mutants of Ps. fluorescens strain X. On the contrary, transcription of supX in the wild type is enhanced by glucose and transcription levels that appear to be higher during the stationary phase. Gcd, which uses PQQ as a cofactor, catalyses the oxidation of glucose to gluconic acid, which controls the activity of the GntR family of transcriptional factors. The genes in the supX putative operon have not been implicated before in the biocontrol of plant pathogens by pseudomonads. They are involved in the biosynthesis of an antimicrobial compound by Ps. fluorescens strain X and their transcription is controlled by glucose, possibly through the activity of a GntR-type transcriptional factor binding upstream of this putative operon.

  11. Genome-wide analysis of UDP-glycosyltransferase super family in Brassica rapa and Brassica oleracea reveals its evolutionary history and functional characterization.

    Science.gov (United States)

    Yu, Jingyin; Hu, Fan; Dossa, Komivi; Wang, Zhaokai; Ke, Tao

    2017-06-23

    Glycosyltransferases comprise a highly divergent and polyphyletic multigene family that is involved in widespread modification of plant secondary metabolites in a process called glycosylation. According to conserved domains identified in their amino acid sequences, these glycosyltransferases can be classified into a single UDP-glycosyltransferase (UGT) 1 superfamily. We performed genome-wide comparative analysis of UGT genes to trace evolutionary history in algae, bryophytes, pteridophytes, and angiosperms; then, we further investigated the expansion mechanisms and function characterization of UGT gene families in Brassica rapa and Brassica oleracea. Using Hidden Markov Model search, we identified 3, 21, 140, 200, 115, 147, and 147 UGTs in Chlamydomonas reinhardtii, Physcomitrella patens, Selaginella moellendorffii, Oryza sativa, Arabidopsis thaliana, B. rapa, and B. oleracea, respectively. Phylogenetic analysis revealed that UGT80 gene family is an ancient gene family, which is shared by all plants and UGT74 gene family is shared by ferns and angiosperms, but the remaining UGT gene families were shared by angiosperms. In dicot lineage, UGTs among three species were classified into three subgroups containing 3, 6, and 12 UGT gene families. Analysis of chromosomal distribution indicates that 98.6 and 71.4% of UGTs were located on B. rapa and B. oleracea pseudo-molecules, respectively. Expansion mechanism analyses uncovered that whole genome duplication event exerted larger influence than tandem duplication on expansion of UGT gene families in B. rapa, and B. oleracea. Analysis of selection forces of UGT orthologous gene pairs in B. rapa, and B. oleracea compared to A. thaliana suggested that orthologous genes in B. rapa, and B. oleracea have undergone negative selection, but there were no significant differences between A. thaliana -B. rapa and A. thaliana -B. oleracea lineages. Our comparisons of expression profiling illustrated that UGTs in B. rapa performed more

  12. A Novel Family of Magnesium Transport Genes in Arabidopsis

    Science.gov (United States)

    Li, Legong; Tutone, Ana F.; Drummond, Revel S. M.; Gardner, Richard C.; Luan, Sheng

    2001-01-01

    Magnesium (Mg2+) is the most abundant divalent cation in plant cells and plays a critical role in many physiological processes. We describe the identification of a 10-member Arabidopsis gene family (AtMGT) encoding putative Mg2+ transport proteins. Most members of the AtMGT family are expressed in a range of Arabidopsis tissues. One member of this family, AtMGT1, functionally complemented a bacterial mutant lacking Mg2+ transport capability. A second member, AtMGT10, complemented a yeast mutant defective in Mg2+ uptake and increased the cellular Mg2+ content of starved cells threefold during a 60-min uptake period. 63Ni tracer studies in bacteria showed that AtMGT1 has highest affinity for Mg2+ but may also be capable of transporting several other divalent cations, including Ni2+, Co2+, Fe2+, Mn2+, and Cu2+. However, the concentrations required for transport of these other cations are beyond normal physiological ranges. Both AtMGT1 and AtMGT10 are highly sensitive to Al3+ inhibition, providing potential molecular targets for Al3+ toxicity in plants. Using green fluorescence protein as a reporter, we localized AtMGT1 protein to the plasma membrane in Arabidopsis plants. We suggest that the AtMGT gene family encodes a Mg2+ transport system in higher plants. PMID:11752386

  13. Genetic diversity of bitter taste receptor gene family in Sichuan ...

    Indian Academy of Sciences (India)

    Abstract. The sense of bitter taste plays a critical role in animals as it can help them to avoid intake of toxic and harmful substances. Previous research had revealed that chicken has only three bitter taste receptor genes (Tas2r1, Tas2r2 and Tas2r7). To better understand the genetic polymorphisms and importance of bitter ...

  14. Gene expression profiling reveals new potential players of gonad differentiation in the chicken embryo.

    Directory of Open Access Journals (Sweden)

    Gwenn-Aël Carré

    Full Text Available BACKGROUND: In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s involved in gonad differentiation is still incomplete. METHODOLOGY/PRINCIPAL FINDINGS: With the aim of improving characterization of the molecular pathway(s involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. CONCLUSION/SIGNIFICANCE: This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors

  15. Gene Expression Profiling Reveals New Potential Players of Gonad Differentiation in the Chicken Embryo

    Science.gov (United States)

    Carré, Gwenn-Aël; Couty, Isabelle; Hennequet-Antier, Christelle; Govoroun, Marina S.

    2011-01-01

    Background In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s) involved in gonad differentiation is still incomplete. Methodology/Principal Findings With the aim of improving characterization of the molecular pathway(s) involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein) and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. Conclusion/Significance This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors of chicken gonad

  16. PlantTribes: a gene and gene family resource for comparative genomics in plants

    Science.gov (United States)

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2008-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, called tribes, using three clustering stringencies (low, medium and high). For all tribes, we have generated protein and DNA alignments and maximum-likelihood phylogenetic trees. A parallel database of microarray experimental results is linked to the genes, which lets researchers identify groups of related genes and their expression patterns. Unified nomenclatures were developed, and tribes can be related to traditional gene families and conserved domain identifiers. SuperTribes, constructed through a second iteration of MCL clustering, connect distant, but potentially related gene clusters. The global classification of nearly 200 000 plant proteins was used as a scaffold for sorting ∼4 million additional cDNA sequences from over 200 plant species. All data and analyses are accessible through a flexible interface allowing users to explore the classification, to place query sequences within the classification, and to download results for further study. PMID:18073194

  17. Expression profile analysis of silkworm P450 family genes after phoxim induction.

    Science.gov (United States)

    Li, Fanchi; Ni, Min; Zhang, Hua; Wang, Binbin; Xu, Kaizun; Tian, Jianghai; Hu, Jingsheng; Shen, Weide; Li, Bing

    2015-07-01

    Silkworm (Bombyx mori) is an important economic insect and a model species for Lepidopteran. Each year, O,O-diethyl O-(alpha-cyanobenzylideneamino) phosphorothioate (phoxim) pesticide poisoning in China results in huge economic losses in sericulture. Silkworm fat body is the main organ for nutrient storage, energy supply, intermediary metabolism, and detoxification. Microarray analysis of silkworm Cytochrome P450 detoxification enzyme genes revealed that all tested P450 4 (CYP4) family genes are expressed in the fat body. Quantitative Real-time PCR (QRT-PCR) was used to detect the expression of CYP4 family genes in silkworm fat body 0, 24, 48, and 72 h after phoxim exposure. The expression levels of silkworm molting hormone synthesis-related genes started to change 24 h after phoxim exposure, with those of CYP302A1, CYP306A1, and CYP314A1 being elevated by 1.38-, 1.33-, and 2.10-fold, respectively. The CYP18A1 gene that participates in steroid hormone inactivation and the CYP15C1 gene that participates in the epoxidation during the synthesis of juvenile hormone (JH) from methyl farnesoate (MF) were increased by 3.85- and 7.82-fold, respectively. Phylogenetic analysis indicated that these endogenous hormone metabolism-related genes belong to CYP mito clan and clan 2, and that phoxim exposure may affect silkworm development and metamorphosis. The CYP4, CYP6, and CYP9 families all showed some degrees of increases in gene expression; among them, CYP49A1, CYP4L6, CYP6AB4, CYP9G3, CYP9A19, and CYP9A22's transcription levels were significantly upregulated to 12.77-, 2.64-, 2.42-, 4.06-, 3.32-, and 2.98-fold, respectively, of the control levels. In the fat body, CYP49A1, CYP6AB4, CYP9A19, and CYP9A22 were constantly expressed at high levels after 24, 48, and 72 h of phoxim treatments; according to phylogenetic analysis, these genes belong to detoxification-related clan 3 and clan 4 CYP families. These genes may participate in the metabolism of phoxim in silkworm fat

  18. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  19. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  20. Repair of DNA damage in the human metallothionein gene family

    International Nuclear Information System (INIS)

    Leadon, S.A.; Snowden, M.M.

    1987-01-01

    In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab

  1. Analysis of a cAMP regulated coactivator family reveals an alternative phosphorylation motif for AMPK family members.

    Science.gov (United States)

    Sonntag, Tim; Moresco, James J; Vaughan, Joan M; Matsumura, Shigenobu; Yates, John R; Montminy, Marc

    2017-01-01

    The second messenger cAMP stimulates cellular gene expression via the PKA-mediated phosphorylation of the transcription factor CREB and through dephosphorylation of the cAMP-responsive transcriptional coactivators (CRTCs). Under basal conditions, CRTCs are phosphorylated by members of the AMPK family of Ser/Thr kinases and sequestered in the cytoplasm via a phosphorylation-dependent association with 14-3-3 proteins. Increases in cAMP promote the dephosphorylation and nuclear translocation of CRTCs, where they bind to CREB and stimulate relevant target genes. Although they share considerable sequence homology, members of the CRTC family exert non-overlapping effects on cellular gene expression through as yet unidentified mechanisms. Here we show that the three CRTCs exhibit distinct patterns of 14-3-3 binding at three conserved sites corresponding to S70, S171, and S275 (in CRTC2). S171 functions as the gatekeeper site for 14-3-3 binding; it acts cooperatively with S275 in stabilizing this interaction following its phosphorylation by the cAMP-responsive SIK and the cAMP-nonresponsive MARK kinases. Although S171 contains a consensus recognition site for phosphorylation by AMPK family members, S70 and S275 carry variant motifs (MNTGGS275LPDL), lacking basic residues that are otherwise critical for SIK/MARK recognition as well as 14-3-3 binding. Correspondingly, the activity of these motifs differs between CRTC family members. As the variant (SLPDL) motif is present and apparently phosphorylated in other mammalian proteins, our studies suggest that the regulation of cellular targets by AMPK family members is more extensive than previously appreciated.

  2. Exome sequencing reveals VCP mutations as a cause of familial ALS

    OpenAIRE

    Johnson, Janel O.; Mandrioli, Jessica; Benatar, Michael; Abramzon, Yevgeniya; Van Deerlin, Vivianna M.; Trojanowski, John Q.; Gibbs, J Raphael; Brunetti, Maura; Gronka, Susan; Wuu, Joanne; Ding, Jinhui; McCluskey, Leo; Martinez-Lage, Maria; Falcone, Dana; Hernandez, Dena G.

    2010-01-01

    Using exome sequencing, we identified a p.R191Q amino acid change in the valosin-containing protein (VCP) gene in an Italian family with autosomal dominantly inherited amyotrophic lateral sclerosis (ALS). Mutations in VCP have previously been identified in families with Inclusion Body Myopathy, Paget’s disease and Frontotemporal Dementia (IBMPFD). Screening of VCP in a cohort of 210 familial ALS cases and 78 autopsy-proven ALS cases identified four additional mutations including a p.R155H mut...

  3. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    2007-03-29

    Mar 29, 2007 ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa. Abstract. Elucidation of genome sequence provides an excellent platform to understand detailed complexity of the various gene families. Hsp100 is an important family of chaperones in diverse living systems. There are eight putative gene loci ...

  4. Comparative transcriptome analysis reveals differentially expressed genes associated with sex expression in garden asparagus (Asparagus officinalis).

    Science.gov (United States)

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gao, Wu-Jun

    2017-08-22

    Garden asparagus (Asparagus officinalis) is a highly valuable vegetable crop of commercial and nutritional interest. It is also commonly used to investigate the mechanisms of sex determination and differentiation in plants. However, the sex expression mechanisms in asparagus remain poorly understood. De novo transcriptome sequencing via Illumina paired-end sequencing revealed more than 26 billion bases of high-quality sequence data from male and female asparagus flower buds. A total of 72,626 unigenes with an average length of 979 bp were assembled. In comparative transcriptome analysis, 4876 differentially expressed genes (DEGs) were identified in the possible sex-determining stage of female and male/supermale flower buds. Of these DEGs, 433, including 285 male/supermale-biased and 149 female-biased genes, were annotated as flower related. Of the male/supermale-biased flower-related genes, 102 were probably involved in anther development. In addition, 43 DEGs implicated in hormone response and biosynthesis putatively associated with sex expression and reproduction were discovered. Moreover, 128 transcription factor (TF)-related genes belonging to various families were found to be differentially expressed, and this finding implied the essential roles of TF in sex determination or differentiation in asparagus. Correlation analysis indicated that miRNA-DEG pairs were also implicated in asparagus sexual development. Our study identified a large number of DEGs involved in the sex expression and reproduction of asparagus, including known genes participating in plant reproduction, plant hormone signaling, TF encoding, and genes with unclear functions. We also found that miRNAs might be involved in the sex differentiation process. Our study could provide a valuable basis for further investigations on the regulatory networks of sex determination and differentiation in asparagus and facilitate further genetic and genomic studies on this dioecious species.

  5. Genome-Wide Analysis and Characterization of Aux/IAA Family Genes in Brassica rapa.

    Science.gov (United States)

    Paul, Parameswari; Dhandapani, Vignesh; Rameneni, Jana Jeevan; Li, Xiaonan; Sivanandhan, Ganesan; Choi, Su Ryun; Pang, Wenxing; Im, Subin; Lim, Yong Pyo

    2016-01-01

    Auxins are the key players in plant growth development involving leaf formation, phototropism, root, fruit and embryo development. Auxin/Indole-3-Acetic Acid (Aux/IAA) are early auxin response genes noted as transcriptional repressors in plant auxin signaling. However, many studies focus on Aux/ARF gene families and much less is known about the Aux/IAA gene family in Brassica rapa (B. rapa). Here we performed a comprehensive genome-wide analysis and identified 55 Aux/IAA genes in B. rapa using four conserved motifs of Aux/IAA family (PF02309). Chromosomal mapping of the B. rapa Aux/IAA (BrIAA) genes facilitated understanding cluster rearrangement of the crucifer building blocks in the genome. Phylogenetic analysis of BrIAA with Arabidopsis thaliana, Oryza sativa and Zea mays identified 51 sister pairs including 15 same species (BrIAA-BrIAA) and 36 cross species (BrIAA-AtIAA) IAA genes. Among the 55 BrIAA genes, expression of 43 and 45 genes were verified using Genebank B. rapa ESTs and in home developed microarray data from mature leaves of Chiifu and RcBr lines. Despite their huge morphological difference, tissue specific expression analysis of BrIAA genes between the parental lines Chiifu and RcBr showed that the genes followed a similar pattern of expression during leaf development and a different pattern during bud, flower and siliqua development stages. The response of the BrIAA genes to abiotic and auxin stress at different time intervals revealed their involvement in stress response. Single Nucleotide Polymorphisms between IAA genes of reference genome Chiifu and RcBr were focused and identified. Our study examines the scope of conservation and divergence of Aux/IAA genes and their structures in B. rapa. Analyzing the expression and structural variation between two parental lines will significantly contribute to functional genomics of Brassica crops and we belive our study would provide a foundation in understanding the Aux/IAA genes in B. rapa.

  6. Genome-Wide Analysis and Characterization of Aux/IAA Family Genes in Brassica rapa.

    Directory of Open Access Journals (Sweden)

    Parameswari Paul

    Full Text Available Auxins are the key players in plant growth development involving leaf formation, phototropism, root, fruit and embryo development. Auxin/Indole-3-Acetic Acid (Aux/IAA are early auxin response genes noted as transcriptional repressors in plant auxin signaling. However, many studies focus on Aux/ARF gene families and much less is known about the Aux/IAA gene family in Brassica rapa (B. rapa. Here we performed a comprehensive genome-wide analysis and identified 55 Aux/IAA genes in B. rapa using four conserved motifs of Aux/IAA family (PF02309. Chromosomal mapping of the B. rapa Aux/IAA (BrIAA genes facilitated understanding cluster rearrangement of the crucifer building blocks in the genome. Phylogenetic analysis of BrIAA with Arabidopsis thaliana, Oryza sativa and Zea mays identified 51 sister pairs including 15 same species (BrIAA-BrIAA and 36 cross species (BrIAA-AtIAA IAA genes. Among the 55 BrIAA genes, expression of 43 and 45 genes were verified using Genebank B. rapa ESTs and in home developed microarray data from mature leaves of Chiifu and RcBr lines. Despite their huge morphological difference, tissue specific expression analysis of BrIAA genes between the parental lines Chiifu and RcBr showed that the genes followed a similar pattern of expression during leaf development and a different pattern during bud, flower and siliqua development stages. The response of the BrIAA genes to abiotic and auxin stress at different time intervals revealed their involvement in stress response. Single Nucleotide Polymorphisms between IAA genes of reference genome Chiifu and RcBr were focused and identified. Our study examines the scope of conservation and divergence of Aux/IAA genes and their structures in B. rapa. Analyzing the expression and structural variation between two parental lines will significantly contribute to functional genomics of Brassica crops and we belive our study would provide a foundation in understanding the Aux/IAA genes in B. rapa.

  7. A missense mutation in the Ca-sensing receptor gene causes familial autosomal dominant hypoparathyroidism

    Energy Technology Data Exchange (ETDEWEB)

    Perry, Y.M.; Finegold, D.N.; Armitage, M.M. [Univ. of Pittsburgh, PA (United States)] [and others

    1994-09-01

    A large family was identified in which hypoparathyroidism was observed to segregate as an autosomal dominant trait in 3 generations. Linkage analysis using short tandem repeat polymorphisms linked the disease phenotype to chromosomal region 3q13. This region contains a newly identified Ca-sensing receptor (PCAR1) gene. This receptor regulates the secretion of parathyroid hormone from parathyroid cells in response to extracellular ionized Ca concentration ([Ca{sup +2}]). PCR-based single stranded conformational analysis of exonic sequences of the PCAR1 gene revealed an abnormal conformer in exon 3 in affected individuals. Direct sequencing of the amplification product from an affected and an unaffected family member showed an A {yields} G transition at nucleotide 770 of the PCAR1 gene [numbering based on the bovine sequence (Genbank accession number S67307)]. This substitution created a Msp1 restriction site which cosegregated with hypoparathyroidism in this family. This substitution was not observed in unaffected family members, unrelated spouses, or unrelated population controls. This substitution is predicted to result in the replacement of a glutamine residue at amino acid 246 by an arginine residue. The Ca-sensing receptor appears to be a member of the family of seven membrane spanning G-protein linked receptors. The extracellular location of this amino acid substitution appears to produce a gain of function mutation increasing the receptor sensitivity to [Ca{sup +2}] and decreasing the calcium {open_quotes}set point{close_quotes}. This is in contrast to the loss of function mutations observed in the PCAR1 gene in pedigrees with familial hypercalcemic hypocalciuria.

  8. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

    Science.gov (United States)

    Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

    2013-01-01

    Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

  9. Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.

    Science.gov (United States)

    Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang

    2015-06-30

    Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.

  10. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  11. Phylogeny, gene structures, and expression patterns of the ERF gene family in soybean (Glycine max L.)

    Science.gov (United States)

    Zhang, Gaiyun; Chen, Ming; Chen, Xueping; Xu, Zhaoshi; Guan, Shan; Li, Lian-Cheng; Li, Aili; Guo, Jiaming; Mao, Long; Ma, Youzhi

    2008-01-01

    Members of the ERF transcription factor family play important roles in regulating gene expression in response to biotic and abiotic stresses. In soybean (Glycine max L.), however, only a few ERF genes have been studied so far. In this study, 98 unigenes that contained a complete AP2/ERF domain were identified from 63 676 unique sequences in the DFCI Soybean Gene Index database. The phylogeny, gene structures, and putative conserved motifs in soybean ERF proteins were analysed, and compared with those of Arabidopsis and rice. The members of the soybean ERF family were divided into 12 subgroups, similar to the case for Arabidopsis. AP2/ERF domains were conserved among soybean, Arabidopsis, and rice. Outside the AP2/ERF domain, many soybean-specific conserved motifs were detected. Expression analysis showed that nine unigenes belonging to six ERF family subgroups were induced by both biotic/abiotic stresses and hormone treatment, suggesting that they were involved in cross-talk between biotic and abiotic stress-responsive signalling pathways. Overexpression of two full-length genes from two different subgroups enhanced the tolerances to drought, salt stresses, and/or pathogen infection of the tobacco plants. These results will be useful for elucidating ERF gene-associated stress response signalling pathways in soybean. PMID:18832187

  12. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  13. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Directory of Open Access Journals (Sweden)

    Preeti Arya

    Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  14. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  15. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy

    Energy Technology Data Exchange (ETDEWEB)

    Shastry, B.S.; Hartzer, M.K. [Oakland Univ., Rochester, MI (United States); Hejtmancik, J.F. [National Eye Institute, Bethesda, MD (United States)] [and others

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Z{sub max} = 2.1, {theta}{sub max} = 0) and DXS228 (Z{sub max} = 0.5, {theta}{sub max} = 0.11), and this was further confirmed by multipoint analysis with these same markers (Z{sub max} = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie`s disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient. 21 refs., 3 figs., 1 tab.

  16. Integrated genomic analysis suggests MLL3 is a novel candidate susceptibility gene for familial nasopharyngeal carcinoma.

    Science.gov (United States)

    Sasaki, Mark M; Skol, Andrew D; Bao, Riyue; Rhodes, Lindsay V; Chambers, Rachelle; Vokes, Everett E; Cohen, Ezra E W; Onel, Kenan

    2015-08-01

    Little is known about genetic factors associated with nasopharyngeal carcinoma (NPC). To gain insight into NPC etiology, we performed whole exome sequencing on germline and tumor DNA from three closely related family members with NPC. The family was ascertained through the Pediatric Familial Cancer Clinic at The University of Chicago (Chicago, IL). The diagnosis of NPC was confirmed pathologically for each individual. For each sample sequenced, 97.3% of the exome was covered at 5×, with an average depth of 44×. Candidate germline and somatic variants associated with NPC were identified and prioritized using a custom pipeline. We discovered 72 rare deleterious germline variants in 56 genes shared by all three individuals. Of these, only three are in previously identified NPC-associated genes, all of which are located within MLL3, a gene known to be somatically altered in NPC. One variant introduces an early stop codon in MLL3, which predicts complete loss-of-function. Tumor DNA analysis revealed somatic mutations and Epstein-Barr virus (EBV) integration events; none, however, were shared among all three individuals. These data suggest that inherited mutations in MLL3 may have predisposed these three individuals from a single family to develop NPC, and may cooperate with individually acquired somatic mutations or EBV integration events in NPC etiology. Our finding is the first instance of a plausible candidate high penetrance inherited mutation predisposing to NPC. ©2015 American Association for Cancer Research.

  17. Gene expression profiling reveals multiple toxicity endpoints induced by hepatotoxicants

    Energy Technology Data Exchange (ETDEWEB)

    Huang Qihong; Jin Xidong; Gaillard, Elias T.; Knight, Brian L.; Pack, Franklin D.; Stoltz, James H.; Jayadev, Supriya; Blanchard, Kerry T

    2004-05-18

    Microarray technology continues to gain increased acceptance in the drug development process, particularly at the stage of toxicology and safety assessment. In the current study, microarrays were used to investigate gene expression changes associated with hepatotoxicity, the most commonly reported clinical liability with pharmaceutical agents. Acetaminophen, methotrexate, methapyrilene, furan and phenytoin were used as benchmark compounds capable of inducing specific but different types of hepatotoxicity. The goal of the work was to define gene expression profiles capable of distinguishing the different subtypes of hepatotoxicity. Sprague-Dawley rats were orally dosed with acetaminophen (single dose, 4500 mg/kg for 6, 24 and 72 h), methotrexate (1 mg/kg per day for 1, 7 and 14 days), methapyrilene (100 mg/kg per day for 3 and 7 days), furan (40 mg/kg per day for 1, 3, 7 and 14 days) or phenytoin (300 mg/kg per day for 14 days). Hepatic gene expression was assessed using toxicology-specific gene arrays containing 684 target genes or expressed sequence tags (ESTs). Principal component analysis (PCA) of gene expression data was able to provide a clear distinction of each compound, suggesting that gene expression data can be used to discern different hepatotoxic agents and toxicity endpoints. Gene expression data were applied to the multiplicity-adjusted permutation test and significantly changed genes were categorized and correlated to hepatotoxic endpoints. Repression of enzymes involved in lipid oxidation (acyl-CoA dehydrogenase, medium chain, enoyl CoA hydratase, very long-chain acyl-CoA synthetase) were associated with microvesicular lipidosis. Likewise, subsets of genes associated with hepatotocellular necrosis, inflammation, hepatitis, bile duct hyperplasia and fibrosis have been identified. The current study illustrates that expression profiling can be used to: (1) distinguish different hepatotoxic endpoints; (2) predict the development of toxic endpoints; and

  18. Gene expression profiling reveals multiple toxicity endpoints induced by hepatotoxicants

    International Nuclear Information System (INIS)

    Huang Qihong; Jin Xidong; Gaillard, Elias T.; Knight, Brian L.; Pack, Franklin D.; Stoltz, James H.; Jayadev, Supriya; Blanchard, Kerry T.

    2004-01-01

    Microarray technology continues to gain increased acceptance in the drug development process, particularly at the stage of toxicology and safety assessment. In the current study, microarrays were used to investigate gene expression changes associated with hepatotoxicity, the most commonly reported clinical liability with pharmaceutical agents. Acetaminophen, methotrexate, methapyrilene, furan and phenytoin were used as benchmark compounds capable of inducing specific but different types of hepatotoxicity. The goal of the work was to define gene expression profiles capable of distinguishing the different subtypes of hepatotoxicity. Sprague-Dawley rats were orally dosed with acetaminophen (single dose, 4500 mg/kg for 6, 24 and 72 h), methotrexate (1 mg/kg per day for 1, 7 and 14 days), methapyrilene (100 mg/kg per day for 3 and 7 days), furan (40 mg/kg per day for 1, 3, 7 and 14 days) or phenytoin (300 mg/kg per day for 14 days). Hepatic gene expression was assessed using toxicology-specific gene arrays containing 684 target genes or expressed sequence tags (ESTs). Principal component analysis (PCA) of gene expression data was able to provide a clear distinction of each compound, suggesting that gene expression data can be used to discern different hepatotoxic agents and toxicity endpoints. Gene expression data were applied to the multiplicity-adjusted permutation test and significantly changed genes were categorized and correlated to hepatotoxic endpoints. Repression of enzymes involved in lipid oxidation (acyl-CoA dehydrogenase, medium chain, enoyl CoA hydratase, very long-chain acyl-CoA synthetase) were associated with microvesicular lipidosis. Likewise, subsets of genes associated with hepatotocellular necrosis, inflammation, hepatitis, bile duct hyperplasia and fibrosis have been identified. The current study illustrates that expression profiling can be used to: (1) distinguish different hepatotoxic endpoints; (2) predict the development of toxic endpoints; and

  19. Familial adult spinal muscular atrophy associated with the VAPB gene: report of 42 cases in Brazil

    Directory of Open Access Journals (Sweden)

    Victor Kosac

    2013-10-01

    Full Text Available Familial spinal muscular atrophy (FSMA associated with the vesicle-associated membrane protein-associated protein B (VAPB gene is a rare autosomal dominant disease with late onset and slow progression. We studied 10 of 42 patients from 5 families by taking clinical histories and performing physical exams, electrophysiological studies, and genetic tests. All patients presented late onset disease with slow progression characterized by fasciculations, proximal weakness, amyotrophy, and hypoactive deep tendon reflex, except two who exhibited brisk reflex. Two patients showed tongue fasciculations and respiratory insufficiency. Electrophysiological studies revealed patterns of lower motor neuron disease, and genetic testing identified a P56S mutation of the VAPB gene. Although it is a rare motor neuron disease, FSMA with this mutation might be much more prevalent in Brazil than expected, and many cases may be undiagnosed. Genetic exams should be performed whenever it is suspected in Brazil.

  20. Mutation analysis of the AATF gene in breast cancer families

    International Nuclear Information System (INIS)

    Haanpää, Maria; Reiman, Mervi; Nikkilä, Jenni; Erkko, Hannele; Pylkäs, Katri; Winqvist, Robert

    2009-01-01

    About 5-10% of breast cancer is due to inherited disease predisposition. Many previously identified susceptibility factors are involved in the maintenance of genomic integrity. AATF plays an important role in the regulation of gene transcription and cell proliferation. It induces apoptosis by associating with p53. The checkpoint kinases ATM/ATR and CHEK2 interact with and phosphorylate AATF, enhancing its accumulation and stability. Based on its biological function, and direct interaction with several known breast cancer risk factors, AATF is a good candidate gene for being involved in heritable cancer susceptibility. Here we have screened the entire coding region of AATF in affected index cases from 121 Finnish cancer families for germline defects, using conformation sensitive gel electrophoresis and direct sequencing. Altogether seven different sequence changes were observed, one missense variant and six intronic ones. Based on the in silico analyses of these sequence alterations, as well as their occurrence in cases and controls, none of them, however, were predicted to be pathogenic. To our knowledge, this is the first study reporting the mutation screening of the AATF gene in familial breast cancer cases. No evidence for the association with breast cancer was observed

  1. MMACHC gene mutation in familial hypogonadism with neurological symptoms.

    Science.gov (United States)

    Shi, Changhe; Shang, Dandan; Sun, Shilei; Mao, Chengyuan; Qin, Jie; Luo, Haiyang; Shao, Mingwei; Chen, Zhengguang; Liu, Yutao; Liu, Xinjing; Song, Bo; Xu, Yuming

    2015-12-15

    Recent studies have convincingly documented that hypogonadism is a component of various hereditary disorders and is often recognized as an important clinical feature in combination with various neurological symptoms, yet, the causative genes in a few related families are still unknown. High-throughput sequencing has become an efficient method to identify causative genes in related complex hereditary disorders. In this study, we performed exome sequencing in a family presenting hypergonadotropic hypogonadism with neurological presentations of mental retardation, epilepsy, ataxia, and leukodystrophy. After bioinformatic analysis and Sanger sequencing validation, we identified compound heterozygous mutations: c.482G>A (p.R161Q) and c.609G>A (p.W203X) in MMACHC gene in this pedigree. MMACHC was previously confirmed to be responsible for methylmalonic aciduria (MMA) combined with homocystinuria, cblC type (cblC disease), a hereditary vitamin B12 metabolic disorder. Biochemical and gas chromatography-mass spectrometry (GC-MS) examinations in this pedigree further supported the cblC disease diagnosis. These results indicated that hypergonadotropic hypogonadism may be a novel clinical manifestation of cblC disease, but more reports on additional patients are needed to support this hypothesis. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Analysis of phylogenetic and functional diverge in plant nine-cis epoxycarotenoid dioxygenase gene family.

    Science.gov (United States)

    Priya, R; Siva, Ramamoorthy

    2015-07-01

    During different environmental stress conditions, plant growth is regulated by the hormone abscisic acid (an apocarotenoid). In the biosynthesis of abscisic acid, the oxidative cleavage of cis-epoxycarotenoid catalyzed by 9-cis-epoxycarotenoid dioxygenase (NCED) is the crucial step. The NCED genes were isolated in numerous plant species and those genes were phylogenetically investigated to understand the evolution of NCED genes in various plant lineages comprising lycophyte, gymnosperm, dicot and monocot. A total of 93 genes were obtained from 48 plant species to statistically estimate their sequence conservation and functional divergence. Selaginella moellendorffii appeared to be evolutionarily distinct from those of the angiosperms, insisting the substantial influence of natural selection pressure on NCED genes. Further, using exon-intron structure analysis, the gene structures of NCED were found to be conserved across some species. In addition, the substitution rate ratio of non-synonymous (Ka) versus synonymous (Ks) mutations using the Bayesian inference approach, depicted the critical amino acid residues for functional divergence. A significant functional divergence was found between some subgroups through the co-efficient of type-I functional divergence. Our results suggest that the evolution of NCED genes occurred by duplication, diversification and exon intron loss events. The site-specific profile and functional diverge analysis revealed NCED genes might facilitate the tissue-specific functional divergence in NCED sub-families, that could combat different environmental stress conditions aiding plant survival.

  3. Isolation, structural analysis, and expression characteristics of the maize (Zea mays L.) hexokinase gene family.

    Science.gov (United States)

    Zhang, Zhongbao; Zhang, Jiewei; Chen, Yajuan; Li, Ruifen; Wang, Hongzhi; Ding, Liping; Wei, Jianhua

    2014-09-01

    Hexokinases (HXKs, EC 2.7.1.1) play important roles in metabolism, glucose (Glc) signaling, and phosphorylation of Glc and fructose and are ubiquitous in all organisms. Despite their physiological importance, the maize HXK (ZmHXK) genes have not been analyzed systematically. We isolated and characterized nine members of the ZmHXK gene family which were distributed on 3 of the 10 maize chromosomes. A multiple sequence alignment and motif analysis revealed that the maize ZmHXK proteins share three conserved domains. Phylogenetic analysis revealed that the ZmHXK family can be divided into four subfamilies. We identified putative cis-elements in the ZmHXK promoter sequences potentially involved in phytohormone and abiotic stress responses, sugar repression, light and circadian rhythm regulation, Ca(2+) responses, seed development and germination, and CO2-responsive transcriptional activation. To study the functions of maize HXK isoforms, we characterized the expression of the ZmHXK5 and ZmHXK6 genes, which are evolutionarily related to the OsHXK5 and OsHXK6 genes from rice. Analysis of tissue-specific expression patterns using quantitative real time-PCR showed that ZmHXK5 was highly expressed in tassels, while ZmHXK6 was expressed in both tassels and leaves. ZmHXK5 and ZmHXK6 expression levels were upregulated by phytohormones and by abiotic stress.

  4. Molecular genetic analysis of consanguineous families with primary microcephaly identified pathogenic variants in the ASPM gene.

    Science.gov (United States)

    Khan, Muzammil Ahmad; Windpassinger, Christian; Ali, Muhammad Zeeshan; Zubair, Muhammad; Gul, Hadia; Abbas, Safdar; Khan, Saadullah; Badar, Muhammad; Mohammad, Ramzi M; Nawaz, Zafar

    2017-06-01

    Autosomal recessive primary microcephaly is a rare genetic disorder that is characterized by reduced head circumference and a varying degree of intellectual disability. Genetic studies on consanguineous families with primary microcephaly have identified 15 (MCPH) causative genes that include MCPH1, WDR62, CDK5RAP2, CASC5, ASPM, CENPJ, STIL, CEP135, CEP152, ZNF335, PHC1, CDK6, CENPE, SASS6 MFSD2A ANKLE2 and CIT (Khan et al. 2014; Yamamoto et al. 2014; Alakbarzade et al. 2015;Morris-Rosendahl and Kaindl 2015; Basit et al. 2016). Physiologically, most of these MCPH proteins are involved in cell cycle and its regulation. In the present clinical genetic study, we have present two consanguineous Pakistani families segregating primary microcephaly and intellectual disability. These families were ascertained from the Saraiki ethnic part of Khyber-Pakhtunkhwa province in Pakistan. Whole exome sequencing in one family revealed a novel 1-bp deletion NM_018136.4: c.10013delA (p.Asp3338Valfs*2), while the other family showed a previously reported nonsense mutation NM_018136.4: c.9730C>T (rs199422195 (p.Arg3244*)) in ASPM gene. The novel frame-shift mutation (p.Asp3338Valfs*2) in ASPM presumably truncates the protein synthesis that results in loss of armadillo-type fold domain.

  5. Pancreatic cancer genomes reveal aberrations in axon guidance pathway genes.

    Science.gov (United States)

    Biankin, Andrew V; Waddell, Nicola; Kassahn, Karin S; Gingras, Marie-Claude; Muthuswamy, Lakshmi B; Johns, Amber L; Miller, David K; Wilson, Peter J; Patch, Ann-Marie; Wu, Jianmin; Chang, David K; Cowley, Mark J; Gardiner, Brooke B; Song, Sarah; Harliwong, Ivon; Idrisoglu, Senel; Nourse, Craig; Nourbakhsh, Ehsan; Manning, Suzanne; Wani, Shivangi; Gongora, Milena; Pajic, Marina; Scarlett, Christopher J; Gill, Anthony J; Pinho, Andreia V; Rooman, Ilse; Anderson, Matthew; Holmes, Oliver; Leonard, Conrad; Taylor, Darrin; Wood, Scott; Xu, Qinying; Nones, Katia; Fink, J Lynn; Christ, Angelika; Bruxner, Tim; Cloonan, Nicole; Kolle, Gabriel; Newell, Felicity; Pinese, Mark; Mead, R Scott; Humphris, Jeremy L; Kaplan, Warren; Jones, Marc D; Colvin, Emily K; Nagrial, Adnan M; Humphrey, Emily S; Chou, Angela; Chin, Venessa T; Chantrill, Lorraine A; Mawson, Amanda; Samra, Jaswinder S; Kench, James G; Lovell, Jessica A; Daly, Roger J; Merrett, Neil D; Toon, Christopher; Epari, Krishna; Nguyen, Nam Q; Barbour, Andrew; Zeps, Nikolajs; Kakkar, Nipun; Zhao, Fengmei; Wu, Yuan Qing; Wang, Min; Muzny, Donna M; Fisher, William E; Brunicardi, F Charles; Hodges, Sally E; Reid, Jeffrey G; Drummond, Jennifer; Chang, Kyle; Han, Yi; Lewis, Lora R; Dinh, Huyen; Buhay, Christian J; Beck, Timothy; Timms, Lee; Sam, Michelle; Begley, Kimberly; Brown, Andrew; Pai, Deepa; Panchal, Ami; Buchner, Nicholas; De Borja, Richard; Denroche, Robert E; Yung, Christina K; Serra, Stefano; Onetto, Nicole; Mukhopadhyay, Debabrata; Tsao, Ming-Sound; Shaw, Patricia A; Petersen, Gloria M; Gallinger, Steven; Hruban, Ralph H; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Schulick, Richard D; Wolfgang, Christopher L; Morgan, Richard A; Lawlor, Rita T; Capelli, Paola; Corbo, Vincenzo; Scardoni, Maria; Tortora, Giampaolo; Tempero, Margaret A; Mann, Karen M; Jenkins, Nancy A; Perez-Mancera, Pedro A; Adams, David J; Largaespada, David A; Wessels, Lodewyk F A; Rust, Alistair G; Stein, Lincoln D; Tuveson, David A; Copeland, Neal G; Musgrove, Elizabeth A; Scarpa, Aldo; Eshleman, James R; Hudson, Thomas J; Sutherland, Robert L; Wheeler, David A; Pearson, John V; McPherson, John D; Gibbs, Richard A; Grimmond, Sean M

    2012-11-15

    Pancreatic cancer is a highly lethal malignancy with few effective therapies. We performed exome sequencing and copy number analysis to define genomic aberrations in a prospectively accrued clinical cohort (n = 142) of early (stage I and II) sporadic pancreatic ductal adenocarcinoma. Detailed analysis of 99 informative tumours identified substantial heterogeneity with 2,016 non-silent mutations and 1,628 copy-number variations. We define 16 significantly mutated genes, reaffirming known mutations (KRAS, TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A and SF3B1), and uncover novel mutated genes including additional genes involved in chromatin modification (EPC1 and ARID2), DNA damage repair (ATM) and other mechanisms (ZIM2, MAP2K4, NALCN, SLC16A4 and MAGEA6). Integrative analysis with in vitro functional data and animal models provided supportive evidence for potential roles for these genetic aberrations in carcinogenesis. Pathway-based analysis of recurrently mutated genes recapitulated clustering in core signalling pathways in pancreatic ductal adenocarcinoma, and identified new mutated genes in each pathway. We also identified frequent and diverse somatic aberrations in genes described traditionally as embryonic regulators of axon guidance, particularly SLIT/ROBO signalling, which was also evident in murine Sleeping Beauty transposon-mediated somatic mutagenesis models of pancreatic cancer, providing further supportive evidence for the potential involvement of axon guidance genes in pancreatic carcinogenesis.

  6. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  7. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    Directory of Open Access Journals (Sweden)

    Chen Aiqun

    2012-06-01

    Full Text Available Abstract Background In plants, sucrose synthase (Sus is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7 identified from diploid fiber cotton (Gossypium arboreum. Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development.

  8. Mouse Obox and Crxos modulate preimplantation transcriptional profiles revealing similarity between paralogous mouse and human homeobox genes

    Directory of Open Access Journals (Sweden)

    Amy H. Royall

    2018-01-01

    Full Text Available Abstract Background ETCHbox genes are eutherian-specific homeobox genes expressed during preimplantation development at a time when the first cell lineage decisions are being made. The mouse has an unusual repertoire of ETCHbox genes with several gene families lost in evolution and the remaining two, Crxos and Obox, greatly divergent in sequence and number. Each has undergone duplication to give a double homeodomain Crxos locus and a large cluster of over 60 Obox loci. The gene content differences between species raise important questions about how evolution can tolerate loss of genes implicated in key developmental events. Results We find that Crxos internal duplication occurred in the mouse lineage, while Obox duplication was stepwise, generating subgroups with distinct sequence and expression. Ectopic expression of three Obox genes and a Crxos transcript in primary mouse embryonic cells followed by transcriptome sequencing allowed investigation into their functional roles. We find distinct transcriptomic influences for different Obox subgroups and Crxos, including modulation of genes related to zygotic genome activation and preparation for blastocyst formation. Comparison with similar experiments performed using human homeobox genes reveals striking overlap between genes downstream of mouse Crxos and genes downstream of human ARGFX. Conclusions Mouse Crxos and human ARGFX homeobox genes are paralogous rather than orthologous, yet they have evolved to regulate a common set of genes. This suggests there was compensation of function alongside gene loss through co-option of a different locus. Functional compensation by non-orthologous genes with dissimilar sequences is unusual but may indicate underlying distributed robustness. Compensation may be driven by the strong evolutionary pressure for successful early embryo development.

  9. Transcriptome analysis reveals dynamic changes in the gene ...

    Indian Academy of Sciences (India)

    significantly differentially expressed genes that were categorized as cation binding, transcription regulation, metabolic pro- ... are significantly altered in response to potassium deficiency, which can result in physiological and morphological changes in .... Tobacco seedling transcriptome response to low potassium stress.

  10. Network analysis reveals a causal role of mitochondrial gene activity in atherosclerotic lesion formation.

    Science.gov (United States)

    Vilne, Baiba; Skogsberg, Josefin; Foroughi Asl, Hassan; Talukdar, Husain Ahammad; Kessler, Thorsten; Björkegren, Johan L M; Schunkert, Heribert

    2017-12-01

    Mitochondrial damage and augmented production of reactive oxygen species (ROS) may represent an intermediate step by which hypercholesterolemia exacerbates atherosclerotic lesion formation. To test this hypothesis, in mice with severe but genetically reversible hypercholesterolemia (i.e. the so called Reversa mouse model), we performed time-resolved analyses of mitochondrial transcriptome in the aortic arch employing a systems-level network approach. During hypercholesterolemia, we observed a massive down-regulation (>28%) of mitochondrial genes, specifically at the time of rapid atherosclerotic lesion expansion and foam cell formation, i.e. between 30 and 40 weeks of age. Both phenomena - down-regulation of mitochondrial genes and lesion expansion - were largely reversible by genetically lowering plasma cholesterol (by >80%, from 427 to 54 ± 31 mg/L) at 30 weeks. Co-expression network analysis revealed that both mitochondrial signature genes were highly connected in two modules, negatively correlating with lesion size and supported as causal for coronary artery disease (CAD) in humans, as expression-associated single nucleotide polymorphisms (eSNPs) representing their genes overlapped markedly with established disease risk loci. Within these modules, we identified the transcription factor estrogen related receptor (ERR)-α and its co-factors PGC1-α and -β, i.e. two members of the peroxisome proliferator-activated receptor γ co-activator 1 family of transcription regulators, as key regulatory genes. Together, these factors are known as major orchestrators of mitochondrial biogenesis and antioxidant responses. Using a network approach, we demonstrate how hypercholesterolemia could hamper mitochondrial activity during atherosclerosis progression and pinpoint potential therapeutic targets to counteract these processes. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Genome-wide identification and analysis of FK506-binding protein family gene family in strawberry (Fragaria × ananassa).

    Science.gov (United States)

    Leng, Xiangpeng; Liu, Dan; Zhao, Mizhen; Sun, Xin; Li, Yu; Mu, Qian; Zhu, Xudong; Li, Pengyu; Fang, Jinggui

    2014-01-25

    The FK506 binding proteins (FKBPs) are abundant and ubiquitous proteins belonging to the large peptidyl-prolylcis-trans isomerase superfamily. FKBPs are known to be involved in many biological processes including hormone signaling, plant growth, and stress responses through a chaperone or an isomerization of proline residues during protein folding. The availability of complete strawberry genome sequences allowed the identification of 23 FKBP genes by HMMER and blast analysis. Chromosome scaffold locations of these FKBP genes in the strawberry genome were determined and the protein domain and motif organization of FaFKBPs analyzed. The phylogenetic relationships between strawberry FKBPs were also assessed. The expression profiles of FaFKBPs genes results revealed that most FaFKBPs were expressed in all tissues, while a few FaFKBPs were specifically expressed in some of the tissues. These data not only contribute to some better understanding of the complex regulation of the strawberry FKBP gene family, but also provide valuable information for further research in strawberry functional genomics. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Functional gene polymorphism to reveal species history: the case of the CRTISO gene in cultivated carrots.

    Directory of Open Access Journals (Sweden)

    Vanessa Soufflet-Freslon

    Full Text Available Carrot is a vegetable cultivated worldwide for the consumption of its root. Historical data indicate that root colour has been differentially selected over time and according to geographical areas. Root pigmentation depends on the relative proportion of different carotenoids for the white, yellow, orange and red types but only internally for the purple one. The genetic control for root carotenoid content might be partially associated with carotenoid biosynthetic genes. Carotenoid isomerase (CRTISO has emerged as a regulatory step in the carotenoid biosynthesis pathway and could be a good candidate to show how a metabolic pathway gene reflects a species genetic history.In this study, the nucleotide polymorphism and the linkage disequilibrium among the complete CRTISO sequence, and the deviation from neutral expectation were analysed by considering population subdivision revealed with 17 microsatellite markers. A sample of 39 accessions, which represented different geographical origins and root colours, was used. Cultivated carrot was divided into two genetic groups: one from Middle East and Asia (Eastern group, and another one mainly from Europe (Western group. The Western and Eastern genetic groups were suggested to be differentially affected by selection: a signature of balancing selection was detected within the first group whereas the second one showed no selection. A focus on orange-rooted carrots revealed that cultivars cultivated in Asia were mainly assigned to the Western group but showed CRTISO haplotypes common to Eastern carrots.The carotenoid pathway CRTISO gene data proved to be complementary to neutral markers in order to bring critical insight in the cultivated carrot history. We confirmed the occurrence of two migration events since domestication. Our results showed a European background in material from Japan and Central Asia. While confirming the introduction of European carrots in Japanese resources, the history of Central Asia

  13. Differential Selective Pressures Experienced by the Aurora Kinase Gene Family

    Directory of Open Access Journals (Sweden)

    Joni M. Seeling

    2017-12-01

    Full Text Available Aurora kinases (AKs are serine/threonine kinases that are essential for cell division. Humans have three AK genes: AKA, AKB, and AKC. AKA is required for centrosome assembly, centrosome separation, and bipolar spindle assembly, and its mutation leads to abnormal spindle morphology. AKB is required for the spindle checkpoint and proper cytokinesis, and mutations cause chromosome misalignment and cytokinesis failure. AKC is expressed in germ cells, and has a role in meiosis analogous to that of AKB in mitosis. Mutation of any of the three isoforms can lead to cancer. AK proteins possess divergent N- and C-termini and a conserved central catalytic domain. We examined the evolution of the AK gene family using an identity matrix and by building a phylogenetic tree. The data suggest that AKA is the vertebrate ancestral gene, and that AKB and AKC resulted from gene duplication in placental mammals. In a nonsynonymous/synonymous rate substitution analysis, we found that AKB experienced the strongest, and AKC the weakest, purifying selection. Both the N- and C-termini and regions within the kinase domain experienced differential selection among the AK isoforms. These differentially selected sequences may be important for species specificity and isoform specificity, and are therefore potential therapeutic targets.

  14. Expression of the Bovine NK-Lysin Gene Family and Activity against Respiratory Pathogens.

    Directory of Open Access Journals (Sweden)

    Junfeng Chen

    Full Text Available Unlike the genomes of many mammals that have a single NK-lysin gene, the cattle genome contains a family of four genes, one of which is expressed preferentially in the lung. In this study, we compared the expression of the four bovine NK-lysin genes in healthy animals to animals challenged with pathogens known to be associated with bovine respiratory disease (BRD using transcriptome sequencing (RNA-seq. The expression of several NK-lysins, especially NK2C, was elevated in challenged relative to control animals. The effects of synthetic peptides corresponding to functional region helices 2 and 3 of each gene product were tested on both model membranes and bio-membranes. Circular dichroism spectroscopy indicated that these peptides adopted a more helical secondary structure upon binding to an anionic model membrane and liposome leakage assays suggested that these peptides disrupt membranes. Bacterial killing assays further confirmed the antimicrobial effects of these peptides on BRD-associated bacteria, including both Pasteurella multocida and Mannhemia haemolytica and an ultrastructural examination of NK-lysin-treated P. multocida cells by transmission electron microscopy revealed the lysis of target membranes. These studies demonstrate that the expanded bovine NK-lysin gene family is potentially important in host defense against pathogens involved in bovine respiratory disease.

  15. Heart morphogenesis gene regulatory networks revealed by temporal expression analysis.

    Science.gov (United States)

    Hill, Jonathon T; Demarest, Bradley; Gorsi, Bushra; Smith, Megan; Yost, H Joseph

    2017-10-01

    During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks (GRNs) driving this phase of heart development, during which many congenital heart disease malformations likely arise, we conducted an RNA-seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern, identified transcription factor binding motifs enriched in each cluster, and generated a model GRN for the major gene batteries in heart morphogenesis. This approach predicted hundreds of regulatory interactions and found batteries enriched in specific cell and tissue types, indicating that the approach can be used to narrow the search for novel genetic markers and regulatory interactions. Subsequent analyses confirmed the GRN using two mutants, Tbx5 and nkx2-5 , and identified sets of duplicated zebrafish genes that do not show temporal subfunctionalization. This dataset provides an essential resource for future studies on the genetic/epigenetic pathways implicated in congenital heart defects and the mechanisms of cardiac transcriptional regulation. © 2017. Published by The Company of Biologists Ltd.

  16. Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity

    Science.gov (United States)

    Schoggins, John W.; MacDuff, Donna A.; Imanaka, Naoko; Gainey, Maria D.; Shrestha, Bimmi; Eitson, Jennifer L.; Mar, Katrina B.; Richardson, R. Blake; Ratushny, Alexander V.; Litvak, Vladimir; Dabelic, Rea; Manicassamy, Balaji; Aitchison, John D.; Aderem, Alan; Elliott, Richard M.; García-Sastre, Adolfo; Racaniello, Vincent; Snijder, Eric J.; Yokoyama, Wayne M.; Diamond, Michael S.; Virgin, Herbert W.; Rice, Charles M.

    2014-01-01

    The type I interferon (IFN) response protects cells from viral infection by inducing hundreds of interferon-stimulated genes (ISGs), some of which encode direct antiviral effectors. Recent screening studies have begun to catalogue ISGs with antiviral activity against several RNA and DNA viruses. However, antiviral ISG specificity across multiple distinct classes of viruses remains largely unexplored. Here we used an ectopic expression assay to screen a library of more than 350 human ISGs for effects on 14 viruses representing 7 families and 11 genera. We show that 47 genes inhibit one or more viruses, and 25 genes enhance virus infectivity. Comparative analysis reveals that the screened ISGs target positive-sense single-stranded RNA viruses more effectively than negative-sense single-stranded RNA viruses. Gene clustering highlights the cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS, also known as MB21D1) as a gene whose expression also broadly inhibits several RNA viruses. In vitro, lentiviral delivery of enzymatically active cGAS triggers a STING-dependent, IRF3-mediated antiviral program that functions independently of canonical IFN/STAT1 signalling. In vivo, genetic ablation of murine cGAS reveals its requirement in the antiviral response to two DNA viruses, and an unappreciated contribution to the innate control of an RNA virus. These studies uncover new paradigms for the preferential specificity of IFN-mediated antiviral pathways spanning several virus families.

  17. Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dong, Chun-Juan; Shang, Qing-Mao

    2013-07-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.

  18. Genome-wide analysis and expression profiles of NTMC2 family genes in Oryza sativa.

    Science.gov (United States)

    Huang, Rui; Zhao, Jin; Liu, Jin; Wang, Yingdian; Han, Shengcheng; Zhao, Heping

    2017-12-30

    N-terminal-TM-C2 domain proteins (NTMC2), which share domain architecture and sequence similarity to synaptotagmins (Syts) in mammals and FAM62 (extended Syts) in metazoans, form a small gene family in plants. Previous studies showed that the Arabidopsis thaliana NTMC2 type 1.1 protein (NTMC2T1.1, named AtSyt1) possesses calcium- and membrane-binding activities that allow it to function in a plasma membrane repair pathway induced by stress. However, we lack understanding of the diverse biological roles of plant NTMC2 family genes. In this study, a total of 13 OsNTMC2 genes was identified through a comprehensive bioinformatics analysis of the rice (Oryza sativa L.) genome and classified into six OsNTMC2 groups (OsNTMC2T1 to OsNTMC2T6) based on phylogeny and motif constitution. OsNTMC2T1 to OsNTMC2T3 have two calcium-binding domains (C2A and C2B), but OsNTMC2T4 to OsNTMC2T6 have single C2 domain. The expression profiles of OsNTMC2 genes were analysed at different stages of vegetative and reproductive development. This analysis revealed that at least one OsNTMC2 gene was abundantly expressed at each stage of development. These results should facilitate research on this gene family and provide new insights elucidating their functions in higher plants. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Genome-wide identification and expression profiling of tomato Hsp20 gene family in response to biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    jiahong yu

    2016-08-01

    Full Text Available The Hsp20 genes are involved in the response of plants to environment stresses including heat shock and also play a vital role in plant growth and development. They represent the most abundant small heat shock proteins (sHsps in plants, but little is known about this family in tomato (Solanum lycopersicum, an important vegetable crop in the world. Here, we characterized heat shock protein 20 (SlHsp20 gene family in tomato through integration of gene structure, chromosome location, phylogenetic relationship and expression profile. Using bioinformatics-based methods, we identified at least 42 putative SlHsp20 genes in tomato. Sequence analysis revealed that most of SlHsp20 genes possessed no intron or a relatively short intron in length. Chromosome mapping indicated that inter-arm and intra-chromosome duplication events contributed remarkably to the expansion of SlHsp20 genes. Phylogentic tree of Hsp20 genes from tomato and other plant species revealed that SlHsp20 genes were grouped into 13 subfamilies, indicating that these genes may have a common ancestor that generated diverse subfamilies prior to the mono-dicot split. In addition, expression analysis using RNA-seq in various tissues and developmental stages of cultivated tomato and the wild relative Solanum pimpinellifolium revealed that most of these genes (83% were expressed in at least one stage from at least one genotype. Out of 42 genes, 4 genes were expressed constitutively in almost all the tissues analyzed, implying that these genes might have specific housekeeping function in tomato cell under normal growth conditions. Two SlHsp20 genes displayed differential expression levels between cultivated tomato and S. pimpinellifolium in vegetative (leaf and root and reproductive organs (floral bud and flower, suggesting inter-species diversification for functional specialization during the process of domestication. Based on genome-wide microarray analysis, we showed that the transcript

  20. Genome-wide analysis and expression profiling of the PIN auxin transporter gene family in soybean (Glycine max).

    Science.gov (United States)

    Wang, Yongqin; Chai, Chenglin; Valliyodan, Babu; Maupin, Christine; Annen, Brad; Nguyen, Henry T

    2015-11-16

    The plant phytohormone auxin controls many aspects of plant growth and development, which largely depends on its uneven distribution in plant tissues. Transmembrane proteins of the PIN family are auxin efflux facilitators. They play a key role in polar auxin transport and are associated with auxin asymmetrical distribution in plants. PIN genes have been characterized in several plant species, while comprehensive analysis of this gene family in soybean has not been reported yet. In this study, twenty-three members of the PIN gene family were identified in the soybean genome through homology searches. Analysis of chromosome distribution and phylogenetic relationships of the soybean PIN genes indicated nine pairs of duplicated genes and a legume specific subfamily. Organ/tissue expression patterns and promoter activity assays of the soybean PINs suggested redundant functions for most duplicated genes and complementary and tissue-specific functions during development for non-duplicated genes. The soybean PIN genes were differentially regulated by various abiotic stresses and phytohormone stimuli, implying crosstalk between auxin and abiotic stress signaling pathways. This was further supported by the altered auxin distribution under these conditions as revealed by DR5::GUS transgenic soybean hairy root. Our data indicates that GmPIN9, a legume-specific PIN gene, which was responsive to several abiotic stresses, might play a role in auxin re-distribution in soybean root under abiotic stress conditions. This study provided the first comprehensive analysis of the soybean PIN gene family. Information on phylogenetic relationships, gene structure, protein profiles and expression profiles of the soybean PIN genes in different tissues and under various abiotic stress treatments helps to identity candidates with potential roles in specific developmental processes and/or environmental stress conditions. Our study advances our understanding of plant responses to abiotic stresses

  1. Comparative genome analysis reveals a conserved family of actin-like proteins in apicomplexan parasites

    Directory of Open Access Journals (Sweden)

    Sibley L David

    2005-12-01

    Full Text Available Abstract Background The phylum Apicomplexa is an early-branching eukaryotic lineage that contains a number of important human and animal pathogens. Their complex life cycles and unique cytoskeletal features distinguish them from other model eukaryotes. Apicomplexans rely on actin-based motility for cell invasion, yet the regulation of this system remains largely unknown. Consequently, we focused our efforts on identifying actin-related proteins in the recently completed genomes of Toxoplasma gondii, Plasmodium spp., Cryptosporidium spp., and Theileria spp. Results Comparative genomic and phylogenetic studies of apicomplexan genomes reveals that most contain only a single conventional actin and yet they each have 8–10 additional actin-related proteins. Among these are a highly conserved Arp1 protein (likely part of a conserved dynactin complex, and Arp4 and Arp6 homologues (subunits of the chromatin-remodeling machinery. In contrast, apicomplexans lack canonical Arp2 or Arp3 proteins, suggesting they lost the Arp2/3 actin polymerization complex on their evolutionary path towards intracellular parasitism. Seven of these actin-like proteins (ALPs are novel to apicomplexans. They show no phylogenetic associations to the known Arp groups and likely serve functions specific to this important group of intracellular parasites. Conclusion The large diversity of actin-like proteins in apicomplexans suggests that the actin protein family has diverged to fulfill various roles in the unique biology of intracellular parasites. Conserved Arps likely participate in vesicular transport and gene expression, while apicomplexan-specific ALPs may control unique biological traits such as actin-based gliding motility.

  2. Revealing targeted therapy for human cancer by gene module maps

    NARCIS (Netherlands)

    Wong, David J.; Nuyten, Dimitry S. A.; Regev, Aviv; Lin, Meihong; Adler, Adam S.; Segal, Eran; van de Vijver, Marc J.; Chang, Howard Y.

    2008-01-01

    A major goal of cancer research is to match specific therapies to molecular targets in cancer. Genome-scale expression profiling has identified new subtypes of cancer based on consistent patterns of variation in gene expression, leading to improved prognostic predictions. However, how these new

  3. Genetic diversity and gene flow revealed by microsatellite DNA ...

    African Journals Online (AJOL)

    Dacryodes edulis is a multipurpose tree integrated in the cropping system of Central African region still dominated by subsistence agriculture. Some populations grown are wild which can provide information on the domestication process, and could also represent a potential source of gene flow. Leaves samples for DNA ...

  4. The mitochondrial cytochrome c oxidase I gene reveals ...

    African Journals Online (AJOL)

    We used a 298 bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) to examine sequence variation in (mostly) museum specimens of the African Goshawk Accipiter tachiro. Our results showed two clades with high bootstrap support in a phylogenetic analysis and two groups in a nonmetric ...

  5. Transcriptome network analysis reveals potential candidate genes for ankylosing spondylitis.

    Science.gov (United States)

    Zhu, Z-Q; Tang, J-S; Cao, X-J

    2013-12-01

    Ankylosing spondylitis (AS) is a chronic, inflammatory arthritis and autoimmune disease. The main symptom of AS is inflammatory spinal pain; with time, some patients develop ankylosis and spinal immobility. We aim to find cure available for ankylosing spondylitis. We used the GSE11886 series to identify potential genes that related to AS to construct a regulation network. In the network, some of TFs and target genes have been proved related with AS in previous study, such as NFKB1, STAT1, STAT4, TNFSF10, IL2RA, and IL2RB. We also found some new TFs (Franscription Factors) and target genes response to AS, such as BXDC5, and EGFR. Further analysis indicated some significant pathways are associated with AS, including antigen processing and presentation and cytokine-cytokine receptor interaction, etc.; although not significant, there was evident that they play an important role in AS progression, such as apoptosis and systemic lupus erythematosus. Therefore, it is demonstrated that transcriptome network analysis is useful in identification of the candidate genes in AS.

  6. The SLEEPER genes: a transposase-derived angiosperm-specific gene family

    Directory of Open Access Journals (Sweden)

    Knip Marijn

    2012-10-01

    Full Text Available Abstract Background DAYSLEEPER encodes a domesticated transposase from the hAT-superfamily, which is essential for development in Arabidopsis thaliana. Little is known about the presence of DAYSLEEPER orthologs in other species, or how and when it was domesticated. We studied the presence of DAYSLEEPER orthologs in plants and propose a model for the domestication of the ancestral DAYSLEEPER gene in angiosperms. Results Using specific BLAST searches in genomic and EST libraries, we found that DAYSLEEPER-like genes (hereafter called SLEEPER genes are unique to angiosperms. Basal angiosperms as well as grasses (Poaceae and dicotyledonous plants possess such putative orthologous genes, but SLEEPER-family genes were not found in gymnosperms, mosses and algae. Most species contain more than one SLEEPER gene. All SLEEPERs contain a C2H2 type BED-zinc finger domain and a hATC dimerization domain. We designated 3 motifs, partly overlapping the BED-zinc finger and dimerization domain, which are hallmark features in the SLEEPER family. Although SLEEPER genes are structurally conserved between species, constructs with SLEEPER genes from grapevine and rice did not complement the daysleeper phenotype in Arabidopsis, when expressed under control of the DAYSLEEPER promoter. However these constructs did cause a dominant phenotype when expressed in Arabidopsis. Rice plant lines with an insertion in the RICESLEEPER1 or 2 locus displayed phenotypic abnormalities, indicating that these genes are functional and important for normal development in rice. We suggest a model in which we hypothesize that an ancestral hAT transposase was retrocopied and stably integrated in the genome during early angiosperm evolution. Evidence is also presented for more recent retroposition events of SLEEPER genes, such as an event in the rice genome, which gave rise to the RICESLEEPER1 and 2 genes. Conclusions We propose the ancestral SLEEPER gene was formed after a process of retro

  7. RNA deep sequencing reveals novel candidate genes and polymorphisms in boar testis and liver tissues with divergent androstenone levels.

    Directory of Open Access Journals (Sweden)

    Asep Gunawan

    Full Text Available Boar taint is an unpleasant smell and taste of pork meat derived from some entire male pigs. The main causes of boar taint are the two compounds androstenone (5α-androst-16-en-3-one and skatole (3-methylindole. It is crucial to understand the genetic mechanism of boar taint to select pigs for lower androstenone levels and thus reduce boar taint. The aim of the present study was to investigate transcriptome differences in boar testis and liver tissues with divergent androstenone levels using RNA deep sequencing (RNA-Seq. The total number of reads produced for each testis and liver sample ranged from 13,221,550 to 33,206,723 and 12,755,487 to 46,050,468, respectively. In testis samples 46 genes were differentially regulated whereas 25 genes showed differential expression in the liver. The fold change values ranged from -4.68 to 2.90 in testis samples and -2.86 to 3.89 in liver samples. Differentially regulated genes in high androstenone testis and liver samples were enriched in metabolic processes such as lipid metabolism, small molecule biochemistry and molecular transport. This study provides evidence for transcriptome profile and gene polymorphisms of boars with divergent androstenone level using RNA-Seq technology. Digital gene expression analysis identified candidate genes in flavin monooxygenease family, cytochrome P450 family and hydroxysteroid dehydrogenase family. Moreover, polymorphism and association analysis revealed mutation in IRG6, MX1, IFIT2, CYP7A1, FMO5 and KRT18 genes could be potential candidate markers for androstenone levels in boars. Further studies are required for proving the role of candidate genes to be used in genomic selection against boar taint in pig breeding programs.

  8. Exome sequences of multiplex, multigenerational families reveal schizophrenia risk loci with potential implications for neurocognitive performance.

    Science.gov (United States)

    Kos, Mark Z; Carless, Melanie A; Peralta, Juan; Curran, Joanne E; Quillen, Ellen E; Almeida, Marcio; Blackburn, August; Blondell, Lucy; Roalf, David R; Pogue-Geile, Michael F; Gur, Ruben C; Göring, Harald H H; Nimgaonkar, Vishwajit L; Gur, Raquel E; Almasy, Laura

    2017-12-01

    Schizophrenia is a serious mental illness, involving disruptions in thought and behavior, with a worldwide prevalence of about one percent. Although highly heritable, much of the genetic liability of schizophrenia is yet to be explained. We searched for susceptibility loci in multiplex, multigenerational families affected by schizophrenia, targeting protein-altering variation with in silico predicted functional effects. Exome sequencing was performed on 136 samples from eight European-American families, including 23 individuals diagnosed with schizophrenia or schizoaffective disorder. In total, 11,878 non-synonymous variants from 6,396 genes were tested for their association with schizophrenia spectrum disorders. Pathway enrichment analyses were conducted on gene-based test results, protein-protein interaction (PPI) networks, and epistatic effects. Using a significance threshold of FDR schizophrenia, with significant cis effects on gene expression (p = 5.5 × 10 -4 ), including brain tissue data from the Genotype-Tissue Expression project (minimum p = 6.0 × 10 -5 ). A second SNP, rs10378 located in TMEM176A, also shows risk effects in the exome data (p = 2.8 × 10 -5 ; q-value = 0.073). PPIs among our top gene-based association results (p schizophrenia risk, whose effects may be modulated by genes involved in synaptic plasticity and neurocognitive performance. © 2017 Wiley Periodicals, Inc.

  9. Phylogenetic, expression and functional characterizations of the maize NLP transcription factor family reveal a role in nitrate assimilation and signaling.

    Science.gov (United States)

    Wang, Zhangkui; Zhang, Lei; Sun, Ci; Gu, Riliang; Mi, Guohua; Yuan, Lixing

    2018-01-24

    Although nitrate represents an important nitrogen (N) source for maize, a major crop of dryland areas, the molecular mechanisms of nitrate uptake and assimilation remain poorly understood. Here, we identified nine maize NIN-like protein (ZmNLP) genes and analyzed the function of one member, ZmNLP3.1, in nitrate nutrition and signaling. The NLP family genes were clustered into three clades in a phylogenic tree. Comparative genomic analysis showed that most ZmNLP genes had collinear relationships to the corresponding NLPs in rice, and that the expansion of the ZmNLP family resulted from segmental duplications in the maize genome. Quantitative PCR analysis revealed the expression of ZmNLP2.1, ZmNLP2.2, ZmNLP3.1, ZmNLP3.2, ZmNLP3.3, and ZmNLP3.4 was induced by nitrate in maize roots. The function of ZmNLP3.1 was investigated by overexpressing it in the Arabidopsis nlp7-1 mutant, which is defective in the AtNLP7 gene for nitrate signaling and assimilation. Ectopic expression of ZmNLP3.1 restored the N-deficient phenotypes of nlp7-1 under nitrate-replete conditions in terms of shoot biomass, root morphology and nitrate assimilation. Furthermore, the nitrate induction of NRT2.1, NIA1, and NiR1 gene expression was recovered in the 35S::ZmNLP3.1/nlp7-1 transgenic lines, indicating that ZmNLP3.1 plays essential roles in nitrate signaling. Taken together, these results suggest that ZmNLP3.1 plays an essential role in regulating nitrate signaling and assimilation processes, and represents a valuable candidate for developing transgenic maize cultivars with high N-use efficiency. This article is protected by copyright. All rights reserved.

  10. Gene Coexpression Analysis Reveals Complex Metabolism of the Monoterpene Alcohol Linalool in Arabidopsis FlowersW

    NARCIS (Netherlands)

    Ginglinger, J.F.; Boachon, B.; Hofer, R.; Paetz, C.; Kollner, T.G.; Miesch, L.; Lugan, R.; Baltenweck, R.; Mutterer, J.; Ullman, P.; Verstappen, F.W.A.; Bouwmeester, H.J.

    2013-01-01

    The cytochrome P450 family encompasses the largest family of enzymes in plant metabolism, and the functions of many of its members in Arabidopsis thaliana are still unknown. Gene coexpression analysis pointed to two P450s that were coexpressed with two monoterpene synthases in flowers and were thus

  11. The zebrafish progranulin gene family and antisense transcripts

    Directory of Open Access Journals (Sweden)

    Baranowski David

    2005-11-01

    Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial

  12. Cyclic nucleotide gated channel gene family in tomato: genome-wide identification and functional analyses in disease resistance

    Directory of Open Access Journals (Sweden)

    Mumtaz Ali Saand

    2015-05-01

    Full Text Available The cyclic nucleotide gated channel (CNGC is suggested to be one of the important calcium conducting channels. Nevertheless, genome-wide identification and systemic functional analysis of CNGC gene family in crop plant species have not yet been conducted. In this study, we performed genome-wide identification of CNGC gene family in the economically important crop tomato (Solanum lycopersicum L. and analyzed function of the group IVb SlCNGC genes in disease resistance. Eighteen CNGC genes were identified in tomato genome, and four CNGC loci that were misannotated at database were corrected by cloning and sequencing. Detailed bioinformatics analyses on gene structure, domain composition and phylogenetic relationship of the SlCNGC gene family were conducted and the group-specific feature was revealed. Comprehensive expression analyses demonstrated that SlCNGC genes were highly and widely responsive to diverse stimuli and the expression profile was gene-dependent. Pharmacological assays showed that the putative CNGC activators cGMP and cAMP enhanced resistance against Sclerotinia sclerotiorum. Silencing of group IVb SlCNGC genes significantly enhanced resistance to fungal pathogens Pythium aphanidermatum and S. sclerotiorum, strongly reduced resistance to viral pathogen Tobacco rattle virus, while attenuated PAMP- and DAMP-triggered immunity as shown by obvious decrease of the flg22- and AtPep1-elicited hydrogen peroxide accumulation in SlCNGC-silenced plants. Additionally, silencing of these SlCNGC genes significantly altered expression of a set of Ca2+ signaling genes including SlCaMs, SlCDPKs and SlCAMTA3. Collectively, our results reveal that group IV SlCNGC genes regulate a wide range of resistance in tomato probably by affecting Ca2+ signaling.

  13. Identification of MBF2 family genes in Bombyx mori and their expression in different tissues and stages and in response to Bacillus bombysepticus infection and starvation.

    Science.gov (United States)

    Zhou, Chun-Yan; Zha, Xing-Fu; Liu, Chun; Han, Min-Jin; Zhang, Li-Ying; Shi, Pan-Pan; Wang, He; Zheng, Ren-Wen; Xia, Qing-You

    2016-08-01

    The Multiprotein bridge factor 2 (MBF2) gene was first identified as a co-activator involved in BmFTZ-F1-mediated activation of the Fushi tarazu gene. Herein, nine homologous genes of MBF2 gene are identified. Evolutionary analysis showed that this gene family is insect-specific and that the family members are closely related to response to pathogens (REPAT) genes. Tissue distribution analysis revealed that these genes could be expressed in a tissue-specific manner. Developmental profiles analysis showed that the MBF2 gene family members were highly expressed in the different stages. Analysis of the expression patterns of nine MBF2 family genes showed that Bacillus bombysepticus treatment induced the up-regulation of several MBF2 family genes, including MBF2-4, -7, -9, -8. Furthermore, we found the MBF2 family genes were modulated by starvation and the expression of these genes recovered upon re-feeding, except for MBF2-5, -9. These findings suggested roles for these proteins in insect defense against pathogens and nutrient metabolism, which has an important guiding significance for designing pest control strategies. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  14. Clinical Auditory Phenotypes Associated with GATA3 Gene Mutations in Familial Hypoparathyroidism-deafness-renal Dysplasia Syndrome

    Science.gov (United States)

    Wang, Li; Lin, Qiong-Fen; Wang, Hong-Yang; Guan, Jing; Lan, Lan; Xie, Lin-Yi; Yu, Lan; Yang, Ju; Zhao, Cui; Liang, Jin-Long; Zhou, Han-Lin; Yang, Huan-Ming; Xiong, Wen-Ping; Zhang, Qiu-Jing; Wang, Da-Yong; Wang, Qiu-Ju

    2017-01-01

    Background: Hypoparathyroidism-deafness-renal dysplasia (HDR) syndrome is an autosomal dominant disorder primarily caused by haploinsufficiency of GATA binding protein 3 (GATA3) gene mutations, and hearing loss is the most frequent phenotypic feature. This study aimed at identifying the causative gene mutation for a three-generation Chinese family with HDR syndrome and analyzing auditory phenotypes in all familial HDR syndrome cases. Methods: Three affected family members underwent otologic examinations, biochemistry tests, and other clinical evaluations. Targeted genes capture combining next-generation sequencing was performed within the family. Sanger sequencing was used to confirm the causative mutation. The auditory phenotypes of all reported familial HDR syndrome cases analyzed were provided. Results: In Chinese family 7121, a heterozygous nonsense mutation c.826C>T (p.R276*) was identified in GATA3. All the three affected members suffered from sensorineural deafness and hypocalcemia; however, renal dysplasia only appeared in the youngest patient. Furthermore, an overview of thirty HDR syndrome families with corresponding GATA3 mutations revealed that hearing impairment occurred earlier in the younger generation in at least nine familial cases (30%) and two thirds of them were found to carry premature stop mutations. Conclusions: This study highlights the phenotypic heterogeneity of HDR and points to a possible genetic anticipation in patients with HDR, which needs to be further investigated. PMID:28303854

  15. Listening to the noise: random fluctuations reveal gene network parameters

    Energy Technology Data Exchange (ETDEWEB)

    Munsky, Brian [Los Alamos National Laboratory; Khammash, Mustafa [UCSB

    2009-01-01

    The cellular environment is abuzz with noise. The origin of this noise is attributed to the inherent random motion of reacting molecules that take part in gene expression and post expression interactions. In this noisy environment, clonal populations of cells exhibit cell-to-cell variability that frequently manifests as significant phenotypic differences within the cellular population. The stochastic fluctuations in cellular constituents induced by noise can be measured and their statistics quantified. We show that these random fluctuations carry within them valuable information about the underlying genetic network. Far from being a nuisance, the ever-present cellular noise acts as a rich source of excitation that, when processed through a gene network, carries its distinctive fingerprint that encodes a wealth of information about that network. We demonstrate that in some cases the analysis of these random fluctuations enables the full identification of network parameters, including those that may otherwise be difficult to measure. This establishes a potentially powerful approach for the identification of gene networks and offers a new window into the workings of these networks.

  16. Neurexin gene family variants as risk factors for autism spectrum disorder.

    Science.gov (United States)

    Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran

    2018-01-01

    Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  17. A large and functionally diverse family of Fad2 genes in safflower (Carthamus tinctorius L.

    Directory of Open Access Journals (Sweden)

    Cao Shijiang

    2013-01-01

    Full Text Available Abstract Background The application and nutritional value of vegetable oil is highly dependent on its fatty acid composition, especially the relative proportion of its two major fatty acids, i.e oleic acid and linoleic acid. Microsomal oleoyl phosphatidylcholine desaturase encoded by FAD2 gene is known to introduce a double bond at the Δ12 position of an oleic acid on phosphatidylcholine and convert it to linoleic acid. The known plant FAD2 enzymes are encoded by small gene families consisting of 1-4 members. In addition to the classic oleate Δ12-desaturation activity, functional variants of FAD2 that are capable of undertaking additional or alternative acyl modifications have also been reported in a limited number of plant species. In this study, our objective was to identify FAD2 genes from safflower and analyse their differential expression profile and potentially diversified functionality. Results We report here the characterization and functional expression of an exceptionally large FAD2 gene family from safflower, and the temporal and spatial expression profiles of these genes as revealed through Real-Time quantitative PCR. The diversified functionalities of some of the safflower FAD2 gene family members were demonstrated by ectopic expression in yeast and transient expression in Nicotiana benthamiana leaves. CtFAD2-1 and CtFAD2-10 were demonstrated to be oleate desaturases specifically expressed in developing seeds and flower head, respectively, while CtFAD2-2 appears to have relatively low oleate desaturation activity throughout the plant. CtFAD2-5 and CtFAD2-8 are specifically expressed in root tissues, while CtFAD2-3, 4, 6, 7 are mostly expressed in the cotyledons and hypocotyls in young safflower seedlings. CtFAD2-9 was found to encode a novel desaturase operating on C16:1 substrate. CtFAD2-11 is a tri-functional enzyme able to introduce a carbon double bond in either cis or trans configuration, or a carbon triple (acetylenic bond

  18. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  19. Genome-Wide Identification and Expression Profile of Dof Transcription Factor Gene Family in Pepper (Capsicum annuum L.).

    Science.gov (United States)

    Wu, Zhiming; Cheng, Jiaowen; Cui, Junjie; Xu, Xiaowan; Liang, Guansheng; Luo, Xirong; Chen, Xiaocui; Tang, Xiangqun; Hu, Kailin; Qin, Cheng

    2016-01-01

    Dof (DNA-binding One Zinc Finger) transcription factor family is unique to plants and has diverse roles associated with plant-specific phenomena, such as light, phytohormone and defense responses as well as seed development and germination. Although, genome-wide analysis of this family has been performed in many species, information regarding Dof genes in the pepper, Capsicum annuum L., is extremely limited. In this study, exhaustive searches of pepper genome revealed 33 potential CaDofs that were phylogenetically clustered into four subgroups. Twenty-nine of the 33 Dof genes could be mapped on 11 chromosomes, except for chromosome 7. The intron/exon organizations and conserved motif compositions of these genes were also analyzed. Additionally, phylogenetic analysis and classification of the Dof transcription factor family in eight plant species revealed that S. lycopersicum and C. annuum as well as O. sativa and S. bicolor Dof proteins may have evolved conservatively. Moreover, comprehensive expression analysis of CaDofs using a RNA-seq atlas and quantitative real-time polymerase chain reaction (qRT-PCR) revealed that these genes exhibit a variety of expression patterns. Most of the CaDofs were expressed in at least one of the tissues tested, whereas several genes were identified as being highly responsive to heat and salt stresses. Overall, this study describes the first genome-wide analysis of the pepper Dof family, whose genes exhibited different expression patterns in all primary fruit developmental stages and tissue types, as in response to abiotic stress. In particular, some Dof genes might be used as biomarkers for heat and salt stress. The results could expand our understanding of the roles of Dof genes in pepper.

  20. Trends in genome dynamics among major orders of insects revealed through variations in protein families.

    Science.gov (United States)

    Rappoport, Nadav; Linial, Michal

    2015-08-07

    Insects belong to a class that accounts for the majority of animals on earth. With over one million identified species, insects display a huge diversity and occupy extreme environments. At present, there are dozens of fully sequenced insect genomes that cover a range of habitats, social behavior and morphologies. In view of such diverse collection of genomes, revealing evolutionary trends and charting functional relationships of proteins remain challenging. We analyzed the relatedness of 17 complete proteomes representative of proteomes from insects including louse, bee, beetle, ants, flies and mosquitoes, as well as an out-group from the crustaceans. The analyzed proteomes mostly represented the orders of Hymenoptera and Diptera. The 287,405 protein sequences from the 18 proteomes were automatically clustered into 20,933 families, including 799 singletons. A comprehensive analysis based on statistical considerations identified the families that were significantly expanded or reduced in any of the studied organisms. Among all the tested species, ants are characterized by an exceptionally high rate of family gain and loss. By assigning annotations to hundreds of species-specific families, the functional diversity among species and between the major clades (Diptera and Hymenoptera) is revealed. We found that many species-specific families are associated with receptor signaling, stress-related functions and proteases. The highest variability among insects associates with the function of transposition and nucleic acids processes (collectively coined TNAP). Specifically, the wasp and ants have an order of magnitude more TNAP families and proteins relative to species that belong to Diptera (mosquitoes and flies). An unsupervised clustering methodology combined with a comparative functional analysis unveiled proteomic signatures in the major clades of winged insects. We propose that the expansion of TNAP families in Hymenoptera potentially contributes to the accelerated

  1. The Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.: Bioinformatic Analysis and Expression Patterns

    Directory of Open Access Journals (Sweden)

    Yazhong eJin

    2016-05-01

    Full Text Available Alcohol dehydrogenases (ADH, encoded by multigene family in plants, play a critical role in plant growth, development, adaptation, fruit ripening and aroma production. Thirteen ADH genes were identified in melon genome, including 12 ADHs and one formaldehyde dehydrogenease (FDH, designated CmADH1-12 and CmFDH1, in which CmADH1 and CmADH2 have been isolated in Cantaloupe. ADH genes shared a lower identity with each other at the protein level and had different intron-exon structure at nucleotide level. No typical signal peptides were found in all CmADHs, and CmADH proteins might locate in the cytoplasm. The phylogenetic tree revealed that 13 ADH genes were divided into 3 groups respectively, namely long-, medium- and short-chain ADH subfamily, and CmADH1,3-11, which belongs to the medium-chain ADH subfamily, fell into 6 medium-chain ADH subgroups. CmADH12 may belong to the long-chain ADH subfamily, while CmFDH1 may be a Class III ADH and serve as an ancestral ADH in melon. Expression profiling revealed that CmADH1, CmADH2, CmADH10 and CmFDH1 were moderately or strongly expressed in different vegetative tissues and fruit at medium and late developmental stages, while CmADH8 and CmADH12 were highly expressed in fruit after 20 days. CmADH3 showed preferential expression in young tissues. CmADH4 only had slight expression in root. Promoter analysis revealed several motifs of CmADH genes involved in the gene expression modulated by various hormones, and the response pattern of CmADH genes to ABA, IAA and ethylene were different. These CmADHs were divided into ethylene-sensitive and –insensitive groups, and the functions of CmADHs were discussed.

  2. The Medicago truncatula lysin [corrected] motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes.

    Science.gov (United States)

    Arrighi, Jean-François; Barre, Annick; Ben Amor, Besma; Bersoult, Anne; Soriano, Lidia Campos; Mirabella, Rossana; de Carvalho-Niebel, Fernanda; Journet, Etienne-Pascal; Ghérardi, Michèle; Huguet, Thierry; Geurts, René; Dénarié, Jean; Rougé, Pierre; Gough, Clare

    2006-09-01

    Rhizobial Nod factors are key symbiotic signals responsible for starting the nodulation process in host legume plants. Of the six Medicago truncatula genes controlling a Nod factor signaling pathway, Nod Factor Perception (NFP) was reported as a candidate Nod factor receptor gene. Here, we provide further evidence for this by showing that NFP is a lysin [corrected] motif (LysM)-receptor-like kinase (RLK). NFP was shown both to be expressed in association with infection thread development and to be involved in the infection process. Consistent with deviations from conserved kinase domain sequences, NFP did not show autophosphorylation activity, suggesting that NFP needs to associate with an active kinase or has unusual functional characteristics different from classical kinases. Identification of nine new M. truncatula LysM-RLK genes revealed a larger family than in the nonlegumes Arabidopsis (Arabidopsis thaliana) or rice (Oryza sativa) of at least 17 members that can be divided into three subfamilies. Three LysM domains could be structurally predicted for all M. truncatula LysM-RLK proteins, whereas one subfamily, which includes NFP, was characterized by deviations from conserved kinase sequences. Most of the newly identified genes were found to be expressed in roots and nodules, suggesting this class of receptors may be more extensively involved in nodulation than was previously known.

  3. AVP-NPII gene mutations and clinical characteristics of the patients with autosomal dominant familial central diabetes insipidus.

    Science.gov (United States)

    Turkkahraman, Doga; Saglar, Emel; Karaduman, Tugce; Mergen, Hatice

    2015-12-01

    Familial central diabetes insipidus (DI), usually an autosomal dominant disorder, is caused by mutations in arginine vasopressin-neurophysin II (AVP-NPII) gene that leads to aberrant preprohormone processing and gradual destruction of AVP-secreting cells. To determine clinical and molecular characteristics of patients with familial central DI from two different Turkish families. The diagnosis of central DI was established by 24-h urine collection, water deprivation test, and desmopressin challenge. To confirm the diagnosis of familial central DI, the entire coding region of AVP-NPII gene was amplified and sequenced. A total of eight affected patients and three unaffected healthy relatives from two families were studied. Genetic analysis revealed a previously reported heterozygous mutation (p.C98X) in family A, and a heterozygous novel mutation (p.G45C) in family B, both detected in exon 2 of AVP-NPII gene. When we compared the clinical characteristics of the two families, it was noticed that as the age of onset of symptoms in family A ranges between 4 and 7 years, it was <1 year in family B. Additionally, pituitary bright spot was present in the affected siblings, but absent in their affected parents. Familial central DI is a progressive disease, and age of onset of symptoms can differ depending on the mutation. Bright spot on pituitary MRI might be present at onset, but become invisible over time. Genetic testing and appropriate counseling should be given in familial cases of central DI to ensure adequate treatment, and to avoid chronic water deprivation that might result in growth retardation in childhood.

  4. Characterization of Ctr family genes and the elucidation of their role in the life cycle of Neurospora crassa.

    Science.gov (United States)

    Korripally, Premsagar; Tiwari, Anand; Haritha, Adhikarla; Kiranmayi, Patnala; Bhanoori, Manjula

    2010-03-01

    Transcriptional analysis using qRT-PCR of 62 metal ion transporters during conidial germination of Neurospora crassa showed a significant up regulation of a hypothetical copper transporter gene, tcu-1, that belongs to the Ctr family. Herein we characterised the Ctr family genes (tcu-1, tcu-2 and tcu-3) and deciphered their role in various developmental phases of the N. crassa life cycle. Cross complementation assays in copper uptake mutant of Saccharomyces cerevisiae revealed that tcu-1, tcu-2 and tcu-3 are functional homologs of S. cerevisiae copper transporters. Expression studies of Ctr family members in various developmental phases of N. crassa showed differential expression pattern for high-affinity copper transporter, TCU1. Functional analysis of their gene knockout mutants showed that tcu-1 is essential for saprophytic conidial germination, vegetative growth and perithecia development under copper limited conditions while conidiation remained unaffected. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  5. Listening to the Noise: Random Fluctuations Reveal Gene Network Parameters

    Science.gov (United States)

    Munsky, Brian; Trinh, Brooke; Khammash, Mustafa

    2010-03-01

    The cellular environment is abuzz with noise originating from the inherent random motion of reacting molecules in the living cell. In this noisy environment, clonal cell populations exhibit cell-to-cell variability that can manifest significant prototypical differences. Noise induced stochastic fluctuations in cellular constituents can be measured and their statistics quantified using flow cytometry, single molecule fluorescence in situ hybridization, time lapse fluorescence microscopy and other single cell and single molecule measurement techniques. We show that these random fluctuations carry within them valuable information about the underlying genetic network. Far from being a nuisance, the ever-present cellular noise acts as a rich source of excitation that, when processed through a gene network, carries its distinctive fingerprint that encodes a wealth of information about that network. We demonstrate that in some cases the analysis of these random fluctuations enables the full identification of network parameters, including those that may otherwise be difficult to measure. We use theoretical investigations to establish experimental guidelines for the identification of gene regulatory networks, and we apply these guideline to experimentally identify predictive models for different regulatory mechanisms in bacteria and yeast.

  6. Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes

    Directory of Open Access Journals (Sweden)

    Deyholos Michael K

    2006-10-01

    Full Text Available Abstract Background Roots are an attractive system for genomic and post-genomic studies of NaCl responses, due to their primary importance to agriculture, and because of their relative structural and biochemical simplicity. Excellent genomic resources have been established for the study of Arabidopsis roots, however, a comprehensive microarray analysis of the root transcriptome following NaCl exposure is required to further understand plant responses to abiotic stress and facilitate future, systems-based analyses of the underlying regulatory networks. Results We used microarrays of 70-mer oligonucleotide probes representing 23,686 Arabidopsis genes to identify root transcripts that changed in relative abundance following 6 h, 24 h, or 48 h of hydroponic exposure to 150 mM NaCl. Enrichment analysis identified groups of structurally or functionally related genes whose members were statistically over-represented among up- or down-regulated transcripts. Our results are consistent with generally observed stress response themes, and highlight potentially important roles for underappreciated gene families, including: several groups of transporters (e.g. MATE, LeOPT1-like; signalling molecules (e.g. PERK kinases, MLO-like receptors, carbohydrate active enzymes (e.g. XTH18, transcription factors (e.g. members of ZIM, WRKY, NAC, and other proteins (e.g. 4CL-like, COMT-like, LOB-Class 1. We verified the NaCl-inducible expression of selected transcription factors and other genes by qRT-PCR. Conclusion Micorarray profiling of NaCl-treated Arabidopsis roots revealed dynamic changes in transcript abundance for at least 20% of the genome, including hundreds of transcription factors, kinases/phosphatases, hormone-related genes, and effectors of homeostasis, all of which highlight the complexity of this stress response. Our identification of these transcriptional responses, and groups of evolutionarily related genes with either similar or divergent

  7. Transcriptomic analyses reveal novel genes with sexually dimorphic expression in the zebrafish gonad and brain.

    Directory of Open Access Journals (Sweden)

    Rajini Sreenivasan

    Full Text Available BACKGROUND: Our knowledge on zebrafish reproduction is very limited. We generated a gonad-derived cDNA microarray from zebrafish and used it to analyze large-scale gene expression profiles in adult gonads and other organs. METHODOLOGY/PRINCIPAL FINDINGS: We have identified 116638 gonad-derived zebrafish expressed sequence tags (ESTs, 21% of which were isolated in our lab. Following in silico normalization, we constructed a gonad-derived microarray comprising 6370 unique, full-length cDNAs from differentiating and adult gonads. Labeled targets from adult gonad, brain, kidney and 'rest-of-body' from both sexes were hybridized onto the microarray. Our analyses revealed 1366, 881 and 656 differentially expressed transcripts (34.7% novel that showed highest expression in ovary, testis and both gonads respectively. Hierarchical clustering showed correlation of the two gonadal transcriptomes and their similarities to those of the brains. In addition, we have identified 276 genes showing sexually dimorphic expression both between the brains and between the gonads. By in situ hybridization, we showed that the gonadal transcripts with the strongest array signal intensities were germline-expressed. We found that five members of the GTP-binding septin gene family, from which only one member (septin 4 has previously been implicated in reproduction in mice, were all strongly expressed in the gonads. CONCLUSIONS/SIGNIFICANCE: We have generated a gonad-derived zebrafish cDNA microarray and demonstrated its usefulness in identifying genes with sexually dimorphic co-expression in both the gonads and the brains. We have also provided the first evidence of large-scale differential gene expression between female and male brains of a teleost. Our microarray would be useful for studying gonad development, differentiation and function not only in zebrafish but also in related teleosts via cross-species hybridizations. Since several genes have been shown to play similar

  8. Family expansion and gene rearrangements contributed to the functional specialization of PRDM genes in vertebrates

    Directory of Open Access Journals (Sweden)

    Alcalay Myriam

    2007-10-01

    Full Text Available Abstract Background Progressive diversification of paralogs after gene expansion is essential to increase their functional specialization. However, mode and tempo of this divergence remain mostly unclear. Here we report the comparative analysis of PRDM genes, a family of putative transcriptional regulators involved in human tumorigenesis. Results Our analysis assessed that the PRDM genes originated in metazoans, expanded in vertebrates and further duplicated in primates. We experimentally showed that fast-evolving paralogs are poorly expressed, and that the most recent duplicates, such as primate-specific PRDM7, acquire tissue-specificity. PRDM7 underwent major structural rearrangements that decreased the number of encoded Zn-Fingers and modified gene splicing. Through internal duplication and activation of a non-canonical splice site (GC-AG, PRDM7 can acquire a novel intron. We also detected an alternative isoform that can retain the intron in the mature transcript and that is predominantly expressed in human melanocytes. Conclusion Our findings show that (a molecular evolution of paralogs correlates with their expression pattern; (b gene diversification is obtained through massive genomic rearrangements; and (c splicing modification contributes to the functional specialization of novel genes.

  9. Exome sequencing in Jewish and Arab patients with rhabdomyolysis reveals single-gene etiology in 43% of cases.

    Science.gov (United States)

    Vivante, Asaf; Ityel, Hadas; Pode-Shakked, Ben; Chen, Jing; Shril, Shirlee; van der Ven, Amelie T; Mann, Nina; Schmidt, Johanna Magdalena; Segel, Reeval; Aran, Adi; Zeharia, Avraham; Staretz-Chacham, Orna; Bar-Yosef, Omer; Raas-Rothschild, Annick; Landau, Yuval E; Lifton, Richard P; Anikster, Yair; Hildebrandt, Friedhelm

    2017-12-01

    Rhabdomyolysis is a clinical emergency that may cause acute kidney injury (AKI). It can be acquired or due to monogenic mutations. Around 60 different rare monogenic forms of rhabdomyolysis have been reported to date. In the clinical setting, identifying the underlying molecular diagnosis is challenging due to nonspecific presentation, the high number of causative genes, and current lack of data on the prevalence of monogenic forms. We employed whole exome sequencing (WES) to reveal the percentage of rhabdomyolysis cases explained by single-gene (monogenic) mutations in one of 58 candidate genes. We investigated a cohort of 21 unrelated families with rhabdomyolysis, in whom no underlying etiology had been previously established. Using WES, we identified causative mutations in candidate genes in nine of the 21 families (43%). We detected disease-causing mutations in eight of 58 candidate genes, grouped into the following categories: (1) disorders of fatty acid metabolism (CPT2), (2) disorders of glycogen metabolism (PFKM and PGAM2), (3) disorders of abnormal skeletal muscle relaxation and contraction (CACNA1S, MYH3, RYR1 and SCN4A), and (4) disorders of purine metabolism (AHCY). Our findings demonstrate a very high detection rate for monogenic etiologies using WES and reveal broad genetic heterogeneity for rhabdomyolysis. These results highlight the importance of molecular genetic diagnostics for establishing an etiologic diagnosis. Because these patients are at risk for recurrent episodes of rhabdomyolysis and subsequent risk for AKI, WES allows adequate prophylaxis and treatment for these patients and their family members and enables a personalized medicine approach.

  10. Molecular cloning and characterization of the family of feline leucine-rich glioma-inactivated (LGI) genes, and mutational analysis in familial spontaneous epileptic cats.

    Science.gov (United States)

    Yu, Yoshihiko; Hasegawa, Daisuke; Fujiwara-Igarashi, Aki; Hamamoto, Yuji; Mizoguchi, Shunta; Kuwabara, Takayuki; Fujita, Michio

    2017-12-13

    Leucine-rich glioma-inactivated (LGI) proteins play a critical role in synaptic transmission. Dysfunction of these genes and encoded proteins is associated with neurological disorders such as genetic epilepsy or autoimmune limbic encephalitis in animals and human. Familial spontaneous epileptic cats (FSECs) are the only feline strain and animal model of familial temporal lobe epilepsy. The seizure semiology of FSECs comprises recurrent limbic seizures with or without evolution into generalized epileptic seizures, while cats with antibodies against voltage-gated potassium channel complexed/LGI1 show limbic encephalitis and recurrent limbic seizures. However, it remains unclear whether the genetics underlying FSECs are associated with LGI family genes. In the present study, we cloned and characterized the feline LGI1-4 genes and examined their association with FSECs. Conventional PCR techniques were performed for cloning and mutational analysis. Characterization was predicted using bioinformatics software. The cDNAs of feline LGI1-4 contained 1674-bp, 1650-bp, 1647-bp, and 1617-bp open reading frames, respectively, and encoded proteins comprising 557, 549, 548, and 538 amino acid residues, respectively. The feline LGI1-4 putative protein sequences showed high homology with Homo sapiens, Canis familiaris, Bos taurus, Sus scrofa, and Equus caballus (92%-100%). Mutational analysis in 8 FSECs and 8 controls for LGI family genes revealed 3 non-synonymous and 14 synonymous single nucleotide polymorphisms in the coding region. Only one non-synonymous single nucleotide polymorphism in LGI4 was found in 3 out of 8 FSECs. Using three separate computational tools, this mutation was not predicted to be disease causing. No co-segregation of the disease was found with any variant. We cloned the cDNAs of the four feline LGI genes, analyzed the amino acid sequences, and revealed that epilepsy in FSEC is not a monogenic disorder associated with LGI genes.

  11. Ceratocystis cacaofunesta genome analysis reveals a large expansion of extracellular phosphatidylinositol-specific phospholipase-C genes (PI-PLC).

    Science.gov (United States)

    Molano, Eddy Patricia Lopez; Cabrera, Odalys García; Jose, Juliana; do Nascimento, Leandro Costa; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Alvarez, Javier Correa; Tiburcio, Ricardo Augusto; Tokimatu Filho, Paulo Massanari; de Lima, Gustavo Machado Alvares; Guido, Rafael Victório Carvalho; Corrêa, Thamy Lívia Ribeiro; Leme, Adriana Franco Paes; Mieczkowski, Piotr; Pereira, Gonçalo Amarante Guimarães

    2018-01-17

    The Ceratocystis genus harbors a large number of phytopathogenic fungi that cause xylem parenchyma degradation and vascular destruction on a broad range of economically important plants. Ceratocystis cacaofunesta is a necrotrophic fungus responsible for lethal wilt disease in cacao. The aim of this work is to analyze the genome of C. cacaofunesta through a comparative approach with genomes of other Sordariomycetes in order to better understand the molecular basis of pathogenicity in the Ceratocystis genus. We present an analysis of the C. cacaofunesta genome focusing on secreted proteins that might constitute pathogenicity factors. Comparative genome analyses among five Ceratocystidaceae species and 23 other Sordariomycetes fungi showed a strong reduction in gene content of the Ceratocystis genus. However, some gene families displayed a remarkable expansion, in particular, the Phosphatidylinositol specific phospholipases-C (PI-PLC) family. Also, evolutionary rate calculations suggest that the evolution process of this family was guided by positive selection. Interestingly, among the 82 PI-PLCs genes identified in the C. cacaofunesta genome, 70 genes encoding extracellular PI-PLCs are grouped in eight small scaffolds surrounded by transposon fragments and scars that could be involved in the rapid evolution of the PI-PLC family. Experimental secretome using LC-MS/MS validated 24% (86 proteins) of the total predicted secretome (342 proteins), including four PI-PLCs and other important pathogenicity factors. Analysis of the Ceratocystis cacaofunesta genome provides evidence that PI-PLCs may play a role in pathogenicity. Subsequent functional studies will be aimed at evaluating this hypothesis. The observed genetic arsenals, together with the analysis of the PI-PLC family shown in this work, reveal significant differences in the Ceratocystis genome compared to the classical vascular fungi, Verticillium and Fusarium. Altogether, our analyses provide new insights into the

  12. Familial pheochromocytoma associated with a novel mutation in the von Hippel-Lindau gene

    Energy Technology Data Exchange (ETDEWEB)

    Gross, D.J.; Avishai, N.; Meiner, V.; Abeliovich, D.; Filon, D. [Hadassah Univ. Hospital and the Hebrew Univ.-Hadassah Medical School, Jerusalem (Israel)] [and others

    1996-01-01

    We report a three generation, 25 member kindred with familial pheochromocytoma. Seven subjects of generations I and II had pheochromocytoma, in five of the seven, the tumors were bilateral, and in two of the seven, the tumors were both adrenal and extraadrenal. One patient also had a carotid body chemodectoma, and one patient had a malignant adrenal tumor and abdominal paraganglioma. In the patient with the chemodectoma, a cerebellar hemagioblastoma became manifest 25 yr after his initial diagnosis with pheochromocytoma, leading only then to a clinical diagnosis of von Hippel-Lindau disease (VHL). A mutational analysis of the VHL gene revealed a novel nucleotide 709 G{r_arrow}T transversion present in all affected subjects and in four presymptomatic children. In familial pheochromocytoma the diagnosis of VHL should be considered, even when the formal criteria for diagnosis of the syndrome are lacking. 16 refs., 2 figs.

  13. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

    (P = 9.01 × 10-7), CNNM2 (P = 6.07 × 10-7), and NT5C2 (P = 4.09 × 10-7). To explore the many small effects, we performed pathway analyses. The most significant pathways involved neuronal function (axonal guidance, neuronal systems, and L1 cell adhesion molecule interaction) and the immune system...... genes. DESIGN We integrated results from a meta-analysis of 18 genome-wide association studies (GWAS) involving 1 085 772 single-nucleotide polymorphisms (SNPs) and 6 databases that showed significant informativeness for SCZ. The 9380 most promising SNPs were then specifically genotyped...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  14. Digital Gene Expression Analysis Based on De Novo Transcriptome Assembly Reveals New Genes Associated with Floral Organ Differentiation of the Orchid Plant Cymbidium ensifolium.

    Directory of Open Access Journals (Sweden)

    Fengxi Yang

    Full Text Available Cymbidium ensifolium belongs to the genus Cymbidium of the orchid family. Owing to its spectacular flower morphology, C. ensifolium has considerable ecological and cultural value. However, limited genetic data is available for this non-model plant, and the molecular mechanism underlying floral organ identity is still poorly understood. In this study, we characterize the floral transcriptome of C. ensifolium and present, for the first time, extensive sequence and transcript abundance data of individual floral organs. After sequencing, over 10 Gb clean sequence data were generated and assembled into 111,892 unigenes with an average length of 932.03 base pairs, including 1,227 clusters and 110,665 singletons. Assembled sequences were annotated with gene descriptions, gene ontology, clusters of orthologous group terms, the Kyoto Encyclopedia of Genes and Genomes, and the plant transcription factor database. From these annotations, 131 flowering-associated unigenes, 61 CONSTANS-LIKE (COL unigenes and 90 floral homeotic genes were identified. In addition, four digital gene expression libraries were constructed for the sepal, petal, labellum and gynostemium, and 1,058 genes corresponding to individual floral organ development were identified. Among them, eight MADS-box genes were further investigated by full-length cDNA sequence analysis and expression validation, which revealed two APETALA1/AGL9-like MADS-box genes preferentially expressed in the sepal and petal, two AGAMOUS-like genes particularly restricted to the gynostemium, and four DEF-like genes distinctively expressed in different floral organs. The spatial expression of these genes varied distinctly in different floral mutant corresponding to different floral morphogenesis, which validated the specialized roles of them in floral patterning and further supported the effectiveness of our in silico analysis. This dataset generated in our study provides new insights into the molecular mechanisms

  15. Enhancer transcription reveals subtype-specific gene expression programs controlling breast cancer pathogenesis.

    Science.gov (United States)

    Franco, Hector L; Nagari, Anusha; Malladi, Venkat S; Li, Wenqian; Xi, Yuanxin; Richardson, Dana; Allton, Kendra L; Tanaka, Kaori; Li, Jing; Murakami, Shino; Keyomarsi, Khandan; Bedford, Mark T; Shi, Xiaobing; Li, Wei; Barton, Michelle C; Dent, Sharon Y R; Kraus, W Lee

    2018-02-01

    Noncoding transcription is a defining feature of active enhancers, linking transcription factor (TF) binding to the molecular mechanisms controlling gene expression. To determine the relationship between enhancer activity and biological outcomes in breast cancers, we profiled the transcriptomes (using GRO-seq and RNA-seq) and epigenomes (using ChIP-seq) of 11 different human breast cancer cell lines representing five major molecular subtypes of breast cancer, as well as two immortalized ("normal") human breast cell lines. In addition, we developed a robust and unbiased computational pipeline that simultaneously identifies putative subtype-specific enhancers and their cognate TFs by integrating the magnitude of enhancer transcription, TF mRNA expression levels, TF motif P -values, and enrichment of H3K4me1 and H3K27ac. When applied across the 13 different cell lines noted above, the Total Functional Score of Enhancer Elements (TFSEE) identified key breast cancer subtype-specific TFs that act at transcribed enhancers to dictate gene expression patterns determining growth outcomes, including Forkhead TFs, FOSL1, and PLAG1. FOSL1, a Fos family TF, (1) is highly enriched at the enhancers of triple negative breast cancer (TNBC) cells, (2) acts as a key regulator of the proliferation and viability of TNBC cells, but not Luminal A cells, and (3) is associated with a poor prognosis in TNBC breast cancer patients. Taken together, our results validate our enhancer identification pipeline and reveal that enhancers transcribed in breast cancer cells direct critical gene regulatory networks that promote pathogenesis. © 2018 Franco et al.; Published by Cold Spring Harbor Laboratory Press.

  16. The SWEET gene family in Hevea brasiliensis - its evolution and expression compared with four other plant species.

    Science.gov (United States)

    Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong

    2017-12-01

    SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.

  17. Perforin gene mutation in familial haemophagocytic lymphohistiocytosis: the first reported case from Hong Kong.

    Science.gov (United States)

    Chiang, Grace P K; Li, C K; Lee, Vincent; Cheng, Frankie W T; Leung, Alex W K; Imashuku, Shinsaku; Imamura, Toshihiko; Shing, Matthew M K

    2014-08-01

    Familial haemophagocytic lymphohistiocytosis is a rare but invariably fatal disease without haematopoietic stem cell transplantation. Genetic defect identification is useful for confirming a clinical diagnosis, predicting the risk of future recurrence, and defining haemophagocytic lymphohistiocytosis predisposition in asymptomatic family members. Notably, familial haemophagocytic lymphohistiocytosis type 2 associates with mutations in the perforin gene (PRF1) which is the most frequent subtype of familial haemophagocytic lymphohistiocytosis. Although perforin gene mutations have been described in Asians, they are largely reported from Japan. The case reported here is the first familial haemophagocytic lymphohistiocytosis type 2 patient in Hong Kong with an identified perforin gene mutation.

  18. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  19. Limitations of the Echinococcus granulosus genome sequence assemblies for analysis of the gene family encoding the EG95 vaccine antigen.

    Science.gov (United States)

    Gauci, Charles G; Alvarez Rojas, Cristian A; Chow, Conan; Lightowlers, Marshall W

    2017-11-27

    Echinococcus granulosus is an important zoonotic parasite that is distributed worldwide. The EG95 vaccine was developed to assist with control of E. granulosus transmission through the parasite's livestock intermediate hosts. The vaccine is based on a recombinant antigen encoded by a gene which is a member of a multi-gene family. With the recent availability of two E. granulosus draft genomes, we sought to map the eg95 gene family to the genomes. We were unable to map unequivocally any of the eg95 gene family members which had previously been characterized by cloning and sequencing both strands of genomic DNA fragments. Our inability to map EG95-related genes to the genomes has revealed limitations in the assembled sequence data when utilized for gene family analyses. This study contrasts with the expectations expressed in often high-profile publications describing draft genomes of parasitic organisms, highlighting deficiencies in currently available genomic resources for E. granulosus and provides a cautionary note for research which seeks to utilize these genome datasets.

  20. AtSIG6 and other members of the sigma gene family jointly but differentially determine plastid target gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Sylvia eBock

    2014-11-01

    Full Text Available Plants contain a nuclear gene family for plastid sigma factors, i.e. proteins that associate with the bacterial-type organellar RNA polymerase and confer the ability for correct promoter binding and transcription initiation. Questions that are still unresolved relate to the division of labour among members of the sigma family, both in terms of their range of target genes and their temporal and spatial activity during development. Clues to the in vivo role of individual sigma genes have mainly come from studies of sigma knockout lines. Despite its obvious strengths, however, this strategy does not necessarily trace-down causal relationships between mutant phenotype and a single sigma gene, if other family members act in a redundant and/or compensatory manner. We made efforts to reduce the complexity by genetic crosses of Arabidopsis single mutants (with focus on a chlorophyll-deficient sig6 line to generate double knockout lines. The latter typically had a similar visible phenotype as the parental lines, but tended to be more strongly affected in the transcript patterns of both plastid and sigma genes. Because triple mutants were lethal under our growth conditions, we exploited a strategy of transformation of single and double mutants with RNAi constructs that contained sequences from the unconserved sigma region (UCR. These RNAi/knockout lines phenotypically resembled their parental lines, but were even more strongly affected in their plastid transcript patterns. Expression patterns of sigma genes revealed both similarities and differences compared to the parental lines, with transcripts at reduced or unchanged amounts and others that were found to be present in higher (perhaps compensatory amounts. Together, our results reveal considerable flexibility of gene activity at the levels of both sigma and plastid gene expression. A (still viable basal state seems to be reached, if 2 - 3 of the 6 Arabidopsis sigma genes are functionally compromised.

  1. The ABC gene family in arthropods: comparative genomics and role in insecticide transport and resistance.

    Science.gov (United States)

    Dermauw, Wannes; Van Leeuwen, Thomas

    2014-02-01

    About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority of ABC proteins function as primary-active transporters that bind and hydrolyze ATP while transporting a large diversity of substrates across lipid membranes. Although extremely well studied in vertebrates for their role in drug resistance, less is known about the role of this family in the transport of endogenous and exogenous substances in arthropods. The ABC families of five insect species, a crustacean and a chelicerate have been annotated in some detail. We conducted a thorough phylogenetic analysis of the seven arthropod and human ABC protein subfamilies, to infer orthologous relationships that might suggest conserved function. Most orthologous relationships were found in the ABCB half transporter, ABCD, ABCE and ABCF subfamilies, but specific expansions within species and lineages are frequently observed and discussed. We next surveyed the role of ABC transporters in the transport of xenobiotics/plant allelochemicals and their involvement in insecticide resistance. The involvement of ABC transporters in xenobiotic resistance in arthropods is historically not well documented, but an increasing number of studies using unbiased differential gene expression analysis now points to their importance. We give an overview of methods that can be used to link ABC transporters to resistance. ABC proteins have also recently been implicated in the mode of action and resistance to Bt toxins in Lepidoptera. Given the enormous interest in Bt toxicology in transgenic crops, such findings will provide an impetus to further reveal the role of ABC transporters in arthropods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Dissecting the complex molecular evolution and expression of polygalacturonase gene family in Brassica rapa ssp. chinensis.

    Science.gov (United States)

    Liang, Ying; Yu, Youjian; Shen, Xiuping; Dong, Heng; Lyu, Meiling; Xu, Liai; Ma, Zhiming; Liu, Tingting; Cao, Jiashu

    2015-12-01

    Polygalacturonases (PGs) participate in pectin disassembly of cell wall and belong to one of the largest hydrolase families in plants. In this study, we identified 99 PG genes in Brassica rapa. Comprehensive analysis of phylogeny, gene structures, physico-chemical properties and coding sequence evolution demonstrated that plant PGs should be classified into seven divergent clades and each clade's members had specific sequence and structure characteristics, and/or were under specific selection pressures. Genomic distribution and retention rate analysis implied duplication events and biased retention contributed to PG family's expansion. Promoter divergence analysis using "shared motif method" revealed a significant correlation between regulatory and coding sequence evolution of PGs, and proved Clades A and E were of ancient origin. Quantitative real-time PCR analysis showed that expression patterns of PGs displayed group specificities in B. rapa. Particularly, nearly half of PG family members, especially those of Clades C, D and F, closely relates to reproductive development. Most duplicates showed similar expression profiles, suggesting dosage constraints accounted for preservation after duplication. Promoter-GUS assay further indicated PGs' extensive roles and possible redundancy during reproductive development. This work can provide a scientific classification of plant PGs, dissect the internal relationships between their evolution and expressions, and promote functional researches.

  3. Revisiting Vitis vinifera subtilase gene family: a possible role in grapevine resistance against Plasmopara viticola

    Directory of Open Access Journals (Sweden)

    Joana Figueiredo

    2016-11-01

    Full Text Available Subtilisin-like proteases, also known as subtilases, are a very diverse family of serine peptidases present in many organisms. In grapevine, there are hints of the involvement of subtilases in defence mechanisms, but their role is not yet understood. The first characterization of the subtilase gene family was performed in 2014. However, simultaneously, the grapevine genome was re-annotated and several sequences were re-annotated or retrieved. We have performed a re-characterization of this family in grapevine and identified 82 genes coding for 97 putative proteins, as result of alternative splicing. All the subtilases identified present the characteristic S8 peptidase domain and the majority of them also have a pro-domain I9 inhibitor, a protease-associated (PA domain and a signal peptide for targeting to the secretory pathway. Phylogenetic studies revealed six subtilase groups denominated VvSBT1 to VvSBT6. As several evidences have highlighted the participation of plant subtilases in response to biotic stimulus, we have investigated subtilase participation in grapevine resistance to Plasmopara viticola, the causative agent of downy mildew. Fourteen grapevine subtilases presenting either high homology to P69C from tomato, SBT3.3 from Arabidopsis thaliana or located near the Resistance to Plasmopara viticola (RPV locus were selected. Expression studies were conducted in the grapevine-P. viticola pathosystem with resistant and susceptible cultivars. Our results may indicate that some of grapevine subtilisins are potentially participating in the defence response against this biotrophic oomycete.

  4. DNA capture reveals transoceanic gene flow in endangered river sharks.

    Science.gov (United States)

    Li, Chenhong; Corrigan, Shannon; Yang, Lei; Straube, Nicolas; Harris, Mark; Hofreiter, Michael; White, William T; Naylor, Gavin J P

    2015-10-27

    For over a hundred years, the "river sharks" of the genus Glyphis were only known from the type specimens of species that had been collected in the 19th century. They were widely considered extinct until populations of Glyphis-like sharks were rediscovered in remote regions of Borneo and Northern Australia at the end of the 20th century. However, the genetic affinities between the newly discovered Glyphis-like populations and the poorly preserved, original museum-type specimens have never been established. Here, we present the first (to our knowledge) fully resolved, complete phylogeny of Glyphis that includes both archival-type specimens and modern material. We used a sensitive DNA hybridization capture method to obtain complete mitochondrial genomes from all of our samples and show that three of the five described river shark species are probably conspecific and widely distributed in Southeast Asia. Furthermore we show that there has been recent gene flow between locations that are separated by large oceanic expanses. Our data strongly suggest marine dispersal in these species, overturning the widely held notion that river sharks are restricted to freshwater. It seems that species in the genus Glyphis are euryhaline with an ecology similar to the bull shark, in which adult individuals live in the ocean while the young grow up in river habitats with reduced predation pressure. Finally, we discovered a previously unidentified species within the genus Glyphis that is deeply divergent from all other lineages, underscoring the current lack of knowledge about the biodiversity and ecology of these mysterious sharks.

  5. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium

    KAUST Repository

    Rao, Pavitra N.

    2016-06-14

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also present earlier in the Alveolata in the free-living, non-parasitophorous, photosynthetic chromerids, Chromera and Vitrella. In P. falciparum and P. berghei blood stage parasites the transcripts of all nine cpw-wpc genes have been detected in gametocytes. RNA immunoprecipitation followed by reverse transcriptase-PCR reveals all P. berghei cpw-wpc transcripts to be bound by the translational repressors DOZI and CITH, and thus are likely under translational control prior to transmission from the rodent host to the mosquito vector in P. berghei. The GFP tagging of two endogenous P. berghei genes confirmed translational silencing in the gametocyte and translation in ookinetes. Establishing a luciferase transgene assay we show that the 3′ untranslated region of PF3D7_1331400 controls protein expression of this reporter in P. falciparum gametocytes. Our analyses suggest that cpw-wpc genes are translationally silenced in gametocytes across Plasmodium spp. and activated during ookinete formation and thus may have a role in transmission to the mosquito.

  6. Patterns of positive selection of the myogenic regulatory factor gene family in vertebrates.

    Science.gov (United States)

    Zhao, Xiao; Yu, Qi; Huang, Ling; Liu, Qing-Xin

    2014-01-01

    The functional divergence of transcriptional factors is critical in the evolution of transcriptional regulation. However, the mechanism of functional divergence among these factors remains unclear. Here, we performed an evolutionary analysis for positive selection in members of the myogenic regulatory factor (MRF) gene family of vertebrates. We selected 153 complete vertebrate MRF nucleotide sequences from our analyses, which revealed substantial evidence of positive selection. Here, we show that sites under positive selection were more frequently detected and identified from the genes encoding the myogenic differentiation factors (MyoG and Myf6) than the genes encoding myogenic determination factors (Myf5 and MyoD). Additionally, the functional divergence within the myogenic determination factors or differentiation factors was also under positive selection pressure. The positive selection sites were more frequently detected from MyoG and MyoD than Myf6 and Myf5, respectively. Amino acid residues under positive selection were identified mainly in their transcription activation domains and on the surface of protein three-dimensional structures. These data suggest that the functional gain and divergence of myogenic regulatory factors were driven by distinct positive selection of their transcription activation domains, whereas the function of the DNA binding domains was conserved in evolution. Our study evaluated the mechanism of functional divergence of the transcriptional regulation factors within a family, whereby the functions of their transcription activation domains diverged under positive selection during evolution.

  7. Fusion gene microarray reveals cancer type-specificity among fusion genes.

    Science.gov (United States)

    Løvf, Marthe; Thomassen, Gard O S; Bakken, Anne Cathrine; Celestino, Ricardo; Fioretos, Thoas; Lind, Guro E; Lothe, Ragnhild A; Skotheim, Rolf I

    2011-05-01

    Detection of fusion genes for diagnostic purposes and as a guide to treatment is well-established in hematological malignancies, and the prevalence of fusion genes in epithelial cancers is also increasingly appreciated. To study whether established fusion genes are present within additional cancer types, we have used an updated version of our fusion gene microarray in a systematic survey of reported fusion genes in multiple cancer types. We assembled a comprehensive database of published fusion genes, including those reported only in individual studies and samples, and fusion genes resulting from deep sequencing of cancer genomes and transcriptomes. From the total set of 548 fusion genes, we designed 599,839 oligonucleotides, targeting both chimeric transcript junctions as well as sequences internal to each of the fusion gene partners. We investigated the presence of fusion genes in a series of 67 cell lines representing 15 different cancer types. Data from ten leukemia cell lines with known fusion gene status were used to develop an automated scoring algorithm, and in five cell lines the correct fusion gene was the top scoring hit, and one came second. Two additional fusion genes, BCAS4-BCAS3 in the MCF-7 breast cancer cell line and CCDC6-RET in the TPC-1 thyroid cancer cell line were validated as true positive fusion transcripts. However, these fusion genes were not new to these cancer types, and none of 548 fusion genes were identified from a novel cancer type. We therefore find it unlikely that the assayed fusion genes are commonly present across multiple cancer types. 2011 Wiley-Liss, Inc.

  8. Extensive expansion of A1 family aspartic proteinases in fungi revealed by evolutionary analyses of 107 complete eukaryotic proteomes

    NARCIS (Netherlands)

    Revuelta, M.V.; Kan, van J.A.L.; Kay, J.; Have, ten A.

    2014-01-01

    The A1 family of eukaryotic aspartic proteinases (APs) forms one of the 16 AP families. Although one of the best characterized families, the recent increase in genome sequence data has revealed many fungal AP homologs with novel sequence characteristics. This study was performed to explore the

  9. Genome-wide identification, phylogenetic and co-expression analysis of OsSET gene family in rice.

    Directory of Open Access Journals (Sweden)

    Zhanhua Lu

    Full Text Available BACKGROUND: SET domain is responsible for the catalytic activity of histone lysine methyltransferases (HKMTs during developmental process. Histone lysine methylation plays a crucial and diverse regulatory function in chromatin organization and genome function. Although several SET genes have been identified and characterized in plants, the understanding of OsSET gene family in rice is still very limited. METHODOLOGY/PRINCIPAL FINDINGS: In this study, a systematic analysis was performed and revealed the presence of at least 43 SET genes in rice genome. Phylogenetic and structural analysis grouped SET proteins into five classes, and supposed that the domains out of SET domain were significant for the specific of histone lysine methylation, as well as the recognition of methylated histone lysine. Based on the global microarray, gene expression profile revealed that the transcripts of OsSET genes were accumulated differentially during vegetative and reproductive developmental stages and preferentially up or down-regulated in different tissues. Cis-elements identification, co-expression analysis and GO analysis of expression correlation of 12 OsSET genes suggested that OsSET genes might be involved in cell cycle regulation and feedback. CONCLUSIONS/SIGNIFICANCE: This study will facilitate further studies on OsSET family and provide useful clues for functional validation of OsSETs.

  10. De novo transcriptome and small RNA analysis of two Chinese willow cultivars reveals stress response genes in Salix matsudana.

    Directory of Open Access Journals (Sweden)

    Guodong Rao

    Full Text Available Salix matsudana Koidz. is a deciduous, rapidly growing, and drought resistant tree and is one of the most widely distributed and commonly cultivated willow species in China. Currently little transcriptomic and small RNAomic data are available to reveal the genes involve in the stress resistant in S. matsudana. Here, we report the RNA-seq analysis results of both transcriptome and small RNAome data using Illumina deep sequencing of shoot tips from two willow variants(Salix. matsudana and Salix matsudana Koidz. cultivar 'Tortuosa'. De novo gene assembly was used to generate the consensus transcriptome and small RNAome, which contained 106,403 unique transcripts with an average length of 944 bp and a total length of 100.45 MB, and 166 known miRNAs representing 35 miRNA families. Comparison of transcriptomes and small RNAomes combined with quantitative real-time PCR from the two Salix libraries revealed a total of 292 different expressed genes(DEGs and 36 different expressed miRNAs (DEMs. Among the DEGs and DEMs, 196 genes and 24 miRNAs were up regulated, 96 genes and 12 miRNA were down regulated in S. matsudana. Functional analysis of DEGs and miRNA targets showed that many genes were involved in stress resistance in S. matsudana. Our global gene expression profiling presents a comprehensive view of the transcriptome and small RNAome which provide valuable information and sequence resources for uncovering the stress response genes in S. matsudana. Moreover the transcriptome and small RNAome data provide a basis for future study of genetic resistance in Salix.

  11. De novo transcriptome and small RNA analysis of two Chinese willow cultivars reveals stress response genes in Salix matsudana.

    Science.gov (United States)

    Rao, Guodong; Sui, Jinkai; Zeng, Yanfei; He, Caiyun; Duan, Aiguo; Zhang, Jianguo

    2014-01-01

    Salix matsudana Koidz. is a deciduous, rapidly growing, and drought resistant tree and is one of the most widely distributed and commonly cultivated willow species in China. Currently little transcriptomic and small RNAomic data are available to reveal the genes involve in the stress resistant in S. matsudana. Here, we report the RNA-seq analysis results of both transcriptome and small RNAome data using Illumina deep sequencing of shoot tips from two willow variants(Salix. matsudana and Salix matsudana Koidz. cultivar 'Tortuosa'). De novo gene assembly was used to generate the consensus transcriptome and small RNAome, which contained 106,403 unique transcripts with an average length of 944 bp and a total length of 100.45 MB, and 166 known miRNAs representing 35 miRNA families. Comparison of transcriptomes and small RNAomes combined with quantitative real-time PCR from the two Salix libraries revealed a total of 292 different expressed genes(DEGs) and 36 different expressed miRNAs (DEMs). Among the DEGs and DEMs, 196 genes and 24 miRNAs were up regulated, 96 genes and 12 miRNA were down regulated in S. matsudana. Functional analysis of DEGs and miRNA targets showed that many genes were involved in stress resistance in S. matsudana. Our global gene expression profiling presents a comprehensive view of the transcriptome and small RNAome which provide valuable information and sequence resources for uncovering the stress response genes in S. matsudana. Moreover the transcriptome and small RNAome data provide a basis for future study of genetic resistance in Salix.

  12. The globin gene family of the cephalochordate amphioxus: implications for chordate globin evolution

    Directory of Open Access Journals (Sweden)

    Marden Michael C

    2010-11-01

    Full Text Available Abstract Background The lancelet amphioxus (Cephalochordata is a close relative of vertebrates and thus may enhance our understanding of vertebrate gene and genome evolution. In this context, the globins are one of the best studied models for gene family evolution. Previous biochemical studies have demonstrated the presence of an intracellular globin in notochord tissue and myotome of amphioxus, but the corresponding gene has not yet been identified. Genomic resources of Branchiostoma floridae now facilitate the identification, experimental confirmation and molecular evolutionary analysis of its globin gene repertoire. Results We show that B. floridae harbors at least fifteen paralogous globin genes, all of which reveal evidence of gene expression. The protein sequences of twelve globins display the conserved characteristics of a functional globin fold. In phylogenetic analyses, the amphioxus globin BflGb4 forms a common clade with vertebrate neuroglobins, indicating the presence of this nerve globin in cephalochordates. Orthology is corroborated by conserved syntenic linkage of BflGb4 and flanking genes. The kinetics of ligand binding of recombinantly expressed BflGb4 reveals that this globin is hexacoordinated with a high oxygen association rate, thus strongly resembling vertebrate neuroglobin. In addition, possible amphioxus orthologs of the vertebrate globin X lineage and of the myoglobin/cytoglobin/hemoglobin lineage can be identified, including one gene as a candidate for being expressed in notochord tissue. Genomic analyses identify conserved synteny between amphioxus globin-containing regions and the vertebrate β-globin locus, possibly arguing against a late transpositional origin of the β-globin cluster in vertebrates. Some amphioxus globin gene structures exhibit minisatellite-like tandem duplications of intron-exon boundaries ("mirages", which may serve to explain the creation of novel intron positions within the globin genes

  13. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  14. Constraints on genome dynamics revealed from gene distribution among the Ralstonia solanacearum species.

    Directory of Open Access Journals (Sweden)

    Pierre Lefeuvre

    Full Text Available Because it is suspected that gene content may partly explain host adaptation and ecology of pathogenic bacteria, it is important to study factors affecting genome composition and its evolution. While recent genomic advances have revealed extremely large pan-genomes for some bacterial species, it remains difficult to predict to what extent gene pool is accessible within or transferable between populations. As genomes bear imprints of the history of the organisms, gene distribution pattern analyses should provide insights into the forces and factors at play in the shaping and maintaining of bacterial genomes. In this study, we revisited the data obtained from a previous CGH microarrays analysis in order to assess the genomic plasticity of the R. solanacearum species complex. Gene distribution analyses demonstrated the remarkably dispersed genome of R. solanacearum with more than half of the genes being accessory. From the reconstruction of the ancestral genomes compositions, we were able to infer the number of gene gain and loss events along the phylogeny. Analyses of gene movement patterns reveal that factors associated with gene function, genomic localization and ecology delineate gene flow patterns. While the chromosome displayed lower rates of movement, the megaplasmid was clearly associated with hot-spots of gene gain and loss. Gene function was also confirmed to be an essential factor in gene gain and loss dynamics with significant differences in movement patterns between different COG categories. Finally, analyses of gene distribution highlighted possible highways of horizontal gene transfer. Due to sampling and design bias, we can only speculate on factors at play in this gene movement dynamic. Further studies examining precise conditions that favor gene transfer would provide invaluable insights in the fate of bacteria, species delineation and the emergence of successful pathogens.

  15. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  16. Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, andexpression analysis

    Directory of Open Access Journals (Sweden)

    Glen Peter

    2009-12-01

    Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig

  17. Dual gene activation and knockout screen reveals directional dependencies in genetic networks. | Office of Cancer Genomics

    Science.gov (United States)

    Understanding the direction of information flow is essential for characterizing how genetic networks affect phenotypes. However, methods to find genetic interactions largely fail to reveal directional dependencies. We combine two orthogonal Cas9 proteins from Streptococcus pyogenes and Staphylococcus aureus to carry out a dual screen in which one gene is activated while a second gene is deleted in the same cell. We analyze the quantitative effects of activation and knockout to calculate genetic interaction and directionality scores for each gene pair.

  18. Adaptive evolution of the Hox gene family for development in bats and dolphins.

    Directory of Open Access Journals (Sweden)

    Lu Liang

    Full Text Available Bats and cetaceans (i.e., whales, dolphins, porpoises are two kinds of mammals with unique locomotive styles and occupy novel niches. Bats are the only mammals capable of sustained flight in the sky, while cetaceans have returned to the aquatic environment and are specialized for swimming. Associated with these novel adaptations to their environment, various development changes have occurred to their body plans and associated structures. Given the importance of Hox genes in many aspects of embryonic development, we conducted an analysis of the coding regions of all Hox gene family members from bats (represented by Pteropus vampyrus, Pteropus alecto, Myotis lucifugus and Myotis davidii and cetaceans (represented by Tursiops truncatus for adaptive evolution using the available draft genome sequences. Differences in the selective pressures acting on many Hox genes in bats and cetaceans were found compared to other mammals. Positive selection, however, was not found to act on any of the Hox genes in the common ancestor of bats and only upon Hoxb9 in cetaceans. PCR amplification data from additional bat and cetacean species, and application of the branch-site test 2, showed that the Hoxb2 gene within bats had significant evidence of positive selection. Thus, our study, with genomic and newly sequenced Hox genes, identifies two candidate Hox genes that may be closely linked with developmental changes in bats and cetaceans, such as those associated with the pancreatic, neuronal, thymus shape and forelimb. In addition, the difference in our results from the genome-wide scan and newly sequenced data reveals that great care must be taken in interpreting results from draft genome data from a limited number of species, and deep genetic sampling of a particular clade is a powerful tool for generating complementary data to address this limitation.

  19. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    with microtubule-associated proteins. CTT residues overwhelming comprise the co-evolving residues between Drosophila alpha 2 and beta 3 tubulin proteins, indicating CTT specializations can be mediated at the level of the tubulin dimer. Gene duplications post-dating separation of the insect orders are unevenly distributed, most often appearing in major alpha 1 and minor beta 2 clades. More than 40 introns are found in tubulins. Their distribution among tubulins reveals that insertion and deletion events are common, surprising given their potential for disrupting tubulin coding sequence. Compensatory evolution is found in Drosophila beta 2 tubulin cis-regulation, and reveals selective pressures acting to maintain testis expression without the use of previously identified testis cis-regulatory elements. Conclusion Tubulins have stringent structure/function relationships, indicated by strong purifying selection, the loss of many gene duplication products, alpha-beta co-evolution in the tubulin dimer, and compensatory evolution in beta 2 tubulin cis-regulation. They evolve through gene duplication, subfunctionalization in expression domain and divergence of duplication products, largely in CTT residues that mediate interactions with other proteins. This has resulted in the tissue-specific minor insect isoforms, and in particular the highly diverse α3, α4, and β2 reproductive tissue-specific tubulin isoforms, illustrating that even a highly conserved protein family can participate in the adaptive process and respond to sexual selection.

  20. Diagnostic Yield of Sequencing Familial Hypercholesterolemia Genes in Severe Hypercholesterolemia

    Science.gov (United States)

    Khera, Amit V.; Won, Hong-Hee; Peloso, Gina M.; Lawson, Kim S.; Bartz, Traci M.; Deng, Xuan; van Leeuwen, Elisabeth M.; Natarajan, Pradeep; Emdin, Connor A.; Bick, Alexander G.; Morrison, Alanna C.; Brody, Jennifer A.; Gupta, Namrata; Nomura, Akihiro; Kessler, Thorsten; Duga, Stefano; Bis, Joshua C.; van Duijn, Cornelia M.; Cupples, L. Adrienne; Psaty, Bruce; Rader, Daniel J.; Danesh, John; Schunkert, Heribert; McPherson, Ruth; Farrall, Martin; Watkins, Hugh; Lander, Eric; Wilson, James G.; Correa, Adolfo; Boerwinkle, Eric; Merlini, Piera Angelica; Ardissino, Diego; Saleheen, Danish; Gabriel, Stacey; Kathiresan, Sekar

    2017-01-01

    Background About 7% of US adults have severe hypercholesterolemia (untreated LDL cholesterol ≥190 mg/dl). Such high LDL levels may be due to familial hypercholesterolemia (FH), a condition caused by a single mutation in any of three genes. Lifelong elevations in LDL cholesterol in FH mutation carriers may confer CAD risk beyond that captured by a single LDL cholesterol measurement. Objectives Assess the prevalence of a FH mutation among those with severe hypercholesterolemia and determine whether CAD risk varies according to mutation status beyond the observed LDL cholesterol. Methods Three genes causative for FH (LDLR, APOB, PCSK9) were sequenced in 26,025 participants from 7 case-control studies (5,540 CAD cases, 8,577 CAD-free controls) and 5 prospective cohort studies (11,908 participants). FH mutations included loss-of-function variants in LDLR, missense mutations in LDLR predicted to be damaging, and variants linked to FH in ClinVar, a clinical genetics database. Results Among 8,577 CAD-free control participants, 430 had LDL cholesterol ≥190 mg/dl; of these, only eight (1.9%) carried a FH mutation. Similarly, among 11,908 participants from 5 prospective cohorts, 956 had LDL cholesterol ≥190 mg/dl and of these, only 16 (1.7%) carried a FH mutation. Within any stratum of observed LDL cholesterol, risk of CAD was higher among FH mutation carriers when compared with non-carriers. When compared to a reference group with LDL cholesterol <130 mg/dl and no mutation, participants with LDL cholesterol ≥190 mg/dl and no FH mutation had six-fold higher risk for CAD (OR 6.0; 95%CI 5.2–6.9) whereas those with LDL cholesterol ≥190 mg/dl as well as a FH mutation demonstrated twenty-two fold increased risk (OR 22.3; 95%CI 10.7–53.2). Conclusions Among individuals with LDL cholesterol ≥190 mg/dl, gene sequencing identified a FH mutation in <2%. However, for any given observed LDL cholesterol, FH mutation carriers are at substantially increased risk for CAD

  1. Transcriptome analysis reveals key differentially expressed genes involved in wheat grain development

    Directory of Open Access Journals (Sweden)

    Yonglong Yu

    2016-04-01

    Full Text Available Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20 during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further information about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.

  2. Comparative genomics of four closely related Clostridium perfringens bacteriophages reveals variable evolution among core genes with therapeutic potential

    Directory of Open Access Journals (Sweden)

    Siragusa Gregory R

    2011-06-01

    Full Text Available Abstract Background Because biotechnological uses of bacteriophage gene products as alternatives to conventional antibiotics will require a thorough understanding of their genomic context, we sequenced and analyzed the genomes of four closely related phages isolated from Clostridium perfringens, an important agricultural and human pathogen. Results Phage whole-genome tetra-nucleotide signatures and proteomic tree topologies correlated closely with host phylogeny. Comparisons of our phage genomes to 26 others revealed three shared COGs; of particular interest within this core genome was an endolysin (PF01520, an N-acetylmuramoyl-L-alanine amidase and a holin (PF04531. Comparative analyses of the evolutionary history and genomic context of these common phage proteins revealed two important results: 1 strongly significant host-specific sequence variation within the endolysin, and 2 a protein domain architecture apparently unique to our phage genomes in which the endolysin is located upstream of its associated holin. Endolysin sequences from our phages were one of two very distinct genotypes distinguished by variability within the putative enzymatically-active domain. The shared or core genome was comprised of genes with multiple sequence types belonging to five pfam families, and genes belonging to 12 pfam families, including the holin genes, which were nearly identical. Conclusions Significant genomic diversity exists even among closely-related bacteriophages. Holins and endolysins represent conserved functions across divergent phage genomes and, as we demonstrate here, endolysins can have significant variability and host-specificity even among closely-related genomes. Endolysins in our phage genomes may be subject to different selective pressures than the rest of the genome. These findings may have important implications for potential biotechnological applications of phage gene products.

  3. Complexity of CNC transcription factors as revealed by gene targeting of the Nrf3 locus.

    Science.gov (United States)

    Derjuga, Anna; Gourley, Tania S; Holm, Teresa M; Heng, Henry H Q; Shivdasani, Ramesh A; Ahmed, Rafi; Andrews, Nancy C; Blank, Volker

    2004-04-01

    Cap'n'collar (CNC) family basic leucine zipper transcription factors play crucial roles in the regulation of mammalian gene expression and development. To determine the in vivo function of the CNC protein Nrf3 (NF-E2-related factor 3), we generated mice deficient in this transcription factor. We performed targeted disruption of two Nrf3 exons coding for CNC homology, basic DNA-binding, and leucine zipper dimerization domains. Nrf3 null mice developed normally and revealed no obvious phenotypic differences compared to wild-type animals. Nrf3(-/-) mice were fertile, and gross anatomy as well as behavior appeared normal. The mice showed normal age progression and did not show any apparent additional phenotype during their life span. We observed no differences in various blood parameters and chemistry values. We infected wild-type and Nrf3(-/-) mice with acute lymphocytic choriomeningitis virus and found no differences in these animals with respect to their number of virus-specific CD8 and CD4 T cells as well as their B-lymphocyte response. To determine whether the mild phenotype of Nrf3 null animals is due to functional redundancy, we generated mice deficient in multiple CNC factors. Contrary to our expectations, an absence of Nrf3 does not seem to cause additional lethality in compound Nrf3(-/-)/Nrf2(-/-) and Nrf3(-/-)/p45(-/-) mice. We hypothesize that the role of Nrf3 in vivo may become apparent only after appropriate challenge to the mice.

  4. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  5. Chromosomal mapping reveals a dynamic organization of the histone genes in aphids (Hemiptera: Aphididae

    Directory of Open Access Journals (Sweden)

    M. Mandrioli

    2013-07-01

    Full Text Available Despite their involvement in different processes, histone genes have been analysed in few insects. In order to improve the knowledge about this important gene family, genes coding for histones have been analysed in the aphid Acyrthosiphon pisum showing that at the amino acid level, aphid histones are highly conserved. In particular, data from A. pisum confirm that H1 is the most variable of the five histones, whereas histones H3 and H4 are highly conserved with the H3 almost identical from insects to vertebrates. A. pisum histone genes are organized in a quintet with the H1 gene followed by H2A and H2B genes that are adjacent and transcribed in same directions, in the opposite strand in respect to the H1 gene. At the 3’ end of the histone cluster, genes H3 and H4 constitute an oppositely transcribed pair. The span of the aphid histone genes (more than 7 kb is greater than the average length of the histone cluster till now reported in insects (about 5 kb. Furthermore, spacers that separate the aphid histone genes vary in length. The histone genes have been mapped in A. pisum and successively in the aphids Myzus persicae and Rhopalosiphum padi showing that they are present in a single large cluster located in an interstitial position of autosomes 1, differently from what reported in the Russian wheat aphid Diuraphis noxia, where histone genes have been localized in a telomere of the two X chromosomes suggesting a dynamic organization of this multigene family in aphids.

  6. Biochemical characterization of Sf9 Sp-family-like protein factors reveals interesting features.

    Science.gov (United States)

    Rasheedi, S; Ramachandran, A; Ehtesham, N Z; Hasnain, S E

    2007-01-01

    We earlier documented the involvement of novel Sp-family-like protein factors in transcription from the Autographa californica nucleopolyhedrovirus (AcNPV) polyhedrin (polh) gene promoter [Ramachandran et al. (2001) J. Biol. Chem. 276: 23440-23449]. These zinc-dependent Sp-like factors bind to two putative Sp-factor-binding motifs, present within the AcSp sequence upstream of the polh promoter, with very high affinity (K(d) = 2.1 x 10(-12) M). Like other polh-promoter-associated host transcription factors, these Sp-like factors display tolerance to high ion concentrations up to even 3 M NaCl. An electrophoretic mobility shift assay demonstrated a probable cross-talk between the Spodoptera frugiperda (Sf9) Sp-family-like proteins and the TFIID complex. In complementary experiments, specific replacements of the Sp-factor-binding motifs with TATA-like elements resulted in expression of a luciferase reporter gene to almost the same level as that obtained with a wild-type native construct. Our results point to the possibility of the involvement of TFIID and Sf9 Sp protein interaction in transcription from the baculovirus polyhedrin promoter.

  7. A family-based test for correlation between gene expression and trait values.

    Science.gov (United States)

    Kraft, Peter; Schadt, Eric; Aten, Jason; Horvath, Steve

    2003-05-01

    Advances in microarray technology have made it attractive to combine information on clinical traits, marker genotypes, and comprehensive gene expression from family studies to dissect complex disease genetics. Without accounting for family structure, methods that test for association between a trait and gene-expression levels can be misleading. We demonstrate that the standard unstratified test based on Pearson's correlation coefficient can produce spurious results when applied to family data, and we present a stratified family expression association test (FEXAT). We illustrate the utility of the FEXAT via simulation and an application to gene-expression data from lymphoblastoid cell lines from four CEPH families. The FEXAT has a smaller estimated false-discovery rate than the standard test when within-family correlations are of interest, and it detects biologically plausible correlations between beta catenin and genes in the WNT-activation pathway in humans that the standard test does not.

  8. Identification and in silico analysis of the Citrus HSP70 molecular chaperone gene family

    Directory of Open Access Journals (Sweden)

    Luciano G. Fietto

    2007-01-01

    Full Text Available The completion of the genome sequencing of the Arabidopsis thaliana model system provided a powerful molecular tool for comparative analysis of gene families present in the genome of economically relevant plant species. In this investigation, we used the sequences of the Arabidopsis Hsp70 gene family to identify and annotate the Citrus Hsp70 genes represented in the CitEST database. Based on sequence comparison analysis, we identified 18 clusters that were further divided into 5 subgroups encoding four mitochondrial mtHsp70s, three plastid csHsp70s, one ER luminal Hsp70 BiP, two HSP110/SSE-related proteins and eight cytosolic Hsp/Hsc70s. We also analyzed the expression profile by digital Northern of each Hsp70 transcript in different organs and in response to stress conditions. The EST database revealed a distinct population distribution of Hsp70 ESTs among isoforms and across the organs surveyed. The Hsp70-5 isoform was highly expressed in seeds, whereas BiP, mitochondrial and plastid HSp70 mRNAs displayed a similar expression profile in the organs analyzed, and were predominantly represented in flowers. Distinct Hsp70 mRNAs were also differentially expressed during Xylella infection and Citrus tristeza viral infection as well as during water deficit. This in silico study sets the groundwork for future investigations to fully characterize functionally the Citrus Hsp70 family and underscores the relevance of Hsp70s in response to abiotic and biotic stresses in Citrus.

  9. A homozygous frameshift mutation in the HOXC13 gene underlies pure hair and nail ectodermal dysplasia in a Syrian family.

    Science.gov (United States)

    Farooq, Muhammad; Kurban, Mazen; Fujimoto, Atsushi; Fujikawa, Hiroki; Abbas, Ossama; Nemer, Georges; Saliba, Jessica; Sleiman, Rima; Tofaili, Mona; Kibbi, Abdul-Ghani; Ito, Masaaki; Shimomura, Yutaka

    2013-04-01

    Pure hair and nail ectodermal dysplasia (PHNED) is a rare genetic disorder characterized by hypotrichosis or complete alopecia, as well as nail dystrophy. Mutations in the type II hair keratin gene KRT85 and the HOXC13 gene on chromosome 12q have recently been identified in families with autosomal-recessive PHNED. In the present study, we have analyzed a consanguineous Syrian family with an affected girl having complete alopecia and nail dystrophy since birth. The family clearly showed linkage to chromosome 12q13.13-12q14.3, which excluded the KRT85 gene. Sequencing of another candidate gene HOXC13 within the linkage interval identified a homozygous frameshift mutation (c.355delC; p.Leu119Trpfs*20). Expression studies in cultured cells revealed that the mutant HOXC13 protein mislocalized within the cytoplasm, and failed to upregulate the promoter activities of its target genes. Our results strongly suggest crucial roles of the HOXC13 gene in the development of hair and nails in humans. © 2013 Wiley Periodicals, Inc.

  10. Mutations in BRCA1 and BRCA2 in breast cancer families: Are there more breast cancer-susceptibility genes?

    Energy Technology Data Exchange (ETDEWEB)

    Serova, O.M.; Mazoyer, S.; Putet, N. [CNRS, Lyon (France)] [and others

    1997-03-01

    To estimate the proportion of breast cancer families due to BRCA1 or BRCA2, we performed mutation screening of the entire coding regions of both genes supplemented with linkage analysis of 31 families, 8 containing male breast cancers and 23 site-specific female breast cancer. A combination of protein-truncation test and SSCP or heteroduplex analyses was used for mutation screening complemented, where possible, by the analysis of expression level of BRCA1 and BRCA2 alleles. Six of the eight families with male breast cancer revealed frameshift mutations, two in BRCA1 and four in BRCA2. Although most families with female site-specific breast cancers were thought to be due to mutations in either BRCA1 or BRCA2, we identified only eight mutations in our series of 23 site-specific female breast cancer families (34%), four in BRCA1 and four in BRCA2. According to the posterior probabilities calculated for mutation-negative families, based on linkage data and mutation screening results, we would expect 8-10 site-specific female breast cancer families of our series to be due to neither BRCA1 nor BRCA2. Thus, our results suggest the existence of at least one more major breast cancer-susceptibility gene. 24 refs., 1 fig., 3 tabs.

  11. Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Shan Goh

    Full Text Available BACKGROUND: Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. METHODOLOGY/PRINCIPAL FINDINGS: Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL(50. When applied to four growth essential genes, both RNA silencing methods resulted in MTL(50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. CONCLUSIONS: RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement.

  12. Genome-wide analysis and expression profiling under heat and drought treatments of HSP70 gene family in soybean (Glycine max L.).

    Science.gov (United States)

    Zhang, Ling; Zhao, Hong-Kun; Dong, Qian-Li; Zhang, Yuan-Yu; Wang, Yu-Min; Li, Hai-Yun; Xing, Guo-Jie; Li, Qi-Yun; Dong, Ying-Shan

    2015-01-01

    Heat shock proteins (HSPs) perform a fundamental role in protecting plants against abiotic stresses. Previous studies have made great efforts in the functional analysis of individual family members, but there has not yet been an overall analysis or expression profiling of the HSP70 gene family in soybeans (Glycine max L.). In this study, an investigation of the soybean genome revealed 61 putative HSP70 genes, which were evaluated. These genes were classified into eight sub-families, denoted I-VIII, based on a phylogenetic analysis. In each sub-family, the constituent parts of the gene structure and motif were relatively conserved. These GmHSP70 genes were distributed unequally on 17 of the 20 chromosomes. The analysis of the expression profiles showed that 53 of the 61 GmHSP70 genes were differentially expressed across the 14 tissues. However, most of the GmHSP70s were differentially expressed in a tissue-specific expression pattern. Furthermore, the expression of some of the duplicate genes was partially redundant, while others showed functional diversity. The quantitative real-time PCR (qRT-PCR) analysis of the 61 soybean HSP70 genes confirmed their stress-inducible expression patterns under both drought and heat stress. These findings provide a thorough overview of the evolution and modification of the GmHSP70 gene family, which will help to determine the functional characteristics of the HSP70 genes in soybean growth and development.

  13. Relaxation rates of gene expression kinetics reveal the feedback signs of autoregulatory gene networks

    Science.gov (United States)

    Jia, Chen; Qian, Hong; Chen, Min; Zhang, Michael Q.

    2018-03-01

    The transient response to a stimulus and subsequent recovery to a steady state are the fundamental characteristics of a living organism. Here we study the relaxation kinetics of autoregulatory gene networks based on the chemical master equation model of single-cell stochastic gene expression with nonlinear feedback regulation. We report a novel relation between the rate of relaxation, characterized by the spectral gap of the Markov model, and the feedback sign of the underlying gene circuit. When a network has no feedback, the relaxation rate is exactly the decaying rate of the protein. We further show that positive feedback always slows down the relaxation kinetics while negative feedback always speeds it up. Numerical simulations demonstrate that this relation provides a possible method to infer the feedback topology of autoregulatory gene networks by using time-series data of gene expression.

  14. The role of gene duplication and unconstrained selective pressures in the melanopsin gene family evolution and vertebrate circadian rhythm regulation.

    Directory of Open Access Journals (Sweden)

    Rui Borges

    Full Text Available Melanopsin is a photosensitive cell protein involved in regulating circadian rhythms and other non-visual responses to light. The melanopsin gene family is represented by two paralogs, OPN4x and OPN4m, which originated through gene duplication early in the emergence of vertebrates. Here we studied the melanopsin gene family using an integrated gene/protein evolutionary approach, which revealed that the rhabdomeric urbilaterian ancestor had the same amino acid patterns (DRY motif and the Y and E conterions as extant vertebrate species, suggesting that the mechanism for light detection and regulation is similar to rhabdomeric rhodopsins. Both OPN4m and OPN4x paralogs are found in vertebrate genomic paralogons, suggesting that they diverged following this duplication event about 600 million years ago, when the complex eye emerged in the vertebrate ancestor. Melanopsins generally evolved under negative selection (ω = 0.171 with some minor episodes of positive selection (proportion of sites = 25% and functional divergence (θ(I = 0.349 and θ(II = 0.126. The OPN4m and OPN4x melanopsin paralogs show evidence of spectral divergence at sites likely involved in melanopsin light absorbance (200F, 273S and 276A. Also, following the teleost lineage-specific whole genome duplication (3R that prompted the teleost fish radiation, type I divergence (θ(I = 0.181 and positive selection (affecting 11% of sites contributed to amino acid variability that we related with the photo-activation stability of melanopsin. The melanopsin intracellular regions had unexpectedly high variability in their coupling specificity of G-proteins and we propose that Gq/11 and Gi/o are the two G-proteins most-likely to mediate the melanopsin phototransduction pathway. The selection signatures were mainly observed on retinal-related sites and the third and second intracellular loops, demonstrating the physiological plasticity of the melanopsin protein group. Our results provide new

  15. [Cloning and analysis of three genes encoding type II CHH family neuropeptides from Fennropenaeus chinensis].

    Science.gov (United States)

    Wang, Zai-Zhao; Xiang, Jian-Hai

    2003-10-01

    On the basis of sequence similarity, the crustean hyperglycemic hormone (CHH) family peptides have been classified into two types of hormones: type I and type II. Molt-inhibiting hormone (MIH) is a neuropeptide member of type II CHH family. Molting in shrimp is controlled by MIH and ecdysone. By inhibiting the synthesis of ecdysone in the Y-organ, MIH indirectly suppresses the molting activity of shrimp. In this study, we reported the cloning and characterization of 3 gene fragments encoding type II CHH family neuropeptides of the shrimp Fennropenaeus chinensis. According to the complementary DNA sequence of the mult-inhibiting hormone of Fennropenaeus chinensis, 3 primers were designed and synthesized. MP1 and MP2 are sense primers, and MP3 is anti-sense primer. Polymerase chain reaction was performed using genomic DNA of Fennropenaeus chinensis as template. Three PCR products were obtained using primers MP1 and MP3. Their sizes are about 600 bp, 850 bp, 1050 bp, respectively. A 580 bp PCR product was obtained using primers MP2 and MP3. All the 4 PCR products were cloned into pMD18-T vector. The recombinant clones were sequenced using ABI 310 Genetic Analyzer. After sequencing, all the DNA sequences were searched in the GenBank by Blast program to find similar gene sequences. The searching results revealed 3 DNA fragment sequences were of high similarity with CHH family neuropeptide genes from various crustean species. The 3 DNA fragments were named as NP1, NP2, and NP3. Their sizes were 540 bp, 601 bp, and 826 bp, respectively. Using the mRNA sequences with the most similarity to the 3 sequence fragments as reference, the gene structure of the 3 DNA fragment sequences was analyzed. The exons of 3 sequence fragments were aligned with their similar sequences by Clustal W program. Both NP1 and NP2 consisted of 1 intron and 2 exons. NP3 consisted of 2 introns and 3 exons. Sequence analysis suggested that these 3 products belonged to sequence fragments of neuropeptide

  16. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  17. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  18. The Cryptococcus neoformans Catalase Gene Family and Its Role in Antioxidant Defense

    OpenAIRE

    Giles, Steven S.; Stajich, Jason E.; Nichols, Connie; Gerrald, Quincy D.; Alspaugh, J. Andrew; Dietrich, Fred; Perfect, John R.

    2006-01-01

    In the present study, we sought to elucidate the contribution of the Cryptococcus neoformans catalase gene family to antioxidant defense. We employed bioinformatics techniques to identify four members of the C. neoformans catalase gene family and created mutants lacking single or multiple catalase genes. Based on a phylogenetic analysis, CAT1 and CAT3 encode putative spore-specific catalases, CAT2 encodes a putative peroxisomal catalase, and CAT4 encodes a putative cytosolic catalase. Only Ca...

  19. Comprehensive analysis of the soybean (Glycine max GmLAX auxin transporter gene family

    Directory of Open Access Journals (Sweden)

    Chenglin eChai

    2016-03-01

    Full Text Available The phytohormone auxin plays a critical role in regulation of plant growth and development as well as plant responses to abiotic stresses. This is mainly achieved through its uneven distribution in plants via a polar auxin transport process. Auxin transporters are major players in polar auxin transport. The AUXIN RESISTANT 1 ⁄ LIKE AUX1 (AUX⁄LAX auxin influx carriers belong to the amino acid permease family of proton-driven transporters and function in the uptake of indole-3-acetic acid (IAA. In this study, genome-wide comprehensive analysis of the soybean AUX⁄LAX (GmLAX gene family, including phylogenic relationships, chromosome localization, and gene structure, were carried out. A total of 15 GmLAX genes, including seven duplicated gene pairs, were identified in the soybean genome. They were distributed on 10 chromosomes. Despite their higher percentage identities at the protein level, GmLAXs exhibited versatile tissue-specific expression patterns, indicating coordinated functioning during plant growth and development. Most GmLAXs were responsive to drought and dehydration stresses and auxin and abscisic acid (ABA stimuli, in a tissue- and/or time point- sensitive mode. Several GmLAX members were involved in responding to salt stress. Sequence analysis revealed that promoters of GmLAXs contained different combinations of stress-related cis-regulatory elements. These studies suggest that the soybean GmLAXs were under control of a very complex regulatory network, responding to various internal and external signals. This study helps to identity candidate GmLAXs for further analysis of their roles in soybean development and adaption to adverse environments.

  20. Genome-wide identification, phylogeny, and expression analyses of the 14-3-3 family reveal their involvement in the development, ripening and abiotic stress response in banana

    Directory of Open Access Journals (Sweden)

    meiying li

    2016-09-01

    Full Text Available Plant 14-3-3 proteins act as critical components of various cellular signaling processes and play an important role in regulating multiple physiological processes. However, less information is known about the 14-3-3 gene family in banana. In this study, 25 14-3-3 genes were identified from the banana genome. Based on the evolutionary analysis, banana 14-3-3 proteins were clustered into ε and non-ε groups. Conserved motif analysis showed that all identified banana 14-3-3 genes had the typical 14-3-3 motif. The gene structure of banana 14-3-3 genes showed distinct class-specific divergence between the ε group and the non-ε group. Most banana 14-3-3 genes showed strong transcript accumulation changes during fruit development and postharvest ripening in two banana varieties, indicating that they might be involved in regulating fruit development and ripening. Moreover, some 14-3-3 genes also showed great changes after osmotic, cold, and salt treatments in two banana varieties, suggested their potential role in regulating banana response to abiotic stress. Taken together, this systemic analysis reveals the involvement of banana 14-3-3 genes in fruit development, postharvest ripening, and response to abiotic stress and provides useful information for understanding the functions of 14-3-3 genes in banana.

  1. Genome-Wide Comparative Analysis of Chemosensory Gene Families in Five Tsetse Fly Species.

    Directory of Open Access Journals (Sweden)

    Rosaline Macharia

    2016-02-01

    Full Text Available For decades, odour-baited traps have been used for control of tsetse flies (Diptera; Glossinidae, vectors of African trypanosomes. However, differential responses to known attractants have been reported in different Glossina species, hindering establishment of a universal vector control tool. Availability of full genome sequences of five Glossina species offers an opportunity to compare their chemosensory repertoire and enhance our understanding of their biology in relation to chemosensation. Here, we identified and annotated the major chemosensory gene families in Glossina. We identified a total of 118, 115, 124, and 123 chemosensory genes in Glossina austeni, G. brevipalpis, G. f. fuscipes, G. pallidipes, respectively, relative to 127 reported in G. m. morsitans. Our results show that tsetse fly genomes have fewer chemosensory genes when compared to other dipterans such as Musca domestica (n>393, Drosophila melanogaster (n = 246 and Anopheles gambiae (n>247. We also found that Glossina chemosensory genes are dispersed across distantly located scaffolds in their respective genomes, in contrast to other insects like D. melanogaster whose genes occur in clusters. Further, Glossina appears to be devoid of sugar receptors and to have expanded CO2 associated receptors, potentially reflecting Glossina's obligate hematophagy and the need to detect hosts that may be out of sight. We also identified, in all species, homologs of Ir84a; a Drosophila-specific ionotropic receptor that promotes male courtship suggesting that this is a conserved trait in tsetse flies. Notably, our selection analysis revealed that a total of four gene loci (Gr21a, GluRIIA, Gr28b, and Obp83a were under positive selection, which confers fitness advantage to species. These findings provide a platform for studies to further define the language of communication of tsetse with their environment, and influence development of novel approaches for control.

  2. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice.

    Science.gov (United States)

    Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M; Bansal, Kailash C

    2015-01-01

    MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by "top-down" and "guide-gene" approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via "top-down" approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by "guide-gene" approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought response in rice

  3. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    Directory of Open Access Journals (Sweden)

    Shuchi eSmita

    2015-12-01

    Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  4. Genome-wide identification and characterization of JAZ gene family in upland cotton (Gossypium hirsutum).

    Science.gov (United States)

    Li, Wen; Xia, Xiao-Cong; Han, Li-Hong; Ni, Ping; Yan, Jing-Qiu; Tao, Miao; Huang, Geng-Qing; Li, Xue-Bao

    2017-06-05

    Plant JAZ (Jasmonate ZIM-domain) proteins play versatile roles in multiple aspects of plant development and defense. However, little is known about the JAZ family in allotetraploid upland cotton (Gossypium hirsutum) so far. In this study, 30 non-redundant JAZ genes were identified in upland cotton through genome-wide screening. Phylogenetic analysis revealed that the 30 proteins in cotton JAZ family are further divided into five groups (I - V), and members in the same group share highly conserved motif structures. Subcellular localization assay demonstrated that GhJAZ proteins are localized in the cell nucleus. Quantitative RT-PCR analysis indicated that GhJAZs display different expression patterns in cotton tissues, and most of them could be induced by Jasmonic (JA). Furthermore, some GhJAZ genes are preferentially expressed in cotton ovules and fibers, and showed differential expression in ovules of wild type cotton and fiberless mutant (fl) during fiber initiation. GhJAZ proteins could interact with each other to form homodimer or heterodimer, and they also interacted with some JA signaling regulators and the proteins involved in cotton fiber initiation. Collectively, our data suggested that some GhJAZ proteins may play important roles in cotton fiber initiation and development by regulating JA signaling as well as some fiber-related proteins.

  5. Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients.

    Science.gov (United States)

    Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan

    2014-05-15

    Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.

  6. Expression Profiling Reveals Genes Involved in the Regulation of Wool Follicle Bulb Regression and Regeneration in Sheep

    Directory of Open Access Journals (Sweden)

    Guangbin Liu

    2015-04-01

    Full Text Available Wool is an important material in textile manufacturing. In order to investigate the intrinsic factors that regulate wool follicle cycling and wool fiber properties, Illumina sequencing was performed on wool follicle bulb samples from the middle anagen, catagen and late telogen/early anagen phases. In total, 13,898 genes were identified. KRTs and KRTAPs are the most highly expressed gene families in wool follicle bulb. In addition, 438 and 203 genes were identified to be differentially expressed in wool follicle bulb samples from the middle anagen phase compared to the catagen phase and the samples from the catagen phase compared to the late telogen/early anagen phase, respectively. Finally, our data revealed that two groups of genes presenting distinct expression patterns during the phase transformation may have important roles for wool follicle bulb regression and regeneration. In conclusion, our results demonstrated the gene expression patterns in the wool follicle bulb and add new data towards an understanding of the mechanisms involved in wool fiber growth in sheep.

  7. Deep RNA sequencing reveals hidden features and dynamics of early gene transcription in Paramecium bursaria chlorella virus 1.

    Directory of Open Access Journals (Sweden)

    Guillaume Blanc

    Full Text Available Paramecium bursaria chlorella virus 1 (PBCV-1 is the prototype of the genus Chlorovirus (family Phycodnaviridae that infects the unicellular, eukaryotic green alga Chlorella variabilis NC64A. The 331-kb PBCV-1 genome contains 416 major open reading frames. A mRNA-seq approach was used to analyze PBCV-1 transcriptomes at 6 progressive times during the first hour of infection. The alignment of 17 million reads to the PBCV-1 genome allowed the construction of single-base transcriptome maps. Significant transcription was detected for a subset of 50 viral genes as soon as 7 min after infection. By 20 min post infection (p.i., transcripts were detected for most PBCV-1 genes and transcript levels continued to increase globally up to 60 min p.i., at which time 41% or the poly (A+-containing RNAs in the infected cells mapped to the PBCV-1 genome. For some viral genes, the number of transcripts in the latter time points (20 to 60 min p.i. was much higher than that of the most highly expressed host genes. RNA-seq data revealed putative polyadenylation signal sequences in PBCV-1 genes that were identical to the polyadenylation signal AAUAAA of green algae. Several transcripts have an RNA fragment excised. However, the frequency of excision and the resulting putative shortened protein products suggest that most of these excision events have no functional role but are probably the result of the activity of misled splicesomes.

  8. FGF: a web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  9. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  10. The Fusarium graminearum genome reveals more secondary metabolite gene clusters and hints of horizontal gene transfer.

    Directory of Open Access Journals (Sweden)

    Christian M K Sieber

    Full Text Available Fungal secondary metabolite biosynthesis genes are of major interest due to the pharmacological properties of their products (like mycotoxins and antibiotics. The genome of the plant pathogenic fungus Fusarium graminearum codes for a large number of candidate enzymes involved in secondary metabolite biosynthesis. However, the chemical nature of most enzymatic products of proteins encoded by putative secondary metabolism biosynthetic genes is largely unknown. Based on our analysis we present 67 gene clusters with significant enrichment of predicted secondary metabolism related enzymatic functions. 20 gene clusters with unknown metabolites exhibit strong gene expression correlation in planta and presumably play a role in virulence. Furthermore, the identification of conserved and over-represented putative transcription factor binding sites serves as additional evidence for cluster co-regulation. Orthologous cluster search provided insight into the evolution of secondary metabolism clusters. Some clusters are characteristic for the Fusarium phylum while others show evidence of horizontal gene transfer as orthologs can be found in representatives of the Botrytis or Cochliobolus lineage. The presented candidate clusters provide valuable targets for experimental examination.

  11. Mutation analysis of PALB2 gene in French breast cancer families.

    Science.gov (United States)

    Damiola, Francesca; Schultz, Inès; Barjhoux, Laure; Sornin, Valérie; Dondon, Marie-Gabrielle; Eon-Marchais, Séverine; Marcou, Morgane; Caron, Olivier; Gauthier-Villars, Marion; de Pauw, Antoine; Luporsi, Elisabeth; Berthet, Pascaline; Delnatte, Capucine; Bonadona, Valérie; Maugard, Christine; Pujol, Pascal; Lasset, Christine; Longy, Michel; Bignon, Yves-Jean; Fricker, Jean-Pierre; Andrieu, Nadine; Sinilnikova, Olga M; Stoppa-Lyonnet, Dominique; Mazoyer, Sylvie; Muller, Danièle

    2015-12-01

    Several population-based and family-based studies have demonstrated that germline mutations of the PALB2 gene (Partner and Localizer of BRCA2) are associated with an increased risk of breast cancer. Distinct mutation frequencies and spectrums have been described depending on the population studied. Here we describe the first complete PALB2 coding sequence screening in the French population. We screened the complete coding sequence and intron-exon boundaries of PALB2, using the EMMA technique, to assess the contribution of pathogenic mutations in a set of 835 familial breast cancer cases and 662 unrelated controls from the French national study GENESIS and the Paul Strauss Cancer Centre, all previously tested negative for BRCA1 and BRCA2 pathogenic mutations. Our analysis revealed the presence of four novel deleterious mutations: c.1186insT, c.1857delT and c.2850delC in three cases, c.3418dupT in one control. In addition, we identified two in-frame insertion/deletion, 19 missense substitutions (two of them predicted as pathogenic), 9 synonymous variants, 28 variants located in introns and 2 in UTRs, as well as frequent variants. Truncating PALB2 mutations were found in 0.36% of familial breast cancer cases, a frequency lower than the one detected in comparable studies in other populations (0.73-3.40%). This suggests a small but significant contribution of PALB2 mutations to the breast cancer susceptibility in the French population.

  12. A Genomic Survey of SCPP Family Genes in Fishes Provides Novel Insights into the Evolution of Fish Scales.

    Science.gov (United States)

    Lv, Yunyun; Kawasaki, Kazuhiko; Li, Jia; Li, Yanping; Bian, Chao; Huang, Yu; You, Xinxin; Shi, Qiong

    2017-11-16

    The family of secretory calcium-binding phosphoproteins (SCPPs) have been considered vital to skeletal tissue mineralization. However, most previous SCPP studies focused on phylogenetically distant animals but not on those closely related species. Here we provide novel insights into the coevolution of SCPP genes and fish scales in 10 species from Otophysi . According to their scale phenotypes, these fishes can be divided into three groups, i.e., scaled, sparsely scaled, and scaleless. We identified homologous SCPP genes in the genomes of these species and revealed an absence of some SCPP members in some genomes, suggesting an uneven evolutionary history of SCPP genes in fishes. In addition, most of these SCPP genes, with the exception of SPP1 , individually form one or two gene cluster(s) on each corresponding genome. Furthermore, we constructed phylogenetic trees using maximum likelihood method to estimate their evolution. The phylogenetic topology mostly supports two subclasses in some species, such as Cyprinus carpio , Sinocyclocheilus anshuiensis , S. grahamin , and S. rhinocerous , but not in the other examined fishes. By comparing the gene structures of recently reported candidate genes, SCPP1 and SCPP5 , for determining scale phenotypes, we found that the hypothesis is suitable for Astyanax mexicanus , but denied by S. anshuiensis , even though they are both sparsely scaled for cave adaptation. Thus, we conclude that, although different fish species display similar scale phenotypes, the underlying genetic changes however might be diverse. In summary, this paper accelerates the recognition of the SCPP family in teleosts for potential scale evolution.

  13. A comparative genome analysis of PME and PMEI families reveals the evolution of pectin metabolism in plant cell walls.

    Science.gov (United States)

    Wang, Maojun; Yuan, Daojun; Gao, Wenhui; Li, Yang; Tan, Jiafu; Zhang, Xianlong

    2013-01-01

    Pectins are fundamental polysaccharides in the plant primary cell wall. Pectins are synthesized and secreted to cell walls as highly methyl-esterified polymers and then demethyl-esterified by pectin methylesterases (PMEs), which are spatially regulated by pectin methylesterase inhibitors (PMEIs). Although PME and PMEI genes are pivotal in plant cell wall formation, few studies have focused on the evolutionary patterns of the PME and PMEI gene families. In this study, the gene origin, evolution, and expression diversity of these two families were systematically analyzed using 11 representative species, including algae, bryophytes, lycophytes and flowering land plants. The results show that 1) for the two subfamilies (PME and proPME) of PME, the origin of the PME subfamily is consistent with the appearance of pectins in early charophyte cell walls, 2) Whole genome duplication (WGD) and tandem duplication contribute to the expansion of proPME and PMEI families in land plants, 3) Evidence of selection pressure shows that the proPME and PMEI families have rapidly evolved, particularly the PMEI family in vascular plants, and 4) Comparative expression profile analysis of the two families indicates that the eudicot Arabidopsis and monocot rice have different expression patterns. In addition, the gene structure and sequence analyses show that the origin of the PMEI domain may be derived from the neofunctionalization of the pro domain after WGD. This study will advance the evolutionary understanding of the PME and PMEI families and plant cell wall development.

  14. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... this study, a total of 52 TCP genes were identified in apple (Malus domestica) genome. Bioinformatic methods were employed to predicate and analyse their relevant gene classification, gene structure, chromosome location, sequence alignment and con- served domains of MdTCP proteins. Expression ...

  15. Genomic organization of a cellulase gene family in Phanerochaete chrysosporium

    Science.gov (United States)

    Sarah F. Covert; Jennifer Bolduc; Daniel Cullen

    1992-01-01

    Southern blot and nucleotide sequence analysis of Phanerochaete chrysosporium BKM-F-1767 genomic clones indicate that this wood-degrading fungus contains at least six genes with significant homology to the Trichoderma reesei cellobiohydrolase I gene (cbh1). Using pulsed-field gel electrophoresis to separate P. chrysosporium chromosomes, the six cellulase genes were...

  16. (TG/CAn repeats in human gene families: abundance and selective patterns of distribution according to function and gene length

    Directory of Open Access Journals (Sweden)

    Ramachandran Srinivasan

    2005-06-01

    Full Text Available Abstract Background Creation of human gene families was facilitated significantly by gene duplication and diversification. The (TG/CAn repeats exhibit length variability, display genome-wide distribution, and are abundant in the human genome. Accumulation of evidences for their multiple functional roles including regulation of transcription and stimulation of recombination and splicing elect them as functional elements. Here, we report analysis of the distribution of (TG/CAn repeats in human gene families. Results The 1,317 human gene families were classified into six functional classes. Distribution of (TG/CAn repeats were analyzed both from a global perspective and from a stratified perspective based on their biological properties. The number of genes with repeats decreased with increasing repeat length and several genes (53% had repeats of multiple types in various combinations. Repeats were positively associated with the class of Signaling and communication whereas, they were negatively associated with the classes of Immune and related functions and of Information. The proportion of genes with (TG/CAn repeats in each class was proportional to the corresponding average gene length. The repeat distribution pattern in large gene families generally mirrored the global distribution pattern but differed particularly for Collagen gene family, which was rich in repeats. The position and flanking sequences of the repeats of Collagen genes showed high conservation in the Chimpanzee genome. However the majority of these repeats displayed length polymorphism. Conclusion Positive association of repeats with genes of Signaling and communication points to their role in modulation of transcription. Negative association of repeats in genes of Information relates to the smaller gene length, higher expression and fundamental role in cellular physiology. In genes of Immune and related functions negative association of repeats perhaps relates to the smaller gene

  17. Functional screening of antibiotic resistance genes from human gut microbiota reveals a novel gene fusion.

    Science.gov (United States)

    Cheng, Gong; Hu, Yongfei; Yin, Yeshi; Yang, Xi; Xiang, Chunsheng; Wang, Baohong; Chen, Yanfei; Yang, Fengling; Lei, Fang; Wu, Na; Lu, Na; Li, Jing; Chen, Quanze; Li, Lanjuan; Zhu, Baoli

    2012-11-01

    The human gut microbiota has a high density of bacteria that are considered a reservoir for antibiotic resistance genes (ARGs). In this study, one fosmid metagenomic library generated from the gut microbiota of four healthy humans was used to screen for ARGs against seven antibiotics. Eight new ARGs were obtained: one against amoxicillin, six against d-cycloserine, and one against kanamycin. The new amoxicillin resistance gene encodes a protein with 53% identity to a class D β-lactamase from Riemerella anatipestifer RA-GD. The six new d-cycloserine resistance genes encode proteins with 73-81% identity to known d-alanine-d-alanine ligases. The new kanamycin resistance gene encodes a protein of 274 amino acids with an N-terminus (amino acids 1-189) that has 42% identity to the 6'-aminoglycoside acetyltransferase [AAC(6')] from Enterococcus hirae and a C-terminus (amino acids 190-274) with 35% identity to a hypothetical protein from Clostridiales sp. SSC/2. A functional study on the novel kanamycin resistance gene showed that only the N-terminus conferred kanamycin resistance. Our results showed that functional metagenomics is a useful tool for the identification of new ARGs. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  18. Multifactor dimensionality reduction reveals gene-gene interactions associated with multiple sclerosis susceptibility in African Americans.

    Science.gov (United States)

    Brassat, D; Motsinger, A A; Caillier, S J; Erlich, H A; Walker, K; Steiner, L L; Cree, B A C; Barcellos, L F; Pericak-Vance, M A; Schmidt, S; Gregory, S; Hauser, S L; Haines, J L; Oksenberg, J R; Ritchie, M D

    2006-06-01

    Multiple sclerosis (MS) is a common disease of the central nervous system characterized by inflammation, myelin loss, gliosis, varying degrees of axonal pathology, and progressive neurological dysfunction. Multiple sclerosis exhibits many of the characteristics that distinguish complex genetic disorders including polygenic inheritance and environmental exposure risks. Here, we used a highly efficient multilocus genotyping assay representing variation in 34 genes associated with inflammatory pathways to explore gene-gene interactions and disease susceptibility in a well-characterized African-American case-control MS data set. We applied the multifactor dimensionality reduction (MDR) test to detect epistasis, and identified single-IL4R(Q576R)- and three-IL4R(Q576R), IL5RA(-80), CD14(-260)- locus association models that predict MS risk with 75-76% accuracy (P<0.01). These results demonstrate the importance of exploring both main effects and gene-gene interactions in the study of complex diseases.

  19. Genome-wide characterization and expression profiling of the AUXIN RESPONSE FACTOR (ARF gene family in Eucalyptus grandis.

    Directory of Open Access Journals (Sweden)

    Hong Yu

    Full Text Available Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation.

  20. [Diabetes mellitus caused by a mutation of glucokinase gene. Report of an affected family].

    Science.gov (United States)

    Pollak C, Felipe; Lagos L, Marcela; Santos M, José L; Poggi, Helena; Urzúa C, Abraham; Rumié C, Hana

    2017-09-01

    Maturity-Onset Diabetes of the Young (MODY) refers to a heterogeneous group of monogenic diabetes. Unlike other types of MODY characterized by genetic defects in transcription factors, MODY 2 is triggered by metabolic alterations caused by mutations of glucokinase (GCK), the first enzyme of the glycolytic pathway. We report a three-generation Chilean family with multiple cases affected with this disease. The index case is a patient who presented severe neonatal hyperglycemia (831 mg/dl, without ketosis) requiring continuous infusion of insulin, which was suspended after 48 hours with normalization of blood glucose. Subsequently, continuous glucose monitoring at 4 months of age revealed 47% of tissue glucose levels above 140 mg/dl, with fasting glucose levels between 120 and 166 mg/dl. The genetic analysis revealed a previously reported mutation in heterozygous state of the GCK gene (c.148C>T; p.His50Tyr). This mutation was also identified in more than one affected relative in the last two generations, with a transmission pattern suggestive of dominant inheritance. GCK gene sequencing led to a correct molecular diagnosis of MODY 2 while bioinformatic analysis indicated the possible molecular causes of the enzyme dysfunction. The knowledge of the molecular diagnosis allowed an adequate medical treatment for this disease.

  1. Quantitative transcription dynamic analysis reveals candidate genes and key regulators for ethanol tolerance in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Ma Menggen

    2010-06-01

    Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance

  2. Integrated pipeline for inferring the evolutionary history of a gene family embedded in the species tree: a case study on the STIMATE gene family.

    Science.gov (United States)

    Song, Jia; Zheng, Sisi; Nguyen, Nhung; Wang, Youjun; Zhou, Yubin; Lin, Kui

    2017-10-03

    Because phylogenetic inference is an important basis for answering many evolutionary problems, a large number of algorithms have been developed. Some of these algorithms have been improved by integrating gene evolution models with the expectation of accommodating the hierarchy of evolutionary processes. To the best of our knowledge, however, there still is no single unifying model or algorithm that can take all evolutionary processes into account through a stepwise or simultaneous method. On the basis of three existing phylogenetic inference algorithms, we built an integrated pipeline for inferring the evolutionary history of a given gene family; this pipeline can model gene sequence evolution, gene duplication-loss, gene transfer and multispecies coalescent processes. As a case study, we applied this pipeline to the STIMATE (TMEM110) gene family, which has recently been reported to play an important role in store-operated Ca 2+ entry (SOCE) mediated by ORAI and STIM proteins. We inferred their phylogenetic trees in 69 sequenced chordate genomes. By integrating three tree reconstruction algorithms with diverse evolutionary models, a pipeline for inferring the evolutionary history of a gene family was developed, and its application was demonstrated.

  3. In silico characterization and transcriptomic analysis of nif family genes from Anabaena sp. PCC7120.

    Science.gov (United States)

    Singh, Shilpi; Shrivastava, Alok Kumar

    2017-10-01

    In silico approaches in conjunction with morphology, nitrogenase activity, and qRT-PCR explore the impact of selected abiotic stressor such as arsenic, salt, cadmium, copper, and butachlor on nitrogen fixing (nif family) genes of diazotrophic cyanobacterium Anabaena sp. PCC7120. A total of 19 nif genes are present within the Anabaena genome that is involved in the process of nitrogen fixation. Docking studies revealed the interaction between these nif gene-encoded proteins and the selected abiotic stressors which were further validated through decreased heterocyst frequency, fragmentation of filaments, and downregulation of nitrogenase activity under these stresses indicating towards their toxic impact on nitrogen fixation potential of filamentous cyanobacterium Anabaena sp. PCC7120. Another appealing finding of this study is even though having similar binding energy and similar interacting residues between arsenic/salt and copper/cadmium to nif-encoded proteins, arsenic and cadmium are more toxic than salt and copper for nitrogenase activity of Anabaena which is crucial for growth and yield of rice paddy and soil reclamation.

  4. Detection of filaggrin gene mutation (2282del4) in Pakistani ichthyosis vulgaris families

    International Nuclear Information System (INIS)

    Naz, N.; Samdani, A.J.

    2011-01-01

    he aim of this study was to detect an 811 bp filaggrin (FLG) gene fragment known to carry a mutation 2282del4 which causes ichthyosis vulgaris. Seven clinically examined ichthyosis vulgaris families were included in this study. An 811 bp FLG gene fragment was targeted in the genomic DNA of all the members of the seven families by PCR amplification using known primers RPT1P7 and RPT2P1. Successful amplification of an 811 bp FLG gene fragment in all the families suggested the possible role of the 2282del4 mutation in causing ichthyosis vulgaris in Pakistani population. (author)

  5. Revealing genes associated with vitellogenesis in the liver of the zebrafish (Danio rerio by transcriptome profiling

    Directory of Open Access Journals (Sweden)

    Hyslop Terry

    2009-03-01

    Full Text Available Abstract Background In oviparous vertebrates, including fish, vitellogenesis consists of highly regulated pathways involving 17β-estradiol (E2. Previous studies focused on a relatively small number of hepatic expressed genes during vitellogenesis. This study aims to identify hepatic genes involved in vitellogenesis and regulated by E2, by using zebrafish microarray gene expression profiling, and to provide information on functional distinctive genes expressed in the liver of a vitellogenic female, using zebrafish as a model fish. Results Genes associated with vitellogenesis were revealed by the following paired t-tests (SAM comparisons: a two-month old vitellogenic (Vit2 females were compared with non-vitellogenic (NV females, showing 825 differentially expressed transcripts during early stages of vitellogenesis, b four-month old vitellogenic (Vit4 females were compared with NV females, showing 1,046 differentially expressed transcripts during vitellogenesis and c E2-treated males were compared with control males, showing 1,828 differentially expressed transcripts regulated by E2. A Venn diagram revealed 822 common transcripts in the three groups, indicating that these transcripts were involved in vitellogenesis and putatively regulated by E2. In addition, 431 transcripts were differentially expressed in Vit2 and Vit4 females but not in E2-treated males, indicating that they were putatively not up-regulated by E2. Correspondence analysis showed high similarity in expression profiles of Vit2 with Vit4 and of NV females with control males. The E2-treated males differed from the other groups. The repertoire of genes putatively regulated by E2 in vitellogenic females included genes associated with protein synthesis and reproduction. Genes associated with the immune system processes and biological adhesion, were among the genes that were putatively not regulated by E2. E2-treated males expressed a large array of transcripts that were not associated

  6. A new germline TP53 gene mutation in a family with Li-Fraumeni syndrome.

    Science.gov (United States)

    Dockhorn-Dworniczak, B; Wolff, J; Poremba, C; Schäfer, K L; Ritter, J; Gullotta, F; Jürgens, H; Böcker, W

    1996-07-01

    This report describes an unusual clinical presentation of Li-Fraumeni syndrome. Family history revealed a mild aggregation of adult cancers in one generation, and an unusual clustering of brain tumours of early childhood in the following generation. In order to evaluate the genetic basis for cancer predisposition in this family, molecular genetic analysis for the occurrence of germline TP53 tumour suppressor gene mutations was performed on 12 siblings of two generations. Indirect mutation analysis was performed by the single-strand conformation polymorphism (SSCP) technique. Alterations were characterised by automated direct fluorescence sequencing analysis. Tumour material was also examined for p53 protein accumulation by immunohistochemistry. Initially, a TP53 gene germline missense mutation was detected in an 11-year-old kindred with acute myeloid leukaemia (AML) following intensive treatment of a brain tumour. In peripheral blood and bone marrow samples of this proband, a reduction to hemizygosity occurred. During AML treatment, detection of LOH of 17p was used as a marker for clonality and treatment control. The mutation was found to be inherited from the proband's mother, who was diagnosed with breast cancer at the age of 48 years. Further, three siblings were carriers, and two are apparently healthy at the age of 21 and 23 years. Knowledge of germline mutations may allow accurate DNA-based carrier diagnosis which is of important clinical significance for treatment strategy and control. Furthermore, the occurrence of unaffected carriers in this family raises questions about appropriate methods of cancer surveillance and counselling for these people.

  7. Unusual presentation of Kallmannn syndrome with contiguous gene deletion in three siblings of a family

    Directory of Open Access Journals (Sweden)

    Sri Venkat Madhu

    2012-01-01

    Full Text Available We report the case of 3 brothers aged 34, 24, and 22 years, unmarried, who presented to our endocrinology clinic with absence of secondary sexual characters. There was no such history in other siblings, but their maternal uncle had similar complaints. On examination, all 3 had pre-pubertal appearance, voice, and genitalia along with anosmia and bimanual synkinesia. Cryptorchidism was noticed in 2 while third person had small hypoplastic testes. It was also noted that all 3 patients had icthyosis mainly involving trunk, back, and limbs. The hormonal assays were consistent with isolated hypogonadotrophic hypogonadism. IQ testing revealed mental retardation in the 2 patients. Ultrasound showed ectopic right kidney in one patient, atrophic right kidney in the second patient while the third patient had normal kidneys. MRI brain of all the patients showed poorly visualized olfactory tract and bulb. Kallmann syndrome (KS was diagnosed based on hormonal evaluation and MRI results. Of the four types of KS: Synkinesia, renal anomaly, and X-linked pedigree pattern in our patients pointed towards X-linked type 1 KS as the possible cause. But, icthyosis and mental retardation are not usual presentation of type 1 KS. They are usually seen as a result of contiguous gene deletion of KAL1, steroid sulfatase (STS, and mental retardation (MRX gene on X chromosome. Hence, the possible gene defect in our cases is inherited defect in contiguous gene deletion. The contiguous gene deletion as the cause of KS in 3 patients of same family is very rare and worth reporting. Also, the significance of phenotype-genotypic association in Kallmann syndrome is discussed

  8. Molecular phylogenetic analysis reveals the new genus Hemisphaericaspora of the family Debaryomycetaceae.

    Directory of Open Access Journals (Sweden)

    Fengli Hui

    Full Text Available Four strains of a novel ascomycetous yeast species were recovered from the frass of wood-boring beetles collected from the Baotianman Nature Reserve and the Laojieling Nature Reserve in Henan Province, China. This species produced unconjugated and deliquescent asci with hemispheroid or helmet-shaped ascospores. Analysis of gene sequences for the D1/D2 domain of the large subunit (LSU rRNA, as well as analysis of concatenated gene sequences for the nearly complete small subunit (SSU rRNA and D1/D2 domain of the large subunit (LSU rRNA placed the novel species in a small clade including only one recognised species, Candida insectamans, in the family Debaryomycetaceae (Saccharomycotina, Ascomycota. DNA sequence analyses demonstrated that the novel species was distinct from all currently recognised teleomorphic yeast genus. The name Hemisphaericaspora nanyangensis gen nov., sp. nov. is proposed to accommodate the novel genus and species. The new genus can be distinguished from closely related teleomorphic genera Lodderomyces and Spathaspora through sequence comparison and ascospore morphology. The ex-type strain of H. nanyangensis is CBS 13020T ( = CICC 33021 = NYNU 13717. Furthermore, based on phenotypic and genotypic characteristics, C. insectamans is transferred to the newly described genus as Hemisphaericaspora insectamans comb. nov., in accordance with the changes in the International Code of Nomenclature for algae, fungi and plants.

  9. Genome-wide analysis of the expansin gene superfamily reveals grapevine-specific structural and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Silvia Dal Santo

    Full Text Available BACKGROUND: Expansins are proteins that loosen plant cell walls in a pH-dependent manner, probably by increasing the relative movement among polymers thus causing irreversible expansion. The expansin superfamily (EXP comprises four distinct families: expansin A (EXPA, expansin B (EXPB, expansin-like A (EXLA and expansin-like B (EXLB. There is experimental evidence that EXPA and EXPB proteins are required for cell expansion and developmental processes involving cell wall modification, whereas the exact functions of EXLA and EXLB remain unclear. The complete grapevine (Vitis vinifera genome sequence has allowed the characterization of many gene families, but an exhaustive genome-wide analysis of expansin gene expression has not been attempted thus far. METHODOLOGY/PRINCIPAL FINDINGS: We identified 29 EXP superfamily genes in the grapevine genome, representing all four EXP families. Members of the same EXP family shared the same exon-intron structure, and phylogenetic analysis confirmed a closer relationship between EXP genes from woody species, i.e. grapevine and poplar (Populus trichocarpa, compared to those from Arabidopsis thaliana and rice (Oryza sativa. We also identified grapevine-specific duplication events involving the EXLB family. Global gene expression analysis confirmed a strong correlation among EXP genes expressed in mature and green/vegetative samples, respectively, as reported for other gene families in the recently-published grapevine gene expression atlas. We also observed the specific co-expression of EXLB genes in woody organs, and the involvement of certain grapevine EXP genes in berry development and post-harvest withering. CONCLUSION: Our comprehensive analysis of the grapevine EXP superfamily confirmed and extended current knowledge about the structural and functional characteristics of this gene family, and also identified properties that are currently unique to grapevine expansin genes. Our data provide a model for the

  10. Targeted gene disruption reveals an essential role for ceruloplasmin in cellular iron efflux

    OpenAIRE

    Harris, Z. Leah; Durley, Alison P.; Man, Tsz Kwong; Gitlin, Jonathan D.

    1999-01-01

    Aceruloplasminemia is an autosomal recessive disorder of iron metabolism. Affected individuals evidence iron accumulation in tissue parenchyma in association with absent serum ceruloplasmin. Genetic studies of such patients reveal inherited mutations in the ceruloplasmin gene. To elucidate the role of ceruloplasmin in iron homeostasis, we created an animal model of aceruloplasminemia by disrupting the murine ceruloplasmin (Cp) gene. Although normal at birth, Cp−/− mice demonstrate progressive...

  11. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

    Science.gov (United States)

    Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

    2012-04-01

    Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

  12. Gene expression profiling reveals candidate genes related to residual feed intake in duodenum of laying ducks.

    Science.gov (United States)

    Zeng, T; Huang, L; Ren, J; Chen, L; Tian, Y; Huang, Y; Zhang, H; Du, J; Lu, L

    2017-12-01

    Feed represents two-thirds of the total costs of poultry production, especially in developing countries. Improvement in feed efficiency would reduce the amount of feed required for production (growth or laying), the production cost, and the amount of nitrogenous waste. The most commonly used measures for feed efficiency are feed conversion ratio (FCR) and residual feed intake (RFI). As a more suitable indicator assessing feed efficiency, RFI is defined as the difference between observed and expected feed intake based on maintenance and growth or laying. However, the genetic and biological mechanisms regulating RFI are largely unknown. Identifying molecular mechanisms explaining divergence in RFI in laying ducks would lead to the development of early detection methods for the selection of more efficient breeding poultry. The objective of this study was to identify duodenum genes and pathways through transcriptional profiling in 2 extreme RFI phenotypes (HRFI and LRFI) of the duck population. Phenotypic aspects of feed efficiency showed that RFI was strongly positive with FCR and feed intake (FI). Transcriptomic analysis identified 35 differentially expressed genes between LRFI and HRFI ducks. These genes play an important role in metabolism, digestibility, secretion, and innate immunity including (), (), (), β (), and (). These results improve our knowledge of the biological basis underlying RFI, which would be useful for further investigations of key candidate genes for RFI and for the development of biomarkers.

  13. Genetic mapping reveals a candidate gene (ClFS1) for fruit shape in watermelon (Citrullus lanatus L.).

    Science.gov (United States)

    Dou, Junling; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhang, Lei; Ali, Aslam; Kuang, Hanhui; Liu, Wenge

    2018-04-01

    A 159 bp deletion in ClFS1 gene encoding IQD protein is responsible for fruit shape in watermelon. Watermelon [Citrullus lanatus (Thunb.) Matsum. & Nakai] is known for its rich diversity in fruit size and shape. Fruit shape has been one of the major objectives of watermelon breeding. However, the candidate genes and the underlying genetic mechanism for such an important trait in watermelon are unknown. In this study, we identified a locus on chromosome 3 of watermelon genome controlling fruit shape. Segregation analysis in F 2 and BC 1 populations derived from a cross between two inbred lines "Duan125" (elongate fruit) and "Zhengzhouzigua" (spherical fruit) suggests that fruit shape of watermelon is controlled by a single locus and elongate fruit (OO) is incompletely dominant to spherical fruit (oo) with the heterozygote (Oo) being oval fruit. GWAS profiles among 315 accessions identified a major locus designated on watermelon chromosome 3, which was confirmed by BSA-seq mapping in the F 2 population. The candidate gene was mapped to a region 46 kb on chromosome 3. There were only four genes present in the corresponding region in the reference genome. Four candidate genes were sequenced in this region, revealing that the CDS of Cla011257 had a 159 bp deletion which resulted in the omission of 53 amino acids in elongate watermelon. An indel marker was derived from the 159 bp deletion to test the F 2 population and 105 watermelon accessions. The results showed that Cla011257 cosegregated with watermelon fruit shape. In addition, the Cla011257 expression was the highest at ovary formation stage. The predicted protein of the Cla011257 gene fitted in IQD protein family which was reported to have association with cell arrays and Ca 2+ -CaM signaling modules. Clear understanding of the genes facilitating the fruit shape along with marker association selection will be an effective way to develop new cultivars.

  14. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer

    Directory of Open Access Journals (Sweden)

    David A. Quigley

    2016-07-01

    Full Text Available Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways. Gene networks related to specific cell types and signaling pathways, including sonic hedgehog (Shh, Wnt, Lgr family stem cell markers, and keratins, differed at these tissue sites, suggesting mechanisms for the differential susceptibility of dorsal and tail skin to development of skin diseases and tumorigenesis. The Pten tumor suppressor gene network is rewired in premalignant tumors compared to normal tissue, but this response to perturbation is lost during malignant progression. We present a software package for expression quantitative trait loci (eQTL network analysis and demonstrate how network analysis of whole tissues provides insights into interactions between cell compartments and signaling molecules.

  15. Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks.

    Science.gov (United States)

    Mai, Hans-Jörg; Pateyron, Stéphanie; Bauer, Petra

    2016-10-03

    FIT (FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR) is the central regulator of iron uptake in Arabidopsis thaliana roots. We performed transcriptome analyses of six day-old seedlings and roots of six week-old plants using wild type, a fit knock-out mutant and a FIT over-expression line grown under iron-sufficient or iron-deficient conditions. We compared genes regulated in a FIT-dependent manner depending on the developmental stage of the plants. We assembled a high likelihood dataset which we used to perform co-expression and functional analysis of the most stably iron deficiency-induced genes. 448 genes were found FIT-regulated. Out of these, 34 genes were robustly FIT-regulated in root and seedling samples and included 13 novel FIT-dependent genes. Three hundred thirty-one genes showed differential regulation in response to the presence and absence of FIT only in the root samples, while this was the case for 83 genes in the seedling samples. We assembled a virtual dataset of iron-regulated genes based on a total of 14 transcriptomic analyses of iron-deficient and iron-sufficient wild-type plants to pinpoint the best marker genes for iron deficiency and analyzed this dataset in depth. Co-expression analysis of this dataset revealed 13 distinct regulons part of which predominantly contained functionally related genes. We could enlarge the list of FIT-dependent genes and discriminate between genes that are robustly FIT-regulated in roots and seedlings or only in one of those. FIT-regulated genes were mostly induced, few of them were repressed by FIT. With the analysis of a virtual dataset we could filter out and pinpoint new candidates among the most reliable marker genes for iron deficiency. Moreover, co-expression and functional analysis of this virtual dataset revealed iron deficiency-induced and functionally distinct regulons.

  16. a photoreceptor gene mutation in an indigenous black african family ...

    African Journals Online (AJOL)

    mutations known to create or destroy a DdeI or MspI restriction enzyme site, respectively. Of the patients studied, 45 were from ADRP families and 19 were classified as simplex cases. Of these southern African families with a history of RD,. 14 were of ethnic black African origin, 5 of Asian origin and 26 of mixed ancestry ...

  17. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium.

    Science.gov (United States)

    Rao, Pavitra N; Santos, Jorge M; Pain, Arnab; Templeton, Thomas J; Mair, Gunnar R

    2016-10-01

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also present earlier in the Alveolata in the free-living, non-parasitophorous, photosynthetic chromerids, Chromera and Vitrella. In Plasmodium falciparum and Plasmodium berghei blood stage parasites, the transcripts of all nine cpw-wpc genes have been detected in gametocytes. RNA immunoprecipitation followed by reverse transcriptase-PCR reveals all P. berghei cpw-wpc transcripts to be bound by the translational repressors DOZI and CITH, and thus are likely under translational control prior to transmission from the rodent host to the mosquito vector in P. berghei. The GFP tagging of two endogenous P. berghei genes confirmed translational silencing in the gametocyte and translation in ookinetes. By establishing a luciferase transgene assay, we show that the 3' untranslated region of PF3D7_1331400 controls protein expression of this reporter in P. falciparum gametocytes. Our analyses suggest that cpw-wpc genes are translationally silenced in gametocytes across Plasmodium spp. and activated during ookinete formation and thus may have a role in transmission to the mosquito. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. CRDB: database of chemosensory receptor gene families in vertebrate.

    Directory of Open Access Journals (Sweden)

    Dong Dong

    Full Text Available Chemosensory receptors (CR are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of 'birth-and-death' evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates.

  19. RNA profiling reveals familial aggregation of molecular subtypes in non-BRCA1/2 breast cancer families

    DEFF Research Database (Denmark)

    Larsen, Martin J; Thomassen, Mads; Tan, Qihua

    2014-01-01

    and provide evidence for epigenetic inactivation of BRCA1 in three of the tumors. In addition, 7 BRCA2-like tumors were found. CONCLUSIONS: Our finding indicates involvement of hereditary factors in non-BRCA1/2 breast cancer families in which family members may carry genetic susceptibility not just to breast...... cancer but to a particular subtype of breast cancer. This is the first study to provide a biological link between breast cancers from family members of high-risk non-BRCA1/2 families in a systematic manner, suggesting that future genetic analysis may benefit from subgrouping families into molecularly......BACKGROUND: In more than 70% of families with a strong history of breast and ovarian cancers, pathogenic mutation in BRCA1 or BRCA2 cannot be identified, even though hereditary factors are expected to be involved. It has been proposed that tumors with similar molecular phenotypes also share similar...

  20. Genome-wide identification and functional analysis of the TIFY gene family in response to drought in cotton.

    Science.gov (United States)

    Zhao, Ge; Song, Yun; Wang, Caixiang; Butt, Hamama Islam; Wang, Qianhua; Zhang, Chaojun; Yang, Zuoren; Liu, Zhao; Chen, Eryong; Zhang, Xueyan; Li, Fuguang

    2016-12-01

    Jasmonates control many aspects of plant biological processes. They are important for regulating plant responses to various biotic and abiotic stresses, including drought, which is one of the most serious threats to sustainable agricultural production. However, little is known regarding how jasmonate ZIM-domain (JAZ) proteins mediate jasmonic acid signals to improve stress tolerance in cotton. This represents the first comprehensive comparative study of TIFY transcription factors in both diploid A, D and tetraploid AD cotton species. In this study, we identified 21 TIFY family members in the genome of Gossypium arboretum, 28 members from Gossypium raimondii and 50 TIFY genes in Gossypium hirsutum. The phylogenetic analyses indicated the TIFY gene family could be divided into the following four subfamilies: TIFY, PPD, ZML, and JAZ subfamilies. The cotton TIFY genes have expanded through tandem duplications and segmental duplications compared with other plant species. Gene expression profile revealed temporal and tissue specificities for TIFY genes under simulated drought conditions in Gossypium arboretum. The JAZ subfamily members were the most highly expressed genes, suggesting that they have a vital role in responses to drought stress. Over-expression of GaJAZ5 gene decreased water loss, stomatal openings, and the accumulation of H 2 O 2 in Arabidopsis thaliana. Additionally, the results of drought tolerance assays suggested that this subfamily might be involved in increasing drought tolerance. Our study provides new data regarding the genome-wide analysis of TIFY gene families and their important roles in drought tolerance in cotton species. These data may form the basis of future studies regarding the relationship between drought and jasmonic acid.

  1. Structures of the first representatives of Pfam family PF06938 (DUF1285) reveal a new fold with repeated structural motifs and possible involvement in signal transduction

    International Nuclear Information System (INIS)

    Han, Gye Won; Bakolitsa, Constantina; Miller, Mitchell D.; Kumar, Abhinav; Carlton, Dennis; Najmanovich, Rafael J.; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Chen, Connie; Chiu, Hsiu-Ju; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Ernst, Dustin; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Jaroszewski, Lukasz; Jin, Kevin K.; Johnson, Hope A.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Marciano, David; McMullan, Daniel; Morse, Andrew T.; Nigoghossian, Edward; Okach, Linda; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; Bedem, Henry van den; Weekes, Dana; Xu, Qingping; Hodgson, Keith O.; Wooley, John; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.

    2010-01-01

    The crystal structures of SPO0140 and Sbal-2486 revealed a two-domain structure that adopts a novel fold. Analysis of the interdomain cleft suggests a nucleotide-based ligand with a genome context indicating signaling as a possible role for this family. The crystal structures of SPO0140 and Sbal-2486 were determined using the semiautomated high-throughput pipeline of the Joint Center for Structural Genomics (JCSG) as part of the NIGMS Protein Structure Initiative (PSI). The structures revealed a conserved core with domain duplication and a superficial similarity of the C-terminal domain to pleckstrin homology-like folds. The conservation of the domain interface indicates a potential binding site that is likely to involve a nucleotide-based ligand, with genome-context and gene-fusion analyses additionally supporting a role for this family in signal transduction, possibly during oxidative stress

  2. KIR and HLA haplotype analysis in a family lacking the KIR 2DL1-2DP1 genes.

    Science.gov (United States)

    Vojvodić, S; Ademović-Sazdanić, D

    2015-06-01

    The killer cell immunoglobulin-like receptor (KIR) gene cluster exhibits extensive allelic and haplotypic diversity that is observed as presence/absence of genes, resulting in expansion and contraction of KIR haplotypes and by allelic variation of individual KIR genes. We report a case of KIR pseudogene 2DP1 and 2DL1 gene absence in members of one family with the children suffering from acute myelogenous leukemia (AML). Killer cell immunoglobulin-like receptor low resolution genotyping was performed by the polymerase chain reaction (PCR)-sequence-specific primers (SSP)/sequence-specific oligonucleotide (SSO) method and haplotype assignment was done by gene content analysis. Both parents and the maternal grandfather, shared the same Cen-B2 KIR haplotype, containing KIR 3DL3, -2DS2, -2DL2 and -3DP1 genes. The second haplotype in the KIR genotype of the mother and grandfather was Tel-A1 with KIR 2DL4 (normal and deleted variant), -3DL1, -22 bp deletion variant of the 2DS4 gene and -3DL2, while the second haplotype in the KIR genotype of the father was Tel-B1 with 2DL4 (normal variant), -3DS1, -2DL5, -2DS5, -2DS1 and 3DL2 genes. Haplotype analysis in all three offsprings revealed that the children inherited the Cen-B2 haplotype with the same gene content but two of the children inherited a deleted variant of the 2DL4 gene, while the third child inherited a normal one. The second haplotype of all three offspring contained KIR 2DL4, -2DL5, -2DS1, -2DS4 (del 22bp variant), -2DS5, -3DL1 and -3DL2 genes, which was the basis of the assumption that there is a hybrid haplotype and that the present 3DL1 gene is a variant of the 3DS1 gene. Due to consanguinity among the ancestors, the results of KIR segregation analysis showed the existence of a very rare KIR genotype in the offspring. The family who is the subject of this case is even more interesting because the father was 10/10 human leukocyte antigen (HLA)-matched to his daughter, all members of the family have the "best

  3. Mapping of gene expression reveals CYP27A1 as a susceptibility gene for sporadic ALS.

    Science.gov (United States)

    Diekstra, Frank P; Saris, Christiaan G J; van Rheenen, Wouter; Franke, Lude; Jansen, Ritsert C; van Es, Michael A; van Vught, Paul W J; Blauw, Hylke M; Groen, Ewout J N; Horvath, Steve; Estrada, Karol; Rivadeneira, Fernando; Hofman, Albert; Uitterlinden, Andre G; Robberecht, Wim; Andersen, Peter M; Melki, Judith; Meininger, Vincent; Hardiman, Orla; Landers, John E; Brown, Robert H; Shatunov, Aleksey; Shaw, Christopher E; Leigh, P Nigel; Al-Chalabi, Ammar; Ophoff, Roel A; van den Berg, Leonard H; Veldink, Jan H

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive, neurodegenerative disease characterized by loss of upper and lower motor neurons. ALS is considered to be a complex trait and genome-wide association studies (GWAS) have implicated a few susceptibility loci. However, many more causal loci remain to be discovered. Since it has been shown that genetic variants associated with complex traits are more likely to be eQTLs than frequency-matched variants from GWAS platforms, we conducted a two-stage genome-wide screening for eQTLs associated with ALS. In addition, we applied an eQTL analysis to finemap association loci. Expression profiles using peripheral blood of 323 sporadic ALS patients and 413 controls were mapped to genome-wide genotyping data. Subsequently, data from a two-stage GWAS (3,568 patients and 10,163 controls) were used to prioritize eQTLs identified in the first stage (162 ALS, 207 controls). These prioritized eQTLs were carried forward to the second sample with both gene-expression and genotyping data (161 ALS, 206 controls). Replicated eQTL SNPs were then tested for association in the second-stage GWAS data to find SNPs associated with disease, that survived correction for multiple testing. We thus identified twelve cis eQTLs with nominally significant associations in the second-stage GWAS data. Eight SNP-transcript pairs of highest significance (lowest p = 1.27 × 10(-51)) withstood multiple-testing correction in the second stage and modulated CYP27A1 gene expression. Additionally, we show that C9orf72 appears to be the only gene in the 9p21.2 locus that is regulated in cis, showing the potential of this approach in identifying causative genes in association loci in ALS. This study has identified candidate genes for sporadic ALS, most notably CYP27A1. Mutations in CYP27A1 are causal to cerebrotendinous xanthomatosis which can present as a clinical mimic of ALS with progressive upper motor neuron loss, making it a plausible susceptibility gene for

  4. Mapping of gene expression reveals CYP27A1 as a susceptibility gene for sporadic ALS.

    Directory of Open Access Journals (Sweden)

    Frank P Diekstra

    Full Text Available Amyotrophic lateral sclerosis (ALS is a progressive, neurodegenerative disease characterized by loss of upper and lower motor neurons. ALS is considered to be a complex trait and genome-wide association studies (GWAS have implicated a few susceptibility loci. However, many more causal loci remain to be discovered. Since it has been shown that genetic variants associated with complex traits are more likely to be eQTLs than frequency-matched variants from GWAS platforms, we conducted a two-stage genome-wide screening for eQTLs associated with ALS. In addition, we applied an eQTL analysis to finemap association loci. Expression profiles using peripheral blood of 323 sporadic ALS patients and 413 controls were mapped to genome-wide genotyping data. Subsequently, data from a two-stage GWAS (3,568 patients and 10,163 controls were used to prioritize eQTLs identified in the first stage (162 ALS, 207 controls. These prioritized eQTLs were carried forward to the second sample with both gene-expression and genotyping data (161 ALS, 206 controls. Replicated eQTL SNPs were then tested for association in the second-stage GWAS data to find SNPs associated with disease, that survived correction for multiple testing. We thus identified twelve cis eQTLs with nominally significant associations in the second-stage GWAS data. Eight SNP-transcript pairs of highest significance (lowest p = 1.27 × 10(-51 withstood multiple-testing correction in the second stage and modulated CYP27A1 gene expression. Additionally, we show that C9orf72 appears to be the only gene in the 9p21.2 locus that is regulated in cis, showing the potential of this approach in identifying causative genes in association loci in ALS. This study has identified candidate genes for sporadic ALS, most notably CYP27A1. Mutations in CYP27A1 are causal to cerebrotendinous xanthomatosis which can present as a clinical mimic of ALS with progressive upper motor neuron loss, making it a plausible

  5. Impact of community-acquired paediatric rotavirus gastroenteritis on family life: data from the REVEAL study

    Directory of Open Access Journals (Sweden)

    Talayero José MP

    2010-03-01

    Full Text Available Abstract Background Rotavirus is the leading cause of acute gastroenteritis (AGE and the most frequent cause of severe diarrhoea in children aged less than 5 years. Although the epidemiology of rotavirus gastroenteritis (RVGE is well documented, there are few data on the impact of RVGE on the families of affected children. Methods Data associated with the burden of RVGE, including number of working days lost, levels of parental stress, the need for alternative childcare arrangements and additional nappies used, were extracted from questionnaires completed by parents of children participating in a prospective, multicentre, observational study (Rotavirus gastroenteritis Epidemiology and Viral types in Europe Accounting for Losses in public health and society, REVEAL, conducted during 2004-2005 in selected areas of Belgium, France, Germany, Italy, Spain, Sweden, and the United Kingdom to estimate the incidence of RVGE in children aged less than 5 years seeking medical care as a result of AGE. Results 1102 children with RVGE were included in the present analysis. The proportion of RVGE cases that required at least one parent or other person to be absent from work was 39%-91% in the hospital setting, 44%-64% in the emergency department, and 20%-64% in primary care. Self-reported levels of parental stress were generally high (mean stress levels, ≥ 5 on a 10-point visual analogue scale. Additional childcare arrangements were required in up to 21% of RVGE episodes. The mean number of nappies used per day during RVGE episodes was approximately double that used when the child was not ill. Conclusions Paediatric RVGE cases cause disruption to families and parental stress. The burden of RVGE on children and their families could be substantially reduced by routine rotavirus vaccination of infants.

  6. Autozygosity reveals recessive mutations and novel mechanisms in dominant genes: implications in variant interpretation

    KAUST Repository

    Monies, Dorota

    2017-04-06

    The purpose of this study is to describe recessive alleles in strictly dominant genes. Identifying recessive mutations in genes for which only dominant disease or risk alleles have been reported can expand our understanding of the medical relevance of these genes both phenotypically and mechanistically. The Saudi population is enriched for autozygosity, which enhances the homozygous occurrence of alleles, including pathogenic alleles in genes that have been associated only with a dominant inheritance pattern.Exome sequencing of patients from consanguineous families with likely recessive phenotypes was performed. In one family, the genotype of the deceased children was inferred from their parents due to lack of available samples.We describe the identification of 11 recessive variants (5 of which are reported here for the first time) in 11 genes for which only dominant disease or risk alleles have been reported. The observed phenotypes for these recessive variants were novel (e.g., FBN2-related myopathy and CSF1R-related brain malformation and osteopetrosis), typical (e.g., ACTG2-related visceral myopathy), or an apparently healthy state (e.g., PDE11A), consistent with the corresponding mouse knockout phenotypes.Our results show that, in the era of genomic sequencing and

  7. Expression of tomato prosystemin gene in Arabidopsis reveals systemic translocation of its mRNA and confers necrotrophic fungal resistance.

    Science.gov (United States)

    Zhang, Haiyan; Yu, Pengli; Zhao, Jiuhai; Jiang, Hongling; Wang, Haiyang; Zhu, Yingfang; Botella, Miguel A; Šamaj, Jozef; Li, Chuanyou; Lin, Jinxing

    2018-01-01

    Systemin (SYS), an octadecapeptide hormone processed from a 200-amino-acid precursor (prosystemin, PS), plays a central role in the systemic activation of defense genes in tomato in response to herbivore and pathogen attacks. However, whether PS mRNA is transferable and its role in systemic defense responses remain unknown. We created the transgenic tomato PS gene tagged with the green fluorescent protein (PS-GFP) using a shoot- or root-specific promoter, and the constitutive 35S promoter in Arabidopsis. Subcellular localization of PS-/SYS-GFP was observed using confocal laser scanning microscopy and gene transcripts were determined using quantitative real-time PCR. In Arabidopsis, PS protein can be processed and SYS is secreted. Shoot-/root-specific expression of PS-GFP in Arabidopsis, and grafting experiments, revealed that the PS mRNA moves in a bi-directional manner. We also found that ectopic expression of PS improves Arabidopsis resistance to the necrotrophic fungus Botrytis cinerea, consistent with substantial upregulation of the transcript levels of specific pathogen-responsive genes. Our results provide novel insights into the multifaceted mechanism of SYS signaling transport and its potential application in genetic engineering for increasing pathogen resistance across diverse plant families. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  8. Systematic analysis of sequences and expression patterns of drought-responsive members of the HD-Zip gene family in maize.

    Directory of Open Access Journals (Sweden)

    Yang Zhao

    Full Text Available BACKGROUND: Members of the homeodomain-leucine zipper (HD-Zip gene family encode transcription factors that are unique to plants and have diverse functions in plant growth and development such as various stress responses, organ formation and vascular development. Although systematic characterization of this family has been carried out in Arabidopsis and rice, little is known about HD-Zip genes in maize (Zea mays L.. METHODS AND FINDINGS: In this study, we described the identification and structural characterization of HD-Zip genes in the maize genome. A complete set of 55 HD-Zip genes (Zmhdz1-55 were identified in the maize genome using Blast search tools and categorized into four classes (HD-Zip I-IV based on phylogeny. Chromosomal location of these genes revealed that they are distributed unevenly across all 10 chromosomes. Segmental duplication contributed largely to the expansion of the maize HD-ZIP gene family, while tandem duplication was only responsible for the amplification of the HD-Zip II genes. Furthermore, most of the maize HD-Zip I genes were found to contain an overabundance of stress-related cis-elements in their promoter sequences. The expression levels of the 17 HD-Zip I genes under drought stress were also investigated by quantitative real-time PCR (qRT-PCR. All of the 17 maize HD-ZIP I genes were found to be regulated by drought stress, and the duplicated genes within a sister pair exhibited the similar expression patterns, suggesting their conserved functions during the process of evolution. CONCLUSIONS: Our results reveal a comprehensive overview of the maize HD-Zip gene family and provide the first step towards the selection of Zmhdz genes for cloning and functional research to uncover their roles in maize growth and development.

  9. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together...

  10. Genetic analysis of the ADGF multigene family by homologous recombination and gene conversion in Drosophila.

    Science.gov (United States)

    Dolezal, Tomas; Gazi, Michal; Zurovec, Michal; Bryant, Peter J

    2003-10-01

    Many Drosophila genes exist as members of multigene families and within each family the members can be functionally redundant, making it difficult to identify them by classical mutagenesis techniques based on phenotypic screening. We have addressed this problem in a genetic analysis of a novel family of six adenosine deaminase-related growth factors (ADGFs). We used ends-in targeting to introduce mutations into five of the six ADGF genes, taking advantage of the fact that five of the family members are encoded by a three-gene cluster and a two-gene cluster. We used two targeting constructs to introduce loss-of-function mutations into all five genes, as well as to isolate different combinations of multiple mutations, independent of phenotypic consequences. The results show that (1) it is possible to use ends-in targeting to disrupt gene clusters; (2) gene conversion, which is usually considered a complication in gene targeting, can be used to help recover different mutant combinations in a single screening procedure; (3) the reduction of duplication to a single copy by induction of a double-strand break is better explained by the single-strand annealing mechanism than by simple crossing over between repeats; and (4) loss of function of the most abundantly expressed family member (ADGF-A) leads to disintegration of the fat body and the development of melanotic tumors in mutant larvae.

  11. RNA Sequencing and Coexpression Analysis Reveal Key Genes Involved in α-Linolenic Acid Biosynthesis in Perilla frutescens Seed

    Directory of Open Access Journals (Sweden)

    Tianyuan Zhang

    2017-11-01

    Full Text Available Perilla frutescen is used as traditional food and medicine in East Asia. Its seeds contain high levels of α-linolenic acid (ALA, which is important for health, but is scarce in our daily meals. Previous reports on RNA-seq of perilla seed had identified fatty acid (FA and triacylglycerol (TAG synthesis genes, but the underlying mechanism of ALA biosynthesis and its regulation still need to be further explored. So we conducted Illumina RNA-sequencing in seven temporal developmental stages of perilla seeds. Sequencing generated a total of 127 million clean reads, containing 15.88 Gb of valid data. The de novo assembly of sequence reads yielded 64,156 unigenes with an average length of 777 bp. A total of 39,760 unigenes were annotated and 11,693 unigenes were found to be differentially expressed in all samples. According to Kyoto Encyclopedia of Genes and Genomes (KEGG pathway analysis, 486 unigenes were annotated in the “lipid metabolism” pathway. Of these, 150 unigenes were found to be involved in fatty acid (FA biosynthesis and triacylglycerol (TAG assembly in perilla seeds. A coexpression analysis showed that a total of 104 genes were highly coexpressed (r > 0.95. The coexpression network could be divided into two main subnetworks showing over expression in the medium or earlier and late phases, respectively. In order to identify the putative regulatory genes, a transcription factor (TF analysis was performed. This led to the identification of 45 gene families, mainly including the AP2-EREBP, bHLH, MYB, and NAC families, etc. After coexpression analysis of TFs with highly expression of FAD2 and FAD3 genes, 162 TFs were found to be significantly associated with two FAD genes (r > 0.95. Those TFs were predicted to be the key regulatory factors in ALA biosynthesis in perilla seed. The qRT-PCR analysis also verified the relevance of expression pattern between two FAD genes and partial candidate TFs. Although it has been reported that some TFs

  12. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  13. Truncating mutation in the NHS gene: phenotypic heterogeneity of Nance-Horan syndrome in an asian Indian family.

    Science.gov (United States)

    Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy

    2005-01-01

    A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.

  14. Bioinformatics analysis of RNA-seq data revealed critical genes in colon adenocarcinoma.

    Science.gov (United States)

    Xi, W-D; Liu, Y-J; Sun, X-B; Shan, J; Yi, L; Zhang, T-T

    2017-07-01

    RNA-seq data of colon adenocarcinoma (COAD) were analyzed with bioinformatics tools to discover critical genes in the disease. Relevant small molecule drugs, transcription factors (TFs) and microRNAs (miRNAs) were also investigated. RNA-seq data of COAD were downloaded from The Cancer Genome Atlas (TCGA). Differential analysis was performed with package edgeR. False positive discovery (FDR) 1 were set as the cut-offs to screen out differentially expressed genes (DEGs). Gene coexpression network was constructed with package Ebcoexpress. GO enrichment analysis was performed for the DEGs in the gene coexpression network with DAVID. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was also performed for the genes with KOBASS 2.0. Modules were identified with MCODE of Cytoscape. Relevant small molecules drugs were predicted by Connectivity map. Relevant miRNAs and TFs were searched by WebGestalt. A total of 457 DEGs, including 255 up-regulated and 202 down-regulated genes, were identified from 437 COAD and 39 control samples. A gene coexpression network was constructed containing 40 DEGs and 101 edges. The genes were mainly associated with collagen fibril organization, extracellular matrix organization and translation. Two modules were identified from the gene coexpression network, which were implicated in muscle contraction and extracellular matrix organization, respectively. Several critical genes were disclosed, such as MYH11, COL5A2 and ribosomal proteins. Nine relevant small molecule drugs were identified, such as scriptaid and STOCK1N-35874. Accordingly, a total of 17 TFs and 10 miRNAs related to COAD were acquired, such as ETS2, NFAT, AP4, miR-124A, MiR-9, miR-96 and let-7. Several critical genes and relevant drugs, TFs and miRNAs were revealed in COAD. These findings could advance the understanding of the disease and benefit therapy development.

  15. Efficient RNAi-based gene family knockdown via set cover optimization.

    Science.gov (United States)

    Zhao, Wenzhong; Fanning, M Leigh; Lane, Terran

    2005-01-01

    We address the problem of selecting an efficient set of initiator molecules (siRNAs) for RNA interference (RNAi)-based gene family knockdown experiments. Our goal is to select a minimal set of siRNAs that (a) cover a targeted gene family or a specified subset of it, (b) do not cover any untargeted genes, and (c) are individually highly effective at inducing knockdown. We give two formalizations of the gene family knockdown problem. First, we show that the problem, minimizing the number of siRNAs required to knock down a family of genes, is NP-Hard via a reduction to the set cover problem. Second, we generalize the basic problem to incorporate additional biological constraints and optimality criteria. To solve the resulting set-cover variants, we modify the classical branch-and-bound algorithm to include some of these biological criteria. We find that in many typical cases these constraints reduce the search space enough that we are able to compute exact minimal siRNA covers within reasonable time. For larger cases, we propose a probabilistic greedy algorithm for finding minimal siRNA covers efficiently. We apply our methods to two different gene families, the FREP genes from Biomphalaria glabrata and the olfactory genes from Caenorhabditis elegans. Our computational results on real biological data show that the probabilistic greedy algorithm produces siRNA covers as good as the branch-and-bound algorithm in most cases. Both algorithms return minimal siRNA covers with high predicted probability that the selected siRNAs will be effective at inducing knockdown. We also examine the role of "off-target" interactions: the constraint of avoiding covering untargeted genes can, in some cases, substantially increase the complexity of the resulting solution. Overall, we find that in many common cases our approach significantly reduces the number of siRNAs required in gene family knockdown experiments, as compared to knocking down genes independently.

  16. New role of LTR-retrotransposons for emergence and expansion of disease-resistance genes and high-copy gene families in plants.

    Science.gov (United States)

    Kim, Seungill; Choi, Doil

    2018-02-01

    Long terminal repeat retrotransposons (LTR-Rs) are major elements creating new genome structure for expansion of plant genomes. However, in addition to the genome expansion, the role of LTR-Rs has been unexplored. In this study, we constructed new reference genome sequences of two pepper species (Capsicum baccatum and C. chinense), and updated the reference genome of C. annuum. We focused on the study for speciation of Capsicum spp. and its driving forces. We found that chromosomal translocation, unequal amplification of LTR-Rs, and recent gene duplications in the pepper genomes as major evolutionary forces for diversification of Capsicum spp. Specifically, our analyses revealed that the nucleotide-binding and leucine-rich-repeat proteins (NLRs) were massively created by LTR-R-driven retroduplication. These retoduplicated NLRs were abundant in higher plants, and most of them were lineage-specific. The retroduplication was a main process for creation of functional disease-resistance genes in Solanaceae plants. In addition, 4-10% of whole genes including highly amplified families such as MADS-box and cytochrome P450 emerged by the retroduplication in the plants. Our study provides new insight into creation of disease-resistance genes and high-copy number gene families by retroduplication in plants. [BMB Reports 2018; 51(2): 55-56].

  17. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  18. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  19. Molecular cloning and expression analysis of the sucrose transporter gene family from Theobroma cacao L.

    Science.gov (United States)

    Li, Fupeng; Wu, Baoduo; Qin, Xiaowei; Yan, Lin; Hao, Chaoyun; Tan, Lehe; Lai, Jianxiong

    2014-08-10

    In this study, we performed cloning and expression analysis of six putative sucrose transporter genes, designated TcSUT1, TcSUT2, TcSUT3, TcSUT4, TcSUT5 and TcSUT6, from the cacao genotype 'TAS-R8'. The combination of cDNA and genomic DNA sequences revealed that the cacao SUT genes contained exon numbers ranging from 1 to 14. The average molecular mass of all six deduced proteins was approximately 56 kDa (range 52 to 66 kDa). All six proteins were predicted to exhibit typical features of sucrose transporters with 12 trans-membrane spanning domains. Phylogenetic analysis revealed that TcSUT2 and TcSUT4 belonged to Group 2 SUT and Group 4 SUT, respectively, and the other TcSUT proteins were belonging to Group 1 SUT. Real-time PCR was conducted to investigate the expression pattern of each member of the SUT family in cacao. Our experiment showed that TcSUT1 was expressed dominantly in pods and that, TcSUT3 and TcSUT4 were highly expressed in both pods and in bark with phloem. Within pods, TcSUT1 and TcSUT4 were expressed more in the seed coat and seed from the pod enlargement stage to the ripening stage. TcSUT5 expression sharply increased to its highest expression level in the seed coat during the ripening stage. Expression pattern analysis indicated that TcSUT genes may be associated with photoassimilate transport into developing seeds and may, therefore, have an impact on seed production. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Evolution of the bovine TLR gene family and member associations with Mycobacterium avium subspecies paratuberculosis infection.

    Directory of Open Access Journals (Sweden)

    Colleen A Fisher

    Full Text Available Members of the Toll-like receptor (TLR gene family occupy key roles in the mammalian innate immune system by functioning as sentries for the detection of invading pathogens, thereafter provoking host innate immune responses. We utilized a custom next-generation sequencing approach and allele-specific genotyping assays to detect and validate 280 biallelic variants across all 10 bovine TLR genes, including 71 nonsynonymous single nucleotide polymorphisms (SNPs and one putative nonsense SNP. Bayesian haplotype reconstructions and median joining networks revealed haplotype sharing between Bos taurus taurus and Bos taurus indicus breeds at every locus, and specialized beef and dairy breeds could not be differentiated despite an average polymorphism density of 1 marker/158 bp. Collectively, 160 tagSNPs and two tag insertion-deletion mutations (indels were sufficient to predict 100% of the variation at 280 variable sites for both Bos subspecies and their hybrids, whereas 118 tagSNPs and 1 tagIndel predictively captured 100% of the variation at 235 variable sites for B. t. taurus. Polyphen and SIFT analyses of amino acid (AA replacements encoded by bovine TLR SNPs indicated that up to 32% of the AA substitutions were expected to impact protein function. Classical and newly developed tests of diversity provide strong support for balancing selection operating on TLR3 and TLR8, and purifying selection acting on TLR10. An investigation of the persistence and continuity of linkage disequilibrium (r2≥0.50 between adjacent variable sites also supported the presence of selection acting on TLR3 and TLR8. A case-control study employing validated variants from bovine TLR genes recognizing bacterial ligands revealed six SNPs potentially eliciting small effects on susceptibility to Mycobacterium avium spp paratuberculosis infection in dairy cattle. The results of this study will broadly impact domestic cattle research by providing the necessary foundation to

  1. Gene family expansions and contractions are associated with host range in plant pathogens of the genus Colletotrichum.

    Science.gov (United States)

    Baroncelli, Riccardo; Amby, Daniel Buchvaldt; Zapparata, Antonio; Sarrocco, Sabrina; Vannacci, Giovanni; Le Floch, Gaétan; Harrison, Richard J; Holub, Eric; Sukno, Serenella A; Sreenivasaprasad, Surapareddy; Thon, Michael R

    2016-08-05

    Many species belonging to the genus Colletotrichum cause anthracnose disease on a wide range of plant species. In addition to their economic impact, the genus Colletotrichum is a useful model for the study of the evolution of host specificity, speciation and reproductive behaviors. Genome projects of Colletotrichum species have already opened a new era for studying the evolution of pathogenesis in fungi. We sequenced and annotated the genomes of four strains in the Colletotrichum acutatum species complex (CAsc), a clade of broad host range pathogens within the genus. The four CAsc proteomes and secretomes along with those representing an additional 13 species (six Colletotrichum spp. and seven other Sordariomycetes) were classified into protein families using a variety of tools. Hierarchical clustering of gene family and functional domain assignments, and phylogenetic analyses revealed lineage specific losses of carbohydrate-active enzymes (CAZymes) and proteases encoding genes in Colletotrichum species that have narrow host range as well as duplications of these families in the CAsc. We also found a lineage specific expansion of necrosis and ethylene-inducing peptide 1 (Nep1)-like protein (NLPs) families within the CAsc. This study illustrates the plasticity of Colletotrichum genomes, and shows that major changes in host range are associated with relatively recent changes in gene content.

  2. a photoreceptor gene mutation in an indigenous black african family

    African Journals Online (AJOL)

    Clearly, within the next decade effective gene therapy for some forms of RD in humans will be possible, bVt once again these will be mutation-specific, so it is essential to identify the retinal disease-causing genes in each and every southern. African RD patient. This research was supported by grants from the RP Foundation.

  3. Genomewide analysis of the chitinase gene family in Populus ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... class II chitinase genes, was induced by methyl jasmonate. (MeJA) rather than other treatments. POPTR_0012s01150.1 is a class III chitinase gene. It was sensitive to elicitor and wound inducements but insensitive to salicylid acid. (SA) and MeJA treatments. When Populus was infected by. M. brunnea, the ...

  4. Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

    Science.gov (United States)

    Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

    2016-07-01

    Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Characterization and Functional Analysis of PEBP Family Genes in Upland Cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Zhang, Xiaohong; Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun

    2016-01-01

    Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton.

  6. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  7. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  8. Molecular Evolution and Expression Divergence of Aconitase (ACO Gene Family in Land Plants

    Directory of Open Access Journals (Sweden)

    Yi-ming Wang

    2016-12-01

    Full Text Available Aconitase (ACO is a key enzyme that catalyzes the isomerization of citrate to isocitrate in the tricarboxylic acid (TCA and glyoxylate cycles. The function of ACOs has been well studied in model plants, such as Arabidopsis. In contrast, the evolutionary patterns of the ACO family in land plants are poorly understood. In this study, we systematically examined the molecular evolution and expression divergence of the ACO gene family in 12 land plant species. Thirty-six ACO genes were identified from the 12 land plant species representing the four major land plant lineages: bryophytes, lycophytes, gymnosperms, and angiosperms. All of these ACOs belong to the cytosolic isoform. Three gene duplication events contributed to the expansion of the ACO family in angiosperms. The ancestor of angiosperms may have contained only one ACO gene. One gene duplication event split angiosperm ACOs into two distinct clades. Two clades showed a divergence in selective pressure and gene expression patterns. The cis-acting elements that function in light responsiveness were most abundant in the promoter region of the ACO genes, indicating that plant ACO genes might participate in light regulatory pathways. Our findings provide comprehensive insights into the ACO gene family in land plants.

  9. Duplication, divergence and persistence in the Phytochrome photoreceptor gene family of cottons (Gossypium spp.

    Directory of Open Access Journals (Sweden)

    Abdukarimov Abdusattor

    2010-06-01

    Full Text Available Abstract Background Phytochromes are a family of red/far-red photoreceptors that regulate a number of important developmental traits in cotton (Gossypium spp., including plant architecture, fiber development, and photoperiodic flowering. Little is known about the composition and evolution of the phytochrome gene family in diploid (G. herbaceum, G. raimondii or allotetraploid (G. hirsutum, G. barbadense cotton species. The objective of this study was to obtain a preliminary inventory and molecular-evolutionary characterization of the phytochrome gene family in cotton. Results We used comparative sequence resources to design low-degeneracy PCR primers that amplify genomic sequence tags (GSTs for members of the PHYA, PHYB/D, PHYC and PHYE gene sub-families from A- and D-genome diploid and AD-genome allotetraploid Gossypium species. We identified two paralogous PHYA genes (designated PHYA1 and PHYA2 in diploid cottons, the result of a Malvaceae-specific PHYA gene duplication that occurred approximately 14 million years ago (MYA, before the divergence of the A- and D-genome ancestors. We identified a single gene copy of PHYB, PHYC, and PHYE in diploid cottons. The allotetraploid genomes have largely retained the complete gene complements inherited from both of the diploid genome ancestors, with at least four PHYA genes and two genes encoding PHYB, PHYC and PHYE in the AD-genomes. We did not identify a PHYD gene in any cotton genomes examined. Conclusions Detailed sequence analysis suggests that phytochrome genes retained after duplication by segmental duplication and allopolyploidy appear to be evolving independently under a birth-and-death-process with strong purifying selection. Our study provides a preliminary phytochrome gene inventory that is necessary and sufficient for further characterization of the biological functions of each of the cotton phytochrome genes, and for the development of 'candidate gene' markers that are potentially useful for

  10. Ixodes scapularis tick serine proteinase inhibitor (serpin gene family; annotation and transcriptional analysis

    Directory of Open Access Journals (Sweden)

    Chalaire Katelyn C

    2009-05-01

    Full Text Available Abstract Background Serine proteinase inhibitors (Serpins are a large superfamily of structurally related, but functionally diverse proteins that control essential proteolytic pathways in most branches of life. Given their importance in the biology of many organisms, the concept that ticks might utilize serpins to evade host defenses and immunizing against or disrupting their functions as targets for tick control is an appealing option. Results A sequence homology search strategy has allowed us to identify at least 45 tick serpin genes in the Ixodes scapularis genome that are structurally segregated into 32 intronless and 13 intron-containing genes. Nine of the intron-containing serpins occur in a cluster of 11 genes that span 170 kb of DNA sequence. Based on consensus amino acid residues in the reactive center loop (RCL and signal peptide scanning, 93% are putatively inhibitory while 82% are putatively extracellular. Among the 11 different amino acid residues that are predicted at the P1 sites, 16 sequences possess basic amino acid (R/K residues. Temporal and spatial expression analyses revealed that 40 of the 45 serpins are differentially expressed in salivary glands (SG and/or midguts (MG of unfed and partially fed ticks. Ten of the 38 serpin genes were expressed from six to 24 hrs of feeding while six and fives genes each are predominantly or exclusively expressed in either MG and SG respectively. Conclusion Given the diversity among tick species, sizes of tick serpin families are likely to be variable. However this study provides insight on the potential sizes of serpin protein families in ticks. Ticks must overcome inflammation, complement activation and blood coagulation to complete feeding. Since these pathways are regulated by serpins that have basic residues at their P1 sites, we speculate that I. scapularis may utilize some of the serpins reported in this study to manipulate host defense. We have discussed our data in the context of

  11. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  12. Transcriptome-wide identification and expression profiling of the DOF transcription factor gene family in Chrysanthemum morifolium

    Directory of Open Access Journals (Sweden)

    Aiping eSong

    2016-02-01

    Full Text Available The family of DNA binding with one finger (DOF transcription factors is plant specific, and these proteins contain a highly conserved domain (DOF domain of 50-52 amino acids that includes a C2C2-type zinc finger motif at the N-terminus that is known to function in a number of plant processes. Here, we characterized 20 DOF genes in the important ornamental species chrysanthemum (Chrysanthemum morifolium based on transcriptomic sequences. Phylogenetic analysis identified one pair of putative orthologous proteins in Arabidopsis and chrysanthemum and six pairs of paralogous proteins in chrysanthemum. Conserved motifs in the DOF proteins shared by Arabidopsis and chrysanthemum were analysed using MEME. Bioinformatics analysis revealed that 13 CmDOFs could be targeted by 16 miRNA families. Moreover, we used 5’ RLM-RACE to map the cleavage sites in CmDOF3, 15 and 21. The expression of these 20 genes in response to phytohormone treatments and abiotic stresses was characterized, and the expression patterns of six pairs of paralogous CmDOF genes were found to completely differ from one another, except for CmDOF6 and CmDOF7. This work will promote our research of the various functions of DOF gene family members in plant hormone and stress responses.

  13. Transcriptome-Wide Identification and Expression Profiling of the DOF Transcription Factor Gene Family in Chrysanthemum morifolium.

    Science.gov (United States)

    Song, Aiping; Gao, Tianwei; Li, Peiling; Chen, Sumei; Guan, Zhiyong; Wu, Dan; Xin, Jingjing; Fan, Qingqing; Zhao, Kunkun; Chen, Fadi

    2016-01-01

    The family of DNA binding with one finger (DOF) transcription factors is plant specific, and these proteins contain a highly conserved domain (DOF domain) of 50-52 amino acids that includes a C2C2-type zinc finger motif at the N-terminus that is known to function in a number of plant processes. Here, we characterized 20 DOF genes in the important ornamental species chrysanthemum (Chrysanthemum morifolium) based on transcriptomic sequences. Phylogenetic analysis identified one pair of putative orthologous proteins in Arabidopsis and chrysanthemum and six pairs of paralogous proteins in chrysanthemum. Conserved motifs in the DOF proteins shared by Arabidopsis and chrysanthemum were analyzed using MEME. Bioinformatics analysis revealed that 13 CmDOFs could be targeted by 16 miRNA families. Moreover, we used 5' RLM-RACE to map the cleavage sites in CmDOF3, 15, and 21. The expression of these 20 genes in response to phytohormone treatments and abiotic stresses was characterized, and the expression patterns of six pairs of paralogous CmDOF genes were found to completely differ from one another, except for CmDOF6 and CmDOF7. This work will promote our research of the various functions of DOF gene family members in plant hormone and stress responses.

  14. High Gene Family Turnover Rates and Gene Space Adaptation in the Compact Genome of the Carnivorous Plant Utricularia gibba.

    Science.gov (United States)

    Carretero-Paulet, Lorenzo; Librado, Pablo; Chang, Tien-Hao; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Rozas, Julio; Albert, Victor A

    2015-05-01

    Utricularia gibba is an aquatic carnivorous plant with highly specialized morphology, featuring fibrous floating networks of branches and leaf-like organs, no recognizable roots, and bladder traps that capture and digest prey. We recently described the compressed genome of U. gibba as sufficient to control the development and reproduction of a complex organism. We hypothesized intense deletion pressure as a mechanism whereby most noncoding DNA was deleted, despite evidence for three independent whole-genome duplications (WGDs). Here, we explore the impact of intense genome fractionation in the evolutionary dynamics of U. gibba's functional gene space. We analyze U. gibba gene family turnover by modeling gene gain/death rates under a maximum-likelihood statistical framework. In accord with our deletion pressure hypothesis, we show that the U. gibba gene death rate is significantly higher than those of four other eudicot species. Interestingly, the gene gain rate is also significantly higher, likely reflecting the occurrence of multiple WGDs and possibly also small-scale genome duplications. Gene ontology enrichment analyses of U. gibba-specific two-gene orthogroups, multigene orthogroups, and singletons highlight functions that may represent adaptations in an aquatic carnivorous plant. We further discuss two homeodomain transcription factor gene families (WOX and HDG/HDZIP-IV) showing conspicuous differential expansions and contractions in U. gibba. Our results 1) reconcile the compactness of the U. gibba genome with its accommodation of a typical number of genes for a plant genome, and 2) highlight the role of high gene family turnover in the evolutionary diversification of U. gibba's functional gene space and adaptations to its unique lifestyle and highly specialized body plan. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Gamma-Tocotrienol Modulated Gene Expression in Senescent Human Diploid Fibroblasts as Revealed by Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Suzana Makpol

    2013-01-01

    Full Text Available The effect of γ-tocotrienol, a vitamin E isomer, in modulating gene expression in cellular aging of human diploid fibroblasts was studied. Senescent cells at passage 30 were incubated with 70 μM of γ-tocotrienol for 24 h. Gene expression patterns were evaluated using Sentrix HumanRef-8 Expression BeadChip from Illumina, analysed using GeneSpring GX10 software, and validated using quantitative RT-PCR. A total of 100 genes were differentially expressed (P<0.001 by at least 1.5 fold in response to γ-tocotrienol treatment. Amongst the genes were IRAK3, SelS, HSPA5, HERPUD1, DNAJB9, SEPR1, C18orf55, ARF4, RINT1, NXT1, CADPS2, COG6, and GLRX5. Significant gene list was further analysed by Gene Set Enrichment Analysis (GSEA, and the Normalized Enrichment Score (NES showed that biological processes such as inflammation, protein transport, apoptosis, and cell redox homeostasis were modulated in senescent fibroblasts treated with γ-tocotrienol. These findings revealed that γ-tocotrienol may prevent cellular aging of human diploid fibroblasts by modulating gene expression.

  16. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  17. Molecular and biochemical characterization of the Fe(III) chelate reductase gene family in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Huilan; Li, Lihua; Du, Juan; Yuan, Youxi; Cheng, Xudong; Ling, Hong-Qing

    2005-09-01

    Iron chelate reductase is required for iron acquisition from soil and for metabolism in plants. In the genome of Arabidopsis thaliana there are eight genes classified into the iron chelate reductase gene family (AtFROs) based on sequence homology with AtFRO2 (a ferric chelate reductase in Arabidopsis). They are localized on chromosome 1 (three AtFROs) and chromosome 5 (five AtFROs) of Arabidopsis and show a high level of amino acid sequence similarity to each other. An assay for ferric chelate reductase activity revealed that AtFRO2, AtFRO3, AtFRO4, AtFRO5, AtFRO7 and AtFRO8 conferred significantly increased iron reduction activity compared with the control when expressed in yeast cells, indicating that the six AtFROs encode iron chelate reductases functioning in iron homeostasis in Arabidopsis. AtFRO2 displayed the highest iron reduction activity among the AtFROs investigated, further demonstrating that AtFRO2 is a major iron reductase gene in Arabidopsis. AtFRO2 and AtFRO3 were mainly expressed in roots of Arabidopsis, AtFRO5 and AtFRO6 in shoots and flowers, and AtFRO7 in cotyledons and trichomes, whereas the transcription of AtFRO8 was specific for leaf veins. Considering the tissue-specific expression profiles of AtFRO genes, we suggest that AtFRO2 and AtFRO3 are two Fe(III) chelate reductases mainly functioning in iron acquisition and metabolism in Arabidopsis roots, while AtFRO5, AtFRO6, AtFRO7 and AtFRO8 are required for iron homeostasis in different tissues of shoots.

  18. Genome wide identification of Dof transcription factor gene family in sorghum and its comparative phylogenetic analysis with rice and Arabidopsis.

    Science.gov (United States)

    Kushwaha, Hariom; Gupta, Shubhra; Singh, Vinay Kumar; Rastogi, Smita; Yadav, Dinesh

    2011-11-01

    The Dof (DNA binding with One Finger) family represents a classic zinc-finger transcription factors involved with multifarious roles exclusively in plants. There exists great diversity in terms of number of Dof genes observed in different crops. In current study, a total of 28 putative Dof genes have been predicted in silico from the recently available whole genome shotgun sequence of Sorghum bicolor (L.) Moench (with assigned accession numbers TPA:BK006983-BK007006 and TPA:BK007079-BK007082). The predicted SbDof genes are distributed on nine out of ten chromosomes of sorghum and most of these genes lack introns based on canonical intron/exon structure. Phylogenetic analysis of 28 SbDof proteins resulted in four subgroups constituting six clusters. The comparative phylogenetic analysis of these Dof proteins along with 30 rice and 36 Arabidopsis Dof proteins revealed six major groups similar to what has been observed earlier for rice and Arabidopsis. Motif analysis revealed the presence of conserved 50-52 amino acids Dof domain uniformly distributed across all the 28 Dof proteins of sorghum. The in silico cis-regulatory elements analysis of these SbDof genes suggested its diverse functions associated with light responsiveness, endosperm specific gene expression, hormone responsiveness, meristem specific expression and stress responsiveness.

  19. Gene Coexpression Analysis Reveals Complex Metabolism of the Monoterpene Alcohol Linalool in Arabidopsis Flowers[W][OPEN

    Science.gov (United States)

    Ginglinger, Jean-François; Boachon, Benoit; Höfer, René; Paetz, Christian; Köllner, Tobias G.; Miesch, Laurence; Lugan, Raphael; Baltenweck, Raymonde; Mutterer, Jérôme; Ullmann, Pascaline; Beran, Franziska; Claudel, Patricia; Verstappen, Francel; Fischer, Marc J.C.; Karst, Francis; Bouwmeester, Harro; Miesch, Michel; Schneider, Bernd; Gershenzon, Jonathan; Ehlting, Jürgen; Werck-Reichhart, Danièle

    2013-01-01

    The cytochrome P450 family encompasses the largest family of enzymes in plant metabolism, and the functions of many of its members in Arabidopsis thaliana are still unknown. Gene coexpression analysis pointed to two P450s that were coexpressed with two monoterpene synthases in flowers and were thus predicted to be involved in monoterpenoid metabolism. We show that all four selected genes, the two terpene synthases (TPS10 and TPS14) and the two cytochrome P450s (CYP71B31 and CYP76C3), are simultaneously expressed at anthesis, mainly in upper anther filaments and in petals. Upon transient expression in Nicotiana benthamiana, the TPS enzymes colocalize in vesicular structures associated with the plastid surface, whereas the P450 proteins were detected in the endoplasmic reticulum. Whether they were expressed in Saccharomyces cerevisiae or in N. benthamiana, the TPS enzymes formed two different enantiomers of linalool: (−)-(R)-linalool for TPS10 and (+)-(S)-linalool for TPS14. Both P450 enzymes metabolize the two linalool enantiomers to form different but overlapping sets of hydroxylated or epoxidized products. These oxygenated products are not emitted into the floral headspace, but accumulate in floral tissues as further converted or conjugated metabolites. This work reveals complex linalool metabolism in Arabidopsis flowers, the ecological role of which remains to be determined. PMID:24285789

  20. Global analysis of ankyrin repeat domain C3HC4-type RING finger gene family in plants.

    Directory of Open Access Journals (Sweden)

    Xiaowei Yuan

    Full Text Available Ankyrin repeat (ANK C3HC4-type RING finger (RF genes comprise a large family in plants and play important roles in various physiological processes of plant life. In this study, we identified 187 ANK C3HC4-type RF proteins from 29 species with complete genomes and named the ANK C3HC4-type RF proteins the XB3-like proteins because they are structurally related to the rice (Oryza sativa XB3. A phylogenetic relationship analysis suggested that the XB3-like genes originated from ferns, and the encoded proteins fell into 3 major groups. Among these groups, we found that the spacing between the metal ligand position 6 and 7, and the conserved residues, which was in addition to the metal ligand amino acids, in the C3HC4-type RF were different. Using a wide range of protein structural analyses, protein models were established, and all XB3-like proteins were found to contain two to seven ANKs and a C3HC4-type RF. The microarray data for the XB3-like genes of Arabidopsis, Oryza sative, Zea mays and Glycine max revealed that the expression of XB3-like genes was in different tissues and during different life stages. The preferential expression of XB3-like genes in specified tissues and the response to phytohormone and abiotic stress treatments of Arabidopsis and Zea mays not only confirmed the microarray analysis data but also demonstrated that the XB3-like proteins play roles in plant growth and development as well as in stress responses. Our data provide a very useful reference for the identification and functional analysis of members of this gene family and also provide a new method for the genome-wide analysis of gene families.

  1. Structure, evolution and functional inference on the Mildew Locus O (MLO) gene family in three cultivated Cucurbitaceae spp.

    Science.gov (United States)

    Iovieno, Paolo; Andolfo, Giuseppe; Schiavulli, Adalgisa; Catalano, Domenico; Ricciardi, Luigi; Frusciante, Luigi; Ercolano, Maria Raffaella; Pavan, Stefano

    2015-12-29

    The powdery mildew disease affects thousands of plant species and arguably represents the major fungal threat for many Cucurbitaceae crops, including melon (Cucumis melo L.), watermelon (Citrullus lanatus L.) and zucchini (Cucurbita pepo L.). Several studies revealed that specific members of the Mildew Locus O (MLO) gene family act as powdery mildew susceptibility factors. Indeed, their inactivation, as the result of gene knock-out or knock-down, is associated with a peculiar form of resistance, referred to as mlo resistance. We exploited recently available genomic information to provide a comprehensive overview of the MLO gene family in Cucurbitaceae. We report the identification of 16 MLO homologs in C. melo, 14 in C. lanatus and 18 in C. pepo genomes. Bioinformatic treatment of data allowed phylogenetic inference and the prediction of several ortholog pairs and groups. Comparison with functionally characterized MLO genes and, in C. lanatus, gene expression analysis, resulted in the detection of candidate powdery mildew susceptibility factors. We identified a series of conserved amino acid residues and motifs that are likely to play a major role for the function of MLO proteins. Finally, we performed a codon-based evolutionary analysis indicating a general high level of purifying selection in the three Cucurbitaceae MLO gene families, and the occurrence of regions under diversifying selection in candidate susceptibility factors. Results of this study may help to address further biological questions concerning the evolution and function of MLO genes. Moreover, data reported here could be conveniently used by breeding research, aiming to select powdery mildew resistant cultivars in Cucurbitaceae.

  2. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  3. Predicting the proteins of Angomonas deanei, Strigomonas culicis and their respective endosymbionts reveals new aspects of the trypanosomatidae family.

    Directory of Open Access Journals (Sweden)

    Maria Cristina Machado Motta

    Full Text Available Endosymbiont-bearing trypanosomatids have been considered excellent models for the study of cell evolution because the host protozoan co-evolves with an intracellular bacterium in a mutualistic relationship. Such protozoa inhabit a single invertebrate host during their entire life cycle and exhibit special characteristics that group them in a particular phylogenetic cluster of the Trypanosomatidae family, thus classified as monoxenics. In an effort to better understand such symbiotic association, we used DNA pyrosequencing and a reference-guided assembly to generate reads that predicted 16,960 and 12,162 open reading frames (ORFs in two symbiont-bearing trypanosomatids, Angomonas deanei (previously named as Crithidia deanei and Strigomonas culicis (first known as Blastocrithidia culicis, respectively. Identification of each ORF was based primarily on TriTrypDB using tblastn, and each ORF was confirmed by employing getorf from EMBOSS and Newbler 2.6 when necessary. The monoxenic organisms revealed conserved housekeeping functions when compared to other trypanosomatids, especially compared with Leishmania major. However, major differences were found in ORFs corresponding to the cytoskeleton, the kinetoplast, and the paraflagellar structure. The monoxenic organisms also contain a large number of genes for cytosolic calpain-like and surface gp63 metalloproteases and a reduced number of compartmentalized cysteine proteases in comparison to other TriTryp organisms, reflecting adaptations to the presence of the symbiont. The assembled bacterial endosymbiont sequences exhibit a high A+T content with a total of 787 and 769 ORFs for the Angomonas deanei and Strigomonas culicis endosymbionts, respectively, and indicate that these organisms hold a common ancestor related to the Alcaligenaceae family. Importantly, both symbionts contain enzymes that complement essential host cell biosynthetic pathways, such as those for amino acid, lipid and purine

  4. Predicting the Proteins of Angomonas deanei, Strigomonas culicis and Their Respective Endosymbionts Reveals New Aspects of the Trypanosomatidae Family

    Science.gov (United States)

    Motta, Maria Cristina Machado; Martins, Allan Cezar de Azevedo; de Souza, Silvana Sant’Anna; Catta-Preta, Carolina Moura Costa; Silva, Rosane; Klein, Cecilia Coimbra; de Almeida, Luiz Gonzaga Paula; de Lima Cunha, Oberdan; Ciapina, Luciane Prioli; Brocchi, Marcelo; Colabardini, Ana Cristina; de Araujo Lima, Bruna; Machado, Carlos Renato; de Almeida Soares, Célia Maria; Probst, Christian Macagnan; de Menezes, Claudia Beatriz Afonso; Thompson, Claudia Elizabeth; Bartholomeu, Daniella Castanheira; Gradia, Daniela Fiori; Pavoni, Daniela Parada; Grisard, Edmundo C.; Fantinatti-Garboggini, Fabiana; Marchini, Fabricio Klerynton; Rodrigues-Luiz, Gabriela Flávia; Wagner, Glauber; Goldman, Gustavo Henrique; Fietto, Juliana Lopes Rangel; Elias, Maria Carolina; Goldman, Maria Helena S.; Sagot, Marie-France; Pereira, Maristela; Stoco, Patrícia H.; de Mendonça-Neto, Rondon Pessoa; Teixeira, Santuza Maria Ribeiro; Maciel, Talles Eduardo Ferreira; de Oliveira Mendes, Tiago Antônio; Ürményi, Turán P.; de Souza, Wanderley; Schenkman, Sergio; de Vasconcelos, Ana Tereza Ribeiro

    2013-01-01

    Endosymbiont-bearing trypanosomatids have been considered excellent models for the study of cell evolution because the host protozoan co-evolves with an intracellular bacterium in a mutualistic relationship. Such protozoa inhabit a single invertebrate host during their entire life cycle and exhibit special characteristics that group them in a particular phylogenetic cluster of the Trypanosomatidae family, thus classified as monoxenics. In an effort to better understand such symbiotic association, we used DNA pyrosequencing and a reference-guided assembly to generate reads that predicted 16,960 and 12,162 open reading frames (ORFs) in two symbiont-bearing trypanosomatids, Angomonas deanei (previously named as Crithidia deanei) and Strigomonas culicis (first known as Blastocrithidia culicis), respectively. Identification of each ORF was based primarily on TriTrypDB using tblastn, and each ORF was confirmed by employing getorf from EMBOSS and Newbler 2.6 when necessary. The monoxenic organisms revealed conserved housekeeping functions when compared to other trypanosomatids, especially compared with Leishmania major. However, major differences were found in ORFs corresponding to the cytoskeleton, the kinetoplast, and the paraflagellar structure. The monoxenic organisms also contain a large number of genes for cytosolic calpain-like and surface gp63 metalloproteases and a reduced number of compartmentalized cysteine proteases in comparison to other TriTryp organisms, reflecting adaptations to the presence of the symbiont. The assembled bacterial endosymbiont sequences exhibit a high A+T content with a total of 787 and 769 ORFs for the Angomonas deanei and Strigomonas culicis endosymbionts, respectively, and indicate that these organisms hold a common ancestor related to the Alcaligenaceae family. Importantly, both symbionts contain enzymes that complement essential host cell biosynthetic pathways, such as those for amino acid, lipid and purine/pyrimidine metabolism

  5. NLRC and NLRX gene family mRNA expression and prognostic value in hepatocellular carcinoma.

    Science.gov (United States)

    Wang, Xiangkun; Yang, Chengkun; Liao, Xiwen; Han, Chuangye; Yu, Tingdong; Huang, Ketuan; Yu, Long; Qin, Wei; Zhu, Guangzhi; Su, Hao; Liu, Xiaoguang; Ye, Xinping; Chen, Bin; Peng, Minhao; Peng, Tao

    2017-11-01

    Nucleotide-binding oligomerization domain (NOD)-like receptor (NLR)C and NLRX family proteins play a key role in the innate immune response. The relationship between these proteins and hepatocellular carcinoma (HCC) remains unclear. This study investigated the prognostic significance of NLRC and NLRX family protein levels in HCC patients. Data from 360 HCC patients in The Cancer Genome Atlas database and 231 patients in the Gene Expression Omnibus database were analyzed. Kaplan-Meier analysis and a Cox regression model were used to determine median survival time (MST) and overall and recurrence-free survival by calculating the hazard ratio (HR) and 95% confidence interval (CI). High NOD2 and low NLRX1 expression in tumor tissue was associated with short MST (P = 0.012 and 0.014, respectively). A joint-effects analysis of NOD2 and NLRX1 combined revealed that groups III and IV had reduced risk of death from HCC as compared to group I (adjusted P = 0.001, adjusted HR = 0.31, 95% CI = 0.16-0.61 and adjusted P = 0.043, adjusted HR = 0.63, 95%CI = 0.41-0.99, respectively). NOD2 and NLRX1 expression levels are potential prognostic markers in HCC following hepatectomy. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  6. Unexpected functional similarities between gatekeeper tumour suppressor genes and proto-oncogenes revealed by systems biology.

    Science.gov (United States)

    Zhao, Yongzhong; Epstein, Richard J

    2011-05-01

    Familial tumor suppressor genes comprise two subgroups: caretaker genes (CTs) that repair DNA, and gatekeeper genes (GKs) that trigger cell death. Since GKs may also induce cell cycle delay and thus enhance cell survival by facilitating DNA repair, we hypothesized that the prosurvival phenotype of GKs could be selected during cancer progression, and we used a multivariable systems biology approach to test this. We performed multidimensional data analysis, non-negative matrix factorization and logistic regression to compare the features of GKs with those of their putative antagonists, the proto-oncogenes (POs), as well as with control groups of CTs and functionally unrelated congenital heart disease genes (HDs). GKs and POs closely resemble each other, but not CTs or HDs, in terms of gene structure (Pexpression level and breadth (Pimplied suggest a common functional attribute that is strongly negatively selected-that is, a shared phenotype that enhances cell survival. The counterintuitive finding of similar evolutionary pressures affecting GKs and POs raises an intriguing possibility: namely, that cancer microevolution is accelerated by an epistatic cascade in which upstream suppressor gene defects subvert the normal bifunctionality of wild-type GKs by constitutively shifting the phenotype away from apoptosis towards survival. If correct, this interpretation would explain the hitherto unexplained phenomenon of frequent wild-type GK (for example, p53) overexpression in tumors.

  7. Sequencing rare marine actinomycete genomes reveals high density of unique natural product biosynthetic gene clusters

    Science.gov (United States)

    Schorn, Michelle A.; Alanjary, Mohammad M.; Aguinaldo, Kristen; Korobeynikov, Anton; Podell, Sheila; Patin, Nastassia; Lincecum, Tommie; Jensen, Paul R.; Ziemert, Nadine

    2016-01-01

    Traditional natural product discovery methods have nearly exhausted the accessible diversity of microbial chemicals, making new sources and techniques paramount in the search for new molecules. Marine actinomycete bacteria have recently come into the spotlight as fruitful producers of structurally diverse secondary metabolites, and remain relatively untapped. In this study, we sequenced 21 marine-derived actinomycete strains, rarely studied for their secondary metabolite potential and under-represented in current genomic databases. We found that genome size and phylogeny were good predictors of biosynthetic gene cluster diversity, with larger genomes rivalling the well-known marine producers in the Streptomyces and Salinispora genera. Genomes in the Micrococcineae suborder, however, had consistently the lowest number of biosynthetic gene clusters. By networking individual gene clusters into gene cluster families, we were able to computationally estimate the degree of novelty each genus contributed to the current sequence databases. Based on the similarity measures between all actinobacteria in the Joint Genome Institute's Atlas of Biosynthetic gene Clusters database, rare marine genera show a high degree of novelty and diversity, with Corynebacterium, Gordonia, Nocardiopsis, Saccharomonospora and Pseudonocardia genera representing the highest gene cluster diversity. This research validates that rare marine actinomycetes are important candidates for exploration, as they are relatively unstudied, and their relatives are historically rich in secondary metabolites. PMID:27902408

  8. Reconstruction of ancestral metabolic enzymes reveals molecular mechanisms underlying evolutionary innovation through gene duplication.

    Directory of Open Access Journals (Sweden)

    Karin Voordeckers

    Full Text Available Gene duplications are believed to facilitate evolutionary innovation. However, the mechanisms shaping the fate of duplicated genes remain heavily debated because the molecular processes and evolutionary forces involved are difficult to reconstruct. Here, we study a large family of fungal glucosidase genes that underwent several duplication events. We reconstruct all key ancestral enzymes and show that the very first preduplication enzyme was primarily active on maltose-like substrates, with trace activity for isomaltose-like sugars. Structural analysis and activity measurements on resurrected and present-day enzymes suggest that both activities cannot be fully optimized in a single enzyme. However, gene duplications repeatedly spawned daughter genes in which mutations optimized either isomaltase or maltase activity. Interestingly, similar shifts in enzyme activity were reached multiple times via different evolutionary routes. Together, our results provide a detailed picture of the molecular mechanisms that drove divergence of these duplicated enzymes and show that whereas the classic models of dosage, sub-, and neofunctionalization are helpful to conceptualize the implications of gene duplication, the three mechanisms co-occur and intertwine.

  9. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S; Larsen, Line H G; Johannesen, Katrine M

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis...... of a wide spectrum of epilepsies with age of onset spanning from the neonatal period to adulthood. A gene panel targeting 46 epilepsy genes was used on a cohort of 216 patients consecutively referred for panel testing. The patients had a range of different epilepsies from benign neonatal seizures......-causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared...

  10. Differential SPL gene expression patterns reveal candidate genes underlying flowering time and architectural differences in Mimulus and Arabidopsis.

    Science.gov (United States)

    Jorgensen, Stacy A; Preston, Jill C

    2014-04-01

    Evolutionary transitions in growth habit and flowering time responses to variable environmental signals have occurred multiple times independently across angiosperms and have major impacts on plant fitness. Proteins in the SPL family of transcription factors collectively regulate flowering time genes that have been implicated in interspecific shifts in annuality/perenniality. However, their potential importance in the evolution of angiosperm growth habit has not been extensively investigated. Here we identify orthologs representative of the major SPL gene clades in annual Arabidopsis thaliana and Mimulus guttatus IM767, and perennial A. lyrata and M. guttatus PR, and characterize their expression. Spatio-temporal expression patterns are complex across both diverse tissues of the same taxa and comparable tissues of different taxa, consistent with genic sub- or neo-functionalization. However, our data are consistent with a general role for several SPL genes in the promotion of juvenile to adult phase change and/or flowering time in Mimulus and Arabidopsis. Furthermore, several candidate genes were identified for future study whose differential expression correlates with growth habit and architectural variation in annual versus perennial taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Evolutionary dynamics of the interferon-induced transmembrane gene family in vertebrates.

    Directory of Open Access Journals (Sweden)

    Zhao Zhang

    Full Text Available Vertebrate interferon-induced transmembrane (IFITM genes have been demonstrated to have extensive and diverse functions, playing important roles in the evolution of vertebrates. Despite observance of their functionality, the evolutionary dynamics of this gene family are complex and currently unknown. Here, we performed detailed evolutionary analyses to unravel the evolutionary history of the vertebrate IFITM family. A total of 174 IFITM orthologous genes and 112 pseudogenes were identified from 27 vertebrate genome sequences. The vertebrate IFITM family can be divided into immunity-related IFITM (IR-IFITM, IFITM5 and IFITM10 sub-families in phylogeny, implying origins from three different progenitors. In general, vertebrate IFITM genes are located in two loci, one containing the IFITM10 gene, and the other locus containing IFITM5 and various numbers of IR-IFITM genes. Conservation of evolutionary synteny was observed in these IFITM genes. Significant functional divergence was detected among the three IFITM sub-families. No gen