WorldWideScience

Sample records for gene family performs

  1. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  2. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  3. Evaluating the performance of clinical criteria for predicting mismatch repair gene mutations in Lynch syndrome: a comprehensive analysis of 3,671 families.

    Science.gov (United States)

    Steinke, Verena; Holzapfel, Stefanie; Loeffler, Markus; Holinski-Feder, Elke; Morak, Monika; Schackert, Hans K; Görgens, Heike; Pox, Christian; Royer-Pokora, Brigitte; von Knebel-Doeberitz, Magnus; Büttner, Reinhard; Propping, Peter; Engel, Christoph

    2014-07-01

    Carriers of mismatch repair (MMR) gene mutations have a high lifetime risk for colorectal and endometrial cancers, as well as other malignancies. As mutation analysis to detect these patients is expensive and time-consuming, clinical criteria and tumor-tissue analysis are widely used as pre-screening methods. The aim of our study was to evaluate the performance of commonly applied clinical criteria (the Amsterdam I and II Criteria, and the original and revised Bethesda Guidelines) and the results of tumor-tissue analysis in predicting MMR gene mutations. We analyzed 3,671 families from the German HNPCC Registry and divided them into nine mutually exclusive groups with different clinical criteria. A total of 680 families (18.5%) were found to have a pathogenic MMR gene mutation. Among all 1,284 families with microsatellite instability-high (MSI-H) colorectal cancer, the overall mutation detection rate was 53.0%. Mutation frequencies and their distribution between the four MMR genes differed significantly between clinical groups (p small-bowel cancer (p small-bowel cancer were clinically relevant predictors for Lynch syndrome. © 2013 UICC.

  4. Gene family matters: expanding the HGNC resource

    Directory of Open Access Journals (Sweden)

    Daugherty Louise C

    2012-07-01

    Full Text Available Abstract The HUGO Gene Nomenclature Committee (HGNC assigns approved gene symbols to human loci. There are currently over 33,000 approved gene symbols, the majority of which represent protein-coding genes, but we also name other locus types such as non-coding RNAs, pseudogenes and phenotypic loci. Where relevant, the HGNC organise these genes into gene families and groups. The HGNC website http://www.genenames.org/ is an online repository of HGNC-approved gene nomenclature and associated resources for human genes, and includes links to genomic, proteomic and phenotypic information. In addition to this, we also have dedicated gene family web pages and are currently expanding and generating more of these pages using data curated by the HGNC and from information derived from external resources that focus on particular gene families. Here, we review our current online resources with a particular focus on our gene family data, using it to highlight our new Gene Symbol Report and gene family data downloads.

  5. Lineage-specific expansion of IFIT gene family: an insight into coevolution with IFN gene family.

    Directory of Open Access Journals (Sweden)

    Ying Liu

    Full Text Available In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system.

  6. Evolution of the mammalian lysozyme gene family

    Science.gov (United States)

    2011-01-01

    Background Lysozyme c (chicken-type lysozyme) has an important role in host defense, and has been extensively studied as a model in molecular biology, enzymology, protein chemistry, and crystallography. Traditionally, lysozyme c has been considered to be part of a small family that includes genes for two other proteins, lactalbumin, which is found only in mammals, and calcium-binding lysozyme, which is found in only a few species of birds and mammals. More recently, additional testes-expressed members of this family have been identified in human and mouse, suggesting that the mammalian lysozyme gene family is larger than previously known. Results Here we characterize the extent and diversity of the lysozyme gene family in the genomes of phylogenetically diverse mammals, and show that this family contains at least eight different genes that likely duplicated prior to the diversification of extant mammals. These duplicated genes have largely been maintained, both in intron-exon structure and in genomic context, throughout mammalian evolution. Conclusions The mammalian lysozyme gene family is much larger than previously appreciated and consists of at least eight distinct genes scattered around the genome. Since the lysozyme c and lactalbumin proteins have acquired very different functions during evolution, it is likely that many of the other members of the lysozyme-like family will also have diverse and unexpected biological properties. PMID:21676251

  7. Evolution of the mammalian lysozyme gene family

    Directory of Open Access Journals (Sweden)

    Biegel Jason M

    2011-06-01

    Full Text Available Abstract Background Lysozyme c (chicken-type lysozyme has an important role in host defense, and has been extensively studied as a model in molecular biology, enzymology, protein chemistry, and crystallography. Traditionally, lysozyme c has been considered to be part of a small family that includes genes for two other proteins, lactalbumin, which is found only in mammals, and calcium-binding lysozyme, which is found in only a few species of birds and mammals. More recently, additional testes-expressed members of this family have been identified in human and mouse, suggesting that the mammalian lysozyme gene family is larger than previously known. Results Here we characterize the extent and diversity of the lysozyme gene family in the genomes of phylogenetically diverse mammals, and show that this family contains at least eight different genes that likely duplicated prior to the diversification of extant mammals. These duplicated genes have largely been maintained, both in intron-exon structure and in genomic context, throughout mammalian evolution. Conclusions The mammalian lysozyme gene family is much larger than previously appreciated and consists of at least eight distinct genes scattered around the genome. Since the lysozyme c and lactalbumin proteins have acquired very different functions during evolution, it is likely that many of the other members of the lysozyme-like family will also have diverse and unexpected biological properties.

  8. Multiple Blockholder Structures and Family Firm Performance

    DEFF Research Database (Denmark)

    Fattoum-Guedri, Asma; Guedri, Zied; Delmar, Frédéric

    2018-01-01

    This study examines how multiple blockholder structures affect family firm performance. Building on arguments from both principal–principal agency and familiness perspectives, we suggest that asymmetrical distribution of voting power among family and nonfamily blockholders hurts firm performance....

  9. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  10. Evolution of the Vertebrate Resistin Gene Family.

    Directory of Open Access Journals (Sweden)

    Qingda Hu

    Full Text Available Resistin (encoded by Retn was previously identified in rodents as a hormone associated with diabetes; however human resistin is instead linked to inflammation. Resistin is a member of a small gene family that includes the resistin-like peptides (encoded by Retnl genes in mammals. Genomic searches of available genome sequences of diverse vertebrates and phylogenetic analyses were conducted to determine the size and origin of the resistin-like gene family. Genes encoding peptides similar to resistin were found in Mammalia, Sauria, Amphibia, and Actinistia (coelacanth, a lobe-finned fish, but not in Aves or fish from Actinopterygii, Chondrichthyes, or Agnatha. Retnl originated by duplication and transposition from Retn on the early mammalian lineage after divergence of the platypus, but before the placental and marsupial mammal divergence. The resistin-like gene family illustrates an instance where the locus of origin of duplicated genes can be identified, with Retn continuing to reside at this location. Mammalian species typically have a single copy Retn gene, but are much more variable in their numbers of Retnl genes, ranging from 0 to 9. Since Retn is located at the locus of origin, thus likely retained the ancestral expression pattern, largely maintained its copy number, and did not display accelerated evolution, we suggest that it is more likely to have maintained an ancestral function, while Retnl, which transposed to a new location, displays accelerated evolution, and shows greater variability in gene number, including gene loss, likely evolved new, but potentially lineage-specific, functions.

  11. The glutamine synthetase gene family in Populus

    Directory of Open Access Journals (Sweden)

    Cánovas Francisco M

    2011-08-01

    Full Text Available Abstract Background Glutamine synthetase (GS; EC: 6.3.1.2, L-glutamate: ammonia ligase ADP-forming is a key enzyme in ammonium assimilation and metabolism of higher plants. The current work was undertaken to develop a more comprehensive understanding of molecular and biochemical features of GS gene family in poplar, and to characterize the developmental regulation of GS expression in various tissues and at various times during the poplar perennial growth. Results The GS gene family consists of 8 different genes exhibiting all structural and regulatory elements consistent with their roles as functional genes. Our results indicate that the family members are organized in 4 groups of duplicated genes, 3 of which code for cytosolic GS isoforms (GS1 and 1 which codes for the choroplastic GS isoform (GS2. Our analysis shows that Populus trichocarpa is the first plant species in which it was observed the complete GS family duplicated. Detailed expression analyses have revealed specific spatial and seasonal patterns of GS expression in poplar. These data provide insights into the metabolic function of GS isoforms in poplar and pave the way for future functional studies. Conclusions Our data suggest that GS duplicates could have been retained in order to increase the amount of enzyme in a particular cell type. This possibility could contribute to the homeostasis of nitrogen metabolism in functions associated to changes in glutamine-derived metabolic products. The presence of duplicated GS genes in poplar could also contribute to diversification of the enzymatic properties for a particular GS isoform through the assembly of GS polypeptides into homo oligomeric and/or hetero oligomeric holoenzymes in specific cell types.

  12. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  13. Shared vision promotes family firm performance

    Science.gov (United States)

    Neff, John E.

    2015-01-01

    A clear picture of the influential drivers of private family firm performance has proven to be an elusive target. The unique characteristics of private family owned firms necessitate a broader, non-financial approach to reveal firm performance drivers. This research study sought to specify and evaluate the themes that distinguish successful family firms from less successful family firms. In addition, this study explored the possibility that these themes collectively form an effective organizational culture that improves longer-term firm performance. At an organizational level of analysis, research findings identified four significant variables: Shared Vision (PNS), Role Clarity (RCL), Confidence in Management (CON), and Professional Networking (OLN) that positively impacted family firm financial performance. Shared Vision exhibited the strongest positive influence among the significant factors. In addition, Family Functionality (APGAR), the functional integrity of the family itself, exhibited a significant supporting role. Taken together, the variables collectively represent an effective family business culture (EFBC) that positively impacted the long-term financial sustainability of family owned firms. The index of effective family business culture also exhibited potential as a predictive non-financial model of family firm performance. PMID:26042075

  14. Shared vision promotes family firm performance.

    Science.gov (United States)

    Neff, John E

    2015-01-01

    A clear picture of the influential drivers of private family firm performance has proven to be an elusive target. The unique characteristics of private family owned firms necessitate a broader, non-financial approach to reveal firm performance drivers. This research study sought to specify and evaluate the themes that distinguish successful family firms from less successful family firms. In addition, this study explored the possibility that these themes collectively form an effective organizational culture that improves longer-term firm performance. At an organizational level of analysis, research findings identified four significant variables: Shared Vision (PNS), Role Clarity (RCL), Confidence in Management (CON), and Professional Networking (OLN) that positively impacted family firm financial performance. Shared Vision exhibited the strongest positive influence among the significant factors. In addition, Family Functionality (APGAR), the functional integrity of the family itself, exhibited a significant supporting role. Taken together, the variables collectively represent an effective family business culture (EFBC) that positively impacted the long-term financial sustainability of family owned firms. The index of effective family business culture also exhibited potential as a predictive non-financial model of family firm performance.

  15. Shared Vision promotes family firm performance

    Directory of Open Access Journals (Sweden)

    John Edward Neff

    2015-05-01

    Full Text Available A clear picture of the influential drivers of private family firm performance has proven to be an elusive target. The unique characteristics of private family owned firms necessitate a broader, non-financial approach to reveal firm performance drivers. This research study sought to specify and evaluate the themes that distinguish successful family firms from less successful family firms. In addition, this study explored the possibility that these themes collectively form an effective organizational culture that improves longer-term firm performance. At an organizational level of analysis, research findings identified four significant variables: Shared Vision (PNS, Role Clarity (RCL, Confidence in Management (CON, and Professional Networking (OLN that positively impacted family firm financial performance. Shared Vision exhibited the strongest positive influence among the significant factors. In addition, Family Functionality (APGAR, the functional integrity of the family itself exhibited a significant supporting role. Taken together, the variables collectively represent an effective family business culture (EFBC that positively impacted the long-term financial sustainability of family owned firms. The index of effective family business culture also exhibited potential as a predictive non-financial model of family firm performance.

  16. Identifying Coevolving Partners from Paralogous Gene Families

    Directory of Open Access Journals (Sweden)

    Chen-Hsiang Yeang

    2008-01-01

    Full Text Available Many methods have been developed to detect coevolution from aligned sequences. However, all the existing methods require a one-to-one mapping of candidate coevolving partners (nucleotides, amino acids a priori. When two families of sequences have distinct duplication and loss histories, finding the one-to-one mapping of coevolving partners can be computationally involved. We propose an algorithm to identify the coevolving partners from two families of sequences with distinct phylogenetic trees. The algorithm maps each gene tree to a reference species tree, and builds a joint state of sequence composition and assignments of coevolving partners for each species tree node. By applying dynamic programming on the joint states, the optimal assignments can be identified. Time complexity is quadratic to the size of the species tree, and space complexity is exponential to the maximum number of gene tree nodes mapped to the same species tree node. Analysis on both simulated data and Pfam protein domain sequences demonstrates that the paralog coevolution algorithm picks up the coevolving partners with 60%–88% accuracy. This algorithm extends phylogeny-based coevolutionary models and make them applicable to a wide range of problems such as predicting protein-protein, protein-DNA and DNA-RNA interactions of two distinct families of sequences.

  17. Autosomal Dominant PTH Gene Signal Sequence Mutation in a Family With Familial Isolated Hypoparathyroidism.

    Science.gov (United States)

    Cinque, Luigia; Sparaneo, Angelo; Penta, Laura; Mencarelli, Amedea; Rogaia, Daniela; Esposito, Susanna; Fabrizio, Federico Pio; Baorda, Filomena; Verrotti, Alberto; Falorni, Alberto; Stangoni, Gabriela; Hendy, Geoffrey N; Guarnieri, Vito; Prontera, Paolo

    2017-11-01

    Familial isolated hypoparathyroidism (FIH) is a genetically heterogeneous disorder due to mutations of the calcium-sensing receptor (CASR), glial cells missing-2 (GCM2), guanine nucleotide binding protein α11 (GNA11), or parathyroid hormone (PTH) genes. Thus far, only four cases with homozygous and two cases with heterozygous mutations in the PTH gene have been reported. To clinically describe an FIH family and identify and characterize the causal gene mutation. Genomic DNA of the family members was subjected to CASR, GCM2, GNA11, and PTH gene mutational analysis. Functional assays were performed on the variant identified. Six subjects of a three-generation FIH family with three affected individuals having severe hypocalcemia and inappropriately low serum PTH. No mutations were detected in the CASR, GCM2, and GNA11 genes. A heterozygous variant that segregated with the disease was identified in PTH gene exon 2 (c.41T>A; p.M14K). This missense variant, in the hydrophobic core of the signal sequence, was predicted in silico to impair cleavage of preproPTH to proPTH. Functional assays in HEK293 cells demonstrated much greater retention intracellularly but impaired secretion into the medium of the M14K mutant relative to wild type. The addition of the pharmacological chaperone, 4-phenylbutyric acid, led to a reduction of cellular retention and increased accumulation in the cell medium of the M14K mutant. We report a heterozygous PTH mutation in an FIH family and demonstrate accumulation of the mutant intracellularly and its impaired secretion. An accurate genetic diagnosis in such hypoparathyroid patients is critical for appropriate treatment and genetic counseling. Copyright © 2017 Endocrine Society

  18. Molecular analysis of the VSX1 gene in familial keratoconus

    Science.gov (United States)

    Liskova, Petra; Ebenezer, Neil D.; Hysi, Pirro G.; Gwilliam, Rhian; El-Ashry, Mohamed F.; Moodaley, Lalitha C.; Hau, Scott; Twa, Michael; Tuft, Stephen J.; Bhatacharya, Shomi S.

    2017-01-01

    Purpose To evaluate the role of the visual system homeobox gene 1 (VSX1) in the pathogenesis of familial keratoconus. Methods Families with two or more individuals with keratoconus were recruited and their members examined. The coding region and intron-exon junctions of the VSX1 gene were sequenced in affected individuals. In cases where there were possible pathogenic changes, segregation within the pedigree was analyzed. Meta analysis of reports on an association of p.D144E change with keratoconus phenotype was performed. Results Probands from a panel of 85 apparently unrelated keratoconus families were included. Eleven sequence variants were observed, including the previously reported c.432C>G (p.D144E) change and two novel intronic single nucleotide polymorphisms. However, these three changes did not cosegregate with the disease phenotype. Conclusions We excluded the c.432C>G sequence alteration as the direct cause of the disease. Lack of possibly pathogenic VSX1 sequence variants in the familial panel suggests that involvement of this gene in the pathogenesis of keratoconus is likely to be confined to a small number of pedigrees, at least in the population studied. PMID:17960127

  19. Performance post succession on Italian family farms

    OpenAIRE

    Bertoni, Danilo; Cavicchioli, Daniele; Latruffe, Laure

    2017-01-01

    We analyse whether the event of succession changes the performance of Italian family farms, using data from the Italian Farm Accountancy Data Network (FADN) and several performance indicators during 2008-2014. T-tests of equality of means and propensity score matching reveal that succession has a negative effect on performance related to capital, due to an increase in capital after succession. Furthermore, in the first years examined, performance per hectare after succession is lower for farm...

  20. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  1. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  2. Genome-Wide Characterization and Expression Profiles of the Superoxide Dismutase Gene Family in Gossypium

    Directory of Open Access Journals (Sweden)

    Jingbo Zhang

    2016-01-01

    Full Text Available Superoxide dismutase (SOD as a group of significant and ubiquitous enzymes plays a critical function in plant growth and development. Previously this gene family has been investigated in Arabidopsis and rice; it has not yet been characterized in cotton. In our study, it was the first time for us to perform a genome-wide analysis of SOD gene family in cotton. Our results showed that 10 genes of SOD gene family were identified in Gossypium arboreum and Gossypium raimondii, including 6 Cu-Zn-SODs, 2 Fe-SODs, and 2 Mn-SODs. The chromosomal distribution analysis revealed that SOD genes are distributed across 7 chromosomes in Gossypium arboreum and 8 chromosomes in Gossypium raimondii. Segmental duplication is predominant duplication event and major contributor for expansion of SOD gene family. Gene structure and protein structure analysis showed that SOD genes have conserved exon/intron arrangement and motif composition. Microarray-based expression analysis revealed that SOD genes have important function in abiotic stress. Moreover, the tissue-specific expression profile reveals the functional divergence of SOD genes in different organs development of cotton. Taken together, this study has imparted new insights into the putative functions of SOD gene family in cotton. Findings of the present investigation could help in understanding the role of SOD gene family in various aspects of the life cycle of cotton.

  3. The Nitrate Transporter (NRT) Gene Family in Poplar

    Science.gov (United States)

    Bai, Hua; Euring, Dejuan; Volmer, Katharina; Janz, Dennis; Polle, Andrea

    2013-01-01

    Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT), which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens) showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth. PMID:23977227

  4. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  5. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  6. Characterization of the caleosin gene family in the Triticeae.

    Science.gov (United States)

    Khalil, Hala Badr; Brunetti, Sabrina C; Pham, Uyen Minh; Maret, Deborah; Laroche, André; Gulick, Patrick J

    2014-03-27

    The caleosin genes encode proteins with a single conserved EF hand calcium-binding domain and comprise small gene families found in a wide range of plant species. Some members of the gene family have been shown to be upregulated by environmental stresses including low water availability and high salinity. Caleosin 3 from wheat has been shown to interact with the α-subunit of the heterotrimeric G proteins, and to act as a GTPase activating protein (GAP). This study characterizes the size and diversity of the gene family in wheat and related species and characterizes the differential tissue-specific expression of members of the gene family. A total of 34 gene family members that belong to eleven paralogous groups of caleosins were identified in the hexaploid bread wheat, T. aestivum. Each group was represented by three homeologous copies of the gene located on corresponding homeologous chromosomes, except the caleosin 10, which has four gene copies. Ten gene family members were identified in diploid barley, Hordeum vulgare, and in rye, Secale cereale, seven in Brachypodium distachyon, and six in rice, Oryza sativa. The analysis of gene expression was assayed in triticale and rye by RNA-Seq analysis of 454 sequence sets and members of the gene family were found to have diverse patterns of gene expression in the different tissues that were sampled in rye and in triticale, the hybrid hexaploid species derived from wheat and rye. Expression of the gene family in wheat and barley was also previously determined by microarray analysis, and changes in expression during development and in response to environmental stresses are presented. The caleosin gene family had a greater degree of expansion in the Triticeae than in the other monocot species, Brachypodium and rice. The prior implication of one member of the gene family in the stress response and heterotrimeric G protein signaling, points to the potential importance of the caleosin gene family. The complexity of the

  7. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  8. Impact of gene family evolutionary histories on phylogenetic species tree inference by gene tree parsimony.

    Science.gov (United States)

    Shi, Tao

    2016-03-01

    Complicated history of gene duplication and loss brings challenge to molecular phylogenetic inference, especially in deep phylogenies. However, phylogenomic approaches, such as gene tree parsimony (GTP), show advantage over some other approaches in its ability to use gene families with duplications. GTP searches the 'optimal' species tree by minimizing the total cost of biological events such as duplications, but accuracy of GTP and phylogenetic signal in the context of different gene families with distinct histories of duplication and loss are unclear. To evaluate how different evolutionary properties of different gene families can impact on species tree inference, 3900 gene families from seven angiosperms encompassing a wide range of gene content, lineage-specific expansions and contractions were analyzed. It was found that the gene content and total duplication number in a gene family strongly influence species tree inference accuracy, with the highest accuracy achieved at either very low or very high gene content (or duplication number) and lowest accuracy centered in intermediate gene content (or duplication number), as the relationship can fit a binomial regression. Besides, for gene families of similar level of average gene content, those with relatively higher lineage-specific expansion or duplication rates tend to show lower accuracy. Additional correlation tests support that high accuracy for those gene families with large gene content may rely on abundant ancestral copies to provide many subtrees to resolve conflicts, whereas high accuracy for single or low copy gene families are just subject to sequence substitution per se. Very low accuracy reached by gene families of intermediate gene content or duplication number can be due to insufficient subtrees to resolve the conflicts from loss of alternative copies. As these evolutionary properties can significantly influence species tree accuracy, I discussed the potential weighting of the duplication cost by

  9. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  10. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  11. MMACHC gene mutation in familial hypogonadism with neurological symptoms.

    Science.gov (United States)

    Shi, Changhe; Shang, Dandan; Sun, Shilei; Mao, Chengyuan; Qin, Jie; Luo, Haiyang; Shao, Mingwei; Chen, Zhengguang; Liu, Yutao; Liu, Xinjing; Song, Bo; Xu, Yuming

    2015-12-15

    Recent studies have convincingly documented that hypogonadism is a component of various hereditary disorders and is often recognized as an important clinical feature in combination with various neurological symptoms, yet, the causative genes in a few related families are still unknown. High-throughput sequencing has become an efficient method to identify causative genes in related complex hereditary disorders. In this study, we performed exome sequencing in a family presenting hypergonadotropic hypogonadism with neurological presentations of mental retardation, epilepsy, ataxia, and leukodystrophy. After bioinformatic analysis and Sanger sequencing validation, we identified compound heterozygous mutations: c.482G>A (p.R161Q) and c.609G>A (p.W203X) in MMACHC gene in this pedigree. MMACHC was previously confirmed to be responsible for methylmalonic aciduria (MMA) combined with homocystinuria, cblC type (cblC disease), a hereditary vitamin B12 metabolic disorder. Biochemical and gas chromatography-mass spectrometry (GC-MS) examinations in this pedigree further supported the cblC disease diagnosis. These results indicated that hypergonadotropic hypogonadism may be a novel clinical manifestation of cblC disease, but more reports on additional patients are needed to support this hypothesis. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  13. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    ... our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways ...

  14. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  15. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  16. The KIT gene in familial mastocytosis

    OpenAIRE

    Tourlaki, Athanasia

    2013-01-01

    Familial cutaneous mastocytosis is an exceptional condition of unknown etiology. In this study we report the largest series of patients with familial cutaneous mastocytosis without other manifestations (18 affected subjects from seven unrelated families), and we investigate the role of germ-line KIT mutations in the pathogenesis of the disease. The mean age at onset was 5.4 years (range from birth to 22 years), and the clinical behavior was variable over a mean follow up period of 15.1 years ...

  17. Identification of metalloprotease gene families in sugarcane

    Directory of Open Access Journals (Sweden)

    O.H.P. Ramos

    2001-12-01

    Full Text Available Metalloproteases play a key role in many physiological processes in mammals such as cell migration, tissue remodeling and processing of growth factors. They have also been identified as important factors in the patho-physiology of a number of human diseases, including cancer and hypertension. Many bacterial pathogens rely on proteases in order to infect the host. Several classes of metalloproteases have been described in humans, bacteria, snake venoms and insects. However, the presence and characterization of plant metalloproteases have rarely been described in the literature. In our research, we searched the sugarcane expressed sequence tag (SUCEST DNA library in order to identify, by homology with sequences deposited in other databases, metalloprotease gene families expressed under different conditions. Protein sequences from Arabidopsis thaliana and Glycine max were used to search the SUCEST data bank. Conserved regions corresponding to different metalloprotease domains and sequence motifs were identified in the reads to characterize each group of enzymes. At least four classes of sugarcane metalloproteases have been identified, i.e. matrix metalloproteases, zincins, inverzincins, and ATP-dependent metalloproteases. Each enzyme class was analyzed for its expression in different conditions and tissues.Metaloproteases exercem papéis importantes em muitos processos fisiológicos em mamíferos tais como migração celular, remodelamento tecidual e processamento de fatores de crescimento. Estas enzimas estão envolvidas também na pato-fisiologia de um grande número de doenças humanas como hipertensão e câncer. Muitas bactérias patogênicas dependem de proteases para infectar o hospedeiro. Diversas classes de metaloproteases foram descritas em seres humanos, bactérias, venenos de serpentes e insetos. No entanto, a presença e a caracterização de metaloproteases em plantas estão pouco descritas na literatura. Neste trabalho, foi

  18. Characterization of two CYP77 gene family members related to ...

    Indian Academy of Sciences (India)

    [Yue Y., Peng H., Sun J., Yang Z., Yang H., Liu G. and Hu H. 2016 Characterization of two CYP77 gene family members related to development of ornamental ... of the largest families in plants, participate in numerous reac- tions of the plant ... real-time quantitative polymerase chain reaction (RT-qPCR), indicating that they ...

  19. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  20. The CK1 gene family: expression patterning in zebrafish development

    Directory of Open Access Journals (Sweden)

    AMELINA ALBORNOZ

    2007-01-01

    Full Text Available Protein kinase CK1 is a ser/thr protein kinase family which has been identified in the cytosol cell fraction, associated with membranes as well as in the nucleus. Several isoforms of this gene family have been described in various organisms: CK1á, CK1ß, CK1δ, CK1å and CK1γ. Over the last decade, several members of this family have been involved in development processes related to wnt and sonic hedgehog signalling pathways. However, there is no detailed temporal information on the CK1 family in embryonic stages, even though orthologous genes have been described in several different vertebrate species. In this study, we describe for the first time the cloning and detailed expression pattern of five CK1 zebrafish genes. Sequence analysis revealed that zebrafish CK1 proteins are highly homologous to other vertebrate orthologues. Zebrafish CK1 genes are expressed throughout development in common and different territories. All the genes studied in development show maternal and zygotic expression with the exception of CK1å. This last gene presents only a zygotic component of expression. In early stages of development CK1 genes are ubiquitously expressed with the exception of CK1å. In later stages the five CK1 genes are expressed in the brain but not in the same way. This observation probably implicates the CK1 family genes in different and also in redundant functions. This is the first time that a detailed comparison of the expression of CK1 family genes is directly assessed in a vertebrate system throughout development

  1. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  2. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  3. Review: the dominant flocculation genes of Saccharomyces cerevisiae constitute a new subtelomeric gene family.

    Science.gov (United States)

    Teunissen, A W; Steensma, H Y

    1995-09-15

    The quality of brewing strains is, in large part, determined by their flocculation properties. By classical genetics, several dominant, semidominant and recessive flocculation genes have been recognized. Recent results of experiments to localize the flocculation genes FLO5 and FLO8, combined with the in silicio analysis of the available sequence data of the yeast genome, have revealed that the flocculation genes belong to a family which comprises at least four genes and three pseudogenes. All members of this gene family are located near the end of chromosomes, just like the SUC, MEL and MAL genes, which are also important for good quality baking or brewing strains. Transcription of the flocculation genes is repressed by several regulatory genes. In addition, a number of genes have been found which cause cell aggregation upon disruption or overexpression in an as yet unknown manner. In total, 33 genes have been reported that are involved in flocculation or cell aggregation.

  4. Corporate Governance and Firm Performance: An Analysis of Family and Non-family Controlled Firms

    OpenAIRE

    Qaiser Rafique Yasser

    2011-01-01

    The aim of this study is to scrutinise the impact of corporate governance mechanism on the performance of family and non-family controlled firms in Pakistan. It has been found that a corporate governance structure influences the performance of both family and non-family controlled companies significantly. However all corporate governance mechanisms are not significant as the significant variables differ between family and non-family controlled companies. Thus, regulators need to be cautious i...

  5. Family Succession and Firm Performance: Evidence from Italian Family Firms

    OpenAIRE

    Marco Cucculelli; Giacinto Micucci

    2008-01-01

    This article contributes to the growing empirical literature on family firms by studying the impact of the founder�chief executive officer (CEO) succession in a sample of Italian firms. We contrast firms that continue to be managed within the family by the heirs to the founders with firms in which the management is passed on to outsiders. Family successions, that is, successions by the founder�s heirs, are further analyzed by assessing the impact of the sectoral intensity of competition o...

  6. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  7. Characterization and Functional Analysis of PEBP Family Genes in Upland Cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Zhang, Xiaohong; Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun

    2016-01-01

    Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton.

  8. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  9. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  10. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  11. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

    (P = 9.01 × 10-7), CNNM2 (P = 6.07 × 10-7), and NT5C2 (P = 4.09 × 10-7). To explore the many small effects, we performed pathway analyses. The most significant pathways involved neuronal function (axonal guidance, neuronal systems, and L1 cell adhesion molecule interaction) and the immune system...... genes. DESIGN We integrated results from a meta-analysis of 18 genome-wide association studies (GWAS) involving 1 085 772 single-nucleotide polymorphisms (SNPs) and 6 databases that showed significant informativeness for SCZ. The 9380 most promising SNPs were then specifically genotyped...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  12. Calling-in the Family: Dialogic Performances of Family Conflict

    Science.gov (United States)

    Congdon, Mark, Jr.; Herakova, Liliana; Bishop, Jessica

    2018-01-01

    Courses: Introduction to Communication, Introduction to Interpersonal Communication, Family Communication, Small Group Communication, Communication and Listening. Objectives: By this end of this activity, students will be able to identify and practice supportive and defensive communication; understand a dialogic approach to conflict; and…

  13. Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation

    Science.gov (United States)

    Li, Tao; Zhang, Zhao-jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-nan; Liu, Hong-yan; Wang, Hong-dan; Wu, Dong; Lou, Gui-yu; Wang, Xin; Zhang, Chao-yang; Liao, Shi-xiu

    2017-01-01

    Abstract Background: Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. Methods: First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. Results: MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. Conclusion: The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. PMID:29390271

  14. Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation: A case report.

    Science.gov (United States)

    Li, Tao; Zhang, Zhao-Jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-Nan; Liu, Hong-Yan; Wang, Hong-Dan; Wu, Dong; Lou, Gui-Yu; Wang, Xin; Zhang, Chao-Yang; Liao, Shi-Xiu

    2017-12-01

    Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  15. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  16. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  17. Evolutionary dynamics of the interferon-induced transmembrane gene family in vertebrates.

    Directory of Open Access Journals (Sweden)

    Zhao Zhang

    Full Text Available Vertebrate interferon-induced transmembrane (IFITM genes have been demonstrated to have extensive and diverse functions, playing important roles in the evolution of vertebrates. Despite observance of their functionality, the evolutionary dynamics of this gene family are complex and currently unknown. Here, we performed detailed evolutionary analyses to unravel the evolutionary history of the vertebrate IFITM family. A total of 174 IFITM orthologous genes and 112 pseudogenes were identified from 27 vertebrate genome sequences. The vertebrate IFITM family can be divided into immunity-related IFITM (IR-IFITM, IFITM5 and IFITM10 sub-families in phylogeny, implying origins from three different progenitors. In general, vertebrate IFITM genes are located in two loci, one containing the IFITM10 gene, and the other locus containing IFITM5 and various numbers of IR-IFITM genes. Conservation of evolutionary synteny was observed in these IFITM genes. Significant functional divergence was detected among the three IFITM sub-families. No gene duplication or positive selection was found in IFITM5 sub-family, implying the functional conservation of IFITM5 in vertebrate evolution, which is involved in bone formation. No IFITM5 locus was identified in the marmoset genome, suggesting a potential association with the tiny size of this monkey. The IFITM10 sub-family was divided into two groups: aquatic and terrestrial types. Functional divergence was detected between the two groups, and five IFITM10-like genes from frog were dispersed into the two groups. Both gene duplication and positive selection were observed in aquatic vertebrate IFITM10-like genes, indicating that IFITM10 might be associated with the adaptation to aquatic environments. A large number of lineage- and species-specific gene duplications were observed in IR-IFITM sub-family and positive selection was detected in IR-IFITM of primates and rodents. Because primates have experienced a long history of

  18. Genetic diversity of bitter taste receptor gene family in Sichuan ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 95; Issue 3. Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE ...

  19. Genomewide analysis of the chitinase gene family in Populus ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... Jiangsu Key Laboratory for Poplar Germplasm Enhancement and Variety Improvement,. Nanjing Forestry University, Nanjing 210037, People's Republic of China. [Jiang C., Huang R. F., Song J. L., Huang M. R. and Xu L. A. 2013 Genomewide analysis of the chitinase gene family in Populus trichocarpa.

  20. Domain combination of the vertebrate-like TLR gene family ...

    Indian Academy of Sciences (India)

    Domain combination of the vertebrate-like TLR gene family: implications for their origin and evolution. Baojun Wu, Tianxiao Huan, Jing Gong, Pin Zhou and Zengliang Bai. J. Genet. 90, 401–408. Figure 1. Unrooted NJ phylogenetic tree of P-Toll proteins from selected phyla based on TIR domains. The putative V-TIR protein.

  1. CCT family genes in cereal crops: A current overview

    Directory of Open Access Journals (Sweden)

    Yipu Li

    2017-12-01

    Full Text Available Control of flowering time is crucial for reproductive success of cereal crops, and has a significant impact on grain yield as well as adaptation to diverse environmental conditions. Plants integrate signals from both environmental cues and endogenous regulatory pathways to fine-tune flowering time. The CCT domain originally described to a 43-amino acid sequence at the C-terminus of three Arabidopsis proteins, namely CONSTANS (CO, CO-LIKE, and TIMING OF CAB1 (TOC1. The CCT domain-containing genes (CCT genes, which encode transcription co-factors, are the major genetic determinants that modulate flowering time, and this in turn enables plants to effectively expand their territory to take advantage of favorable habitats. Moreover, certain CCT genes have pleiotropic effects on morphological traits and confer resistance/tolerance to biotic/abiotic stresses. CCT genes can be classified into three families, namely COL (CONSTANS-like, PRR (Pseudo-response regulator, and CMF (CCT motif family, based on their non-CCT domains. During domestication, natural and artificial selection resulted in reduced nucleotide diversity of CCT genes in modern cultivated cereals than their wild types. Here, we review the features and functions of CCT genes in cereal crops and propose future research to focus on CCT genes and their utilization in crop breeding. Keywords: CCT domain, Flowering time, Photoperiod, Pleiotropy

  2. [R1239H mutation of CACNA1S gene in a Chinese family with hypokalaemic periodic paralysis].

    Science.gov (United States)

    Ke, Qing; Wu, Wei-ping; Guo, Xiu-hai; Xu, Quan-gang; Huang, De-hui; Mao, Yan-ling; Huo, Chun-nuan

    2006-06-01

    Mutation screening was performed to a Chinese family with hypokalaemic periodic paraiysis(HOKPP) for locating the corresponding mutations of gene and for specifying the clinical features associated with mutations. The cilnical features of patients from HOKPP family were summurized. Techniques of target exon PCR and direct sequencing were used to screen the mutation in CACNA1S and SCN4A genes in all numbers of the family. Two patients of the family showed the typical features of HOKPP: the age of disease onset is during the childhood, acetazolamide is effective to patients treated. A heterozygous point mutation 3716 (G>A) causing R1239H was found in exon 30 of CACNA1S gene of the patients, but not found in normal members of the family. The mutant R1239H in CACNA1S gene exists in Chinese patients with familial hypokalaemic periodic paralysis.

  3. Genome-wide comparative phylogenetic analysis of the rice and Arabidopsis Dof gene families

    Science.gov (United States)

    Lijavetzky, Diego; Carbonero, Pilar; Vicente-Carbajosa, Jesús

    2003-01-01

    Background Dof proteins are a family of plant-specific transcription factors that contain a particular class of zinc-finger DNA-binding domain. Members of this family have been found to play diverse roles in gene regulation of processes restricted to the plants. The completed genome sequences of rice and Arabidopsis constitute a valuable resource for comparative genomic analyses, since they are representatives of the two major evolutionary lineages within the angiosperms. In this framework, the identification of phylogenetic relationships among Dof proteins in these species is a fundamental step to unravel functionality of new and yet uncharacterised genes belonging to this group. Results We identified 30 different Dof genes in the rice Oryza sativa genome and performed a phylogenetic analysis of a complete collection of the 36-reported Arabidopsis thaliana and the rice Dof transcription factors identified herein. This analysis led to a classification into four major clusters of orthologous genes and showed gene loss and duplication events in Arabidopsis and rice, that occurred before and after the last common ancestor of the two species. Conclusions According to our analysis, the Dof gene family in angiosperms is organized in four major clusters of orthologous genes or subfamilies. The proposed clusters of orthology and their further analysis suggest the existence of monocot specific genes and invite to explore their functionality in relation to the distinct physiological characteristics of these evolutionary groups. PMID:12877745

  4. Comprehensive analyses of the annexin gene family in wheat.

    Science.gov (United States)

    Xu, Lei; Tang, Yimiao; Gao, Shiqing; Su, Shichao; Hong, Lin; Wang, Weiwei; Fang, Zhaofeng; Li, Xueyin; Ma, Jinxiu; Quan, Wei; Sun, Hui; Li, Xia; Wang, Yongbo; Liao, Xiangzheng; Gao, Jiangang; Zhang, Fengting; Li, Lei; Zhao, Changping

    2016-05-28

    Annexins are an evolutionarily conserved multigene family of calcium-dependent phospholipid binding proteins that play important roles in stress resistance and plant development. They have been relatively well characterized in model plants Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa), but nothing has been reported in hexaploid bread wheat (Triticum aestivum) and barely (Hordeum vulgare), which are the two most economically important plants. Based on available genomic and transcriptomic data, 25 and 11 putative annexin genes were found through in silico analysis in wheat and barley, respectively. Additionally, eight and 11 annexin genes were identified from the draft genome sequences of Triticum urartu and Aegilops tauschii, progenitor for the A and D genome of wheat, respectively. By phylogenetic analysis, annexins in these four species together with other monocots and eudicots were classified into six different orthologous groups. Pi values of each of Ann1-12 genes among T. aestivum, T. urartu, A. tauschii and H. vulgare species was very low, with the exception of Ann2 and Ann5 genes. Ann2 gene has been under positive selection, but Ann6 and Ann7 have been under purifying selection among the four species in their evolutionary histories. The nucleotide diversities of Ann1-12 genes in the four species were 0.52065, 0.59239, 0.60691 and 0.53421, respectively. No selective pressure was operated on annexin genes in the same species. Gene expression patterns obtained by real-time PCR and re-analyzing the public microarray data revealed differential temporal and spatial regulation of annexin genes in wheat under different abiotic stress conditions such as salinity, drought, cold and abscisic acid. Among those genes, TaAnn10 is specifically expressed in the anther but fails to be induced by low temperature in thermosensitive genic male sterile lines, suggesting that specific down-regulation of TaAnn10 is associated with conditional male sterility in wheat

  5. TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Mutai Hideki

    2003-06-01

    Full Text Available Abstract Background Mutations in the transmembrane cochlear expressed gene 1 (TMC1 cause deafness in human and mouse. Mutations in two homologous genes, EVER1 and EVER2 increase the susceptibility to infection with certain human papillomaviruses resulting in high risk of skin carcinoma. Here we report that TMC1, EVER1 and EVER2 (now TMC6 and TMC8 belong to a larger novel gene family, which is named TMC for trans membrane channel-like gene family. Results Using a combination of iterative database searches and reverse transcriptase-polymerase chain reaction (RT-PCR experiments we assembled contigs for cDNA encoding human, murine, puffer fish, and invertebrate TMC proteins. TMC proteins of individual species can be grouped into three subfamilies A, B, and C. Vertebrates have eight TMC genes. The majority of murine TMC transcripts are expressed in most organs; some transcripts, however, in particular the three subfamily A members are rare and more restrictively expressed. Conclusion The eight vertebrate TMC genes are evolutionary conserved and encode proteins that form three subfamilies. Invertebrate TMC proteins can also be categorized into these three subfamilies. All TMC genes encode transmembrane proteins with intracellular amino- and carboxyl-termini and at least eight membrane-spanning domains. We speculate that the TMC proteins constitute a novel group of ion channels, transporters, or modifiers of such.

  6. Exceptional memory performance in the Long Life Family Study

    DEFF Research Database (Denmark)

    Barral, Sandra; Cosentino, Stephanie; Costa, Rosann

    2013-01-01

    Research to understand variability at the highest end of the cognitive performance distribution has been scarce. Our aim was to define a cognitive endophenotype based on exceptional episodic memory (EM) performance and to investigate familial aggregation of EM in families from the Long Life Family...... Study (LLFS). Using a sample of 1911 nondemented offspring of long-lived probands, we created a quantitative phenotype, EM (memory z ≥ 1.5), and classified LLFS families as EM and non-EM families based on the number of EM offspring. We then assessed differences in memory performance between LLFS...... = 1.4 × 10(-4)). We demonstrated that there is a familial correlation of the EM endophenotype, suggesting that genetic variants might influence memory performance in long-lived families....

  7. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  8. A novel gene mutation in a family with X-linked retinoschisis.

    Science.gov (United States)

    Lai, Yu-Hung; Huang, Shun-Ping; Chen, Shee-Ping; Hu, Pei-Shin; Lin, Shu-Fung; Sheu, Min-Muh; Wang, Hwei-Zu; Tsai, Rong Kung

    2015-09-01

    To describe the clinical characteristics of a Taiwanese family with X-linked retinoschisis (XLRS) and to investigate the molecular genetics of a novel mutation in the retinoschisin 1 (RS1) gene. A total of 15 participants in this XLRS family were analyzed. Complete ophthalmic examinations and fundus photography were performed on 15 family members. These tests identified five affected males and two female carriers. Blood samples were collected, and genomic DNA was extracted. Best-corrected visual acuity, optical coherence tomography (OCT), electroretinogram (ERG), and direct DNA sequence analysis of the RS1 gene were performed on 15 family members. Five affected males, with visual acuity ranging from 0.2 to 0.7, had macular schisis and abnormal retinal pigment epithelium pigmentation. The mixed scotopic ERG "b" wave was more reduced than the "a" wave. OCT revealed typical microcystic schisis cavities within the macula area. Direct DNA sequence analysis revealed a single base pair deletion, 97delT, in all the affected individuals. This deletion resulted in a frameshift mutation of the RS1 gene, causing protein truncation. The affected males in this family showed moderately decreased visual acuity and dysfunction in both cone cells and phototransduction. We identified a novel RS1 (97delT) mutation in a Taiwanese family with XLRS. This finding expands the RS1 mutation spectrum and may help to further understand the molecular pathogenesis of XLRS. Copyright © 2014. Published by Elsevier B.V.

  9. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  10. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  11. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  12. SVM-based generalized multifactor dimensionality reduction approaches for detecting gene-gene interactions in family studies.

    Science.gov (United States)

    Fang, Yao-Hwei; Chiu, Yen-Feng

    2012-02-01

    Gene-gene interaction plays an important role in the etiology of complex diseases, which may exist without a genetic main effect. Most current statistical approaches, however, focus on assessing an interaction effect in the presence of the gene's main effects. It would be very helpful to develop methods that can detect not only the gene's main effects but also gene-gene interaction effects regardless of the existence of the gene's main effects while adjusting for confounding factors. In addition, when a disease variant is rare or when the sample size is quite limited, the statistical asymptotic properties are not applicable; therefore, approaches based on a reasonable and applicable computational framework would be practical and frequently applied. In this study, we have developed an extended support vector machine (SVM) method and an SVM-based pedigree-based generalized multifactor dimensionality reduction (PGMDR) method to study interactions in the presence or absence of main effects of genes with an adjustment for covariates using limited samples of families. A new test statistic is proposed for classifying the affected and the unaffected in the SVM-based PGMDR approach to improve performance in detecting gene-gene interactions. Simulation studies under various scenarios have been performed to compare the performances of the proposed and the original methods. The proposed and original approaches have been applied to a real data example for illustration and comparison. Both the simulation and real data studies show that the proposed SVM and SVM-based PGMDR methods have great prediction accuracies, consistencies, and power in detecting gene-gene interactions. © 2012 Wiley Periodicals, Inc.

  13. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  14. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  15. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Birt-Hogg-Dubé syndrome in two Chinese families with mutations in the FLCN gene.

    Science.gov (United States)

    Hou, Xiaocan; Zhou, Yuan; Peng, Yun; Qiu, Rong; Xia, Kun; Tang, Beisha; Zhuang, Wei; Jiang, Hong

    2018-01-22

    Birt-Hogg-Dubé syndrome is an autosomal dominant hereditary condition caused by mutations in the folliculin-encoding gene FLCN (NM_144997). It is associated with skin lesions such as fibrofolliculoma, acrochordon and trichodiscoma; pulmonary lesions including spontaneous pneumothorax and pulmonary cysts and renal cancer. Genomic DNA was extracted from peripheral venous blood samples of the propositi and their family members. Genetic analysis was performed by whole exome sequencing and Sanger sequencing aiming at corresponding exons in FLCN gene to explore the genetic mutations of these two families. In this study, we performed genetic analysis by whole exome sequencing and Sanger sequencing aiming at corresponding exons in FLCN gene to explore the genetic mutations in two Chinese families. Patients from family 1 mostly suffered from pneumothorax and pulmonary cysts, several of whom also mentioned skin lesions or kidney lesions. While in family 2, only thoracic lesions were found in the patients, without any other clinical manifestations. Two FLCN mutations have been identified: One is an insertion mutation (c.1579_1580insA/p.R527Xfs on exon 14) previously reported in three Asian families (one mainland family and two Taiwanese families); while the other is a firstly reviewed mutation in Asian population (c.649C > T / p.Gln217X on exon 7) that ever been detected in a French family. Overall, The detection of these two mutations expands the spectrum of FLCN mutations and will provide insight into genetic diagnosis and counseling of Birt-Hogg-Dubé syndrome.

  17. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  18. Effect of Family Type on Secondary School Students\\' Performance ...

    African Journals Online (AJOL)

    This study investigated the effect of family type on Secondary School students\\' performance in physics in Ilorin metropolis. The sample comprised one hundred Senior Secondary II students from four schools in Ilorin metropolis. The instrument for the study titled \\"Effect of Family type on Students\\' Performance in Physics ...

  19. A Novel Family of Magnesium Transport Genes in Arabidopsis

    Science.gov (United States)

    Li, Legong; Tutone, Ana F.; Drummond, Revel S. M.; Gardner, Richard C.; Luan, Sheng

    2001-01-01

    Magnesium (Mg2+) is the most abundant divalent cation in plant cells and plays a critical role in many physiological processes. We describe the identification of a 10-member Arabidopsis gene family (AtMGT) encoding putative Mg2+ transport proteins. Most members of the AtMGT family are expressed in a range of Arabidopsis tissues. One member of this family, AtMGT1, functionally complemented a bacterial mutant lacking Mg2+ transport capability. A second member, AtMGT10, complemented a yeast mutant defective in Mg2+ uptake and increased the cellular Mg2+ content of starved cells threefold during a 60-min uptake period. 63Ni tracer studies in bacteria showed that AtMGT1 has highest affinity for Mg2+ but may also be capable of transporting several other divalent cations, including Ni2+, Co2+, Fe2+, Mn2+, and Cu2+. However, the concentrations required for transport of these other cations are beyond normal physiological ranges. Both AtMGT1 and AtMGT10 are highly sensitive to Al3+ inhibition, providing potential molecular targets for Al3+ toxicity in plants. Using green fluorescence protein as a reporter, we localized AtMGT1 protein to the plasma membrane in Arabidopsis plants. We suggest that the AtMGT gene family encodes a Mg2+ transport system in higher plants. PMID:11752386

  20. Sequence analysis of candidate genes in two Roma families with severe tooth agenesis

    Directory of Open Access Journals (Sweden)

    Gabriková Dana

    2016-01-01

    Full Text Available Selective tooth agenesis is the most common congenital disorder affecting the formation of dentition in humans. Both its forms (hypodontia and more severe oligodontia can be found either in isolated form and they can be associated with systemic condition (syndromic tooth agenesis. In addition to previously known genes (PAX9, MSX1 and AXIN2 mutations in EDA, EDARADD and WNT10 gene were recently found to be involved in isolated forms of tooth agenesis. The objective of this study was to characterize the phenotype of affected members in two large families of Roma origin segregating severe isolated tooth agenesis with very variable phenotype and to perform mutation analysis of seven genes with aim to find causal mutation. 26 family members were clinically examined and coding regions of seven genes (MSX1, PAX9, AXIN2, EDA, EDAR, EDARADD and WNT10A were sequenced. With exclusion of third molars, average number of missing teeth was 8.2 ± 4.9 in family 1 and 7.1 ± 2.3 in family 2. The most frequently missing teeth were maxillary lateral incisors and first premolars and mandibular central incisors. Sequencing revealed four potentially damaging variants (g.Ala40Gly in MSX1, g.Ala240Pro in PAX9, g.Pro50Ser in AXIN2 and g.Met9Ile in EDARADD; however, none of them was present in all affected family members. Variable phenotype in both families examined in this study is in favour of heterogeneous genetic cause of tooth agenesis in these families: possible interaction of several defected genes, sequence variants in regulatory regions and additional environmental factors is assumed.

  1. PlantTribes: a gene and gene family resource for comparative genomics in plants

    Science.gov (United States)

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2008-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, called tribes, using three clustering stringencies (low, medium and high). For all tribes, we have generated protein and DNA alignments and maximum-likelihood phylogenetic trees. A parallel database of microarray experimental results is linked to the genes, which lets researchers identify groups of related genes and their expression patterns. Unified nomenclatures were developed, and tribes can be related to traditional gene families and conserved domain identifiers. SuperTribes, constructed through a second iteration of MCL clustering, connect distant, but potentially related gene clusters. The global classification of nearly 200 000 plant proteins was used as a scaffold for sorting ∼4 million additional cDNA sequences from over 200 plant species. All data and analyses are accessible through a flexible interface allowing users to explore the classification, to place query sequences within the classification, and to download results for further study. PMID:18073194

  2. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  3. Genome-Wide Identification, Characterization and Expression Analysis of the TCP Gene Family in Prunus mume.

    Science.gov (United States)

    Zhou, Yuzhen; Xu, Zongda; Zhao, Kai; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang

    2016-01-01

    TCP proteins, belonging to a plant-specific transcription factors family, are known to have great functions in plant development, especially flower and leaf development. However, there is little information about this gene family in Prunus mume, which is widely cultivated in China as an ornamental and fruit tree. Here a genome-wide analysis of TCP genes was performed to explore their evolution in P. mume. Nineteen PmTCPs were identified and three of them contained putative miR319 target sites. Phylogenetic and comprehensive bioinformatics analyses of these genes revealed that different types of TCP genes had undergone different evolutionary processes and the genes in the same clade had similar chromosomal location, gene structure, and conserved domains. Expression analysis of these PmTCPs indicated that there were diverse expression patterns among different clades. Most TCP genes were predominantly expressed in flower, leaf, and stem, and showed high expression levels in the different stages of flower bud differentiation, especially in petal formation stage and gametophyte development. Genes in TCP-P subfamily had main roles in both flower development and gametophyte development. The CIN genes in double petal cultivars might have key roles in the formation of petal, while they were correlated with gametophyte development in the single petal cultivar. The CYC/TB1 type genes were highly detected in the formation of petal and pistil. The less-complex flower types of P. mume might result from the fact that there were only two CYC type genes present in P. mume and a lack of CYC2 genes to control the identity of flower types. These results lay the foundation for further study on the functions of TCP genes during flower development.

  4. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  5. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)

    1995-11-06

    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  6. Are Family Firms Better Performers during Financial Crisis?

    DEFF Research Database (Denmark)

    Zhou, Haoyong

    (Italy) during the period 2006-2010, I give empirical evidences examining the performance of family firms vis-à-vis non-family firms during the current financial crisis. I find that broadly defined family firms, comprising 35 percent of the sample, do not outperform non-family firms during the crisis...... that in the financial crisis, founder firms bear the least agency cost and Tobin’s Q is not a good measure of corporate performance.......Despite extensive researches on efficiency of family firms in normal or good economic times, we know rather little about whether family firms are superior performers in recession times. Using a dataset covering firms from S&P 500 (US), FTE100 (UK), DAX 30 (Germany), CAC 40 (France) and FTSE MIB 40...

  7. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  8. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  9. Repair of DNA damage in the human metallothionein gene family

    International Nuclear Information System (INIS)

    Leadon, S.A.; Snowden, M.M.

    1987-01-01

    In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab

  10. Gene expression of NOX family members and their clinical significance in hepatocellular carcinoma.

    Science.gov (United States)

    Eun, Hyuk Soo; Cho, Sang Yeon; Joo, Jong Seok; Kang, Sun Hyung; Moon, Hee Seok; Lee, Eaum Seok; Kim, Seok Hyun; Lee, Byung Seok

    2017-09-11

    Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase complex-derived reactive oxygen species (ROS) promote chronic liver inflammation and remodeling that can drive hepatocellular carcinoma development. The role of NOX expression in hepatocellular carcinoma (HCC) has been partially investigated; however, the clinical relevance of collective or individual NOX family member expression for HCC survival remains unclear. Here, we obtained NOX mRNA expression data for 377 HCC samples and 21 normal liver controls from the TCGA data portal and performed Kaplan-Meier survival, gene ontology functional enrichment, and gene set enrichment analyses. Although most NOX genes exhibited little change, some were significantly induced in HCC compared to that in normal controls. In addition, HCC survival analyses indicated better overall survival in patients with high NOX4 and DUOX1 expression, whereas patients with high NOX1/2/5 expression showed poor prognoses. Gene-neighbour and gene set enrichment analyses revealed that NOX1/2/5 were strongly correlated with genes associated with cancer cell survival and metastasis, whereas increased NOX4 and DUOX1 expression was associated with genes that inhibit tumour progression. On the basis of these data, NOX family gene expression analysis could be a predictor of survival and identify putative therapeutic targets in HCC.

  11. The SUPERMAN gene family in Populus: nucleotide diversity and gene expression in a dioecious plant.

    Science.gov (United States)

    Song, Yuepeng; Ma, Kaifeng; Ci, Dong; Tian, Xueyuan; Zhang, Zhiyi; Zhang, Deqiang

    2013-08-01

    SUP gene family expression and regulation patterns reported in dioecious woody plant. Phylogenetic and nucleotide diversity analysis indicated PtoSUP1 is highly conserved and has undergone strong purifying selection. The molecular basis of SUPERMAN (SUP) regulation during floral development in monoecious plants has been extensively studied, but little is known of the SUP gene family in dioecious woody plants. In this study, we systematically examined the diversification of the SUP gene family in Populus, integrating genomic organization, expression, and phylogeny data. SUP family members showed sex-specific expression throughout flower development. Transcript profiling of rare gynomonoecious poplar flowers revealed that a significant reduction in PtoSUP1 mRNA might be important for stamen development in gynomonoecious poplar flowers. We found that the coding regions of Populus SUP genes are very highly conserved and that synonymous sites in exon regions have undergone strong purifying selection during SUP evolution in Populus. These results indicate that SUP genes play an important role in floral development of dioecious plants. Expression analysis of SUP suggested possible regulatory mechanisms for gynomonoecious poplar flower development. These findings provide an important insight into the mechanisms of the evolution of SUP function and may help enable engineered regulation of flower development for breeding improved tree varieties.

  12. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    2007-03-29

    Mar 29, 2007 ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa. Abstract. Elucidation of genome sequence provides an excellent platform to understand detailed complexity of the various gene families. Hsp100 is an important family of chaperones in diverse living systems. There are eight putative gene loci ...

  13. Gender in childhood obesity: family environment, hormones, and genes.

    Science.gov (United States)

    Wisniewski, Amy B; Chernausek, Steven D

    2009-01-01

    The prevalence of obesity among children in the United States represents a pool of latent morbidity. Though the prevalence of obesity has increased in both boys and girls, the causes and consequences differ between the sexes. Thus, interventions proposed to treat and prevent childhood obesity will need to account for these differences. This review examines gender differences in the presentation of obesity in children and describes environmental, hormonal, and genetic factors that contribute to observed gender differences. A search of peer-reviewed, published literature was performed with PubMed for articles published from January 1974 through October 2008. Search terms used were obesity, sex, gender, hormones, family environment, body composition, adiposity, and genes. Studies of children aged 0 to 18 years were included, and only articles published in English were reviewed for consideration. Articles that illustrated gender differences in either the presentation or underlying mechanisms of obesity in children were reviewed for content, and their bibliographies were used to identify other relevant literature. Gender differences in childhood obesity have been understudied partially because of how we define the categories of overweight and obesity. Close examination of studies revealed that gender differences were common, both before and during puberty. Boys and girls differ in body composition, patterns of weight gain, hormone biology, and the susceptibility to certain social, ethnic, genetic, and environmental factors. Our understanding of how gender differences in pediatric populations relate to the pathogenesis of obesity and the subsequent development of associated comorbid states is critical to developing and implementing both therapeutic and preventive interventions.

  14. Phylogeny, gene structures, and expression patterns of the ERF gene family in soybean (Glycine max L.)

    Science.gov (United States)

    Zhang, Gaiyun; Chen, Ming; Chen, Xueping; Xu, Zhaoshi; Guan, Shan; Li, Lian-Cheng; Li, Aili; Guo, Jiaming; Mao, Long; Ma, Youzhi

    2008-01-01

    Members of the ERF transcription factor family play important roles in regulating gene expression in response to biotic and abiotic stresses. In soybean (Glycine max L.), however, only a few ERF genes have been studied so far. In this study, 98 unigenes that contained a complete AP2/ERF domain were identified from 63 676 unique sequences in the DFCI Soybean Gene Index database. The phylogeny, gene structures, and putative conserved motifs in soybean ERF proteins were analysed, and compared with those of Arabidopsis and rice. The members of the soybean ERF family were divided into 12 subgroups, similar to the case for Arabidopsis. AP2/ERF domains were conserved among soybean, Arabidopsis, and rice. Outside the AP2/ERF domain, many soybean-specific conserved motifs were detected. Expression analysis showed that nine unigenes belonging to six ERF family subgroups were induced by both biotic/abiotic stresses and hormone treatment, suggesting that they were involved in cross-talk between biotic and abiotic stress-responsive signalling pathways. Overexpression of two full-length genes from two different subgroups enhanced the tolerances to drought, salt stresses, and/or pathogen infection of the tobacco plants. These results will be useful for elucidating ERF gene-associated stress response signalling pathways in soybean. PMID:18832187

  15. Investigating Seven Recently Identified Genes in 100 Iranian Families with Autosomal Recessive Non-syndromic Hearing Loss

    Directory of Open Access Journals (Sweden)

    Reihaneh Alikhani

    2015-09-01

    Full Text Available Objectives: Hearing loss (HL is the most common sensory disorder, and affects 1 in 1000 newborns. About 50% of HL is due to genetics and 70% of them are non-syndromic with a recessive pattern of inheritance. Up to now, more than 50 genes have been detected which are responsible for autosomal recessive non-syndromic hearing loss, (ARNSHL. In  Iran, HL is one of the most common disabilities due to consanguineous marriages. The aim was to investigate the prevalence of three new ARHL genes (GJB4, GJC3, and SLITRK6 reported in neighboring countries among Iranian families with ARNSHL. Methods: One hundred unrelated families with at least two affected siblings in consanguineous marriage, who were negative for GJB2 gene mutations, were selected. By using three STR markers for each gene, homozygosity mapping was performed. Results: Two families showed linkage to GJB4, six families were linked to GJC3 and only one family linked to SLITRK6. The samples of these families who showed linkage were sent for Sanger sequencing to detect the causative mutations. However, after analyzing the sequencing results, no mutation could be detected in either of the families. Molecular analysis for these nine families is underway in order to determine the pathogenic mutations using whole exome sequencing. Discussion: These data demonstrate a very low prevalence of mutation in these three genes (GJB4, GJC3, and SLITRK6 in the Iranian population, since no mutation was detected in our study group of 100 families.

  16. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  17. A case of familial breast cancer with double heterozygosity for BRCA1 and BRCA2 genes.

    Science.gov (United States)

    Nomizu, Tadashi; Matsuzaki, Masami; Katagata, Naoto; Kobayashi, Yusuke; Sakuma, Takeshi; Monma, Tomoyuki; Saito, Motonobu; Watanabe, Fumiaki; Midorikawa, Shinichi; Yamaguchi, Yoshiko

    2015-09-01

    We report an extremely rare case of familial breast cancer with deleterious germline mutations in both BRCA1 and BRCA2 genes, of which, to date, no such case has been reported among Japanese breast/ovarian cancer patients. Genetic testing of the family members indicated that the same double heterozygosity for BRCA1 and BRCA2 genes was transmitted to the paternal cousin, and the same BRCA2 mutation to the younger sister with bilateral breast cancer, younger brother with stomach cancer, and proband's son and daughter without cancer. Immunohistochemical analysis of BRCA protein expression was performed using breast cancer tissues from the proband with double heterozygosity for BRCA1 and BRCA2 genes and from her sibling without BRCA1 mutation but with BRCA2 mutation. There was no staining of either BRCA in the proband and no staining of BRCA2 in the sibling.

  18. Mutation analysis of the AATF gene in breast cancer families

    International Nuclear Information System (INIS)

    Haanpää, Maria; Reiman, Mervi; Nikkilä, Jenni; Erkko, Hannele; Pylkäs, Katri; Winqvist, Robert

    2009-01-01

    About 5-10% of breast cancer is due to inherited disease predisposition. Many previously identified susceptibility factors are involved in the maintenance of genomic integrity. AATF plays an important role in the regulation of gene transcription and cell proliferation. It induces apoptosis by associating with p53. The checkpoint kinases ATM/ATR and CHEK2 interact with and phosphorylate AATF, enhancing its accumulation and stability. Based on its biological function, and direct interaction with several known breast cancer risk factors, AATF is a good candidate gene for being involved in heritable cancer susceptibility. Here we have screened the entire coding region of AATF in affected index cases from 121 Finnish cancer families for germline defects, using conformation sensitive gel electrophoresis and direct sequencing. Altogether seven different sequence changes were observed, one missense variant and six intronic ones. Based on the in silico analyses of these sequence alterations, as well as their occurrence in cases and controls, none of them, however, were predicted to be pathogenic. To our knowledge, this is the first study reporting the mutation screening of the AATF gene in familial breast cancer cases. No evidence for the association with breast cancer was observed

  19. Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

    Science.gov (United States)

    Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

    2014-05-09

    The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Corporate Governance Provisions, Family Involvement, and Firm Performance in Publicly Traded Family Firms

    Directory of Open Access Journals (Sweden)

    Esra Memili

    2015-07-01

    Full Text Available This study examines the moderation effects of corporate governance provisions on the link between family involvement (i.e., family ownership and family management in publicly-traded firms and firm performance by drawing upon agency theory, with a focus on principal-principal agency issues, and the extant family governance literature. We develop and test the hypotheses on 386 of the S&P 500 firms longitudinally. Findings support the hypotheses suggesting the moderation effects of the use of provisions (a protecting controlling owners in terms of their sustainability of controlling status, and (b protecting management legally on the inverted U-shaped relationship between family ownership and firm performance. We also found support for the moderation effects of provisions (c protecting controlling owners in terms of their voting rights, (d protecting noncontrolling owners, and (e protecting management monetarily on the inverted U-shaped relationship between family management and firm performance. By this, our study provides empirical support for the principal-principal agency perspective on the corporate governance in publicly-traded family firms. As such, it suggests new avenues of research for both the corporate governance literature, as well as for the theory of the family firm. Our study also offers insights to policy directed toward monitoring the actions of large shareholders such as family and enhancing the overall shareholder value in publicly-traded family firms.

  1. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  2. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  3. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  4. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    Science.gov (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  5. Familial adult spinal muscular atrophy associated with the VAPB gene: report of 42 cases in Brazil

    Directory of Open Access Journals (Sweden)

    Victor Kosac

    2013-10-01

    Full Text Available Familial spinal muscular atrophy (FSMA associated with the vesicle-associated membrane protein-associated protein B (VAPB gene is a rare autosomal dominant disease with late onset and slow progression. We studied 10 of 42 patients from 5 families by taking clinical histories and performing physical exams, electrophysiological studies, and genetic tests. All patients presented late onset disease with slow progression characterized by fasciculations, proximal weakness, amyotrophy, and hypoactive deep tendon reflex, except two who exhibited brisk reflex. Two patients showed tongue fasciculations and respiratory insufficiency. Electrophysiological studies revealed patterns of lower motor neuron disease, and genetic testing identified a P56S mutation of the VAPB gene. Although it is a rare motor neuron disease, FSMA with this mutation might be much more prevalent in Brazil than expected, and many cases may be undiagnosed. Genetic exams should be performed whenever it is suspected in Brazil.

  6. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi

    2007-01-01

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated

  7. Differential Selective Pressures Experienced by the Aurora Kinase Gene Family

    Directory of Open Access Journals (Sweden)

    Joni M. Seeling

    2017-12-01

    Full Text Available Aurora kinases (AKs are serine/threonine kinases that are essential for cell division. Humans have three AK genes: AKA, AKB, and AKC. AKA is required for centrosome assembly, centrosome separation, and bipolar spindle assembly, and its mutation leads to abnormal spindle morphology. AKB is required for the spindle checkpoint and proper cytokinesis, and mutations cause chromosome misalignment and cytokinesis failure. AKC is expressed in germ cells, and has a role in meiosis analogous to that of AKB in mitosis. Mutation of any of the three isoforms can lead to cancer. AK proteins possess divergent N- and C-termini and a conserved central catalytic domain. We examined the evolution of the AK gene family using an identity matrix and by building a phylogenetic tree. The data suggest that AKA is the vertebrate ancestral gene, and that AKB and AKC resulted from gene duplication in placental mammals. In a nonsynonymous/synonymous rate substitution analysis, we found that AKB experienced the strongest, and AKC the weakest, purifying selection. Both the N- and C-termini and regions within the kinase domain experienced differential selection among the AK isoforms. These differentially selected sequences may be important for species specificity and isoform specificity, and are therefore potential therapeutic targets.

  8. Genome-Wide Analysis and Characterization of Aux/IAA Family Genes in Brassica rapa.

    Science.gov (United States)

    Paul, Parameswari; Dhandapani, Vignesh; Rameneni, Jana Jeevan; Li, Xiaonan; Sivanandhan, Ganesan; Choi, Su Ryun; Pang, Wenxing; Im, Subin; Lim, Yong Pyo

    2016-01-01

    Auxins are the key players in plant growth development involving leaf formation, phototropism, root, fruit and embryo development. Auxin/Indole-3-Acetic Acid (Aux/IAA) are early auxin response genes noted as transcriptional repressors in plant auxin signaling. However, many studies focus on Aux/ARF gene families and much less is known about the Aux/IAA gene family in Brassica rapa (B. rapa). Here we performed a comprehensive genome-wide analysis and identified 55 Aux/IAA genes in B. rapa using four conserved motifs of Aux/IAA family (PF02309). Chromosomal mapping of the B. rapa Aux/IAA (BrIAA) genes facilitated understanding cluster rearrangement of the crucifer building blocks in the genome. Phylogenetic analysis of BrIAA with Arabidopsis thaliana, Oryza sativa and Zea mays identified 51 sister pairs including 15 same species (BrIAA-BrIAA) and 36 cross species (BrIAA-AtIAA) IAA genes. Among the 55 BrIAA genes, expression of 43 and 45 genes were verified using Genebank B. rapa ESTs and in home developed microarray data from mature leaves of Chiifu and RcBr lines. Despite their huge morphological difference, tissue specific expression analysis of BrIAA genes between the parental lines Chiifu and RcBr showed that the genes followed a similar pattern of expression during leaf development and a different pattern during bud, flower and siliqua development stages. The response of the BrIAA genes to abiotic and auxin stress at different time intervals revealed their involvement in stress response. Single Nucleotide Polymorphisms between IAA genes of reference genome Chiifu and RcBr were focused and identified. Our study examines the scope of conservation and divergence of Aux/IAA genes and their structures in B. rapa. Analyzing the expression and structural variation between two parental lines will significantly contribute to functional genomics of Brassica crops and we belive our study would provide a foundation in understanding the Aux/IAA genes in B. rapa.

  9. Genome-Wide Analysis and Characterization of Aux/IAA Family Genes in Brassica rapa.

    Directory of Open Access Journals (Sweden)

    Parameswari Paul

    Full Text Available Auxins are the key players in plant growth development involving leaf formation, phototropism, root, fruit and embryo development. Auxin/Indole-3-Acetic Acid (Aux/IAA are early auxin response genes noted as transcriptional repressors in plant auxin signaling. However, many studies focus on Aux/ARF gene families and much less is known about the Aux/IAA gene family in Brassica rapa (B. rapa. Here we performed a comprehensive genome-wide analysis and identified 55 Aux/IAA genes in B. rapa using four conserved motifs of Aux/IAA family (PF02309. Chromosomal mapping of the B. rapa Aux/IAA (BrIAA genes facilitated understanding cluster rearrangement of the crucifer building blocks in the genome. Phylogenetic analysis of BrIAA with Arabidopsis thaliana, Oryza sativa and Zea mays identified 51 sister pairs including 15 same species (BrIAA-BrIAA and 36 cross species (BrIAA-AtIAA IAA genes. Among the 55 BrIAA genes, expression of 43 and 45 genes were verified using Genebank B. rapa ESTs and in home developed microarray data from mature leaves of Chiifu and RcBr lines. Despite their huge morphological difference, tissue specific expression analysis of BrIAA genes between the parental lines Chiifu and RcBr showed that the genes followed a similar pattern of expression during leaf development and a different pattern during bud, flower and siliqua development stages. The response of the BrIAA genes to abiotic and auxin stress at different time intervals revealed their involvement in stress response. Single Nucleotide Polymorphisms between IAA genes of reference genome Chiifu and RcBr were focused and identified. Our study examines the scope of conservation and divergence of Aux/IAA genes and their structures in B. rapa. Analyzing the expression and structural variation between two parental lines will significantly contribute to functional genomics of Brassica crops and we belive our study would provide a foundation in understanding the Aux/IAA genes in B. rapa.

  10. Genome-wide analysis of the SBP-box gene family in Chinese cabbage (Brassica rapa subsp. pekinensis).

    Science.gov (United States)

    Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin

    2015-11-01

    The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.

  11. Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.

    Science.gov (United States)

    Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang

    2015-06-30

    Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.

  12. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    tissues, although mRNA levels were regulated between cell-types and family members. Gene expression patterns were often highly correlated between akirin paralogues, suggesting that natural selection has maintained an intricate network of co-regulation among family members. We concluded that the Atlantic salmon akirin family performs a multifaceted role during myogenesis and has physiological functions spanning many cell-types.

  13. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    were regulated between cell-types and family members. Gene expression patterns were often highly correlated between akirin paralogues, suggesting that natural selection has maintained an intricate network of co-regulation among family members. We concluded that the Atlantic salmon akirin family performs a multifaceted role during myogenesis and has physiological functions spanning many cell-types.

  14. Mutation analysis of the RET gene in individuals with sporadic and familial pheochromocytoma

    Energy Technology Data Exchange (ETDEWEB)

    Iyengar, S.; Sirugo, G.; Bale, A.E. [Yale Univ. School of Medicine, New Haven, CT (United States)] [and others

    1994-09-01

    Pheochromocytoma is common to many familial cancer syndromes including multiple endocrine neoplasia type 2A (MEN2A), von Hippel-Lindau (VHL) and neurofibromatosis (NF). Although sporadic cases of pheochromocytoma have been examined for mutations in exons 10, 11 and 16 of the RET gene, only one case with a mutation in exon 16 has been reported thus far. We are performing systematic examination of exons of the RET gene, which has previously been associated with mutation in both MEN2 A and B, to determine the role RET may play in the etiology of pheochromocytoma. Seventeen cases of sporadic pheochromocytoma and 3 cases of sporadic medullary thyroid carcinoma were obtained from the pathology archives. Histopathology of all specimens was confirmed to be either pheochromocytoma or medullary thyroid carcinoma before DNA was extracted from 0.5{mu} thin sections of paraffin-embedded tissue. DNA from familial pheochromocytoma patients was also available for analysis. All sporadic and familial cases were amplified for exons 2, 6 and 16 of the RET gene. Single strand conformational polymorphism (SSCP) analysis was performed for exons 2 and 6. On finding a variation in the SSCP pattern in the pheochromocytoma kindred we sequenced all the samples for exon 2. A single base pair variation was found, which did not segregate with pheochromocytoma in the family. No variant SSCP patterns have been observed with the exon 6 PCR products thus far. Exon 16 PCR products were subjected to DNA restriction analysis with Fok I. This enzyme detects a single base pair change associated with MEN2 B. With the exception of one sample with sporadic medullary thyroid carcinoma, all samples showed the normal pattern on DNA restriction analysis. Thus we can exclude exons 2 and 6 of the RET gene in the pathogenesis of pheochromocytoma. SSCP analyses with other exons in the RET gene are underway.

  15. Performance of full-sib families of Douglas-fir in pure-family and mixed-family deployments

    Science.gov (United States)

    Peter J. Gould; J. Bradley St.Clair; Paul D. Anderson

    2011-01-01

    A major objective of tree improvement programs is to identify genotypes that will perform well in operational deployments. Relatively little is known, however, about how the competitive environment affects performance in different types of deployments. We tested whether the genetic composition and density of deployments affect the performance of full-sib families of...

  16. Family and academic performance: identifying high school student profiles

    Directory of Open Access Journals (Sweden)

    Alicia Aleli Chaparro Caso López

    2016-01-01

    Full Text Available The objective of this study was to identify profiles of high school students, based on variables related to academic performance, socioeconomic status, cultural capital and family organization. A total of 21,724 high school students, from the five municipalities of the state of Baja California, took part. A K-means cluster analysis was performed to identify the profiles. The analyses identified two clearly-defined clusters: Cluster 1 grouped together students with high academic performance and who achieved higher scores for socioeconomic status, cultural capital and family involvement, whereas Cluster 2 brought together students with low academic achievement, and who also obtained lower scores for socioeconomic status and cultural capital, and had less family involvement. It is concluded that the family variables analyzed form student profiles that can be related to academic achievement.

  17. Distinct functions of Egr gene family members in cognitive processes

    Directory of Open Access Journals (Sweden)

    Roseline Poirier

    2008-07-01

    Full Text Available The different gene members of the Egr family of transcriptional regulators have often been considered to have related functions in brain, based on their co-expression in many cell-types and structures, the relatively high homology of the translated proteins and their ability to bind to the same consensus DNA binding sequence. Recent research, however, suggest this might not be the case. In this review, we focus on the current understanding of the functional roles of the different Egr family members in learning and memory. We briefly outline evidence from mutant mice that Egr1 is required specifically for the consolidation of long-term memory, while Egr3 is primarily essential for short-term memory. We also review our own recent findings from newly generated forebrain-specific conditional Egr2 mutant mice, which revealed that Egr2, as opposed to Egr1 and Egr3, is dispensable for several forms of learning and memory and on the contrary can act as an inhibitory constraint for certain cognitive functions. The studies reviewed here highlight the fact that Egr family members may have different, and in certain circumstances antagonistic functions in the adult brain.

  18. The SLEEPER genes: a transposase-derived angiosperm-specific gene family

    Directory of Open Access Journals (Sweden)

    Knip Marijn

    2012-10-01

    Full Text Available Abstract Background DAYSLEEPER encodes a domesticated transposase from the hAT-superfamily, which is essential for development in Arabidopsis thaliana. Little is known about the presence of DAYSLEEPER orthologs in other species, or how and when it was domesticated. We studied the presence of DAYSLEEPER orthologs in plants and propose a model for the domestication of the ancestral DAYSLEEPER gene in angiosperms. Results Using specific BLAST searches in genomic and EST libraries, we found that DAYSLEEPER-like genes (hereafter called SLEEPER genes are unique to angiosperms. Basal angiosperms as well as grasses (Poaceae and dicotyledonous plants possess such putative orthologous genes, but SLEEPER-family genes were not found in gymnosperms, mosses and algae. Most species contain more than one SLEEPER gene. All SLEEPERs contain a C2H2 type BED-zinc finger domain and a hATC dimerization domain. We designated 3 motifs, partly overlapping the BED-zinc finger and dimerization domain, which are hallmark features in the SLEEPER family. Although SLEEPER genes are structurally conserved between species, constructs with SLEEPER genes from grapevine and rice did not complement the daysleeper phenotype in Arabidopsis, when expressed under control of the DAYSLEEPER promoter. However these constructs did cause a dominant phenotype when expressed in Arabidopsis. Rice plant lines with an insertion in the RICESLEEPER1 or 2 locus displayed phenotypic abnormalities, indicating that these genes are functional and important for normal development in rice. We suggest a model in which we hypothesize that an ancestral hAT transposase was retrocopied and stably integrated in the genome during early angiosperm evolution. Evidence is also presented for more recent retroposition events of SLEEPER genes, such as an event in the rice genome, which gave rise to the RICESLEEPER1 and 2 genes. Conclusions We propose the ancestral SLEEPER gene was formed after a process of retro

  19. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy

    Energy Technology Data Exchange (ETDEWEB)

    Shastry, B.S.; Hartzer, M.K. [Oakland Univ., Rochester, MI (United States); Hejtmancik, J.F. [National Eye Institute, Bethesda, MD (United States)] [and others

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Z{sub max} = 2.1, {theta}{sub max} = 0) and DXS228 (Z{sub max} = 0.5, {theta}{sub max} = 0.11), and this was further confirmed by multipoint analysis with these same markers (Z{sub max} = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie`s disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient. 21 refs., 3 figs., 1 tab.

  20. Integrated genomic analysis suggests MLL3 is a novel candidate susceptibility gene for familial nasopharyngeal carcinoma.

    Science.gov (United States)

    Sasaki, Mark M; Skol, Andrew D; Bao, Riyue; Rhodes, Lindsay V; Chambers, Rachelle; Vokes, Everett E; Cohen, Ezra E W; Onel, Kenan

    2015-08-01

    Little is known about genetic factors associated with nasopharyngeal carcinoma (NPC). To gain insight into NPC etiology, we performed whole exome sequencing on germline and tumor DNA from three closely related family members with NPC. The family was ascertained through the Pediatric Familial Cancer Clinic at The University of Chicago (Chicago, IL). The diagnosis of NPC was confirmed pathologically for each individual. For each sample sequenced, 97.3% of the exome was covered at 5×, with an average depth of 44×. Candidate germline and somatic variants associated with NPC were identified and prioritized using a custom pipeline. We discovered 72 rare deleterious germline variants in 56 genes shared by all three individuals. Of these, only three are in previously identified NPC-associated genes, all of which are located within MLL3, a gene known to be somatically altered in NPC. One variant introduces an early stop codon in MLL3, which predicts complete loss-of-function. Tumor DNA analysis revealed somatic mutations and Epstein-Barr virus (EBV) integration events; none, however, were shared among all three individuals. These data suggest that inherited mutations in MLL3 may have predisposed these three individuals from a single family to develop NPC, and may cooperate with individually acquired somatic mutations or EBV integration events in NPC etiology. Our finding is the first instance of a plausible candidate high penetrance inherited mutation predisposing to NPC. ©2015 American Association for Cancer Research.

  1. Genome-wide characterization and comparative analysis of the MLO gene family in cotton.

    Science.gov (United States)

    Wang, Xiaoyan; Ma, Qifeng; Dou, Lingling; Liu, Zhen; Peng, Renhai; Yu, Shuxun

    2016-06-01

    In plants, MLO (Mildew Locus O) gene encodes a plant-specific seven transmembrane (TM) domain protein involved in several cellular processes, including susceptibility to powdery mildew (PM). In this study, a genome-wide characterization of the MLO gene family in G. raimondii L., G. arboreum L. and G. hirsutum L. was performed. In total, 22, 17 and 38 homologous sequences were identified for each species, respectively. Gene organization, including chromosomal location, gene clustering and gene duplication, was investigated. Homologues related to PM susceptibility in upland cotton were inferred by phylogenetic relationships with functionally characterized MLO proteins. To conduct a comparative analysis between MLO candidate genes from G. raimondii L., G. arboreum L. and G. hirsutum L., orthologous relationships and conserved synteny blocks were constructed. The transcriptional variation of 38 GhMLO genes in response to exogenous application of salt, mannitol (Man), abscisic acid (ABA), ethylene (ETH), jasmonic acid (JA) and salicylic acid (SA) was monitored. Further studies should be conducted to elucidate the functions of MLO genes in PM susceptibility and phytohormone signalling pathways. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  2. Evolutionary Analysis of the B56 Gene Family of PP2A Regulatory Subunits

    Directory of Open Access Journals (Sweden)

    Lauren M. Sommer

    2015-05-01

    Full Text Available Protein phosphatase 2A (PP2A is an abundant serine/threonine phosphatase that functions as a tumor suppressor in numerous cell-cell signaling pathways, including Wnt, myc, and ras. The B56 subunit of PP2A regulates its activity, and is encoded by five genes in humans. B56 proteins share a central core domain, but have divergent amino- and carboxy-termini, which are thought to provide isoform specificity. We performed phylogenetic analyses to better understand the evolution of the B56 gene family. We found that B56 was present as a single gene in eukaryotes prior to the divergence of animals, fungi, protists, and plants, and that B56 gene duplication prior to the divergence of protostomes and deuterostomes led to the origin of two B56 subfamilies, B56αβε and B56γδ. Further duplications led to three B56αβε genes and two B56γδ in vertebrates. Several nonvertebrate B56 gene names are based on distinct vertebrate isoform names, and would best be renamed. B56 subfamily genes lack significant divergence within primitive chordates, but each became distinct in complex vertebrates. Two vertebrate lineages have undergone B56 gene loss, Xenopus and Aves. In Xenopus, B56δ function may be compensated for by an alternatively spliced transcript, B56δ/γ, encoding a B56δ-like amino-terminal region and a B56γ core.

  3. Familial Lymphoproliferative Malignancies and Tandem Duplication of NF1 Gene

    Directory of Open Access Journals (Sweden)

    Gustavo Fernandes

    2014-01-01

    Full Text Available Background. Neurofibromatosis type 1 is a genetic disorder caused by loss-of-function mutations in a tumor suppressor gene (NF1 which codifies the protein neurofibromin. The frequent genetic alterations that modify neurofibromin function are deletions and insertions. Duplications are rare and phenotype in patients bearing duplication of NF1 gene is thought to be restricted to developmental abnormalities, with no reference to cancer susceptibility in these patients. We evaluated a patient who presented with few clinical signs of neurofibromatosis type 1 and a conspicuous personal and familiar history of different types of cancer, especially lymphoproliferative malignancies. The coding region of the NF-1 gene was analyzed by real-time polymerase chain reaction and direct sequencing. Multiplex ligation-dependent probe amplification was performed to detect the number of mutant copies. The NF1 gene analysis showed the following alterations: mosaic duplication of NF1, TRAF4, and MYO1D. Fluorescence in situ hybridization using probes (RP5-1002G3 and RP5-92689 flanking NF1 gene in 17q11.2 and CEP17 for 17q11.11.1 was performed. There were three signals (RP5-1002G3conRP5-92689 in the interphases analyzed and two signals (RP5-1002G3conRP5-92689 in 93% of cells. These findings show a tandem duplication of 17q11.2. Conclusion. The case suggests the possibility that NF1 gene duplication may be associated with a phenotype characterized by lymphoproliferative disorders.

  4. Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder.

    Science.gov (United States)

    Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P

    2018-03-01

    Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Family expansion and gene rearrangements contributed to the functional specialization of PRDM genes in vertebrates

    Directory of Open Access Journals (Sweden)

    Alcalay Myriam

    2007-10-01

    Full Text Available Abstract Background Progressive diversification of paralogs after gene expansion is essential to increase their functional specialization. However, mode and tempo of this divergence remain mostly unclear. Here we report the comparative analysis of PRDM genes, a family of putative transcriptional regulators involved in human tumorigenesis. Results Our analysis assessed that the PRDM genes originated in metazoans, expanded in vertebrates and further duplicated in primates. We experimentally showed that fast-evolving paralogs are poorly expressed, and that the most recent duplicates, such as primate-specific PRDM7, acquire tissue-specificity. PRDM7 underwent major structural rearrangements that decreased the number of encoded Zn-Fingers and modified gene splicing. Through internal duplication and activation of a non-canonical splice site (GC-AG, PRDM7 can acquire a novel intron. We also detected an alternative isoform that can retain the intron in the mature transcript and that is predominantly expressed in human melanocytes. Conclusion Our findings show that (a molecular evolution of paralogs correlates with their expression pattern; (b gene diversification is obtained through massive genomic rearrangements; and (c splicing modification contributes to the functional specialization of novel genes.

  6. Control Management and Business Performances: The Malaysian Family SMEs Perspectives

    Directory of Open Access Journals (Sweden)

    Edward Wong Sek Khin

    2015-06-01

    Full Text Available This study examined the relationship between control management and family business performance in the Malaysian context. It has two objectives, the first being to determine the relationship of organizational credit control policy and procedures, employee development and motivation, and intelligence collection systems to subsequent collection reports in Malaysian family SMEs. The second objective is to investigate the moderating effect of participation in decision-making and work effort towards innovation and business performance. This is a descriptive study involving 90 senior executives employed in 90 Malaysian family SMEs/firms. A correlation analysis from this study confirmed previous researchers’ observations that high-level organizational commitment to credit control management is linked to improvements in business performance. The results suggest that three components – credit policy, employee development, and intelligence collection systems – are the most important predictors for the efficiency and effectiveness of credit control management.    

  7. Family-based clusters of cognitive test performance in familial schizophrenia

    Directory of Open Access Journals (Sweden)

    Partonen Timo

    2004-07-01

    Full Text Available Abstract Background Cognitive traits derived from neuropsychological test data are considered to be potential endophenotypes of schizophrenia. Previously, these traits have been found to form a valid basis for clustering samples of schizophrenia patients into homogeneous subgroups. We set out to identify such clusters, but apart from previous studies, we included both schizophrenia patients and family members into the cluster analysis. The aim of the study was to detect family clusters with similar cognitive test performance. Methods Test scores from 54 randomly selected families comprising at least two siblings with schizophrenia spectrum disorders, and at least two unaffected family members were included in a complete-linkage cluster analysis with interactive data visualization. Results A well-performing, an impaired, and an intermediate family cluster emerged from the analysis. While the neuropsychological test scores differed significantly between the clusters, only minor differences were observed in the clinical variables. Conclusions The visually aided clustering algorithm was successful in identifying family clusters comprising both schizophrenia patients and their relatives. The present classification method may serve as a basis for selecting phenotypically more homogeneous groups of families in subsequent genetic analyses.

  8. Multiple lineage specific expansions within the guanylyl cyclase gene family

    Directory of Open Access Journals (Sweden)

    O'Halloran Damien M

    2006-03-01

    , which have occurred within the GC gene family during metazoan evolution. Our phylogenetic analyses reveal that the rGC and sGC multi-domain proteins evolved early in eumetazoan evolution. Subsequent gene duplications, tissue specific expression patterns and lineage specific expansions resulted in the evolution of new networks of interaction and new biological functions associated with the maintenance of organismal complexity and homeostasis.

  9. Perforin gene mutation in familial haemophagocytic lymphohistiocytosis: the first reported case from Hong Kong.

    Science.gov (United States)

    Chiang, Grace P K; Li, C K; Lee, Vincent; Cheng, Frankie W T; Leung, Alex W K; Imashuku, Shinsaku; Imamura, Toshihiko; Shing, Matthew M K

    2014-08-01

    Familial haemophagocytic lymphohistiocytosis is a rare but invariably fatal disease without haematopoietic stem cell transplantation. Genetic defect identification is useful for confirming a clinical diagnosis, predicting the risk of future recurrence, and defining haemophagocytic lymphohistiocytosis predisposition in asymptomatic family members. Notably, familial haemophagocytic lymphohistiocytosis type 2 associates with mutations in the perforin gene (PRF1) which is the most frequent subtype of familial haemophagocytic lymphohistiocytosis. Although perforin gene mutations have been described in Asians, they are largely reported from Japan. The case reported here is the first familial haemophagocytic lymphohistiocytosis type 2 patient in Hong Kong with an identified perforin gene mutation.

  10. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  11. Diabetes, child care, and performance of family functions

    Directory of Open Access Journals (Sweden)

    Ewa Kobos

    2017-03-01

    Full Text Available Introduction : Parents caring for a child with diabetes may experience a burden on both a practical and an emotional level. Aim of the research : Analysis of the correlations between the care burden level and the perceived influence of type 1 diabetes in children on the performance of family functions. Material and methods : The study included 112 caregivers of children with diabetes. The following inclusion criteria were taken into account: full family, direct caregiver of the child, the child’s age 3–16 years, disease duration of at least 6 months, and no chronic diseases in siblings. The study material was collected using an interview questionnaire and the Caregiver Burden Scale. Correlation analysis was performed using the Spearman correlation coefficient. The significance level was defined as p = 0.05. Results : A higher burden level of a caregiver in the individual subscales of the CB Scale was associated with a significant decrease in the intensity of performance of the cultural and social function as well as consumption function, the increased amount of time spent with a sick child, and an increase in parental disagreements. The overall burden level differentiated the performance of the religious function. An increase in the burden level on the overall effort subscale was accompanied by lower interest in sex and less frequent sexual intercourse. The higher level of caregiver burden occurs in families where permanent job income has fallen. The differences were shown in the performance of control-socialisation function due to the sense of burden on the environment subscale. Conclusions : The burden level of a caregiver is important in the perceived influence of the child’s illness on the functioning of the family. Stimulating a caregiver in dealing with the problems that are the consequence of the disease, as well as activating and preparing other family members to participate in the care of a sick child, and financial support may

  12. Family history and renin-angiotensin system gene polymorphisms in Chinese patients with type 2 diabetes mellitus.

    Science.gov (United States)

    Pan, Yan-Hong; Huang, Yan-Mei; Qiao, Yong-Chao; Ling, Wei; Geng, Li-Jun; Xiao, Jian-Long; Zhang, Xiao-Xi; Zhao, Hai-Lu

    2017-12-01

    A positive family history is recognized as an important risk factor for type 2 diabetes mellitus (T2DM), but the association of family history with rennin-angiotensin system (RAS) gene polymorphisms has not been reported yet, thus we aim to investigate it.Family history records, clinical and biochemical data were obtained from 1239 T2DM patients. Polymerase chain reaction (PCR) was performed for angiotensin-converting enzyme (ACE) genotyping and PCR-restricted fragment length polymorphism was used for angiotensinogen (AGT) genotyping.Patients with a negative family history had higher level of triglyceride and blood pressure, whereas those with a positive family history showed younger onset age and lower body mass index value (All P history (All P history and those with a negative family history had comparable genotype and allele distribution of ACE gene insertion/deletion polymorphisms and AGT gene M/T polymorphisms.A positive family history of diabetes was not associated with the RAS gene polymorphisms. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  13. Evaluation of candidate genes for DYX1 and DYX2 in families with dyslexia.

    Science.gov (United States)

    Brkanac, Zoran; Chapman, Nicola H; Matsushita, Mark M; Chun, Lani; Nielsen, Kathleen; Cochrane, Elizabeth; Berninger, Virginia W; Wijsman, Ellen M; Raskind, Wendy H

    2007-06-05

    Dyslexia is a common heterogeneous disorder with a significant genetic component. Multiple studies have replicated the evidence for linkage between variously defined phenotypes of dyslexia and chromosomal regions on 15q21 (DYX1) and 6p22.2 (DYX2). Based on association studies and the possibility for functional significance of several polymorphisms, candidate genes responsible for the observed linkage signal have been proposed-DYX1C1 for 15q21, and KIAA0319 and DCDC2 for 6p22.2. We investigated the evidence for contribution of these candidate genes to dyslexia in our sample of multigenerational families. Our previous quantitative linkage analyses in this dataset provided supportive evidence for linkage of dyslexia to the locus on chromosome 15, but not to the locus on chromosome 6. In the current study, we used probands from 191 families for a case control analysis, and proband-parent trios for family-based TDT analyses. The observation of weak evidence for transmission disequilibrium for one of the two studied polymorphisms in DYX1C1 suggests involvement of this gene in dyslexia in our dataset. We did not find evidence for the association of KIAA0319 or DCDC2 alleles to dyslexia in our sample. We observed a slight tendency for an intronic deletion in DCDC2 to be associated with worse performance on some quantitative measures of dyslexia in the probands in our sample, but not in their parents. (c) 2007 Wiley-Liss, Inc.

  14. Clinical Auditory Phenotypes Associated with GATA3 Gene Mutations in Familial Hypoparathyroidism-deafness-renal Dysplasia Syndrome

    Science.gov (United States)

    Wang, Li; Lin, Qiong-Fen; Wang, Hong-Yang; Guan, Jing; Lan, Lan; Xie, Lin-Yi; Yu, Lan; Yang, Ju; Zhao, Cui; Liang, Jin-Long; Zhou, Han-Lin; Yang, Huan-Ming; Xiong, Wen-Ping; Zhang, Qiu-Jing; Wang, Da-Yong; Wang, Qiu-Ju

    2017-01-01

    Background: Hypoparathyroidism-deafness-renal dysplasia (HDR) syndrome is an autosomal dominant disorder primarily caused by haploinsufficiency of GATA binding protein 3 (GATA3) gene mutations, and hearing loss is the most frequent phenotypic feature. This study aimed at identifying the causative gene mutation for a three-generation Chinese family with HDR syndrome and analyzing auditory phenotypes in all familial HDR syndrome cases. Methods: Three affected family members underwent otologic examinations, biochemistry tests, and other clinical evaluations. Targeted genes capture combining next-generation sequencing was performed within the family. Sanger sequencing was used to confirm the causative mutation. The auditory phenotypes of all reported familial HDR syndrome cases analyzed were provided. Results: In Chinese family 7121, a heterozygous nonsense mutation c.826C>T (p.R276*) was identified in GATA3. All the three affected members suffered from sensorineural deafness and hypocalcemia; however, renal dysplasia only appeared in the youngest patient. Furthermore, an overview of thirty HDR syndrome families with corresponding GATA3 mutations revealed that hearing impairment occurred earlier in the younger generation in at least nine familial cases (30%) and two thirds of them were found to carry premature stop mutations. Conclusions: This study highlights the phenotypic heterogeneity of HDR and points to a possible genetic anticipation in patients with HDR, which needs to be further investigated. PMID:28303854

  15. Influence of Family Background on the Academic Performance of ...

    African Journals Online (AJOL)

    The study was conducted to investigate the influence of family background on the academic performance of secondary school students in Nigeria. The study was carried out in the three senatorial districts of Kwara State. Three hundred respondents participated in this research. Descriptive statistics was used to analyze the ...

  16. WORK-FAMILY ROLE CONFLICT AND JOB PERFORMANCE ...

    African Journals Online (AJOL)

    Prof

    Abstract. This study examined work-family role conflict and job performance among female bankers in selected banks within the Federal Capital. Territory, Abuja, Nigeria. To achieve this objective, the study made use of a sample of 920 female bankers from selected banks. It relied on the. ―border crossing theory‖ as well ...

  17. Work-family role conflict and job performance among women ...

    African Journals Online (AJOL)

    This study examined work-family role conflict and job performance among female bankers in selected banks within the Federal Capital Territory, Abuja, Nigeria. To achieve this objective, the study made use of a sample of 920 female bankers from selected banks. It relied on the ―border crossing theory‖ as well as ...

  18. Parental divorce, sibship size, family resources, and children's academic performance.

    Science.gov (United States)

    Sun, Yongmin; Li, Yuanzhang

    2009-09-01

    Using data from 19,839 adolescents from the National Education Longitudinal Study, this study investigates whether the effects of parental divorce on adolescents' academic test performance vary by sibship size. Analyses show that the negative effect of divorce on adolescent performance attenuates as sibship size increases. On the other side of the interaction, the inverse relationship between sibship size and test performance is weaker in disrupted than in two-biological-parent families. Trends of such interactions are evident when sibship size is examined either as a continuous or a categorical measure. Finally, the observed interactions on adolescents' academic performance are completely explained by variations in parental financial, human, cultural, and social resources. In sum, this study underlines the importance of treating the effect of parental divorce as a variable and calls for more research to identify child and family features that may change the magnitude of such an effect.

  19. Spectrum of candidate gene mutations associated with Indian familial oculocutaneous and ocular albinism.

    Science.gov (United States)

    Renugadevi, Kathirvel; Sil, Asim Kumar; Perumalsamy, Vijayalakshmi; Sundaresan, Periasamy

    2010-08-09

    Albinism is a group of genetic disorders, showing a broad spectrum of different phenotypes. The purpose of this study was to screen known candidate genes for oculocutaneous albinism (OCA) and ocular albinism (OA) mutations in Indian patients. Blood samples were collected from 23 probands and 13 affected family members from 23 genetically unrelated Indian families (22 diagnosed as OCA and 1 diagnosed as OA) and analyzed by bidirectional DNA sequencing of the classic OCA genes--tyrosinase (TYR, or oculocutaneous albinism IA), pink eyed dilution (P; or oculocutaneous albinism II (OCA2]), tyrosinase-related protein 1 (TYRP1), solute carrier family 45, member 2 (SLC45A2; or membrane-associated transporter protein [MATP])--and the OA1 gene, G protein-coupled receptor 143 (GPR143). Three missense mutations, c. 715 C>T (R239W), c. 896 G>A (R299H), c.1255 G>A (G419R), and one termination c. 832 C>T (R278X), were identified in TYR, as well as one novel mutation, c.1453 G>A (G485R) in P. One novel single nucleotide polymorphism (SNP) was identified in both TYR and P; few reported SNPs were identified. The G>A base substitution caused relatively conservative amino acid changes, which altered glycine to arginine residues within the topological domain. The novel OCA2 mutation was not present in 100 control samples. This study identified two probands carrying mutations alone, 16 probands carrying SNPs alone, 4 probands carrying both mutations and SNPs and only one proband carrying neither mutations nor SNPs. Although sequence analysis was performed with all five candidate genes, only four (17.39%) of the 23 probands showed mutations in TYR and 2 probands (8.69%) showed an unreported novel mutation in P. Genetic counseling for phenotypical diagnosis and genetic mutation screening of these genes will help to minimize the incidence of OCA and OA in future generations.

  20. GDNF Gene Is Associated With Tourette Syndrome in a Family Study

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

    2016-01-01

    Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

  1. A family-based association study of the HTR1B gene in eating disorders

    Directory of Open Access Journals (Sweden)

    Sandra Hernández

    Full Text Available Objective: To explore the association of three polymorphisms of the serotonin receptor 1Dβ gene (HTR1B in the etiology of eating disorders and their relationship with clinical characteristics. Methods: We analyzed the G861C, A-161T, and A1180G polymorphisms of the HTR1B gene through a family-based association test (FBAT in 245 nuclear families. The sample was stratified into anorexia nervosa (AN spectrum and bulimia nervosa (BN spectrum. In addition, we performed a quantitative FBAT analysis of anxiety severity, depression severity, and Yale-Brown-Cornell Eating Disorders Scale (YBC-EDS in the AN and BN-spectrum groups. Results: FBAT analysis of the A-161T polymorphism found preferential transmission of allele A-161 in the overall sample. This association was stronger when the sample was stratified by spectrums, showing transmission disequilibrium between the A-161 allele and BN spectrum (z = 2.871, p = 0.004. Quantitative trait analysis showed an association between severity of anxiety symptoms and the C861 allele in AN-spectrum participants (z = 2.871, p = 0.004. We found no associations on analysis of depression severity or preoccupation and ritual scores in AN or BN-spectrum participants. Conclusions: Our preliminary findings suggest a role of the HTR1B gene in susceptibility to development of BN subtypes. Furthermore, this gene might have an impact on the severity of anxiety in AN-spectrum patients.

  2. A family-based association study of the HTR1B gene in eating disorders.

    Science.gov (United States)

    Hernández, Sandra; Camarena, Beatriz; González, Laura; Caballero, Alejandro; Flores, Griselda; Aguilar, Alejandro

    2016-01-01

    To explore the association of three polymorphisms of the serotonin receptor 1Dβ gene (HTR1B) in the etiology of eating disorders and their relationship with clinical characteristics. We analyzed the G861C, A-161T, and A1180G polymorphisms of the HTR1B gene through a family-based association test (FBAT) in 245 nuclear families. The sample was stratified into anorexia nervosa (AN) spectrum and bulimia nervosa (BN) spectrum. In addition, we performed a quantitative FBAT analysis of anxiety severity, depression severity, and Yale-Brown-Cornell Eating Disorders Scale (YBC-EDS) in the AN and BN-spectrum groups. FBAT analysis of the A-161T polymorphism found preferential transmission of allele A-161 in the overall sample. This association was stronger when the sample was stratified by spectrums, showing transmission disequilibrium between the A-161 allele and BN spectrum (z = 2.871, p = 0.004). Quantitative trait analysis showed an association between severity of anxiety symptoms and the C861 allele in AN-spectrum participants (z = 2.871, p = 0.004). We found no associations on analysis of depression severity or preoccupation and ritual scores in AN or BN-spectrum participants. Our preliminary findings suggest a role of the HTR1B gene in susceptibility to development of BN subtypes. Furthermore, this gene might have an impact on the severity of anxiety in AN-spectrum patients.

  3. Revisiting Vitis vinifera subtilase gene family: a possible role in grapevine resistance against Plasmopara viticola

    Directory of Open Access Journals (Sweden)

    Joana Figueiredo

    2016-11-01

    Full Text Available Subtilisin-like proteases, also known as subtilases, are a very diverse family of serine peptidases present in many organisms. In grapevine, there are hints of the involvement of subtilases in defence mechanisms, but their role is not yet understood. The first characterization of the subtilase gene family was performed in 2014. However, simultaneously, the grapevine genome was re-annotated and several sequences were re-annotated or retrieved. We have performed a re-characterization of this family in grapevine and identified 82 genes coding for 97 putative proteins, as result of alternative splicing. All the subtilases identified present the characteristic S8 peptidase domain and the majority of them also have a pro-domain I9 inhibitor, a protease-associated (PA domain and a signal peptide for targeting to the secretory pathway. Phylogenetic studies revealed six subtilase groups denominated VvSBT1 to VvSBT6. As several evidences have highlighted the participation of plant subtilases in response to biotic stimulus, we have investigated subtilase participation in grapevine resistance to Plasmopara viticola, the causative agent of downy mildew. Fourteen grapevine subtilases presenting either high homology to P69C from tomato, SBT3.3 from Arabidopsis thaliana or located near the Resistance to Plasmopara viticola (RPV locus were selected. Expression studies were conducted in the grapevine-P. viticola pathosystem with resistant and susceptible cultivars. Our results may indicate that some of grapevine subtilisins are potentially participating in the defence response against this biotrophic oomycete.

  4. Performance management in a family business: a case study

    OpenAIRE

    Silva, Paulino; Silva, Rui

    2014-01-01

    This research, still at an early stage, and then presented in a poster format, intended to explain the management of organizational performance of a family business in the succession process using the case study method. The scripts for semi-structured interviews that will apply to managers, owners and other workers who are deemed suitable for the investigation, which include relatives of the owners of the company are being developed. For this work the model of organizational performance manag...

  5. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  6. Exome sequences of multiplex, multigenerational families reveal schizophrenia risk loci with potential implications for neurocognitive performance.

    Science.gov (United States)

    Kos, Mark Z; Carless, Melanie A; Peralta, Juan; Curran, Joanne E; Quillen, Ellen E; Almeida, Marcio; Blackburn, August; Blondell, Lucy; Roalf, David R; Pogue-Geile, Michael F; Gur, Ruben C; Göring, Harald H H; Nimgaonkar, Vishwajit L; Gur, Raquel E; Almasy, Laura

    2017-12-01

    Schizophrenia is a serious mental illness, involving disruptions in thought and behavior, with a worldwide prevalence of about one percent. Although highly heritable, much of the genetic liability of schizophrenia is yet to be explained. We searched for susceptibility loci in multiplex, multigenerational families affected by schizophrenia, targeting protein-altering variation with in silico predicted functional effects. Exome sequencing was performed on 136 samples from eight European-American families, including 23 individuals diagnosed with schizophrenia or schizoaffective disorder. In total, 11,878 non-synonymous variants from 6,396 genes were tested for their association with schizophrenia spectrum disorders. Pathway enrichment analyses were conducted on gene-based test results, protein-protein interaction (PPI) networks, and epistatic effects. Using a significance threshold of FDR schizophrenia, with significant cis effects on gene expression (p = 5.5 × 10 -4 ), including brain tissue data from the Genotype-Tissue Expression project (minimum p = 6.0 × 10 -5 ). A second SNP, rs10378 located in TMEM176A, also shows risk effects in the exome data (p = 2.8 × 10 -5 ; q-value = 0.073). PPIs among our top gene-based association results (p schizophrenia risk, whose effects may be modulated by genes involved in synaptic plasticity and neurocognitive performance. © 2017 Wiley Periodicals, Inc.

  7. Performative family: homosexuality, marriage and intergenerational dynamics in China.

    Science.gov (United States)

    Choi, Susanne Yp; Luo, Ming

    2016-06-01

    Using in-depth interview data on nominal marriages - legal marriages between a gay man and a lesbian to give the appearance of heterosexuality - this paper develops the concept of performative family to explain the processes through which parents and their adult children negotiate and resolve disagreements in relation to marriage decisions in post-socialist China. We identify three mechanisms - network pressure, a revised discourse of filial piety and resource leverage - through which parents influence their gay offspring's decision to turn to nominal marriage. We also delineate six strategies, namely minimizing network participation, changing expectations, making partial concessions, drawing the line, delaying decisions and ending the marriage, by which gay people in nominal marriages attempt to meet parental expectations while simultaneously retaining a degree of autonomy. Through these interactions, we argue that Chinese parents and their gay adult children implicitly and explicitly collaborate to perform family, emphasizing the importance of formally meeting society's expectations about marriage rather than substantively yielding to its demands. We also argue that the performative family is a pragmatic response to the tension between the persistent centrality of family and marriage and the rising tide of individualism in post-socialist China. We believe that our findings highlight the specific predicament of homosexual people. They also shed light on the more general dynamics of intergenerational negotiation because there is evidence that the mechanisms used by parents to exert influence may well be similar between gay and non-gay people. © London School of Economics and Political Science 2016.

  8. Diagnostic Yield of Sequencing Familial Hypercholesterolemia Genes in Severe Hypercholesterolemia

    Science.gov (United States)

    Khera, Amit V.; Won, Hong-Hee; Peloso, Gina M.; Lawson, Kim S.; Bartz, Traci M.; Deng, Xuan; van Leeuwen, Elisabeth M.; Natarajan, Pradeep; Emdin, Connor A.; Bick, Alexander G.; Morrison, Alanna C.; Brody, Jennifer A.; Gupta, Namrata; Nomura, Akihiro; Kessler, Thorsten; Duga, Stefano; Bis, Joshua C.; van Duijn, Cornelia M.; Cupples, L. Adrienne; Psaty, Bruce; Rader, Daniel J.; Danesh, John; Schunkert, Heribert; McPherson, Ruth; Farrall, Martin; Watkins, Hugh; Lander, Eric; Wilson, James G.; Correa, Adolfo; Boerwinkle, Eric; Merlini, Piera Angelica; Ardissino, Diego; Saleheen, Danish; Gabriel, Stacey; Kathiresan, Sekar

    2017-01-01

    Background About 7% of US adults have severe hypercholesterolemia (untreated LDL cholesterol ≥190 mg/dl). Such high LDL levels may be due to familial hypercholesterolemia (FH), a condition caused by a single mutation in any of three genes. Lifelong elevations in LDL cholesterol in FH mutation carriers may confer CAD risk beyond that captured by a single LDL cholesterol measurement. Objectives Assess the prevalence of a FH mutation among those with severe hypercholesterolemia and determine whether CAD risk varies according to mutation status beyond the observed LDL cholesterol. Methods Three genes causative for FH (LDLR, APOB, PCSK9) were sequenced in 26,025 participants from 7 case-control studies (5,540 CAD cases, 8,577 CAD-free controls) and 5 prospective cohort studies (11,908 participants). FH mutations included loss-of-function variants in LDLR, missense mutations in LDLR predicted to be damaging, and variants linked to FH in ClinVar, a clinical genetics database. Results Among 8,577 CAD-free control participants, 430 had LDL cholesterol ≥190 mg/dl; of these, only eight (1.9%) carried a FH mutation. Similarly, among 11,908 participants from 5 prospective cohorts, 956 had LDL cholesterol ≥190 mg/dl and of these, only 16 (1.7%) carried a FH mutation. Within any stratum of observed LDL cholesterol, risk of CAD was higher among FH mutation carriers when compared with non-carriers. When compared to a reference group with LDL cholesterol <130 mg/dl and no mutation, participants with LDL cholesterol ≥190 mg/dl and no FH mutation had six-fold higher risk for CAD (OR 6.0; 95%CI 5.2–6.9) whereas those with LDL cholesterol ≥190 mg/dl as well as a FH mutation demonstrated twenty-two fold increased risk (OR 22.3; 95%CI 10.7–53.2). Conclusions Among individuals with LDL cholesterol ≥190 mg/dl, gene sequencing identified a FH mutation in <2%. However, for any given observed LDL cholesterol, FH mutation carriers are at substantially increased risk for CAD

  9. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  10. A family-based test for correlation between gene expression and trait values.

    Science.gov (United States)

    Kraft, Peter; Schadt, Eric; Aten, Jason; Horvath, Steve

    2003-05-01

    Advances in microarray technology have made it attractive to combine information on clinical traits, marker genotypes, and comprehensive gene expression from family studies to dissect complex disease genetics. Without accounting for family structure, methods that test for association between a trait and gene-expression levels can be misleading. We demonstrate that the standard unstratified test based on Pearson's correlation coefficient can produce spurious results when applied to family data, and we present a stratified family expression association test (FEXAT). We illustrate the utility of the FEXAT via simulation and an application to gene-expression data from lymphoblastoid cell lines from four CEPH families. The FEXAT has a smaller estimated false-discovery rate than the standard test when within-family correlations are of interest, and it detects biologically plausible correlations between beta catenin and genes in the WNT-activation pathway in humans that the standard test does not.

  11. Genetic analysis of Chinese families reveals a novel truncation allele of the retinitis pigmentosa GTPase regulator gene

    Directory of Open Access Journals (Sweden)

    Fang Hu

    2014-10-01

    Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.

  12. Cyclic nucleotide gated channel gene family in tomato: genome-wide identification and functional analyses in disease resistance

    Directory of Open Access Journals (Sweden)

    Mumtaz Ali Saand

    2015-05-01

    Full Text Available The cyclic nucleotide gated channel (CNGC is suggested to be one of the important calcium conducting channels. Nevertheless, genome-wide identification and systemic functional analysis of CNGC gene family in crop plant species have not yet been conducted. In this study, we performed genome-wide identification of CNGC gene family in the economically important crop tomato (Solanum lycopersicum L. and analyzed function of the group IVb SlCNGC genes in disease resistance. Eighteen CNGC genes were identified in tomato genome, and four CNGC loci that were misannotated at database were corrected by cloning and sequencing. Detailed bioinformatics analyses on gene structure, domain composition and phylogenetic relationship of the SlCNGC gene family were conducted and the group-specific feature was revealed. Comprehensive expression analyses demonstrated that SlCNGC genes were highly and widely responsive to diverse stimuli and the expression profile was gene-dependent. Pharmacological assays showed that the putative CNGC activators cGMP and cAMP enhanced resistance against Sclerotinia sclerotiorum. Silencing of group IVb SlCNGC genes significantly enhanced resistance to fungal pathogens Pythium aphanidermatum and S. sclerotiorum, strongly reduced resistance to viral pathogen Tobacco rattle virus, while attenuated PAMP- and DAMP-triggered immunity as shown by obvious decrease of the flg22- and AtPep1-elicited hydrogen peroxide accumulation in SlCNGC-silenced plants. Additionally, silencing of these SlCNGC genes significantly altered expression of a set of Ca2+ signaling genes including SlCaMs, SlCDPKs and SlCAMTA3. Collectively, our results reveal that group IV SlCNGC genes regulate a wide range of resistance in tomato probably by affecting Ca2+ signaling.

  13. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  14. Expression of the Circadian Clock Genes Pert, Per2 in Sporadic, Familial Breast Tumors

    Directory of Open Access Journals (Sweden)

    Sherry L. Winter

    2007-10-01

    Full Text Available There is a growing body of evidence implicating aberrant circadian clock expression in the development of cancer. Based on our initial experiments identifying a putative interaction between BRCA1, the clock proteins Per1, Per2, as well as the reported involvement of the circadian clock in the development of cancer, we have performed an expression analysis of the circadian clock genes Per1, Per2 in both sporadic, familial primary breast tumors, normal breast tissues using real-time polymerase chain reaction. Significantly decreased levels of Per1 were observed between sporadic tumors, normal samples (P < .00001, as well as a further significant decrease between familial, sporadic breast tumors for both Per1 (P < .00001, Per2 (P < .00001. Decreased Per1 was also associated with estrogen receptor negativity (53% vs 15%, P = .04. These results suggest a role for both Perl, Per2 in normal breast function, show for the first time that deregulation of the circadian clock may be an important factor in the development of familial breast cancer. Aberrant expression of circadian clock genes could have important consequences on the transactivation of downstream targets that control the cell cycle, on the ability of cells to undergo apoptosis, potentially promoting carcinogenesis.

  15. The Cryptococcus neoformans Catalase Gene Family and Its Role in Antioxidant Defense

    OpenAIRE

    Giles, Steven S.; Stajich, Jason E.; Nichols, Connie; Gerrald, Quincy D.; Alspaugh, J. Andrew; Dietrich, Fred; Perfect, John R.

    2006-01-01

    In the present study, we sought to elucidate the contribution of the Cryptococcus neoformans catalase gene family to antioxidant defense. We employed bioinformatics techniques to identify four members of the C. neoformans catalase gene family and created mutants lacking single or multiple catalase genes. Based on a phylogenetic analysis, CAT1 and CAT3 encode putative spore-specific catalases, CAT2 encodes a putative peroxisomal catalase, and CAT4 encodes a putative cytosolic catalase. Only Ca...

  16. Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families.

    Science.gov (United States)

    Voloshanenko, Oksana; Gmach, Philipp; Winter, Jan; Kranz, Dominique; Boutros, Michael

    2017-11-01

    Signaling pathway modules are often encoded by several closely related paralogous genes that can have redundant roles and are therefore difficult to analyze by loss-of-function analysis. A typical example is the Wnt signaling pathway, which in mammals is mediated by 19 Wnt ligands that can bind to 10 Frizzled (FZD) receptors. Although significant progress in understanding Wnt-FZD receptor interactions has been made in recent years, tools to generate systematic interaction maps have been largely lacking. Here we generated cell lines with multiplex mutant alleles of FZD1 , FZD2 , and FZD7 and demonstrate that these cells are unresponsive to canonical Wnt ligands. Subsequently, we performed genetic rescue experiments with combinations of FZDs and canonical Wnts to create a functional ligand-receptor interaction map. These experiments showed that whereas several Wnt ligands, such as Wnt3a, induce signaling through a broad spectrum of FZD receptors, others, such as Wnt8a, act through a restricted set of FZD genes. Together, our results map functional interactions of FZDs and 10 Wnt ligands and demonstrate how multiplex targeting by clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 can be used to systematically elucidate the functions of multigene families.-Voloshanenko, O., Gmach, P., Winter, J., Kranz, D., Boutros, M. Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families. © The Author(s).

  17. Patterns of positive selection of the myogenic regulatory factor gene family in vertebrates.

    Science.gov (United States)

    Zhao, Xiao; Yu, Qi; Huang, Ling; Liu, Qing-Xin

    2014-01-01

    The functional divergence of transcriptional factors is critical in the evolution of transcriptional regulation. However, the mechanism of functional divergence among these factors remains unclear. Here, we performed an evolutionary analysis for positive selection in members of the myogenic regulatory factor (MRF) gene family of vertebrates. We selected 153 complete vertebrate MRF nucleotide sequences from our analyses, which revealed substantial evidence of positive selection. Here, we show that sites under positive selection were more frequently detected and identified from the genes encoding the myogenic differentiation factors (MyoG and Myf6) than the genes encoding myogenic determination factors (Myf5 and MyoD). Additionally, the functional divergence within the myogenic determination factors or differentiation factors was also under positive selection pressure. The positive selection sites were more frequently detected from MyoG and MyoD than Myf6 and Myf5, respectively. Amino acid residues under positive selection were identified mainly in their transcription activation domains and on the surface of protein three-dimensional structures. These data suggest that the functional gain and divergence of myogenic regulatory factors were driven by distinct positive selection of their transcription activation domains, whereas the function of the DNA binding domains was conserved in evolution. Our study evaluated the mechanism of functional divergence of the transcriptional regulation factors within a family, whereby the functions of their transcription activation domains diverged under positive selection during evolution.

  18. Analytical Performance of Multiplexed Screening Test for 10 Antibiotic Resistance Genes from Perianal Swab Samples.

    Science.gov (United States)

    Walker, G Terrance; Rockweiler, Tony J; Kersey, Rossio K; Frye, Kelly L; Mitchner, Susan R; Toal, Douglas R; Quan, Julia

    2016-02-01

    Multiantibiotic-resistant bacteria pose a threat to patients and place an economic burden on health care systems. Carbapenem-resistant bacilli and extended-spectrum β-lactamase (ESBL) producers drive the need to screen infected and colonized patients for patient management and infection control. We describe a multiplex microfluidic PCR test for perianal swab samples (Acuitas(®) MDRO Gene Test, OpGen) that detects the vancomycin-resistance gene vanA plus hundreds of gene subtypes from the carbapenemase and ESBL families Klebsiella pneumoniae carbapenemase (KPC), New Delhi metallo-β-lactamase (NDM), Verona integron-mediated metallo-β-lactamase (VIM), imipenemase metallo-β-lactamase (IMP), OXA-23, OXA-48, OXA-51, CTX-M-1, and CTX-M-2, regardless of the bacterial species harboring the antibiotic resistance. Analytical test sensitivity per perianal swab is 11-250 CFU of bacteria harboring the antibiotic resistance genes. Test throughput is 182 samples per test run (1820 antibiotic resistance gene family results). We demonstrate reproducible test performance and 100% gene specificity for 265 clinical bacterial organisms harboring a variety of antibiotic resistance genes. The Acuitas MDRO Gene Test is a sensitive, specific, and high-throughput test to screen colonized patients and diagnose infections for several antibiotic resistance genes directly from perianal swab samples, regardless of the bacterial species harboring the resistance genes. © 2015 American Association for Clinical Chemistry.

  19. FGF: a web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  20. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  1. Evolution of the RH gene family in vertebrates revealed by brown hagfish (Eptatretus atami) genome sequences.

    Science.gov (United States)

    Suzuki, Akinori; Komata, Hidero; Iwashita, Shogo; Seto, Shotaro; Ikeya, Hironobu; Tabata, Mitsutoshi; Kitano, Takashi

    2017-02-01

    In vertebrates, there are four major genes in the RH (Rhesus) gene family, RH, RHAG, RHBG, and RHCG. These genes are thought to have been formed by the two rounds of whole-genome duplication (2R-WGD) in the common ancestor of all vertebrates. In our previous work, where we analyzed details of the gene duplications process of this gene family, three nucleotide sequences belonging to this family were identified in Far Eastern brook lamprey (Lethenteron reissneri), and the phylogenetic positions of the genes were determined. Lampreys, along with hagfishes, are cyclostomata (jawless fishes), which is a sister group of gnathostomata (jawed vertebrates). Although those results suggested that one gene was orthologous to the gnathostome RHCG genes, we did not identify clear orthologues for other genes. In this study, therefore, we identified three novel cDNA sequences that belong to the RH gene family using de novo transcriptome analysis of another cyclostome: the brown hagfish (Eptatretus atami). We also determined the nucleotide sequences for the RHBG and RHCG genes in a red stingray (Dasyatis akajei), which belongs to the cartilaginous fishes. The phylogenetic tree showed that two brown hagfish genes, which were probably duplicated in the cyclostome lineage, formed a cluster with the gnathostome RHAG genes, whereas another brown hagfish gene formed a cluster with the gnathostome RHCG genes. We estimated that the RH genes had a higher evolutionary rate than the RHAG, RHBG, and RHCG genes. Interestingly, in the RHBG genes, only the bird lineage showed a higher rate of nonsynonymous substitutions. It is likely that this higher rate was caused by a state of relaxed functional constraints rather than positive selection nor by pseudogenization. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    Science.gov (United States)

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  3. Candidate gene resequencing to identify rare, pedigree-specific variants influencing healthy aging phenotypes in the long life family study

    DEFF Research Database (Denmark)

    Druley, Todd E; Wang, Lihua; Lin, Shiow J

    2016-01-01

    : We performed custom hybridization capture sequencing to identify the functional variants in 464 candidate genes for longevity or the major diseases of aging in 615 pedigrees (4,953 individuals) from the LLFS, using a multiplexed, custom hybridization capture. Variants were analyzed individually...... from six pedigrees. OBFC1 (chromosome 10) is involved in telomere maintenance, and falls within a linkage peak recently reported from an analysis of telomere length in LLFS families. Two different algorithms for single gene associations identified three genes with an enrichment of variation...

  4. Genome-wide identification of MAPKK and MAPKKK gene families in tomato and transcriptional profiling analysis during development and stress response.

    Directory of Open Access Journals (Sweden)

    Jian Wu

    Full Text Available Mitogen-activated protein kinase (MAPK cascades have important functions in plant growth, development, and response to various stresses. The MAPKK and MAPKKK gene families in tomato have never been systematically analyzed. In this study, we performed a genome-wide analysis of the MAPKK and MAPKKK gene families in tomato and identified 5 MAPKK genes and 89 MAPKKK genes. Phylogenetic analyses of the MAPKK and MAPKKK gene families showed that all the MAPKK genes formed four groups (groups A, B, C, and D, whereas all the MAPKKK genes were classified into three subfamilies, namely, MEKK, RAF, and ZIK. Evolutionary analysis showed that whole genome or chromosomal segment duplications were the main factors responsible for the expansion of the MAPKK and MAPKKK gene families in tomato. Quantitative real-time RT-PCR analysis showed that the majority of MAPKK and MAPKKK genes were expressed in all tested organs with considerable differences in transcript levels indicating that they might be constitutively expressed. However, the expression level of most of these genes changed significantly under heat, cold, drought, salt, and Pseudomonas syringae treatment. Furthermore, their expression levels exhibited significant changes in response to salicylic acid and indole-3-acetic acid treatment, implying that these genes might have important roles in the plant hormone network. Our comparative analysis of the MAPKK and MAPKKK families would improve our understanding of the evolution and functional characterization of MAPK cascades in tomato.

  5. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice.

    Science.gov (United States)

    Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M; Bansal, Kailash C

    2015-01-01

    MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by "top-down" and "guide-gene" approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via "top-down" approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by "guide-gene" approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought response in rice

  6. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    Directory of Open Access Journals (Sweden)

    Shuchi eSmita

    2015-12-01

    Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  7. Clinical genetics and gene mapping studies on a family in the area of northeast with hereditary cataract

    Directory of Open Access Journals (Sweden)

    Tian-Xiao Zhang

    2013-06-01

    Full Text Available AIM: To map the causal gene of congenital nuclear cataract in a family in the area of northeast.METHODS: We investigated there generations of a Chinese family affected with hereditary cataract. Peripheral blood samples were collected from all of the family members, and genomic DNA was then extracted from the blood samples. Linkage analysis was performed using 62microsatellite markers. Two-point LOD scores(Zwere calculated using the LINKAGE programs(ver. 5.2. Haplotypes were constructed according to the allele information.RESULTS: The affected members in this family showed classic phenotype of autosomal dominant congenital cataract. The maximum two-point LOD score of 2.71 was obtained for marker D22S689(θ = 0. Haplotype analysis traced the disease gene on chromosome 22q11.2-12.1, containing CRYBB1, CRYBB2, CRYBB3, CRYBA4 genes. CONCLUSION: The occurrence of congenital nuclear cataract consistents with the autosomal dominant inherited regular, and the causal gene of congenital nuclear cataract localize at 22q11.2-12.1 in this family.

  8. Molecular cloning and characterization of the family of feline leucine-rich glioma-inactivated (LGI) genes, and mutational analysis in familial spontaneous epileptic cats.

    Science.gov (United States)

    Yu, Yoshihiko; Hasegawa, Daisuke; Fujiwara-Igarashi, Aki; Hamamoto, Yuji; Mizoguchi, Shunta; Kuwabara, Takayuki; Fujita, Michio

    2017-12-13

    Leucine-rich glioma-inactivated (LGI) proteins play a critical role in synaptic transmission. Dysfunction of these genes and encoded proteins is associated with neurological disorders such as genetic epilepsy or autoimmune limbic encephalitis in animals and human. Familial spontaneous epileptic cats (FSECs) are the only feline strain and animal model of familial temporal lobe epilepsy. The seizure semiology of FSECs comprises recurrent limbic seizures with or without evolution into generalized epileptic seizures, while cats with antibodies against voltage-gated potassium channel complexed/LGI1 show limbic encephalitis and recurrent limbic seizures. However, it remains unclear whether the genetics underlying FSECs are associated with LGI family genes. In the present study, we cloned and characterized the feline LGI1-4 genes and examined their association with FSECs. Conventional PCR techniques were performed for cloning and mutational analysis. Characterization was predicted using bioinformatics software. The cDNAs of feline LGI1-4 contained 1674-bp, 1650-bp, 1647-bp, and 1617-bp open reading frames, respectively, and encoded proteins comprising 557, 549, 548, and 538 amino acid residues, respectively. The feline LGI1-4 putative protein sequences showed high homology with Homo sapiens, Canis familiaris, Bos taurus, Sus scrofa, and Equus caballus (92%-100%). Mutational analysis in 8 FSECs and 8 controls for LGI family genes revealed 3 non-synonymous and 14 synonymous single nucleotide polymorphisms in the coding region. Only one non-synonymous single nucleotide polymorphism in LGI4 was found in 3 out of 8 FSECs. Using three separate computational tools, this mutation was not predicted to be disease causing. No co-segregation of the disease was found with any variant. We cloned the cDNAs of the four feline LGI genes, analyzed the amino acid sequences, and revealed that epilepsy in FSEC is not a monogenic disorder associated with LGI genes.

  9. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... this study, a total of 52 TCP genes were identified in apple (Malus domestica) genome. Bioinformatic methods were employed to predicate and analyse their relevant gene classification, gene structure, chromosome location, sequence alignment and con- served domains of MdTCP proteins. Expression ...

  10. Genomic organization of a cellulase gene family in Phanerochaete chrysosporium

    Science.gov (United States)

    Sarah F. Covert; Jennifer Bolduc; Daniel Cullen

    1992-01-01

    Southern blot and nucleotide sequence analysis of Phanerochaete chrysosporium BKM-F-1767 genomic clones indicate that this wood-degrading fungus contains at least six genes with significant homology to the Trichoderma reesei cellobiohydrolase I gene (cbh1). Using pulsed-field gel electrophoresis to separate P. chrysosporium chromosomes, the six cellulase genes were...

  11. (TG/CAn repeats in human gene families: abundance and selective patterns of distribution according to function and gene length

    Directory of Open Access Journals (Sweden)

    Ramachandran Srinivasan

    2005-06-01

    Full Text Available Abstract Background Creation of human gene families was facilitated significantly by gene duplication and diversification. The (TG/CAn repeats exhibit length variability, display genome-wide distribution, and are abundant in the human genome. Accumulation of evidences for their multiple functional roles including regulation of transcription and stimulation of recombination and splicing elect them as functional elements. Here, we report analysis of the distribution of (TG/CAn repeats in human gene families. Results The 1,317 human gene families were classified into six functional classes. Distribution of (TG/CAn repeats were analyzed both from a global perspective and from a stratified perspective based on their biological properties. The number of genes with repeats decreased with increasing repeat length and several genes (53% had repeats of multiple types in various combinations. Repeats were positively associated with the class of Signaling and communication whereas, they were negatively associated with the classes of Immune and related functions and of Information. The proportion of genes with (TG/CAn repeats in each class was proportional to the corresponding average gene length. The repeat distribution pattern in large gene families generally mirrored the global distribution pattern but differed particularly for Collagen gene family, which was rich in repeats. The position and flanking sequences of the repeats of Collagen genes showed high conservation in the Chimpanzee genome. However the majority of these repeats displayed length polymorphism. Conclusion Positive association of repeats with genes of Signaling and communication points to their role in modulation of transcription. Negative association of repeats in genes of Information relates to the smaller gene length, higher expression and fundamental role in cellular physiology. In genes of Immune and related functions negative association of repeats perhaps relates to the smaller gene

  12. Genome-wide analysis and expression profiling of the GRF gene family in oilseed rape (Brassica napus L.).

    Science.gov (United States)

    Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na

    2017-07-15

    Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.

  13. [Cloning and analysis of three genes encoding type II CHH family neuropeptides from Fennropenaeus chinensis].

    Science.gov (United States)

    Wang, Zai-Zhao; Xiang, Jian-Hai

    2003-10-01

    On the basis of sequence similarity, the crustean hyperglycemic hormone (CHH) family peptides have been classified into two types of hormones: type I and type II. Molt-inhibiting hormone (MIH) is a neuropeptide member of type II CHH family. Molting in shrimp is controlled by MIH and ecdysone. By inhibiting the synthesis of ecdysone in the Y-organ, MIH indirectly suppresses the molting activity of shrimp. In this study, we reported the cloning and characterization of 3 gene fragments encoding type II CHH family neuropeptides of the shrimp Fennropenaeus chinensis. According to the complementary DNA sequence of the mult-inhibiting hormone of Fennropenaeus chinensis, 3 primers were designed and synthesized. MP1 and MP2 are sense primers, and MP3 is anti-sense primer. Polymerase chain reaction was performed using genomic DNA of Fennropenaeus chinensis as template. Three PCR products were obtained using primers MP1 and MP3. Their sizes are about 600 bp, 850 bp, 1050 bp, respectively. A 580 bp PCR product was obtained using primers MP2 and MP3. All the 4 PCR products were cloned into pMD18-T vector. The recombinant clones were sequenced using ABI 310 Genetic Analyzer. After sequencing, all the DNA sequences were searched in the GenBank by Blast program to find similar gene sequences. The searching results revealed 3 DNA fragment sequences were of high similarity with CHH family neuropeptide genes from various crustean species. The 3 DNA fragments were named as NP1, NP2, and NP3. Their sizes were 540 bp, 601 bp, and 826 bp, respectively. Using the mRNA sequences with the most similarity to the 3 sequence fragments as reference, the gene structure of the 3 DNA fragment sequences was analyzed. The exons of 3 sequence fragments were aligned with their similar sequences by Clustal W program. Both NP1 and NP2 consisted of 1 intron and 2 exons. NP3 consisted of 2 introns and 3 exons. Sequence analysis suggested that these 3 products belonged to sequence fragments of neuropeptide

  14. Integrated pipeline for inferring the evolutionary history of a gene family embedded in the species tree: a case study on the STIMATE gene family.

    Science.gov (United States)

    Song, Jia; Zheng, Sisi; Nguyen, Nhung; Wang, Youjun; Zhou, Yubin; Lin, Kui

    2017-10-03

    Because phylogenetic inference is an important basis for answering many evolutionary problems, a large number of algorithms have been developed. Some of these algorithms have been improved by integrating gene evolution models with the expectation of accommodating the hierarchy of evolutionary processes. To the best of our knowledge, however, there still is no single unifying model or algorithm that can take all evolutionary processes into account through a stepwise or simultaneous method. On the basis of three existing phylogenetic inference algorithms, we built an integrated pipeline for inferring the evolutionary history of a given gene family; this pipeline can model gene sequence evolution, gene duplication-loss, gene transfer and multispecies coalescent processes. As a case study, we applied this pipeline to the STIMATE (TMEM110) gene family, which has recently been reported to play an important role in store-operated Ca 2+ entry (SOCE) mediated by ORAI and STIM proteins. We inferred their phylogenetic trees in 69 sequenced chordate genomes. By integrating three tree reconstruction algorithms with diverse evolutionary models, a pipeline for inferring the evolutionary history of a gene family was developed, and its application was demonstrated.

  15. Detection of filaggrin gene mutation (2282del4) in Pakistani ichthyosis vulgaris families

    International Nuclear Information System (INIS)

    Naz, N.; Samdani, A.J.

    2011-01-01

    he aim of this study was to detect an 811 bp filaggrin (FLG) gene fragment known to carry a mutation 2282del4 which causes ichthyosis vulgaris. Seven clinically examined ichthyosis vulgaris families were included in this study. An 811 bp FLG gene fragment was targeted in the genomic DNA of all the members of the seven families by PCR amplification using known primers RPT1P7 and RPT2P1. Successful amplification of an 811 bp FLG gene fragment in all the families suggested the possible role of the 2282del4 mutation in causing ichthyosis vulgaris in Pakistani population. (author)

  16. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  17. Collagen gene interactions and endurance running performance

    African Journals Online (AJOL)

    (STROBE) statement: Guidelines for reporting observational studies. PLoS Med 2007;4(10):e296. [http://dx.doi.org/10.1371/journal.pmed.0040296]. 18. Mokone GG, Schwellnus MP, Noakes TD, Collins M. The COL5A1 gene and Achilles tendon pathology. Scand J Med Sci Sports 2006;16(1):19-26. 19. Posthumus M ...

  18. Mutation analyses and prenatal diagnosis in families of X-linked severe combined immunodeficiency caused by IL2Rγ gene novel mutation.

    Science.gov (United States)

    Bai, Q L; Liu, N; Kong, X D; Xu, X J; Zhao, Z H

    2015-06-11

    We investigated the feasibility of interleukin-2 receptor gamma (IL2Rγ) gene based on gene mutation analysis and pre-natal diagnosis of X-linked severe combined immunodeficiency (X-SCID). Blood samples of patients and their parents of X-SCID (family 1) and X-SCID (family 2) were collected. IL2Rγ gene sequences of the 2 families were analyzed using bi-directional direct sequencing by polymerase chain reaction. DNA sequence changes in the IL2Rγ gene exon region and shear zone were also analyzed. We also sequenced the IL2Rγ gene in 100 healthy individuals. Prenatal genetic diagnoses for a high-risk fetus in family 1 were performed by chorionic villus sampling after determining each family's genotypes. The suspect fe-male in family 1 underwent carrier detection. Two novel mutations of IL2Rγ gene were identified, including c.361-363delGAG (p.E121del) in the patient and his mother in family 1, and c.510-511insGAACT (p.W173X) heterozygous mutation in the proband's mother in family 2. These mutations were absent in the 100 controls. Prenatal diagnosis of early pregnancy in the female fetus of family 1 was performed; the fetus was heterozygous, which was confirmed at postnatal follow-up. The suspect female in family 1 showed no mutation in carrier detection. The novel p.E121del and p.W173X mutations in IL2Rγ may have been the primary causes of disease in 2 families with X-SCID. In couples with an X-SCID reproductive history, prenatal gene mutation analysis of IL2Rγ can effectively prevent the birth of children with X-SCID and carrier detection for suspected females.

  19. a photoreceptor gene mutation in an indigenous black african family ...

    African Journals Online (AJOL)

    mutations known to create or destroy a DdeI or MspI restriction enzyme site, respectively. Of the patients studied, 45 were from ADRP families and 19 were classified as simplex cases. Of these southern African families with a history of RD,. 14 were of ethnic black African origin, 5 of Asian origin and 26 of mixed ancestry ...

  20. Mini review roles of the bZIP gene family in rice.

    Science.gov (United States)

    E, Z G; Zhang, Y P; Zhou, J H; Wang, L

    2014-04-16

    The basic leucine zipper (bZIP) genes encode transcription factors involved in the regulation of various biological processes. Similar to WRKY, basic helix-loop-helix, and several other groups of proteins, the bZIP proteins form a superfamily of transcription factors that mediate plant stress responses. In this review, we present the roles of bZIP proteins in multiple biological processes that include pathogen defense; responses to abiotic stresses; seed development and germination; senescence; and responses to salicylic, jasmonic, and abscisic acids in rice. We also examined the characteristics of the bZIP proteins and their genetic composition. To ascertain the evolutionary changes in and functions of this supergene family, we performed an exhaustive comparison among the 89 rice bZIP genes that were previously described and those more recently listed in the MSU Rice Genome Annotation Project Database using a Hidden Markov Model. We excluded 3 genes from the list, resulting in a total of 86 bZIP genes in japonica rice.

  1. CRDB: database of chemosensory receptor gene families in vertebrate.

    Directory of Open Access Journals (Sweden)

    Dong Dong

    Full Text Available Chemosensory receptors (CR are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of 'birth-and-death' evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates.

  2. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  3. Mutations in BRCA1 and BRCA2 in breast cancer families: Are there more breast cancer-susceptibility genes?

    Energy Technology Data Exchange (ETDEWEB)

    Serova, O.M.; Mazoyer, S.; Putet, N. [CNRS, Lyon (France)] [and others

    1997-03-01

    To estimate the proportion of breast cancer families due to BRCA1 or BRCA2, we performed mutation screening of the entire coding regions of both genes supplemented with linkage analysis of 31 families, 8 containing male breast cancers and 23 site-specific female breast cancer. A combination of protein-truncation test and SSCP or heteroduplex analyses was used for mutation screening complemented, where possible, by the analysis of expression level of BRCA1 and BRCA2 alleles. Six of the eight families with male breast cancer revealed frameshift mutations, two in BRCA1 and four in BRCA2. Although most families with female site-specific breast cancers were thought to be due to mutations in either BRCA1 or BRCA2, we identified only eight mutations in our series of 23 site-specific female breast cancer families (34%), four in BRCA1 and four in BRCA2. According to the posterior probabilities calculated for mutation-negative families, based on linkage data and mutation screening results, we would expect 8-10 site-specific female breast cancer families of our series to be due to neither BRCA1 nor BRCA2. Thus, our results suggest the existence of at least one more major breast cancer-susceptibility gene. 24 refs., 1 fig., 3 tabs.

  4. Genome-wide analysis and expression profiling under heat and drought treatments of HSP70 gene family in soybean (Glycine max L.).

    Science.gov (United States)

    Zhang, Ling; Zhao, Hong-Kun; Dong, Qian-Li; Zhang, Yuan-Yu; Wang, Yu-Min; Li, Hai-Yun; Xing, Guo-Jie; Li, Qi-Yun; Dong, Ying-Shan

    2015-01-01

    Heat shock proteins (HSPs) perform a fundamental role in protecting plants against abiotic stresses. Previous studies have made great efforts in the functional analysis of individual family members, but there has not yet been an overall analysis or expression profiling of the HSP70 gene family in soybeans (Glycine max L.). In this study, an investigation of the soybean genome revealed 61 putative HSP70 genes, which were evaluated. These genes were classified into eight sub-families, denoted I-VIII, based on a phylogenetic analysis. In each sub-family, the constituent parts of the gene structure and motif were relatively conserved. These GmHSP70 genes were distributed unequally on 17 of the 20 chromosomes. The analysis of the expression profiles showed that 53 of the 61 GmHSP70 genes were differentially expressed across the 14 tissues. However, most of the GmHSP70s were differentially expressed in a tissue-specific expression pattern. Furthermore, the expression of some of the duplicate genes was partially redundant, while others showed functional diversity. The quantitative real-time PCR (qRT-PCR) analysis of the 61 soybean HSP70 genes confirmed their stress-inducible expression patterns under both drought and heat stress. These findings provide a thorough overview of the evolution and modification of the GmHSP70 gene family, which will help to determine the functional characteristics of the HSP70 genes in soybean growth and development.

  5. Genome-Wide Identification and Expression Profile of Dof Transcription Factor Gene Family in Pepper (Capsicum annuum L.).

    Science.gov (United States)

    Wu, Zhiming; Cheng, Jiaowen; Cui, Junjie; Xu, Xiaowan; Liang, Guansheng; Luo, Xirong; Chen, Xiaocui; Tang, Xiangqun; Hu, Kailin; Qin, Cheng

    2016-01-01

    Dof (DNA-binding One Zinc Finger) transcription factor family is unique to plants and has diverse roles associated with plant-specific phenomena, such as light, phytohormone and defense responses as well as seed development and germination. Although, genome-wide analysis of this family has been performed in many species, information regarding Dof genes in the pepper, Capsicum annuum L., is extremely limited. In this study, exhaustive searches of pepper genome revealed 33 potential CaDofs that were phylogenetically clustered into four subgroups. Twenty-nine of the 33 Dof genes could be mapped on 11 chromosomes, except for chromosome 7. The intron/exon organizations and conserved motif compositions of these genes were also analyzed. Additionally, phylogenetic analysis and classification of the Dof transcription factor family in eight plant species revealed that S. lycopersicum and C. annuum as well as O. sativa and S. bicolor Dof proteins may have evolved conservatively. Moreover, comprehensive expression analysis of CaDofs using a RNA-seq atlas and quantitative real-time polymerase chain reaction (qRT-PCR) revealed that these genes exhibit a variety of expression patterns. Most of the CaDofs were expressed in at least one of the tissues tested, whereas several genes were identified as being highly responsive to heat and salt stresses. Overall, this study describes the first genome-wide analysis of the pepper Dof family, whose genes exhibited different expression patterns in all primary fruit developmental stages and tissue types, as in response to abiotic stress. In particular, some Dof genes might be used as biomarkers for heat and salt stress. The results could expand our understanding of the roles of Dof genes in pepper.

  6. Phylogenetic analysis reveals dynamic evolution of the poly(A)-binding protein gene family in plants.

    Science.gov (United States)

    Gallie, Daniel R; Liu, Renyi

    2014-11-25

    The poly(A)-binding protein (PABP) binds the poly(A) tail of eukaryotic mRNAs and functions to maintain the integrity of the mRNA while promoting protein synthesis through its interaction with eukaryotic translation initiation factor (eIF) 4G and eIF4B. PABP is encoded by a single gene in yeast and marine algae but during plant evolution the PABP gene family expanded substantially, underwent sequence divergence into three subclasses, and acquired tissue-specificity in gene family member expression. Although such changes suggest functional specialization, the size of the family and its sequence divergence have complicated an understanding of which gene family members may be foundational and which may represent more recent expansions of the family to meet the specific needs of speciation. Here, we examine the evolution of the plant PABP gene family to provide insight into these aspects of the family that may yield clues into the function of individual family members. The PABP gene family had expanded to two members by the appearance of fresh water algae and four members in non-vascular plants. In lycophytes, the first sequence divergence yielding a specific class member occurs. The earliest members of the gene family share greatest similarity to those modern members whose expression is confined to reproductive tissues, suggesting that supporting reproductive-associated gene expression is the most conserved function of this family. A family member sharing similarity to modern vegetative-associated members first appears in gymnosperms. Further elaboration of the reproductive-associated and vegetative-associated members occurred during the evolution of flowering plants. Expansion of the plant PABP gene family began prior to the colonization of land. By the evolution of lycophytes, the first class member whose expression is confined to reproductive tissues in higher plants had appeared. A second class member whose expression is vegetative-associated appeared in

  7. A new germline TP53 gene mutation in a family with Li-Fraumeni syndrome.

    Science.gov (United States)

    Dockhorn-Dworniczak, B; Wolff, J; Poremba, C; Schäfer, K L; Ritter, J; Gullotta, F; Jürgens, H; Böcker, W

    1996-07-01

    This report describes an unusual clinical presentation of Li-Fraumeni syndrome. Family history revealed a mild aggregation of adult cancers in one generation, and an unusual clustering of brain tumours of early childhood in the following generation. In order to evaluate the genetic basis for cancer predisposition in this family, molecular genetic analysis for the occurrence of germline TP53 tumour suppressor gene mutations was performed on 12 siblings of two generations. Indirect mutation analysis was performed by the single-strand conformation polymorphism (SSCP) technique. Alterations were characterised by automated direct fluorescence sequencing analysis. Tumour material was also examined for p53 protein accumulation by immunohistochemistry. Initially, a TP53 gene germline missense mutation was detected in an 11-year-old kindred with acute myeloid leukaemia (AML) following intensive treatment of a brain tumour. In peripheral blood and bone marrow samples of this proband, a reduction to hemizygosity occurred. During AML treatment, detection of LOH of 17p was used as a marker for clonality and treatment control. The mutation was found to be inherited from the proband's mother, who was diagnosed with breast cancer at the age of 48 years. Further, three siblings were carriers, and two are apparently healthy at the age of 21 and 23 years. Knowledge of germline mutations may allow accurate DNA-based carrier diagnosis which is of important clinical significance for treatment strategy and control. Furthermore, the occurrence of unaffected carriers in this family raises questions about appropriate methods of cancer surveillance and counselling for these people.

  8. Molecular cloning and expression analysis of hyp-1 type PR-10 family genes in Hypericum perforatum

    Directory of Open Access Journals (Sweden)

    Katja eKarppinen

    2016-04-01

    Full Text Available Hypericum perforatum L. is an important medicinal plant for the treatment of depression. The plant contains bioactive hypericins that accumulate in dark glands present especially in reproductive parts of the plant. In this study, pathogenesis-related class 10 (PR-10 family genes were identified in H. perforatum, including three previously unidentified members with sequence homology to hyp-1, a phenolic coupling protein that has earlier been suggested to participate in hypericin biosynthesis and binding/transportation. The PR-10 genes showed constitutive but variable expression patterns in different H. perforatum tissues. They were all expressed at relatively high levels in leaves, variably in roots and low levels in stem and reproductive parts of the plant with no association with dark glands. The gene expression was up-regulated in leaves after salicylic acid, abscisic acid and wounding treatments but with variable levels. To study exact location of the gene expression, in situ hybridization of hyp-1 transcripts was performed and the accumulation of the Hyp-1 protein was examined in various tissues. The presence of Hyp-1 protein in H. perforatum tissues mostly paralleled with the mRNA levels. In situ RNA hybridization localized the hyp-1 transcripts predominantly in vascular tissues in root and stem, while in leaf the mRNA levels were high also in mesophyll cells in addition to vasculature. Our results indicate that the studied PR-10 genes are likely to contribute to the defence responses in H. perforatum. Furthermore, despite the location of the hyp-1 transcripts in vasculature, no support for the transportation of the Hyp-1 protein to dark glands was found in the current study. The present results together with earlier data question the role of the hyp-1 as a key gene responsible for the hypericin biosynthesis in dark glands of H. perforatum.

  9. Are Family Firms Better Performers during Financial Crisis?

    DEFF Research Database (Denmark)

    Zhou, Haoyong

    firms, by contrast, does not exhibit difference significantly. I interpret the attenuation of founder firms’ market value premium as the result of high volatility of stock prices and investors’ overreaction during the crisis (Veronesi, 1999; Glode et al., 2010). Further testing shows that in the crisis......, compared with non-family firms, founder firms have less administrative costs incurred. Moreover, they invest significantly less and have better access to credit market. All these findings contribute to superior accounting performance of founder firms during the crisis. My results suggest...

  10. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together...

  11. Prenatal genotyping of four common oculocutaneous albinism genes in 51 Chinese families.

    Science.gov (United States)

    Wei, Ai-Hua; Zang, Dong-Jie; Zhang, Zhao; Yang, Xiu-Min; Li, Wei

    2015-06-20

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder characterized by hypopigmentation in eyes, hair and skin, accompanied with vision loss. Currently, six genes have been identified as causative genes for non-syndromic OCA (OCA-1∼4, 6, 7), and ten genes for syndromic OCA (HPS-1-9, CHS-1). Genetic counseling of 51 Chinese OCA families (39 OCA-1 with mutations in the TYR gene, 6 OCA-2 with mutations in the OCA2 gene, 4 OCA-4 with mutations in the SLC45A2 gene, 1 HPS-1 (Hermansky-Pudlak syndrome-1) with mutation in the HPS1 gene, and 1 mixed OCA-1 and OCA-4) led us to perform the prenatal genetic testing of OCA using amniotic fluid cells through the implementation of our optimized strategy. In our cohort, eleven previously unidentified alleles (PUAs) (5 in TYR, 2 in OCA2, and 4 in SLC45A2) were found. Three missense PUAs (p.C112R, p.H363R and p.G379V of TYR) and one in-frame deletional PUA (p.S222del of SLC24A5) led to fetuses with OCA when co-inherited with other disease causative alleles. Three PUAs (p.P152H and p.W272X of TYR, p.A486T of SLC24A5) identified in the OCA probands did not co-transmit with known pathological alleles and thus gave rise to unaffected fetuses. Four PUAs (p.Q83X and p.A658T of TYR, p.G161R and p.G366R of SLC24A5) did not transmit to the unaffected fetuses. In addition, the in vitro transfection assays showed that the p.S192Y variant of TYR produced less pigment compared to the wild-type allele. A fetus with a digenic carrier of OCA-1 and OCA-4 was unaffected. In combination with functional assays, the family inheritance pattern is useful for the evaluation of pathogenicity of PUAs and genetic counseling of OCA. Copyright © 2015 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  12. Genetic analysis of the ADGF multigene family by homologous recombination and gene conversion in Drosophila.

    Science.gov (United States)

    Dolezal, Tomas; Gazi, Michal; Zurovec, Michal; Bryant, Peter J

    2003-10-01

    Many Drosophila genes exist as members of multigene families and within each family the members can be functionally redundant, making it difficult to identify them by classical mutagenesis techniques based on phenotypic screening. We have addressed this problem in a genetic analysis of a novel family of six adenosine deaminase-related growth factors (ADGFs). We used ends-in targeting to introduce mutations into five of the six ADGF genes, taking advantage of the fact that five of the family members are encoded by a three-gene cluster and a two-gene cluster. We used two targeting constructs to introduce loss-of-function mutations into all five genes, as well as to isolate different combinations of multiple mutations, independent of phenotypic consequences. The results show that (1) it is possible to use ends-in targeting to disrupt gene clusters; (2) gene conversion, which is usually considered a complication in gene targeting, can be used to help recover different mutant combinations in a single screening procedure; (3) the reduction of duplication to a single copy by induction of a double-strand break is better explained by the single-strand annealing mechanism than by simple crossing over between repeats; and (4) loss of function of the most abundantly expressed family member (ADGF-A) leads to disintegration of the fat body and the development of melanotic tumors in mutant larvae.

  13. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  14. Efficient RNAi-based gene family knockdown via set cover optimization.

    Science.gov (United States)

    Zhao, Wenzhong; Fanning, M Leigh; Lane, Terran

    2005-01-01

    We address the problem of selecting an efficient set of initiator molecules (siRNAs) for RNA interference (RNAi)-based gene family knockdown experiments. Our goal is to select a minimal set of siRNAs that (a) cover a targeted gene family or a specified subset of it, (b) do not cover any untargeted genes, and (c) are individually highly effective at inducing knockdown. We give two formalizations of the gene family knockdown problem. First, we show that the problem, minimizing the number of siRNAs required to knock down a family of genes, is NP-Hard via a reduction to the set cover problem. Second, we generalize the basic problem to incorporate additional biological constraints and optimality criteria. To solve the resulting set-cover variants, we modify the classical branch-and-bound algorithm to include some of these biological criteria. We find that in many typical cases these constraints reduce the search space enough that we are able to compute exact minimal siRNA covers within reasonable time. For larger cases, we propose a probabilistic greedy algorithm for finding minimal siRNA covers efficiently. We apply our methods to two different gene families, the FREP genes from Biomphalaria glabrata and the olfactory genes from Caenorhabditis elegans. Our computational results on real biological data show that the probabilistic greedy algorithm produces siRNA covers as good as the branch-and-bound algorithm in most cases. Both algorithms return minimal siRNA covers with high predicted probability that the selected siRNAs will be effective at inducing knockdown. We also examine the role of "off-target" interactions: the constraint of avoiding covering untargeted genes can, in some cases, substantially increase the complexity of the resulting solution. Overall, we find that in many common cases our approach significantly reduces the number of siRNAs required in gene family knockdown experiments, as compared to knocking down genes independently.

  15. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  16. a photoreceptor gene mutation in an indigenous black african family

    African Journals Online (AJOL)

    Clearly, within the next decade effective gene therapy for some forms of RD in humans will be possible, bVt once again these will be mutation-specific, so it is essential to identify the retinal disease-causing genes in each and every southern. African RD patient. This research was supported by grants from the RP Foundation.

  17. Genomewide analysis of the chitinase gene family in Populus ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... class II chitinase genes, was induced by methyl jasmonate. (MeJA) rather than other treatments. POPTR_0012s01150.1 is a class III chitinase gene. It was sensitive to elicitor and wound inducements but insensitive to salicylid acid. (SA) and MeJA treatments. When Populus was infected by. M. brunnea, the ...

  18. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  19. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  20. Molecular Evolution and Expression Divergence of Aconitase (ACO Gene Family in Land Plants

    Directory of Open Access Journals (Sweden)

    Yi-ming Wang

    2016-12-01

    Full Text Available Aconitase (ACO is a key enzyme that catalyzes the isomerization of citrate to isocitrate in the tricarboxylic acid (TCA and glyoxylate cycles. The function of ACOs has been well studied in model plants, such as Arabidopsis. In contrast, the evolutionary patterns of the ACO family in land plants are poorly understood. In this study, we systematically examined the molecular evolution and expression divergence of the ACO gene family in 12 land plant species. Thirty-six ACO genes were identified from the 12 land plant species representing the four major land plant lineages: bryophytes, lycophytes, gymnosperms, and angiosperms. All of these ACOs belong to the cytosolic isoform. Three gene duplication events contributed to the expansion of the ACO family in angiosperms. The ancestor of angiosperms may have contained only one ACO gene. One gene duplication event split angiosperm ACOs into two distinct clades. Two clades showed a divergence in selective pressure and gene expression patterns. The cis-acting elements that function in light responsiveness were most abundant in the promoter region of the ACO genes, indicating that plant ACO genes might participate in light regulatory pathways. Our findings provide comprehensive insights into the ACO gene family in land plants.

  1. Duplication, divergence and persistence in the Phytochrome photoreceptor gene family of cottons (Gossypium spp.

    Directory of Open Access Journals (Sweden)

    Abdukarimov Abdusattor

    2010-06-01

    Full Text Available Abstract Background Phytochromes are a family of red/far-red photoreceptors that regulate a number of important developmental traits in cotton (Gossypium spp., including plant architecture, fiber development, and photoperiodic flowering. Little is known about the composition and evolution of the phytochrome gene family in diploid (G. herbaceum, G. raimondii or allotetraploid (G. hirsutum, G. barbadense cotton species. The objective of this study was to obtain a preliminary inventory and molecular-evolutionary characterization of the phytochrome gene family in cotton. Results We used comparative sequence resources to design low-degeneracy PCR primers that amplify genomic sequence tags (GSTs for members of the PHYA, PHYB/D, PHYC and PHYE gene sub-families from A- and D-genome diploid and AD-genome allotetraploid Gossypium species. We identified two paralogous PHYA genes (designated PHYA1 and PHYA2 in diploid cottons, the result of a Malvaceae-specific PHYA gene duplication that occurred approximately 14 million years ago (MYA, before the divergence of the A- and D-genome ancestors. We identified a single gene copy of PHYB, PHYC, and PHYE in diploid cottons. The allotetraploid genomes have largely retained the complete gene complements inherited from both of the diploid genome ancestors, with at least four PHYA genes and two genes encoding PHYB, PHYC and PHYE in the AD-genomes. We did not identify a PHYD gene in any cotton genomes examined. Conclusions Detailed sequence analysis suggests that phytochrome genes retained after duplication by segmental duplication and allopolyploidy appear to be evolving independently under a birth-and-death-process with strong purifying selection. Our study provides a preliminary phytochrome gene inventory that is necessary and sufficient for further characterization of the biological functions of each of the cotton phytochrome genes, and for the development of 'candidate gene' markers that are potentially useful for

  2. Genome-wide analysis of Aux/IAA and ARF gene families in Populus trichocarpa

    Energy Technology Data Exchange (ETDEWEB)

    Kalluri, Udaya C [ORNL; DiFazio, Stephen P [West Virginia University; Brunner, A. [Virginia Polytechnic Institute and State University (Virginia Tech); Tuskan, Gerald A [ORNL

    2007-01-01

    Auxin/Indole-3-Acetic Acid (Aux/IAA) and Auxin Response Factor (ARF) transcription factors are key regulators of auxin responses in plants. A total of 35 Aux/IAA and 39 ARF genes were identified in the Populus genome. Comparative phylogenetic analysis revealed that the subgroups PoptrARF2, 6, 9 and 16 and PoptrIAA3, 16, 27 and 29 have differentially expanded in Populus relative to Arabidopsis. Activator ARFs were found to be two fold-overrepresented in the Populus genome. PoptrIAA and PoptrARF gene families appear to have expanded due to high segmental and low tandem duplication events. Furthermore, expression studies showed that genes in the expanded PoptrIAA3 subgroup display differential expression. The gene-family analysis reported here will be useful in conducting future functional genomics studies to understand how the molecular roles of these large gene families translate into a diversity of biologically meaningful auxin effects.

  3. High Gene Family Turnover Rates and Gene Space Adaptation in the Compact Genome of the Carnivorous Plant Utricularia gibba.

    Science.gov (United States)

    Carretero-Paulet, Lorenzo; Librado, Pablo; Chang, Tien-Hao; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Rozas, Julio; Albert, Victor A

    2015-05-01

    Utricularia gibba is an aquatic carnivorous plant with highly specialized morphology, featuring fibrous floating networks of branches and leaf-like organs, no recognizable roots, and bladder traps that capture and digest prey. We recently described the compressed genome of U. gibba as sufficient to control the development and reproduction of a complex organism. We hypothesized intense deletion pressure as a mechanism whereby most noncoding DNA was deleted, despite evidence for three independent whole-genome duplications (WGDs). Here, we explore the impact of intense genome fractionation in the evolutionary dynamics of U. gibba's functional gene space. We analyze U. gibba gene family turnover by modeling gene gain/death rates under a maximum-likelihood statistical framework. In accord with our deletion pressure hypothesis, we show that the U. gibba gene death rate is significantly higher than those of four other eudicot species. Interestingly, the gene gain rate is also significantly higher, likely reflecting the occurrence of multiple WGDs and possibly also small-scale genome duplications. Gene ontology enrichment analyses of U. gibba-specific two-gene orthogroups, multigene orthogroups, and singletons highlight functions that may represent adaptations in an aquatic carnivorous plant. We further discuss two homeodomain transcription factor gene families (WOX and HDG/HDZIP-IV) showing conspicuous differential expansions and contractions in U. gibba. Our results 1) reconcile the compactness of the U. gibba genome with its accommodation of a typical number of genes for a plant genome, and 2) highlight the role of high gene family turnover in the evolutionary diversification of U. gibba's functional gene space and adaptations to its unique lifestyle and highly specialized body plan. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. The Echinococcus granulosus antigen B gene family comprises at least 10 unique genes in five subclasses which are differentially expressed.

    Science.gov (United States)

    Zhang, Wenbao; Li, Jun; Jones, Malcolm K; Zhang, Zhuangzhi; Zhao, Li; Blair, David; McManus, Donald Peter

    2010-08-10

    Antigen B (EgAgB) is a major protein produced by the metacestode cyst of Echinococcus granulosus, the causative agent of cystic hydatid disease. This protein has been shown to play an important role in modulating host immune responses, although its precise biological function still remains unknown. It is generally accepted that EgAgB is comprised of a gene family of five subfamilies which are highly polymorphic, but the actual number of genes present is unknown. Based on published sequences for the family, we designed specific primers for each subfamily and used PCR to amplify them from genomic DNA isolated from individual mature adult worms (MAW) taken from an experimentally infected dog in China and individual larval protoscoleces (PSC) excised from a single hydatid cyst taken from an Australian kangaroo. We then used real-time PCR to measure expression of each of the genes comprising the five EgAgB subfamilies in all life-cycle stages including the oncosphere (ONC). Based on sequence alignment analysis, we found that the EgAgB gene family comprises at least ten unique genes. Each of the genes was identical in both larval and adult E. granulosus isolates collected from two geographical areas (different continents). DNA alignment comparisons with EgAgB sequences deposited in GenBank databases showed that each gene in the gene family is highly conserved within E. granulosus, which contradicts previous studies claiming significant variation and polymorphism in EgAgB. Quantitative PCR analysis revealed that the genes were differentially expressed in different life-cycle stages of E. granulosus with EgAgB3 expressed predominantly in all stages. These findings are fundamental for determining the expression and the biological function of antigen B.

  5. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  6. Genome-wide identification, phylogenetic and co-expression analysis of OsSET gene family in rice.

    Directory of Open Access Journals (Sweden)

    Zhanhua Lu

    Full Text Available BACKGROUND: SET domain is responsible for the catalytic activity of histone lysine methyltransferases (HKMTs during developmental process. Histone lysine methylation plays a crucial and diverse regulatory function in chromatin organization and genome function. Although several SET genes have been identified and characterized in plants, the understanding of OsSET gene family in rice is still very limited. METHODOLOGY/PRINCIPAL FINDINGS: In this study, a systematic analysis was performed and revealed the presence of at least 43 SET genes in rice genome. Phylogenetic and structural analysis grouped SET proteins into five classes, and supposed that the domains out of SET domain were significant for the specific of histone lysine methylation, as well as the recognition of methylated histone lysine. Based on the global microarray, gene expression profile revealed that the transcripts of OsSET genes were accumulated differentially during vegetative and reproductive developmental stages and preferentially up or down-regulated in different tissues. Cis-elements identification, co-expression analysis and GO analysis of expression correlation of 12 OsSET genes suggested that OsSET genes might be involved in cell cycle regulation and feedback. CONCLUSIONS/SIGNIFICANCE: This study will facilitate further studies on OsSET family and provide useful clues for functional validation of OsSETs.

  7. The Lesion Simulating Disease (LSD) gene family as a variable in soybean response to Phakopsora pachyrhizi infection and dehydration.

    Science.gov (United States)

    Cabreira, Caroline; Cagliari, Alexandro; Bücker-Neto, Lauro; Wiebke-Strohm, Beatriz; de Freitas, Loreta B; Marcelino-Guimarães, Francismar C; Nepomuceno, Alexandre L; Margis-Pinheiro, Márcia M A N; Bodanese-Zanettini, Maria H

    2013-08-01

    The Lesion Simulating Disease (LSD) genes encode a family of zinc finger proteins that are reported to play an important role in the hypersensitive response and programmed cell death (PCD) that are caused by biotic and abiotic stresses. In the present study, 117 putative LSD family members were identified in Viridiplantae. Genes with one, two, or three conserved LSD domains were identified. Proteins with three LSD domains were highly represented in the species analyzed and were present in basal organisms. Proteins with two LSD domains were identified only in the Embryophyte clade, and proteins possessing one LSD domain were highly represented in grass species. Expression analyses of Glycine max LSD (GmLSD) genes were performed by real-time quantitative polymerase chain reaction. The results indicated that GmLSD genes are not ubiquitously expressed in soybean organs and that their expression patterns are instead organ-dependent. The expression of the majority of GmLSD genes is modulated in soybean during Phakopsora pachyrhizi infection. In addition, the expression of some GmLSD genes is modulated in plants under dehydration stress. These results suggest the involvement of GmLSD genes in the response of soybean to both biotic and abiotic stresses.

  8. Truncating mutation in the NHS gene: phenotypic heterogeneity of Nance-Horan syndrome in an asian Indian family.

    Science.gov (United States)

    Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy

    2005-01-01

    A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.

  9. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  10. The use of genes for performance enhancement: doping or therapy?

    Directory of Open Access Journals (Sweden)

    R.S. Oliveira

    2011-12-01

    Full Text Available Recent biotechnological advances have permitted the manipulation of genetic sequences to treat several diseases in a process called gene therapy. However, the advance of gene therapy has opened the door to the possibility of using genetic manipulation (GM to enhance athletic performance. In such ‘gene doping’, exogenous genetic sequences are inserted into a specific tissue, altering cellular gene activity or leading to the expression of a protein product. The exogenous genes most likely to be utilized for gene doping include erythropoietin (EPO, vascular endothelial growth factor (VEGF, insulin-like growth factor type 1 (IGF-1, myostatin antagonists, and endorphin. However, many other genes could also be used, such as those involved in glucose metabolic pathways. Because gene doping would be very difficult to detect, it is inherently very attractive for those involved in sports who are prepared to cheat. Moreover, the field of gene therapy is constantly and rapidly progressing, and this is likely to generate many new possibilities for gene doping. Thus, as part of the general fight against all forms of doping, it will be necessary to develop and continually improve means of detecting exogenous gene sequences (or their products in athletes. Nevertheless, some bioethicists have argued for a liberal approach to gene doping.

  11. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S; Larsen, Line H G; Johannesen, Katrine M

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis...... of a wide spectrum of epilepsies with age of onset spanning from the neonatal period to adulthood. A gene panel targeting 46 epilepsy genes was used on a cohort of 216 patients consecutively referred for panel testing. The patients had a range of different epilepsies from benign neonatal seizures......-causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared...

  12. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  13. A novel mutation in the WFS1 gene identified in a Taiwanese family with low-frequency hearing impairment

    Directory of Open Access Journals (Sweden)

    Chung Shing-Fang

    2007-05-01

    Full Text Available Abstract Background Wolfram syndrome gene 1 (WFS1 accounts for most of the familial nonsyndromic low-frequency sensorineural hearing loss (LFSNHL which is characterized by sensorineural hearing losses equal to and below 2000 Hz. The current study aimed to contribute to our understanding of the molecular basis of LFSNHL in an affected Taiwanese family. Methods The Taiwanese family with LFSNHL was phenotypically characterized using audiologic examination and pedigree analysis. Genetic characterization was performed by direct sequencing of WFS1 and mutation analysis. Results Pure tone audiometry confirmed that the family members affected with LFSNHL had a bilateral sensorineural hearing loss equal to or below 2000 Hz. The hearing loss threshold of the affected members showed no progression, a characteristic that was consistent with a mutation in the WFS1 gene located in the DFNA6/14/38 locus. Pedigree analysis showed a hereditarily autosomal dominant pattern characterized by a full penetrance. Among several polymorphisms, a missense mutation Y669H (2005T>C in exon 8 of WFS1 was identified in members of a Taiwanese family diagnosed with LFSNHL but not in any of the control subjects. Conclusion We discovered a novel heterozygous missense mutation in exon 8 of WFS1 (i.e., Y669H which is likely responsible for the LFSNHL phenotype in this particular Taiwanese family.

  14. Interleukin-6 Gene Promoter Polymorphisms and Cardiovascular Risk Factors. A family study

    Directory of Open Access Journals (Sweden)

    Iris Paola Guzmán-Guzmán

    2010-01-01

    Full Text Available Interleukin-6 (IL-6 is a cytokine involved in inflammatory process, as well as in glucose and lipid metabolism. Several studies of the biological relevance of IL-6 gene polymorphisms have indicated a relationship with cardiovascular disease. The aim of this study was to assess whether the –174 G/C and –572 G/C of IL-6 gene polymorphisms are associated with cardiovascular risk factors in Mexican families. Ninety members of 30 Mexican families, in which an index case (proband had obesity, were included in the study. We evaluated the body composition by bioelectrical impedance. Peripheral blood samples were collected to determine biochemical and hematological parameters. High sensitivity C- reactive protein levels were measurement for nephelometric analysis. Screening for both polymorphisms studied was performed by PCR-RFLP. In the parents, both polymorphisms were in Hardy-Weinberg's equilibrium. The genotypes –174 GC/CC were associated with T2D (OR = 1.23, IC95% 1.01–1.5 and highest levels of hsCRP (p = 0.02, whereas genotype –572 GG was associated with T2D (OR = 1.24, IC95% 1.04–1.47 with an inflammatory state determined by the increase in the leukocyte count (OR = 1.24, IC95% 1.02–1.51. The genotypes –174 GC/CC and –572 GG may confer susceptibility for the development of subclinical inflammation and type 2 diabetes in Mexican families.

  15. YeastWeb: a workset-centric web resource for gene family analysis in yeast

    Directory of Open Access Journals (Sweden)

    Bao Haihua

    2010-07-01

    Full Text Available Abstract Background Currently, a number of yeast genomes with different physiological features have been sequenced and annotated, which provides invaluable information to investigate yeast genetics, evolutionary mechanism, structure and function of gene families. Description YeastWeb is a novel database created to provide access to gene families derived from the available yeast genomes by assigning the genes into putative families. It has many useful features that complement existing databases, such as SGD, CYGD and Génolevures: 1 Detailed computational annotation was conducted with each entry with InterProScan, EMBOSS and functional/pathway databases, such as GO, COG and KEGG; 2 A well established user-friendly environment was created to allow users to retrieve the annotated genes and gene families using functional classification browser, keyword search or similarity-based search; 3 Workset offers users many powerful functions to manage the retrieved data efficiently, associate the individual items easily and save the intermediate results conveniently; 4 A series of comparative genomics and molecular evolution analysis tools are neatly implemented to allow users to view multiple sequence alignments and phylogenetic tree of gene families. At present, YeastWeb holds the gene families clustered from various MCL inflation values from a total of 13 available yeast genomes. Conclusions Given the great interest in yeast research, YeastWeb has the potential to become a useful resource for the scientific community of yeast biologists and related researchers investigating the evolutionary relationship of yeast gene families. YeastWeb is available at http://centre.bioinformatics.zj.cn/Yeast/.

  16. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

    2006-01-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  17. Major genes regulating total serum immunoglobulin E levels in families with asthma

    NARCIS (Netherlands)

    Postma, DS; Howard, TD; Koppelman, GH; Zheng, SL; Stine, OC; Bleecker, ER; Meyers, DA

    2000-01-01

    Immunoglobulin E (IgE) has a major role in the pathogenesis of allergic disorders and asthma. Previous data from 92 families, each identified through a proband with asthma, showed evidence for two major genes regulating total serum IgE levels. One of these genes mapped to 5q31-33. In the current

  18. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Research on evolutionary relationship and expression profiles of MATE-type gene family in maize .... To analyse the evolutionary relationships among the 49 ... sess 11 to 13 introns. Additionally, some close gene pairs were indeed distinct in intron–exon arrangements. For exam- ple, ZmMATE24 contained six introns, ...

  19. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  20. KIR and HLA haplotype analysis in a family lacking the KIR 2DL1-2DP1 genes.

    Science.gov (United States)

    Vojvodić, S; Ademović-Sazdanić, D

    2015-06-01

    The killer cell immunoglobulin-like receptor (KIR) gene cluster exhibits extensive allelic and haplotypic diversity that is observed as presence/absence of genes, resulting in expansion and contraction of KIR haplotypes and by allelic variation of individual KIR genes. We report a case of KIR pseudogene 2DP1 and 2DL1 gene absence in members of one family with the children suffering from acute myelogenous leukemia (AML). Killer cell immunoglobulin-like receptor low resolution genotyping was performed by the polymerase chain reaction (PCR)-sequence-specific primers (SSP)/sequence-specific oligonucleotide (SSO) method and haplotype assignment was done by gene content analysis. Both parents and the maternal grandfather, shared the same Cen-B2 KIR haplotype, containing KIR 3DL3, -2DS2, -2DL2 and -3DP1 genes. The second haplotype in the KIR genotype of the mother and grandfather was Tel-A1 with KIR 2DL4 (normal and deleted variant), -3DL1, -22 bp deletion variant of the 2DS4 gene and -3DL2, while the second haplotype in the KIR genotype of the father was Tel-B1 with 2DL4 (normal variant), -3DS1, -2DL5, -2DS5, -2DS1 and 3DL2 genes. Haplotype analysis in all three offsprings revealed that the children inherited the Cen-B2 haplotype with the same gene content but two of the children inherited a deleted variant of the 2DL4 gene, while the third child inherited a normal one. The second haplotype of all three offspring contained KIR 2DL4, -2DL5, -2DS1, -2DS4 (del 22bp variant), -2DS5, -3DL1 and -3DL2 genes, which was the basis of the assumption that there is a hybrid haplotype and that the present 3DL1 gene is a variant of the 3DS1 gene. Due to consanguinity among the ancestors, the results of KIR segregation analysis showed the existence of a very rare KIR genotype in the offspring. The family who is the subject of this case is even more interesting because the father was 10/10 human leukocyte antigen (HLA)-matched to his daughter, all members of the family have the "best

  1. MS/MS networking guided analysis of molecule and gene cluster families

    Science.gov (United States)

    Nguyen, Don Duy; Wu, Cheng-Hsuan; Moree, Wilna J.; Lamsa, Anne; Medema, Marnix H.; Zhao, Xiling; Gavilan, Ronnie G.; Aparicio, Marystella; Atencio, Librada; Jackson, Chanaye; Ballesteros, Javier; Sanchez, Joel; Watrous, Jeramie D.; Phelan, Vanessa V.; van de Wiel, Corine; Kersten, Roland D.; Mehnaz, Samina; De Mot, René; Shank, Elizabeth A.; Charusanti, Pep; Nagarajan, Harish; Duggan, Brendan M.; Moore, Bradley S.; Bandeira, Nuno; Palsson, Bernhard Ø.; Pogliano, Kit; Gutiérrez, Marcelino; Dorrestein, Pieter C.

    2013-01-01

    The ability to correlate the production of specialized metabolites to the genetic capacity of the organism that produces such molecules has become an invaluable tool in aiding the discovery of biotechnologically applicable molecules. Here, we accomplish this task by matching molecular families with gene cluster families, making these correlations to 60 microbes at one time instead of connecting one molecule to one organism at a time, such as how it is traditionally done. We can correlate these families through the use of nanospray desorption electrospray ionization MS/MS, an ambient pressure MS technique, in conjunction with MS/MS networking and peptidogenomics. We matched the molecular families of peptide natural products produced by 42 bacilli and 18 pseudomonads through the generation of amino acid sequence tags from MS/MS data of specific clusters found in the MS/MS network. These sequence tags were then linked to biosynthetic gene clusters in publicly accessible genomes, providing us with the ability to link particular molecules with the genes that produced them. As an example of its use, this approach was applied to two unsequenced Pseudoalteromonas species, leading to the discovery of the gene cluster for a molecular family, the bromoalterochromides, in the previously sequenced strain P. piscicida JCM 20779T. The approach itself is not limited to 60 related strains, because spectral networking can be readily adopted to look at molecular family–gene cluster families of hundreds or more diverse organisms in one single MS/MS network. PMID:23798442

  2. The vertebrate RCAN gene family: novel insights into evolution, structure and regulation.

    Directory of Open Access Journals (Sweden)

    Eva Serrano-Candelas

    Full Text Available Recently there has been much interest in the Regulators of Calcineurin (RCAN proteins which are important endogenous modulators of the calcineurin-NFATc signalling pathway. They have been shown to have a crucial role in cellular programmes such as the immune response, muscle fibre remodelling and memory, but also in pathological processes such as cardiac hypertrophy and neurodegenerative diseases. In vertebrates, the RCAN family form a functional subfamily of three members RCAN1, RCAN2 and RCAN3 whereas only one RCAN is present in the rest of Eukarya. In addition, RCAN genes have been shown to collocate with RUNX and CLIC genes in ACD clusters (ACD21, ACD6 and ACD1. How the RCAN genes and their clustering in ACDs evolved is still unknown. After analysing RCAN gene family evolution using bioinformatic tools, we propose that the three RCAN vertebrate genes within the ACD clusters, which evolved from single copy genes present in invertebrates and lower eukaryotes, are the result of two rounds of whole genome duplication, followed by a segmental duplication. This evolutionary scenario involves the loss or gain of some RCAN genes during evolution. In addition, we have analysed RCAN gene structure and identified the existence of several characteristic features that can be involved in RCAN evolution and gene expression regulation. These included: several transposable elements, CpG islands in the 5' region of the genes, the existence of antisense transcripts (NAT associated with the three human genes, and considerable evidence for bidirectional promoters that regulate RCAN gene expression. Furthermore, we show that the CpG island associated with the RCAN3 gene promoter is unmethylated and transcriptionally active. All these results provide timely new insights into the molecular mechanisms underlying RCAN function and a more in depth knowledge of this gene family whose members are obvious candidates for the development of future therapies.

  3. From manual curation to visualization of gene families and networks across Solanaceae plant species.

    Science.gov (United States)

    Pujar, Anuradha; Menda, Naama; Bombarely, Aureliano; Edwards, Jeremy D; Strickler, Susan R; Mueller, Lukas A

    2013-01-01

    High-quality manual annotation methods and practices need to be scaled to the increased rate of genomic data production. Curation based on gene families and gene networks is one approach that can significantly increase both curation efficiency and quality. The Sol Genomics Network (SGN; http://solgenomics.net) is a comparative genomics platform, with genetic, genomic and phenotypic information of the Solanaceae family and its closely related species that incorporates a community-based gene and phenotype curation system. In this article, we describe a manual curation system for gene families aimed at facilitating curation, querying and visualization of gene interaction patterns underlying complex biological processes, including an interface for efficiently capturing information from experiments with large data sets reported in the literature. Well-annotated multigene families are useful for further exploration of genome organization and gene evolution across species. As an example, we illustrate the system with the multigene transcription factor families, WRKY and Small Auxin Up-regulated RNA (SAUR), which both play important roles in responding to abiotic stresses in plants. Database URL: http://solgenomics.net/

  4. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  5. Evolution of a microbial nitrilase gene family: a comparative and environmental genomics study

    Science.gov (United States)

    Podar, Mircea; Eads, Jonathan R; Richardson, Toby H

    2005-01-01

    Background Completed genomes and environmental genomic sequences are bringing a significant contribution to understanding the evolution of gene families, microbial metabolism and community eco-physiology. Here, we used comparative genomics and phylogenetic analyses in conjunction with enzymatic data to probe the evolution and functions of a microbial nitrilase gene family. Nitrilases are relatively rare in bacterial genomes, their biological function being unclear. Results We examined the genetic neighborhood of the different subfamily genes and discovered conserved gene clusters or operons associated with specific nitrilase clades. The inferred evolutionary transitions that separate nitrilases which belong to different gene clusters correlated with changes in their enzymatic properties. We present evidence that Darwinian adaptation acted during one of those transitions and identified sites in the enzyme that may have been under positive selection. Conclusion Changes in the observed biochemical properties of the nitrilases associated with the different gene clusters are consistent with a hypothesis that those enzymes have been recruited to a novel metabolic pathway following gene duplication and neofunctionalization. These results demonstrate the benefits of combining environmental genomic sampling and completed genomes data with evolutionary and biochemical analyses in the study of gene families. They also open new directions for studying the functions of nitrilases and the genes they are associated with. PMID:16083508

  6. Evolution of a microbial nitrilase gene family: a comparative and environmental genomics study

    Directory of Open Access Journals (Sweden)

    Eads Jonathan R

    2005-08-01

    Full Text Available Abstract Background Completed genomes and environmental genomic sequences are bringing a significant contribution to understanding the evolution of gene families, microbial metabolism and community eco-physiology. Here, we used comparative genomics and phylogenetic analyses in conjunction with enzymatic data to probe the evolution and functions of a microbial nitrilase gene family. Nitrilases are relatively rare in bacterial genomes, their biological function being unclear. Results We examined the genetic neighborhood of the different subfamily genes and discovered conserved gene clusters or operons associated with specific nitrilase clades. The inferred evolutionary transitions that separate nitrilases which belong to different gene clusters correlated with changes in their enzymatic properties. We present evidence that Darwinian adaptation acted during one of those transitions and identified sites in the enzyme that may have been under positive selection. Conclusion Changes in the observed biochemical properties of the nitrilases associated with the different gene clusters are consistent with a hypothesis that those enzymes have been recruited to a novel metabolic pathway following gene duplication and neofunctionalization. These results demonstrate the benefits of combining environmental genomic sampling and completed genomes data with evolutionary and biochemical analyses in the study of gene families. They also open new directions for studying the functions of nitrilases and the genes they are associated with.

  7. History of a prolific family: the Hes/Hey-related genes of the annelid Platynereis.

    Science.gov (United States)

    Gazave, Eve; Guillou, Aurélien; Balavoine, Guillaume

    2014-01-01

    The Hes superfamily or Hes/Hey-related genes encompass a variety of metazoan-specific bHLH genes, with somewhat fuzzy phylogenetic relationships. Hes superfamily members are involved in a variety of major developmental mechanisms in metazoans, notably in neurogenesis and segmentation processes, in which they often act as direct effector genes of the Notch signaling pathway. We have investigated the molecular and functional evolution of the Hes superfamily in metazoans using the lophotrochozoan Platynereis dumerilii as model. Our phylogenetic analyses of more than 200 Metazoan Hes/Hey-related genes revealed the presence of five families, three of them (Hes, Hey and Helt) being pan-metazoan. Those families were likely composed of a unique representative in the last common metazoan ancestor. The evolution of the Hes family was shaped by many independent lineage specific tandem duplication events. The expression patterns of 13 of the 15 Hes/Hey-related genes in Platynereis indicate a broad functional diversification. Nevertheless, a majority of these genes are involved in two crucial developmental processes in annelids: neurogenesis and segmentation, resembling functions highlighted in other animal models. Combining phylogenetic and expression data, our study suggests an unusual evolutionary history for the Hes superfamily. An ancestral multifunctional annelid Hes gene may have undergone multiples rounds of duplication-degeneration-complementation processes in the lineage leading to Platynereis, each gene copies ensuring their maintenance in the genome by subfunctionalisation. Similar but independent waves of duplications are at the origin of the multiplicity of Hes genes in other metazoan lineages.

  8. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  9. Identification of Two Disease-causing Genes TJP2 and GJB2 in a Chinese Family with Unconditional Autosomal Dominant Nonsyndromic Hereditary Hearing Impairment

    Directory of Open Access Journals (Sweden)

    Hong-Yang Wang

    2015-01-01

    Full Text Available Background: There are more than 300 genetic loci that have been found to be related to hereditary hearing impairment (HHI, including 92 causative genes for nonsyndromic hearing loss, among which 34 genes are related to autosomal dominant nonsyndromic HHI (ADNSHHI. Traditional linkage analysis and candidate gene sequencing are not effective at detecting the ADNSHHI, especially for the unconditional families that may have more than one pathogenic cause. This study identified two disease-causing genes TJP2 and GJB2 in a Chinese family with unconditional ADNSHHI. Methods: To decipher the genetic code of a Chinese family (family 686 with ADNSHHI, different gene screening techniques have been performed, including linkage analysis, candidate genes screening, high-throughput sequencing and Sanger sequencing. These techniques were done on samples obtained from this family over a period of 10 years. Results: We identified a pathogenic missense mutation, c. 2081G>A (p.G694E, in TJP2, a gene that plays a crucial role in apoptosis and age-related hearing loss (ARHL. The mutation was co-segregated in this pedigree in all, but not in the two patients who presented with different phenotypes from the other affected family members. In one of the two patients, we confirmed that the compound heterozygosity for p.Y136FNx01 and p.G45E in the GJB2 gene may account for the phenotype shown in this patient. Conclusions: We identified the co-occurrence of two genetic causes in family 686. The possible disease-causing missense mutation of TJP2 in family 686 presents an opportunity for further investigation into ARHL. It is necessary to combine various genes screening methods, especially for some unconventional cases.

  10. Identification and characterization of CBL and CIPK gene families in canola (Brassica napus L.).

    Science.gov (United States)

    Zhang, Hanfeng; Yang, Bo; Liu, Wu-Zhen; Li, Hongwei; Wang, Lei; Wang, Boya; Deng, Min; Liang, Wanwan; Deyholos, Michael K; Jiang, Yuan-Qing

    2014-01-07

    Canola (Brassica napus L.) is one of the most important oil-producing crops in China and worldwide. The yield and quality of canola is frequently threatened by environmental stresses including drought, cold and high salinity. Calcium is a ubiquitous intracellular secondary messenger in plants. Calcineurin B-like proteins (CBLs) are Ca2+ sensors and regulate a group of Ser/Thr protein kinases called CBL-interacting protein kinases (CIPKs). Although the CBL-CIPK network has been demonstrated to play crucial roles in plant development and responses to various environmental stresses in Arabidopsis, little is known about their function in canola. In the present study, we identified seven CBL and 23 CIPK genes from canola by database mining and cloning of cDNA sequences of six CBLs and 17 CIPKs. Phylogenetic analysis of CBL and CIPK gene families across a variety of species suggested genome duplication and diversification. The subcellular localization of three BnaCBLs and two BnaCIPKs were determined using green fluorescence protein (GFP) as the reporter. We also demonstrated interactions between six BnaCBLs and 17 BnaCIPKs using yeast two-hybrid assay, and a subset of interactions were further confirmed by bimolecular fluorescence complementation (BiFC). Furthermore, the expression levels of six selected BnaCBL and 12 BnaCIPK genes in response to salt, drought, cold, heat, ABA, methyl viologen (MV) and low potassium were examined by quantitative RT-PCR and these CBL or CIPK genes were found to respond to multiple stimuli, suggesting that the canola CBL-CIPK network may be a point of convergence for several different signaling pathways. We also performed a comparison of interaction patterns and expression profiles of CBL and CIPK in Arabidospsis, canola and rice, to examine the differences between orthologs, highlighting the importance of studying CBL-CIPK in canola as a prerequisite for improvement of this crop. Our findings indicate that CBL and CIPK family members may

  11. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Science.gov (United States)

    2012-01-01

    Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450), glutathione S-transferases (GST), and carboxyl/cholinesterases (CCE). However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE) technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75%) were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a susceptible strain. Fifteen

  12. Diverse expression of sucrose transporter gene family in Zea mays

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Phosphate starvation had led to an increase in the level of ZmSUT1 and ... resistance. Sugar signalling is the immediate response of Pi starvation in a plant which follows increased sucrose biosyn- thesis in source tissues (Karthikeyan et al. 2007). .... ation of several genes involved in overcoming phosphate.

  13. Genetic diversity of bitter taste receptor gene family in Sichuan ...

    Indian Academy of Sciences (India)

    Abstract. The sense of bitter taste plays a critical role in animals as it can help them to avoid intake of toxic and harmful substances. Previous research had revealed that chicken has only three bitter taste receptor genes (Tas2r1, Tas2r2 and Tas2r7). To better understand the genetic polymorphisms and importance of bitter ...

  14. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Jimai 22 were used as an experimental model to analyse the expression patterns of wheat TPS genes .... the Bioanalyzer 2100 algorithm (Agilent Technologies, Palo. Alto, USA); high quality (RNA integrity ... software (Premier Biosoft International, Palo Alto, USA). Sequences and other information of the ...

  15. The zebrafish progranulin gene family and antisense transcripts

    Directory of Open Access Journals (Sweden)

    Baranowski David

    2005-11-01

    Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial

  16. The effect of 5-HTT gene promoter polymorphism on impulsivity depends on family relations in girls.

    Science.gov (United States)

    Paaver, Marika; Kurrikoff, Triin; Nordquist, Niklas; Oreland, Lars; Harro, Jaanus

    2008-07-01

    The short (S) allele of the 5-HTT gene promoter region polymorphism (5-HTTLPR), in combination with adverse environmental influence, leads to higher likelihood of depression. Impulsivity has been related to low serotonin turnover, poor regulation of affect, and problems in the family, including child maltreatment. The current study explored the effect of the 5-HTTLPR polymorphism in the serotonin transporter gene and adverse family environment on impulsivity in adolescents. Healthy adolescents participating in the Estonian Children Personality Behaviour and Health Study (n=483) filled the Adaptive and Maladaptive Impulsivity Scale (AMIS), Barratt Impulsiveness Scale (BIS-11), a scale measuring family relations, and were genotyped. While genotype alone was not associated with thoughtlessness, BIS-11 impulsiveness, fast decision-making or excitement seeking, 5-HTTLPR S allele carriers, however, had higher scores of disinhibition. In girls carrying the S allele, scores of thoughtlessness and disinhibition depended on family relations, being higher with less warmth in the family. Adverse family relations had no effect on impulsivity in girls with LL genotype. In boys, the effects of family relations on maladaptive impulsivity did not depend on genotype. However, the S allele and high maltreatment in the family both independently increased disinhibition and the BIS-11 score in boys. Family environment and the 5-HTTLPR genotype had no interactive effect on excitement seeking or fast decision-making. In summary, carrying the S allele may lead to high maladaptive impulsivity due to higher sensitivity to environmental adversity, which is more significantly expressed in girls.

  17. Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

    Science.gov (United States)

    Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

    2017-11-07

    The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

  18. Identification and gene expression analysis of a taxonomically restricted cysteine-rich protein family in reef-building corals.

    Directory of Open Access Journals (Sweden)

    Shinichi Sunagawa

    Full Text Available The amount of genomic sequence information continues to grow at an exponential rate, while the identification and characterization of genes without known homologs remains a major challenge. For non-model organisms with limited resources for manipulative studies, high-throughput transcriptomic data combined with bioinformatics methods provide a powerful approach to obtain initial insights into the function of unknown genes. In this study, we report the identification and characterization of a novel family of putatively secreted, small, cysteine-rich proteins herein named Small Cysteine-Rich Proteins (SCRiPs. Their discovery in expressed sequence tag (EST libraries from the coral Montastraea faveolata required the performance of an iterative search strategy based on BLAST and Hidden-Markov-Model algorithms. While a discernible homolog could neither be identified in the genome of the sea anemone Nematostella vectensis, nor in a large EST dataset from the symbiotic sea anemone Aiptasia pallida, we identified SCRiP sequences in multiple scleractinian coral species. Therefore, we postulate that this gene family is an example of lineage-specific gene expansion in reef-building corals. Previously published gene expression microarray data suggest that a sub-group of SCRiPs is highly responsive to thermal stress. Furthermore, data from microarray experiments investigating developmental gene expression in the coral Acropora millepora suggest that different SCRiPs may play distinct roles in the development of corals. The function of these proteins remains to be elucidated, but our results from in silico, transcriptomic, and phylogenetic analyses provide initial insights into the evolution of SCRiPs, a novel, taxonomically restricted gene family that may be responsible for a lineage-specific trait in scleractinian corals.

  19. Structure, evolution and functional inference on the Mildew Locus O (MLO) gene family in three cultivated Cucurbitaceae spp.

    Science.gov (United States)

    Iovieno, Paolo; Andolfo, Giuseppe; Schiavulli, Adalgisa; Catalano, Domenico; Ricciardi, Luigi; Frusciante, Luigi; Ercolano, Maria Raffaella; Pavan, Stefano

    2015-12-29

    The powdery mildew disease affects thousands of plant species and arguably represents the major fungal threat for many Cucurbitaceae crops, including melon (Cucumis melo L.), watermelon (Citrullus lanatus L.) and zucchini (Cucurbita pepo L.). Several studies revealed that specific members of the Mildew Locus O (MLO) gene family act as powdery mildew susceptibility factors. Indeed, their inactivation, as the result of gene knock-out or knock-down, is associated with a peculiar form of resistance, referred to as mlo resistance. We exploited recently available genomic information to provide a comprehensive overview of the MLO gene family in Cucurbitaceae. We report the identification of 16 MLO homologs in C. melo, 14 in C. lanatus and 18 in C. pepo genomes. Bioinformatic treatment of data allowed phylogenetic inference and the prediction of several ortholog pairs and groups. Comparison with functionally characterized MLO genes and, in C. lanatus, gene expression analysis, resulted in the detection of candidate powdery mildew susceptibility factors. We identified a series of conserved amino acid residues and motifs that are likely to play a major role for the function of MLO proteins. Finally, we performed a codon-based evolutionary analysis indicating a general high level of purifying selection in the three Cucurbitaceae MLO gene families, and the occurrence of regions under diversifying selection in candidate susceptibility factors. Results of this study may help to address further biological questions concerning the evolution and function of MLO genes. Moreover, data reported here could be conveniently used by breeding research, aiming to select powdery mildew resistant cultivars in Cucurbitaceae.

  20. [Mutation analysis and prenatal diagnosis in families of X-linked agammaglobulinemia caused by BTK gene mutation].

    Science.gov (United States)

    Kong, Xiangdong; Mo, Guiling; Liu, Ning; Tian, Peichao; Chen, Minfang

    2014-05-13

    To evaluate the genetic diagnostic feasibility of Bruton's tyrosine kinase (BTK) gene in three families with X-linked agammagobulinemia (XLA) birth history, mutation analysis and prenatal genetic diagnosis of BTK gene for two families with XLA. Polymerase chain reaction (PCR) was applied to amplify the regions of exon and exon-intron boundaries of BTK gene in 3 unrelated patients of XLA and their mothers from January 2011 to June 2012. The PCR products were further analyzed by direct sequencing. Prenatal genetic diagnosis was performed by chorionic villus sampling after genotyping of mothers of probands. Three novel mutations of BTK gene were identified in 3 pedigrees of XLA. A missense mutation c.1117C > A (p.L373I) were detected in pedigree 1. The mutation was possible damage by predicting in sillico. A nonsense mutation c.126T > G (p.Y42X) was found in pedigree 2. A single base deletion mutation c.1679delC (p. P560fsX10) was found in pedigree 3. The three mutations, p.L373I, p.Y42X and p. P560fsX10 were novel. The three novel mutations were absent in the 100 normal controls. The male fetus in pedigree 3 was free of mutations identical to the proband and the female fetus in pedigree 2 was a carrier. The two families continued the pregnancies and the infants showed no symptom of XLA after one year old. Three novel mutations were identified. The mutations of p.Y42X and p. P560fsX10 in BTK gene may be the major causes of pedigrees 2 and 3 with XLA. The mutation p.L373I of BTK gene is possibly the cause of pedigree 1 with XLA, but functional verification is needed. For pedigree of XLA, direct sequencing of BTK gene is available for providing genetic counseling, prenatal diagnosis.

  1. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs

    Science.gov (United States)

    2010-01-01

    Background Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Results Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. Conclusions We have uncovered major changes in gene

  2. Distribution of Gene Mutations Associated with Familial Normosmic Idiopathic Hypogonadotropic Hypogonadism

    Science.gov (United States)

    Gürbüz, Fatih; Kotan, L. Damla; Mengen, Eda; Şıklar, Zeynep; Berberoğlu, Merih; Dökmetaş, Sebila; Kılıçlı, Mehmet Fatih; Güven, Ayla; Kirel, Birgül; Saka, Nurçin; Poyrazoğlu, Şükran; Cesur, Yaşar; Doğan, Murat; Özen, Samim; Özbek, Mehmet Nuri; Demirbilek, Hüseyin; Kekil, M. Burcu; Temiz, Fatih; Önenli Mungan, Neslihan; Yüksel, Bilgin; Topaloğlu, Ali Kemal

    2012-01-01

    Objective: Normosmic idiopathic hypogonadotropic hypogonadism (nIHH) is characterized by failure of initiation or maintenance of puberty due to insufficient gonadotropin release, which is not associated with anosmia/hyposmia. The objective of this study was to determine the distribution of causative mutations in a hereditary form of nIHH. Methods: In this prospective collaborative study, 22 families with more than one affected individual (i.e. multiplex families) with nIHH were recruited and screened for genes known or suspected to be strong candidates for nIHH. Results: Mutations were identified in five genes (GNRHR, TACR3, TAC3, KISS1R, and KISS1) in 77% of families with autosomal recessively inherited nIHH. GNRHR and TACR3 mutations were the most common two causative mutations occurring with about equal frequency. Conclusions: Mutations in these five genes account for about three quarters of the causative mutations in nIHH families with more than one affected individual. This frequency is significantly greater than the previously reported rates in all inclusive (familial plus sporadic) cohorts. GNRHR and TACR3 should be the first two genes to be screened for diagnostic purposes. Identification of causative mutations in the remaining families will shed light on the regulation of puberty. Conflict of interest:None declared. PMID:22766261

  3. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  4. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Identification of a missense mutation in the tyrosinase gene in a Chinese family with oculocutaneous albinism type 1.

    Science.gov (United States)

    Lu, Qian; Yuan, Lamei; Xu, Hongbo; Huang, Xiangjun; Yang, Zhijian; Yi, Junhui; Ni, Bin; Chen, Yong; Deng, Hao

    2017-03-01

    Oculocutaneous albinism (OCA) is a group of heterogeneous and autosomal recessive disorders characterized by a reduction or complete loss of melanin biosynthesis in melanocytes. OCA type 1 (OCA1) is the most severe and common form of OCA, and is caused by mutations in the tyrosinase gene (TYR). The present study aimed to identify the genetic cause of OCA1 in a four‑generation consanguineous Chinese Han family. Complete physical examinations were performed and blood samples were collected from five members of the family and 100 unrelated healthy controls. Exome sequencing was conducted in the proband, followed by verification in other family members, using Sanger sequencing. Patients in the family presented with typical OCA1 features, including hypopigmentation of the skin and hair, and distinctive ocular changes. A homozygous missense variant, c.896G>A (p.R299H), in the TYR gene was identified in two patients, which co‑segregated with disease in the family. This variant was not present in the 100 healthy controls. These results expand the number of mutations identified to be responsible for OCA1 in the Chinese Han population, and may have implications for genetic counseling and clinical management of the disease.

  6. Phylogenomic analysis reveals dynamic evolutionary history of the Drosophila heterochromatin protein 1 (HP1 gene family.

    Directory of Open Access Journals (Sweden)

    Mia T Levine

    Full Text Available Heterochromatin is the gene-poor, satellite-rich eukaryotic genome compartment that supports many essential cellular processes. The functional diversity of proteins that bind and often epigenetically define heterochromatic DNA sequence reflects the diverse functions supported by this enigmatic genome compartment. Moreover, heterogeneous signatures of selection at chromosomal proteins often mirror the heterogeneity of evolutionary forces that act on heterochromatic DNA. To identify new such surrogates for dissecting heterochromatin function and evolution, we conducted a comprehensive phylogenomic analysis of the Heterochromatin Protein 1 gene family across 40 million years of Drosophila evolution. Our study expands this gene family from 5 genes to at least 26 genes, including several uncharacterized genes in Drosophila melanogaster. The 21 newly defined HP1s introduce unprecedented structural diversity, lineage-restriction, and germline-biased expression patterns into the HP1 family. We find little evidence of positive selection at these HP1 genes in both population genetic and molecular evolution analyses. Instead, we find that dynamic evolution occurs via prolific gene gains and losses. Despite this dynamic gene turnover, the number of HP1 genes is relatively constant across species. We propose that karyotype evolution drives at least some HP1 gene turnover. For example, the loss of the male germline-restricted HP1E in the obscura group coincides with one episode of dramatic karyotypic evolution, including the gain of a neo-Y in this lineage. This expanded compendium of ovary- and testis-restricted HP1 genes revealed by our study, together with correlated gain/loss dynamics and chromosome fission/fusion events, will guide functional analyses of novel roles supported by germline chromatin.

  7. A gene family expressing a host-protective antigen of Echinococcus granulosus.

    Science.gov (United States)

    Chow, C; Gauci, C G; Cowman, A F; Lightowlers, M W

    2001-11-01

    Echinococcus granulosus causes cystic hydatidosis in humans. A recombinant antigen vaccine has been developed, for use in the parasite's natural animal intermediate hosts, that may provide a new tool for control of hydatid disease transmission. The antigen, designated EG95, is encoded by a cDNA the features of which indicate it to be an incomplete copy of the associated mRNA. Characterisation of the gene(s) encoding the antigen was undertaken in order to enable subsequent study of genetic variability in the gene and associated protein in different parasite isolates. Southern hybridisation studies of E. granulosus genomic DNA probed with the eg95 cDNA revealed that the gene belonged to a gene family. DNA sequence analysis of cloned genomic fragments indicated that the gene family consists of at least seven members, one of which is a pseudogene. The gene having identity with the eg95 cDNA was cloned and sequenced, and the full length mRNA characterised. Genomic sequence and structure of the eg95 gene family members are highly conserved with respect to the gene encoding EG95. Four eg95-related genes are predicted to express an identical EG95 protein and all four were shown to be expressed in the oncosphere life-cycle stage. The full length EG95 protein has a predicted molecular mass of 16.9 kDa, secretory signal sequence, carboxy-terminal glycosylphosphatidylinositol hydrophobic anchor motif and a fibronectin type III domain. PCR amplification conditions were established which allow gene-specific characterisation of the eg95 gene in E. granulosus isolates from different host species and geographical locations.

  8. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  9. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  10. Family Status, Family Constellation, and Home Environmental Variables as Predictors of Cognitive Performance of Mexican American Children.

    Science.gov (United States)

    Valencia, Richard R.; And Others

    1985-01-01

    The relative contributions of family status variables, a family constellation variable, and the Henderson Environmental Learning Process Scale to prediction of cognitive performance among Mexican American preschool children from low-income backgrounds were examined. Implications of including background variables in research on relations between…

  11. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  12. Genome-wide identification and expression profiling of auxin response factor (ARF gene family in maize

    Directory of Open Access Journals (Sweden)

    Zhang Yirong

    2011-04-01

    Full Text Available Abstract Background Auxin signaling is vital for plant growth and development, and plays important role in apical dominance, tropic response, lateral root formation, vascular differentiation, embryo patterning and shoot elongation. Auxin Response Factors (ARFs are the transcription factors that regulate the expression of auxin responsive genes. The ARF genes are represented by a large multigene family in plants. The first draft of full maize genome assembly has recently been released, however, to our knowledge, the ARF gene family from maize (ZmARF genes has not been characterized in detail. Results In this study, 31 maize (Zea mays L. genes that encode ARF proteins were identified in maize genome. It was shown that maize ARF genes fall into related sister pairs and chromosomal mapping revealed that duplication of ZmARFs was associated with the chromosomal block duplications. As expected, duplication of some ZmARFs showed a conserved intron/exon structure, whereas some others were more divergent, suggesting the possibility of functional diversification for these genes. Out of these 31 ZmARF genes, 14 possess auxin-responsive element in their promoter region, among which 7 appear to show small or negligible response to exogenous auxin. The 18 ZmARF genes were predicted to be the potential targets of small RNAs. Transgenic analysis revealed that increased miR167 level could cause degradation of transcripts of six potential targets (ZmARF3, 9, 16, 18, 22 and 30. The expressions of maize ARF genes are responsive to exogenous auxin treatment. Dynamic expression patterns of ZmARF genes were observed in different stages of embryo development. Conclusions Maize ARF gene family is expanded (31 genes as compared to Arabidopsis (23 genes and rice (25 genes. The expression of these genes in maize is regulated by auxin and small RNAs. Dynamic expression patterns of ZmARF genes in embryo at different stages were detected which suggest that maize ARF genes may

  13. Identification and analysis of the germin-like gene family in soybean

    Directory of Open Access Journals (Sweden)

    Wang Xiang-Jing

    2010-11-01

    Full Text Available Abstract Background Germin and germin-like proteins constitute a ubiquitous family of plant proteins. A role of some family members in defense against pathogen attack had been proposed based on gene regulation studies and transgenic approaches. Soybean (G. max L. Merr. germin genes had not been characterized at the molecular and functional levels. Results In the present study, twenty-one germin gene members in soybean cultivar 'Maple Arrow' (partial resistance to Sclerotinia stem rot of soybean were identified by in silico identification and RACE method (GmGER 1 to GmGER 21. A genome-wide analyses of these germin-like protein genes using a bioinformatics approach showed that the genes located on chromosomes 8, 1, 15, 20, 16, 19, 7, 3 and 10, on which more disease-resistant genes were located on. Sequence comparison revealed that the genes encoded three germin-like domains. The phylogenetic relationships and functional diversity of the germin gene family of soybean were analyzed among diverse genera. The expression of the GmGER genes treated with exogenous IAA suggested that GmGER genes might be regulated by auxin. Transgenic tobacco that expressed the GmGER 9 gene exhibited high tolerance to the salt stress. In addition, the GmGER mRNA increased transiently at darkness and peaked at a time that corresponded approximately to the critical night length. The mRNA did not accumulate significantly under the constant light condition, and did not change greatly under the SD and LD treatments. Conclusions This study provides a complex overview of the GmGER genes in soybean. Phylogenetic analysis suggested that the germin and germin-like genes of the plant species that had been founded might be evolved by independent gene duplication events. The experiment indicated that germin genes exhibited diverse expression patterns during soybean development. The different time courses of the mRNAs accumulation of GmGER genes in soybean leaves appeared to have a

  14. Novel gene PUS3 c.A212G mutation in Ukrainian family with intellectual disability

    Directory of Open Access Journals (Sweden)

    Gulkovskyi R. V.

    2015-04-01

    Full Text Available Aim. To evaluate a possible role of a novel c.A212G substitution in the PUS3 gene at intellectual disability (ID. Methods. The observed group consisted of the ID Ukrainian family members (parents and two affected children and the control group – of 300 healthy individuals from general population of Ukraine. Sanger sequencing of the PUS3 gene exon 1 was performed for the family members. Polymorphic variants of c.A212G were analyzed using ARMS PCR. The homology models of wild type and p.Y71C mutant catalytic domains of human Pus3 were generated using the crystal structure of the human Pus1 catalytic domain (PDB ID: 4NZ6 as a template. Results. It was shown that the father of the affected siblings was the c.A212G substitution heterozygous carrier whereas the mother was a wild type allele homozygote, and the exom sequencing result was confirmed – the affected children are 212G homozygotes. We supposed de novo mutation in the maternal germ line. A low frequency of 212G allele (0.0017 was shown in the population of Ukraine. Homology modelling of the wild type and p.Y71C mutant catalytic domain of human Pus3 revealed that substitution p.Y71C is located in close proximity to its active site. Conclusions. The absence of hypoproteinemia in our patients, homozygous for the 212C allele allows us to assume that the mutation c.A212G PUS3 is rather neutral and cannot be the major cause of ID. However, considering a low frequency of the 212G allele in the population and close localization of p.Y71C substitution to the active site of hPus3 we cannot exclude that the c.A212G mutation in PUS3 may be a modifier for some pathologies including syndromic ID.

  15. A novel splice site mutation in the dentin sialophosphoprotein gene in a Chinese family with dentinogenesis imperfecta type II

    International Nuclear Information System (INIS)

    Wang Haoyang; Hou Yanning; Cui Yingxia; Huang Yufeng; Shi Yichao; Xia Xinyi; Lu Hongyong; Wang Yunhua; Li Xiaojun

    2009-01-01

    Twenty-four individuals were investigated that spanned six generations in a Chinese family affected with an apparently autosomal dominant form of dentinogenesis imperfecta type II (DGI-II, OMIM 125490). All affected individuals presented with typical, clinical and radiographic features of DGI-II, but without bilateral progressive high-frequency sensorineural hearing loss. To investigate the mutated molecule, a positional candidate approach was used to determine the mutated gene in this family. Genomic DNA was obtained from 24 affected individuals, 18 unaffected relatives of the family and 50 controls. Haplotype analysis was performed using leukocyte DNA for 6 short tandem repeat (STR) markers present in chromosome 4 (D4S1534, GATA62A11, DSPP, DMP1, SPP1 and D4S1563). In the critical region between D4S1534 and DMP1, the dentin sialophosphoprotein (DSPP) gene (OMIM *125485) was considered as the strongest candidate gene. The first four exons and exon/intron boundaries of the gene were analyzed using DNA from 24 affected individuals and 18 unaffected relatives of the same family. DNA sequencing revealed a heterozygous deletion mutation in intron 2 (at positions -3 to -25), which resulted in a frameshift mutation, that changed the acceptor site sequence from CAG to AAG (IVS2-3C→A) and may also have disrupted the branch point consensus sequence in intron 2. The mutation was found in the 24 affected individuals, but not in the 18 unaffected relatives and 50 controls. The deletion was identified by allele-specific sequencing and denaturing high-performance liquid chromatography (DHPLC) analysis. We conclude that the heterozygous deletion mutation contributed to the pathogenesis of DGI-II

  16. [Genetic diagnosis for a family without exonic deletions and duplications of dystrophin gene].

    Science.gov (United States)

    Li, Tao; Hou, Qiaofang; Wu, Dong; Wang, Hongdan; Liu, Hongyan; Yang, Yangli; Zhang, Chaoyang; Ding, Xuebing; Liao, Shixiu

    2015-02-01

    To conduct genetic diagnosis for a family in which no exonic deletions and duplications of the dystrophin gene were detected. Potential exonic deletions and duplications of the dystrophin gene were initially analyzed with using multiplex ligation-dependent probe amplification (MLPA). Subsequently, all of the 79 exons of the dystrophin gene of the proband and a pregnant woman from the family were analyzed with PCR amplification and DNA sequencing. Following identification of the causative mutation, prenatal diagnosis was provided. MLPA analysis had detected no exonic deletions and duplications of the dystrophin gene. Sequence analysis has identified a C>T mutation on the 22nd nucleotide position of the 70th exon of the dystrophin gene (c.10108 C>T), which has replaced the codon CGA to a stop codon (TGA). The patient's mother and sister were both heterozygous for the same mutation. Upon prenatal diagnosis, the fetus was found to be positive for the Y chromosome sex-determining gene (SRY) and has carried above mutation. The result of short tandem repeat linkage analysis also confirmed that the fetus has inherited the mutant X chromosome. The causative mutation of the dystrophin gene has been discovered in an affected family, which has enabled prenatal diagnosis of the disease.

  17. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  18. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  19. Genome-wide identification and characterization of the Dof gene family in Medicago truncatula.

    Science.gov (United States)

    Shu, Y J; Song, L L; Zhang, J; Liu, Y; Guo, C H

    2015-09-09

    The DNA-binding one zinc finger (Dof) family is a classic plant-specific zinc-finger transcription factor family, which is involved in many important processes, including seed maturation and germination, plant growth and development, and light responses. Investigation of the Medicago truncatula genome revealed 42 putative Dof genes, each of which holds one Dof domain. These genes were classified into four groups based on phylogenetic analysis, which are similar to the groups reported for Arabidopsis and rice. Based on genome duplication analysis, it was found that the MtDof genes were distributed on all chromosomes and had expanded through tandem gene duplication and segmental duplication events. Two main duplication regions were identified, one from tandem duplication and another from segmental duplication. By analyzing high-throughput sequencing data from M. truncatula, we found that most of the MtDof genes showed specific expression patterns in different tissues. According to cis-regulatory element analysis, these MtDof genes are regulated by different cis-acting motifs, which are important for the functional divergence of the MtDof genes in different processes. Thus, using genome-wide identification, evolution, and expression pattern analysis of the Dof genes in M. truncatula, our study provides valuable information for understanding the potential function of the Dof genes in regulating the growth and development of M. truncatula.

  20. Burden of rare variants in ALS genes influences survival in familial and sporadic ALS.

    Science.gov (United States)

    Pang, Shirley Yin-Yu; Hsu, Jacob Shujui; Teo, Kay-Cheong; Li, Yan; Kung, Michelle H W; Cheah, Kathryn S E; Chan, Danny; Cheung, Kenneth M C; Li, Miaoxin; Sham, Pak-Chung; Ho, Shu-Leong

    2017-10-01

    Genetic variants are implicated in the development of amyotrophic lateral sclerosis (ALS), but it is unclear whether the burden of rare variants in ALS genes has an effect on survival. We performed whole genome sequencing on 8 familial ALS (FALS) patients with superoxide dismutase 1 (SOD1) mutation and whole exome sequencing on 46 sporadic ALS (SALS) patients living in Hong Kong and found that 67% had at least 1 rare variant in the exons of 40 ALS genes; 22% had 2 or more. Patients with 2 or more rare variants had lower probability of survival than patients with 0 or 1 variant (p = 0.001). After adjusting for other factors, each additional rare variant increased the risk of respiratory failure or death by 60% (p = 0.0098). The presence of the rare variant was associated with the risk of ALS (Odds ratio 1.91, 95% confidence interval 1.03-3.61, p = 0.03), and ALS patients had higher rare variant burden than controls (MB, p = 0.004). Our findings support an oligogenic basis with the burden of rare variants affecting the development and survival of ALS. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Detection of gene-environment interactions in a family-based population using SCAD.

    Science.gov (United States)

    Kim, Gwangsu; Lai, Chao-Qiang; Arnett, Donna K; Parnell, Laurence D; Ordovas, Jose M; Kim, Yongdai; Kim, Joungyoun

    2017-09-30

    Gene-environment interaction (GxE) is emphasized as one potential source of missing genetic variation on disease traits, and the ultimate goal of GxE research is prediction of individual risk and prevention of complex diseases. However, there are various challenges in statistical analysis of GxE. In this paper, we focus on the three methodological challenges: (i) the high dimensions of genes; (ii) the hierarchical structure between interaction effects and their corresponding main effects; and (iii) the correlation among subjects from family-based population studies. In this paper, we propose an algorithm that approaches all three challenges simultaneously. This is the first penalized method focusing on an interaction search based on a linear mixed effect model. For verification, we compare the empirical performance of our new method with other existing methods in simulation study. The results demonstrate the superiority of our method under overall simulation setup. In particular, the outperformance obviously becomes greater as the correlation among subjects increases. In addition, the new method provides a robust estimate for the correlation among subjects. We also apply the new method on Genetics of Lipid Lowering Drugs and Diet Network study data. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  2. A novel deletion mutation in the TUSC3 gene in a consanguineous Pakistani family with autosomal recessive nonsyndromic intellectual disability

    Directory of Open Access Journals (Sweden)

    Ali Nadir

    2011-04-01

    Full Text Available Abstract Background Intellectual disability (ID is a serious disorder of the central nervous system with a prevalence of 1-3% in a general population. In the past decades, the research focus has been predominantly on X-linked ID (68 loci and 19 genes for non syndromic X linked ID while for autosomal recessive nonsyndromic ID (NSID only 30 loci and 6 genes have been reported to date. Methods Genome-wide homozygosity mapping with 500 K Nsp1 array (Affymetrix, CNV analysis, PCR based breakpoint mapping and DNA sequencing was performed to explore the genetic basis of autosomal recessive nonsyndromic ID in a large Pakistani family. Results Data analysis showed linkage at 8p23 locus with common homozygous region between SNPs rs6989820 and rs2237834, spanning a region of 12.494 Mb. The subsequent CNV analysis of the data revealed a homozygous deletion of 170.673 Kb which encompassed the TUSC3 gene. Conclusion We report a novel deletion mutation in TUSC3 gene which is the second gene after TRAPPC9 in which mutation has been identified in more than one family with autosomal recessive NSID. The study will aid in exploring the molecular pathway of cognition.

  3. [Mutation analyses and prenatal diagnosis in two families of X linked severe combined immunodeficiency caused by IL2RG gene novel mutation].

    Science.gov (United States)

    Kong, Xiangdong; Liu, Ning; Xu, Xueju; Wu, Qinghua; Zhao, Zhenhua; Bai, Qiaoling; Meng, Jingjing

    2014-04-29

    To evaluate the diagnostic feasibility of mutation analysis and prenatal genetic diagnosis genetic analysis of IL2RG gene in two families with a birth history of X-linked severe combined immunodeficiency (X-SCID). Blood samples of a male infant patient of X-SCID and his mother in family 1 and the parents of another deceased child with X-SCID in family 2 from January 2012 to February 2013 were collected.Eight exons comprising IL2RG open reading frame and their exon/intron boundaries were analyzed by bi-directional direct sequencing of polymerase chain reaction (PCR) products. Prenatal genetic diagnoses were performed by chorionic villus sampling after the genotypes of maternal probands were identified in family 1. Two mutations of IL2RG gene were identified in these two families. The c.361-363delGAG (p.E121del) mutation was identified in family 1. The c.510-511insGAACT (p.W173X) mutation appeared in family 2. The two mutations of c.361-363delGAG (p.E121del) and c.510-511insGAACT (p.W173X) were novel. The two novel mutations were absent in 100 normal controls. The pregnancy in family 1 continued and the infant showed no symptom of X-SCID at 1 year after birth. The aunt (II-3) of proband in family 1 was not a carrier. The female fetus in family 1 had no mutation. Two novel mutations of c.361-363delGAG (p.E121del) and c.510-511insGAACT (p.W173X) in IL2RG gene may be a major cause of disease in two families with X-SCID. And direct sequencing of IL2RG gene provides genetic counseling, prenatal diagnosis and carrier screening for families with X-SCID.

  4. Heterozygous deletion at the SOX10 gene locus in two patients from a Chinese family with Waardenburg syndrome type II.

    Science.gov (United States)

    Wenzhi, He; Ruijin, Wen; Jieliang, Li; Xiaoyan, Ma; Haibo, Liu; Xiaoman, Wang; Jiajia, Xian; Shaoying, Li; Shuanglin, Li; Qing, Li

    2015-10-01

    Waardenburg syndrome (WS) is a rare disease characterized by sensorineural deafness and pigment disturbance. To date, almost 100 mutations have been reported, but few reports on cases with SOX10 gene deletion. The inheritance pattern of SOX10 gene deletion is still unclear. Our objective was to identify the genetic causes of Waardenburg syndrome type II in a two-generation Chinese family. Clinical evaluations were conducted in both of the patients. Microarray analysis and multiplex ligation-dependent probe amplification (MLPA) were performed to identify disease-related copy number variants (CNVs). DNA sequencing of the SOX10, MITF and SNAI2 genes was performed to identify the pathogenic mutation responsible for WS2. A 280kb heterozygous deletion at the 22q13.1 chromosome region (including SOX10) was detected in both of the patients. No mutation was found in the patients, unaffected family members and 30 unrelated healthy controls. This report is the first to describe SOX10 heterozygous deletions in Chinese WS2 patients. Our result conform the thesis that heterozygous deletions at SOX10 is an important pathogenicity for WS, and present as autosomal dominant inheritance. Nevertheless, heterozygous deletion of the SOX10 gene would be worth investigating to understand their functions and contributions to neurologic phenotypes. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  6. Global analysis of the MATE gene family of metabolite transporters in tomato

    OpenAIRE

    Santos, Adolfo Luís dos; Chaves-Silva, Samuel; Yang, Lina; Maia, Lucas Gontijo Silva; Chalfun-Júnior, Antonio; Sinharoy, Senjuti; Zhao, Jian; Benedito, Vagner Augusto

    2017-01-01

    Background Species in the Solanaceae family are known for producing plethora of specialized metabolites. In addition to biosynthesis pathways, a full comprehension of secondary metabolism must also take into account the transport and subcellular compartmentalization of substances. Here, we examined the MATE (Multidrug and Toxic Compound Extrusion, or Multi-Antimicrobial Extrusion) gene family in the tomato (Solanum lycopersicum) genome with the objective of better understanding the transport ...

  7. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  8. Double heterozygosity in the BRCA1 and BRCA2 genes in Italian family.

    Science.gov (United States)

    Vietri, Maria Teresa; Molinari, Anna Maria; Caliendo, Gemma; De Paola, Maria Laura; Giovanna, D'Elia; Gambardella, Anna Laura; Petronella, Pasquale; Cioffi, Michele

    2013-12-01

    Double heterozygosity (DH) is an extremely rare event in which both BRCA1 and BRCA2 are mutated simultaneously in a family. To date, few cases of DH have been reported, especially in Ashkenazi populations. In Italy some cases of DH have been reported. In this study, we have described an Italian family with double heterozygosity in the BRCA genes. The proband is a 43-year-old woman with bilateral breast cancer. She presented two pathogenic mutations in both BRCA genes, IVS8+2T>A (c.547+2T>A;p.Gln148Aspfsx51) in BRCA1, K944X (c.2830A>T;p.Lys944X) in BRCA2 and a novel variant IVS4-57A>G (c.426-57A>G) in BRCA2, not previously described. Both mutations were inherited from the paternal lineage in the proband's family. We investigated all available members of this family and we identified other two family members with DH. Our observations support the hypothesis of a non-specific severe phenotype in DH carriers in terms of age of disease onset, cumulative lifetime risk and multiple primary tumours. Furthermore, our findings confirm that in order to identify all cases of DH, it is important not to limit the identification of mutations in a single gene, but extend the analysis to BRCA1 and BRCA2 and other breast cancer susceptibility genes.

  9. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    Science.gov (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  10. Genetic variability of the 45W gene family between Chinese and Mexican Taenia solium.

    Science.gov (United States)

    Zheng, Yadong; Cai, Xuepeng; Luo, Xuenong; Zhang, Dongfeng; Jing, Zhizhong

    2008-06-01

    Taenia solium 45W proteins are good candidates for development of anti-cysticercosis vaccines. However, the genetic characteristics of the 45 gene family are still unclear between different isolates. We investigated the polymorphism of the 45 gene family between Chinese and Mexican T. solium. Alignment showed that TSO45-4B and TSO45-1C antigens were conserved absolutely, whereas other TSO45 proteins varied between these two isolates. It is informative to guide using of recombinant 45W vaccines to control porcine cysticercosis caused by Asiatic or African/Latin American T. solium.

  11. Serotonin Transporter (5-HTT) and gamma-Aminobutyric Acid Receptor Subunit beta3 (GABRB3) Gene Polymorphisms are not Associated with Autism in the IMGSA Families

    DEFF Research Database (Denmark)

    Maestrini, E.; Lai, C.; Marlow, A.

    1999-01-01

    on the collection of families grom the International Molecular Genetic Study of Autism (IMGSA) Consortium, using the transmission disequilibrium test. Two polymorphisms in the 5-HTT gene (a functional insertion-deletion polymorphism in the promoter and a variable nubmer tandem repeat in the second intron) were...... examined in 90 families comprising 174 affected individuals. Furthermore, seven microsatellite markers spanning the 15q11-q13 region were studied in 94 families with 182 affected individuals. No significant evidence of association or linkage was found at any of the markers tested, indicating that the 5-HTT......Previous studies have suggested that the serotonin transporter (5-HTT) gene and the gamma-aminobutyric acid receptor subunit beta3 (GABRB3) gene, or other genes in the 15q11-q13 region, are possibly involved in susceptibility to autism. To test this hypothesis we performed an association study...

  12. Evolution of the B3 DNA binding superfamily: new insights into REM family gene diversification.

    Directory of Open Access Journals (Sweden)

    Elisson A C Romanel

    Full Text Available BACKGROUND: The B3 DNA binding domain includes five families: auxin response factor (ARF, abscisic acid-insensitive3 (ABI3, high level expression of sugar inducible (HSI, related to ABI3/VP1 (RAV and reproductive meristem (REM. The release of the complete genomes of the angiosperm eudicots Arabidopsis thaliana and Populus trichocarpa, the monocot Orysa sativa, the bryophyte Physcomitrella patens,the green algae Chlamydomonas reinhardtii and Volvox carteri and the red algae Cyanidioschyzon melorae provided an exceptional opportunity to study the evolution of this superfamily. METHODOLOGY: In order to better understand the origin and the diversification of B3 domains in plants, we combined comparative phylogenetic analysis with exon/intron structure and duplication events. In addition, we investigated the conservation and divergence of the B3 domain during the origin and evolution of each family. CONCLUSIONS: Our data indicate that showed that the B3 containing genes have undergone extensive duplication events, and that the REM family B3 domain has a highly diverged DNA binding. Our results also indicate that the founding member of the B3 gene family is likely to be similar to the ABI3/HSI genes found in C. reinhardtii and V. carteri. Among the B3 families, ABI3, HSI, RAV and ARF are most structurally conserved, whereas the REM family has experienced a rapid divergence. These results are discussed in light of their functional and evolutionary roles in plant development.

  13. The ARGOS gene family functions in a negative feedback loop to desensitize plants to ethylene.

    Science.gov (United States)

    Rai, Muneeza Iqbal; Wang, Xiaomin; Thibault, Derek M; Kim, Hyo Jung; Bombyk, Matthew M; Binder, Brad M; Shakeel, Samina N; Schaller, G Eric

    2015-06-24

    Ethylene plays critical roles in plant growth and development, including the regulation of cell expansion, senescence, and the response to biotic and abiotic stresses. Elements of the initial signal transduction pathway have been determined, but we are still defining regulatory mechanisms by which the sensitivity of plants to ethylene is modulated. We report here that members of the ARGOS gene family of Arabidopsis, previously implicated in the regulation of plant growth and biomass, function as negative feedback regulators of ethylene signaling. Expression of all four members of the ARGOS family is induced by ethylene, but this induction is blocked in ethylene-insensitive mutants. The dose dependence for ethylene induction varies among the ARGOS family members, suggesting that they could modulate responses across a range of ethylene concentrations. GFP-fusions of ARGOS and ARL localize to the endoplasmic reticulum, the same subcellular location as the ethylene receptors and other initial components of the ethylene signaling pathway. Seedlings with increased expression of ARGOS family members exhibit reduced ethylene sensitivity based on physiological and molecular responses. These results support a model in which the ARGOS gene family functions as part of a negative feedback circuit to desensitize the plant to ethylene, thereby expanding the range of ethylene concentrations to which the plant can respond. These results also indicate that the effects of the ARGOS gene family on plant growth and biomass are mediated through effects on ethylene signal transduction.

  14. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  15. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  16. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  17. A novel missense mutation of the paired box 3 gene in a Turkish family with Waardenburg syndrome type 1.

    Science.gov (United States)

    Hazan, Filiz; Ozturk, A Taylan; Adibelli, Hamit; Unal, Nurettin; Tukun, Ajlan

    2013-01-01

    Screening of mutations in the paired box 3 (PAX3) gene in three generations of a Turkish family with Waardenburg syndrome type 1 (WS1). WS1 was diagnosed in a 13-month-old girl according to the WS Consortium criteria. Detailed family history of the proband revealed eight affected members in three generations. Routine clinical and audiological examination and ophthalmologic evaluation were performed on eight affected and five healthy members of the study family. Dystopia canthorum was detected in all affected patients; however, a brilliant blue iris was present in five patients who also had mild retinal hypopigmentation. Genomic DNA was extracted from the peripheral blood of affected and unaffected individuals in the family as well as 50 unrelated healthy volunteers. All coding exons and adjacent intronic regions of PAX3 were sequenced directly. A novel missense heterozygous c.788T>G mutation was identified in eight patients. This nucleotide alteration was not found in unaffected members of the study family or in the 50 unrelated control subjects. The mutation causes V263G amino-acid substitution in the homeodomain of the PAX3 protein, which represents the 45(th) residue of helix 3. We identified a novel missense c.788T>G mutation in PAX3 in a family with Waardenburg syndrome with intrafamilial phenotypic heterogeneity.

  18. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  19. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  20. Molecular cloning and expression analysis of the sucrose transporter gene family from Theobroma cacao L.

    Science.gov (United States)

    Li, Fupeng; Wu, Baoduo; Qin, Xiaowei; Yan, Lin; Hao, Chaoyun; Tan, Lehe; Lai, Jianxiong

    2014-08-10

    In this study, we performed cloning and expression analysis of six putative sucrose transporter genes, designated TcSUT1, TcSUT2, TcSUT3, TcSUT4, TcSUT5 and TcSUT6, from the cacao genotype 'TAS-R8'. The combination of cDNA and genomic DNA sequences revealed that the cacao SUT genes contained exon numbers ranging from 1 to 14. The average molecular mass of all six deduced proteins was approximately 56 kDa (range 52 to 66 kDa). All six proteins were predicted to exhibit typical features of sucrose transporters with 12 trans-membrane spanning domains. Phylogenetic analysis revealed that TcSUT2 and TcSUT4 belonged to Group 2 SUT and Group 4 SUT, respectively, and the other TcSUT proteins were belonging to Group 1 SUT. Real-time PCR was conducted to investigate the expression pattern of each member of the SUT family in cacao. Our experiment showed that TcSUT1 was expressed dominantly in pods and that, TcSUT3 and TcSUT4 were highly expressed in both pods and in bark with phloem. Within pods, TcSUT1 and TcSUT4 were expressed more in the seed coat and seed from the pod enlargement stage to the ripening stage. TcSUT5 expression sharply increased to its highest expression level in the seed coat during the ripening stage. Expression pattern analysis indicated that TcSUT genes may be associated with photoassimilate transport into developing seeds and may, therefore, have an impact on seed production. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. TIS11 Family Proteins and Their Roles in Posttranscriptional Gene Regulation

    Directory of Open Access Journals (Sweden)

    Maria Baou

    2009-01-01

    Full Text Available Posttranscriptional regulation of gene expression of mRNAs containing adenine-uridine rich elements (AREs in their 3 untranslated regions is mediated by a number of different proteins that interact with these elements to either stabilise or destabilise them. The present review concerns the TPA-inducible sequence 11 (TIS11 protein family, a small family of proteins, that appears to interact with ARE-containing mRNAs and promote their degradation. This family of proteins has been extensively studied in the past decade. Studies have focussed on determining their biochemical functions, identifying their target mRNAs, and determining their roles in cell functions and diseases.

  2. Rapid expansion of the protein disulfide isomerase gene family facilitates the folding of venom peptides

    DEFF Research Database (Denmark)

    Safavi-Hemami, Helena; Li, Qing; Jackson, Ronneshia L.

    2016-01-01

    Formation of correct disulfide bonds in the endoplasmic reticulum is a crucial step for folding proteins destined for secretion. Protein disulfide isomerases (PDIs) play a central role in this process. We report a previously unidentified, hypervariable family of PDIs that represents the most...... diverse gene family of oxidoreductases described in a single genus to date. These enzymes are highly expressed specifically in the venom glands of predatory cone snails, animals that synthesize a remarkably diverse set of cysteine-rich peptide toxins (conotoxins). Enzymes in this PDI family, termed...

  3. Comparative analysis of genome-wide Mlo gene family in Cajanus cajan and Phaseolus vulgaris.

    Science.gov (United States)

    Deshmukh, Reena; Singh, V K; Singh, B D

    2016-04-01

    The Mlo gene was discovered in barley because the mutant 'mlo' allele conferred broad-spectrum, non-race-specific resistance to powdery mildew caused by Blumeria graminis f. sp. hordei. The Mlo genes also play important roles in growth and development of plants, and in responses to biotic and abiotic stresses. The Mlo gene family has been characterized in several crop species, but only a single legume species, soybean (Glycine max L.), has been investigated so far. The present report describes in silico identification of 18 CcMlo and 20 PvMlo genes in the important legume crops Cajanus cajan (L.) Millsp. and Phaseolus vulgaris L., respectively. In silico analysis of gene organization, protein properties and conserved domains revealed that the C. cajan and P. vulgaris Mlo gene paralogs are more divergent from each other than from their orthologous pairs. The comparative phylogenetic analysis classified CcMlo and PvMlo genes into three major clades. A comparative analysis of CcMlo and PvMlo proteins with the G. max Mlo proteins indicated close association of one CcMlo, one PvMlo with two GmMlo genes, indicating that there was no further expansion of the Mlo gene family after the separation of these species. Thus, most of the diploid species of eudicots might be expected to contain 15-20 Mlo genes. The genes CcMlo12 and 14, and PvMlo11 and 12 are predicted to participate in powdery mildew resistance. If this prediction were verified, these genes could be targeted by TILLING or CRISPR to isolate powdery mildew resistant mutants.

  4. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  5. Nonsense mutations in the shelterin complex genes ACD and TERF2IP in familial melanoma

    DEFF Research Database (Denmark)

    Aoude, Lauren G; Pritchard, Antonia L; Robles-Espinoza, Carla Daniela

    2015-01-01

    . Maximum likelihood and LOD [logarithm (base 10) of odds] analyses were used. Mutation clustering was assessed with χ(2) and Fisher's exact tests. P values under .05 were considered statistically significant (one-tailed with Yates' correction). RESULTS: Six families had mutations in ACD and four families......BACKGROUND: The shelterin complex protects chromosomal ends by regulating how the telomerase complex interacts with telomeres. Following the recent finding in familial melanoma of inactivating germline mutations in POT1, encoding a member of the shelterin complex, we searched for mutations...... in the other five components of the shelterin complex in melanoma families. METHODS: Next-generation sequencing techniques were used to screen 510 melanoma families (with unknown genetic etiology) and control cohorts for mutations in shelterin complex encoding genes: ACD, TERF2IP, TERF1, TERF2, and TINF 2...

  6. Domain combination of the vertebrate-like TLR gene family ...

    Indian Academy of Sciences (India)

    v 2.0 program with default parameters (Larkin et al. 2007). MEGA4.0 was used for phylogenetic analysis with the neighbour-joining (NJ) method with 1000 bootstrap values. (Tamura et al. 2007). In addition, to further verify the relia- bility of the NJ trees, the maximum-likelihood (ML) analy- sis was performed using ProtTest v ...

  7. Expression profile analysis of silkworm P450 family genes after phoxim induction.

    Science.gov (United States)

    Li, Fanchi; Ni, Min; Zhang, Hua; Wang, Binbin; Xu, Kaizun; Tian, Jianghai; Hu, Jingsheng; Shen, Weide; Li, Bing

    2015-07-01

    Silkworm (Bombyx mori) is an important economic insect and a model species for Lepidopteran. Each year, O,O-diethyl O-(alpha-cyanobenzylideneamino) phosphorothioate (phoxim) pesticide poisoning in China results in huge economic losses in sericulture. Silkworm fat body is the main organ for nutrient storage, energy supply, intermediary metabolism, and detoxification. Microarray analysis of silkworm Cytochrome P450 detoxification enzyme genes revealed that all tested P450 4 (CYP4) family genes are expressed in the fat body. Quantitative Real-time PCR (QRT-PCR) was used to detect the expression of CYP4 family genes in silkworm fat body 0, 24, 48, and 72 h after phoxim exposure. The expression levels of silkworm molting hormone synthesis-related genes started to change 24 h after phoxim exposure, with those of CYP302A1, CYP306A1, and CYP314A1 being elevated by 1.38-, 1.33-, and 2.10-fold, respectively. The CYP18A1 gene that participates in steroid hormone inactivation and the CYP15C1 gene that participates in the epoxidation during the synthesis of juvenile hormone (JH) from methyl farnesoate (MF) were increased by 3.85- and 7.82-fold, respectively. Phylogenetic analysis indicated that these endogenous hormone metabolism-related genes belong to CYP mito clan and clan 2, and that phoxim exposure may affect silkworm development and metamorphosis. The CYP4, CYP6, and CYP9 families all showed some degrees of increases in gene expression; among them, CYP49A1, CYP4L6, CYP6AB4, CYP9G3, CYP9A19, and CYP9A22's transcription levels were significantly upregulated to 12.77-, 2.64-, 2.42-, 4.06-, 3.32-, and 2.98-fold, respectively, of the control levels. In the fat body, CYP49A1, CYP6AB4, CYP9A19, and CYP9A22 were constantly expressed at high levels after 24, 48, and 72 h of phoxim treatments; according to phylogenetic analysis, these genes belong to detoxification-related clan 3 and clan 4 CYP families. These genes may participate in the metabolism of phoxim in silkworm fat

  8. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  9. Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene.

    Science.gov (United States)

    Bhagavath, Bala; Layman, Lawrence C; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G; Kim, Hyung-Goo; Carr, Bruce R

    2014-08-05

    46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. The spectrum of familial Mediterranean fever gene mutations in Arabs: report of a large series.

    Science.gov (United States)

    Majeed, Hasan A; El-Khateeb, Mohammed; El-Shanti, Hatem; Rabaiha, Zaid Abu; Tayeh, Marwan; Najib, Dana

    2005-06-01

    To identify the frequency and distribution of familial Mediterranean fever (FMF) gene (MEFV) mutations in Arab patients. The study was performed in the pediatric FMF clinic of Jordan University Hospital over a period of 4 years. Patients were referred by their physicians for diagnosis, management, genetic study, and counseling. A diagnosis of FMF was made according to published criteria. Screening for 5 mutations, namely M694V, V726A, M694I, M680I, and E148Q, was performed by amplification refractory mutation system (ARMS) for the first 4 and by restriction endonuclease testing for E148Q. Of the 407 unrelated patients investigated, 239 (59%) had 1 or 2 mutations and 168 (41%) had none of the studied mutations detected. Of those with mutations, 92 were homozygous, 53 were compound heterozygotes, 3 had complex alleles, and 91 patients had only 1 identifiable mutation. Of the mutations, M694V, V726A, M694I, M680I, and E148Q accounted for 38, 26, 14, 10 and 13%, respectively. Twelve of our patients developed the protracted febrile myalgia syndrome (PFMS) of whom 5 (42%) were homozygous for M694V. Only 2 developed chronic renal failure, both of whom were homozygous for M694V and were not on colchicine prophylaxis. However, 43 patients had a family history of chronic renal failure, and 15 (35%) were homozygous for M694V. Our data indicate that the 5 MEFV mutations are well distributed in Arabs. They also show that M694V is the most common mutation in Arab patients with FMF and seems to have an association with the development of amyloidosis and the PFMS. The high frequency of V726A, and the unique high frequency of M694I in Arabs compared with 3 other ethnic groups, are confirmed.

  11. General and family-specific gene expression responses to viral hemorrhagic septicaemia virus infection in rainbow trout (Oncorhynchus mykiss)

    DEFF Research Database (Denmark)

    Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.

    2011-01-01

    challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...

  12. Gene family structure, expression and functional analysis of HD-Zip III genes in angiosperm and gymnosperm forest trees

    OpenAIRE

    C?t?, Caroline L; Boileau, Francis; Roy, Vicky; Ouellet, Mario; Levasseur, Caroline; Morency, Marie-Jos?e; Cooke, Janice EK; S?guin, Armand; MacKay, John J

    2010-01-01

    Abstract Background Class III Homeodomain Leucine Zipper (HD-Zip III) proteins have been implicated in the regulation of cambium identity, as well as primary and secondary vascular differentiation and patterning in herbaceous plants. They have been proposed to regulate wood formation but relatively little evidence is available to validate such a role. We characterised and compared HD-Zip III gene family in an angiosperm tree, Populus spp. (poplar), and the gymnosperm Picea glauca (white spruc...

  13. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  14. Comparative genomics and evolution of the HSP90 family of genes across all kingdoms of organisms

    Directory of Open Access Journals (Sweden)

    Zhong Daibin

    2006-06-01

    Full Text Available Abstract Background HSP90 proteins are essential molecular chaperones involved in signal transduction, cell cycle control, stress management, and folding, degradation, and transport of proteins. HSP90 proteins have been found in a variety of organisms suggesting that they are ancient and conserved. In this study we investigate the nuclear genomes of 32 species across all kingdoms of organisms, and all sequences available in GenBank, and address the diversity, evolution, gene structure, conservation and nomenclature of the HSP90 family of genes across all organisms. Results Twelve new genes and a new type HSP90C2 were identified. The chromosomal location, exon splicing, and prediction of whether they are functional copies were documented, as well as the amino acid length and molecular mass of their polypeptides. The conserved regions across all protein sequences, and signature sequences in each subfamily were determined, and a standardized nomenclature system for this gene family is presented. The proeukaryote HSP90 homologue, HTPG, exists in most Bacteria species but not in Archaea, and it evolved into three lineages (Groups A, B and C via two gene duplication events. None of the organellar-localized HSP90s were derived from endosymbionts of early eukaryotes. Mitochondrial TRAP and endoplasmic reticulum HSP90B separately originated from the ancestors of HTPG Group A in Firmicutes-like organisms very early in the formation of the eukaryotic cell. TRAP is monophyletic and present in all Animalia and some Protista species, while HSP90B is paraphyletic and present in all eukaryotes with the exception of some Fungi species, which appear to have lost it. Both HSP90C (chloroplast HSP90C1 and location-undetermined SP90C2 and cytosolic HSP90A are monophyletic, and originated from HSP90B by independent gene duplications. HSP90C exists only in Plantae, and was duplicated into HSP90C1 and HSP90C2 isoforms in higher plants. HSP90A occurs across all

  15. Determining Mean Predicted Performance for Army Job Families

    National Research Council Canada - National Science Library

    Zeidner, Joseph

    2003-01-01

    ...). The specific research objectives are as follows: 1. To compute regression weights for the 7 ASVAB tests to form assignment composites corresponding to the two alternative second-tier structures (9 or 17 families...

  16. Genome-wide analysis of SAUR gene family in Solanaceae species.

    Science.gov (United States)

    Wu, Jian; Liu, Songyu; He, Yanjun; Guan, Xiaoyan; Zhu, Xiangfei; Cheng, Lin; Wang, Jie; Lu, Gang

    2012-11-01

    The plant hormone auxin plays a vital role in regulating many aspects of plant growth and development. Small auxin up-regulated RNAs (SAURs) are primary auxin response genes hypothesized to be involved in auxin signaling pathway, but their functions remain unclear. Here, a genome-wide search for SAUR gene homologues in Solanaceae species identified 99 and 134 members of SAUR gene family from tomato and potato, respectively. Phylogenetic analysis indicated that the SAUR proteins from Arabidopsis, rice, sorghum, tomato and potato were divided into four major groups with 16 subgroups. Among them, 25 histidine-rich SAURs genes with metal-binding characteristics were found in Arabidopsis, sorghum and Solanaceae species, but not in rice. Using tomato as a model, a comprehensive overview of SAUR gene family is presented, including the gene structures, phylogeny and chromosome locations. Quantitative real-time PCR analysis indicated that 11 randomly selected SlSAUR genes in tomato could be expressed at least in one of the tomato organs/tissues tested. However, different SlSAUR genes displayed distinctive expression levels. SlSAUR16 and SlSAUR71 exhibited highly tissue-specific expression patterns. Almost all of the detected SlSAURs showed an accumulating pattern of mRNA along tomato flower and fruit development. Some of them displayed differential response to exogenous IAA treatment. The abiotic (cold, salt and drought) stresses significantly modified transcript levels of SlSAURs genes. Most of them were down-regulated in response to abiotic stresses (drought, heat and salinity), but SlSAUR58, as a histidine-rich SAUR gene, was up-regulated after salt treatment, indicating that it may play a specific role in the salt signaling transduction pathway. Our comparative analysis provides some basic genomic information for the SAUR genes in the Solanaceae species and will pave the way for deciphering their function during plant development. Copyright © 2012 Elsevier B.V. All

  17. Genome-wide identification and characterization of phospholipase C gene family in cotton (Gossypium spp.).

    Science.gov (United States)

    Zhang, Bing; Wang, Yanmei; Liu, Jin-Yuan

    2018-01-01

    Phospholipase C (PLC) are important regulatory enzymes involved in several lipid and Ca 2+ -dependent signaling pathways. Previous studies have elucidated the versatile roles of PLC genes in growth, development and stress responses of many plants, however, the systematic analyses of PLC genes in the important fiber-producing plant, cotton, are still deficient. In this study, through genome-wide survey, we identified twelve phosphatidylinositol-specific PLC (PI-PLC) and nine non-specific PLC (NPC) genes in the allotetraploid upland cotton Gossypium hirsutum and nine PI-PLC and six NPC genes in two diploid cotton G. arboretum and G.raimondii, respectively. The PI-PLC and NPC genes of G. hirsutum showed close phylogenetic relationship with their homologous genes in the diploid cottons and Arabidopsis. Segmental and tandem duplication contributed greatly to the formation of the gene family. Expression profiling indicated that few of the PLC genes are constitutely expressed, whereas most of the PLC genes are preferentially expressed in specific tissues and abiotic stress conditions. Promoter analyses further implied that the expression of these PLC genes might be regulated by MYB transcription factors and different phytohormones. These results not only suggest an important role of phospholipase C members in cotton plant development and abiotic stress response but also provide good candidate targets for future molecular breeding of superior cotton cultivars.

  18. A novel mutation in the calcium channel gene in a family with hypokalemic periodic paralysis.

    Science.gov (United States)

    Hirano, Makito; Kokunai, Yosuke; Nagai, Asami; Nakamura, Yusaku; Saigoh, Kazumasa; Kusunoki, Susumu; Takahashi, Masanori P

    2011-10-15

    Hypokalemic periodic paralysis (HypoPP) type 1 is an autosomal dominant disease caused by mutations in the Ca(V)1.1 calcium channel encoded by the CACNA1S gene. Only seven mutations have been found since the discovery of the causative gene in 1994. We describe a patient with HypoPP who had a high serum potassium concentration after recovery from a recent paralysis, which complicated the correct diagnosis. This patient and other affected family members had a novel mutation, p.Arg900Gly, in the CACNA1S gene. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  20. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1......). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks...

  1. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  2. Does Family Control Affect Trade Performance? Evidence for Italian Firms

    OpenAIRE

    Giorgio Barba Navaretti; Riccardo Faini; Alessandra Tucci

    2008-01-01

    This paper examines whether the export decision of firms is affected by their ownership structure, specifically it looks at whether family control is an obstacle to entering foreign markets. The underlying assumption is that family firms are risk averse. Risk aversion may be an obstacle to entering foreign markets, as far as these are perceived as more volatile and risky than the domestic one, particularly when such choice entices bearing relatively high sunk costs. We develop an illustrative...

  3. Identification and expression analysis of WRKY family genes under biotic and abiotic stresses in Brassica rapa.

    Science.gov (United States)

    Kayum, Md Abdul; Jung, Hee-Jeong; Park, Jong-In; Ahmed, Nasar Uddin; Saha, Gopal; Yang, Tae-Jin; Nou, Ill-Sup

    2015-02-01

    WRKY proteins constitute one of the largest transcription factor families in higher plants, and they are involved in multiple biological processes such as plant development, metabolism, and responses to biotic and abiotic stresses. Genes of this family have been well documented in response to many abiotic and biotic stresses in many plant species, but not yet against Pectobacterium carotovorum subsp. carotovorum and Fusarium oxysporum f.sp. conglutinans in any of the plants. Moreover, potentiality of a specific gene may vary depending on stress conditions and genotypes. To identify stress resistance-related potential WRKY genes of Brassica rapa, we analyzed their expressions against above-mentioned pathogens and cold, salt, and drought stresses in B. rapa. Stress resistance-related functions of all Brassica rapa WRKY (BrWRKY) genes were firstly analyzed through homology study with existing biotic and abiotic stress resistance-related WRKY genes of other plant species and found a high degree of homology. We then identified all BrWRKY genes in a Br135K microarray dataset, which was created by applying low-temperature stresses to two contrasting Chinese cabbage doubled haploid (DH) lines, Chiifu and Kenshin, and selected 41 BrWRKY genes with high and differential transcript abundance levels. These selected genes were further investigated under cold, salt, and drought stresses as well as after infection with P. carotovorum subsp. carotovorum and F. oxysporum f.sp. conglutinans in B. rapa. The selected genes showed an organ-specific expression, and 22 BrWRKY genes were differentially expressed in Chiifu compared to Kenshin under cold and drought stresses. Six BrWRKY genes were more responsive in Kenshin compared to Chiffu under salt stress. In addition, eight BrWRKY genes showed differential expression after P. carotovorum subsp. carotovorum infection and five genes after F. oxysporum f.sp. conglutinans infection in B. rapa. Thus, the differentially expressed Br

  4. The nicotinic acetylcholine receptor gene family of the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Zhang Chuan-Xi

    2007-09-01

    Full Text Available Abstract Background Nicotinic acetylcholine receptors (nAChRs mediate fast synaptic cholinergic transmission in the insect central nervous system. The insect nAChR is the molecular target of a class of insecticides, neonicotinoids. Like mammalian nAChRs, insect nAChRs are considered to be made up of five subunits, coded by homologous genes belonging to the same family. The nAChR subunit genes of Drosophila melanogaster, Apis mellifera and Anopheles gambiae have been cloned previously based on their genome sequences. The silkworm Bombyx mori is a model insect of Lepidoptera, among which are many agricultural pests. Identification and characterization of B. mori nAChR genes could provide valuable basic information for this important family of receptor genes and for the study of the molecular mechanisms of neonicotinoid action and resistance. Results We searched the genome sequence database of B. mori with the fruit fly and honeybee nAChRs by tBlastn and cloned all putative silkworm nAChR cDNAs by reverse transcriptase-polymerase chain reaction (RT-PCR and rapid amplification of cDNA ends (RACE methods. B. mori appears to have the largest known insect nAChR gene family to date, including nine α-type subunits and three β-type subunits. The silkworm possesses three genes having low identity with others, including one α and two β subunits, α9, β2 and β3. Like the fruit fly and honeybee counterparts, silkworm nAChR gene α6 has RNA-editing sites, and α4, α6 and α8 undergo alternative splicing. In particular, alternative exon 7 of Bmα8 may have arisen from a recent duplication event. Truncated transcripts were found for Bmα4 and Bmα5. Conclusion B. mori possesses a largest known insect nAChR gene family characterized to date, including nine α-type subunits and three β-type subunits. RNA-editing, alternative splicing and truncated transcripts were found in several subunit genes, which might enhance the diversity of the gene family.

  5. The role of retrotransposons in gene family expansions in the human and mouse genomes

    Czech Academy of Sciences Publication Activity Database

    Janoušek, Václav; Laukaitis, C. M.; Yanchukov, Alexey; Karn, R. C.

    2016-01-01

    Roč. 8, č. 9 (2016), s. 2632-2650 ISSN 1759-6653 R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 Keywords : gene families * transposable elements * retrotransposons * LINE * LTR * SINE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.979, year: 2016

  6. [From gene to disease; tumor necrosis factor receptor and a syndrome of familial periodic fever

    NARCIS (Netherlands)

    Simon, A.; Drenth, J.P.H.; Meer, J.W.M. van der

    2001-01-01

    Familial Hibernian fever (FHF) is a rare hereditary syndrome that causes periodic attacks of fever and inflammation. It is an autosomal dominantly inherited disorder. The gene involved in FHF encodes for a receptor for tumour necrosis factor (TNFR1). These mutations are thought to result in impaired

  7. Rare variants in axonogenesis genes connect three families with sound-color synesthesia.

    Science.gov (United States)

    Tilot, Amanda K; Kucera, Katerina S; Vino, Arianna; Asher, Julian E; Baron-Cohen, Simon; Fisher, Simon E

    2018-03-20

    Synesthesia is a rare nonpathological phenomenon where stimulation of one sense automatically provokes a secondary perception in another. Hypothesized to result from differences in cortical wiring during development, synesthetes show atypical structural and functional neural connectivity, but the underlying molecular mechanisms are unknown. The trait also appears to be more common among people with autism spectrum disorder and savant abilities. Previous linkage studies searching for shared loci of large effect size across multiple families have had limited success. To address the critical lack of candidate genes, we applied whole-exome sequencing to three families with sound-color (auditory-visual) synesthesia affecting multiple relatives across three or more generations. We identified rare genetic variants that fully cosegregate with synesthesia in each family, uncovering 37 genes of interest. Consistent with reports indicating genetic heterogeneity, no variants were shared across families. Gene ontology analyses highlighted six genes- COL4A1 , ITGA2 , MYO10 , ROBO3 , SLC9A6 , and SLIT2 -associated with axonogenesis and expressed during early childhood when synesthetic associations are formed. These results are consistent with neuroimaging-based hypotheses about the role of hyperconnectivity in the etiology of synesthesia and offer a potential entry point into the neurobiology that organizes our sensory experiences. Copyright © 2018 the Author(s). Published by PNAS.

  8. Discovery AP2/ERF family genes in silico in Medicago truncatula

    African Journals Online (AJOL)

    aghomotsegin

    Discovery AP2/ERF family genes in silico in. Medicago truncatula. Zhifei Zhang*, Qian Zhou, Zhijian Yang and Jingpeng Jiang. College of Agronomy, Hunan Agricultural University, Furong District, Changsha, Hunan Province 410128, P.R. China. Accepted 27 May, 2013. Medicago truncatula is a legume model plant due to ...

  9. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands

    NARCIS (Netherlands)

    Lombardi, M. P.; Redeker, E. J.; Defesche, J. C.; Kamerling, S. W.; Trip, M. D.; Mannens, M. M.; Havekes, L. M.; Kastelein, J. J.

    2000-01-01

    Mutations in the LDL receptor are responsible for familial hypercholesterolemia (FH). At present, more than 600 mutations of the LDL receptor gene are known to underlie FH. However, the array of mutations varies considerably in different populations. Therefore, the delineation of essentially all LDL

  10. A mutation in the HSD11B2 gene in a family with apparent mineralocorticoid excess

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, R.C.; Harbison, M.D.; Wei, J.Q. [New York Hospital-Cornell Medical Center, NY (United States)] [and others

    1995-07-01

    A mutation in the HSD11B2 gene has been discovered in a consanguineous Iranian family with three sibs suffering from Apparent Mineralocorticoid Excess (AME). Sequence data demonstrate a C to T transition resulting in an R337C mutation. 9 refs., 2 figs., 3 tabs.

  11. Polymorphisms of the interleukin-1 gene family, oral microbial pathogens, and smoking in adult periodontitis

    NARCIS (Netherlands)

    Laine, ML; Farre, MA; Garcia-Gonzalez, MA; van Dijk, LJ; Ham, AJ; Winkel, EG; Crusius, JBA; Vandenbroucke, JP; van Winkelhoff, AJ; Pena, AS

    Interleukin (IL)-1alpha IL-1beta, and IL-1ra contribute to regulation of the inflammatory response in periodontal tissues. We aimed to investigate the distribution of polymorphisms in the IL-1 gene family among periodontitis patients and controls, taking into account smoking and microbiology as

  12. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  13. Genome-wide identification and analysis of FK506-binding protein family gene family in strawberry (Fragaria × ananassa).

    Science.gov (United States)

    Leng, Xiangpeng; Liu, Dan; Zhao, Mizhen; Sun, Xin; Li, Yu; Mu, Qian; Zhu, Xudong; Li, Pengyu; Fang, Jinggui

    2014-01-25

    The FK506 binding proteins (FKBPs) are abundant and ubiquitous proteins belonging to the large peptidyl-prolylcis-trans isomerase superfamily. FKBPs are known to be involved in many biological processes including hormone signaling, plant growth, and stress responses through a chaperone or an isomerization of proline residues during protein folding. The availability of complete strawberry genome sequences allowed the identification of 23 FKBP genes by HMMER and blast analysis. Chromosome scaffold locations of these FKBP genes in the strawberry genome were determined and the protein domain and motif organization of FaFKBPs analyzed. The phylogenetic relationships between strawberry FKBPs were also assessed. The expression profiles of FaFKBPs genes results revealed that most FaFKBPs were expressed in all tissues, while a few FaFKBPs were specifically expressed in some of the tissues. These data not only contribute to some better understanding of the complex regulation of the strawberry FKBP gene family, but also provide valuable information for further research in strawberry functional genomics. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Evolutionarily Dynamic, but Robust, Targeting of Resistance Genes by the miR482/2118 Gene Family in the Solanaceae.

    Science.gov (United States)

    de Vries, Sophie; Kloesges, Thorsten; Rose, Laura E

    2015-11-19

    Plants are exposed to pathogens around the clock. A common resistance response in plants upon pathogen detection is localized cell death. Given the irreversible nature of this response, multiple layers of negative regulation are present to prevent the untimely or misexpression of resistance genes. One layer of negative regulation is provided by a recently discovered microRNA (miRNA) gene family, miR482/2118. This family targets the transcripts of resistance genes in plants. We investigated the evolutionary history and specificity of this miRNA gene family within the Solanaceae. This plant family includes many important crop species, providing a set of well-defined resistance gene repertoires. Across 14 species from the Solanaceae, we identified eight distinct miR482/2118 gene family members. Our studies show conservation of miRNA type and number in the group of wild tomatoes and, to a lesser extent, throughout the Solanaceae. The eight orthologous miRNA gene clusters evolved under different evolutionary constraints, allowing for individual subfunctionalization of the miRNAs. Despite differences in the predicted targeting behavior of each miRNA, the miRNA-R-gene network is robust due to its high degree of interconnectivity and redundant targeting. Our data suggest that the miR482/2118 gene family acts as an evolutionary buffer for R-gene sequence diversity. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W

    2015-12-29

    GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

  16. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  17. The Rh protein family: gene evolution, membrane biology, and disease association.

    Science.gov (United States)

    Huang, Cheng-Han; Ye, Mao

    2010-04-01

    The Rh (Rhesus) genes encode a family of conserved proteins that share a structural fold of 12 transmembrane helices with members of the major facilitator superfamily. Interest in this family has arisen from the discovery of Rh factor's involvement in hemolytic disease in the fetus and newborn, and of its homologs widely expressed in epithelial tissues. The Rh factor and Rh-associated glycoprotein (RhAG), with epithelial cousins RhBG and RhCG, form four subgroups conferring upon vertebrates a genealogical commonality. The past decade has heralded significant advances in understanding the phylogenetics, allelic diversity, crystal structure, and biological function of Rh proteins. This review describes recent progress on this family and the molecular insights gleaned from its gene evolution, membrane biology, and disease association. The focus is on its long evolutionary history and surprising structural conservation from prokaryotes to humans, pointing to the importance of its functional role, related to but distinct from ammonium transport proteins.

  18. Candidate genes for performance in horses, including monocarboxylate transporters

    Directory of Open Access Journals (Sweden)

    Inaê Cristina Regatieri

    Full Text Available ABSTRACT: Some horse breeds are highly selected for athletic activities. The athletic potential of each animal can be measured by its performance in sports. High athletic performance depends on the animal capacity to produce energy through aerobic and anaerobic metabolic pathways, among other factors. Transmembrane proteins called monocarboxylate transporters, mainly the isoform 1 (MCT1 and its ancillary protein CD147, can help the organism to adapt to physiological stress caused by physical exercise, transporting lactate and H+ ions. Horse breeds are selected for different purposes so we might expect differences in the amount of those proteins and in the genotypic frequencies for genes that play a significant role in the performance of the animals. The study of MCT1 and CD147 gene polymorphisms, which can affect the formation of the proteins and transport of lactate and H+, can provide enough information to be used for selection of athletic horses increasingly resistant to intense exercise. Two other candidate genes, the PDK4 and DMRT3, have been associated with athletic potential and indicated as possible markers for performance in horses. The oxidation of fatty acids is highly effective in generating ATP and is controlled by the expression of PDK4 (pyruvate dehydrogenase kinase, isozyme 4 in skeletal muscle during and after exercise. The doublesex and mab-3 related transcription factor 3 (DMRT3 gene encodes an important transcription factor in the setting of spinal cord circuits controlling movement in vertebrates and may be associated with gait performance in horses. This review describes how the monocarboxylate transporters work during physical exercise in athletic horses and the influence of polymorphisms in candidate genes for athletic performance in horses.

  19. Genome-wide Identification and Expression of ARF Gene Family during Adventitious Root Development in Hot Pepper (Capsicum annuum

    Directory of Open Access Journals (Sweden)

    Huanxin ZHANG

    2017-07-01

    Full Text Available Auxin response factors (ARFs are transcription factors that activate or repress the expression of primary/early auxin response genes by binding to auxin-responsive elements (AuxREs in their promoter regions. The ARFs play important roles in diverse developmental processes. To explore the ARF gene family in hot pepper (Capsicum annuum L., we performed a genome-wide identification and expression analysis. In this study, 19 pepper ARF genes (CaARFs clustered into three phylogenetic groups (I, II, and III were comprehensively analyzed. Conserved domain analysis showed that all CaARFs contained a B3 DNA-binding domain and a middle domain, but two members lacked the carboxy-terminal dimerization (CTD domain. The number of introns in CaARF genes ranged from 1 to 13 and the gene structure was similar among genes in the same phylogenetic group. Additionally, prediction of CaARFs promoter elements and putative targets for microRNAs suggested that the regulation of CaARFs may occur at both transcriptional and posttranscriptional levels. Most CaARFs were expressed in more than one tested tissue, and most CaARFs were identified as being responsive to exogenous auxin. Moreover, time-course transcription profiles of CaARFs revealed their roles in adventitious rooting of hypocotyl cuttings from pepper seedlings. Therefore, our results will provide a foundation for better understanding the regulatory mechanisms and molecular functions of CaARFs in hot pepper.

  20. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  1. Earnings Management and Performance in Family-Controlled Firms:Evidence from an Emerging Economy

    OpenAIRE

    Mauricio Jara-Bertin; Jean P. Sepulveda

    2014-01-01

    This study introduces an earnings management dimension to compute premanipulated accounting performance to determine whether family-controlled firms have higher performance relative to non-family-controlled firms. Using a premanipulated return on assets measure for Chilean firms dataset, we find that the premanipulated performance of familycontrolled firms is superior to that of non-family-controlled firms. We also show that the presence of institutional investors in the firm’s ownership st...

  2. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  3. The odd-skipped family of zinc finger genes promotes Drosophila leg segmentation.

    Science.gov (United States)

    Hao, Irene; Green, Ryan B; Dunaevsky, Olga; Lengyel, Judith A; Rauskolb, Cordelia

    2003-11-15

    Notch signaling controls formation of joints at leg segment borders and growth of the developing Drosophila leg. Here, we identify the odd-skipped gene family as a key group of genes that function downstream of the Notch receptor to promote morphological changes associated with joint formation during leg development. odd, sob, drm, and bowl are expressed in a segmental pattern in the developing leg, and their expression is regulated by Notch signaling. Ectopic expression of odd, sob, or drm can induce invaginations in the leg disc epithelium and morphological changes in the adult leg that are characteristic of endogenous invaginating joint cells. These effects are not due to an alteration in the expression of other genes of the developing joint. While odd or drm mutant clones do not affect leg segmentation, and thus appear to act redundantly, bowl mutant clones do perturb leg development. Specifically, bowl mutant clones result in a failure of joint formation from the distal tibia to tarsal segment 5, while more proximal clones cause melanotic protrusions from the leg cuticle. Together, these results indicate that the odd-skipped family of genes mediates Notch function during leg development by promoting a specific aspect of joint formation, an epithelial invagination. As the odd-skipped family genes are involved in regulating cellular morphogenesis during both embryonic segmentation and hindgut development, we suggest that they may be required in multiple developmental contexts to induce epithelial cellular changes.

  4. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  5. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

  6. A missense mutation in the Ca-sensing receptor gene causes familial autosomal dominant hypoparathyroidism

    Energy Technology Data Exchange (ETDEWEB)

    Perry, Y.M.; Finegold, D.N.; Armitage, M.M. [Univ. of Pittsburgh, PA (United States)] [and others

    1994-09-01

    A large family was identified in which hypoparathyroidism was observed to segregate as an autosomal dominant trait in 3 generations. Linkage analysis using short tandem repeat polymorphisms linked the disease phenotype to chromosomal region 3q13. This region contains a newly identified Ca-sensing receptor (PCAR1) gene. This receptor regulates the secretion of parathyroid hormone from parathyroid cells in response to extracellular ionized Ca concentration ([Ca{sup +2}]). PCR-based single stranded conformational analysis of exonic sequences of the PCAR1 gene revealed an abnormal conformer in exon 3 in affected individuals. Direct sequencing of the amplification product from an affected and an unaffected family member showed an A {yields} G transition at nucleotide 770 of the PCAR1 gene [numbering based on the bovine sequence (Genbank accession number S67307)]. This substitution created a Msp1 restriction site which cosegregated with hypoparathyroidism in this family. This substitution was not observed in unaffected family members, unrelated spouses, or unrelated population controls. This substitution is predicted to result in the replacement of a glutamine residue at amino acid 246 by an arginine residue. The Ca-sensing receptor appears to be a member of the family of seven membrane spanning G-protein linked receptors. The extracellular location of this amino acid substitution appears to produce a gain of function mutation increasing the receptor sensitivity to [Ca{sup +2}] and decreasing the calcium {open_quotes}set point{close_quotes}. This is in contrast to the loss of function mutations observed in the PCAR1 gene in pedigrees with familial hypercalcemic hypocalciuria.

  7. Beyond classification: gene-family phylogenies from shotgun metagenomic reads enable accurate community analysis.

    Science.gov (United States)

    Riesenfeld, Samantha J; Pollard, Katherine S

    2013-06-22

    Sequence-based phylogenetic trees are a well-established tool for characterizing diversity of both macroorganisms and microorganisms. Phylogenetic methods have recently been applied to shotgun metagenomic data from microbial communities, particularly with the aim of classifying reads. But the accuracy of gene-family phylogenies that characterize evolutionary relationships among short, non-overlapping sequencing reads has not been thoroughly evaluated. To quantify errors in metagenomic read trees, we developed MetaPASSAGE, a software pipeline to generate in silico bacterial communities, simulate a sample of shotgun reads from a gene family represented in the community, orient or translate reads, and produce a profile-based alignment of the reads from which a gene-family phylogenetic tree can be built. We applied MetaPASSAGE to a variety of RNA and protein-coding gene families, built trees using a range of different phylogenetic methods, and compared the resulting trees using topological and branch-length error metrics. We identified read length as one of the major sources of error. Because phylogenetic methods use a reference database of full-length sequences from the gene family to guide construction of alignments and trees, we found that error can also be substantially reduced through increasing the size and diversity of the reference database. Finally, UniFrac analysis, which compares metagenomic samples based on a summary statistic computed over all branches in a read tree, is very robust to the level of error we observe. Bacterial community diversity can be quantified using phylogenetic approaches applied to shotgun metagenomic data. As sequencing reads get longer and more genomes across the bacterial tree of life are sequenced, the accuracy of this approach will continue to improve, opening the door to more applications.

  8. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

    Science.gov (United States)

    Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

    2013-01-01

    Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

  10. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  11. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  12. Expression analysis of LIM gene family in poplar, toward an updated phylogenetic classification

    Directory of Open Access Journals (Sweden)

    Arnaud Dominique

    2012-02-01

    Full Text Available Abstract Background Plant LIM domain proteins may act as transcriptional activators of lignin biosynthesis and/or as actin binding and bundling proteins. Plant LIM genes have evolved in phylogenetic subgroups differing in their expression profiles: in the whole plant or specifically in pollen. However, several poplar PtLIM genes belong to uncharacterized monophyletic subgroups and the expression patterns of the LIM gene family in a woody plant have not been studied. Findings In this work, the expression pattern of the twelve duplicated poplar PtLIM genes has been investigated by semi quantitative RT-PCR in different vegetative and reproductive tissues. As in other plant species, poplar PtLIM genes were widely expressed in the tree or in particular tissues. Especially, PtXLIM1a, PtXLIM1b and PtWLIM1b genes were preferentially expressed in the secondary xylem, suggesting a specific function in wood formation. Moreover, the expression of these genes and of the PtPLIM2a gene was increased in tension wood. Western-blot analysis confirmed the preferential expression of PtXLIM1a protein during xylem differentiation and tension wood formation. Genes classified within the pollen specific PLIM2 and PLIM2-like subgroups were all strongly expressed in pollen but also in cottony hairs. Interestingly, pairs of duplicated PtLIM genes exhibited different expression patterns indicating subfunctionalisations in specific tissues. Conclusions The strong expression of several LIM genes in cottony hairs and germinating pollen, as well as in xylem fibers suggests an involvement of plant LIM domain proteins in the control of cell expansion. Comparisons of expression profiles of poplar LIM genes with the published functions of closely related plant LIM genes suggest conserved functions in the areas of lignin biosynthesis, pollen tube growth and mechanical stress response. Based on these results, we propose a novel nomenclature of poplar LIM domain proteins.

  13. Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.

    Directory of Open Access Journals (Sweden)

    Giselle Sek Suan Nah

    Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.

  14. Comparative and functional triatomine genomics reveals reductions and expansions in insecticide resistance-related gene families.

    Directory of Open Access Journals (Sweden)

    Lucila Traverso

    2017-02-01

    Full Text Available Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs, Cytochromes P450 (CYPs and Carboxyl/Cholinesterases (CCEs. Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease.The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms

  15. 2 Novel deletions of the sterol 27-hydroxylase gene in a Chinese Family with Cerebrotendinous Xanthomatosis

    Directory of Open Access Journals (Sweden)

    Tian Di

    2011-10-01

    Full Text Available Abstract Background Cerebrotendinous xanthomatosis (CTX is a rare lipid-storage disease. We investigated the clinic manifestation, histopathology and sterol 27-hydroxylase gene (CYP27A1 in a Chinese family with Cerebrotendinous Xanthomatosis (CTX. Case Presentation A 36-year-old female with typical CTX clinical manifestation had Spindle-shaped lipid crystal clefts in xanthomas and "onion-like demyelination" in sural nerve. The patient was compound heterozygote carrying two deletions in exon 1 (c.73delG and exon 2 (c.369_375delGTACCCA. The family memebers were carriers. Conclusions A Chinese family with Cerebrotendinous Xanthomatosis had typical clinical manifestation. CYP27A1 mutations were found in the proband and all other family members.

  16. High genetic abundance of Rpi-blb2/Mi-1.2/Cami gene family in Solanaceae.

    Science.gov (United States)

    Zhao, Lina; Zhang, Qijun; Gao, Rongchao; Yang, Sihai; Liu, Haoxuan; Zhang, Xiaohui

    2015-09-30

    Three NBS-LRR genes, Rpi-blb2, Mi-1.2, and Cami, constitute a very special plant resistance gene family. These genes confer resistance against 4 distantly related pathogen species in 3 different Solanaceae hosts. To characterize this noted resistance, we conducted a series of studies on this gene family. First, homologs of this gene family were identified in the pepper, tomato and potato genomes. This revealed a large variation in copy number within this gene family among species and a great divergence was found both between and within species. To gain more information pertaining to gene resistance within this family, 121 LRR regions were cloned in 16 different wild/cultivated potato accessions. Again, frequent copy number variations and a high level of divergence between homolog were observed common among accessions. The divergence within species was so high that it reaches the level of divergence between species. Also, frequent frameshift mutations and abundant gene conversion events were identified in these LRR regions. Our findings suggest that this family harbors an unusually high level of genetic abundance, making it of particular interest. Together with other reported examples, our study also provides evidence that multi-resistance is a common trait in R gene families like this.

  17. Adaptive evolution in the Arabidopsis MADS-box gene family inferred from its complete resolved phylogeny

    Science.gov (United States)

    Martínez-Castilla, León Patricio; Alvarez-Buylla, Elena R.

    2003-01-01

    Gene duplication is a substrate of evolution. However, the relative importance of positive selection versus relaxation of constraints in the functional divergence of gene copies is still under debate. Plant MADS-box genes encode transcriptional regulators key in various aspects of development and have undergone extensive duplications to form a large family. We recovered 104 MADS sequences from the Arabidopsis genome. Bayesian phylogenetic trees recover type II lineage as a monophyletic group and resolve a branching sequence of monophyletic groups within this lineage. The type I lineage is comprised of several divergent groups. However, contrasting gene structure and patterns of chromosomal distribution between type I and II sequences suggest that they had different evolutionary histories and support the placement of the root of the gene family between these two groups. Site-specific and site-branch analyses of positive Darwinian selection (PDS) suggest that different selection regimes could have affected the evolution of these lineages. We found evidence for PDS along the branch leading to flowering time genes that have a direct impact on plant fitness. Sites with high probabilities of having been under PDS were found in the MADS and K domains, suggesting that these played important roles in the acquisition of novel functions during MADS-box diversification. Detected sites are targets for further experimental analyses. We argue that adaptive changes in MADS-domain protein sequences have been important for their functional divergence, suggesting that changes within coding regions of transcriptional regulators have influenced phenotypic evolution of plants. PMID:14597714

  18. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  19. Global analysis of the MATE gene family of metabolite transporters in tomato.

    Science.gov (United States)

    Santos, Adolfo Luís Dos; Chaves-Silva, Samuel; Yang, Lina; Maia, Lucas Gontijo Silva; Chalfun-Júnior, Antonio; Sinharoy, Senjuti; Zhao, Jian; Benedito, Vagner Augusto

    2017-10-30

    Species in the Solanaceae family are known for producing plethora of specialized metabolites. In addition to biosynthesis pathways, a full comprehension of secondary metabolism must also take into account the transport and subcellular compartmentalization of substances. Here, we examined the MATE (Multidrug and Toxic Compound Extrusion, or Multi-Antimicrobial Extrusion) gene family in the tomato (Solanum lycopersicum) genome with the objective of better understanding the transport of secondary metabolites in this model species. MATE membrane effluxers encompass an ancient gene family of secondary transporters present in all kingdoms of life, but with a remarkable expansion in plants. They mediate the transport of primary and secondary metabolites using the proton motive force through several membrane systems of the cell. We identified 67 genes coding for MATE transporters in the tomato genome, 33 of which are expressed constitutively whereas 34 are expressed in specific cell types or environmental conditions. Synteny analyses revealed bona fide paralogs and Arabidopsis orthologs. Co-expression analysis between MATE and regulatory genes revealed 78 positive and 8 negative strong associations (ρ≥|0.8|). We found no evidence of MATE transporters belonging to known metabolic gene clusters in tomato. Altogether, our expression data, phylogenetic analyses, and synteny study provide strong evidence of functional homologies between MATE genes of tomato and Arabidopsis thaliana. Our co-expression study revealed potential transcriptional regulators of MATE genes that warrant further investigation. This work sets the stage for genome-wide functional analyses of MATE transporters in tomato and other Solanaceae species of economic relevance.

  20. Genome-wide analysis of the GST gene family in Gossypium hirsutum L.

    Science.gov (United States)

    Xu, Lei; Chen, Wen; Si, Guo-Yang; Huang, Yi-Yuan; Lin, Yi; Cai, Yong-Ping; Gao, Jun-Shan

    2017-08-20

    Glutathione-S-transferase (GST) is a ubiquitous multi-functional protein superfamily that plays important roles in plant primary and secondary metabolism, stress and intercellular signal transduction. Concomitantly, it also functions as a ligand in the metabolism of plant hormones and substance transport. In order to understand the GST gene family in upland cotton (Gossypium hirsutum L.), herein we analyzed the species, evolutionary relationship, physical location, gene structure, conserved motifs and expression patterns. We identified 70 GST genes in the whole genome of upland cotton, and divided them into U, F, T, Z, EF1Bγ and TCHQD groups by phylogenetic tree and gene structure analyses. The gene mapping analysis indicated that the GST genes were on every chromosome except chromosome AD/At2, AD/At4, AD/At5, AD/Dt5 and AD/Dt10. Moreover, the GST gene cluster appeared on four chromosomes (AD/At9, AD/Dt7, AD/Dt12 and AD/Dt13). qRT-PCR assays showed that eight genes (GhGSTF2-9) were expressed in the root, stem, leave and fiber of different developmental stages while GhGSTF1 might be a pseudogene. Combining qRT-PCR and bioinformatic analysis, we speculated that GhGSTF8 might be involved in the transport and accumulation of proanthocyanidins/anthocyanins; GhGSTF4, 6 and 9 might play roles in regulating the growth and stress response of upland cotton; the function of GhGSTF2, 3, 5 and 7 remains to be further investigated. Our work provides a theoretical basis for further studies on the molecular evolution and function of the GST gene family in upland cotton.

  1. Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

    1995-12-01

    T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

  2. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    Directory of Open Access Journals (Sweden)

    Chen Aiqun

    2012-06-01

    Full Text Available Abstract Background In plants, sucrose synthase (Sus is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7 identified from diploid fiber cotton (Gossypium arboreum. Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development.

  3. Genome-wide analysis of the MYB gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Zhou, Changpin; Chen, Yanbo; Wu, Zhenying; Lu, Wenjia; Han, Jinli; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2015-11-01

    The MYB proteins comprise one of the largest transcription factor families in plants, and play key roles in regulatory networks controlling development, metabolism, and stress responses. A total of 125 MYB genes (JcMYB) have been identified in the physic nut (Jatropha curcas L.) genome, including 120 2R-type MYB, 4 3R-MYB, and 1 4R-MYB genes. Based on exon-intron arrangement of MYBs from both lower (Physcomitrella patens) and higher (physic nut, Arabidopsis, and rice) plants, we can classify plant MYB genes into ten groups (MI-X), except for MIX genes which are nonexistent in higher plants. We also observed that MVIII genes may be one of the most ancient MYB types which consist of both R2R3- and 3R-MYB genes. Most MYB genes (76.8% in physic nut) belong to the MI group which can be divided into 34 subgroups. The JcMYB genes were nonrandomly distributed on its 11 linkage groups (LGs). The expansion of MYB genes across several subgroups was observed and resulted from genome triplication of ancient dicotyledons and from both ancient and recent tandem duplication events in the physic nut genome. The expression patterns of several MYB duplicates in the physic nut showed differences in four tissues (root, stem, leaf, and seed), and 34 MYB genes responded to at least one abiotic stressor (drought, salinity, phosphate starvation, and nitrogen starvation) in leaves and/or roots based on the data analysis of digital gene expression tags. Overexpression of the JcMYB001 gene in Arabidopsis increased its sensitivity to drought and salinity stresses. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Phosphomannosylation and the Functional Analysis of the Extended Candida albicans MNN4-Like Gene Family

    Directory of Open Access Journals (Sweden)

    Roberto J. González-Hernández

    2017-11-01

    Full Text Available Phosphomannosylation is a modification of cell wall proteins that occurs in some species of yeast-like organisms, including the human pathogen Candida albicans. These modified mannans confer a negative charge to the wall, which is important for the interactions with phagocytic cells of the immune systems and cationic antimicrobial peptides. In Saccharomyces cerevisiae, the synthesis of phosphomannan relies on two enzymes, the phosphomannosyltransferase Ktr6 and its positive regulator Mnn4. However, in C. albicans, at least three phosphomannosyltransferases, Mnn4, Mnt3 and Mnt5, participate in the addition of phosphomannan. In addition to MNN4, C. albicans has a MNN4-like gene family composed of seven other homologous members that have no known function. Here, using the classical mini-Ura-blaster approach and the new gene knockout CRISPR-Cas9 system for gene disruption, we generated mutants lacking single and multiple genes of the MNN4 family; and demonstrate that, although Mnn4 has a major impact on the phosphomannan content, MNN42 was also required for full protein phosphomannosylation. The reintroduction of MNN41, MNN42, MNN46, or MNN47 in a genetic background lacking MNN4 partially restored the phenotype associated with the mnn4Δ null mutant, suggesting that there is partial redundancy of function between some family members and that the dominant effect of MNN4 over other genes could be due to its relative abundance within the cell. We observed that additional copies of alleles number of any of the other family members, with the exception of MNN46, restored the phosphomannan content in cells lacking both MNT3 and MNT5. We, therefore, suggest that phosphomannosylation is achieved by three groups of proteins: [i] enzymes solely activated by Mnn4, [ii] enzymes activated by the dual action of Mnn4 and any of the products of other MNN4-like genes, with exception of MNN46, and [iii] activation of Mnt3 and Mnt5 by Mnn4 and Mnn46. Therefore

  5. Rare variants in axonogenesis genes connect three families with sound–color synesthesia

    Science.gov (United States)

    Kucera, Katerina S.; Vino, Arianna; Asher, Julian E.; Baron-Cohen, Simon

    2018-01-01

    Synesthesia is a rare nonpathological phenomenon where stimulation of one sense automatically provokes a secondary perception in another. Hypothesized to result from differences in cortical wiring during development, synesthetes show atypical structural and functional neural connectivity, but the underlying molecular mechanisms are unknown. The trait also appears to be more common among people with autism spectrum disorder and savant abilities. Previous linkage studies searching for shared loci of large effect size across multiple families have had limited success. To address the critical lack of candidate genes, we applied whole-exome sequencing to three families with sound–color (auditory–visual) synesthesia affecting multiple relatives across three or more generations. We identified rare genetic variants that fully cosegregate with synesthesia in each family, uncovering 37 genes of interest. Consistent with reports indicating genetic heterogeneity, no variants were shared across families. Gene ontology analyses highlighted six genes—COL4A1, ITGA2, MYO10, ROBO3, SLC9A6, and SLIT2—associated with axonogenesis and expressed during early childhood when synesthetic associations are formed. These results are consistent with neuroimaging-based hypotheses about the role of hyperconnectivity in the etiology of synesthesia and offer a potential entry point into the neurobiology that organizes our sensory experiences. PMID:29507195

  6. Gene-based segregation method for identifying rare variants in family-based sequencing studies.

    Science.gov (United States)

    Qiao, Dandi; Lange, Christoph; Laird, Nan M; Won, Sungho; Hersh, Craig P; Morrow, Jarrett; Hobbs, Brian D; Lutz, Sharon M; Ruczinski, Ingo; Beaty, Terri H; Silverman, Edwin K; Cho, Michael H

    2017-05-01

    Whole-exome sequencing using family data has identified rare coding variants in Mendelian diseases or complex diseases with Mendelian subtypes, using filters based on variant novelty, functionality, and segregation with the phenotype within families. However, formal statistical approaches are limited. We propose a gene-based segregation test (GESE) that quantifies the uncertainty of the filtering approach. It is constructed using the probability of segregation events under the null hypothesis of Mendelian transmission. This test takes into account different degrees of relatedness in families, the number of functional rare variants in the gene, and their minor allele frequencies in the corresponding population. In addition, a weighted version of this test allows incorporating additional subject phenotypes to improve statistical power. We show via simulations that the GESE and weighted GESE tests maintain appropriate type I error rate, and have greater power than several commonly used region-based methods. We apply our method to whole-exome sequencing data from 49 extended pedigrees with severe, early-onset chronic obstructive pulmonary disease (COPD) in the Boston Early-Onset COPD study (BEOCOPD) and identify several promising candidate genes. Our proposed methods show great potential for identifying rare coding variants of large effect and high penetrance for family-based sequencing data. The proposed tests are implemented in an R package that is available on CRAN (https://cran.r-project.org/web/packages/GESE/). © 2017 WILEY PERIODICALS, INC.

  7. Analysis of phylogenetic and functional diverge in plant nine-cis epoxycarotenoid dioxygenase gene family.

    Science.gov (United States)

    Priya, R; Siva, Ramamoorthy

    2015-07-01

    During different environmental stress conditions, plant growth is regulated by the hormone abscisic acid (an apocarotenoid). In the biosynthesis of abscisic acid, the oxidative cleavage of cis-epoxycarotenoid catalyzed by 9-cis-epoxycarotenoid dioxygenase (NCED) is the crucial step. The NCED genes were isolated in numerous plant species and those genes were phylogenetically investigated to understand the evolution of NCED genes in various plant lineages comprising lycophyte, gymnosperm, dicot and monocot. A total of 93 genes were obtained from 48 plant species to statistically estimate their sequence conservation and functional divergence. Selaginella moellendorffii appeared to be evolutionarily distinct from those of the angiosperms, insisting the substantial influence of natural selection pressure on NCED genes. Further, using exon-intron structure analysis, the gene structures of NCED were found to be conserved across some species. In addition, the substitution rate ratio of non-synonymous (Ka) versus synonymous (Ks) mutations using the Bayesian inference approach, depicted the critical amino acid residues for functional divergence. A significant functional divergence was found between some subgroups through the co-efficient of type-I functional divergence. Our results suggest that the evolution of NCED genes occurred by duplication, diversification and exon intron loss events. The site-specific profile and functional diverge analysis revealed NCED genes might facilitate the tissue-specific functional divergence in NCED sub-families, that could combat different environmental stress conditions aiding plant survival.

  8. An Efficient Test for Gene-Environment Interaction in Generalized Linear Mixed Models with Family Data.

    Science.gov (United States)

    Mazo Lopera, Mauricio A; Coombes, Brandon J; de Andrade, Mariza

    2017-09-27

    Gene-environment (GE) interaction has important implications in the etiology of complex diseases that are caused by a combination of genetic factors and environment variables. Several authors have developed GE analysis in the context of independent subjects or longitudinal data using a gene-set. In this paper, we propose to analyze GE interaction for discrete and continuous phenotypes in family studies by incorporating the relatedness among the relatives for each family into a generalized linear mixed model (GLMM) and by using a gene-based variance component test. In addition, we deal with collinearity problems arising from linkage disequilibrium among single nucleotide polymorphisms (SNPs) by considering their coefficients as random effects under the null model estimation. We show that the best linear unbiased predictor (BLUP) of such random effects in the GLMM is equivalent to the ridge regression estimator. This equivalence provides a simple method to estimate the ridge penalty parameter in comparison to other computationally-demanding estimation approaches based on cross-validation schemes. We evaluated the proposed test using simulation studies and applied it to real data from the Baependi Heart Study consisting of 76 families. Using our approach, we identified an interaction between BMI and the Peroxisome Proliferator Activated Receptor Gamma ( PPARG ) gene associated with diabetes.

  9. An Efficient Test for Gene-Environment Interaction in Generalized Linear Mixed Models with Family Data

    Directory of Open Access Journals (Sweden)

    Mauricio A. Mazo Lopera

    2017-09-01

    Full Text Available Gene-environment (GE interaction has important implications in the etiology of complex diseases that are caused by a combination of genetic factors and environment variables. Several authors have developed GE analysis in the context of independent subjects or longitudinal data using a gene-set. In this paper, we propose to analyze GE interaction for discrete and continuous phenotypes in family studies by incorporating the relatedness among the relatives for each family into a generalized linear mixed model (GLMM and by using a gene-based variance component test. In addition, we deal with collinearity problems arising from linkage disequilibrium among single nucleotide polymorphisms (SNPs by considering their coefficients as random effects under the null model estimation. We show that the best linear unbiased predictor (BLUP of such random effects in the GLMM is equivalent to the ridge regression estimator. This equivalence provides a simple method to estimate the ridge penalty parameter in comparison to other computationally-demanding estimation approaches based on cross-validation schemes. We evaluated the proposed test using simulation studies and applied it to real data from the Baependi Heart Study consisting of 76 families. Using our approach, we identified an interaction between BMI and the Peroxisome Proliferator Activated Receptor Gamma (PPARG gene associated with diabetes.

  10. Conserved and Diversified Gene Families of Monovalent Cation/H+ Antiporters from Algae to Flowering Plants

    Directory of Open Access Journals (Sweden)

    Salil eChanroj

    2012-02-01

    Full Text Available All organisms have evolved strategies to regulate ion and pH homeostasis in response to developmental and environmental cues. One strategy is mediated by cation-proton antiporters (CPA. CPA1 genes found in bacteria, fungi, metazoa and plants have been functionally-characterized; though roles of plant CPA2 genes in KEA (K+-efflux antiporter and CHX (cation/H+ exchanger families are largely unknown. Phylogenetic analysis showed that three clades of the Na+-H+ exchanger (NHX family have been conserved from single-celled alga to Arabidopsis. These are i plasma membrane-bound SOS1/AtNHX7 that share ancestry with prokaryote NhaP, ii endosomal AtNHX5/6 that is part of the eukaryote Intracellular-NHE clade, and iii a vacuolar NHX clade (AtNHX1-4 specific to plants. Early diversification of KEA genes possibly from ancestral genes of a cyanobacterium is suggested for three K+-efflux antiporter clades (KEA/Kef seen in all plants. Intriguingly, the CHX gene family blossomed from a few members in early land plants to >40 genes in legumes. Homologs from spirogyra or moss share high similarity with guard cell-specific AtCHX20, suggesting that AtCHX20 and its relatives (AtCHX16-19 are founders of the family. Evolutionary analysis suggests pollen-expressed CHX genes appeared later in monocots and early eudicots. AtCHX proteins have been localized to intracellular and plasma membrane of plants, and shown to mediate K+ transport and pH homeostasis. Thus KEA genes are conserved from green algae to angiosperms, and their presence in red algae and secondary endosymbionts suggest a role in plastids. In contrast, AtNHX1-4 subtype evolved in ancestral plants to handle ion homeostasis of vacuoles in all cell types. The strong presence of CHX genes in land plants, but not in metazoa or fungi, would infer a role of ion and pH homeostasis at dynamic endomembranes to support vegetative and reproductive success of flowering plants.

  11. Molecular genetic analysis of consanguineous families with primary microcephaly identified pathogenic variants in the ASPM gene.

    Science.gov (United States)

    Khan, Muzammil Ahmad; Windpassinger, Christian; Ali, Muhammad Zeeshan; Zubair, Muhammad; Gul, Hadia; Abbas, Safdar; Khan, Saadullah; Badar, Muhammad; Mohammad, Ramzi M; Nawaz, Zafar

    2017-06-01

    Autosomal recessive primary microcephaly is a rare genetic disorder that is characterized by reduced head circumference and a varying degree of intellectual disability. Genetic studies on consanguineous families with primary microcephaly have identified 15 (MCPH) causative genes that include MCPH1, WDR62, CDK5RAP2, CASC5, ASPM, CENPJ, STIL, CEP135, CEP152, ZNF335, PHC1, CDK6, CENPE, SASS6 MFSD2A ANKLE2 and CIT (Khan et al. 2014; Yamamoto et al. 2014; Alakbarzade et al. 2015;Morris-Rosendahl and Kaindl 2015; Basit et al. 2016). Physiologically, most of these MCPH proteins are involved in cell cycle and its regulation. In the present clinical genetic study, we have present two consanguineous Pakistani families segregating primary microcephaly and intellectual disability. These families were ascertained from the Saraiki ethnic part of Khyber-Pakhtunkhwa province in Pakistan. Whole exome sequencing in one family revealed a novel 1-bp deletion NM_018136.4: c.10013delA (p.Asp3338Valfs*2), while the other family showed a previously reported nonsense mutation NM_018136.4: c.9730C>T (rs199422195 (p.Arg3244*)) in ASPM gene. The novel frame-shift mutation (p.Asp3338Valfs*2) in ASPM presumably truncates the protein synthesis that results in loss of armadillo-type fold domain.

  12. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica

    NARCIS (Netherlands)

    Pessina, S.; Pavan, S.N.C.; Catalano, D.; Gallotta, A.; Visser, R.G.F.; Bai, Y.; Malnoy, M.; Schouten, H.J.

    2014-01-01

    Background Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO

  13. Genome-wide characterization of the MADS-box gene family in radish (Raphanus sativus L. and assessment of its roles in flowering and floral organogenesis

    Directory of Open Access Journals (Sweden)

    Chao Li

    2016-09-01

    Full Text Available The MADS-box gene family is an important transcription factor (TF family that is involved in various aspects of plant growth and development, especially flowering time and floral organogenesis. Although it has been reported in many plant species, the systematic identification and characterization of MADS-box TF family is still limited in radish (Raphanus sativus L.. In the present study, a comprehensive analysis of MADS-box genes was performed, and a total of 144 MADS-box family members were identified from the whole radish genome. Meanwhile, a detailed list of MADS-box genes from other 28 plant species was also investigated. Through the phylogenetic analysis between radish and Arabidopsis thaliana, all the RsMADS genes were classified into two groups including 68 type I (31 Mα, 12 Mβ and 25Mγ and 76 type II (70 MIKCC and 6 MIKC*. Among them, 41 (28.47% RsMADS genes were located in nine linkage groups of radish from R1 to R9. Moreover, the homologous MADS-box gene pairs were identified among radish, A. thaliana, Chinese cabbage and rice. Additionally, the expression profiles of RsMADS genes were systematically investigated in different tissues and growth stages. Furthermore, quantitative real-time PCR analysis was employed to validate expression patterns of some crucial RsMADS genes. These results could provide a valuable resource to explore the potential functions of RsMADS genes in radish, and facilitate dissecting MADS-box gene-mediated molecular mechanisms underlying flowering and floral organogenesis in root vegetable crops.

  14. Association of killer cell immunoglobulin-like receptor genes with Hodgkin's lymphoma in a familial study.

    Directory of Open Access Journals (Sweden)

    Caroline Besson

    Full Text Available BACKGROUND: Epstein-Barr virus (EBV is the major environmental factor associated with Hodgkin's lymphoma (HL, a common lymphoma in young adults. Natural killer (NK cells are key actors of the innate immune response against viruses. The regulation of NK cell function involves activating and inhibitory Killer cell Immunoglobulin-like receptors (KIRs, which are expressed in variable numbers on NK cells. Various viral and virus-related malignant disorders have been associated with the presence/absence of certain KIR genes in case/control studies. We investigated the role of the KIR cluster in HL in a family-based association study. METHODOLOGY: We included 90 families with 90 HL index cases (age 16-35 years and 255 first-degree relatives (parents and siblings. We developed a procedure for reconstructing full genotypic information (number of gene copies at each KIR locus from the standard KIR gene content. Out of the 90 collected families, 84 were informative and suitable for further analysis. An association study was then carried out with specific family-based analysis methods on these 84 families. PRINCIPAL FINDINGS: Five KIR genes in strong linkage disequilibrium were found significantly associated with HL. Refined haplotype analysis showed that the association was supported by a dominant protective effect of KIR3DS1 and/or KIR2DS1, both of which are activating receptors. The odds ratios for developing HL in subjects with at least one copy of KIR3DS1 or KIR2DS1 with respect to subjects with neither of these genes were 0.44[95% confidence interval 0.23-0.85] and 0.42[0.21-0.85], respectively. No significant association was found in a tentative replication case/control study of 68 HL cases (age 18-71 years. In the familial study, the protective effect of KIR3DS1/KIR2DS1 tended to be stronger in HL patients with detectable EBV in blood or tumour cells. CONCLUSIONS: This work defines a template for family-based association studies based on full

  15. Structure and expression of B-myc, a new member of the myc gene family.

    OpenAIRE

    Ingvarsson, S; Asker, C; Axelson, H; Klein, G; Sümegi, J

    1988-01-01

    The myc family of genes contains five functional members. We describe the cloning of a new member of the myc family from rat genomic and cDNA libraries, designated B-myc. A fragment of cloned B-myc was used to map the corresponding rat locus by Southern blotting of DNA prepared from rat X mouse somatic cell hybrids. B-myc mapped to rat chromosome 3. We have previously mapped the c-myc to rat chromosome 7 (J. Sümegi, J. Spira, H. Bazin, J. Szpirer, G. Levan, and G. Klein, Nature [London] 306:4...

  16. Parathyroid hormone gene family in a cartilaginous fish, the elephant shark (Callorhinchus milii).

    Science.gov (United States)

    Liu, Yang; Ibrahim, Alexander S; Tay, Boon-Hui; Richardson, Samantha J; Bell, Justin; Walker, Terence I; Brenner, Sydney; Venkatesh, Byrappa; Danks, Janine A

    2010-12-01

    The development of bone was a major step in the evolution of vertebrates. A bony skeleton provided structural support and a calcium reservoir essential for the movement from an aquatic to a terrestrial environment. Cartilaginous fishes are the oldest living group of jawed vertebrates. In this study we have identified three members of the parathyroid hormone (Pth) gene family in a cartilaginous fish, the elephant shark (Callorhinchus milii). The three genes include two Pth genes, designated as Pth1 and Pth2, and a Pthrp gene. Phylogenetic analysis suggested that elephant shark Pth2 is an ancient gene whose orthologue is lost in bony vertebrates. The Pth1 and Pth2 genes have the same structure as the Pth gene in bony vertebrates, whereas the structure of the Pthrp gene is more complex in tetrapods compared with elephant shark. The three elephant shark genes showed distinct patterns of expression, with Pth2 being expressed only in the brain and spleen. This contrasts with localization of the corresponding proteins, which showed considerable overlap in their distribution. There were conserved sites of localization for Pthrp between elephant shark and mammals, including tissues such as kidney, skin, skeletal and cardiac muscle, pancreas, and cartilage. The elephant shark Pth1(1-34) and Pthrp(1-34) peptides were able to stimulate cAMP accumulation in mammalian UMR106.01 cells. However, Pth2(1-34) peptide did not show such PTH-like biologic activity. The presence of Pth and Pthrp genes in the elephant shark indicates that these genes played fundamental roles before their recruitment to bone development in bony jawed vertebrates. Copyright © 2010 American Society for Bone and Mineral Research.

  17. Aux/IAA gene family is conserved in the gymnosperm, loblolly pine (Pinus taeda).

    Science.gov (United States)

    Goldfarb, Barry; Lanz-Garcia, Carmen; Lian, Zhigang; Whetten, Ross

    2003-12-01

    We isolated five members of the Aux/IAA gene family in loblolly pine (Pinus taeda L.). Degenerate primers complementary to conserved regions of angiosperm Aux/IAA genes were used to amplify fragments that were, in turn, used as probes to screen a cDNA library constructed from auxin-treated hypocotyls. The five unique clones, named PTIAA1-5, contain the four highly conserved domains that are characteristic of the Aux/IAA proteins. All clones contain the bipartite nuclear localization signal (NLS) between Domains I and II that is predicted in most angiosperm Aux/IAA genes, but only one, PTIAA2, contains the conserved NLS in Domain IV. The five invariant residues in Domain II that have been found to constitute part of a protein destabilization element in Arabidopsis thaliana (L.) Heynh. are conserved in all the PTIAAs. A postulated phosphorylation site located between Domains I and II and proximal to the conserved bipartite NLS was conserved in 20 out of 36 genes in this analysis, including the pine genes. Transcripts of all five PTIAAs accumulated specifically in the hypocotyls in response to exogenous auxin treatment and were induced by all auxins tested. Transcript abundance above basal levels in response to 1-naphthaleneacetic acid treatment was first detected after 10 min (PTIAA3) to 3 h (PTIAA2) in the different genes and remained above basal levels throughout 7 days. Induction of PTIAA2 was inhibited by the protein synthesis inhibitor cycloheximide, indicating that PTIAA2 is a secondary response gene. Phylogenetic analysis showed that all five pine genes clustered within a single class (Class I) of the dendrogram. Clone PTIAA2 has a sequence that is relatively distinct from the other four and is the most closely related to the angiosperm genes of Class I. Class I contains both primary and secondary auxin response genes, suggesting that it is the original lineage and that other gene classes have evolved subsequent to the angiosperm/gymnosperm divergence.

  18. Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dong, Chun-Juan; Shang, Qing-Mao

    2013-07-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.

  19. A novel missense mutation of ADAR1 gene in a Chinese family ...

    Indian Academy of Sciences (India)

    2017-12-18

    Dec 18, 2017 ... This study was mainlyto explore the pathogenic mutation of ADAR1 gene and provide genetics counselling and prenatal diagnostic testing for childbearing individuals.Mutational analysis of ADAR1 gene was performed by polymerase chain reaction (PCR) and electrophoretic separation of PCR products by ...

  20. Genome-wide analysis and expression profiles of NTMC2 family genes in Oryza sativa.

    Science.gov (United States)

    Huang, Rui; Zhao, Jin; Liu, Jin; Wang, Yingdian; Han, Shengcheng; Zhao, Heping

    2017-12-30

    N-terminal-TM-C2 domain proteins (NTMC2), which share domain architecture and sequence similarity to synaptotagmins (Syts) in mammals and FAM62 (extended Syts) in metazoans, form a small gene family in plants. Previous studies showed that the Arabidopsis thaliana NTMC2 type 1.1 protein (NTMC2T1.1, named AtSyt1) possesses calcium- and membrane-binding activities that allow it to function in a plasma membrane repair pathway induced by stress. However, we lack understanding of the diverse biological roles of plant NTMC2 family genes. In this study, a total of 13 OsNTMC2 genes was identified through a comprehensive bioinformatics analysis of the rice (Oryza sativa L.) genome and classified into six OsNTMC2 groups (OsNTMC2T1 to OsNTMC2T6) based on phylogeny and motif constitution. OsNTMC2T1 to OsNTMC2T3 have two calcium-binding domains (C2A and C2B), but OsNTMC2T4 to OsNTMC2T6 have single C2 domain. The expression profiles of OsNTMC2 genes were analysed at different stages of vegetative and reproductive development. This analysis revealed that at least one OsNTMC2 gene was abundantly expressed at each stage of development. These results should facilitate research on this gene family and provide new insights elucidating their functions in higher plants. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Identification and characterization of the abscisic acid (ABA) receptor gene family and its expression in response to hormones in the rubber tree.

    Science.gov (United States)

    Guo, Dong; Zhou, Ying; Li, Hui-Liang; Zhu, Jia-Hong; Wang, Ying; Chen, Xiong-Ting; Peng, Shi-Qing

    2017-03-23

    Abscisic acid (ABA) is an essential phytohormone involved in diverse physiological processes. Although genome-wide analyses of the ABA receptor PYR/PYL/RCAR (PYL) protein/gene family have been performed in certain plant species, little is known about the ABA receptor protein/gene family in the rubber tree (Hevea brasiliensis). In this study, we identified 14 ABA receptor PYL proteins/genes (designated HbPYL1 through HbPYL14) in the most recent rubber tree genome. A phylogenetic tree was constructed, which demonstrated that HbPYLs can be divided into three subfamilies that correlate well with the corresponding Arabidopsis subfamilies. Eight HbPYLs are highly expressed in laticifers. Five of the eight genes are simultaneously regulated by ABA, jasmonic acid (JA) and ethylene (ET). The identification and characterization of HbPYLs should enable us to further understand the role of ABA signal in the rubber tree.

  2. Expression of the Bovine NK-Lysin Gene Family and Activity against Respiratory Pathogens.

    Directory of Open Access Journals (Sweden)

    Junfeng Chen

    Full Text Available Unlike the genomes of many mammals that have a single NK-lysin gene, the cattle genome contains a family of four genes, one of which is expressed preferentially in the lung. In this study, we compared the expression of the four bovine NK-lysin genes in healthy animals to animals challenged with pathogens known to be associated with bovine respiratory disease (BRD using transcriptome sequencing (RNA-seq. The expression of several NK-lysins, especially NK2C, was elevated in challenged relative to control animals. The effects of synthetic peptides corresponding to functional region helices 2 and 3 of each gene product were tested on both model membranes and bio-membranes. Circular dichroism spectroscopy indicated that these peptides adopted a more helical secondary structure upon binding to an anionic model membrane and liposome leakage assays suggested that these peptides disrupt membranes. Bacterial killing assays further confirmed the antimicrobial effects of these peptides on BRD-associated bacteria, including both Pasteurella multocida and Mannhemia haemolytica and an ultrastructural examination of NK-lysin-treated P. multocida cells by transmission electron microscopy revealed the lysis of target membranes. These studies demonstrate that the expanded bovine NK-lysin gene family is potentially important in host defense against pathogens involved in bovine respiratory disease.

  3. Crustacean neuropeptide genes of the CHH/MIH/GIH family: implications from molecular studies.

    Science.gov (United States)

    Chan, Siu-Ming; Gu, Pei-Li; Chu, Ka-Hou; Tobe, Stephen S

    2003-12-01

    The crustacean eyestalk CHH/MIH/GIH gene family represents a unique group of neuropeptide originally identified in crustaceans. These neuropeptides shared a high degree of amino acid identity, and the conservation of cysteine residues at the same relative positions. Based on their biological, biochemical, and molecular properties, they can be divided into the CHH and MIH subtypes with two major members in each subtype. In the shrimp, the CHH-subtypes can be divided into two forms (CHH-A and CHH-B). The CHH-A gene also comprises several isoforms which shared a high overall sequence identity. Although the MIH subtypes are postulated to have evolved from the CHH subtypes, the number of major MIH subtypes in each species has yet to be confirmed. While most of the genes consist of the basic plan of three exons and two introns, other alternative spliced variants have recently been described. Moreover, these alternative forms are usually expressed in non-eyestalk tissues. These findings suggest that these neuropeptides may have a broader spectrum of functions in crustaceans. The results from phylogenetic analysis suggest that the evolution of this group of neuropeptides occurs in a manner similar is to the gene duplication and mutation events hypothesized for the origin of the prolactin and growth hormone gene family of the vertebrate pituitary system.

  4. The retinoblastoma gene family in cell cycle regulation and suppression of tumorigenesis.

    Science.gov (United States)

    Dannenberg, Jan-Hermen; te Riele, Hein P J

    2006-01-01

    Since its discovery in 1986, as the first tumor suppressor gene, the retinoblastoma gene (Rb) has been extensively studied. Numerous biochemical and genetic studies have elucidated in great detail the function of the Rb gene and placed it at the heart of the molecular machinery controlling the cell cycle. As more insight was gained into the genetic events required for oncogenic transformation, it became clear that the retinoblastoma gene is connected to biochemical pathways that are dysfunctional in virtually all tumor types. Besides regulating the E2F transcription factors, pRb is involved in numerous biological processes such as apoptosis, DNA repair, chromatin modification, and differentiation. Further complexity was added to the system with the discovery of p107 and p130, two close homologs of Rb. Although the three family members share similar functions, it is becoming clear that these proteins also have unique functions in differentiation and regulation of transcription. In contrast to Rb, p107 and p130 are rarely found inactivated in human tumors. Yet, evidence is accumulating that these proteins are part of a "tumor-surveillance" mechanism and can suppress tumorigenesis. Here we provide an overview of the knowledge obtained from studies involving the retinoblastoma gene family with particular focus on its role in suppressing tumorigenesis.

  5. The first missense mutation of NHS gene in a Tunisian family with clinical features of NHS syndrome including cardiac anomaly.

    Science.gov (United States)

    Chograni, Manèl; Rejeb, Imen; Jemaa, Lamia Ben; Châabouni, Myriam; Bouhamed, Habiba Chaabouni

    2011-08-01

    Nance-Horan Syndrome (NHS) or X-linked cataract-dental syndrome is a disease of unknown gene action mechanism, characterized by congenital cataract, dental anomalies, dysmorphic features and, in some cases, mental retardation. We performed linkage analysis in a Tunisian family with NHS in which affected males and obligate carrier female share a common haplotype in the Xp22.32-p11.21 region that contains the NHS gene. Direct sequencing of NHS coding exons and flanking intronic sequences allowed us to identify the first missense mutation (P551S) and a reported SNP-polymorphism (L1319F) in exon 6, a reported UTR-SNP (c.7422 C>T) and a novel one (c.8239 T>A) in exon 8. Both variations P551S and c.8239 T>A segregate with NHS phenotype in this family. Although truncations, frame-shift and copy number variants have been reported in this gene, no missense mutations have been found to segregate previously. This is the first report of a missense NHS mutation causing NHS phenotype (including cardiac defects). We hypothesize also that the non-reported UTR-SNP of the exon 8 (3'-UTR) is specific to the Tunisian population.

  6. Mutational analysis ofBRCA1andBRCA2genes in Peruvian families with hereditary breast and ovarian cancer.

    Science.gov (United States)

    Buleje, Jose; Guevara-Fujita, Maria; Acosta, Oscar; Huaman, Francia D P; Danos, Pierina; Murillo, Alexis; Pinto, Joseph A; Araujo, Jhajaira M; Aguilar, Alfredo; Ponce, Jaime; Vigil, Carlos; Castaneda, Carlos; Calderon, Gabriela; Gomez, Henry L; Fujita, Ricardo

    2017-09-01

    Breast cancer is one of the most prevalent malignancies in the world. In Peru, breast cancer is the second cause of death among women. Five to ten percent of patients present a high genetic predisposition due to BRCA1 and BRCA2 germline mutations. We performed a comprehensive analysis of BRCA1 and BRCA2 genes by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) to detect large rearrangements in patients from 18 families, which met the criteria for hereditary breast cancer. In this series, we found four pathogenic mutations, three previously reported ( BRCA1 : c.302-1G>C and c.815_824dup10; BRCA2 : c.5946delT) and a duplication of adenines in exon 15 in BRCA1 gene (c.4647_4648dupAA, ClinVar SCV000256598.1). We also found two exonic and four intronic variants of unknown significance and 28 polymorphic variants. This is the first report to determine the spectrum of mutations in the BRCA1/BRCA2 genes in Peruvian families selected by clinical and genetic criteria. The alteration rate in BRCA1/BRCA2 with proven pathogenic mutation was 22.2% (4 out 18) and this finding could be influenced by the reduced sample size or clinical criteria. In addition, we found three known BRCA1/BRCA2 mutations and a BRCA1 c.4647_4648dupAA as a novel pathogenic mutation.

  7. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... studied NAC genes to be important for signalling processes and for the execution of degradation processes during leaf senescence in barley. Seven models for DNA-binding motifs for NAC transcription factors were designed based on published motifs, and available promoter sequences of barley genes were...

  8. Effects of Family Ownership, Debt and Board Composition on Mexican Firms Performance

    Directory of Open Access Journals (Sweden)

    Juan Manuel San Martin-Reyna

    2015-03-01

    Full Text Available This study examines the relationship between ownership structure and performance of public firms in Mexico, considering debt and the structure of the board of directors as contextual and institutional factors. This research seeks to explain the mixed results about the relationship of ownership and performance presented by other relevant studies in family and non-family businesses, mainly in emerging countries. The results confirm the positive association between family ownership concentration and performance, calculated by Tobin’s Q, showing how the participation of inside shareholders on the board and a low debt level contribute to higher performance. However, the association of these variables with performance shows a contrasting effect in the case of family as compared to non-family businesses. The particular corporate legal context in Mexico could be highlighted as one of the main reasons for these results.

  9. Genome-wide comparative analysis of the IQD gene families in Arabidopsis thaliana and Oryza sativa

    Science.gov (United States)

    Abel, Steffen; Savchenko, Tatyana; Levy, Maggie

    2005-01-01

    Background Calcium signaling plays a prominent role in plants for coordinating a wide range of developmental processes and responses to environmental cues. Stimulus-specific generation of intracellular calcium transients, decoding of calcium signatures, and transformation of the signal into cellular responses are integral modules of the transduction process. Several hundred proteins with functions in calcium signaling circuits have been identified, and the number of downstream targets of calcium sensors is expected to increase. We previously identified a novel, calmodulin-binding nuclear protein, IQD1, which stimulates glucosinolate accumulation and plant defense in Arabidopsis thaliana. Here, we present a comparative genome-wide analysis of a new class of putative calmodulin target proteins in Arabidopsis and rice. Results We identified and analyzed 33 and 29 IQD1-like genes in Arabidopsis thaliana and Oryza sativa, respectively. The encoded IQD proteins contain a plant-specific domain of 67 conserved amino acid residues, referred to as the IQ67 domain, which is characterized by a unique and repetitive arrangement of three different calmodulin recruitment motifs, known as the IQ, 1-5-10, and 1-8-14 motifs. We demonstrated calmodulin binding for IQD20, the smallest IQD protein in Arabidopsis, which consists of a C-terminal IQ67 domain and a short N-terminal extension. A striking feature of IQD proteins is the high isoelectric point (~10.3) and frequency of serine residues (~11%). We compared the Arabidopsis and rice IQD gene families in terms of gene structure, chromosome location, predicted protein properties and motifs, phylogenetic relationships, and evolutionary history. The existence of an IQD-like gene in bryophytes suggests that IQD proteins are an ancient family of calmodulin-binding proteins and arose during the early evolution of land plants. Conclusion Comparative phylogenetic analyses indicate that the major IQD gene lineages originated before the

  10. Updated Multiplex PCR for Detection of All Six Plasmid-Mediated qnr Gene Families.

    Science.gov (United States)

    Kraychete, Gabriela Bergiante; Botelho, Larissa Alvarenga Batista; Campana, Eloiza Helena; Picão, Renata Cristina; Bonelli, Raquel Regina

    2016-12-01

    Plasmid-mediated qnr genes have been reported in bacteria worldwide and are widely associated with other relevant determinants of resistance in multiresistance plasmids. Here, we provide an update on a previously described multiplex PCR in order to detect all six qnr families (including qnrA, qnrS, qnrB, qnrC, qnrD, and qnrVC) described until now. The proposed method makes possible the screening of these genes, reducing cost and time, and it may demonstrate an underestimated prevalence of the latest variants described. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. A large and functionally diverse family of Fad2 genes in safflower (Carthamus tinctorius L.

    Directory of Open Access Journals (Sweden)

    Cao Shijiang

    2013-01-01

    Full Text Available Abstract Background The application and nutritional value of vegetable oil is highly dependent on its fatty acid composition, especially the relative proportion of its two major fatty acids, i.e oleic acid and linoleic acid. Microsomal oleoyl phosphatidylcholine desaturase encoded by FAD2 gene is known to introduce a double bond at the Δ12 position of an oleic acid on phosphatidylcholine and convert it to linoleic acid. The known plant FAD2 enzymes are encoded by small gene families consisting of 1-4 members. In addition to the classic oleate Δ12-desaturation activity, functional variants of FAD2 that are capable of undertaking additional or alternative acyl modifications have also been reported in a limited number of plant species. In this study, our objective was to identify FAD2 genes from safflower and analyse their differential expression profile and potentially diversified functionality. Results We report here the characterization and functional expression of an exceptionally large FAD2 gene family from safflower, and the temporal and spatial expression profiles of these genes as revealed through Real-Time quantitative PCR. The diversified functionalities of some of the safflower FAD2 gene family members were demonstrated by ectopic expression in yeast and transient expression in Nicotiana benthamiana leaves. CtFAD2-1 and CtFAD2-10 were demonstrated to be oleate desaturases specifically expressed in developing seeds and flower head, respectively, while CtFAD2-2 appears to have relatively low oleate desaturation activity throughout the plant. CtFAD2-5 and CtFAD2-8 are specifically expressed in root tissues, while CtFAD2-3, 4, 6, 7 are mostly expressed in the cotyledons and hypocotyls in young safflower seedlings. CtFAD2-9 was found to encode a novel desaturase operating on C16:1 substrate. CtFAD2-11 is a tri-functional enzyme able to introduce a carbon double bond in either cis or trans configuration, or a carbon triple (acetylenic bond

  12. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development

    International Nuclear Information System (INIS)

    Gao, Junpeng; Cao, Xiaoli; Shi, Shandang; Ma, Yuling; Wang, Kai; Liu, Shengjie; Chen, Dan; Chen, Qin; Ma, Haoli

    2016-01-01

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. - Highlights: • A systematic analysis of the potato AUX/IAA gene family were performed. • StIAA genes were related to auxin perception and signal transduction. • Candidate StIAA genes likely related to tuber initiation and expansion were screened.

  13. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Junpeng [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Innovation Experimental College, Northwest A& F University, Yangling, Shaanxi 712100 (China); Cao, Xiaoli; Shi, Shandang [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Ma, Yuling [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Innovation Experimental College, Northwest A& F University, Yangling, Shaanxi 712100 (China); Wang, Kai; Liu, Shengjie [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Chen, Dan [School of Life Sciences and Technology, Xidian University, Xi' an, Shaanxi 710071 (China); Chen, Qin [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Ma, Haoli, E-mail: mahaoli@nwsuaf.edu.cn [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China)

    2016-03-04

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. - Highlights: • A systematic analysis of the potato AUX/IAA gene family were performed. • StIAA genes were related to auxin perception and signal transduction. • Candidate StIAA genes likely related to tuber initiation and expansion were screened.

  14. Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

    Science.gov (United States)

    Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

    2015-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

  15. Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

    Directory of Open Access Journals (Sweden)

    Yun Wang

    Full Text Available Oculocutaneous albinism (OCA is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR and OCA2 gene, respectively.The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families.Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR, sequenced and compared with a reference database.Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively. The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure.This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene may be responsible for partial clinical manifestations of OCA.

  16. Lampreys have a single gene cluster for the fast skeletal myosin heavy chain gene family.

    Directory of Open Access Journals (Sweden)

    Daisuke Ikeda

    Full Text Available Muscle tissues contain the most classic sarcomeric myosin, called myosin II, which consists of 2 heavy chains (MYHs and 4 light chains. In the case of humans (tetrapod, a total of 6 fast skeletal-type MYH genes (MYHs are clustered on a single chromosome. In contrast, torafugu (teleost contains at least 13 fast skeletal MYHs, which are distributed in 5 genomic regions; the MYHs are clustered in 3 of these regions. In the present study, the evolutionary relationship among fast skeletal MYHs is elucidated by comparing the MYHs of teleosts and tetrapods with those of cyclostome lampreys, one of two groups of extant jawless vertebrates (agnathans. We found that lampreys contain at least 3 fast skeletal MYHs, which are clustered in a head-to-tail manner in a single genomic region. Although there was apparent synteny in the corresponding MYH cluster regions between lampreys and tetrapods, phylogenetic analysis indicated that lamprey and tetrapod MYHs have independently duplicated and diversified. Subsequent transgenic approaches showed that the 5'-flanking sequences of Japanese lamprey fast skeletal MYHs function as a regulatory sequence to drive specific reporter gene expression in the fast skeletal muscle of zebrafish embryos. Although zebrafish MYH promoters showed apparent activity to direct reporter gene expression in myogenic cells derived from mice, promoters from Japanese lamprey MYHs had no activity. These results suggest that the muscle-specific regulatory mechanisms are partially conserved between teleosts and tetrapods but not between cyclostomes and tetrapods, despite the conserved synteny.

  17. Evolution and expression analysis of the grape (Vitis vinifera L.) WRKY gene family.

    Science.gov (United States)

    Guo, Chunlei; Guo, Rongrong; Xu, Xiaozhao; Gao, Min; Li, Xiaoqin; Song, Junyang; Zheng, Yi; Wang, Xiping

    2014-04-01

    WRKY proteins comprise a large family of transcription factors that play important roles in plant defence regulatory networks, including responses to various biotic and abiotic stresses. To date, no large-scale study of WRKY genes has been undertaken in grape (Vitis vinifera L.). In this study, a total of 59 putative grape WRKY genes (VvWRKY) were identified and renamed on the basis of their respective chromosome distribution. A multiple sequence alignment analysis using all predicted grape WRKY genes coding sequences, together with those from Arabidopsis thaliana and tomato (Solanum lycopersicum), indicated that the 59 VvWRKY genes can be classified into three main groups (I-III). An evaluation of the duplication events suggested that several WRKY genes arose before the divergence of the grape and Arabidopsis lineages. Moreover, expression profiles derived from semiquantitative PCR and real-time quantitative PCR analyses showed distinct expression patterns in various tissues and in response to different treatments. Four VvWRKY genes showed a significantly higher expression in roots or leaves, 55 responded to varying degrees to at least one abiotic stress treatment, and the expression of 38 were altered following powdery mildew (Erysiphe necator) infection. Most VvWRKY genes were downregulated in response to abscisic acid or salicylic acid treatments, while the expression of a subset was upregulated by methyl jasmonate or ethylene treatments.

  18. Genome wide in silico characterization of Dof gene families of pigeonpea (Cajanus cajan (L) Millsp.).

    Science.gov (United States)

    Malviya, N; Gupta, S; Singh, V K; Yadav, M K; Bisht, N C; Sarangi, B K; Yadav, D

    2015-02-01

    The DNA binding with One Finger (Dof) protein is a plant specific transcription factor involved in the regulation of wide range of processes. The analysis of whole genome sequence of pigeonpea has identified 38 putative Dof genes (CcDof) distributed on 8 chromosomes. A total of 17 out of 38 CcDof genes were found to be intronless. A comprehensive in silico characterization of CcDof gene family including the gene structure, chromosome location, protein motif, phylogeny, gene duplication and functional divergence has been attempted. The phylogenetic analysis resulted in 3 major clusters with closely related members in phylogenetic tree revealed common motif distribution. The in silico cis-regulatory element analysis revealed functional diversity with predominance of light responsive and stress responsive elements indicating the possibility of these CcDof genes to be associated with photoperiodic control and biotic and abiotic stress. The duplication pattern showed that tandem duplication is predominant over segmental duplication events. The comparative phylogenetic analysis of these Dof proteins along with 78 soybean, 36 Arabidopsis and 30 rice Dof proteins revealed 7 major clusters. Several groups of orthologs and paralogs were identified based on phylogenetic tree constructed. Our study provides useful information for functional characterization of CcDof genes.

  19. Identification and Phylogenetic Analysis of the POLYGALACTURONASE Gene Family in Apple

    Directory of Open Access Journals (Sweden)

    Hongfei Chen

    2016-09-01

    Full Text Available In this study, a total of 85 apple polygalacturonase genes were characterized and clustered into seven groups based on the Malus × domestica whole-genome sequence. These genes coded for proteins containing 176–1 125 amino acids with isoelectric points ranging from 4.68 to 9.58. The predicted MdPG genes were distributed on all chromosomes except the 14th. We then systematically analyzed conserved MdPG protein motifs and the structures of MdPG genes. We identified MdPG proteins containing four conserved motifs that are widely found in different PG proteins. Additionally, we found that MdPG75 was the largest gene, encompassing 18 exons. Finally, we systematically analyzed the functional connection network of MdPG proteins and predicted the functions of related MdPG genes before undertaking a preliminary validation. Overall, we have described the genome-wide identification and analysis of the apple PG gene family.

  20. miR-92a family and their target genes in tumorigenesis and metastasis

    International Nuclear Information System (INIS)

    Li, Molin; Guan, Xingfang; Sun, Yuqiang; Mi, Jun; Shu, Xiaohong; Liu, Fang; Li, Chuangang

    2014-01-01

    The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis

  1. miR-92a family and their target genes in tumorigenesis and metastasis

    Energy Technology Data Exchange (ETDEWEB)

    Li, Molin, E-mail: molin_li@hotmail.com [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Guan, Xingfang; Sun, Yuqiang [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Mi, Jun [Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Shu, Xiaohong [College of Pharmacy, Dalian Medical University Cancer Center, Dalian 116044 (China); Liu, Fang [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China); Li, Chuangang, E-mail: li_chuangang@sina.com [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China)

    2014-04-15

    The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis.

  2. Novel heterozygous nonsense mutation of the OPTN gene segregating in a Danish family with ALS

    DEFF Research Database (Denmark)

    Tümer, Zeynep; Bertelsen, Birgitte; Gredal, Ole

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disorder. About 10% of ALS cases are familial (FALS) and the genetic defect is known only in approximately 20%-30% of these cases. The most common genetic cause of ALS is SOD1 (superoxide dismutase 1) mutation. Very recently......, mutations of the optineurin gene (OPTN), which is involved in open-angle glaucoma, were identified in 3 Japanese patients/families with ALS, and subsequently in a few FALS patients of European descent. We found a heterozygous nonsense mutation (c.493C>T, p.Gln165X, exon 6) in the OPTN gene in a Danish...... patient with ALS, and the mutation segregated from his affected father. The p.Gln165X mutation could not be detected in 1070 healthy Danish controls, in 1000 Danish individuals with metabolic phenotypes or in 64 sporadic ALS (SALS) cases. The p.Gln165X mutation described in this study is the first...

  3. Gene analysis techniques and susceptibility gene discovery in non-BRCA1/BRCA2 familial breast cancer.

    Science.gov (United States)

    Aloraifi, Fatima; Boland, Michael R; Green, Andrew J; Geraghty, James G

    2015-06-01

    Breast cancer is the leading cause of cancer deaths in females worldwide occurring in both hereditary and sporadic forms. Women with inherited pathogenic mutations in the BRCA1 or BRCA2 genes have up to an 85% risk of developing breast cancer in their lifetimes. These patients are candidates for risk-reduction measures such as intensive radiological screening, prophylactic surgery or chemoprevention. However, only about 20% of familial breast cancer cases are attributed to mutations in BRCA1 and BRCA2, while a further 5-10% are attributed to mutations in other rare susceptibility genes such as TP53, STK11, PTEN, ATM and CHEK2. A multitude of genome wide association studies (GWAS) have been conducted confirming low-risk common variants associated with breast cancer in excess of 90 loci, which may contribute to a further 23% of the heritability. We currently find ourselves in "the next generation", with technologies offering deep sequencing at a fraction of the cost. Starting off primarily in a research setting, multi-gene panel testing is now utilized in the clinic to sequence multiple predisposing genes simultaneously (otherwise known as multi-gene panel testing). In this review, we focus on the hereditary breast cancer discoveries, techniques and the challenges we face in this complex disease, especially in the light of the vast amount of data we now have at hand. It has been 20 years since the first breast cancer susceptibility gene has been discovered and there has been substantial progress in unraveling the genetic component of the disease. However, hereditary breast cancer remains a challenging topic subject to common debate. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. The Medicago truncatula lysin [corrected] motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes.

    Science.gov (United States)

    Arrighi, Jean-François; Barre, Annick; Ben Amor, Besma; Bersoult, Anne; Soriano, Lidia Campos; Mirabella, Rossana; de Carvalho-Niebel, Fernanda; Journet, Etienne-Pascal; Ghérardi, Michèle; Huguet, Thierry; Geurts, René; Dénarié, Jean; Rougé, Pierre; Gough, Clare

    2006-09-01

    Rhizobial Nod factors are key symbiotic signals responsible for starting the nodulation process in host legume plants. Of the six Medicago truncatula genes controlling a Nod factor signaling pathway, Nod Factor Perception (NFP) was reported as a candidate Nod factor receptor gene. Here, we provide further evidence for this by showing that NFP is a lysin [corrected] motif (LysM)-receptor-like kinase (RLK). NFP was shown both to be expressed in association with infection thread development and to be involved in the infection process. Consistent with deviations from conserved kinase domain sequences, NFP did not show autophosphorylation activity, suggesting that NFP needs to associate with an active kinase or has unusual functional characteristics different from classical kinases. Identification of nine new M. truncatula LysM-RLK genes revealed a larger family than in the nonlegumes Arabidopsis (Arabidopsis thaliana) or rice (Oryza sativa) of at least 17 members that can be divided into three subfamilies. Three LysM domains could be structurally predicted for all M. truncatula LysM-RLK proteins, whereas one subfamily, which includes NFP, was characterized by deviations from conserved kinase sequences. Most of the newly identified genes were found to be expressed in roots and nodules, suggesting this class of receptors may be more extensively involved in nodulation than was previously known.

  5. Revisiting the phosphatidylethanolamine-binding protein (PEBP) gene family reveals cryptic FLOWERING LOCUS T gene homologs in gymnosperms and sheds new light on functional evolution.

    Science.gov (United States)

    Liu, Yan-Yan; Yang, Ke-Zhen; Wei, Xiao-Xin; Wang, Xiao-Quan

    2016-11-01

    Angiosperms and gymnosperms are two major groups of extant seed plants. It has been suggested that gymnosperms lack FLOWERING LOCUS T (FT), a key integrator at the core of flowering pathways in angiosperms. Taking advantage of newly released gymnosperm genomes, we revisited the evolutionary history of the plant phosphatidylethanolamine-binding protein (PEBP) gene family through phylogenetic reconstruction. Expression patterns in three gymnosperm taxa and heterologous expression in Arabidopsis were studied to investigate the functions of gymnosperm FT-like and TERMINAL FLOWER 1 (TFL1)-like genes. Phylogenetic reconstruction suggests that an ancient gene duplication predating the divergence of seed plants gave rise to the FT and TFL1 genes. Expression patterns indicate that gymnosperm TFL1-like genes play a role in the reproductive development process, while GymFT1 and GymFT2, the FT-like genes resulting from a duplication event in the common ancestor of gymnosperms, function in both growth rhythm and sexual development pathways. When expressed in Arabidopsis, both spruce FT-like and TFL1-like genes repressed flowering. Our study demonstrates that gymnosperms do have FT-like and TFL1-like genes. Frequent gene and genome duplications contributed significantly to the expansion of the plant PEBP gene family. The expression patterns of gymnosperm PEBP genes provide novel insight into the functional evolution of this gene family. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  6. Calcitonin gene-related peptide does not cause migraine attacks in patients with familial hemiplegic migraine

    DEFF Research Database (Denmark)

    Hansen, Jakob M; Thomsen, Lise L; Olesen, Jes

    2011-01-01

    Calcitonin gene-related peptide (CGRP) is a key molecule in migraine pathogenesis. Intravenous CGRP triggers migraine-like attacks in patients with migraine with aura and without aura. In contrast, patients with familial hemiplegic migraine (FHM) with known mutations did not report more migraine......-like attacks compared to controls. Whether CGRP triggers migraine-like attacks in FHM patients without known mutations is unknown....

  7. Novel missense mutations and unexpected multiple changes of RYR1 gene in 75 malignant hyperthermia families.

    Science.gov (United States)

    Tammaro, A; Di Martino, A; Bracco, A; Cozzolino, S; Savoia, G; Andria, B; Cannavo, A; Spagnuolo, M; Piluso, G; Aurino, S; Nigro, V

    2011-05-01

    Malignant hyperthermia (MH) is an autosomal dominant pharmacogenetic disorder of skeletal muscle characterized by disturbance of intracellular calcium homeostasis in the sarcoplasmic reticulum. Mutations of the ryanodine receptor 1 (RYR1) gene account for most cases, with some studies claiming up to 86% of mutations in this locus. However, RYR1 gene is large and variants are common even in the normal population. We examined 54 families with MH susceptibility and 21 diagnosed with equivocal MH. Thirty-five were selected for an anesthetic reaction, whereas the remainder for hyperCKemia. In these, we studied all 106 exons of the RYR1 gene. When no mutation was found, we also screened: sodium channel voltage-gated, type IV alpha subunit (SCN4A), calcium channel voltage-dependent, L type, alpha 1S subunit (CACNA1S), and L-type voltage-gated calcium channel alpha 2/delta-subunit (CACNL2A). Twenty-nine different RYR1 mutations were discovered in 40 families. Three other MH genes were tested in negative cases. Fourteen RYR1 amino acid changes were novel, of which 12 were located outside the mutational 'hot spots'. In two families, the known mutation p.R3903Q was also observed in malignant hyperthermia-nonsusceptible (MHN) individuals. Unexpectedly, four changes were also found in the same family and two in another. Our study confirms that MH is genetically heterogeneous and that a consistent number of cases are not due to RYR1 mutations. The discordance between in vitro contracture test status and the presence of a proven causative RYR1 mutation suggests that the penetrance may vary due to as yet unknown factors. © 2010 John Wiley & Sons A/S.

  8. Genome-wide analysis and characterization of Aux/IAA family genes related to fruit ripening in papaya (Carica papaya L.).

    Science.gov (United States)

    Liu, Kaidong; Yuan, Changchun; Feng, Shaoxian; Zhong, Shuting; Li, Haili; Zhong, Jundi; Shen, Chenjia; Liu, Jinxiang

    2017-05-05

    Auxin/indole-3-acetic acid (Aux/IAA) family genes encode short-lived nuclear proteins that mediate the responses of auxin-related genes and are involved in several plant developmental and growth processes. However, how Aux/IAA genes function in the fruit development and ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive identification and a distinctive expression analysis of 18 C. papaya Aux/IAA (CpIAA) genes were performed using newly updated papaya reference genome data. The Aux/IAA gene family in papaya is slightly smaller than that in Arabidopsis, but all of the phylogenetic subfamilies are represented. Most of the CpIAA genes are responsive to various phytohormones and expressed in a tissues-specific manner. To understand the putative biological functions of the CpIAA genes involved in fruit development and ripening, quantitative real-time PCR was used to test the expression profiling of CpIAA genes at different stages. Furthermore, an IAA treatment significantly delayed the ripening process in papaya fruit at the early stages. The expression changes of CpIAA genes in ACC and 1-MCP treatments suggested a crosstalk between auxin and ethylene during the fruit ripening process of papaya. Our study provided comprehensive information on the Aux/IAA family in papaya, including gene structures, phylogenetic relationships and expression profiles. The involvement of CpIAA gene expression changes in fruit development and ripening gives us an opportunity to understand the roles of auxin signaling in the maturation of papaya reproductive organs.

  9. Analysis of inversions in the factor VIII gene in Spanish hemophilia A patients and families

    Energy Technology Data Exchange (ETDEWEB)

    Domenech, M.; Tizzano, E.; Baiget, M. [Hospital de Sant Pau, Barcelona (Spain); Altisent, C. [Hospital Vall d`Hebron, Barcelona (Spain)

    1994-09-01

    Intron 22 is the largest intron of the factor VIII gene and contains a CpG island from which two additional transcripts originate. One of these transcripts corresponds to the F8A gene which have telomeric extragenic copies in the X chromosome. An inversion involving homologous recombination between the intragenic and the distal or proximal copies of the F8A gene has been recently described as a common cause of severe hemophilia A (HA). We analyzed intron 22 rearrangements in 195 HA patients (123 familial and 72 sporadic cases). According to factor VIII levels, our sample was classified as severe in 114 cases, moderate in 29 cases and mild in 52 cases. An intron 22 (F8A) probe was hybridized to Southern blots of BcII digested DNA obtained from peripheral blood. A clear pattern of altered bands identifies distal or proximal inversions. We detected an abnormal pattern identifying an inversion in 49 (25%) of the analyzed cases. 43% of severe HA patients (49 cases) showed an inversion. As expected, no inversion was found in the moderate and mild group of patients. We found a high proportion (78%) of the distal rearrangement. From 49 identified inversions, 33 were found in familial cases (27%), while the remaining 15 were detected in sporadic patients (22%) in support that this mutational event occurs with a similar frequency in familial or sporadic cases. In addition, we detected a significant tendency of distal inversion to occur more frequently in familial cases than in sporadic cases. Inhibitor development to factor VIII was documented in approximately 1/3 of the patients with inversion. The identification of such a frequent molecular event in severe hemophilia A patients has been applied in our families to carrier and prenatal diagnosis, to determine the origin of the mutation in the sporadic cases and to detect the presence of germinal mosaicism.

  10. Neurexin gene family variants as risk factors for autism spectrum disorder.

    Science.gov (United States)

    Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran

    2018-01-01

    Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  11. Emotional intelligence and job performance: The mediating role of work-family balance.

    Science.gov (United States)

    Weinzimmer, Laurence G; Baumann, Heidi M; Gullifor, Daniel P; Koubova, Veronika

    2017-01-01

    In this study, we examine the dynamics between emotional intelligence, work-family balance, and job performance. A review of the literature to date has shown distinct relationships between emotional intelligence to job performance and work-family balance to job performance. We utilize a sample of 233 respondents to empirically test our set of hypotheses that contend work-family balance mediates the relationship between emotional intelligence and job performance. Our results support these hypotheses. Practical implications and directions for future research are discussed.

  12. Mutation analysis of GJB2 gene and prenatal diagnosis in a non-syndromic deafness family

    Directory of Open Access Journals (Sweden)

    Xiao-hua CHEN

    2014-08-01

    Full Text Available Objective To identify the pathogenic gene in a non-syndromic deafness family, provide an accurate genetic consultation and early intervention for deaf family to reduce the incidence of congenital deafness. Methods Mutation analysis was carried out by polymerase chain reaction followed by DNA sequencing of coding region of GJB2 gene. The fetal DNA was extracted from the amniotic fluid cells by amniocentesis at 20 weeks during pregnancy. The genotype of the fetus was characterized for predicting the status of hearing. Results Complex heterozygous mutations 235delC and 176-191del16bp were detected in the proband of the family, heterozygous mutation 176-191del16bp was detected in the father, and 235delC was detected in the mother. Fetus carried 235delC heterozygous mutation inherited from his mother. Conclusions The proband's hearing loss is resulted from the complex heterozygous mutations 235delC and 176-191del16bp in GJB2 gene. Fetus is a heterozygous mutation 235delC carrier. Prenatal diagnosis for deafness assisted by genetic test can provide efficient guidance about offspring's hearing condition, and prevent another deaf-mute member from birth. DOI: 10.11855/j.issn.0577-7402.2014.07.09

  13. AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families

    International Nuclear Information System (INIS)

    Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen

    2007-01-01

    Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population

  14. Identification and localisation of the NB-LRR gene family within the potato genome

    Directory of Open Access Journals (Sweden)

    Jupe Florian

    2012-02-01

    Full Text Available Abstract Background The potato genome sequence derived from the Solanum tuberosum Group Phureja clone DM1-3 516 R44 provides unparalleled insight into the genome composition and organisation of this important crop. A key class of genes that comprises the vast majority of plant resistance (R genes contains a nucleotide-binding and leucine-rich repeat domain, and is collectively known as NB-LRRs. Results As part of an effort to accelerate the process of functional R gene isolation, we performed an amino acid motif based search of the annotated potato genome and identified 438 NB-LRR type genes among the ~39,000 potato gene models. Of the predicted genes, 77 contain an N-terminal toll/interleukin 1 receptor (TIR-like domain, and 107 of the remaining 361 non-TIR genes contain an N-terminal coiled-coil (CC domain. Physical map positions were established for 370 predicted NB-LRR genes across all 12 potato chromosomes. The majority of NB-LRRs are physically organised within 63 identified clusters, of which 50 are homogeneous in that they contain NB-LRRs derived from a recent common ancestor. Conclusions By establishing the phylogenetic and positional relationship of potato NB-LRRs, our analysis offers significant insight into the evolution of potato R genes. Furthermore, the data provide a blueprint for future efforts to identify and more rapidly clone functional NB-LRR genes from Solanum species.

  15. Nonsense mutations in the shelterin complex genes ACD and TERF2IP in familial melanoma.

    Science.gov (United States)

    Aoude, Lauren G; Pritchard, Antonia L; Robles-Espinoza, Carla Daniela; Wadt, Karin; Harland, Mark; Choi, Jiyeon; Gartside, Michael; Quesada, Víctor; Johansson, Peter; Palmer, Jane M; Ramsay, Andrew J; Zhang, Xijun; Jones, Kristine; Symmons, Judith; Holland, Elizabeth A; Schmid, Helen; Bonazzi, Vanessa; Woods, Susan; Dutton-Regester, Ken; Stark, Mitchell S; Snowden, Helen; van Doorn, Remco; Montgomery, Grant W; Martin, Nicholas G; Keane, Thomas M; López-Otín, Carlos; Gerdes, Anne-Marie; Olsson, Håkan; Ingvar, Christian; Borg, Ake; Gruis, Nelleke A; Trent, Jeffrey M; Jönsson, Göran; Bishop, D Timothy; Mann, Graham J; Newton-Bishop, Julia A; Brown, Kevin M; Adams, David J; Hayward, Nicholas K

    2015-02-01

    The shelterin complex protects chromosomal ends by regulating how the telomerase complex interacts with telomeres. Following the recent finding in familial melanoma of inactivating germline mutations in POT1, encoding a member of the shelterin complex, we searched for mutations in the other five components of the shelterin complex in melanoma families. Next-generation sequencing techniques were used to screen 510 melanoma families (with unknown genetic etiology) and control cohorts for mutations in shelterin complex encoding genes: ACD, TERF2IP, TERF1, TERF2, and TINF 2. Maximum likelihood and LOD [logarithm (base 10) of odds] analyses were used. Mutation clustering was assessed with χ(2) and Fisher's exact tests. P values under .05 were considered statistically significant (one-tailed with Yates' correction). Six families had mutations in ACD and four families carried TERF2IP variants, which included nonsense mutations in both genes (p.Q320X and p.R364X, respectively) and point mutations that cosegregated with melanoma. Of five distinct mutations in ACD, four clustered in the POT1 binding domain, including p.Q320X. This clustering of novel mutations in the POT1 binding domain of ACD was statistically higher (P = .005) in melanoma probands compared with population control individuals (n = 6785), as were all novel and rare variants in both ACD (P = .040) and TERF2IP (P = .022). Families carrying ACD and TERF2IP mutations were also enriched with other cancer types, suggesting that these variants also predispose to a broader spectrum of cancers than just melanoma. Novel mutations were also observed in TERF1, TERF2, and TINF2, but these were not convincingly associated with melanoma. Our findings add to the growing support for telomere dysregulation as a key process associated with melanoma susceptibility. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Genomic organization, phylogenetic and expression analysis of the B-BOX gene family in tomato

    Directory of Open Access Journals (Sweden)

    Zhuan Nan Chu

    2016-10-01

    Full Text Available The B-BOX (BBX proteins encode a class of zinc-finger transcription factors possessing one or two B-BOX domains and in some cases an additional CCT (CO, CO-like, and TOC1 motif, which play important roles in regulating plant growth, development and stress response. Nevertheless, no systematic study of BBX genes has been undertaken in tomato (Solanum lycopersicum. Here we present the results of a genome-wide analysis of the 29 BBX genes in this important vegetable species. Their structures, conserved domains, phylogenetic relationships, subcellular localizations, and promoter cis-regulatory elements were analyzed; their tissue expression profiles and expression patterns under various hormones and stress treatments were also investigated in detail. Tomato BBX genes can be divided into five subfamilies, and thirteen of them were found to be segmentally duplicated. Real-time quantitative PCR analysis showed that most BBX genes exhibited different temporal and spatial expression patterns, such as SlBBX24, which was constitutively expressed with high abundance in nearly all tissues studied, and eight genes (SlBBX4, 5, 6, 11, 16, 18, 19, and 22 showed relatively higher expression levels in vegetative tissues and non-ripening fruits. The expression of most BBX genes can be induced by drought, polyethylene glycol-6000 or heat stress. Some BBX genes were induced strongly by phytohormones such as abscisic acid, gibberellic acid or ethephon. The majority of tomato BBX proteins was predicted to be located in nuclei, and the transient expression assay using Arabidopsis mesophyll protoplasts demonstrated that all the seven BBX members tested (SlBBX5, 7, 15, 17, 20, 22 and 24 were localized in nucleus. Our analysis of tomato BBX genes on the genome scale would provide valuable information for future functional characterization of specific genes in this family.

  17. Mutational screening in the LDLR gene among patients presenting familial hypercholesterolemia in the Southeast of Brazil.

    Science.gov (United States)

    Molfetta, G A; Zanette, D L; Santos, J E; Silva, W A

    2017-08-31

    Familial hypercholesterolemia (FH) is a dominant, autosomal disease characterized by high LDL levels in blood plasma, and is caused by a defect in the gene encoding the LDL receptor (LDLR). The clinical diagnosis is based on personal and familial history, physical examination findings, and measures of high LDL cholesterol concentrations. LDLR is a cell-surface glycoprotein that controls the level of blood plasma cholesterol and triglyceride by LDLR-mediated endocytosis. Here we sequenced the entire LDLR gene-coding region to screen for mutations in 32 patients diagnosed with FH, and we have found 20 mutations including synonymous, missense, and intronic mutations. Six of them were characterized as pathogenic mutations (D178Y, C184Y, S326C, C681X, IVS7+10G>C, and IVS11-10G>A). We have also found one intronic mutation not described so far (IVS11-63C>A). Our study corroborates the broad spectrum of mutations distributed along the entire LDLR gene, and we suggest that the genes APOB and PCSK9 should also be screened for mutations when considering the diagnosis of FH. It is already known that different types of mutations are directly associated with the phenotype heterogeneity presented by patients. Considering that Brazilian population is highly admixed, it is important to determine the geographic spectrum of LDLR mutations to provide information on the prognosis and treatment of each FH patient.

  18. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  19. Evolutionary genomics and adaptive evolution of the hedgehog gene family (Shh, Ihh and Dhh) in vertebrates

    DEFF Research Database (Denmark)

    Pereira, Joana; Johnson, Warren E.; O'Brien, Stephen J.

    2014-01-01

    The Hedgehog (Hh) gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typi...... in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots....... typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog - Shh; Indian hedgehog - Ihh; and Desert hedgehog - Dhh), each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification....... In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD) events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive...

  20. Isolation, structural analysis, and expression characteristics of the maize (Zea mays L.) hexokinase gene family.

    Science.gov (United States)

    Zhang, Zhongbao; Zhang, Jiewei; Chen, Yajuan; Li, Ruifen; Wang, Hongzhi; Ding, Liping; Wei, Jianhua

    2014-09-01

    Hexokinases (HXKs, EC 2.7.1.1) play important roles in metabolism, glucose (Glc) signaling, and phosphorylation of Glc and fructose and are ubiquitous in all organisms. Despite their physiological importance, the maize HXK (ZmHXK) genes have not been analyzed systematically. We isolated and characterized nine members of the ZmHXK gene family which were distributed on 3 of the 10 maize chromosomes. A multiple sequence alignment and motif analysis revealed that the maize ZmHXK proteins share three conserved domains. Phylogenetic analysis revealed that the ZmHXK family can be divided into four subfamilies. We identified putative cis-elements in the ZmHXK promoter sequences potentially involved in phytohormone and abiotic stress responses, sugar repression, light and circadian rhythm regulation, Ca(2+) responses, seed development and germination, and CO2-responsive transcriptional activation. To study the functions of maize HXK isoforms, we characterized the expression of the ZmHXK5 and ZmHXK6 genes, which are evolutionarily related to the OsHXK5 and OsHXK6 genes from rice. Analysis of tissue-specific expression patterns using quantitative real time-PCR showed that ZmHXK5 was highly expressed in tassels, while ZmHXK6 was expressed in both tassels and leaves. ZmHXK5 and ZmHXK6 expression levels were upregulated by phytohormones and by abiotic stress.

  1. Familial hypocalciuric hypercalcemia associated with mutation in the human Ca{sup 2+}-sensing receptor gene

    Energy Technology Data Exchange (ETDEWEB)

    Aida, Kaoru; Koishi, Sawako; Inoue, Masaharu [Univ. of Yamanashi Medical School, Yamanashi (Japan)] [and others

    1995-09-01

    Familial hypocalciuric hypercalcemia (FHH) is generally characterized by lifelong hypercalcemia without hypercalciuria and is inherited in an autosomal dominant manner. Affected individuals show abnormal parathyroid and renal responses to changes in the extracellular calcium concentration. A Japanese FHH family was screened for mutations in the Ca{sup 2+} -sensing receptor gene by the polymerase chain reaction and single strand conformation polymorphism. The proband with hypercalcemia showed an abnormal pattern in exon 1 of the gene, whereas her two sisters with normocalcemia showed a normal pattern. The consanguineous parents with borderline serum calcium concentrations showed both patterns. Nucleotide sequence analysis identified a G{yields}C point mutation at nucleotide 118 that resulted in the conversion of the normal codon for proline into a codon for alanine at amino acid 40 (numbered according to the bovine complementary DNA). The proband was homozygous for the mutation, and the parents were heterozygous. These results imply that this mutation in the human Ca{sup 2+}-sensing receptor gene causes FHH and that the dosage of the gene defect determines disease phenotype. 33 refs., 4 figs., 1 tab.

  2. Clinical and genetic studies in a family with a new splice-site mutation in the choroideremia gene.

    Science.gov (United States)

    Contestabile, Maria T; Piane, Maria; Cascone, Nikhil C; Pasquale, Nadia; Ciarnella, Angela; Recupero, Santi M; Chessa, Luciana

    2014-01-01

    To describe the clinical and molecular findings of an Italian family with a new mutation in the choroideremia (CHM) gene. We performed a comprehensive ophthalmologic examination, fundus photography, macular optical coherence tomography, perimetry, electroretinography, and fluorescein angiography in an Italian family. The clinical diagnosis was supported by western blot analysis of lymphoblastoid cell lines from patients with CHM and carriers, using a monoclonal antibody against the 415 C-terminal amino acids of Rab escort protein-1 (REP-1). Sequencing of the CHM gene was undertaken on genomic DNA from affected men and carriers; the RNA transcript was analyzed with reverse transcriptase-PCR. The affected men showed a variability in the rate of visual change and in the degree of clinical and functional ophthalmologic involvement, mainly age-related, while the women displayed aspecific areas of chorioretinal degeneration. Western blot did not show a detectable amount of normal REP-1 protein in affected men who were hemizygous for a novel mutation, c.819+2T>A at the donor splicing site of intron 6 of the CHM gene; the mutation was confirmed in heterozygosity in the carriers. Western blot of the REP-1 protein confirmed the clinical diagnosis, and molecular analysis showed the new in-frame mutation, c.819+2T>A, leading to loss of function of the REP-1 protein. These results emphasize the value of a diagnostic approach that correlates genetic and ophthalmologic data for identifying carriers in families with CHM. An early diagnosis might be crucial for genetic counseling of this type of progressive and still untreatable disease.

  3. Molecular Evolution and Expression Divergence of HMT Gene Family in Plants

    Directory of Open Access Journals (Sweden)

    Man Zhao

    2018-04-01

    Full Text Available Homocysteine methyltransferase (HMT converts homocysteine to methionine using S-methylmethionine (SMM or S-adenosylmethionine (SAM as methyl donors in organisms, playing an important role in supplying methionine for the growth and the development of plants. To better understand the functions of the HMT genes in plants, we conducted a wide evolution and expression analysis of these genes. Reconstruction of the phylogenetic relationship showed that the HMT gene family was divided into Class 1 and Class 2. In Class 1, HMTs were only found in seed plants, while Class 2 presented in all land plants, which hinted that the HMT genes might have diverged in seed plants. The analysis of gene structures and selection pressures showed that they were relatively conserved during evolution. However, type I functional divergence had been detected in the HMTs. Furthermore, the expression profiles of HMTs showed their distinct expression patterns in different tissues, in which some HMTs were widely expressed in various organs, whereas the others were highly expressed in some specific organs, such as seeds or leaves. Therefore, according to our results in the evolution, functional divergence, and expression, the HMT genes might have diverged during evolution. Further analysis in the expression patterns of AthHMTs with their methyl donors suggested that the diverged HMTs might be related to supply methionine for the development of plant seeds.

  4. The pentatricopeptide repeat (PPR) gene family, a tremendous resource for plant phylogenetic studies.

    Science.gov (United States)

    Yuan, Yao-Wu; Liu, Chang; Marx, Hannah E; Olmstead, Richard G

    2009-01-01

    * Despite the paramount importance of nuclear gene data in plant phylogenetics, the search for candidate loci is believed to be challenging and time-consuming. Here we report that the pentatricopeptide repeat (PPR) gene family, containing hundreds of members in plant genomes, holds tremendous potential as nuclear gene markers. * We compiled a list of 127 PPR loci that are all intronless and have a single orthologue in both rice (Oryza sativa) and Arabidopsis thaliana. The uncorrected p-distances were calculated for these loci between two Arabidopsis species and among three Poaceae genera. We also selected 13 loci to evaluate their phylogenetic utility in resolving relationships among six Poaceae genera and nine diploid Oryza species. * PPR genes have a rapid rate of evolution and can be best used at intergeneric and interspecific levels. Although with substantial amounts of missing data, almost all individual data sets from the 13 loci generate well-resolved gene trees. * With the unique combination of three characteristics (having a large number of loci with established orthology assessment, being intronless, and being rapidly evolving), the PPR genes have many advantages as phylogenetic markers (e.g. straightforward alignment, minimal effort in generating sequence data, and versatile utilities). We perceive that these loci will play an important role in plant phylogenetics.

  5. MUSTANG is a novel family of domesticated transposase genes found in diverse angiosperms.

    Science.gov (United States)

    Cowan, Rebecca K; Hoen, Douglas R; Schoen, Daniel J; Bureau, Thomas E

    2005-10-01

    While transposons have traditionally been viewed as genomic parasites or "junk DNA," the discovery of transposon-derived host genes has fueled an ongoing debate over the evolutionary role of transposons. In particular, while mobility-related open reading frames have been known to acquire host functions, the contribution of these types of events to the evolution of genes is not well understood. Here we report that genome-wide searches for Mutator transposase-derived host genes in Arabidopsis thaliana (Columbia-0) and Oryza sativa ssp. japonica (cv. Nipponbare) (domesticated rice) identified 121 sequences, including the taxonomically conserved MUSTANG1. Syntenic MUSTANG1 orthologs in such varied plant species as rice, poplar, Arabidopsis, and Medicago truncatula appear to be under purifying selection. However, despite the evidence of this pathway of gene evolution, MUSTANG1 belongs to one of only two Mutator-like gene families with members in both monocotyledonous and dicotyledonous plants, suggesting that Mutator-like elements seldom evolve into taxonomically widespread host genes.

  6. Family controlled firm, governance mechanisms and corporate performance: Evidence from Indonesia

    OpenAIRE

    Eko Suyono

    2016-01-01

    This study investigates, firstly, the influence of family-controlled firm on corporate performance, and secondly, the influences of corporate governance mechanisms including control variable on corporate performance in the companies listed on the Indonesian Stock Exchange. By using five years (2009-2013) company data, this study used Ordinary Least Square (OLS) regression to test the hypotheses. The results based on OLS, indicate that family controlled firms tend to have better performance th...

  7. A KRT1 gene mutation related to epidermolytic ichthyosis in a Chinese family.

    Science.gov (United States)

    Ji, Y Z; Bai, Y; Wang, S; Li, F Q

    2015-12-01

    We report a Chinese family with members affected by epidermolytic ichthyosis (EI), caused by KRT gene mutations. The proband was a 14-year-old boy who had simultaneous appearance of nephroblastoma and epidermolytic ichthyosis (EI). Both the patient and his mother exhibited the specific clinical and pathological manifestations of EI. We analysed all exons and flanking sequences of the KRT1 and KRT10 genes using PCR, and found that the proband and his mother had a G>C transition at nucleotide position 1432 in exon 7 of KRT1, resulting in an amino acid substitution of glutamate (GAA) to glutamine (CAA) at codon 478 (E478Q). The KRT10 gene had no mutations. © 2015 British Association of Dermatologists.

  8. The human gene for neurotrophic tyrosine kinase receptor type 2 (NTRK2) is located on chromosome 9 but is not the familial dysautonomia gene

    Energy Technology Data Exchange (ETDEWEB)

    Slaugenhaupt, S.A. [Massachusetts General Hospital, Boston, MA (United States)]|[Harvard Medical School, Boston, MA (United States); Liebert, C.B.; Lucente, D.E. [Massachusetts General Hospital, Boston, MA (United States)] [and others

    1995-02-10

    The neurotrophic tyrosine kinase receptor type 2 (NTRK2) gene is a member of the trk family of tyrosine protein kinases, which encode receptors for the nerve growth factor-related proteins known as neurotrophins. The neurotrophins and their receptors have long been considered candidate genes for familial dysautonomia (FD), a hereditary sensory neuropathy resulting from the congenital loss of both sensory and autonomic neurons. The DYS gene has recently been mapped to human chromosome 9q31-q33, and therefore we set out to determine the chromosomal localization of the candidate gene NTRK2. A mouse trkB probe was hybridized to both somatic cell hybrids containing human chromosome 9 and a human chromosome 9 flow-sorted cosmid library. The human homologue of trkB, NTRK2, was assigned to chromosome 9. To localize the NTRK2 gene further, a dinucleotide repeat polymorphism was identified within a cosmid that contains NTRK2 exon sequences. This marker was genotyped in the CEPH reference pedigrees and places the NTRK2 gene near D9S1 on the proximal long arm of human chromosome 9. The NTRK2 gene is located approximately 22 cm proximal to DYS and shows several recombinants in disease families. Therefore, the NTRK2 gene can now be excluded as a candidate gene for familial dysautonomia. 18 refs., 1 fig.

  9. Molecular analysis and test of linkage between the FMR-I gene and infantile autism in multiplex families

    Energy Technology Data Exchange (ETDEWEB)

    Hallmayer, J.; Pintado, E.; Lotspeich, L.; Spiker, D.; Kraemer, H.C.; Lee Wong, D.; Lin, A.; Herbert, J.; Cavalli-Sforza, L.L.; Ciaranello, R.D. [Stanford Univ., CA (United States)] [and others

    1994-11-01

    Approximately 2%-5% of autistic children show cytogenetic evidence of the fragile X syndrome. This report tests whether infantile autism in multiplex autism families arises from an unusual manifestion of the fragile X syndrome. This could arise either by expansion of the (CGG)n trinucleotide repeat in FMR-1 or from a mutation elsewhere in the gene. We studied 35 families that met stringent criteria for multiplex autism. Amplification of the trinucleotide repeat and analysis of methylation status were performed in 79 autistic children and in 31 of their unaffected siblings by Southern blot analysis. No examples of amplified repeats were seen in the autistic or control children or in their parents or grandparents. We next examined the hypothesis that there was a mutation elsewhere in the FMR-1 gene, by linkage analysis in 32 of these families. We tested four different dominant models and a recessive model. Linkage to FMR-1 could be excluded (lod score between -24 and -62) in all models by using probes DXS548, FRAXAC1, and FRAXAC2 and the CGG repeat itself. Tests for heterogeneity in this sample were negative, and the occurrence of positive lod scores in this data set could be attributed to chance. Analysis of the data by the affected-sib method also did not show evidence for linkage of any marker to autism. These results enable us to reject the hypothesis that multiplex autism arises from expansion of the (CGG)n trinucleotide repeat in FMR-1. Further, because the overall lod scores for all probes in all models tested were highly negative, linkage to FMR-1 can also be ruled out in multiplex autistic families. 35 refs., 2 figs., 5 tabs.

  10. Impact of flexible scheduling on employee performance regarding stress and work-family conflict

    OpenAIRE

    Raja Abdul Ghafoor Khan; Furqan Ahmad Khan; Dr. Muhammad Aslam Khan; Mohsin Shakeel

    2011-01-01

    Stress, work-family conflicts and flexible scheduling are three of the most important elements in organizational studies. The focus of current study is to understand the effect of Stress,work family conflicts and flexible scheduling on employee’s performance and also to understand whether flexible scheduling helps in reducing stress and work-family conflicts or not. The back bone of this study is the secondary data comprised of comprehensive literature review. A survey has also been conducted...

  11. When job performance is all relative: how family motivation energizes effort and compensates for intrinsic motivation

    OpenAIRE

    Menges, Jochen Immanuel; Tussing, DV; Wihler, A; Grant, A

    2017-01-01

    Supporting one's family is a major reason why many people work, yet surprisingly little research has examined the implications of family motivation. Drawing on theories of prosocial motivation and action identification, we propose that family motivation increases job performance by enhancing energy and reducing stress, and it is especially important when intrinsic motivation is lacking. Survey and diary data collected across multiple time points in a Mexican maquiladora generally support our ...

  12. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  13. Evolutionary genomics and adaptive evolution of the Hedgehog gene family (Shh, Ihh and Dhh in vertebrates.

    Directory of Open Access Journals (Sweden)

    Joana Pereira

    Full Text Available The Hedgehog (Hh gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh, each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.

  14. Update of the NAD(PH:quinone oxidoreductase (NQO gene family

    Directory of Open Access Journals (Sweden)

    Vasiliou Vasilis

    2006-03-01

    Full Text Available Abstract The NAD(PH:quinone acceptor oxidoreductase (NQO gene family belongs to the flavoprotein clan and, in the human genome, consists of two genes (NQO1 and NQO2. These two genes encode cytosolic flavoenzymes that catalyse the beneficial two-electron reduction of quinones to hydroquinones. This reaction prevents the unwanted one-electron reduction of quinones by other quinone reductases; one-electron reduction results in the formation of reactive oxygen species, generated by redox cycling of semiquinones in the presence of molecular oxygen. Both the mammalian NQO1 and NQO2 genes are upregulated as a part of the oxidative stress response and are inexplicably overexpressed in particular types of tumours. A non-synonymous mutation in the NQO1 gene, leading to absence of enzyme activity, has been associated with an increased risk of myeloid leukaemia and other types of blood dyscrasia in workers exposed to benzene. NQO2 has a melatonin-binding site, which may explain the anti-oxidant role of melatonin. An ancient NQO3 subfamily exists in eubacteria and the authors suggest that there should be additional divisions of the NQO family to include the NQO4 subfamily in fungi and NQO5 subfamily in archaebacteria. Interestingly, no NQO genes could be identified in the worm, fly, sea squirt or plants; because these taxa carry quinone reductases capable of one- and two-electron reductions, there has been either convergent evolution or redundancy to account for the appearance of these enzyme functions whenever they have been needed during evolution.

  15. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    Science.gov (United States)

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  16. Clustered organization and transcriptional analysis of a family of five csp genes of Lactococcus lactis MG1363

    NARCIS (Netherlands)

    Wouters, Jeroen A.; Sanders, Jan-Willem; Kok, Jan; Vos, Willem M. de; Kuipers, Oscar P.; Abee, Tjakko; Wouters, J.W.

    1998-01-01

    A family of genes encoding cold-shock proteins, named cspA, cspB, cspC, cspD and cspE, was cloned and sequenced from Lactococcus lactis MG1363. The genes cspA and cspB and the genes cspC and cspD are located in tandem repeats, an organization of csp genes that has never been encountered before. The

  17. Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, andexpression analysis

    Directory of Open Access Journals (Sweden)

    Glen Peter

    2009-12-01

    Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig

  18. Whole exome sequencing identified a novel single base pair insertion mutation in the EYS gene in a six generation family with retinitis pigmentosa.

    Science.gov (United States)

    Hashmi, Jamil Amjad; Albarry, Maan Abdullah; Almatrafi, Ahmed M; Albalawi, Alia M; Mahmood, Amer; Basit, Sulman

    2018-01-01

    Retinitis pigmentosa (RP) is a group of inherited progressive retinal dystrophies (RD) and is characterized by photoreceptor degeneration. RP is clinically and genetically heterogeneous disorder. More than 70 genes are known and, thus, identification of causative genes and mutations in known genes is challenging. This study was designed to identify the underlying genetic defect in a large extended Saudi family with multiple RP affected members. Fundus photography, Optical Coherence Tomography (OCT) and visual field perimetry were performed for affected individuals. Whole exome sequencing was used to detect the underlying genetic defect in a large family with 12 affected individuals showing autosomal recessive isolated RP. WES data analysis identified a novel insertion mutation in the EYS (eyes shut homolog) gene (c.910_911insT; p.Trp304LeufsTer8). Sanger sequencing validates the variant discovered through exome in all 12 affected individuals and showed that this mutation is segregating with RP phenotype in an autosomal recessive manner in 51 individuals of the family tested here. Our study expands the mutation spectrum of EYS gene in RP patients and extends the body of evidence that supports the importance of EYS gene in eye development. © 2017 Japanese Teratology Society.

  19. Naxos disease in an Arab family is not caused by the Pk2157del2 mutation; evidance for exclusion of the plakoglobin gene

    International Nuclear Information System (INIS)

    Stuhmann, M.; El-Harith, A.; Bukhari, Iqbal A.

    2004-01-01

    Nax os disease is a rare hereditary disorder characterized by palmoplantar keratoderma, woolly hair and cardiomyopathy. This study aims to determine whether Naxos disease in a Saudi Arab family is caused by the Pk2157del2 mutation that was identified in Greek families from Naxos Island where the disease had originally been described. This study was undertaken at King Fahad Hospital of the University, Al-Khobar, and the Medical University of Hannover, in the spring of 2003. Naxos disease has been encountered in a 2-year-old girl and her 30-year-old aunt of a Saudi Arab family. Deoxyribonucleic acid samples of this family were analyzed by polymerase chain-reaction (PCR) amplification of the respective region of the plakoglobin gene, and direct nucleotide sequencing of the PCR-products. Segregation analysis was performed employing the newly detected IVS11+22G/A polymorphism. Molecular genetic analysis of the DNA sample of the child diagnosed with Naxos disease showed absence of the Pk2157del2 mutation. In addition, the segregation analysis revealed heterozygosity for IVS11+22G/A in the affected girl. Absence of the Pk2157del2 frameshift in the affected child proved that Naxos disease in this Saudi Arab family is not caused by the same mutation that was identified in the Greek families. Furthermore, heterozygosity for the IVS11+22G/A polymorphism provided evidence for exclusion of the plakoglobin gene in this consanguineous family. (author)

  20. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  1. The role of gene duplication and unconstrained selective pressures in the melanopsin gene family evolution and vertebrate circadian rhythm regulation.

    Directory of Open Access Journals (Sweden)

    Rui Borges

    Full Text Available Melanopsin is a photosensitive cell protein involved in regulating circadian rhythms and other non-visual responses to light. The melanopsin gene family is represented by two paralogs, OPN4x and OPN4m, which originated through gene duplication early in the emergence of vertebrates. Here we studied the melanopsin gene family using an integrated gene/protein evolutionary approach, which revealed that the rhabdomeric urbilaterian ancestor had the same amino acid patterns (DRY motif and the Y and E conterions as extant vertebrate species, suggesting that the mechanism for light detection and regulation is similar to rhabdomeric rhodopsins. Both OPN4m and OPN4x paralogs are found in vertebrate genomic paralogons, suggesting that they diverged following this duplication event about 600 million years ago, when the complex eye emerged in the vertebrate ancestor. Melanopsins generally evolved under negative selection (ω = 0.171 with some minor episodes of positive selection (proportion of sites = 25% and functional divergence (θ(I = 0.349 and θ(II = 0.126. The OPN4m and OPN4x melanopsin paralogs show evidence of spectral divergence at sites likely involved in melanopsin light absorbance (200F, 273S and 276A. Also, following the teleost lineage-specific whole genome duplication (3R that prompted the teleost fish radiation, type I divergence (θ(I = 0.181 and positive selection (affecting 11% of sites contributed to amino acid variability that we related with the photo-activation stability of melanopsin. The melanopsin intracellular regions had unexpectedly high variability in their coupling specificity of G-proteins and we propose that Gq/11 and Gi/o are the two G-proteins most-likely to mediate the melanopsin phototransduction pathway. The selection signatures were mainly observed on retinal-related sites and the third and second intracellular loops, demonstrating the physiological plasticity of the melanopsin protein group. Our results provide new

  2. The ABC gene family in arthropods: comparative genomics and role in insecticide transport and resistance.

    Science.gov (United States)

    Dermauw, Wannes; Van Leeuwen, Thomas

    2014-02-01

    About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority of ABC proteins function as primary-active transporters that bind and hydrolyze ATP while transporting a large diversity of substrates across lipid membranes. Although extremely well studied in vertebrates for their role in drug resistance, less is known about the role of this family in the transport of endogenous and exogenous substances in arthropods. The ABC families of five insect species, a crustacean and a chelicerate have been annotated in some detail. We conducted a thorough phylogenetic analysis of the seven arthropod and human ABC protein subfamilies, to infer orthologous relationships that might suggest conserved function. Most orthologous relationships were found in the ABCB half transporter, ABCD, ABCE and ABCF subfamilies, but specific expansions within species and lineages are frequently observed and discussed. We next surveyed the role of ABC transporters in the transport of xenobiotics/plant allelochemicals and their involvement in insecticide resistance. The involvement of ABC transporters in xenobiotic resistance in arthropods is historically not well documented, but an increasing number of studies using unbiased differential gene expression analysis now points to their importance. We give an overview of methods that can be used to link ABC transporters to resistance. ABC proteins have also recently been implicated in the mode of action and resistance to Bt toxins in Lepidoptera. Given the enormous interest in Bt toxicology in transgenic crops, such findings will provide an impetus to further reveal the role of ABC transporters in arthropods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Genome-wide analysis of the sox family in the calcareous sponge Sycon ciliatum: multiple genes with unique expression patterns

    Directory of Open Access Journals (Sweden)

    Fortunato Sofia

    2012-07-01

    Full Text Available Abstract Background Sox genes are HMG-domain containing transcription factors with important roles in developmental processes in animals; many of them appear to have conserved functions among eumetazoans. Demosponges have fewer Sox genes than eumetazoans, but their roles remain unclear. The aim of this study is to gain insight into the early evolutionary history of the Sox gene family by identification and expression analysis of Sox genes in the calcareous sponge Sycon ciliatum. Methods Calcaronean Sox related sequences were retrieved by searching recently generated genomic and transcriptome sequence resources and analyzed using variety of phylogenetic methods and identification of conserved motifs. Expression was studied by whole mount in situ hybridization. Results We have identified seven Sox genes and four Sox-related genes in the complete genome of Sycon ciliatum. Phylogenetic and conserved motif analyses showed that five of Sycon Sox genes represent groups B, C, E, and F present in cnidarians and bilaterians. Two additional genes are classified as Sox genes but cannot be assigned to specific subfamilies, and four genes are more similar to Sox genes than to other HMG-containing genes. Thus, the repertoire of Sox genes is larger in this representative of calcareous sponges than in the demosponge Amphimedon queenslandica. It remains unclear whether this is due to the expansion of the gene family in Sycon or a secondary reduction in the Amphimedon genome. In situ hybridization of Sycon Sox genes revealed a variety of expression patterns during embryogenesis and in specific cell types of adult sponges. Conclusions In this study, we describe a large family of Sox genes in Sycon ciliatum with dynamic expression patterns, indicating that Sox genes are regulators in development and cell type determination in sponges, as observed in higher animals. The revealed differences between demosponge and calcisponge Sox genes repertoire highlight the need to

  4. IKBKAP/ELP1 gene mutations: mechanisms of familial dysautonomia and gene-targeting therapies

    Directory of Open Access Journals (Sweden)

    Rubin BY

    2017-12-01

    Full Text Available Berish Y Rubin, Sylvia L Anderson Department of Biological Sciences, Fordham University, Bronx, NY, USA Abstract: The successful completion of the Human Genome Project led to the discovery of the molecular basis of thousands of genetic disorders. The identification of the mutations that cause familial dysautonomia (FD, an autosomal recessive disorder that impacts sensory and autonomic neurons, was aided by the release of the human DNA sequence. The identification and characterization of the genetic cause of FD have changed the natural history of this disease. Genetic testing programs, which were established shortly after the disease-causing mutations were identified, have almost completely eliminated the birth of children with this disorder. Characterization of the principal disease-causing mutation has led to the development of therapeutic modalities that ameliorate its effect, while the development of mouse models that recapitulate the impact of the mutation has allowed for the in-depth characterization of its impact on neuronal development and survival. The intense research focus on this disorder, while clearly benefiting the FD patient population, also serves as a model for the positive impact focused research efforts can have on the future of other genetic diseases. Here, we present the research advances and scientific breakthroughs that have changed and will continue to change the natural history of this centuries-old genetic disease. Keywords: HSAN, splicing, MAO, tocotrienol, EGCG, Ashkenazi

  5. Branch-and-bound approach for parsimonious inference of a species tree from a set of gene family trees.

    Science.gov (United States)

    Doyon, Jean-Philippe; Chauve, Cedric

    2011-01-01

    We describe a Branch-and-Bound algorithm for computing a parsimonious species tree, given a set of gene family trees. Our algorithm can consider three cost measures: number of gene duplications, number of gene losses, and both combined. Moreover, to cope with intrinsic limitations of Branch-and-Bound algorithms for species trees inference regarding the number of taxa that can be considered, our algorithm can naturally take into account predefined relationships between sets of taxa. We test our algorithm on a dataset of eukaryotic gene families spanning 29 taxa.

  6. Effects of Family Functioning and Parenting Style on Early Entrants' Academic Performance and Program Completion

    Science.gov (United States)

    Huey, Erron L.; Sayler, Michael F.; Rinn, Anne N.

    2013-01-01

    The purpose of the current study was to examine the predictive nature of parenting style and overall family environment on the academic performance and program completion of early college entrants. Furthermore, gender and family form were examined as possible moderators to these relationships. A total of 88 early college entrants participated in…

  7. Identification and expression analysis of the IPT and CKX gene families during axillary bud outgrowth in apple (Malus domestica Borkh.).

    Science.gov (United States)

    Tan, Ming; Li, Guofang; Qi, Siyan; Liu, Xiaojie; Chen, Xilong; Ma, Juanjuan; Zhang, Dong; Han, Mingyu

    2018-04-20

    Cytokinins (CKs) play a crucial role in promoting axillary bud outgrowth and targeting the control of CK metabolism can be used to enhance branching in plants. CK levels are maintained mainly by CK biosynthesis (isopentenyl transferase, IPT) and degradation (dehydrogenase, CKX) genes in plants. A systematic study of the IPT and CKX gene families in apple, however, has not been conducted. In the present study, 12 MdIPTs and 12 MdCKXs were identified in the apple genome. Systematic phylogenetic, structural, and synteny analyses were performed. Expression analysis of these genes in different tissues was also assessed. MdIPT and MdCKX genes exhibit distinct expression patterns in different tissues. The response of MdIPT, MdCKX, and MdPIN1 genes to various treatments (6-BA, decapitation and Lovastatin, an inhibitor of CKs synthesis) that impact branching were also investigated. Results indicated that most of the MdIPT and MdCKX, and MdPIN1 genes were upregulated by 6-BA and decapitation treatment, but inhibited by Lovastatin, a compound that effectively suppresses axillary bud outgrowth induced by decapitation. These findings suggest that cytokinin biosynthesis is required for the activation of bud break and the export of auxin from buds in apple tree with intact primary shoot apex or decapitated apple tree. MdCKX8 and MdCKX10, however, exhibited little response to decapitation, but were significantly up-regulated by 6-BA and Lovastatin, a finding that warrants further investigation in order to understand their function in bud-outgrowth. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Genetic variation in a member of the laminin gene family affects variation in body composition in Drosophila and humans

    Directory of Open Access Journals (Sweden)

    Hunter Gary R

    2008-08-01

    Full Text Available Abstract Background The objective of the present study was to map candidate loci influencing naturally occurring variation in triacylglycerol (TAG storage using quantitative complementation procedures in Drosophila melanogaster. Based on our results from Drosophila, we performed a human population-based association study to investigate the effect of natural variation in LAMA5 gene on body composition in humans. Results We identified four candidate genes that contributed to differences in TAG storage between two strains of D. melanogaster, including Laminin A (LanA, which is a member of the α subfamily of laminin chains. We confirmed the effects of this gene using a viable LanA mutant and showed that female flies homozygous for the mutation had significantly lower TAG storage, body weight, and total protein content than control flies. Drosophila LanA is closely related to human LAMA5 gene, which maps to the well-replicated obesity-linkage region on chromosome 20q13.2-q13.3. We tested for association between three common single nucleotide polymorphisms (SNPs in the human LAMA5 gene and variation in body composition and lipid profile traits in a cohort of unrelated women of European American (EA and African American (AA descent. In both ethnic groups, we found that SNP rs659822 was associated with weight (EA: P = 0.008; AA: P = 0.05 and lean mass (EA: P= 0.003; AA: P = 0.03. We also found this SNP to be associated with height (P = 0.01, total fat mass (P = 0.01, and HDL-cholesterol (P = 0.003 but only in EA women. Finally, significant associations of SNP rs944895 with serum TAG levels (P = 0.02 and HDL-cholesterol (P = 0.03 were observed in AA women. Conclusion Our results suggest an evolutionarily conserved role of a member of the laminin gene family in contributing to variation in weight and body composition.

  9. Robust and Comprehensive Analysis of 20 Osteoporosis Candidate Genes by Very High-Density Single-Nucleotide Polymorphism Screen Among 405 White Nuclear Families Identified Significant Association and Gene–Gene Interaction

    Science.gov (United States)

    Xiong, Dong-Hai; Shen, Hui; Zhao, Lan-Juan; Xiao, Peng; Yang, Tie-Lin; Guo, Yan; Wang, Wei; Guo, Yan-Fang; Liu, Yong-Jun; Recker, Robert R; Deng, Hong-Wen

    2007-01-01

    Many “novel” osteoporosis candidate genes have been proposed in recent years. To advance our knowledge of their roles in osteoporosis, we screened 20 such genes using a set of high-density SNPs in a large family-based study. Our efforts led to the prioritization of those osteoporosis genes and the detection of gene–gene interactions. Introduction We performed large-scale family-based association analyses of 20 novel osteoporosis candidate genes using 277 single nucleotide polymorphisms (SNPs) for the quantitative trait BMD variation and the qualitative trait osteoporosis (OP) at three clinically important skeletal sites: spine, hip, and ultradistal radius (UD). Materials and Methods One thousand eight hundred seventy-three subjects from 405 white nuclear families were genotyped and analyzed with an average density of one SNP per 4 kb across the 20 genes. We conducted association analyses by SNP- and haplotype-based family-based association test (FBAT) and performed gene–gene interaction analyses using multianalytic approaches such as multifactor-dimensionality reduction (MDR) and conditional logistic regression. Results and Conclusions We detected four genes (DBP, LRP5, CYP17, and RANK) that showed highly suggestive associations (10,000-permutation derived empirical global p ≤ 0.01) with spine BMD/OP; four genes (CYP19, RANK, RANKL, and CYP17) highly suggestive for hip BMD/OP; and four genes (CYP19, BMP2, RANK, and TNFR2) highly suggestive for UD BMD/OP. The associations between BMP2 with UD BMD and those between RANK with OP at the spine, hip, and UD also met the experiment-wide stringent criterion (empirical global p ≤ 0.0007). Sex-stratified analyses further showed that some of the significant associations in the total sample were driven by either male or female subjects. In addition, we identified and validated a two-locus gene–gene interaction model involving GCR and ESR2, for which prior biological evidence exists. Our results suggested the

  10. Cloning and expression profiling of the VLDLR gene associated with egg performance in duck (Anas platyrhynchos

    Directory of Open Access Journals (Sweden)

    Peng Xiu-li

    2011-08-01

    Full Text Available Abstract Background The very low density lipoprotein receptor gene (VLDLR, a member of the low density lipoprotein receptor (LDLR gene family, plays a crucial role in the synthesis of yolk protein precursors in oviparous species. Differential splicing of this gene has been reported in human, rabbit and rat. In chicken, studies showed that the VLDLR protein on the oocyte surface mediates the uptake of yolk protein precursors into growing oocytes. However, information on the VLDLR gene in duck is still scarce. Methods Full-length duck VLDLR cDNA was obtained by comparative cloning and rapid amplification of cDNA ends (RACE. Tissue expression patterns were analysed by semi-quantitative reverse-transcription polymerase chain reaction (RT-PCR. Association between the different genotypes and egg performance traits was investigated with the general linear model (GLM procedure of the SAS® software package. Results In duck, two VLDLR transcripts were identified, one transcript (variant-a containing an O-linked sugar domain and the other (variant-b not containing this sugar domain. These transcripts share ~70 to 90% identity with their counterparts in other species. A phylogenetic tree based on amino acid sequences showed that duck VLDLR proteins were closely related with those of chicken and zebra finch. The two duck VLDLR transcripts are differentially expressed i.e. VLDLR-a is mainly expressed in muscle tissue and VLDLR-b in reproductive organs. We have localized the duck VLDLR gene on chromosome Z. An association analysis using two completely linked SNP sites (T/C at position 2025 bp of the ORF and G/A in intron 13 and records from two generations demonstrated that the duck VLDLR gene was significantly associated with egg production (P Conclusions Duck and chicken VLDLR genes probably perform similar function in the development of growing oocytes and deposition of yolk lipoprotein. Therefore, VLDLR could be a candidate gene for duck egg performance

  11. The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

    Directory of Open Access Journals (Sweden)

    Iva Tomalova

    Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

  12. Calcitonin gene-related peptide induced migraine attacks in patients with and without familial aggregation of migraine

    DEFF Research Database (Denmark)

    Guo, Song; Christensen, Anne Francke; Liu, Marie Louise

    2017-01-01

    Background Calcitonin gene-related peptide provokes migraine attacks in 65% of patients with migraine without aura. Whether aggregation of migraine in first-degree relatives (family load) or a high number of risk-conferring single nucleotide polymorphisms contributes to migraine susceptibility...... to calcitonin gene-related peptide infusion in migraine patients is unknown. We hypothesized that genetic enrichment plays a role in triggering of migraine and, therefore, migraine without aura patients with high family load would report more migraine attacks after calcitonin gene-related peptide infusion than...... patients with low family load. Methods We allocated 40 previously genotyped migraine without aura patients to receive intravenous infusion of 1.5 μg/min calcitonin gene-related peptide and recorded migraine attacks including headache characteristics and associated symptoms. Information of familial...

  13. Internationalisation and performance in Spanish family SMES: The W-curve

    Directory of Open Access Journals (Sweden)

    Marta Fernández-Olmos

    2016-04-01

    Full Text Available Previous studies have provided mixed evidence on the relationship between internationalisation and firm performance. We advance theoretically in this line of research by investigating the impact of the family dimension of a business on this relationship. Using a panel data analysis for the 2006–2011 period, we find empirically that Spanish family SMEs follow a W-curve. Our findings highlight the importance of differentiating family from non-family firms, and provide a potential explanation for the previous mixed evidence.

  14. Dissecting the complex molecular evolution and expression of polygalacturonase gene family in Brassica rapa ssp. chinensis.

    Science.gov (United States)

    Liang, Ying; Yu, Youjian; Shen, Xiuping; Dong, Heng; Lyu, Meiling; Xu, Liai; Ma, Zhiming; Liu, Tingting; Cao, Jiashu

    2015-12-01

    Polygalacturonases (PGs) participate in pectin disassembly of cell wall and belong to one of the largest hydrolase families in plants. In this study, we identified 99 PG genes in Brassica rapa. Comprehensive analysis of phylogeny, gene structures, physico-chemical properties and coding sequence evolution demonstrated that plant PGs should be classified into seven divergent clades and each clade's members had specific sequence and structure characteristics, and/or were under specific selection pressures. Genomic distribution and retention rate analysis implied duplication events and biased retention contributed to PG family's expansion. Promoter divergence analysis using "shared motif method" revealed a significant correlation between regulatory and coding sequence evolution of PGs, and proved Clades A and E were of ancient origin. Quantitative real-time PCR analysis showed that expression patterns of PGs displayed group specificities in B. rapa. Particularly, nearly half of PG family members, especially those of Clades C, D and F, closely relates to reproductive development. Most duplicates showed similar expression profiles, suggesting dosage constraints accounted for preservation after duplication. Promoter-GUS assay further indicated PGs' extensive roles and possible redundancy during reproductive development. This work can provide a scientific classification of plant PGs, dissect the internal relationships between their evolution and expressions, and promote functional researches.

  15. Effects of common haplotypes of the ileal sodium dependent bile acid transporter gene on the development of sporadic and familial colorectal cancer: A case control study

    Directory of Open Access Journals (Sweden)

    Friedrichs Nicolaus

    2008-07-01

    Full Text Available Abstract Background The genetics of sporadic and non-syndromic familial colorectal cancer (CRC is not well defined. However, genetic factors that promote the development of precursor lesions, i.e. adenomas, might also predispose to CRC. Recently, an association of colorectal adenoma with two variants (c.507C>T;p.L169L and c.511G>T;p.A171S of the ileal sodium dependent bile acid transporter gene (SLC10A2 has been reported. Here, we reconstructed haplotypes of the SLC10A2 gene locus and tested for association with non-syndromic familial and sporadic CRC compared to 'hyper-normal' controls who displayed no colorectal polyps on screening colonoscopy. Methods We included 150 patients with sporadic CRC, 93 patients with familial CRC but exclusion of familial adenomatous polyposis and Lynch's syndrome, and 204 'hyper-normal' controls. Haplotype-tagging SLC10A2 gene variants were identified in the Hapmap database and genotyped using PCR-based 5' exonuclease assays with fluorescent dye-labelled probes. Haplotypes were reconstructed using the PHASE algorithm. Association testing was performed with both SNPs and reconstructed haplotypes. Results Minor allele frequencies of all SLC10A2 polymorphisms are within previously reported ranges, and no deviations from Hardy-Weinberg equilibrium are observed. However, we found no association with any of the SLC10A2 haplotypes with sporadic or familial CRC in our samples (all P values > 0.05. Conclusion Common variants of the SLC10A2 gene are not associated with sporadic or familial CRC. Hence, albeit this gene might be associated with early stages of colorectal neoplasia, it appears not to represent a major risk factor for progression to CRC.

  16. Genetic heterogeneity of activating mutations of the luteinizing hormone receptor gene in familial male-limited precocious puberty

    Energy Technology Data Exchange (ETDEWEB)

    Laue, L.; Chan, W.Y.; Wu, S.M. [Georgetown Univ. Medical Center, Washington, DC (United States)] [and others

    1994-09-01

    Familial male-limited precocious puberty (FMPP) is an autosomal dominant disorder characterized by elevated serum levels of testosterone, low levels of gonadotropins, and Leydig cell hyperplasia. Recently, 3 mutations have been found in FMPP families which encode substitution of Gly for Asp 578, Ile for Met 571, and Ile for Thr 577 in transmembrane helix 6 (TM 6) of the luteinizing hormone receptor (LHR). We have studied 28 additional unrelated FMPP families. Genomic DNA was isolated from affected males and PCR was performed to amplify a fragment of the LHR gene encoding amino acid residues 441 to 594. MspI restriction enzyme digests were positive for the Asp 578 to Gly mutation in 22 families. Four new mutations were found in the remaining 6 families: an A to C transition encoding substitution of Leu for Ile 542 in transmembrane helix 5 (TM 5), an A to G transition encoding substitution of Gly for Asp 564 in the third cytoplasmic loop, a G to T transition encoding substitution of Try for Asp 578 in TM 6, and a T to C transition encoding substitution of Arg for Cys 581 in TM 6 of the LHR. 293 cells transfected with cDNAs for each of the 4 mutant LHRs, created by site-directed mutagenesis of the wild-type LHR cDNA, exhibited markedly increased levels of basal cAMP production in the absence of agonist, indicating constitutive activation of the mutant LHRs. We conclude that substitution of residues at multiple sites with TM 5, TM 6, and the intervening third cytoplasmic loop of the LHR cause constitutive receptor activation resulting in FMPP. These findings allow future diagnosis of affected patients and provide the basis to study the receptor domains involved in G-protein activation.

  17. Laccase Gene Family in Cerrena sp. HYB07: Sequences, Heterologous Expression and Transcriptional Analysis

    Directory of Open Access Journals (Sweden)

    Jie Yang

    2016-08-01

    Full Text Available Laccases are a class of multi-copper oxidases with industrial potential. In this study, eight laccases (Lac1–8 from Cerrena sp. strain HYB07, a white-rot fungus with high laccase yields, were analyzed. The laccases showed moderate identities to each other as well as with other fungal laccases and were predicted to have high redox potentials except for Lac6. Selected laccase isozymes were heterologously expressed in the yeast Pichia pastoris, and different enzymatic properties were observed. Transcription of the eight laccase genes was differentially regulated during submerged and solid state fermentation, as shown by quantitative real-time polymerase chain reaction and validated reference genes. During 6-day submerged fermentation, Lac7 and 2 were successively the predominantly expressed laccase gene, accounting for over 95% of all laccase transcripts. Interestingly, accompanying Lac7 downregulation, Lac2 transcription was drastically upregulated on days 3 and 5 to 9958-fold of the level on day 1. Consistent with high mRNA abundance, Lac2 and 7, but not other laccases, were identified in the fermentation broth by LC-MS/MS. In solid state fermentation, less dramatic differences in transcript abundance were observed, and Lac3, 7 and 8 were more highly expressed than other laccase genes. Elucidating the properties and expression profiles of the laccase gene family will facilitate understanding, production and commercialization of the fungal strain and its laccases.

  18. Phylogenetic analysis and protein structure modelling identifies distinct Ca(2+)/Cation antiporters and conservation of gene family structure within Arabidopsis and rice species.

    Science.gov (United States)

    Pittman, Jon K; Hirschi, Kendal D

    2016-12-01

    The Ca(2+)/Cation Antiporter (CaCA) superfamily is an ancient and widespread family of ion-coupled cation transporters found in nearly all kingdoms of life. In animals, K(+)-dependent and K(+)-indendent Na(+)/Ca(2+) exchangers (NCKX and NCX) are important CaCA members. Recently it was proposed that all rice and Arabidopsis CaCA proteins should be classified as NCX proteins. Here we performed phylogenetic analysis of CaCA genes and protein structure homology modelling to further characterise members of this transporter superfamily. Phylogenetic analysis of rice and Arabidopsis CaCAs in comparison with selected CaCA members from non-plant species demonstrated that these genes form clearly distinct families, with the H(+)/Cation exchanger (CAX) and cation/Ca(2+) exchanger (CCX) families dominant in higher plants but the NCKX and NCX families absent. NCX-related Mg(2+)/H(+) exchanger (MHX) and CAX-related Na(+)/Ca(2+) exchanger-like (NCL) proteins are instead present. Analysis of genomes of ten closely-related rice species and four Arabidopsis-related species found that CaCA gene family structures are highly conserved within related plants, apart from minor variation. Protein structures were modelled for OsCAX1a and OsMHX1. Despite exhibiting broad structural conservation, there are clear structural differences observed between the different CaCA types. Members of the CaCA superfamily form clearly distinct families with different phylogenetic, structural and functional characteristics, and therefore should not be simply classified as NCX proteins, which should remain as a separate gene family.

  19. [Expression of interferon alpha family gene of Chinese marmot in eukaryotic and prokaryotic cells].

    Science.gov (United States)

    Lu, Yin-ping; Wang, Bao-ju; Huang, Hong-ping; Tian, Yong-jun; Yang, Yan; Dong, Ji-hua; Lu, Meng-ji; Yang, Dong-liang

    2006-02-01

    To investigate the function of interferon alpha (IFNalpha) in a Chinese marmot model of hepatitis B, we expressed the Chinese marmot (Marmota himalayana) IFNalpha family gene (IFNA) in eukaryotic cells and prokaryotic cells. Eukaryotic and prokaryotic expression plasmids harboring Chinese marmot interferon alpha gene with different genotypes were generated using molecular cloning technology. We detected the biological activity of all expression products by viral protection assay, and analyzed their differences and species restriction of the biological activity. The Chinese marmot functional genotype IFNalpha was expressed in the baby hamster kidney (BHK) cell line, and these products protected WH12/6 cells challenged by encephalomyocarditis virus (EMCV). The Chinese marmot IFN-alpha5 also expressed in E. Coli induced by IPTG, and purified fusion protein had antiviral biological activity. The biologic activity displayed differences among different subtype IFNalpha, and it had strict species restriction. The IFNalpha family gene of the Chinese marmot can be expressed in both eukaryotic and prokaryotic cells, and the expression products show antiviral activity in a protection assay. This study provides, for the first time, evidence that IFNalpha from the Chinese marmot has an antiviral function in vitro and can be used to improve the efficacy of current therapies for HBV infection in our Chinese marmot model.

  20. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium

    KAUST Repository

    Rao, Pavitra N.

    2016-06-14

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also pres