WorldWideScience

Sample records for gene family members

  1. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  2. Co-ordinate regulation of cytokinin gene family members during flag leaf and reproductive development in wheat.

    Science.gov (United States)

    Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth

    2012-06-06

    As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.

  3. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    Directory of Open Access Journals (Sweden)

    Tianyu Zhou

    2015-01-01

    Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

  4. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    Science.gov (United States)

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

  5. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  6. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

    Science.gov (United States)

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

    2009-11-01

    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  7. Phylogenetic analysis of members of the Phycodnaviridae virus family, using amplified fragments of the major capsid protein gene.

    Science.gov (United States)

    Larsen, J B; Larsen, A; Bratbak, G; Sandaa, R-A

    2008-05-01

    Algal viruses are considered ecologically important by affecting host population dynamics and nutrient flow in aquatic food webs. Members of the family Phycodnaviridae are also interesting due to their extraordinary genome size. Few algal viruses in the Phycodnaviridae family have been sequenced, and those that have been have few genes in common and low gene homology. It has hence been difficult to design general PCR primers that allow further studies of their ecology and diversity. In this study, we screened the nine type I core genes of the nucleocytoplasmic large DNA viruses for sequences suitable for designing a general set of primers. Sequence comparison between members of the Phycodnaviridae family, including three partly sequenced viruses infecting the prymnesiophyte Pyramimonas orientalis and the haptophytes Phaeocystis pouchetii and Chrysochromulina ericina (Pyramimonas orientalis virus 01B [PoV-01B], Phaeocystis pouchetii virus 01 [PpV-01], and Chrysochromulina ericina virus 01B [CeV-01B], respectively), revealed eight conserved regions in the major capsid protein (MCP). Two of these regions also showed conservation at the nucleotide level, and this allowed us to design degenerate PCR primers. The primers produced 347- to 518-bp amplicons when applied to lysates from algal viruses kept in culture and from natural viral communities. The aim of this work was to use the MCP as a proxy to infer phylogenetic relationships and genetic diversity among members of the Phycodnaviridae family and to determine the occurrence and diversity of this gene in natural viral communities. The results support the current legitimate genera in the Phycodnaviridae based on alga host species. However, while placing the mimivirus in close proximity to the type species, PBCV-1, of Phycodnaviridae along with the three new viruses assigned to the family (PoV-01B, PpV-01, and CeV-01B), the results also indicate that the coccolithoviruses and phaeoviruses are more diverged from this

  8. Analysis of odorant-binding protein gene family members in the polyembryonic wasp, Copidosoma floridanum: evidence for caste bias and host interaction.

    Science.gov (United States)

    Donnell, David M

    2014-01-01

    The polyembryonic wasp Copidosoma floridanum produces two larval castes, soldiers and reproductives, during development within its caterpillar host. Primary structures were determined for 6 odorant-binding protein (OBP) gene family members in Copidosoma and then analyzed alongside two formerly sequenced OBP genes from this wasp. The genes were examined for caste-bias in expression patterns using reverse transcription-polymerase chain reaction (RT-PCR) and in situ expression studies. Six of the 8 genes show a clear bias in gene expression towards one or the other larval caste. Of the 3 distinct in situ probe hybridization patterns observed in this study, none lie in tissues with clear chemosensory functions. Two of the patterns suggest the majority of the Copidosoma OBP gene family members discovered thus far come into contact with host hemolymph. Most of these OBPs are expressed exclusively in the serosal membrane encompassing each of the reproductive larvae. The absence of expression in the membrane surrounding soldier larvae strongly suggests these OBPs are performing caste-specific functions in the host. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  10. Family members' experiences of autopsy

    NARCIS (Netherlands)

    Oppewal, F; Meyboom-de Jong, B

    Background. The experiences of family members will teach us how to handle an autopsy, the ultimate quality assessment tool. Objective. The aim of this study was to determine surviving family members' experience of autopsy. Method. Seven GPs were asked to approach surviving family members of

  11. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  12. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

    2007-01-01

    from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

  13. Novel gene fusion of PRCC-MITF defines a new member of MiT family translocation renal cell carcinoma: clinicopathological analysis and detection of the gene fusion by RNA sequencing and FISH.

    Science.gov (United States)

    Xia, Qiu-Yuan; Wang, Xiao-Tong; Ye, Sheng-Bing; Wang, Xuan; Li, Rui; Shi, Shan-Shan; Fang, Ru; Zhang, Ru-Song; Ma, Heng-Hui; Lu, Zhen-Feng; Shen, Qin; Bao, Wei; Zhou, Xiao-Jun; Rao, Qiu

    2018-04-01

    MITF, TFE3, TFEB and TFEC belong to the same microphthalmia-associated transcription factor family (MiT). Two transcription factors in this family have been identified in two unusual types of renal cell carcinoma (RCC): Xp11 translocation RCC harbouring TFE3 gene fusions and t(6;11) RCC harbouring a MALAT1-TFEB gene fusion. The 2016 World Health Organisation classification of renal neoplasia grouped these two neoplasms together under the category of MiT family translocation RCC. RCCs associated with the other two MiT family members, MITF and TFEC, have rarely been reported. Herein, we identify a case of MITF translocation RCC with the novel PRCC-MITF gene fusion by RNA sequencing. Histological examination of the present tumour showed typical features of MiT family translocation RCCs, overlapping with Xp11 translocation RCC and t(6;11) RCC. However, this tumour showed negative results in TFE3 and TFEB immunochemistry and split fluorescence in-situ hybridisation (FISH) assays. The other MiT family members, MITF and TFEC, were tested further immunochemically and also showed negative results. RNA sequencing and reverse transcription-polymerase chain reaction confirmed the presence of a PRCC-MITF gene fusion: a fusion of PRCC exon 5 to MITF exon 4. We then developed FISH assays covering MITF break-apart probes and PRCC-MITF fusion probes to detect the MITF gene rearrangement. This study both proves the recurring existence of MITF translocation RCC and expands the genotype spectrum of MiT family translocation RCCs. © 2017 John Wiley & Sons Ltd.

  14. Synthesis, antimicrobial activity and gene structure of a novel member of the dermaseptin B family.

    Science.gov (United States)

    Fleury, Y; Vouille, V; Beven, L; Amiche, M; Wróblewski, H; Delfour, A; Nicolas, P

    1998-03-09

    Dermaseptins are a family of cationic (Lys-rich) antimicrobial peptides that are abundant in the skin secretions of the arboreal frogs Phyllomedusa bicolor and P. sauvagii. In vitro, these peptides are microbicidal against a wide variety of microorganisms including Gram-positive and Gram-negative bacteria, yeasts, protozoa and fungi. To date, 6 dermaseptin B mature peptides, 24-34 residues long, 2 dermaseptin B cDNAs and 2 gene sequences have been identified in P. bicolor. To assess dermaseptin related genes further, we screened a P. bicolor genomic library with 32P-labeled cDNAs coding either for prepro-dermaseptins B1 or B2 (adenoregulin). A gene sequence was identified that coded a novel dermaseptin B, termed Drg3, which exhibits 23-42% amino acids identities with other members of the family. Analysis of the cDNAs coding precursors for several opioid and antimicrobial peptides originating from the skin of various amphibian species revealed that the 25-residue preproregion of these preproforms are all encoded by conserved nucleotides encompassed by the first coding exon of the Drg3 gene. Synthetic dermaseptin Drg3 exhibited a bactericidal activity towards several species of mollicutes (wall-less eubacteria), firmicutes (Gram-positive eubacteria), and gracilicutes (Gram-negative eubacteria), with minimal inhibitory concentrations (MICs) ranging from 6.25 to 100 microM. Experiments performed on Acholeplasma laidlawii cells revealed that this peptide is membranotropic and that if efficiently depolarizes the plasma membrane.

  15. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  16. An Uncharacterized Member of the Ribokinase Family in Thermococcus kodakarensis Exhibits myo-Inositol Kinase Activity*

    Science.gov (United States)

    Sato, Takaaki; Fujihashi, Masahiro; Miyamoto, Yukika; Kuwata, Keiko; Kusaka, Eriko; Fujita, Haruo; Miki, Kunio; Atomi, Haruyuki

    2013-01-01

    Here we performed structural and biochemical analyses on the TK2285 gene product, an uncharacterized protein annotated as a member of the ribokinase family, from the hyperthermophilic archaeon Thermococcus kodakarensis. The three-dimensional structure of the TK2285 protein resembled those of previously characterized members of the ribokinase family including ribokinase, adenosine kinase, and phosphofructokinase. Conserved residues characteristic of this protein family were located in a cleft of the TK2285 protein as in other members whose structures have been determined. We thus examined the kinase activity of the TK2285 protein toward various sugars recognized by well characterized ribokinase family members. Although activity with sugar phosphates and nucleosides was not detected, kinase activity was observed toward d-allose, d-lyxose, d-tagatose, d-talose, d-xylose, and d-xylulose. Kinetic analyses with the six sugar substrates revealed high Km values, suggesting that they were not the true physiological substrates. By examining activity toward amino sugars, sugar alcohols, and disaccharides, we found that the TK2285 protein exhibited prominent kinase activity toward myo-inositol. Kinetic analyses with myo-inositol revealed a greater kcat and much lower Km value than those obtained with the monosaccharides, resulting in over a 2,000-fold increase in kcat/Km values. TK2285 homologs are distributed among members of Thermococcales, and in most species, the gene is positioned close to a myo-inositol monophosphate synthase gene. Our results suggest the presence of a novel subfamily of the ribokinase family whose members are present in Archaea and recognize myo-inositol as a substrate. PMID:23737529

  17. Identification of a novel IL-1 cytokine family member in teleost fish.

    Science.gov (United States)

    Wang, Tiehui; Bird, Steve; Koussounadis, Antonis; Holland, Jason W; Carrington, Allison; Zou, Jun; Secombes, Christopher J

    2009-07-15

    A novel IL-1 family member (nIL-1F) has been discovered in fish, adding a further member to this cytokine family. The unique gene organization of nIL-1F, together with its location in the genome and low homology to known family members, suggests that this molecule is not homologous to known IL-1F. Nevertheless, it contains a predicted C-terminal beta-trefoil structure, an IL-1F signature region within the final exon, a potential IL-1 converting enzyme cut site, and its expression level is clearly increased following infection, or stimulation of macrophages with LPS or IL-1beta. A thrombin cut site is also present and may have functional relevance. The C-terminal recombinant protein antagonized the effects of rainbow trout rIL-1beta on inflammatory gene expression in a trout macrophage cell line, suggesting it is an IL-1beta antagonist. Modeling studies confirmed that nIL-1F has the potential to bind to the trout IL-1RI receptor protein, and may be a novel IL-1 receptor antagonist.

  18. ZmCPK1, a calcium-independent kinase member of the Zea mays CDPK gene family, functions as a negative regulator in cold stress signalling.

    Science.gov (United States)

    Weckwerth, Philipp; Ehlert, Britta; Romeis, Tina

    2015-03-01

    Calcium-dependent protein kinases (CDPKs) have been shown to play important roles in plant environmental stress signal transduction. We report on the identification of ZmCPK1 as a member of the maize (Zea mays) CDPK gene family involved in the regulation of the maize cold stress response. Based upon in silico analysis of the Z. mays cv. B73 genome, we identified that the maize CDPK gene family consists of 39 members. Two CDPK members were selected whose gene expression was either increased (Zmcpk1) or decreased (Zmcpk25) in response to cold exposure. Biochemical analysis demonstrated that ZmCPK1 displays calcium-independent protein kinase activity. The C-terminal calcium-binding domain of ZmCPK1 was sufficient to mediate calcium independency of a previously calcium-dependent enzyme in chimeric ZmCPK25-CPK1 proteins. Furthermore, co-transfection of maize mesophyll protoplasts with active full-length ZmCPK1 suppressed the expression of a cold-induced marker gene, Zmerf3 (ZmCOI6.21). In accordance, heterologous overexpression of ZmCPK1 in Arabidopsis thaliana yielded plants with altered acclimation-induced frost tolerance. Our results identify ZmCPK1 as a negative regulator of cold stress signalling in maize. © 2014 John Wiley & Sons Ltd.

  19. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  20. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  1. Stress regulated members of the plant organic cation transporter family are localized to the vacuolar membrane

    Directory of Open Access Journals (Sweden)

    Koch Wolfgang

    2008-07-01

    Full Text Available Abstract Background In Arabidopsis six genes group into the gene family of the organic cation transporters (OCTs. In animals the members of the OCT-family are mostly characterized as polyspecific transporters involved in the homeostasis of solutes, the transport of monoamine neurotransmitters and the transport of choline and carnitine. In plants little is known about function, localisation and regulation of this gene family. Only one protein has been characterized as a carnitine transporter at the plasma membrane so far. Findings We localized the five uncharacterized members of the Arabidopsis OCT family, designated OCT2-OCT6, via GFP fusions and protoplast transformation to the tonoplast. Expression analysis with RNA Gel Blots showed a distinct, organ-specific expression pattern of the individual genes. With reporter gene fusion of four members we analyzed the tissue specific distribution of OCT2, 3, 4, and 6. In experiments with salt, drought and cold stress, we could show that AtOCT4, 5 and 6 are up-regulated during drought stress, AtOCT3 and 5 during cold stress and AtOCT 5 and 6 during salt stress treatments. Conclusion Localisation of the proteins at the tonoplast and regulation of the gene expression under stress conditions suggests a specific role for the transporters in plant adaptation to environmental stress.

  2. Silencing of the pollen-specific gene NTP303 and its family members in tobacco affects in vivo pollen tube growth and results in male sterile plants.

    Science.gov (United States)

    de Groot, Peter; Weterings, Koen; de Been, Mark; Wittink, Floyd; Hulzink, Raymond; Custers, Jan; van Herpen, Marinus; Wullems, George

    2004-07-01

    In seed plants, successful fertilization requires correct regulation of pollen tube growth. At germination and during growth, the pollen tube interacts with tissues from the pistil while the pollen tube extends via tip growth. Despite the fact that much research has been devoted to the mechanisms regulating pollen tube growth, many aspects are currently unknown. Previously, we have isolated a pollen-specific gene from tobacco--NTP303--that probably functions during pollen tube growth. NTP303 is part of a family of five members. Its expression is regulated both at the transcriptional and at the translational level. While NTP303 transcripts accumulate to high levels between early bi-cellular and mature pollen stages, NTP303 protein is hardly detectable until germination and pollen tube growth. In order to elucidate the role and function of NTP303 in the pollen tube, we studied the effect of NTP303 gene silencing on pollen function. Therefore, we have transformed tobacco plants with NTP303 co-suppression and anti-sense gene constructs. In these plants, the kanamycin resistance trait--which was linked to the NTP303-silencing gene--was not transmitted through the male gametophyte. This indicated that lowering the transcript level of NTP303 and/or its family members interferes with pollen function. Because we could not find a readily distinguishable phenotype in pollen from the hemizygous anti-sense and co-suppression plants, we rescued the defective pollen to produce doubled haploid plants that were homozygous for the NTP303 anti-sense gene. We found that in pollen from these plants the transcript levels of all NTP303 family members were reduced. Although pollen and pollen tubes from these plants appeared completely normal in vitro, the pollen tubes showed slower growth rates in vivo and arrested in the style before they reached the ovary, so that fertilization failed. These data demonstrate that NTP303 and its family members are essential for normal pollen tube growth

  3. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  4. Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato.

    Science.gov (United States)

    Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther

    2013-04-01

    Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.

  5. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    Science.gov (United States)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  6. Communication Among Melanoma Family Members

    Science.gov (United States)

    Bowen, Deborah J; Albrecht, Terrance; Hay, Jennifer; Eggly, Susan; Harris-Wei, Julie; Meischke, Hendrika; Burke, Wylie

    2017-01-01

    Interventions to improve communication among family members may facilitate information flow about familial risk and preventive health behaviors. This is a secondary analysis of the effects of an interactive website intervention aimed at increasing communication frequency and agreement about health risk among melanoma families. Participants were family units, consisting of one family member with melanoma identified from a previous research study (the case) and an additional first degree relative and a parent of a child 0–17. Family triads were randomized to receive access to the website intervention or to serve as control families. Family communication frequency and agreement about melanoma prevention behaviors and beliefs were measured at baseline and again at one year post randomization. Intervention participants of all three types significantly increased the frequency of communication to their first degree relatives (Parents, siblings, children; range =14–18 percentage points; all pcommunication about cancer risk. PMID:28248624

  7. Overlapping protective roles for glutathione transferase gene family members in chemical and oxidative stress response in Agrobacterium tumefaciens.

    Science.gov (United States)

    Skopelitou, Katholiki; Muleta, Abdi W; Pavli, Ourania; Skaracis, Georgios N; Flemetakis, Emmanouil; Papageorgiou, Anastassios C; Labrou, Nikolaos E

    2012-03-01

    In the present work, we describe the characterisation of the glutathione transferase (GST) gene family from Agrobacterium tumefaciens C58. A genome survey revealed the presence of eight GST-like proteins in A. tumefaciens (AtuGSTs). Comparison by multiple sequence alignment generated a dendrogram revealing the phylogenetic relationships of AtuGSTs-like proteins. The beta and theta classes identified in other bacterial species are represented by five members in A. tumefaciens C58. In addition, there are three "orphan" sequences that do not fit into any previously recognised GST classes. The eight GST-like genes were cloned, expressed in Escherichia coli and their substrate specificity was determined towards 17 different substrates. The results showed that AtuGSTs catalyse a broad range of reactions, with different members of the family exhibiting quite varied substrate specificity. The 3D structures of AtuGSTs were predicted using molecular modelling. The use of comparative sequence and structural analysis of the AtuGST isoenzymes allowed us to identify local sequence and structural characteristics between different GST isoenzymes and classes. Gene expression profiling was conducted under normal culture conditions as well as under abiotic stress conditions (addition of xenobiotics, osmotic stress and cold and heat shock) to induce and monitor early stress-response mechanisms. The results reveal the constitutive expression of GSTs in A. tumefaciens and a modulation of GST activity after treatments, indicating that AtuGSTs presumably participate in a wide range of functions, many of which are important in counteracting stress conditions. These functions may be relevant to maintaining cellular homeostasis as well as in the direct detoxification of toxic compounds.

  8. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  9. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  10. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  11. Non-host Plant Resistance against Phytophthora capsici Is Mediated in Part by Members of the I2 R Gene Family in Nicotiana spp.

    Science.gov (United States)

    Vega-Arreguín, Julio C; Shimada-Beltrán, Harumi; Sevillano-Serrano, Jacobo; Moffett, Peter

    2017-01-01

    The identification of host genes associated with resistance to Phytophthora capsici is crucial to developing strategies of control against this oomycete pathogen. Since there are few sources of resistance to P. capsici in crop plants, non-host plants represent a promising source of resistance genes as well as excellent models to study P. capsici - plant interactions. We have previously shown that non-host resistance to P. capsici in Nicotiana spp. is mediated by the recognition of a specific P. capsici effector protein, PcAvr3a1 in a manner that suggests the involvement of a cognate disease resistance (R) genes. Here, we have used virus-induced gene silencing (VIGS) and transgenic tobacco plants expressing dsRNA in Nicotiana spp. to identify candidate R genes that mediate non-host resistance to P. capsici . Silencing of members of the I2 multigene family in the partially resistant plant N. edwardsonii and in the resistant N. tabacum resulted in compromised resistance to P. capsici . VIGS of two other components required for R gene-mediated resistance, EDS1 and SGT1 , also enhanced susceptibility to P. capsici in N. edwardsonii , as well as in the susceptible plants N. benthamiana and N. clevelandii . The silencing of I2 family members in N. tabacum also compromised the recognition of PcAvr3a1. These results indicate that in this case, non-host resistance is mediated by the same components normally associated with race-specific resistance.

  12. [Life lessons of eight families donating organs of deceased family members].

    Science.gov (United States)

    Avilés R, Lissette; Rivera M, M Soledad; Catoni S, María Isabel

    2014-06-01

    Most organ donors are already death. Therefore family members become an essential link in the final decision for organ donation. To get acquainted about the life lessons of people who accepted donating an organ of a deceased family member. Qualitative research, in depth interviews to eight families that accepted donating an organ of a deceased family member. The interviews were analyzed using the method proposed by Streubert et al and modified by Rivera. The life lessons are described in six comprehensive categories. The painful experience changed towards the feeling that the loved one remains alive. This sensation generated a sense of pride in family members and sensitized them towards the painful experience of other people. Therefore, a desire to help and improve as humans beings was awakened. A compassionate approach towards families donating organs with improve organ donation and humanize the process.

  13. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  14. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  15. E2F family members are differentially regulated by reversible acetylation

    DEFF Research Database (Denmark)

    Marzio, G; Wagener, C; Gutierrez, M I

    2000-01-01

    of the other E2F family members. Here we report that E2F-1, -2, and -3, but not E2F-4, -5, and -6, associate with and are acetylated by p300 and cAMP-response element-binding protein acetyltransferases. Acetylation occurs at three conserved lysine residues located at the N-terminal boundary of their DNA......The six members of the E2F family of transcription factors play a key role in the control of cell cycle progression by regulating the expression of genes involved in DNA replication and cell proliferation. E2F-1, -2, and -3 belong to a structural and functional subfamily distinct from those...

  16. Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

    Science.gov (United States)

    Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong

    2016-04-01

    Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. The Pic19 NBS-LRR gene family members are closely linked to Scmv1, but not involved in maize resistance to sugarcane mosaic virus

    DEFF Research Database (Denmark)

    Jiang, Lu; Ingvardsen, Christina Rønn; Lübberstedt, Thomas

    2008-01-01

    the isolation and characterization of the Pic19R gene family members from the inbred line FAP1360A, which shows complete resistance to SCMV. Two primer pairs were designed based on the conserved regions among the known Pic19 paralogs and used for rapid amplification of cDNA ends of FAP1360A. Six full-length c...... of the Pic19R family indicated that the Pic19R-1 paralog is identical to the known Rxo1 gene conferring resistance to rice bacterial streak disease and none of the other Pic19R paralogs seems to be involved in resistance to SCMV...

  18. Rice Snl6, a cinnamoyl-CoA reductase-like gene family member, is required for NH1-mediated immunity to Xanthomonas oryzae pv. oryzae.

    Directory of Open Access Journals (Sweden)

    Rebecca S Bart

    2010-09-01

    Full Text Available Rice NH1 (NPR1 homolog 1 is a key mediator of innate immunity. In both plants and animals, the innate immune response is often accompanied by rapid cell death at the site of pathogen infection. Over-expression of NH1 in rice results in resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo, constitutive expression of defense related genes and enhanced benzothiadiazole (BTH- mediated cell death. Here we describe a forward genetic screen that identified a suppressor of NH1-mediated lesion formation and resistance, snl6. Comparative genome hybridization and fine mapping rapidly identified the genomic location of the Snl6 gene. Snl6 is a member of the cinnamoyl-CoA reductase (CCR-like gene family. We show that Snl6 is required for NH1-mediated resistance to Xoo. Further, we show that Snl6 is required for pathogenesis-related gene expression. In contrast to previously described CCR family members, disruption of Snl6 does not result in an obvious morphologic phenotype. Snl6 mutants have reduced lignin content and increased sugar extractability, an important trait for the production of cellulosic biofuels. These results suggest the existence of a conserved group of CCR-like genes involved in the defense response, and with the potential to alter lignin content without affecting development.

  19. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  20. Nonredundant Regulation of Rice Arbuscular Mycorrhizal Symbiosis by Two Members of the Phosphate Transporter 1 Gene Family

    DEFF Research Database (Denmark)

    Yang, Shu-Yi; Grønlund, Mette; Jakobsen, Iver

    2012-01-01

    Pi acquisition of crops via arbuscular mycorrhizal (AM) symbiosis is becoming increasingly important due to limited highgrade rock Pi reserves and a demand for environmentally sustainable agriculture. Here, we show that 70% of the overall Pi acquired by rice (Oryza sativa) is delivered via...... or PT13 affected the development of the symbiosis, demonstrating that both genes are important for AM symbiosis. For symbiotic Pi uptake, however, only PT11 is necessary and sufficient. Consequently, our results demonstrate that mycorrhizal rice depends on the AM symbiosis to satisfy its Pi demands...... the symbiotic route. To better understand this pathway, we combined genetic, molecular, and physiological approaches to determine the specific functions of two symbiosis-specific members of the PHOSPHATE TRANSPORTER1 (PHT1) gene family from rice, ORYsa;PHT1;11 (PT11) and ORYsa;PHT1;13 (PT13). The PT11 lineage...

  1. Faustoviruses: Comparative genomics of new Megavirales family members

    Directory of Open Access Journals (Sweden)

    Samia eBenamar

    2016-02-01

    Full Text Available An emerging interest for the giant virus discovery process, genome sequencing and analysis has allowed an expansion of the number of known Megavirales members. Using the protist Vermamoeba sp. as cell support, a new giant virus named Faustovirus has been isolated. In this study, we describe the genome sequences of nine Faustoviruses and build a genomic comparison in order to have a comprehensive overview of genomic composition and diversity among this new virus family. The average sequence length of these viruses is 467,592.44 bp (ranging from 455,803 bp to 491,024 bp, making them the fourth largest Megavirales genome after Mimiviruses, Pandoraviruses and Pithovirus sibericum. Faustovirus genomes displayed an average G+C content of 37.14 % (ranging from 36.22% to 39.59% which is close to the G+C content range of the Asfarviridae genomes (38%. The proportion of best matches and the phylogenetic analysis suggest a shared origin with Asfarviridae without belonging to the same family. The core-gene-based phylogeny of Faustoviruses study has identified four lineages. These results were confirmed by the analysis of amino acids and COGs category distribution. The diversity of the gene composition of these lineages is mainly explained by gene deletion or acquisition and some exceptions for gene duplications. The high proportion of best matches from Bacteria and Phycodnaviridae on the pan-genome and unique genes may be explained by an interaction occurring after the separation of the lineages. The Faustovirus core-genome appears to consolidate the surrounding of 207 genes whereas the pan-genome is described as an open pan-genome, its enrichment via the discovery of new Faustoviruses is required to better seize all the genomic diversity of this family.

  2. Mental Wellbeing of Family Members of Autistic Adults

    Science.gov (United States)

    Herrema, Renske; Garland, Deborah; Osborne, Malcolm; Freeston, Mark; Honey, Emma; Rodgers, Jacqui

    2017-01-01

    Family members are often the primary caregiver for autistic adults and this responsibility may impact on the carer's wellbeing and quality of life. 109 family members of autistic adults completed an online survey assessing their wellbeing relating to their caring role for their autistic relative. Family members who were supporting an autistic…

  3. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  4. Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

    DEFF Research Database (Denmark)

    Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan

    2012-01-01

    expression combined with genetic variation in large multigene families with high homology among the alleles is very challenging. Results We designed a rapid qRT-PCR system with the aim of characterising the variation in the expression of hordein genes families. All the known D-, C-, B-, and gamma......-hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...

  5. A Family Affair : Explaining Co-Working By Family Members

    NARCIS (Netherlands)

    Ruijter, Esther de; Lippe, Tanja van der; Raub, Werner; Weessie, Jeroen

    2008-01-01

    This study focuses on co-working by intimate partners and other family members in entrepreneurs’ businesses. We hypothesize that co-working by family is beneficial because it reduces trust problems associated with employment relations. On the other hand, co-working is risky because co-working family

  6. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  7. MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells.

    Science.gov (United States)

    Chen, Dan; Chen, Zujian; Jin, Yi; Dragas, Dragan; Zhang, Leitao; Adjei, Barima S; Wang, Anxun; Dai, Yang; Zhou, Xiaofeng

    2013-01-01

    The miR-99 family is one of the evolutionarily most ancient microRNA families, and it plays a critical role in developmental timing and the maintenance of tissue identity. Recent studies, including reports from our group, suggested that the miR-99 family regulates various physiological processes in adult tissues, such as dermal wound healing, and a number of disease processes, including cancer. By combining 5 independent genome-wide expression profiling experiments, we identified a panel of 266 unique transcripts that were down-regulated in epithelial cells transfected with miR-99 family members. A comprehensive bioinformatics analysis using 12 different sequence-based microRNA target prediction algorithms revealed that 81 out of these 266 down-regulated transcripts are potential direct targets for the miR-99 family. Confirmation experiments and functional analyses were performed to further assess 6 selected miR-99 target genes, including mammalian Target of rapamycin (mTOR), Homeobox A1 (HOXA1), CTD small phosphatase-like (CTDSPL), N-myristoyltransferase 1 (NMT1), Transmembrane protein 30A (TMEM30A), and SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (SMARCA5). HOXA1 is a known proto-oncogene, and it also plays an important role in embryonic development. The direct targeting of the miR-99 family to two candidate binding sequences located in the HOXA1 mRNA was confirmed using a luciferase reporter gene assay and a ribonucleoprotein-immunoprecipitation (RIP-IP) assay. Ectopic transfection of miR-99 family reduced the expression of HOXA1, which, in consequence, down-regulated the expression of its downstream gene (i.e., Bcl-2) and led to reduced proliferation and cell migration, as well as enhanced apoptosis. In summary, we identified a number of high-confidence miR-99 family target genes, including proto-oncogene HOXA1, which may play an important role in regulating epithelial cell proliferation and migration during

  8. MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells.

    Directory of Open Access Journals (Sweden)

    Dan Chen

    Full Text Available The miR-99 family is one of the evolutionarily most ancient microRNA families, and it plays a critical role in developmental timing and the maintenance of tissue identity. Recent studies, including reports from our group, suggested that the miR-99 family regulates various physiological processes in adult tissues, such as dermal wound healing, and a number of disease processes, including cancer. By combining 5 independent genome-wide expression profiling experiments, we identified a panel of 266 unique transcripts that were down-regulated in epithelial cells transfected with miR-99 family members. A comprehensive bioinformatics analysis using 12 different sequence-based microRNA target prediction algorithms revealed that 81 out of these 266 down-regulated transcripts are potential direct targets for the miR-99 family. Confirmation experiments and functional analyses were performed to further assess 6 selected miR-99 target genes, including mammalian Target of rapamycin (mTOR, Homeobox A1 (HOXA1, CTD small phosphatase-like (CTDSPL, N-myristoyltransferase 1 (NMT1, Transmembrane protein 30A (TMEM30A, and SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (SMARCA5. HOXA1 is a known proto-oncogene, and it also plays an important role in embryonic development. The direct targeting of the miR-99 family to two candidate binding sequences located in the HOXA1 mRNA was confirmed using a luciferase reporter gene assay and a ribonucleoprotein-immunoprecipitation (RIP-IP assay. Ectopic transfection of miR-99 family reduced the expression of HOXA1, which, in consequence, down-regulated the expression of its downstream gene (i.e., Bcl-2 and led to reduced proliferation and cell migration, as well as enhanced apoptosis. In summary, we identified a number of high-confidence miR-99 family target genes, including proto-oncogene HOXA1, which may play an important role in regulating epithelial cell proliferation and

  9. Dying in the Hospital: Perspectives of family members.

    Science.gov (United States)

    Dose, Ann Marie; Carey, Elise C; Rhudy, Lori M; Chiu, Yichen; Frimannsdottir, Katrin; Ottenberg, Abigale L; Koenig, Barbara A

    2015-01-01

    Although most patients express a preference to die at home, many (over 30 percent) still die in hospital. This study's purpose was to explore the experience of hospital death from the perspective of patients' family members. interviews were conducted with family members of patients who had died at hospitals affiliated with a large tertiary referral centre in the United States. Content analysis was used to analyze findings. We interviewed 30 family members by phone. Themes were arranged by time frame: before death, time of death, and after death. Families do not interpret clinical cues leading up to death in the same way healthcare providers do; families need clear and direct explanations from providers. Clinicians should assess patient and family understandings of prognosis and communicate clearly and directly. Family members value being with their loved one at the time of death, and they value spending time with the body after death; this should be facilitated in clinical practice.

  10. Coping Strategies of Family Members of Hospitalized Psychiatric Patients

    Directory of Open Access Journals (Sweden)

    Phyllis M. Eaton

    2011-01-01

    Full Text Available This exploratory research paper investigated the coping strategies of families of hospitalized psychiatric patients and identified their positive and negative coping strategies. In this paper, the coping strategies of 45 family members were examined using a descriptive, correlational, mixed method research approach. Guided by the Neuman Systems Model and using the Family Crisis Oriented Personal Evaluation Scales and semistructured interviews, this paper found that these family members used more emotion-focused coping strategies than problem-focused coping strategies. The common coping strategies used by family members were communicating with immediate family, acceptance of their situation, passive appraisal, avoidance, and spirituality. The family members also utilized resources and support systems, such as their immediate families, mental health care professionals, and their churches.

  11. The relationship between mental health workers and family members

    NARCIS (Netherlands)

    van de Bovenkamp, H.M.; Trappenburg, M.J.

    2010-01-01

    Objective To study the relationship between family members and mental health care workers to learn more about the support available to family members of mental health patients. Methods Eighteen interviews were conducted with family members, seven with professionals and two with patients.

  12. [Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

    Science.gov (United States)

    Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-05-01

    The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

  13. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  14. Mental Wellbeing of Family Members of Autistic Adults.

    Science.gov (United States)

    Herrema, Renske; Garland, Deborah; Osborne, Malcolm; Freeston, Mark; Honey, Emma; Rodgers, Jacqui

    2017-11-01

    Family members are often the primary caregiver for autistic adults and this responsibility may impact on the carer's wellbeing and quality of life. 109 family members of autistic adults completed an online survey assessing their wellbeing relating to their caring role for their autistic relative. Family members who were supporting an autistic relative with co-occurring mental health difficulties and who they reported as unprepared for the future, self-reported higher levels of worry, depression, anxiety and stress, and poorer quality of life. These findings emphasise the importance of support for family members of autistic adults, whether through external services to support their relative or individual mental health support for the carer.

  15. Expanding access to naloxone for family members: The Massachusetts experience.

    Science.gov (United States)

    Bagley, Sarah M; Forman, Leah S; Ruiz, Sarah; Cranston, Kevin; Walley, Alexander Y

    2018-05-01

    The Massachusetts Department of Public Health Overdose Education and Naloxone Distribution Program provides overdose education and naloxone rescue kits to people at risk for overdose and bystanders, including family members. Using Massachusetts Department of Public Health data, the aims are to: (i) describe characteristics of family members who receive naloxone; (ii) identify where family members obtain naloxone; and (iii) describe characteristics of rescues by family members. We conducted a retrospective review using program enrollee information collected on a standardised form between 2008 and 2015. We calculated descriptive statistics, including demographics, current substance use, enrolment location, history of witnessed overdoses and rescue attempt characteristics. We conducted a stratified analysis comparing family members who used drugs with those who did not. Family members were 27% of total program enrollees (n = 10 883/40 801). Family members who reported substance use (n = 4679) were 35.6 years (mean), 50.6% female, 76.3% non-Hispanic white, 75.6% had witnessed an overdose, and they obtained naloxone most frequently at HIV prevention programs. Family members who did not report substance use (n = 6148) were 49.2 years (mean), 73.8% female, 87.9% non-Hispanic white, 35.3% had witnessed an overdose, and they obtained naloxone most frequently at community meetings. Family members were responsible for 20% (n = 860/4373) of the total rescue attempts. The Massachusetts experience demonstrates that family members can be active participants in responding to the overdose epidemic by rescuing family members and others. Targeted intervention strategies for families should be included in efforts to expand overdose education and naloxone in Massachusetts. © 2017 Australasian Professional Society on Alcohol and other Drugs.

  16. Unrecognized pediatric and adult family members of children with acute brucellosis.

    Science.gov (United States)

    Çiftdoğan, Dilek Yılmaz; Aslan, Selda

    Brucellosis is an infectious, contagious and zoonotic disease that occurs worldwide. The family members of an index case of brucellosis may be especially susceptible, due to sharing the same source of infection and similar risk factors for brucellosis. In this study, we propose to screen pediatric and adult family members of brucellosis index cases for detecting additional unrecognized infected family members. 114 family members of 41 pediatric patients with brucellosis were evaluated. All family members completed a brief questionnaire and were tested by a standard tube agglutination test (STA). The majority of family members (n=96, 84.2%) were children. Among the 114 family members, 42 (36.8%) were seropositive, and 15 (35.7%) were symptomatic. The majority of the symptomatic seropositive family members (n=12, 80%) had STA titers (≥1:640) higher than asymptomatic seropositive family members (n=9, 33%; p=0.004). The routine screening of both pediatric and adult family members of index cases is a priority in endemic areas. Using this screening approach, unrecognized family members who are seropositive for brucellosis will be identified earlier and be able to receive prompt treatment. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

  17. Understanding type 2 diabetes: including the family member's perspective.

    LENUS (Irish Health Repository)

    White, Patricia

    2012-02-01

    PURPOSE: The purpose of this study was to examine the relationship between psychological and social factors and diabetes outcomes in people with type 2 diabetes and their family members. METHODS: A total of 153 patients with type 2 diabetes were assessed at a diabetes outpatient clinic and postal questionnaires were sent to nominated family members. The measures examined were diabetes knowledge, social support, well-being, and illness perceptions. RESULTS: When compared with those with diabetes, family members reported lower positive well-being and lower levels of satisfaction with support. They also perceived diabetes as a more cyclical illness, which was controlled more by treatment than by the individual. Family members also reported that the person with diabetes was more emotionally distressed and knew more about diabetes than the patient had actually reported himself or herself. There were no differences between the family members of those in good or poor glycaemic control. CONCLUSIONS: This study reinforces the importance of understanding social context and illness beliefs in diabetes management. It also highlights the potential for including family members in discussions and education about diabetes management.

  18. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  19. Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.

    Directory of Open Access Journals (Sweden)

    Juergen H Nett

    Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.

  20. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  1. Clinical procedure for colon carcinoma tissue sampling directly affects the cancer marker-capacity of VEGF family members

    International Nuclear Information System (INIS)

    Pringels, Sarah; Van Damme, Nancy; De Craene, Bram; Pattyn, Piet; Ceelen, Wim; Peeters, Marc; Grooten, Johan

    2012-01-01

    mRNA levels of members of the Vascular Endothelial Growth Factor family (VEGF-A, -B, -C, -D, Placental Growth Factor/PlGF) have been investigated as tissue-based markers of colon cancer. These studies, which used specimens obtained by surgical resection or colonoscopic biopsy, yielded contradictory results. We studied the effect of the sampling method on the marker accuracy of VEGF family members. Comparative RT-qPCR analysis was performed on healthy colon and colon carcinoma samples obtained by biopsy (n = 38) or resection (n = 39) to measure mRNA expression levels of individual VEGF family members. mRNA levels of genes encoding the eicosanoid enzymes cyclooxygenase 2 (COX2) and 5-lipoxygenase (5-LOX) and of genes encoding the hypoxia markers glucose transporter 1 (GLUT-1) and carbonic anhydrase IX (CAIX) were included as markers for cellular stress and hypoxia. Expression levels of COX2, 5-LOX, GLUT-1 and CAIX revealed the occurrence in healthy colon resection samples of hypoxic cellular stress and a concurrent increment of basal expression levels of VEGF family members. This increment abolished differential expression of VEGF-B and VEGF-C in matched carcinoma resection samples and created a surgery-induced underexpression of VEGF-D. VEGF-A and PlGF showed strong overexpression in carcinoma samples regardless of the sampling method. Sampling-induced hypoxia in resection samples but not in biopsy samples affects the marker-reliability of VEGF family members. Therefore, biopsy samples provide a more accurate report on VEGF family mRNA levels. Furthermore, this limited expression analysis proposes VEGF-A and PlGF as reliable, sampling procedure insensitive mRNA-markers for molecular diagnosis of colon cancer

  2. Theobroma cacao L. pathogenesis-related gene tandem array members show diverse expression dynamics in response to pathogen colonization.

    Science.gov (United States)

    Fister, Andrew S; Mejia, Luis C; Zhang, Yufan; Herre, Edward Allen; Maximova, Siela N; Guiltinan, Mark J

    2016-05-17

    The pathogenesis-related (PR) group of proteins are operationally defined as polypeptides that increase in concentration in plant tissues upon contact with a pathogen. To date, 17 classes of highly divergent proteins have been described that act through multiple mechanisms of pathogen resistance. Characterizing these families in cacao, an economically important tree crop, and comparing the families to those in other species, is an important step in understanding cacao's immune response. Using publically available resources, all members of the 17 recognized pathogenesis-related gene families in the genome of Theobroma cacao were identified and annotated resulting in a set of ~350 members in both published cacao genomes. Approximately 50 % of these genes are organized in tandem arrays scattered throughout the genome. This feature was observed in five additional plant taxa (three dicots and two monocots), suggesting that tandem duplication has played an important role in the evolution of the PR genes in higher plants. Expression profiling captured the dynamics and complexity of PR genes expression at basal levels and after induction by two cacao pathogens (the oomycete, Phytophthora palmivora, and the fungus, Colletotrichum theobromicola), identifying specific genes within families that are more responsive to pathogen challenge. Subsequent qRT-PCR validated the induction of several PR-1, PR-3, PR-4, and PR-10 family members, with greater than 1000 fold induction detected for specific genes. We describe candidate genes that are likely to be involved in cacao's defense against Phytophthora and Colletotrichum infection and could be potentially useful for marker-assisted selection for breeding of disease resistant cacao varieties. The data presented here, along with existing cacao-omics resources, will enable targeted functional genetic screening of defense genes likely to play critical functions in cacao's defense against its pathogens.

  3. Family members' unique perspectives of the family: examining their scope, size, and relations to individual adjustment.

    Science.gov (United States)

    Jager, Justin; Bornstein, Marc H; Putnick, Diane L; Hendricks, Charlene

    2012-06-01

    Using the McMaster Family Assessment Device (Epstein, Baldwin, & Bishop, 1983) and incorporating the perspectives of adolescent, mother, and father, this study examined each family member's "unique perspective" or nonshared, idiosyncratic view of the family. We used a modified multitrait-multimethod confirmatory factor analysis that (a) isolated for each family member's 6 reports of family dysfunction the nonshared variance (a combination of variance idiosyncratic to the individual and measurement error) from variance shared by 1 or more family members and (b) extracted common variance across each family member's set of nonshared variances. The sample included 128 families from a U.S. East Coast metropolitan area. Each family member's unique perspective generalized across his or her different reports of family dysfunction and accounted for a sizable proportion of his or her own variance in reports of family dysfunction. In addition, after holding level of dysfunction constant across families and controlling for a family's shared variance (agreement regarding family dysfunction), each family member's unique perspective was associated with his or her own adjustment. Future applications and competing alternatives for what these "unique perspectives" reflect about the family are discussed. PsycINFO Database Record (c) 2012 APA, all rights reserved.

  4. Family Members' Unique Perspectives of the Family: Examining their Scope, Size, and Relations to Individual Adjustment

    Science.gov (United States)

    Jager, Justin; Bornstein, Marc H.; Diane, L. Putnick; Hendricks, Charlene

    2012-01-01

    Using the Family Assessment Device (FAD; Epstein, Baldwin, & Bishop, 1983) and incorporating the perspectives of adolescent, mother, and father, this study examined each family member's “unique perspective” or non-shared, idiosyncratic view of the family. To do so we used a modified multitrait-multimethod confirmatory factor analysis that (1) isolated for each family member's six reports of family dysfunction the non-shared variance (a combination of variance idiosyncratic to the individual and measurement error) from variance shared by one or more family members and (2) extracted common variance across each family member's set of non-shared variances. The sample included 128 families from a U.S. East Coast metropolitan area. Each family member's unique perspective generalized across his or her different reports of family dysfunction and accounted for a sizable proportion of his or her own variance in reports of family dysfunction. Additionally, after holding level of dysfunction constant across families and controlling for a family's shared variance (agreement regarding family dysfunction), each family member's unique perspective was associated with his or her own adjustment. Future applications and competing alternatives for what these “unique perspectives” reflect about the family are discussed. PMID:22545933

  5. Posttraumatic stress disorder in women with war missing family members.

    Science.gov (United States)

    Baraković, Devla; Avdibegović, Esmina; Sinanović, Osman

    2014-12-01

    Research in crisis areas indicate that survivors' responses to the forced disappearance of family members are similar to reactions to other traumatic events. The aim of this study was to determine the presence of symptoms of posttraumatic stress disorder (PTSD) in women with war missing family members in Bosnia and Herzegovina 18 years after the war in this region (1992-1995). The study included 160 women aged 47.1±14.0 from three regions of Bosnia and Herzegovina. It was carried out in the period from April 2010 to May 2011. Of the 160 participants, 120 women had a war missing family member and 40 women had no war missing family members. The Harvard Trauma Questionnaire (HTQ), the Beck Depression Inventory (BDI) and the Hamilton Anxiety Rating Scale (HAMA) were used for data collection. Basic socio-demographic data and data concerning the missing family members were also collected. Women with war missing family members experienced significantly more traumatic war experiences (18.43±5.27 vs 6.57±4.34, pfamily members. Women with war missing family members showed significantly more severe PTSD symptoms. Based on the results of this study, it was determined that the forced disappearance of a family member is an ambiguous situation that can be characterized as a traumatic experience.

  6. Mining and comparative survey of EST-SSR markers among members of Euphorbiaceae family.

    Science.gov (United States)

    Sen, Surojit; Dehury, Budheswar; Sahu, Jagajjit; Rathi, Sunayana; Yadav, Raj Narain Singh

    2018-04-06

    Euphorbiaceae represents flowering plants family of tropical and sub-tropical region rich in secondary metabolites of economic importance. To understand and assess the genetic makeup among the members, this study was undertaken to characterize and compare SSR markers from publicly available ESTs and GSSs of nine selected species of the family. Mining of SSRs was performed by MISA, primer designing by Primer3, while functional annotation, gene ontology (GO) and enrichment analysis were performed by Blast2GO. A total 12,878 number of SSRs were detected from 101,701 number of EST sequences. SSR density ranged from 1 SSR/3.22 kb to 1 SSR/15.65 kb. A total of 1873 primer pairs were designed for the annotated SSR-Contigs. About 77.07% SSR-ESTs could be assigned a significant match to the protein database. 3037 unique SSR-FDM were assigned and IPR003657 (WRKY Domain) was found to be the most dominant FDM among the members. 1810 unique GO terms obtained were further subjected to enrichment analysis to obtain 513 statistically significant GO terms mapped to the SSR containing ESTs. Most frequent enriched GO terms were, GO:0003824 for molecular function, GO:0006350 for biological process and GO:0005886 for cellular component, justifying the richness of defensive secondary metabolites and phytomedicine within the family. The results from this study provides tangible insight to genetic make-up and distribution of SSRs. Functional annotation corresponded many genes of unknown functions which may be considered as novel genes or genes responsible for stress specific secondary metabolites. Further studies are required to understand stress specific genes accountable for leveraging the synthesis of secondary metabolites.

  7. Coping with stigma by association and family burden among family members of people with mental illness.

    Science.gov (United States)

    van der Sanden, Remko L M; Stutterheim, Sarah E; Pryor, John B; Kok, Gerjo; Bos, Arjan E R

    2014-10-01

    In this study, we explored stigma by association, family burden, and their impact on the family members of people with mental illness. We also studied the ways in which family members coped with these phenomena. We conducted semistructured interviews with 23 immediate family members of people with mental illness. Participants reported various experiences of stigma by association and family burden. Social exclusion, being blamed, not being taken seriously, time-consuming caregiving activities, and exhaustion appeared to be the predominant forms of stigma by association and family burden experienced by the participants. The participants used problem-focused and emotion-focused coping strategies, separately or simultaneously, to cope with the negative impact of stigma by association and family burden. The results suggest that family members should have access to services to address these problems. Social, instrumental, and emotional support should be given to family members by community members and mental health professionals.

  8. Evolutionary study of vertebrate and invertebrate members of the dystrophin and utrophin gene family

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, R.G.; Nicholson, L.; Bobrow, M. [Paediatric Research Unit, London (United Kingdom)] [and others

    1994-09-01

    Vertebrates express two members of the dystrophin gene family. The prototype, dystrophin, is expressed in muscle and neural tissue, and is defective in the human disorders Duchenne and Becker muscular dystrophy (DMD, BMD). The dystrophin homologue utrophin is more generally expressed but has not yet been associated with a genetic disorder. The function of neither protein is clear. A comparison of human utrophin with the known dystrophins (human, mouse, chicken, Torpedo) suggests that dystrophin and utrophin diverged before the vertebrate radiation. We have used reverse-transcript PCR (RT-PCR) directed by degenerate primers to characterize dystrophin and utrophin transcripts from a range of vertebrate and invertebrate animals. Our results suggest that the duplication leading to distinct dystrophin and utrophin genes occurred close to the point of divergence of urochordates from the cephalochordate-vertebrate lineage. This divergence may have occurred to fulfill a novel role which arose at this point, or may reflect a need for separate regulation of the neuromuscular and other functions of the ancient dystrophin. Our data include sequences of the first non-human utrophins to be characterized, and show these to be substantially more divergent than their cognate dystrophins. In addition, our results provide a large body of information regarding the tolerance of amino acid positions in the cysteine-rich and C-terminal domains to substitution. This will aid the interpretations of DMD and BMD missense mutations in these regions.

  9. Helping concerned family members of individuals with substance use and concurrent disorders: An evaluation of a family member-oriented treatment program.

    Science.gov (United States)

    Denomme, William James; Benhanoh, Orry

    2017-08-01

    There is a growing body of research demonstrating that families of individuals with substance use and concurrent disorders (SUCD) experience a wide range of biopsychosocial problems that significantly impedes their quality of life and health. However, there has been a relative lack of treatment programs primarily focused on improving the well-being and quality of life of these family members. The current study assessed the efficacy of such a program at reducing stress, increasing perceived social support from family and friends, and increasing general, dyadic, and self-rated family functioning within these concerned family members. A sample of 125 family members of individuals with SUCDs was recruited, of which 97 participated in the treatment program and 28 were used as the comparison group. Results indicated that the treatment program significantly reduced stress, increased perceived social support from family and friends, and increased general, dyadic and self-rated family functioning. A perceived personal benefits questionnaire demonstrated that participants had a better understanding of SUCDs, better coping capabilities in regard to emotional difficulties, adopted stronger coping methods, participated in more leisure activities, and improved their relationship with the individual with a SUCD. The results of the current study further demonstrate the need to implement more of these family-member oriented psycho-educational treatment programs. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Mental health and family relations among people who inject drugs and their family members in Vietnam.

    Science.gov (United States)

    Li, Li; Tuan, Nguyen Anh; Liang, Li-Jung; Lin, Chunqing; Farmer, Shu C; Flore, Martin

    2013-11-01

    This article explores the association of people who inject drugs and their family members in terms of mental health and family relations. The objective was to understand the family context and its impact on people who inject drugs in a family-oriented culture in Vietnam. Cross-sectional assessment data were gathered from 83 people who inject drugs and 83 of their family members recruited from four communes in Phú Thọ province, Vietnam. Depressive symptoms and family relations were measured for both people who inject drugs and family members. Internalized shame and drug-using behavior were reported by people who inject drugs, and caregiver burden was reported by family members. We found that higher level of drug using behavior of people who inject drugs was significantly associated with higher depressive symptoms and lower family relations reported by themselves as well as their family members. Family relations reported by people who inject drugs and their family members were positively correlated. The findings highlight the need for interventions that address psychological distress and the related challenges faced by family members of people who inject drugs. The article has policy implication which concludes with an argument for developing strategies that enhance the role of families in supporting behavioral change among people who inject drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  12. Technical nursing students interacting with family members of hospitalized children

    Directory of Open Access Journals (Sweden)

    Juliana Yukari Takahashi Onishi

    Full Text Available ABSTRACT Objective: To understand technical nursing students' meaning of interacting with family members of hospitalized children. Method: Symbolic Interactionism was used as the theoretical framework and Qualitative Content Analysis was the methodological procedure. A total of eight graduates from an institution situated in the city of Osasco, Sao Paulo state, participated in this study. Data were collected through semi-structured interviews. Results: A total of five representative themes were revealed: Dealing with difficult situations with family members; Perceiving oneself to be unprepared to interact with family members; Family members being a helpful tool; Developing strategies to obtain a good interaction with family members; and Teachers being facilitators of the interaction with family members. Final considerations: To be acquainted with this experience has led to the understanding of the need to include the theme of family care in the curriculum of the Technical Nursing Course. Additionally, the present study contributed to reflections on the importance of such knowledge for this population and to the development of future studies, as this theme has been scarcely explored in the literature.

  13. Technical nursing students interacting with family members of hospitalized children.

    Science.gov (United States)

    Onishi, Juliana Yukari Takahashi; Ribeiro, Circéa Amália; Silva, Maria Cristina Ferreira Carlos Rodrigues da; Borba, Regina Issuzu Hirooka de

    2017-01-01

    To understand technical nursing students' meaning of interacting with family members of hospitalized children. Symbolic Interactionism was used as the theoretical framework and Qualitative Content Analysis was the methodological procedure. A total of eight graduates from an institution situated in the city of Osasco, Sao Paulo state, participated in this study. Data were collected through semi-structured interviews. A total of five representative themes were revealed: Dealing with difficult situations with family members; Perceiving oneself to be unprepared to interact with family members; Family members being a helpful tool; Developing strategies to obtain a good interaction with family members; and Teachers being facilitators of the interaction with family members. To be acquainted with this experience has led to the understanding of the need to include the theme of family care in the curriculum of the Technical Nursing Course. Additionally, the present study contributed to reflections on the importance of such knowledge for this population and to the development of future studies, as this theme has been scarcely explored in the literature.

  14. Family presence during resuscitation: A descriptive study with Iranian nurses and patients' family members.

    Science.gov (United States)

    Zali, Mahnaz; Hassankhani, Hadi; Powers, Kelly A; Dadashzadeh, Abbas; Rajaei Ghafouri, Rouzbeh

    2017-09-01

    Family presence during resuscitation (FPDR) has advantages for the patients' family member to be present at the bedside. However, FPDR is not regularly practiced by nurses, especially in low to middle income countries. The purpose of this study was to determine Iranian nurses' and family members' attitudes towards FPDR. In a descriptive study, data was collected from the random sample of 178 nurses and 136 family members in four hospitals located in Iran. A 27-item questionnaire was used to collect data on attitudes towards FPDR, and descriptive and correlational analyses were conducted. Of family members, particularly the women, 57.2% (n=78) felt it is their right to experience FPDR and that it has many advantages for the family; including the ability to see that everything was done and worry less. However, 62.5% (n=111) of the nurses disagreed with an adult implementation of FPDR. Nurses perceived FPDR to have many disadvantages. Family members becoming distressed and interfering with the patient which may prolong the resuscitation effort. Nurses with prior education on FPDR were more willing to implement it. FPDR was desired by the majority of family members. To meet their needs, it is important to improve Iranian nurses' views about the advantages of the implementation of FPDR. Education on FPDR is recommended to improve Iranian nurses' views about the advantages of the implementation of FPDR. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Evolution, functional differentiation, and co-expression of the RLK gene family revealed in Jilin ginseng, Panax ginseng C.A. Meyer.

    Science.gov (United States)

    Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping

    2018-02-21

    Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.

  16. Patient and family members perspectives on radioactive iodine treatment

    Energy Technology Data Exchange (ETDEWEB)

    McGrath, P.; Fitch, M.I. [Toronto-Sunnybrook Regional Cancer Centre, Toronto, Ontario (Canada)

    1999-08-01

    This report documents the findings of a survey of patients who received radioactive iodine therapy and their family members. The main objective of the survey was to gain an understanding of the experience of receiving radioactive iodine from the patient and family's perspective. The data from this study helped to inform the ARCP and GMA as they developed AC-9 - Principles of the management of radionuclide therapies. A survey was distributed to 700 patients and family members through physicians at 8 sites across Canada. Locations included: Newfoundland, Nova Scotia, Ontario (2 sites), Quebec (2 sites), Manitoba and British Columbia. A total of 190 patients and 140 family members returned completed surveys. Data was analyzed separately for individuals treated as inpatients and those treated as outpatients. The results of the survey provided a perspective from patients and families about their experiences regarding radioactive iodine therapy. The data indicate variation in patients' and family members' perspectives about how precautions are to be implemented. Both patients and family members expressed the desire for more information regarding many aspects of the treatment experience. The results have implications for the development of patient information, continuing education (in particular in the areas of precaution), the provision of access to supportive and counselling services, and the importance of looking at the individual situations of patients and their families. (author)

  17. Patient and family members perspectives on radioactive iodine treatment

    International Nuclear Information System (INIS)

    McGrath, P.; Fitch, M.I.

    1999-08-01

    This report documents the findings of a survey of patients who received radioactive iodine therapy and their family members. The main objective of the survey was to gain an understanding of the experience of receiving radioactive iodine from the patient and family's perspective. The data from this study helped to inform the ARCP and GMA as they developed AC-9 - Principles of the management of radionuclide therapies. A survey was distributed to 700 patients and family members through physicians at 8 sites across Canada. Locations included: Newfoundland, Nova Scotia, Ontario (2 sites), Quebec (2 sites), Manitoba and British Columbia. A total of 190 patients and 140 family members returned completed surveys. Data was analyzed separately for individuals treated as inpatients and those treated as outpatients. The results of the survey provided a perspective from patients and families about their experiences regarding radioactive iodine therapy. The data indicate variation in patients' and family members' perspectives about how precautions are to be implemented. Both patients and family members expressed the desire for more information regarding many aspects of the treatment experience. The results have implications for the development of patient information, continuing education (in particular in the areas of precaution), the provision of access to supportive and counselling services, and the importance of looking at the individual situations of patients and their families. (author)

  18. Genetic variation in a member of the laminin gene family affects variation in body composition in Drosophila and humans

    Directory of Open Access Journals (Sweden)

    Hunter Gary R

    2008-08-01

    Full Text Available Abstract Background The objective of the present study was to map candidate loci influencing naturally occurring variation in triacylglycerol (TAG storage using quantitative complementation procedures in Drosophila melanogaster. Based on our results from Drosophila, we performed a human population-based association study to investigate the effect of natural variation in LAMA5 gene on body composition in humans. Results We identified four candidate genes that contributed to differences in TAG storage between two strains of D. melanogaster, including Laminin A (LanA, which is a member of the α subfamily of laminin chains. We confirmed the effects of this gene using a viable LanA mutant and showed that female flies homozygous for the mutation had significantly lower TAG storage, body weight, and total protein content than control flies. Drosophila LanA is closely related to human LAMA5 gene, which maps to the well-replicated obesity-linkage region on chromosome 20q13.2-q13.3. We tested for association between three common single nucleotide polymorphisms (SNPs in the human LAMA5 gene and variation in body composition and lipid profile traits in a cohort of unrelated women of European American (EA and African American (AA descent. In both ethnic groups, we found that SNP rs659822 was associated with weight (EA: P = 0.008; AA: P = 0.05 and lean mass (EA: P= 0.003; AA: P = 0.03. We also found this SNP to be associated with height (P = 0.01, total fat mass (P = 0.01, and HDL-cholesterol (P = 0.003 but only in EA women. Finally, significant associations of SNP rs944895 with serum TAG levels (P = 0.02 and HDL-cholesterol (P = 0.03 were observed in AA women. Conclusion Our results suggest an evolutionarily conserved role of a member of the laminin gene family in contributing to variation in weight and body composition.

  19. Identification and characterization of new members of the SXT/R391 family of integrative and conjugative elements (ICEs) in Proteus mirabilis.

    Science.gov (United States)

    Bie, Luyao; Wu, Hao; Wang, Xin-Hua; Wang, Mingyu; Xu, Hai

    2017-08-01

    Integrative and conjugative elements (ICEs) are self-transmissible chromosomal mobile elements that play significant roles in the dissemination of antimicrobial resistance genes. Identification of the structures and functions of ICEs, particularly those in pathogens, improves understanding of the dissemination of antimicrobial resistance. This study identified new members of the sulfamethoxazole-trimethoprim (SXT)/R391 family of ICEs that could confer multi-drug resistance in the opportunistic pathogen Proteus mirabilis, characterized their genetic structures, and explored their evolutionary connection with other members of this family of ICEs. Three new members of the SXT/R391 family of ICEs were detected in six of 77 P. mirabilis strains isolated in China: ICEPmiChn2 (one strain), ICEPmiChn3 (one strain) and ICEPmiChn4 (three strains). All three new ICEs harbour antimicrobial resistance genes from diverse origins, suggesting their capability in acquiring foreign genes and serving as important carriers for antimicrobial resistance genes. Structural analysis showed that ICEPmiChn3 is a particularly interesting and unique ICE that has lost core genes involved in conjugation, and could not transfer to other cells via conjugation. This finding confirmed the key roles of these missing genes in conjugation. Further phylogenetic analysis suggested that ICEs in geographically close strains are also connected evolutionarily, and ICEPmiChn3 lost its conjugation cassette from a former mobile ICE. The identification and characterization of the three new members of the SXT/R391 family of ICEs in this work leads to suggestions of core ICE genes essential for conjugation, and extends understanding on the structures of ICEs, evolutionary relationships between ICEs, and the antimicrobial resistance mechanisms of P. mirabilis. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  20. The CC2D1A, a member of a new gene family with C2 domains, is involved in autosomal recessive non-syndromic mental retardation.

    Science.gov (United States)

    Basel-Vanagaite, L; Attia, R; Yahav, M; Ferland, R J; Anteki, L; Walsh, C A; Olender, T; Straussberg, R; Magal, N; Taub, E; Drasinover, V; Alkelai, A; Bercovich, D; Rechavi, G; Simon, A J; Shohat, M

    2006-03-01

    The molecular basis of autosomal recessive non-syndromic mental retardation (NSMR) is poorly understood, mostly owing to heterogeneity and absence of clinical criteria for grouping families for linkage analysis. Only two autosomal genes, the PRSS12 gene on chromosome 4q26 and the CRBN on chromosome 3p26, have been shown to cause autosomal recessive NSMR, each gene in only one family. To identify the gene causing autosomal recessive NSMR on chromosome 19p13.12. The candidate region established by homozygosity mapping was narrowed down from 2.4 Mb to 0.9 Mb on chromosome 19p13.12. A protein truncating mutation was identified in the gene CC2D1A in nine consanguineous families with severe autosomal recessive NSMR. The absence of the wild type protein in the lymphoblastoid cells of the patients was confirmed. CC2D1A is a member of a previously uncharacterised gene family that carries two conserved motifs, a C2 domain and a DM14 domain. The C2 domain is found in proteins which function in calcium dependent phospholipid binding; the DM14 domain is unique to the CC2D1A protein family and its role is unknown. CC2D1A is a putative signal transducer participating in positive regulation of I-kappaB kinase/NFkappaB cascade. Expression of CC2D1A mRNA was shown in the embryonic ventricular zone and developing cortical plate in staged mouse embryos, persisting into adulthood, with highest expression in the cerebral cortex and hippocampus. A previously unknown signal transduction pathway is important in human cognitive development.

  1. Si dios quiere: Hispanic families' experiences of caring for a seriously mentally ill family member.

    Science.gov (United States)

    Guarnaccia, P J; Parra, P; Deschamps, A; Milstein, G; Argiles, N

    1992-06-01

    Among Hispanics, the family is viewed as the primary care giver for seriously mentally ill family members. This paper reports on a study of minority families' conceptions of serious mental illness, of their interaction with mental health resources, and on the burdens experienced by families in caring for a seriously mentally ill family member. The focus of this paper is on Hispanic families in New Jersey, with some comparative data from other ethnic group families. Families' conceptions of serious mental illness are explored and analyzed to demonstrate the importance of concepts of nervios and fallo mental in shaping families' responses to their ill family member. Social support systems for families are also explored with particular attention to the role of religious institutions and religious healing as a major source of solace.

  2. Military Personnel: Medical, Family Support, and Educational Services Are Available for Exceptional Family Members

    National Research Council Canada - National Science Library

    Crosse, Marcia

    2007-01-01

    The Department of Defense's (DOD) Exceptional Family Member Program (EFMP) is a mandatory enrollment program for active duty servicemembers who have family members with special medical needs. The Ronald W...

  3. Differential evolution of members of the rhomboid gene family with conservative and divergent patterns.

    Science.gov (United States)

    Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong

    2015-04-01

    Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  4. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  5. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  6. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  7. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  8. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  9. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  10. Cadherin-related family member 3, a childhood asthma susceptibility gene product, mediates rhinovirus C binding and replication.

    Science.gov (United States)

    Bochkov, Yury A; Watters, Kelly; Ashraf, Shamaila; Griggs, Theodor F; Devries, Mark K; Jackson, Daniel J; Palmenberg, Ann C; Gern, James E

    2015-04-28

    Members of rhinovirus C (RV-C) species are more likely to cause wheezing illnesses and asthma exacerbations compared with other rhinoviruses. The cellular receptor for these viruses was heretofore unknown. We report here that expression of human cadherin-related family member 3 (CDHR3) enables the cells normally unsusceptible to RV-C infection to support both virus binding and replication. A coding single nucleotide polymorphism (rs6967330, C529Y) was previously linked to greater cell-surface expression of CDHR3 protein, and an increased risk of wheezing illnesses and hospitalizations for childhood asthma. Compared with wild-type CDHR3, cells transfected with the CDHR3-Y529 variant had about 10-fold increases in RV-C binding and progeny yields. We developed a transduced HeLa cell line (HeLa-E8) stably expressing CDHR3-Y529 that supports RV-C propagation in vitro. Modeling of CDHR3 structure identified potential binding sites that could impact the virus surface in regions that are highly conserved among all RV-C types. Our findings identify that the asthma susceptibility gene product CDHR3 mediates RV-C entry into host cells, and suggest that rs6967330 mutation could be a risk factor for RV-C wheezing illnesses.

  11. Strengths of families to limit relapse in mentally ill family members

    African Journals Online (AJOL)

    Tlhalefi T. Tlhowe

    The purpose of this research was to explore and describe the strengths of .... In this review family strengths refer to qualities of families with a mentally ill .... they thought that their mentally ill family members were just acting out when ..... techniques, creative communication and praise as strengths. .... International Journal of.

  12. The high price of depression: Family members' health conditions and health care costs.

    Science.gov (United States)

    Ray, G Thomas; Weisner, Constance M; Taillac, Cosette J; Campbell, Cynthia I

    2017-05-01

    To compare the health conditions and health care costs of family members of patients diagnosed with a Major Depressive Disorder (MDD) to family members of patients without an MDD diagnosis. Using electronic health record data, we identified family members (n=201,914) of adult index patients (n=92,399) diagnosed with MDD between 2009 and 2014 and family members (n=187,011) of matched patients without MDD. Diagnoses, health care utilization and costs were extracted for each family member. Logistic regression and multivariate models were used to compare diagnosed health conditions, health services cost, and utilization of MDD and non-MDD family members. Analyses covered the 5years before and after the index patient's MDD diagnosis. MDD family members were more likely than non-MDD family members to be diagnosed with mood disorders, anxiety, substance use disorder, and numerous other conditions. MDD family members had higher health care costs than non-MDD family members in every period analyzed, with the highest difference being in the year before the index patient's MDD diagnosis. Family members of patients with MDD are more likely to have a number of health conditions compared to non-MDD family members, and to have higher health care cost and utilization. Copyright © 2017. Published by Elsevier Inc.

  13. Genome-Wide Analysis of the Musa WRKY Gene Family: Evolution and Differential Expression during Development and Stress.

    Science.gov (United States)

    Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H

    2016-01-01

    The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.

  14. Genome-wide analysis of the Musa WRKY gene family: evolution and differential expression during development and stress

    Directory of Open Access Journals (Sweden)

    Ridhi eGoel

    2016-03-01

    Full Text Available The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/ development including fruit ripening process respectively.

  15. Patients in a persistent vegetative state attitudes and reactions of family members.

    Science.gov (United States)

    Tresch, D D; Sims, F H; Duthie, E H; Goldstein, M D

    1991-01-01

    Patients in a persistent vegetative state (PVS) constituted approximately 3% of the population in four Milwaukee nursing homes. In order to understand family members' attitudes and reactions toward such patients, 33 (92%) of 36 family members of patients in PVS contacted were studied. The age of the patients ranged from 19 to 95 with a mean age of 73.4 +/- 17.2 years, and family members' ages ranged from 41 to 89 with a mean age of 61.8 +/- 3.3 years. The etiology of the PVS varied from dementia to cerebral trauma. The mean duration of the PVS was 54 +/- 8.4 months (range 12 to 204). Family members reported that they visited patients 260 times during the first year following the onset of the PVS and were still visiting at a rate of 209 visits yearly at the time of the interview. There was no significant correlation between the frequency of the family members visits and the duration of the PVS, the patient's or family member's age, or the family member's relationship to the patient. Ninety percent of patients were considered by family members to have some awareness of pain, light or darkness, environment, taste, verbal conversation, or the family member's presence. Most family members thought they understood the patient's medical condition, and the majority did not expect the patient to improve. Nevertheless, the majority of family members wanted the patient to undergo therapeutic interventions, including transfer to the acute hospital and surgery.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. The CC2D1A, a member of a new gene family with C2 domains, is involved in autosomal recessive non‐syndromic mental retardation

    Science.gov (United States)

    Basel‐Vanagaite, L; Attia, R; Yahav, M; Ferland, R J; Anteki, L; Walsh, C A; Olender, T; Straussberg, R; Magal, N; Taub, E; Drasinover, V; Alkelai, A; Bercovich, D; Rechavi, G; Simon, A J; Shohat, M

    2006-01-01

    Background The molecular basis of autosomal recessive non‐syndromic mental retardation (NSMR) is poorly understood, mostly owing to heterogeneity and absence of clinical criteria for grouping families for linkage analysis. Only two autosomal genes, the PRSS12 gene on chromosome 4q26 and the CRBN on chromosome 3p26, have been shown to cause autosomal recessive NSMR, each gene in only one family. Objective To identify the gene causing autosomal recessive NSMR on chromosome 19p13.12. Results The candidate region established by homozygosity mapping was narrowed down from 2.4 Mb to 0.9 Mb on chromosome 19p13.12. A protein truncating mutation was identified in the gene CC2D1A in nine consanguineous families with severe autosomal recessive NSMR. The absence of the wild type protein in the lymphoblastoid cells of the patients was confirmed. CC2D1A is a member of a previously uncharacterised gene family that carries two conserved motifs, a C2 domain and a DM14 domain. The C2 domain is found in proteins which function in calcium dependent phospholipid binding; the DM14 domain is unique to the CC2D1A protein family and its role is unknown. CC2D1A is a putative signal transducer participating in positive regulation of I‐κB kinase/NFκB cascade. Expression of CC2D1A mRNA was shown in the embryonic ventricular zone and developing cortical plate in staged mouse embryos, persisting into adulthood, with highest expression in the cerebral cortex and hippocampus. Conclusions A previously unknown signal transduction pathway is important in human cognitive development. PMID:16033914

  17. Strengths of families to limit relapse in mentally ill family members ...

    African Journals Online (AJOL)

    Background: Relapse prevention in mental health care is important. Utilising the strengths of families can be a valuable approach in relapse prevention. Studies on family strengths have been conducted but little has been done on the strengths of family members to help limit relapse in mental health care users. The purpose ...

  18. WD-repeat instability and diversification of the Podospora anserina hnwd non-self recognition gene family.

    Science.gov (United States)

    Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu

    2010-05-06

    Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.

  19. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  20. Genome-wide analysis of the homeodomain-leucine zipper (HD-ZIP) gene family in peach (Prunus persica).

    Science.gov (United States)

    Zhang, C H; Ma, R J; Shen, Z J; Sun, X; Korir, N K; Yu, M L

    2014-04-08

    In this study, 33 homeodomain-leucine zipper (HD-ZIP) genes were identified in peach using the HD-ZIP amino acid sequences of Arabidopsis thaliana as a probe. Based on the phylogenetic analysis and the individual gene or protein characteristics, the HD-ZIP gene family in peach can be classified into 4 subfamilies, HD-ZIP I, II, III, and IV, containing 14, 7, 4, and 8 members, respectively. The most closely related peach HD-ZIP members within the same subfamilies shared very similar gene structure in terms of either intron/exon numbers or lengths. Almost all members of the same subfamily shared common motif compositions, thereby implying that the HD-ZIP proteins within the same subfamily may have functional similarity. The 33 peach HD-ZIP genes were distributed across scaffolds 1 to 7. Although the primary structure varied among HD-ZIP family proteins, their tertiary structures were similar. The results from this study will be useful in selecting candidate genes from specific subfamilies for functional analysis.

  1. An overview of the GAGE cancer/testis antigen family with the inclusion of newly identified members

    DEFF Research Database (Denmark)

    Gjerstorff, M F; Ditzel, H J

    2008-01-01

    . This review describes the structure and phylogeny of the GAGE family members and presents a revised nomenclature, which will enable a more clear distinction of genes and gene products. The GAGE gene locus at chromosome X p11.23 consists of at least 16 genes, each of which is located in one of an equal number...... of highly conserved tandem repeats, and more genes remain to be identified. These genes are likely the creation of unequal replication under positive selection after the divergence of primates from other mammals. The encoded products are predicted to be highly similar small acidic proteins involved in germ...

  2. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  3. Effective doses to family members of patients treated with radioiodine-131

    International Nuclear Information System (INIS)

    Kocovska, M Zdraveska; Vaskova, O; Majstorov, V; Kuzmanovska, S; Gjorceva, D Pop; Jokic, V Spasic

    2011-01-01

    The purpose of this study was to evaluate the effective dose to family members of thyroid cancer and hyperthyroid patients treated with radioiodine-131, and also to compare the results with dose constraints proposed by the International Commission of Radiological Protection (ICRP) and the Basic Safety Standards (BSS) of the International Atomic Energy Agency (IAEA). For the estimation of the effective doses, sixty family members of sixty patients, treated with radioiodine-131, and thermoluminiscent dosimeters (Model TLD 100) were used. Thyroid cancer patients were hospitalized for three days, while hyperthyroid patients were treated on out-patient basis. The family members wore TLD in front of the torso for seven days. The radiation doses to family members of thyroid cancer patients were well below the recommended dose constraint of 1 mSv. The mean value of effective dose was 0.21 mSv (min 0.02 - max 0.51 mSv). Effective doses, higher than 1 mSv, were detected for 11 family members of hyperthyroid patients. The mean value of effective dose of family members of hyperthyroid patients was 0.87 mSv (min 0.12 - max 6.79). The estimated effective doses to family members of hyperthyroid patients were higher than the effective doses to family members of thyroid carcinoma patients. These findings may be considered when establishing new national guidelines concerning radiation protection and release of patients after a treatment with radioiodine therapy.

  4. Expression analysis of the CLCA gene family in mouse and human with emphasis on the nervous system

    NARCIS (Netherlands)

    M. Piirsoo (Marko); D. Meijer (Daniëlle); T. Timmusk (Tnis)

    2009-01-01

    textabstractBackground. Members of the calcium-activated chloride channel (CLCA) gene family have been suggested to possess a variety of functions including cell adhesion and tumor suppression. Expression of CLCA family members has mostly been analyzed in non-neural tissues. Here we describe the

  5. Mental Health and Family Relations: Correlated Reports from People Who Inject Drugs and their Family Members in Vietnam

    Science.gov (United States)

    Li, Li; Tuan, Nguyen Anh; Liang, Li-Jung; Lin, Chunqing; Farmer, Shu C.; Flore, Martin

    2013-01-01

    Background This article explores the association of people who inject drugs and their family members in terms of mental health and family relations. The objective was to understand the family context and its impact on people who inject drugs in a family-oriented culture in Vietnam. Methods Cross-sectional assessment data were gathered from 83 people who inject drugs and 83 of their family members recruited from four communes in Phú Thọ province, Vietnam. Depressive symptoms and family relations were measured for both people who inject drugs and family members. Internalized shame and drug-using behavior were reported by people who inject drugs, and caregiver burden was reported by family members. Results We found that higher level of drug using behavior of people who inject drugs was significantly associated with higher depressive symptoms and lower family relations reported by themselves as well as their family members. Family relations reported by people who inject drugs and their family members were positively correlated. Conclusion The findings highlight the need for interventions that address psychological distress and the related challenges faced by family members of people who inject drugs. The article has policy implication which concludes with an argument for developing strategies that enhance the role of families in supporting behavioral change of people who inject drugs. PMID:23910167

  6. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  7. Resilient family processes, personal reintegration, and subjective well-being outcomes for military personnel and their family members.

    Science.gov (United States)

    Clark, Malissa A; O'Neal, Catherine W; Conley, Kate M; Mancini, Jay A

    2018-01-01

    Deployment affects not just the service members, but also their family members back home. Accordingly, this study examined how resilient family processes during a deployment (i.e., frequency of communication and household management) were related to the personal reintegration of each family member (i.e., how well each family member begins to "feel like oneself again" after a deployment), as well as several indicators of subjective well-being. Drawing from the family attachment network model (Riggs & Riggs, 2011), the present study collected survey data from 273 service members, their partners, and their adolescent children. Resilient family processes during the deployment itself (i.e., frequency of communication, household management), postdeployment positive and negative personal reintegration, and several indicators of well-being were assessed. Frequency of communication was related to personal reintegration for service members, while household management was related to personal reintegration for nondeployed partners; both factors were related to personal reintegration for adolescents. Negative and positive personal reintegration related to a variety of subjective well-being outcomes for each individual family member. Interindividual (i.e., crossover) effects were also found, particularly between adolescents and nondeployed partners. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  8. Support for Teens When a Family Member has Cancer

    Science.gov (United States)

    When a parent, brother, or sister has been diagnosed with cancer, family members need extra support. Information to help teens learn how to cope, talk with family members, manage stress, and get support from counselors when a loved one has been diagnosed with, or is being treated for, cancer.

  9. Military service absences and family members' mental health: A timeline followback assessment.

    Science.gov (United States)

    Rodriguez, Aubrey J; Margolin, Gayla

    2015-08-01

    Although military service, and particularly absence due to deployment, has been linked to risk for depression and anxiety among some spouses and children of active duty service members, there is limited research to explain the heterogeneity in family members' reactions to military service stressors. The current investigation introduces the Timeline Followback Military Family Interview (TFMFI) as a clinically useful strategy to collect detailed time-linked information about the service member's absences. Two dimensions of parent absence--the extent to which absences coincide with important family events and cumulative time absent--were tested as potential risks to family members' mental health. Data from 70 mother-adolescent pairs revealed that the number of important family events missed by the service member was linked to elevated youth symptoms of depression, even when accounting for the number of deployments and cumulative duration of the service member's absence. However, youth who reported more frequent contact with the service member during absences were buffered from the effects of extensive absence. Mothers' symptoms were associated with the cumulative duration of the service members' time away, but not with family events missed by the service member. These results identify circumstances that increase the risk for mental health symptoms associated with military family life. The TFMFI provides an interview-based strategy for clinicians wishing to understand military family members' lived experience during periods of service-member absence. (c) 2015 APA, all rights reserved).

  10. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  11. Family members' lived experience in the intensive care unit: a phemenological study.

    LENUS (Irish Health Repository)

    McKiernan, Margaret

    2012-01-31

    AIM: To describe the lived experience of family members of patients in the intensive care unit. BACKGROUND: Admission of a critically ill relative to an intensive care unit causes anxiety and stress to family members. Nursing care is initially focused on maintaining the physiological stability of the patient and less on the needs and concerns of family members. Understanding how families make sense of this experience may help nurses focus on the delivery of family centred care. METHODOLOGY: A phenomenological method was used to describe the lived experiences of family members of patients in an intensive care unit. In-depth interviews were conducted with six family members and analysed using qualitative thematic analysis. RESULTS: Four main themes emerged from the data: the need to know, making sense of it all, being there with them and caring and support. Family members needed honest information about the patient\\'s progress and outcome to make the situation more bearable for them. Making sense of the situation was a continuous process which involved tracking and evaluating care given. Being with their relative sustained their family bond and was a way to demonstrate love and support. Caring reassurance provided by the nurses enabled a sense of security. Support was needed by family members to assist them in coping. CONCLUSION: The research provided an insight into how family members viewed the impact of the admission and how they subsequently found ways of dealing with the situation. RELEVANCE TO CLINICAL PRACTICE: Using a holistic approach to nursing assessment and care delivery in intensive care necessitates that nurses interact with and care for family members of patients. Development of a philosophy of family centred care is necessary, with formal assessment of families to take place soon after admission and an appropriate plan of care drawn up at this time.

  12. Registered Nurses working together with family members of older people.

    Science.gov (United States)

    Weman, Karin; Fagerberg, Ingegerd

    2006-03-01

    The aim of the study was to reach a more profound understanding, through looking at nurses' working situation, of those factors that influence how nurses are able to work together with family members of older people living in nursing homes or similar facilities. Working with the care of older people as a Registered Nurse provides a varied job with many challenges. Nurses have to co-operate with family members of those in community health care. Co-operation is important and necessary for all involved. Nurses working in elder care in a geographically defined area received a questionnaire with three open-ended questions, on the difficulties and/or problems involved with working together with family members, and the positive or negative aspects of this co-operation. Analysis was carried out using the latent content analysis method. Three themes, problems within the system, interaction with families and caring in nursing work, are presented with categories and their subcategories. The nurses wanted their superior to be a nurse so that their working situation would be better understood. Appreciation from their superior and family members was also a very important part of their work as nurses in community health care. The frequent changes and the lack of time in the work of elder care often put nurses under considerable psychological pressure. For the most part family members are a resource for the elder, but sometimes they will avoid contact, which will make co-operating difficult. Registered Nurses and family members are dependent on each other in their care of the elder. Relevance to clinical practice. More attention should be paid to the working situation of Registered Nurses in community health care, and their ability to work together with family members of older people.

  13. Differential expression of three members of the multidomain adhesion CCp family in Babesia bigemina, Babesia bovis and Theileria equi.

    Directory of Open Access Journals (Sweden)

    Reginaldo G Bastos

    Full Text Available Members of the CCp protein family have been previously described to be expressed on gametocytes of apicomplexan Plasmodium parasites. Knocking out Plasmodium CCp genes blocks the development of the parasite in the mosquito vector, making the CCp proteins potential targets for the development of a transmission-blocking vaccine. Apicomplexans Babesia bovis and Babesia bigemina are the causative agents of bovine babesiosis, and apicomplexan Theileria equi causes equine piroplasmosis. Bovine babesiosis and equine piroplasmosis are the most economically important parasite diseases that affect worldwide cattle and equine industries, respectively. The recent sequencing of the B. bovis and T. equi genomes has provided the opportunity to identify novel genes involved in parasite biology. Here we characterize three members of the CCp family, named CCp1, CCp2 and CCp3, in B. bigemina, B. bovis and T. equi. Using B. bigemina as an in vitro model, expression of all three CCp genes and proteins was demonstrated in temperature-induced sexual stages. Transcripts for all three CCp genes were found in vivo in blood stages of T. equi, and transcripts for CCp3 were detected in vivo in blood stages of B. bovis. However, no protein expression was detected in T. equi blood stages or B. bovis blood stages or B. bovis tick stages. Collectively, the data demonstrated a differential pattern of expression of three orthologous genes of the multidomain adhesion CCp family by B. bigemina, B. bovis and T. equi. The novel CCp members represent potential targets for innovative approaches to control bovine babesiosis and equine piroplasmosis.

  14. Development of a new marker system for identifying the complex members of the low-molecular-weight glutenin subunit gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Zhang, Xiaofei; Liu, Dongcheng; Yang, Wenlong; Liu, Kunfan; Sun, Jiazhu; Guo, Xiaoli; Li, Yiwen; Wang, Daowen; Ling, Hongqing; Zhang, Aimin

    2011-05-01

    Low-molecular-weight glutenin subunits (LMW-GSs) play an important role in determining the bread-making quality of bread wheat. However, LMW-GSs display high polymorphic protein complexes encoded by multiple genes, and elucidating the complex LMW-GS gene family in bread wheat remains challenging. In the present study, using conventional polymerase chain reaction (PCR) with conserved primers and high-resolution capillary electrophoresis, we developed a new molecular marker system for identifying LMW-GS gene family members. Based on sequence alignment of 13 LMW-GS genes previously identified in the Chinese bread wheat variety Xiaoyan 54 and other genes available in GenBank, PCR primers were developed and assigned to conserved sequences spanning the length polymorphism regions of LMW-GS genes. After PCR amplification, 17 DNA fragments in Xiaoyan 54 were detected using capillary electrophoresis. In total, 13 fragments were identical to previously identified LMW-GS genes, and the other 4 were derived from unique LMW-GS genes by sequencing. This marker system was also used to identify LMW-GS genes in Chinese Spring and its group 1 nulli-tetrasomic lines. Among the 17 detected DNA fragments, 4 were located on chromosome 1A, 5 on 1B, and 8 on 1D. The results suggest that this marker system is useful for large-scale identification of LMW-GS genes in bread wheat varieties, and for the selection of desirable LMW-GS genes to improve the bread-making quality in wheat molecular breeding programmes.

  15. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  16. Expression analysis of five tobacco EIN3 family members in relation to tissue-specific ethylene responses.

    Science.gov (United States)

    Rieu, I; Mariani, C; Weterings, K

    2003-10-01

    Ethylene induces different sets of genes in different tissues and at different stages of development. To investigate whether these differential responses are caused by differential expression of members of the EIN3 family transcription factors, five tobacco family members were isolated. They can be divided into three subgroups, which is probably due to the amphidiploid nature of tobacco. In phylogenetic analysis, each of the subgroups clustered with one of the three tomato EIL proteins and all NtEILs proved to be most homologous to Arabidopsis EIN3 and EIL1. Although organ-specific ethylene responses have been observed before, northern blot analysis showed that all NtEILs were expressed in all organs. To study differential NtEIL expression at the cellular level, in situ hybridization was used on the tobacco ovary. It was found that different ovary tissues displayed variable ethylene-induced expression of two ethylene-responsive marker genes. By contrast, no differences were found in expression level or tissue-specificity for any of the NtEILs in the ovary, before or after ethylene treatment. This indicates that the organ and tissue-specific ethylene responses are not caused by differential expression of NtEIL family members. These results support a model in which the developmental signals that regulate the tissue-specific responses are integrated with the ethylene signal downstream of a common primary ethylene-signalling pathway.

  17. Routine HIV Testing of Family Members of Hospitalized Patients in Nigeria

    Directory of Open Access Journals (Sweden)

    Olusegun Busari

    2012-04-01

    Full Text Available Background: HIV testing for family members of HIV-positive patients may enhance disclosure of status of spouses, encourage family social support and improve access to HIV services. Objective was to employ the approach of routine HIV testing to determine the prevalence of HIV among family members of both HIV positive and negative patients on admission in a federal HIV treatment designated hospital in Western Nigeria Methodology: This prospective study was conducted between January 2006 and June 2009. Ethical clearance was obtained from the Research and Ethics committee of the hospital prior to the study. Informed consent was obtained from each participant. HIV testing was offered to consenting family members of HIV positive and negative patients on admission. The family members included spouses, children of patients, parents of paediatric patients and other family members. Analysis was done in frequencies and percentages Results: 162 family members of 184 patients were tested. Spouses were, 81 (50.0%; fathers, 14 (8.6%; mothers, 20 (12.3%; children, 19 (11.7% and others family members, 28 (17.3%. 151 (93.2% of testers were first timers. Majority of those tested (82.1% had post-test counseling. The overall HIV prevalence was 12.3% (20/162. HIV prevalence within different family members was 14.8% (12/81, 20% (4/20, 7.1% (1/14, 10.5% (2/19 and 3.6% (1/28 for spouses, mothers, fathers, children and others respectively.In addition, the prevalence of HIV among family members of HIV positive and negative patients was 15.6% (14/90 and 8.3% (6/72 respectively. Of 12 spouses that were positive, 7 (13.5% were HIV-discordant; and in 71.4% (5/7 of discordant couples, the spouse was positive while the patient on admission was negative. Conclusion: The results indicate that routine HIV testing of family members of patients on admission is a strategy for identification of vast number of HIV infected persons. This method is not only innovative, but also a novel

  18. REGISTRATION OF VEHICLES IN SWITZERLAND: MEMBERS OF THE FAMILY OF A MEMBER OF THE PERSONNEL

    CERN Multimedia

    Service des Relations avec les Pays Hôtes

    1999-01-01

    The Permanent Mission of Switzerland to the International Organisations in Geneva has informed CERN that members of the family of a member of the personnel who hold a carte delégitimation or a Ci permit may not register a vehicle in Switzerland. Only those members of the family who are of Swiss nationality or hold an ordinary permit (e.g. a 'B' or 'C' permit) may register vehicles in their own names.Relations with the Host States Servicehttp://www.cern.ch/relations/Tel. 72848

  19. Perceived Family Resources Based on Number of Members with ADHD

    Science.gov (United States)

    Corwin, Melinda; Mulsow, Miriam; Feng, Du

    2012-01-01

    Objective: This study examines how the number of family members with ADHD affects other family members' perceived resources. Method: A total of 40 adolescents diagnosed with ADHD and their mothers, fathers, and adolescent siblings living in the household participated. Hierarchical linear modeling was used to analyze family-level data from a total…

  20. The dying child and surviving family members.

    Science.gov (United States)

    Shrier, D K

    1980-12-01

    This overview of death and dying focuses on the dying child and surviving family members. Children's concepts of death at different developmental stages are reviewed. These range from an inability to distinguish death from other forms of separation prior to age 3, through partial concepts of death until, by age 10 to 15 years, children are able to conceptualize death as universal, inevitable and final. The importance of adults assisting in the child's growing comprehension of death is stressed. The stages of grief and mourning, as outlined by Kubler-Ross, are reviewed from the perspective of the child and family: denial, anger, bargaining, depression and acceptance. Recognition is given to the variations in coping styles among different family members. The special circumstances related to the death of an infant and the impact of the death of a child on the surviving siblings are discussed. Specific helpful interventions to assist families in coping with mourning are described. The death of a child remains one of the most painful and difficult events for a family and its physician to accept.

  1. Ten Warning Signs Your Older Family Member May Need Help

    Science.gov (United States)

    ... Warning Signs Your Older Family Member May Need Help Changes in physical and cognitive abilities that may ... and their family members, friends, and caregivers. To help in determining when an older adult may need ...

  2. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  3. Lesch-Nyhan variant syndrome: variable presentation in 3 affected family members.

    Science.gov (United States)

    Sarafoglou, Kyriakie; Grosse-Redlinger, Krista; Boys, Christopher J; Charnas, Laurence; Otten, Noelle; Broock, Robyn; Nyhan, William L

    2010-06-01

    Lesch-Nyhan disease is an inborn error of purine metabolism that results from deficiency of the activity of hypoxanthine phosphoribosyltransferase (HPRT). The heterogeneity of clinical phenotypes seen in HPRT deficiency corresponds to an inverse relationship between HPRT enzyme activity and clinical severity. With rare exception, each mutation produces a stereotypical pattern of clinical disease; onset of neurologic symptoms occurs during infancy and is thought to be nonprogressive. To document a family in which a single HPRT gene mutation has led to 3 different clinical and enzymatic phenotypes. Case report. Settings A university-based outpatient metabolic clinic and a biochemical genetics laboratory. Patients Three males (2 infants and their grandfather) from the same family with Lesch-Nyhan variant, including one of the oldest patients with Lesch-Nyhan variant at diagnosis (65 years). Clinical and biochemical observations. Sequencing of 5 family members revealed a novel mutation c.550G>T in exon 7 of the HPRT gene. The considerably variable clinical phenotype corresponded with the variable enzymatic activity in the 3 males, with the grandfather being the most severely affected. The different phenotypes encountered in the enzymatic analysis of cultured fibroblasts from a single mutation in the same family is unprecedented. The significant decrease in the grandfather's HPRT enzymatic activity compared with that of his grandchildren could be a function of the Hayflick Limit Theory of cell senescence.

  4. Transcriptome-wide identification of salt-responsive members of the WRKY gene family in Gossypium aridum.

    Science.gov (United States)

    Fan, Xinqi; Guo, Qi; Xu, Peng; Gong, YuanYong; Shu, Hongmei; Yang, Yang; Ni, Wanchao; Zhang, Xianggui; Shen, Xinlian

    2015-01-01

    WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs) in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III), as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.

  5. Transcriptome-wide identification of salt-responsive members of the WRKY gene family in Gossypium aridum.

    Directory of Open Access Journals (Sweden)

    Xinqi Fan

    Full Text Available WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III, as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.

  6. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  7. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  8. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  9. Family Members' Reports of the Technology Use of Family Members with Intellectual and Developmental Disabilities

    Science.gov (United States)

    Palmer, S. B.; Wehmeyer, M. L.; Davies, D. K.; Stock, S. E.

    2012-01-01

    Background: A nationwide survey of family members of people with intellectual and developmental disabilities ranging in age from birth through adulthood was conducted to replicate a similar effort by Wehmeyer and update the knowledge base concerning technology use by people with intellectual and developmental disabilities. Method: Survey responses…

  10. Stress-coping morbidity among family members of addiction patients in Singapore.

    Science.gov (United States)

    Lee, Kae Meng Thomas; Manning, Victoria; Teoh, Hui Chin; Winslow, Munidasa; Lee, Arthur; Subramaniam, Mythily; Guo, Song; Wong, Kim Eng

    2011-07-01

    INTRODUCTIONS AND AIMS: Research from western countries indicates that family members of addiction patients report heightened stress and psychological morbidity. This current study aimed to examine stress, coping behaviours, related morbidity and subsequent resource utilisation among family members of patients attending a national treatment program in Singapore. The study used a matched case-control design. One hundred family members of addiction patients attending treatment and 100 matched controls completed a semi-structured interview with a researcher. This included the Beck Depression Inventory-II, Short-Form Health Survey-36, General Health Questionnaire-28, Perceived Stress Scale, Family Member Impact Scale and Coping Questionnaire, and also assessed service utilisation. T-tests revealed significantly greater depression, stress and psychiatric morbidity and poorer overall well-being (Short-Form Health Survey-36) among family members compared with controls. Despite the apparent negative impact on mental health, their physical morbidity did not differ from controls and services utilisation was low. Tolerant-inactive coping was found to be most strongly correlated with psychological well-being. Multivariate analysis indicated that perceived stress was the strongest predictor of overall strain (General Health Questionnaire), but this was not moderated by coping style. Subjective appraisal of stress and coping responses are essential factors affecting the morbidity of family members. Family members demonstrated a need and willingness to engage in formal treatment/counselling for their own problems that were attributed to living with an addiction patient. This provides an opportunity for stress management and brief interventions to modify coping styles, thereby minimizing the potential negative mental health impact on family members. © 2011 Australasian Professional Society on Alcohol and other Drugs.

  11. Strategies needed to involve men, other family members.

    Science.gov (United States)

    Barnett, B

    1998-01-01

    Women typically do not make decisions about contraceptive use and family planning on their own, and many women often have little, if any, decision-making power in the home. Strategies are therefore needed to empower women, educate family members, and involve men in reproductive health programs. Policymakers should expand the range of male services and encourage the greater use of male contraceptive methods. Furthermore, health programs should include counseling to help men and women improve their communications skills and conduct education campaigns to inform men about the roles they can play in family planning. Men should also learn about the side effects of both male and female methods, since concern over method side effects can frustrate their support of family planning. Appropriate strategies can be tailored to meet individual group needs. Programs in Madagascar, Bangladesh, Honduras, and Nepal are described as examples of how the support of family members can positively affect family planning use and reproductive health.

  12. Knowledge of Dementia: Do family members understand dementia as a terminal condition?

    Science.gov (United States)

    Andrews, Sharon; McInerney, Fran; Toye, Christine; Parkinson, Camillus-Anthony; Robinson, Andrew

    2017-07-01

    Current research identifies advanced dementia to be the terminal phase of this progressive and incurable condition. However, there has been relatively little investigation into how family members of people with advanced dementia understand their relative's condition. In this article, we report on semi-structured interviews with 10 family members of people with advanced dementia, in a residential aged care facility. Using a qualitative, descriptive design, we explored family members' understandings of dementia, whether they were aware that it was a terminal condition, and the ways they developed their understandings. Findings revealed that the majority of family members could not recognize the terminal nature of dementia. Relying on predominantly lay understandings, they had little access to formal information and most failed to conceptualize a connection between dementia and death. Moreover, family members engaged in limited dialogue with aged care staff about such issues, despite their relatives being in an advanced stage of the disease. Findings from our study suggest that how family members understand their relative's condition requires greater attention. The development of staff/family partnerships that promote shared communication about dementia and dying may enhance family members' understandings of the dementia trajectory and the types of decisions they may be faced with during the more advanced stages of the disease.

  13. A member of a new plant gene family encoding a meprin and TRAF homology (MATH) domain-containing protein is involved in restriction of long distance movement of plant viruses

    Science.gov (United States)

    Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie

    2010-01-01

    Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558

  14. Arabidopsis thaliana BTB/ POZ-MATH proteins interact with members of the ERF/AP2 transcription factor family.

    Science.gov (United States)

    Weber, Henriette; Hellmann, Hanjo

    2009-11-01

    In Arabidopsis thaliana, the BTB/POZ-MATH (BPM) proteins comprise a small family of six members. They have been described previously to use their broad complex, tram track, bric-a-brac/POX virus and zinc finger (BTB/POZ) domain to assemble with CUL3a and CUL3b and potentially to serve as substrate adaptors to cullin-based E3-ligases in plants. In this article, we show that BPMs can also assemble with members of the ethylene response factor/Apetala2 transcription factor family, and that this is mediated by their meprin and TRAF (tumor necrosis factor receptor-associated factor) homology (MATH) domain. In addition, we provide a detailed description of BPM gene expression patterns in different tissues and on abiotic stress treatments, as well as their subcellular localization. This work connects, for the first time, BPM proteins with ethylene response factor/Apetala2 family members, which is likely to represent a novel regulatory mechanism of transcriptional control.

  15. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  16. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  17. Identification of Variants in RET and IHH Pathway Members in a Large Family With History of Hirschsprung Disease.

    Science.gov (United States)

    Sribudiani, Y; Chauhan, R K; Alves, M M; Petrova, L; Brosens, E; Harrison, C; Wabbersen, T; de Graaf, B M; Rügenbrink, T; Burzynski, G; Brouwer, R W W; IJcken, W F J van; Maas, S M; de Klein, A; Osinga, J; Eggen, B J L; Burns, A J; Brooks, A S; Shepherd, I T; Hofstra, R M W

    2018-03-27

    Hirschsprung disease (HSCR) is an inherited congenital disorder characterized by absence of enteric ganglia in the distal part of the gut. Variants in ret proto-oncogene (RET) have been associated with up to 50% of familial and 35% of sporadic cases. We searched for variants that affect disease risk in a large, multi-generational family with history of HSCR in a linkage region previously associated with the disease (4q31.3-q32.3) and exome wide. We performed exome sequencing analyses of a family in the Netherlands with 5 members diagnosed with HSCR and 2 members diagnosed with functional constipation. We initially focused on variants in genes located in 4q31.3-q32.3. However, we also performed an exome-wide analysis in which known HSCR or HSCR-associated gene variants predicted to be deleterious were prioritized for further analysis. Candidate genes were expressed in HEK293, COS-7, and Neuro-2a cells and analyzed by luciferase and immunoblot assays. Morpholinos were designed to target exons of candidate genes and injected into 1-cell stage zebrafish embryos. Embryos were allowed to develop and stained for enteric neurons. Within the linkage region, we identified 1 putative splice variant in the LPS responsive beige-like anchor protein gene (LRBA). Functional assays could not confirm its predicted effect on mRNA splicing or on expression of the mab-21 like 2 gene (MAB21L2), which is embedded in LRBA. Zebrafish that developed following injection of the lrba morpholino had a shortened body axis and subtle gut morphological defects, but no significant reduction in number of enteric neurons compared with controls. Outside the linkage region, members of 1 branch of the family carried a previously unidentified RET variant or an in-frame deletion in the glial cell line derived neurotrophic factor gene (GDNF), which encodes a ligand of RET. This deletion was located 6 base pairs before the last codon. We also found variants in the indian hedgehog gene (IHH) and its mediator

  18. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

    Science.gov (United States)

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-11-01

    Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  19. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

    Directory of Open Access Journals (Sweden)

    Xiaoyan Huang

    2017-01-01

    Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  20. SP140L, an Evolutionarily Recent Member of the SP100 Family, Is an Autoantigen in Primary Biliary Cirrhosis

    Directory of Open Access Journals (Sweden)

    Mario Saare

    2015-01-01

    Full Text Available The SP100 family members comprise a set of closely related genes on chromosome 2q37.1. The widely expressed SP100 and the leukocyte-specific proteins SP110 and SP140 have been associated with transcriptional regulation and various human diseases. Here, we have characterized the SP100 family member SP140L. The genome sequence analysis showed the formation of SP140L gene through rearrangements of the two neighboring genes, SP100 and SP140, during the evolution of higher primates. The SP140L expression is interferon-inducible with high transcript levels in B cells and other peripheral blood mononuclear cells. Subcellularly, SP140L colocalizes with SP100 and SP140 in nuclear structures that are devoid of SP110, PML, or p300 proteins. Similarly to SP100 and SP140 protein, we detected serum autoantibodies to SP140L in patients with primary biliary cirrhosis using luciferase immunoprecipitation system and immunoblotting assays. In conclusion, our results show that SP140L is phylogenetically recent member of SP100 proteins and acts as an autoantigen in primary biliary cirrhosis patients.

  1. Resilience in families in which a member has been diagnosed with schizophrenia.

    Science.gov (United States)

    Bishop, M; Greeff, A P

    2015-09-01

    Due to the extensive focus of the literature on the burden placed on families in which a member has been diagnosed with a mental illness such as schizophrenia, there is a need to identify factors that may help these families to be resilient and adapt to their crisis. The aim of this study was to identify family resilience qualities in families in which a member has been diagnosed with schizophrenia. The study comprised 42 families, represented by 33 parents and 9 siblings of the diagnosed family member. Families were recruited from three support groups within the Cape Metropolitan area, Western Cape, South Africa. Qualitative data were obtained through an open-ended question and quantitative data were collected with seven self-report questionnaires. The following family resilience qualities were identified: family income; finding support in their community; family togetherness; family communication style during crises; affirming and supportive communication patterns; family hardiness; commitment to the family; reframing crises as a challenge; and an internal locus of control within the family. The findings may be used by professionals and support group facilitators to enhance the resilience and functioning of families living with a member with schizophrenia. With approximately 1% of the world's population diagnosed with schizophrenia, it is clear that many families are affected when a member has been diagnosed. There is a need to identify factors that may help these families to be resilient. The aim of this study was to identify family resilience qualities in families in which a member has been diagnosed with schizophrenia. The following family resilience qualities were identified as resources that helped them to adapt to the many challenges put to them: family income, finding support in their community, the availability of hospitals, churches and professionals, family togetherness, family communication, family hardiness, commitment to the family, reframing crises

  2. Annotation, Phylogeny and Expression Analysis of the Nuclear Factor Y Gene Families in Common Bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Carolina eRípodas

    2015-01-01

    Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.

  3. A novel mutation of the EYA4 gene associated with post-lingual hearing loss in a proband is co-segregating with a novel PAX3 mutation in two congenitally deaf family members.

    Science.gov (United States)

    Cesca, Federica; Bettella, Elisa; Polli, Roberta; Cama, Elona; Scimemi, Pietro; Santarelli, Rosamaria; Murgia, Alessandra

    2018-01-01

    This work was aimed at establishing the molecular etiology of hearing loss in a 9-year old girl with post-lingual non-syndromic mild sensorineural hearing loss with a complex family history of clinically heterogeneous deafness. The proband's DNA was subjected to NGS analysis of a 59-targeted gene panel, with the use of the Ion Torrent PGM platform. Conventional Sanger sequencing was used for segregation analysis in all the affected relatives. The proband and all the other hearing impaired members of the family underwent a thorough clinical and audiological evaluation. A new likely pathogenic mutation in the EYA4 gene (c.1154C > T; p.Ser385Leu) was identified in the proband and in her 42-year-old father with post-lingual non-syndromic profound sensorineural hearing loss. The EYA4 mutation was also found in the proband's grandfather and uncle, both showing clinical features of Waardenburg syndrome type 1. A novel pathogenic splice-site mutation (c.321+1G > A) of the PAX3 gene was found to co-segregate with the EYA4 mutation in these two subjects. The identified novel EYA4 mutation can be considered responsible of the hearing loss observed in the proband and her father, while a dual molecular diagnosis was reached in the relatives co-segregating the EYA4 and the PAX3 mutations. In these two subjects the DFNA10 phenotype was masked by Waardenburg syndrome. The use of NGS targeted gene-panel, in combination with an extensive clinical and audiological examination led us to identify the genetic cause of the hearing loss in members of a family in which different forms of autosomal dominant deafness segregate. These results provide precise and especially important prognostic and follow-up information for the future audiologic management in the youngest affected member. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Epigenetic modifications by Trithorax group proteins during early embryogenesis: do members of Trx-G function as maternal effect genes?

    Science.gov (United States)

    Andreu-Vieyra, Claudia; Matzuk, Martin M

    2007-02-01

    Maternal effect genes encode transcripts that are expressed during oogenesis. These gene products are stored in the oocyte and become functional during resumption of meiosis and zygote genome activation, and in embryonic stem cells. To date, a few maternal effect genes have been identified in mammals. Epigenetic modifications have been shown to be important during early embryonic development and involve DNA methylation and post-translational modification of core histones. During development, two families of proteins have been shown to be involved in epigenetic changes: Trithorax group (Trx-G) and Polycomb group (Pc-G) proteins. Trx-G proteins function as transcriptional activators and have been shown to accumulate in the oocyte. Deletion of Trx-G members using conventional knockout technology results in embryonic lethality in the majority of the cases analysed to date. Recent studies using conditional knockout mice have revealed that at least one family member is necessary for zygote genome activation. We propose that other Trx-G members may also regulate embryonic genome activation and that the use of oocyte-specific deletor mouse lines will help clarify their roles in this process.

  5. Family Benefits In Member States Of The European Union: A Comparative Perspective

    Directory of Open Access Journals (Sweden)

    Stănescu Simona Maria

    2015-06-01

    Full Text Available The article intends to be a screening of family benefits in the 28 Member States of the European Union (EU and to contribute to the research of shared trends with respect to family approach in these countries. Four types of family benefits including eight distinctive categories are analysed: child-benefit, child care allowances, child-raising allowances, and other benefits (birth and adoption grants, allowance for single parents, special allowances for children with disabilities, advance payments for maintenance and other allowances. The paper is based on primary and secondary analysis of 28 sets of national data provided through the European Union's Mutual Information System on Social Protection (MISSOC. Three categories of member states are considered: founder member states of the EU, other “old” member states, and the new Central and Eastern ones. Chronological development of national regulations with impact on family benefits is analysed in connection with the moment of becoming a member state. Various forms of family benefits legislation and their main subjects of interest are further researched. The last part of the article looks at the coverage of family benefits. Seven member states operate in this respect based on regulations adopted before EU accession. Belgium, Finland, and Lithuania have the “most preserved” family regulations per category of member states. The first three topics of family regulations are: child, family, and allowance / benefit. The most frequently provided family benefits are: birth and adoption grants, and special allowance for children with disabilities. All eight family benefits are provided in France, Finland, Hungary, and Slovenia. Only two types of family benefits are available in Ireland, Spain, and Cyprus.

  6. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  7. Lipasin, thermoregulated in brown fat, is a novel but atypical member of the angiopoietin-like protein family.

    Science.gov (United States)

    Fu, Zhiyao; Yao, Fayi; Abou-Samra, Abdul B; Zhang, Ren

    2013-01-18

    Hyperlipidemia is a major contributor to cardiovascular diseases. Members of the angiopoietin-like protein family (ANGPTLs) are important determinants of blood lipid levels. Lipasin, a newly identified gene that regulates serum triglycerides, is homologous to ANGPTL3's N-terminal domain, which is sufficient and necessary for blood lipid regulation. Brown fat is critical in mediating energy homeostasis. Thermogenesis is the primary function of brown fat, in which Lipasin and some ANGPTLs are abundant; it is unknown, however, whether these genes are thermoregulated. We therefore comprehensively examined the thermoregulation of Lipasin and ANGPTLs in brown fat. Here we show that Lipasin is a novel but atypical member of the ANGPTL family because it is within the same branch as ANGPTL3 and 4 by phylogenetic analysis. The mRNA levels of Lipasin are dramatically increased in the cold environment (4 °C for 4 h) whereas those of ANGPTL4 and ANGPTL2 are suppressed. Fasting dramatically suppresses Lipasin but increases ANGPTL4. High-fat diet treatment increases Lipasin, but reduces ANGPTL2. The distinct transcriptional regulations of Lipasin, ANGPTL2 and ANGPTL4 in brown fat in response to cold exposure and nutritional stimulation suggest distinct physiological roles for ANGPTL family members in mediating thermogenesis and energy homeostasis. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W

    2015-12-29

    GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

  9. Genetic analysis of Chinese families reveals a novel truncation allele of the retinitis pigmentosa GTPase regulator gene

    Directory of Open Access Journals (Sweden)

    Fang Hu

    2014-10-01

    Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.

  10. Female children with incarcerated adult family members at risk for lifelong neurological decline.

    Science.gov (United States)

    Brewer-Smyth, Kathleen; Pohlig, Ryan T; Bucurescu, Gabriel

    2016-07-01

    A secondary analysis of data from adult female prison inmates in the mid-Atlantic United States defined relationships between having incarcerated adult family members during childhood and neurological outcomes. Of 135 inmates, 99 (60%) had one or more incarcerated adult family members during childhood. Regression analyses revealed that having incarcerated adult family members was related to greater frequency and severity of childhood abuse and higher incidence of neurological deficits in adulthood, especially related to traumatic brain injuries, compared to those without incarcerated adult family members. Along with being role models, adult family members impact the neurological health of children throughout their life-span.

  11. Effect of praziquantel on the differential expression of mouse hepatic genes and parasite ATP binding cassette transporter gene family members during Schistosoma mansoni infection.

    Directory of Open Access Journals (Sweden)

    Melissa C Sanchez

    2017-06-01

    Full Text Available Schistosomiasis is a chronic parasitic disease caused by sexually dimorphic blood flukes of the genus Schistosoma. Praziquantel (PZQ is the only drug widely available to treat the disease but does not kill juvenile parasites. Here we report the use of next generation sequencing to study the transcriptional effect of PZQ on murine hepatic inflammatory, immune and fibrotic responses to Schistosoma mansoni worms and eggs. An initial T helper cell 1 (Th1 response is induced against schistosomes in mice treated with drug vehicle (Vh around the time egg laying begins, followed by a T helper cell 2 (Th2 response and the induction of genes whose action leads to granuloma formation and fibrosis. When PZQ is administered at this time, there is a significant reduction in egg burden yet the hepatic Th1, Th2 and fibrotic responses are still observed in the absence of granuloma formation suggesting some degree of gene regulation may be induced by antigens released from the dying adult worms. Quantitative real-time PCR was used to examine the relative expression of 16 juvenile and adult S. mansoni genes during infection and their response to Vh and PZQ treatment in vivo. While the response of stress genes in adult parasites suggests the worms were alive immediately following exposure to PZQ, they were unable to induce transcription of any of the 9 genes encoding ATP-binding cassette (ABC transporters tested. In contrast, juvenile schistosomes were able to significantly induce the activities of ABCB, C and G family members, underscoring the possibility that these efflux systems play a major role in drug resistance.

  12. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  13. Family Decision Making: Benefits to Persons with Developmental Disabilities and Their Family Members

    Science.gov (United States)

    Neely-Barnes, Susan; Graff, J. Carolyn; Marcenko, Maureen; Weber, Lisa

    2008-01-01

    Family involvement in planning and choosing services has become a key intervention concept in developmental disability services. This study (N = 547) modeled patterns of family decision making and assessed benefits to persons with developmental disabilities (DDs) and their family members. A latent profile analysis identified 4 classes that were…

  14. Understanding of advance care planning by family members of persons undergoing hemodialysis.

    Science.gov (United States)

    Calvin, Amy O; Engebretson, Joan C; Sardual, S Alexander

    2014-11-01

    The purpose of this qualitative descriptive study was to explore hemodialysis patients' family members' understanding of end-of-life decision-making processes. The project aimed to address (a) family members' constructions of advance care planning (ACP), including their roles and responsibilities, and (b) family members' perceptions of health care providers' roles and responsibilities in ACP. Eighteen family members of persons undergoing hemodialysis were recruited primarily from outpatient dialysis facilities and interviewed individually. Confirmed transcript data were analyzed, coded, and compared, and categories were established. Interpretations were validated throughout the interviews and peer debriefing sessions were used at a later stage in the analysis. The overarching construct identified was one of Protection. Family members protect patients by (a) Sharing Burdens, (b) Normalizing Life, and (c) Personalizing Care. Recommendations for future research include the need to explore ACP of persons undergoing hemodialysis who do not have a family support system. © The Author(s) 2013.

  15. The Mycobacterium leprae antigen 85 complex gene family: identification of the genes for the 85A, 85C, and related MPT51 proteins

    NARCIS (Netherlands)

    Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.

    1993-01-01

    The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes

  16. Effective doses to family members of patients treated with radioiodine 131

    International Nuclear Information System (INIS)

    Kocovska, Marina Zdravevska; Ristevska, Svetlana Micevska; Nikolovski, Sasho; Jokic, Vesna Spasic

    2010-01-01

    The purpose of this study was to evaluate the effective dose to family members of thyroid cancer and hyperthyroid patients treated with radioiodine 131; also to compare the results with dose constraints proposed by International Commission of Radiological Protection (ICRP) and Basic Safety Standards (BSS) of the International Atomic Energy Agency (IAEA). Material and methods: for estimation of effective doses at sixty family members of thirty thyroid cancer and thirty hyperthyroid patients treated with radioiodine 131, the thermoluminescent dosimeters, Model TLD 100, were used. Thyroid cancer patients were hospitalized for three days, while hyperthyroid patients were treated on out-patient basis. The family members wore thermoluminescent dosimeter in front of the torso for seven days. Results: The radiation doses to family members of thyroid cancer patients were well below recommended dose constraint of 1 mSv. The mean value of effective dose was 0.21 mSv (min 0.02 - max 0.51 mSv). Effective doses, higher than 1 mSv, were detected at 11 family members of hyperthyroid patients.. The mean value of effective dose at family members of hyperthyroid patients was 0.87 mSv (min 0.12 - max 6.79) Conclusion: After three days of hospitalization and detailed given oral and written instruction, thyroid carcinoma patients maintain not to exceed the proposed dose limits. Hyperthyroid patients present a greater radiation hazard than thyroid carcinoma patients. The estimated effective doses were higher than the effective doses at family members of thyroid carcinoma patients. These findings may be considered when establishing new national guidelines concerning radiation protection and release of patients after a treatment with radioiodine therapy.(Author)

  17. Karyopherin alpha7 (KPNA7), a divergent member of the importin alpha family of nuclear import receptors.

    Science.gov (United States)

    Kelley, Joshua B; Talley, Ashley M; Spencer, Adam; Gioeli, Daniel; Paschal, Bryce M

    2010-08-11

    Classical nuclear localization signal (NLS) dependent nuclear import is carried out by a heterodimer of importin alpha and importin beta. NLS cargo is recognized by importin alpha, which is bound by importin beta. Importin beta mediates translocation of the complex through the central channel of the nuclear pore, and upon reaching the nucleus, RanGTP binding to importin beta triggers disassembly of the complex. To date, six importin alpha family members, encoded by separate genes, have been described in humans. We sequenced and characterized a seventh member of the importin alpha family of transport factors, karyopherin alpha 7 (KPNA7), which is most closely related to KPNA2. The domain of KPNA7 that binds Importin beta (IBB) is divergent, and shows stronger binding to importin beta than the IBB domains from of other importin alpha family members. With regard to NLS recognition, KPNA7 binds to the retinoblastoma (RB) NLS to a similar degree as KPNA2, but it fails to bind the SV40-NLS and the human nucleoplasmin (NPM) NLS. KPNA7 shows a predominantly nuclear distribution under steady state conditions, which contrasts with KPNA2 which is primarily cytoplasmic. KPNA7 is a novel importin alpha family member in humans that belongs to the importin alpha2 subfamily. KPNA7 shows different subcellular localization and NLS binding characteristics compared to other members of the importin alpha family. These properties suggest that KPNA7 could be specialized for interactions with select NLS-containing proteins, potentially impacting developmental regulation.

  18. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  19. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability.

    Science.gov (United States)

    Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R

    2017-06-07

    The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.

  20. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability

    Directory of Open Access Journals (Sweden)

    J. Noelia Dufay

    2017-06-01

    Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.

  1. Genome-wide analysis and expression profiling of the GRF gene family in oilseed rape (Brassica napus L.).

    Science.gov (United States)

    Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na

    2017-07-15

    Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.

  2. RelAp43, a member of the NF-κB family involved in innate immune response against Lyssavirus infection.

    Science.gov (United States)

    Luco, Sophie; Delmas, Olivier; Vidalain, Pierre-Olivier; Tangy, Frédéric; Weil, Robert; Bourhy, Hervé

    2012-01-01

    NF-κB transcription factors are crucial for many cellular processes. NF-κB is activated by viral infections to induce expression of antiviral cytokines. Here, we identified a novel member of the human NF-κB family, denoted RelAp43, the nucleotide sequence of which contains several exons as well as an intron of the RelA gene. RelAp43 is expressed in all cell lines and tissues tested and exhibits all the properties of a NF-κB protein. Although its sequence does not include a transactivation domain, identifying it as a class I member of the NF-κB family, it is able to potentiate RelA-mediated transactivation and stabilize dimers comprising p50. Furthermore, RelAp43 stimulates the expression of HIAP1, IRF1, and IFN-β - three genes involved in cell immunity against viral infection. It is also targeted by the matrix protein of lyssaviruses, the agents of rabies, resulting in an inhibition of the NF-κB pathway. Taken together, our data provide the description of a novel functional member of the NF-κB family, which plays a key role in the induction of anti-viral innate immune response.

  3. RelAp43, a member of the NF-κB family involved in innate immune response against Lyssavirus infection.

    Directory of Open Access Journals (Sweden)

    Sophie Luco

    Full Text Available NF-κB transcription factors are crucial for many cellular processes. NF-κB is activated by viral infections to induce expression of antiviral cytokines. Here, we identified a novel member of the human NF-κB family, denoted RelAp43, the nucleotide sequence of which contains several exons as well as an intron of the RelA gene. RelAp43 is expressed in all cell lines and tissues tested and exhibits all the properties of a NF-κB protein. Although its sequence does not include a transactivation domain, identifying it as a class I member of the NF-κB family, it is able to potentiate RelA-mediated transactivation and stabilize dimers comprising p50. Furthermore, RelAp43 stimulates the expression of HIAP1, IRF1, and IFN-β - three genes involved in cell immunity against viral infection. It is also targeted by the matrix protein of lyssaviruses, the agents of rabies, resulting in an inhibition of the NF-κB pathway. Taken together, our data provide the description of a novel functional member of the NF-κB family, which plays a key role in the induction of anti-viral innate immune response.

  4. Exploring the stigma related experiences of family members of ...

    African Journals Online (AJOL)

    Celenkosini Thembelenkosini Nxumalo

    a cycle of disability on the part of the patient and family. Purpose: To explore the stigma .... prevention of stigmatisation of people with mental illness and their families in rural ... as a family member's accounts of stigma related feelings, situations or ..... ishment from the family as a reason for the bad behaviour. The participants ...

  5. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  6. Sensory loss amongst old family members

    DEFF Research Database (Denmark)

    Rasmussen, Jon Dag; Winther, Ida Wentzel

    2018-01-01

    and their close family. Our tentative findings point towards a prominence of different insecurities and discomforts in social life that directly links to the decreased sensory abilities. Experiences of being ‘lost’, ‘set afloat’ and disconnected in everyday life interactions are broadly described by all...... on the old people suffering a decline in sensory abilities, but also on family members as individual loss becomes collective loss in the context of family and kinship. The paper presentation takes its point of departure in rough pieces of empirical material (e.g. film-clips, sound......-clips/montage and ethnographic description) and through exposition of tentative analysis and research findings we aim to initiate a discussion around central themes of the work....

  7. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  8. The impact of leader-member exchange (LMX) on work-family interference and work-family facilitation

    NARCIS (Netherlands)

    L.G. Tummers (Lars); B.A.C. Bronkhorst (Babette)

    2014-01-01

    markdownabstract__Abstract__ Purpose – We analyze the effects of leadership on work-family spillovers. Specifically, we analyze the relationships between leadership (leader-member exchange, LMX) with one negative work-family spillover effect (work-family interference) and one positive work-family

  9. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  10. "Living with dying": the evolution of family members' experience of mechanical ventilation.

    Science.gov (United States)

    Sinuff, Tasnim; Giacomini, Mita; Shaw, Rhona; Swinton, Marilyn; Cook, Deborah J

    2009-01-01

    Communication with families about mechanical ventilation may be more effective once we gain a better understanding of what families experience and understand about this life support technology when their loved ones are admitted to the intensive care unit (ICU). We conducted in-depth interviews with family members of 27 critically ill patients who required mechanical ventilation for > or = 7 days and had an estimated ICU mortality of > or = 50%. Team members reviewed transcripts independently and used grounded theory analysis. The central theme of family members' experience with mechanical ventilation was "living with dying." Initial reactions to the ventilator were of shock and surprise. Family members perceived no option except mechanical ventilation. Although the ventilator kept the patient alive, it also symbolized proximity to death. In time, families became accustomed to images of the ICU as ventilation became more familiar and routine. Their shock and horror were replaced by hope that the ventilator would allow the body to rest, heal, and recover. However, ongoing exposure to their loved one's critical illness and the new role as family spokesperson were traumatizing. Family members' experiences and their understanding of mechanical ventilation change over time, influenced by their habituation to the ICU environment and its routines. They face uncertainty about death, but maintain hope. Understanding these experiences may engender more respectful, meaningful communication about life support with families.

  11. Perceptions of Individual and Family Functioning Among Deployed Female National Guard Members.

    Science.gov (United States)

    Kelly, Patricia J; Cheng, An-Lin; Berkel, LaVerne A; Nilsson, Johanna

    2016-08-01

    Females currently make up 15% of U.S. military service members. Minimal attention has been paid to families of female National Guard members who have been deployed and their subsequent reintegration challenges. This cross-sectional Internet-based survey of female members of four National Guard units compared those who were and were not deployed. Instruments, guided by the variables of the Family Resilience Model, measured individual, family, and deployment-related factors. Bivariate analysis and ordinal logistic regression were done to assess differences between the groups. Of the 239 National Guard members surveyed, deployed women (n = 164) had significantly higher levels of posttraumatic stress disorder (PTSD; p family functioning were higher among deployed when compared with never deployed women. Results indicate community interventions that focus on strengthening coping skills of female Guard members would be useful for this population. © The Author(s) 2016.

  12. [Genome-wide identification, phylogenetic analysis and expression profiling of the WOX family genes in Solanum lycopersicum].

    Science.gov (United States)

    Li, Xiao-xu; Liu, Cheng; Li, Wei; Zhang, Zeng-lin; Gao, Xiao-ming; Zhou, Hui; Guo, Yong-feng

    2016-05-01

    Members of the plant-specific WOX transcription factor family have been reported to play important roles in cell to cell communication as well as other physiological and developmental processes. In this study, ten members of the WOX transcription factor family were identified in Solanum lycopersicum with HMMER. Neighbor-joining phylogenetic tree, maximum-likelihood tree and Bayesian-inference tree were constructed and similar topologies were shown using the protein sequences of the homeodomain. Phylogenetic study revealed that the 25 WOX family members from Arabidopsis and tomato fall into three clades and nine subfamilies. The patterns of exon-intron structures and organization of conserved domains in Arabidopsis and tomato were consistent based on the phylogenetic results. Transcriptome analysis showed that the expression patterns of SlWOXs were different in different tissue types. Gene Ontology (GO) analysis suggested that, as transcription factors, the SlWOX family members could be involved in a number of biological processes including cell to cell communication and tissue development. Our results are useful for future studies on WOX family members in tomato and other plant species.

  13. A novel germline mutation in the aryl hydrocarbon receptor-interacting protein (AIP) gene in an Italian family with gigantism.

    Science.gov (United States)

    Urbani, C; Russo, D; Raggi, F; Lombardi, M; Sardella, C; Scattina, I; Lupi, I; Manetti, L; Tomisti, L; Marcocci, C; Martino, E; Bogazzi, F

    2014-10-01

    Acromegaly usually occurs as a sporadic disease, but it may be a part of familial pituitary tumor syndromes in rare cases. Germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene have been associated with a predisposition to familial isolated pituitary adenoma. The aim of the present study was to evaluate the AIP gene in a patient with gigantism and in her relatives. Direct sequencing of AIP gene was performed in fourteen members of the family, spanning among three generations. The index case was an 18-year-old woman with gigantism due to an invasive GH-secreting pituitary adenoma and a concomitant tall-cell variant of papillary thyroid carcinoma. A novel germline mutation in the AIP gene (c.685C>T, p.Q229X) was identified in the proband and in two members of her family, who did not present clinical features of acromegaly or other pituitary disorders. Eleven subjects had no mutation in the AIP gene. Two members of the family with clinical features of acromegaly refused either the genetic or the biochemical evaluation. The Q229X mutation was predicted to generate a truncated AIP protein, lacking the last two tetratricopeptide repeat domains and the final C-terminal α-7 helix. We identified a new AIP germline mutation predicted to produce a truncated AIP protein, lacking its biological properties due to the disruption of the C-terminus binding sites for both the chaperones and the client proteins of AIP.

  14. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

  15. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  16. Basfia succiniciproducens gen. nov., sp. nov., a new member of the family Pasteurellaceae isolated from bovine rumen.

    Science.gov (United States)

    Kuhnert, Peter; Scholten, Edzard; Haefner, Stefan; Mayor, Désirée; Frey, Joachim

    2010-01-01

    Gram-negative, coccoid, non-motile bacteria that are catalase-, urease- and indole-negative, facultatively anaerobic and oxidase-positive were isolated from the bovine rumen using an improved selective medium for members of the Pasteurellaceae. All strains produced significant amounts of succinic acid under anaerobic conditions with glucose as substrate. Phenotypic characterization and multilocus sequence analysis (MLSA) using 16S rRNA, rpoB, infB and recN genes were performed on seven independent isolates. All four genes showed high sequence similarity to their counterparts in the genome sequence of the patent strain MBEL55E, but less than 95 % 16S rRNA gene sequence similarity to any other species of the Pasteurellaceae. Genetically these strains form a very homogeneous group in individual as well as combined phylogenetic trees, clearly separated from other genera of the family from which they can also be separated based on phenotypic markers. Genome relatedness as deduced from the recN gene showed high interspecies similarities, but again low similarity to any of the established genera of the family. No toxicity towards bovine, human or fish cells was observed and no RTX toxin genes were detected in members of the new taxon. Based on phylogenetic clustering in the MLSA analysis, the low genetic similarity to other genera and the phenotypic distinction, we suggest to classify these bovine rumen isolates as Basfia succiniciproducens gen. nov., sp. nov. The type strain is JF4016(T) (=DSM 22022(T) =CCUG 57335(T)).

  17. Family members' expectations regarding nurses' competence in care homes: a qualitative interview study.

    Science.gov (United States)

    Kiljunen, Outi; Kankkunen, Päivi; Partanen, Pirjo; Välimäki, Tarja

    2017-11-22

    Structural and cultural changes in the care of older people have influenced nursing practice, creating a need to identify current competency requirements for nurses working in care homes. Family members have an important role in ensuring the well-being of older people living in care homes, and family members' can provide valuable information about competence requirements. To explore the expectations of the care home residents' family members regarding the competence of nurses in care homes for older people. A qualitative descriptive design was used. Semi-structured interviews were conducted with 18 care home residents' family members between March and September 2016. Participants were recruited with help from regional associations and member associations of The Central Association of Carers in Finland and from regional associations of The Alzheimer's Society of Finland. The snowball technique was also used. The data were analysed using inductive content analysis. Ethics committee approval was obtained from the university committee on research ethics, and written informed consent was obtained from participants. The care home residents' family members expected that nurses would be able to interact with and treat people respectfully. Reflective collaboration between the nurse and a family member was also emphasised. Family members expected nurses to provide high-quality basic care and nursing and support residents' well-being individually and holistically. Family members' expectations reflect the need for ethical and interactional competence in the care home. In addition, evidence-based practice competencies are required to provide high-quality care. Nurses' ability to provide person-centred, individual and holistic care is vital to ensure care home residents' well-being. © 2017 Nordic College of Caring Science.

  18. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  19. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  20. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  1. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    Science.gov (United States)

    Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

    2016-01-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

  2. Suicidal Ideation and Distress in Family Members Bereaved by Suicide in Portugal

    OpenAIRE

    Santos, Sara; Campos, Rui; Tavares, Sofia

    2015-01-01

    The present study assessed the impact of suicide and distress on suicidal ideation in a sample of 93 Portuguese family members bereaved by suicide. A control community sample of 102 adults also participated. After controlling for educational level, those bereaved by the suicide of a family member were found to have higher levels of suicidal ideation. Forty-two percent of family members had Suicide Ideation Questionnaire scores at or above the cutoff point. General distress, dep...

  3. Characterization of PPMUCL1/2/3, three members of a new oomycete-specific mucin-like protein family residing in Phytophthora parasitica biofilm.

    Science.gov (United States)

    Larousse, Marie; Govetto, Benjamin; Séassau, Aurélie; Etienne, Catherine; Industri, Benoit; Theodorakopoulos, Nicolas; Deleury, Emeline; Ponchet, Michel; Panabières, Franck; Galiana, Eric

    2014-05-01

    The plant pathogen Phytophthora parasitica forms a biofilm on the host surface. The biofilm transcriptome is characterized by the expression of PPMUCL1/2/3 (PHYTOPHTHORA PARASITICA MUCIN-LIKE) genes, which we report here to be members of a new, large mucin-like gene family restricted to the oomycete lineage. These genes encode secreted proteins organized into two domains. The NH2-terminal domain is highly conserved, but of unknown function. The second domain is a mucin-like domain enriched in threonine and serine residues, with a large number of putative O-glycosylation sites and a repeated motif defining 15 subgroups among the 315 members of the family. The second domain was found to be glycosylated in the recombinant rPPMUCL1 and rPPMUCL2 proteins. An analysis of PPMUCL1/2/3 gene expression indicated that these genes were expressed in a specific and coordinated manner in the biofilm. A novel cis-motif (R) bound to nuclear proteins, suggesting a possible role in PPMUCL1/2/3 gene regulation. Immunohistochemical staining revealed that the PPMUCL1/2 proteins were secreted and accumulated on the surface of the biofilm. Our data demonstrate that PPMUCL1/2/3 belong to a new oomycete-specific family of mucin-like proteins playing a structural role in the biofilm extracellular matrix. Copyright © 2014 Elsevier GmbH. All rights reserved.

  4. Female children with incarcerated adult family members at risk for life-long neurological decline

    Science.gov (United States)

    Brewer-Smyth, Kathleen; Pohlig, Ryan T.; Bucurescu, Gabriel

    2016-01-01

    A secondary analysis of data from adult female prison inmates in the mid-Atlantic United States defined relationships between having incarcerated adult family members during childhood and neurological outcomes. Of 135 inmates, 99(73%) had one or more incarcerated adult family members during childhood. Regression analyses revealed that having incarcerated adult family members was related to greater frequency and severity of childhood abuse and higher incidence of neurological deficits in adulthood, especially related to traumatic brain injuries, compared to those without incarcerated adult family members. Along with being role models, adult family members impact the neurological health of children throughout their lifespan. PMID:26788781

  5. Acute Physiologic Stress and Subsequent Anxiety Among Family Members of ICU Patients.

    Science.gov (United States)

    Beesley, Sarah J; Hopkins, Ramona O; Holt-Lunstad, Julianne; Wilson, Emily L; Butler, Jorie; Kuttler, Kathryn G; Orme, James; Brown, Samuel M; Hirshberg, Eliotte L

    2018-02-01

    The ICU is a complex and stressful environment and is associated with significant psychologic morbidity for patients and their families. We sought to determine whether salivary cortisol, a physiologic measure of acute stress, was associated with subsequent psychologic distress among family members of ICU patients. This is a prospective, observational study of family members of adult ICU patients. Adult medical and surgical ICU in a tertiary care center. Family members of ICU patients. Participants provided five salivary cortisol samples over 24 hours at the time of the patient ICU admission. The primary measure of cortisol was the area under the curve from ground; the secondary measure was the cortisol awakening response. Outcomes were obtained during a 3-month follow-up telephone call. The primary outcome was anxiety, measured by the Hospital Anxiety and Depression Scale-Anxiety. Secondary outcomes included depression and posttraumatic stress disorder. Among 100 participants, 92 completed follow-up. Twenty-nine participants (32%) reported symptoms of anxiety at 3 months, 15 participants (16%) reported depression symptoms, and 14 participants (15%) reported posttraumatic stress symptoms. In our primary analysis, cortisol level as measured by area under the curve from ground was not significantly associated with anxiety (odds ratio, 0.94; p = 0.70). In our secondary analysis, however, cortisol awakening response was significantly associated with anxiety (odds ratio, 1.08; p = 0.02). Roughly one third of family members experience anxiety after an ICU admission for their loved one, and many family members also experience depression and posttraumatic stress. Cortisol awakening response is associated with anxiety in family members of ICU patients 3 months following the ICU admission. Physiologic measurements of stress among ICU family members may help identify individuals at particular risk of adverse psychologic outcomes.

  6. The impact of leader-member exchange (LMX) on work-family interference and work-family facilitation

    NARCIS (Netherlands)

    L.G. Tummers (Lars); B.A.C. Bronkhorst (Babette)

    2014-01-01

    markdownabstract__Abstract__ __Purpose__ – We analyze the effects of leadership on work-family spillovers. Specifically, we analyze the relationships between leadership (leader-member exchange, LMX) with one negative work-family spillover effect (work-family interference) and one positive

  7. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  8. The experiences of family members in the nursing home to hospital transfer decision

    Directory of Open Access Journals (Sweden)

    Kathleen Abrahamson

    2016-11-01

    Full Text Available Abstract Background The objective of this study was to better understand the experiences of family members in the nursing home to hospital transfer decision making process. Semi-structured interviews were conducted with 20 family members who had recently been involved in a nursing home to hospital transfer decision. Results Family members perceived themselves to play an advocacy role in their resident’s care and interview themes clustered within three over-arching categories: Family perception of the nursing home’s capacity to provide medical care: Resident and family choices; and issues at ‘hand-off’ and the hospital. Multiple sub-themes were also identified. Conclusions Findings from this study contribute to knowledge surrounding the nursing home transfer decision by illuminating the experiences of family members in the transfer decision process.

  9. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  10. Exploring the stigma related experiences of family members of ...

    African Journals Online (AJOL)

    The stigma of families is seen in the form of assignment of blame, social isolation and rejection. This stigma subsequently perpetuates a cycle of disability on the part of the patient and family. Purpose: To explore the stigma related experiences of family members of persons with mental illness in a selected community in the ...

  11. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Characterization and role of p53 family members in the symbiont-induced morphogenesis of the Euprymna scolopes light organ.

    Science.gov (United States)

    Goodson, Michael S; Crookes-Goodson, Wendy J; Kimbell, Jennifer R; McFall-Ngai, Margaret J

    2006-08-01

    Within hours of hatching, the squid Euprymna scolopes forms a specific light organ symbiosis with the marine luminous bacterium Vibrio fischeri. Interactions with the symbiont result in the loss of a complex ciliated epithelium dedicated to promoting colonization of host tissue, and some or all of this loss is due to widespread, symbiont-induced apoptosis. Members of the p53 family, including p53, p63, and p73, are conserved across broad phyletic lines and p63 is thought to be the ancestral gene. These proteins have been shown to induce apoptosis and developmental morphogenesis. In this study, we characterized p63-like transcripts from mRNA isolated from the symbiotic tissues of E. scolopes and described their role in symbiont-induced morphogenesis. Using degenerate RT-PCR and RACE PCR, we identified two p63-like transcripts encoding proteins of 431 and 567 amino acids. These transcripts shared identical nucleotides where they overlapped, suggesting that they are splice variants of the same gene. Immunocytochemistry and Western blots using an antibody specific for E. scolopes suggested that the p53 family members are activated in cells of the symbiont-harvesting structures of the symbiotic light organ. We propose that once the symbiosis is initiated, a symbiont-induced signal activates p53 family members, inducing apoptosis and developmental morphogenesis of the light organ.

  13. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. Emotional disorders in pairs of patients and their family members during and after ICU stay.

    Directory of Open Access Journals (Sweden)

    Renata Rego Lins Fumis

    Full Text Available INTRODUCTION: Patients and family members undergo different experiences of suffering from emotional disorders during ICU stay and after ICU discharge. The purpose of this study was to compare the incidence of anxiety, depression and post-traumatic stress disorder (PTSD symptoms in pairs (patient and respective family member, during stay at an open visit ICU and at 30 and 90-days post-ICU discharge. We hypothesized that there was a positive correlation with the severity of symptoms among pairs and different patterns of suffering over time. METHODS: A prospective study was conducted in a 22-bed adult general ICU including patients with >48 hours stay. The Hospital Anxiety and Depression Scale (HADS was completed by the pairs (patients/respective family member. Interviews were made by phone at 30 and 90-days post-ICU discharge using the Impact of Event Scale (IES and the HADS. Multivariate models were constructed to predict IES score at 30 days for patients and family members. RESULTS: Four hundred and seventy one family members and 289 patients were interviewed in the ICU forming 184 pairs for analysis. Regarding HADS score, patients presented less symptoms than family members of patients who survived and who deceased at 30 and 90-days (p<0.001. However, family members of patients who deceased scored higher anxiety and depression symptoms (p = 0.048 at 90-days when compared with family members of patients who survived. Patients and family members at 30-days had a similar IES score, but it was higher in family members at 90-days (p = 0.019. For both family members and patients, age and symptoms of anxiety and depression during ICU were the major determinants for PTSD at 30-days. CONCLUSIONS: Anxiety, depression and PTSD symptoms were higher in family members than in the patients. Furthermore, these symptoms in family members persisted at 3 months, while they decreased in patients.

  15. Synchronous down-modulation of miR-17 family members is an early causative event in the retinal angiogenic switch.

    Science.gov (United States)

    Nunes, Diana N; Dias-Neto, Emmanuel; Cardó-Vila, Marina; Edwards, Julianna K; Dobroff, Andrey S; Giordano, Ricardo J; Mandelin, Jami; Brentani, Helena P; Hasselgren, Catrin; Yao, Virginia J; Marchiò, Serena; Pereira, Carlos A B; Passetti, Fabio; Calin, George A; Sidman, Richard L; Arap, Wadih; Pasqualini, Renata

    2015-03-24

    Six members of the microRNA-17 (miR-17) family were mapped to three different chromosomes, although they share the same seed sequence and are predicted to target common genes, among which are those encoding hypoxia-inducible factor-1α (HIF1A) and VEGFA. Here, we evaluated the in vivo expression profile of the miR-17 family in the murine retinopathy of prematurity (ROP) model, whereby Vegfa expression is highly enhanced at the early stage of retinal neovascularization, and we found simultaneous reduction of all miR-17 family members at this stage. Using gene reporter assays, we observed binding of these miRs to specific sites in the 3' UTRs of Hif1a and Vegfa. Furthermore, overexpression of these miRs decreased HIF1A and VEGFA expression in vitro. Our data indicate that this miR-17 family elicits a regulatory synergistic down-regulation of Hif1a and Vegfa expression in this biological model. We propose the existence of a coordinated regulatory network, in which diverse miRs are synchronously regulated to target the Hif1a transcription factor, which in turn, potentiates and reinforces the regulatory effects of the miRs on Vegfa to trigger and sustain a significant physiological response.

  16. The impact of leader-member exchange (LMX) on work-family interference and work-family facilitation

    OpenAIRE

    Tummers, Lars; Bronkhorst, Babette

    2014-01-01

    markdownabstract__Abstract__ Purpose – We analyze the effects of leadership on work-family spillovers. Specifically, we analyze the relationships between leadership (leader-member exchange, LMX) with one negative work-family spillover effect (work-family interference) and one positive work-family spillover effect (work-family facilitation). We hypothesize that LMX influences work-family spillover via different mediators, rather than one all-encompassing mediator, such as empowerment. Design/m...

  17. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  18. An audit of clinical service examining the uptake of genetic testing by at-risk family members.

    Science.gov (United States)

    Forrest, Laura; Delatycki, Martin; Curnow, Lisette; Gen Couns, M; Skene, Loane; Aitken, Maryanne

    2012-01-01

    The aim of this study was to investigate the uptake of genetic testing by at-risk family members for four genetic conditions: chromosomal translocations, fragile X syndrome, Huntington disease, and spinal muscular atrophy. A clinical audit was undertaken using genetics files from Genetic Health Services Victoria. Data were extracted from the files regarding the number of at-risk family members and the proportion tested. Information was also collected about whether discussion of at-risk family members and family communication during the genetic consultation was recorded. The proportion of at-risk family members who had genetic testing ranged from 11% to 18%. First-degree family members were most frequently tested and the proportion of testing decreased by degree of relatedness to the proband. Smaller families were significantly more likely to have genetic testing for all conditions except Huntington disease. Female at-risk family members were significantly more likely to have testing for fragile X syndrome. The majority of at-risk family members do not have genetic testing. Family communication is likely to influence the uptake of genetic testing by at-risk family members and therefore it is important that families are supported while communicating to ensure that at-risk family members are able to make informed decisions about genetic testing.

  19. Family Members as Third Parties in Dyadic Family Conflict: Strategies, Alliances, and Outcomes.

    Science.gov (United States)

    Vuchinich, Samuel; And Others

    1988-01-01

    Analyzes conflicts of 52 families observed during dinner. Findings suggest that family members frequently joined dyadic conflicts, they were equally likely to attempt to end or continue conflicts, they formed alliances half of the time, and their intervention strategies were related to the patterning and outcome of the conflicts. (RJC)

  20. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

  1. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  2. Cloning of the ω-secalin gene family in a wheat 1BL/1RS translocation line using BAC clone sequencing

    Directory of Open Access Journals (Sweden)

    Meng Jun Li

    2016-05-01

    Conclusion: The ω-secalin gene family consisted of at least 18 members in the 1BL/1RS translocation line cv. Shimai 15. Eight ω-secalin genes were expressed during seed development. Eighteen members may originate from a progenitor with a 1,074-bp ORF. The spacers differed in length and sequence conservation.

  3. An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

    Science.gov (United States)

    Varmanen, P; Rantanen, T; Palva, A

    1996-12-01

    A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

  4. E2F-6: a novel member of the E2F family is an inhibitor of E2F-dependent transcription

    DEFF Research Database (Denmark)

    Cartwright, P; Müller, H; Wagener, C

    1998-01-01

    with E2Fs 1-5, especially within the DNA binding, heterodimerization and marked box domains. Unlike E2Fs 1-5, E2F-6 lacks a transactivation and a pocket protein binding domain, hence, forms a unique third group within the E2F family. E2F-6 is a nuclear protein that can form heterodimers with the DP......The E2F family of transcription factors are essential for the regulation of genes required for appropriate progression through the cell cycle. Five members of the E2F family have been previously reported, namely E2F1-5. All five are key elements in transcriptional regulation of essential genes......, and they can be divided into two functional groups, those that induce S-phase progression when overexpressed in quiescent cells (E2Fs 1-3), and those that do not (E2Fs 4-5). Here, we describe the identification of a novel member of this family, which we refer to as E2F-6. E2F-6 shares significant homology...

  5. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  6. Follow-Up Study to Family Members' Reactions to the Initial Special Education Meeting

    Science.gov (United States)

    Ingalls, Lawrence; Hammond, Helen; Paez, Carlos; Rodriguez, Ivan

    2016-01-01

    Family involvement is a central component of Individuals with Disabilities Education Act (IDEA). Family members are to be integrated in all aspects of the special education process. At the onset, of family involvement, it is imperative for educators to be aware of possible reactions family members may experience in this initial stage. This…

  7. NWHSS Implement Family Member Assessment Component in the Millennium Cohort Study

    Science.gov (United States)

    2012-10-01

    Response and Referral Rates (McMaster) Panel 4 Impact of Cognitive Dissonance Improvement Strategies *Open Discussion* Family Improvement... Cognitive Dissonance (Via Effort Justification) Study  This pilot study utilized a random selection of married Panel 4 Millennium Cohort members taking...Spousal and family  functioning  Determine service member  factors that are associated  with spouse reports of  marital  satisfaction  and  family

  8. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  9. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  10. Genome-wide identification and functional analysis of the TIFY gene family in response to drought in cotton.

    Science.gov (United States)

    Zhao, Ge; Song, Yun; Wang, Caixiang; Butt, Hamama Islam; Wang, Qianhua; Zhang, Chaojun; Yang, Zuoren; Liu, Zhao; Chen, Eryong; Zhang, Xueyan; Li, Fuguang

    2016-12-01

    Jasmonates control many aspects of plant biological processes. They are important for regulating plant responses to various biotic and abiotic stresses, including drought, which is one of the most serious threats to sustainable agricultural production. However, little is known regarding how jasmonate ZIM-domain (JAZ) proteins mediate jasmonic acid signals to improve stress tolerance in cotton. This represents the first comprehensive comparative study of TIFY transcription factors in both diploid A, D and tetraploid AD cotton species. In this study, we identified 21 TIFY family members in the genome of Gossypium arboretum, 28 members from Gossypium raimondii and 50 TIFY genes in Gossypium hirsutum. The phylogenetic analyses indicated the TIFY gene family could be divided into the following four subfamilies: TIFY, PPD, ZML, and JAZ subfamilies. The cotton TIFY genes have expanded through tandem duplications and segmental duplications compared with other plant species. Gene expression profile revealed temporal and tissue specificities for TIFY genes under simulated drought conditions in Gossypium arboretum. The JAZ subfamily members were the most highly expressed genes, suggesting that they have a vital role in responses to drought stress. Over-expression of GaJAZ5 gene decreased water loss, stomatal openings, and the accumulation of H 2 O 2 in Arabidopsis thaliana. Additionally, the results of drought tolerance assays suggested that this subfamily might be involved in increasing drought tolerance. Our study provides new data regarding the genome-wide analysis of TIFY gene families and their important roles in drought tolerance in cotton species. These data may form the basis of future studies regarding the relationship between drought and jasmonic acid.

  11. Evolution of hematopoiesis: Three members of the PU.1 transcription factor family in a cartilaginous fish, Raja eglanteria

    Science.gov (United States)

    Anderson, M. K.; Sun, X.; Miracle, A. L.; Litman, G. W.; Rothenberg, E. V.

    2001-01-01

    T lymphocytes and B lymphocytes are present in jawed vertebrates, including cartilaginous fishes, but not in jawless vertebrates or invertebrates. The origins of these lineages may be understood in terms of evolutionary changes in the structure and regulation of transcription factors that control lymphocyte development, such as PU.1. The identification and characterization of three members of the PU.1 family of transcription factors in a cartilaginous fish, Raja eglanteria, are described here. Two of these genes are orthologs of mammalian PU.1 and Spi-C, respectively, whereas the third gene, Spi-D, is a different family member. In addition, a PU.1-like gene has been identified in a jawless vertebrate, Petromyzon marinus (sea lamprey). Both DNA-binding and transactivation domains are highly conserved between mammalian and skate PU.1, in marked contrast to lamprey Spi, in which similarity is evident only in the DNA-binding domain. Phylogenetic analysis of sequence data suggests that the appearance of Spi-C may predate the divergence of the jawed and jawless vertebrates and that Spi-D arose before the divergence of the cartilaginous fish from the lineage leading to the mammals. The tissue-specific expression patterns of skate PU.1 and Spi-C suggest that these genes share regulatory as well as structural properties with their mammalian orthologs.

  12. The importance of older family members in providing social resources and promoting cancer screening in families with a hereditary cancer syndrome.

    Science.gov (United States)

    Ashida, Sato; Hadley, Donald W; Goergen, Andrea F; Skapinsky, Kaley F; Devlin, Hillary C; Koehly, Laura M

    2011-12-01

    This study evaluates the role of older family members as providers of social resources within familial network systems affected by an inherited cancer susceptibility syndrome.  Respondents who previously participated in a study that involved genetic counseling and testing for Lynch syndrome and their family network members were invited to participate in a onetime telephone interview about family communication. A total of 206 respondents from 33 families identified 2,051 social relationships (dyads). Nineteen percent of the respondents and 25% of the network members were older (≥60 years). Younger respondents (≤59 years) were more likely to nominate older network members as providers of social resources than younger members: instrumental support (odds ratio [OR] = 1.68), emotional support (OR = 1.71), help in crisis situation (OR = 2.04), and dependability when needed (OR = 2.15). Compared with younger network members, older members were more likely to be listed as encouragers of colon cancer screening by both younger (OR = 3.40) and older respondents (OR = 1.90) independent of whether support exchange occurred in the relationship. Engaging older network members in health interventions to facilitate screening behaviors and emotional well-being of younger members within families affected by inherited conditions may be beneficial. Findings can be used to empower older individuals about their important social roles in enhancing the well-being of their family members and to inform younger individuals about their older relatives' resourcefulness to facilitate positive social interactions.

  13. Witnesses to Transformation: Family Member Experiences Providing Individualized Music to Their Relatives with Dementia

    Science.gov (United States)

    Johnston, Elizabeth; Rasmusson, Xeno; Foyil, Barbara; Shopland, Patricia

    2017-01-01

    Content analysis of 35 family members stories found that sharing individualized music enhanced memory, mood and provided interactive opportunities, where family members connected and communicated with relatives who had dementia. Technology supports a positive new role for family members, who often use MP3 players (e.g. iPods), headphones,…

  14. Effects of cognitive-behavioral treatment for weight loss in family members.

    Science.gov (United States)

    Rossini, Raffaella; Moscatiello, Simona; Tarrini, Giulietta; Di Domizio, Silvia; Soverini, Valentina; Romano, Andreina; Mazzotti, Arianna; Dalle Grave, Riccardo; Marchesini, Giulio

    2011-11-01

    The possibility that lifestyle changes may be shared by the family members of subjects with obesity attending cognitive-behavioral treatment (CBT) for weight loss has been scarcely evaluated. The purpose of this study was to measure the changes in body weight, lifestyle habits, and stage of change toward physical activity in the family members of 149 subjects with overweight/obesity enrolled into a weekly group CBT for weight management in the years 2007-2008. 230 adult (aged >18 years) family members (129 spouses, 72 children (43 female, 29 male), 29 with a different family relationship) completed a self-administered questionnaire at baseline and soon after the end of the completion of their relatives' program (approximately 6 months later). The questionnaire consisted of qualitative information regarding food choices, estimation of energy and food intake, self-report of height and weight, and motivation toward physical activity. At baseline, self-reported body mass index was normal in 115 cases, in the range 25 to 29.9 in 80 and ≥30 in 35. Following CBT of their relatives, the family members significantly reduced their average daily energy intake (-232 kcal/day; Pfood choices revealed a reduced average daily amount of energy from dressings (-40 kcal, Pbread (-58 kcal, P<0.001), breakfast biscuits (-23 kcal, P=0.005), chocolate (-7 kcal, P=0.024), and nonalcoholic beverages (fruit juices and carbonated drinks; -10 kcal; P=0.013), whereas fruit consumption was increased (+10 kcal; P=0.023). There was also a shift in the stage of change toward exercising. Body mass index changes of family members and CBT subjects were significantly correlated, mainly within spouses. In conclusion, CBT for weight loss positively influences the lifestyle habits of family members of participants, reducing energy intake and promoting a more favorable attitude toward physical activity. Copyright © 2011 American Dietetic Association. Published by Elsevier Inc. All rights reserved.

  15. MicroRNA-125 family members exert a similar role in the regulation of murine hematopoiesis.

    Science.gov (United States)

    Wojtowicz, Edyta E; Walasek, Marta A; Broekhuis, Mathilde J C; Weersing, Ellen; Ritsema, Martha; Ausema, Albertina; Bystrykh, Leonid V; de Haan, Gerald

    2014-10-01

    MicroRNAs (miRNAs) are crucial for proper functioning of hematopoietic stem and progenitor cells (HSPCs). Members of the miRNA-125 family (consisting of miR-125a, miR-125b1, and miR-125b2) are known to confer a proliferative advantage on cells upon overexpression, to decrease the rate of apoptosis by targeting proapoptotic genes, and to promote differentiation toward the myeloid lineage in mice. However, many distinct biological effects of the three miR-125 species have been reported as well. In the current study, we set out to assess whether the three miRNA-125s that carry identical seed sequences could be functionally different. Our data show that overexpression of each of the three miR-125 family members preserves HSPCs in a primitive state in vitro, results in a competitive advantage upon serial transplantation, and promotes skewing toward the myeloid lineage. All miR-125 family members decreased the pool of phenotypically defined Lin(-)Sca(+)Kit(+)CD48(-)CD150(+) long-term hematopoietic stem cells, simultaneously increasing the self-renewal activity upon secondary transplantation. The downregulation of miR-125s in hematopoietic stem cells abolishes these effects and impairs long-term contribution to blood cell production. The introduction of a point mutation within the miRNA-125 seed sequence abolishes all abovementioned effects and leads to the restoration of normal hematopoiesis. Our results show that all miR-125 family members are similar in function, they likely operate in a seed-sequence-dependent manner, and they induce a highly comparable hematopoietic phenotype. Copyright © 2014 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  16. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  17. Association of the solute carrier family 11 member 1 gene polymorphisms with susceptibility to leprosy in a Brazilian sample

    Directory of Open Access Journals (Sweden)

    Maria José Franco Brochado

    2016-02-01

    Full Text Available Natural resistance-associated macrophage protein 1/solute carrier family 11 member 1 gene (Nramp1/Slc11a1 is a gene that controls the susceptibility of inbred mice to intracellular pathogens. Polymorphisms in the human Slc11a1/Nramp1 gene have been associated with host susceptibility to leprosy. This study has evaluated nine polymorphisms of the Slc11a1/Nramp1 gene [(GTn, 274C/T, 469+14G/C, 577-18G/A, 823C/T, 1029 C/T, 1465-85G/A, 1703G/A, and 1729+55del4] in 86 leprosy patients (67 and 19 patients had the multibacillary and the paucibacillary clinical forms of the disease, respectively, and 239 healthy controls matched by age, gender, and ethnicity. The frequency of allele 2 of the (GTn polymorphism was higher in leprosy patients [p = 0.04, odds ratio (OR = 1.49], whereas the frequency of allele 3 was higher in the control group (p = 0.03; OR = 0.66. Patients carrying the 274T allele (p = 0.04; OR = 1.49 and TT homozygosis (p = 0.02; OR = 2.46, such as the 469+14C allele (p = 0.03; OR = 1.53 of the 274C/T and 469+14G/C polymorphisms, respectively, were more frequent in the leprosy group. The leprosy and control groups had similar frequency of the 577-18G/A, 823C/T, 1029C/T, 1465-85G/A, 1703G/A, and 1729+55del4 polymorphisms. The 274C/T polymorphism in exon 3 and the 469+14G/C polymorphism in intron 4 were associated with susceptibility to leprosy, while the allele 2 and 3 of the (GTn polymorphism in the promoter region were associated with susceptibility and protection to leprosy, respectively.

  18. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  19. Differential transcript abundance and genotypic variation of four putative allergen-encoding gene families in melting peach

    NARCIS (Netherlands)

    Yang, Z.; Ma, Y.; Chen, L.; Xie, R.; Zhang, X.; Zhang, B.; Lu, M.; Wu, S.; Gilissen, L.J.W.J.; Ree, van R.; Gao, Z.

    2011-01-01

    We analysed the temporal and spatial transcript expression of the panel of 18 putative isoallergens from four gene families (Pru p 1–4) in the peach fruit, anther and leaf of two melting cultivars, to gain insight into their expression profiles and to identify the key family members. Genotypic

  20. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  1. PURA, the gene encoding Pur-alpha, member of an ancient nucleic acid-binding protein family with mammalian neurological functions.

    Science.gov (United States)

    Daniel, Dianne C; Johnson, Edward M

    2018-02-15

    The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding

  2. ERP, a new member of the ets transcription factor/oncoprotein family: cloning, characterization, and differential expression during B-lymphocyte development.

    Science.gov (United States)

    Lopez, M; Oettgen, P; Akbarali, Y; Dendorfer, U; Libermann, T A

    1994-05-01

    The ets gene family encodes a group of proteins which function as transcription factors under physiological conditions and, if aberrantly expressed, can cause cellular transformation. We have recently identified two regulatory elements in the murine immunoglobulin heavy-chain (IgH) enhancer, pi and microB, which exhibit striking similarity to binding sites for ets-related proteins. To identify ets-related transcriptional regulators expressed in pre-B lymphocytes that may interact with either the pi or the microB site, we have used a PCR approach with degenerate oligonucleotides encoding conserved sequences in all members of the ets family. We have cloned the gene for a new ets-related transcription factor, ERP (ets-related protein), from the murine pre-B cell line BASC 6C2 and from mouse lung tissue. The ERP protein contains a region of high homology with the ETS DNA-binding domain common to all members of the ets transcription factor/oncoprotein family. Three additional smaller regions show homology to the ELK-1 and SAP-1 genes, a subgroup of the ets gene family that interacts with the serum response factor. Full-length ERP expresses only negligible DNA-binding activity by itself. Removal of the carboxy terminus enables ERP to interact with a variety of ets-binding sites including the E74 site, the IgH enhancer pi site, and the lck promoter ets site, suggesting a carboxy-terminal negative regulatory domain. At least three ERP-related transcripts are expressed in a variety of tissues. However, within the B-cell lineage, ERP is highly expressed primarily at early stages of B-lymphocyte development, and expression declines drastically upon B-cell maturation, correlating with the enhancer activity of the IgH pi site. These data suggest that ERP might play a role in B-cell development and in IgH gene regulation.

  3. Phylogenetic analysis and protein structure modelling identifies distinct Ca(2+)/Cation antiporters and conservation of gene family structure within Arabidopsis and rice species.

    Science.gov (United States)

    Pittman, Jon K; Hirschi, Kendal D

    2016-12-01

    The Ca(2+)/Cation Antiporter (CaCA) superfamily is an ancient and widespread family of ion-coupled cation transporters found in nearly all kingdoms of life. In animals, K(+)-dependent and K(+)-indendent Na(+)/Ca(2+) exchangers (NCKX and NCX) are important CaCA members. Recently it was proposed that all rice and Arabidopsis CaCA proteins should be classified as NCX proteins. Here we performed phylogenetic analysis of CaCA genes and protein structure homology modelling to further characterise members of this transporter superfamily. Phylogenetic analysis of rice and Arabidopsis CaCAs in comparison with selected CaCA members from non-plant species demonstrated that these genes form clearly distinct families, with the H(+)/Cation exchanger (CAX) and cation/Ca(2+) exchanger (CCX) families dominant in higher plants but the NCKX and NCX families absent. NCX-related Mg(2+)/H(+) exchanger (MHX) and CAX-related Na(+)/Ca(2+) exchanger-like (NCL) proteins are instead present. Analysis of genomes of ten closely-related rice species and four Arabidopsis-related species found that CaCA gene family structures are highly conserved within related plants, apart from minor variation. Protein structures were modelled for OsCAX1a and OsMHX1. Despite exhibiting broad structural conservation, there are clear structural differences observed between the different CaCA types. Members of the CaCA superfamily form clearly distinct families with different phylogenetic, structural and functional characteristics, and therefore should not be simply classified as NCX proteins, which should remain as a separate gene family.

  4. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  5. Members of FOX family could be drug targets of cancers.

    Science.gov (United States)

    Wang, Jinhua; Li, Wan; Zhao, Ying; Kang, De; Fu, Weiqi; Zheng, Xiangjin; Pang, Xiaocong; Du, Guanhua

    2018-01-01

    FOX families play important roles in biological processes, including metabolism, development, differentiation, proliferation, apoptosis, migration, invasion and longevity. Here we are focusing on roles of FOX members in cancers, FOX members and drug resistance, FOX members and stem cells. Finally, FOX members as drug targets of cancer treatment were discussed. Future perspectives of FOXC1 research were described in the end. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Quality of relationship between veterans with traumatic brain injury and their family members.

    Science.gov (United States)

    Winter, Laraine; Moriarty, Helene J

    2017-01-01

    The quality of the relationship between patients with many illnesses and their family members has been shown to affect the well-being of both. Yet, relationship quality has not been studied in traumatic brain injury (TBI), and giving and receiving aspects have not been distinguished. The present study of veterans with TBI examined associations between relationship quality and caregiver burden, satisfaction with caregiving, and veterans' competence in interpersonal functioning, rated by veterans and family members. In this cross-sectional study, 83 veterans and their family members were interviewed at home. Measures of quality of relationship, veterans' interpersonal competence and sociodemographics were collected for both, caregiver burden and satisfaction for family members only. As predicted, veteran-rated Q rel /Giving was associated with family-rated Q rel /Receiving, and veteran-rated Q rel /Receiving with family-rated Q rel /Giving. Lower caregiver burden and higher caregiving satisfaction were associated with higher Q rel /Receiving scores but not with Q rel /Giving scores. Veterans' interpersonal competence was associated with total Q rel as rated by either veterans or family members. Relationship quality should be included in family research in TBI, and giving and receiving aspects should be differentiated. Findings suggest that lower caregiver burden and greater satisfaction should be more achievable by increasing caregivers' sense of benefits received from the relationship.

  7. Positive family history of aortic dissection dramatically increases dissection risk in family members.

    Science.gov (United States)

    Ma, Wei-Guo; Chou, Alan S; Mok, Salvior C M; Ziganshin, Bulat A; Charilaou, Paris; Zafar, Mohammad A; Sieller, Richard S; Tranquilli, Maryann; Rizzo, John A; Elefteriades, John A

    2017-08-01

    Although family members of patients with aortic dissection (AoD) are believed to be at higher risk of AoD, the prognostic value of family history (FH) of aortic dissection (FHAD) in family members of patients with AoD has not been studied rigorously. We seek examine how much a positive FHAD increases the risk of developing new aortic dissection (AoD) among first-degree relatives. Patients with AoD at our institution were analyzed for information of FHAD. Positive FHAD referred to that AoD occurred in index patient and one or more first-degree relatives. Negative FHAD was defined as the condition in which only one case of AoD (the index patient) occurred in the family. The age at AoD, exposure years in adulthood before AoD, and annual probability of AoD among first-degree relatives were compared between patients with negative and positive FHADs. FHAD was positive in 32 and negative in 68 among the 100 AoD patients with detailed family history information. Mean age at dissection was 59.9±14.7years. Compared to negative FHAD, patients with positive FHAD dissected at significantly younger age (54.7±16.8 vs 62.4±13.0years, p=0.013), had more AoD events in first-degree relatives (2.3±0.6 vs 1.0±0.0, pfamily members, with a higher annual probability of aortic dissection, a shorter duration of "exposure time" before dissection occurs and a lower mean age at time of dissection. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  8. Members of miR-169 family are induced by high salinity and transiently inhibit the NF-YA transcription factor

    Directory of Open Access Journals (Sweden)

    Lin Hongxuan

    2009-04-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are endogenously expressed small RNAs with a length of about 21 nt. MiRNAs silence their target genes at the post-transcriptional level. In plants, miRNAs play various developmental and physiological roles by cleavaging mRNAs predominantly. Drought and high salinity are the most severe environmental abiotic stresses and cause crop losses all over the world. Results In this study, we identified miR-169g and miR-169n (o as high salinity-responsive miRNAs in rice. MiR-169n and miR169o were in a miRNA cluster with a distance of 3707 base pairs (bp. The high degree of conservation and close phylogenic distance of pre-miR-169n and pre-miR-169o indicated that they were derived from a very recent tandem duplication evolutionary event. The existence of a cis-acting abscisic acid responsive element (ABRE in the upstream region of miR-169n (o suggested that miR-169n (o may be regulated by ABA. In our previous study, we found that miR-169g was induced by the osmotic stress caused by drought via a dehydration-responsive element (DRE. Thus, our data showed that there were both overlapping and distinct responses of the miR-169 family to drought and salt stresses. We also showed that these miR-169 members selectively cleaved one of the NF-YA genes, Os03g29760, which is a CCAAT-box binding transcription factor and participates in transcriptional regulation of large number genes. Finally, we found one or more ath-miR-169 member that was also induced by high salinity. Conclusion We identified members of the miR-169 family as salt-induced miRNAs and analyzed their evolution, gene organization, expression, transcriptional regulation motif and target gene. Our data also indicated that the salt-induction of some miR-169 members was a general property in plants.

  9. Members of miR-169 family are induced by high salinity and transiently inhibit the NF-YA transcription factor.

    Science.gov (United States)

    Zhao, Botao; Ge, Liangfa; Liang, Ruqiang; Li, Wei; Ruan, Kangcheng; Lin, Hongxuan; Jin, Youxin

    2009-04-08

    MicroRNAs (miRNAs) are endogenously expressed small RNAs with a length of about 21 nt. MiRNAs silence their target genes at the post-transcriptional level. In plants, miRNAs play various developmental and physiological roles by cleavaging mRNAs predominantly. Drought and high salinity are the most severe environmental abiotic stresses and cause crop losses all over the world. In this study, we identified miR-169g and miR-169n (o) as high salinity-responsive miRNAs in rice. MiR-169n and miR169o were in a miRNA cluster with a distance of 3707 base pairs (bp). The high degree of conservation and close phylogenic distance of pre-miR-169n and pre-miR-169o indicated that they were derived from a very recent tandem duplication evolutionary event. The existence of a cis-acting abscisic acid responsive element (ABRE) in the upstream region of miR-169n (o) suggested that miR-169n (o) may be regulated by ABA. In our previous study, we found that miR-169g was induced by the osmotic stress caused by drought via a dehydration-responsive element (DRE). Thus, our data showed that there were both overlapping and distinct responses of the miR-169 family to drought and salt stresses. We also showed that these miR-169 members selectively cleaved one of the NF-YA genes, Os03g29760, which is a CCAAT-box binding transcription factor and participates in transcriptional regulation of large number genes. Finally, we found one or more ath-miR-169 member that was also induced by high salinity. We identified members of the miR-169 family as salt-induced miRNAs and analyzed their evolution, gene organization, expression, transcriptional regulation motif and target gene. Our data also indicated that the salt-induction of some miR-169 members was a general property in plants.

  10. Impact of Family History Assessment on Communication with Family Members and Health Care Providers: A report from the Family Healthware™ Impact Trial (FHITr)

    Science.gov (United States)

    Wang, Catharine; Sen, Ananda; Plegue, Melissa; Ruffin, Mack T.; O'Neill, Suzanne M.; Rubinstein, Wendy S.; Acheson, Louise S.

    2015-01-01

    Objective This study examines the impact of Family Healthware™ on communication behaviors; specifically, communication with family members and health care providers about family health history. Methods A total of 3786 participants were enrolled in the Family Healthware™ Impact Trial (FHITr) in the United States from 2005-7. The trial employed a two-arm cluster-randomized design, with primary care practices serving as the unit of randomization. Using generalized estimating equations (GEE), analyses focused on communication behaviors at 6 month follow-up, adjusting for age, site and practice clustering. Results A significant interaction was observed between study arm and baseline communication status for the family communication outcomes (psfamily members about family history risk (OR=1.24, p=0.042) and actively collecting family history information at follow-up (OR=2.67, p=0.026). Family Healthware™ did not have a significant effect on family communication among those already communicating at baseline, or on provider communication, regardless of baseline communication status. Greater communication was observed among those at increased familial risk for a greater number of diseases. Conclusion Family Healthware™ prompted more communication about family history with family members, among those who were not previously communicating. Efforts are needed to identify approaches to encourage greater sharing of family history information, particularly with health care providers. PMID:25901453

  11. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  12. ICU versus Non-ICU Hospital Death: Family Member Complicated Grief, Posttraumatic Stress, and Depressive Symptoms.

    Science.gov (United States)

    Probst, Danielle R; Gustin, Jillian L; Goodman, Lauren F; Lorenz, Amanda; Wells-Di Gregorio, Sharla M

    2016-04-01

    Family members of patients who die in an ICU are at increased risk of psychological sequelae compared to those who experience a death in hospice. This study explored differences in rates and levels of complicated grief (CG), posttraumatic stress disorder (PTSD), and depression between family members of patients who died in an ICU versus a non-ICU hospital setting. Differences in family members' most distressing experiences at the patient's end of life were also explored. The study was an observational cohort. Subjects were next of kin of 121 patients who died at a large, Midwestern academic hospital; 77 died in the ICU. Family members completed measures of CG, PTSD, depression, and end-of-life experiences. Participants were primarily Caucasian (93%, N = 111), female (81%, N = 98), spouses (60%, N = 73) of the decedent, and were an average of nine months post-bereavement. Forty percent of family members met the Inventory of Complicated Grief CG cut-off, 31% met the Impact of Events Scale-Revised PTSD cut-off, and 51% met the Center for Epidemiologic Studies Depression Scale depression cut-off. There were no significant differences in rates or levels of CG, PTSD, or depressive symptoms reported by family members between hospital settings. Several distressing experiences were ranked highly by both groups, but each setting presented unique distressing experiences for family members. Psychological distress of family members did not differ by hospital setting, but the most distressing experiences encountered at end of life in each setting highlight potentially unique interventions to reduce distress post-bereavement for family members.

  13. Multifunctionality and diversity of GDSL esterase/lipase gene family in rice (Oryza sativa L. japonica genome: new insights from bioinformatics analysis

    Directory of Open Access Journals (Sweden)

    Chepyshko Hanna

    2012-07-01

    Full Text Available Abstract Background GDSL esterases/lipases are a newly discovered subclass of lipolytic enzymes that are very important and attractive research subjects because of their multifunctional properties, such as broad substrate specificity and regiospecificity. Compared with the current knowledge regarding these enzymes in bacteria, our understanding of the plant GDSL enzymes is very limited, although the GDSL gene family in plant species include numerous members in many fully sequenced plant genomes. Only two genes from a large rice GDSL esterase/lipase gene family were previously characterised, and the majority of the members remain unknown. In the present study, we describe the rice OsGELP (Oryza sativa GDSL esterase/lipase protein gene family at the genomic and proteomic levels, and use this knowledge to provide insights into the multifunctionality of the rice OsGELP enzymes. Results In this study, an extensive bioinformatics analysis identified 114 genes in the rice OsGELP gene family. A complete overview of this family in rice is presented, including the chromosome locations, gene structures, phylogeny, and protein motifs. Among the OsGELPs and the plant GDSL esterase/lipase proteins of known functions, 41 motifs were found that represent the core secondary structure elements or appear specifically in different phylogenetic subclades. The specification and distribution of identified putative conserved clade-common and -specific peptide motifs, and their location on the predicted protein three dimensional structure may possibly signify their functional roles. Potentially important regions for substrate specificity are highlighted, in accordance with protein three-dimensional model and location of the phylogenetic specific conserved motifs. The differential expression of some representative genes were confirmed by quantitative real-time PCR. The phylogenetic analysis, together with protein motif architectures, and the expression profiling were

  14. Grief elaboration in families with handicapped member.

    Science.gov (United States)

    Calandra, C; Finocchiaro, G; Raciti, L; Alberti, A

    1992-01-01

    Families with handicapped member seem to follow the same five stages (rejection and isolation, anger, dealing with the problem, depression, acceptance) of Kubler-Ross grief elaboration theory while dealing with the narcissistic wound of a handicapped child. Some of these families show a block in one of the stages. The effort of psychotherapy is to remove the block and let them reach the last stage. In this paper families under systemic psychotherapeutic treatment are analyzed, who had in common the birth of a child with low or modest invalidating signs and psychotic or autistic features. The families structure did not show the characteristics of a psychotic family. Nevertheless either one or both parents ignored the evidence of their child disease and they built a "disease-incongrous" wait around the child, trying to push away the painful reality. The authors explain the importance of this approach for the improvement of the autistic traits.

  15. Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.

    Science.gov (United States)

    Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C

    2001-01-01

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.

  16. Perceptions of family members of palliative medicine and hospice patients who experienced music therapy.

    Science.gov (United States)

    Gallagher, Lisa M; Lagman, Ruth; Bates, Debbie; Edsall, Melissa; Eden, Patricia; Janaitis, Jessica; Rybicki, Lisa

    2017-06-01

    Evidence shows that music therapy aids in symptom management and improves quality of life for palliative medicine and hospice patients. The majority of previous studies have addressed patient needs, while only a few addressed the needs of family members. The primary purpose of this study was to understand family members' perceptions of music therapy experienced by a relative in palliative medicine or hospice. Patient self-reported scales and music therapist assessment of change were also investigated. Patients scored their symptoms (pain, anxiety, depression, shortness of breath, and mood) before and after music therapy sessions. One family member present during the session assessed perceived effect on the patient's pain, anxiety, depression, shortness of breath, stress level, restlessness, comfort level, mood, and quality of life. The effect on family member's stress level, quality of life, and mood and helpfulness of the music therapy session for the patient and self were studied. Recommendations about future patient participation in music therapy and qualitative comments were also solicited. Fifty family member/patient dyads participated in the study. Family member perceptions were positive, with 82% of responders indicating improvement for self and patient in stress, mood, and quality of life; 80% rating the session as extremely helpful; and 100% of 49 recommending further music therapy sessions for the patient. Patients reported statistically significant improvement in pain, depression, distress, and mood scores. Family members of patients in palliative medicine and hospice settings reported an immediate positive impact of music therapy on the patient and on themselves. More research needs to be conducted to better understand the benefits of music therapy for family members.

  17. Effects of continued psychological care toward brain tumor patients and their family members' negative emotions.

    Science.gov (United States)

    Xiao, Ning; Zhu, Dan; Xiao, Shuiyuan

    2018-01-01

    Numerous studies have confirmed that brain tumor patients and their family members frequently exhibit negative emotional reactions, such as anxiety and depression, during diagnosis and treatment of the disease. Family members experience increasing pressure as the year of survival of patient progress. The aim of this study was to investigate the effects of the continued psychological care (CPC) toward the brain tumor patients and their family members' emotions. The asynchronous clinical control trial was performed, and 162 brain tumor patients and their family members were divided into the control group and the intervention group. The control group was only performed the telephone follow-up toward the patients. Beside this way, the intervention group was performed the CPC toward the patients and their family member. The self-rating anxiety scale (SAS) and the self-rating depression scale (SDS) were used to measure the negative emotions of the patients and their family members, and the patients' treatment compliance and the incidence of seizures were compared. The SAS and SDS scores of the intervention group on the 14 days, 28 days and 3 months of the CPC were significantly lower than the control group (P family members.

  18. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  19. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  20. Death at the Worksite: Helping Grieving Family Members

    Science.gov (United States)

    ... Grief at Work Working Through Grief About Us Death at the Worksite: Helping Grieving Family Members By ... fatal heart attacks occur in the workplace. Other deaths — from accidents, for example — can also happen during ...

  1. Combined Occurrence of Autosomal Dominant Aniridia and Autosomal Recessive Albinism in Several Members of a Family.

    Science.gov (United States)

    Yahalom, Claudia; Sharon, Dror; Dalia, Eli; Simhon, Shiran Ben; Shemesh, Efrat; Blumenfeld, Anat

    2015-06-01

    To characterize clinical and genetic aspects of a family with a unique combination of two hereditary blinding eye diseases. Comprehensive eye examination of proband and family members. Molecular analyses of the TYR and PAX6 genes. A young couple, both legally blind, requested genetic counselling regarding their ocular condition. The female was previously diagnosed with oculocutaneous albinism (OCA1A) and her spouse was diagnosed with Peters anomaly. A comprehensive clinical examination revealed that the female had OCA1A combined with signs of another ocular disease, showing some similarity to aniridia. A complete ocular examination of her family members revealed that her brother also suffered from the same combined phenotype, her father had typical OCA1A signs, and her mother and sister had aniridia-like phenotype, without clinical diagnosis until the time of presentation. Molecular analysis identified two compound heterozygous TYR mutations known to cause OCAIA and cosegregate with oculocutaneous albinism. In addition, we identified a novel heterozygous PAX6 mutation confirming the atypical aniridia phenotype. We report here a unique and rare clinical phenotype that is explained by the segregation of two severe inherited eye diseases. The clinical and genetic analysis in this family allowed them to receive accurate genetic counseling.

  2. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  3. Genetic anticipation in a special form of hypertrophic cardiomyopathy with sudden cardiac death in a family with 74 members across 5 generations.

    Science.gov (United States)

    Guo, Xiying; Fan, Chaomei; Wang, Yanping; Wang, Miao; Cai, Chi; Yang, Yinjian; Zhao, Shihua; Duan, Fujian; Li, Yishi

    2017-03-01

    Hypertrophic cardiomyopathy (HCM) is the most common heritable heart disease. The genetic anticipation of HCM and its associated etiology, sudden cardiac death (SCD), remains unclear. The aim of this study was to investigate the mechanism underlying the genetic anticipation of HCM and associated SCD.An HCM family including 5 generations and 74 members was studied. Two-dimensional echocardiography was performed to diagnose HCM. The age of onset of HCM was defined as the age at first diagnosis according to hospital records. The information on SCD was confirmed by verification by ≥2 family members and a review of hospital records. Whole-genome sequencing was performed on 4 HCM subjects and 1 healthy control in the family. The identified mutations were screened in all available family members and 216 unrelated healthy controls by Sanger sequencing.The median ages of onset of HCM were 63.5, 38.5, and 18.0 years in members of the second, third, and fourth generations of the family, respectively, and the differences between the generations were significant (P anticipation, with a decreased age of onset and increased severity in successive generations. Multiple gene mutations may contribute to genetic anticipation in HCM and thus may be of prognostic value.

  4. Insider Research with Family Members who have a Member Living with Rare Cancer

    Directory of Open Access Journals (Sweden)

    Jan Foster PhD

    2009-12-01

    Full Text Available In this article the author explores insider research in relation to family members facing a diagnosis of rare cancer, using her experiences as one such family member undertaking doctoral research into journeys similar to hers. The “insider” issue is explored through three realms: the ethical realm, including issues of “fitness” to undertake the research; the methodological realm, including how data are obtained and used; and the trustworthiness realm, including research rigor. The exploration of her insider experiences includes personal challenges in relation to facing familiar emotionally charged experiences, insights gained as a result of her insider status, and her ability to join with participants in ways that might not be possible for an outsider. In the paper the author challenges taken-for-granted assumptions that trustworthiness can be assured only from the position of “objective” researcher. Rather, this analysis places knowledge gained through the processes and products of research as constituted and contextualized.

  5. Circadian clock gene aryl hydrocarbon receptor nuclear translocator-like polymorphisms are associated with seasonal affective disorder: An Indian family study.

    Science.gov (United States)

    Rajendran, Bhagya; Janakarajan, Veeramahali Natarajan

    2016-01-01

    Polymorphisms in aryl hydrocarbon receptor nuclear translocator-like (ARNTL) gene, the key component of circadian clock manifests circadian rhythm abnormalities. As seasonal affective disorder (SAD) is associated with disrupted circadian rhythms, the main objective of this study was to screen an Indian family with SAD for ARNTL gene polymorphisms. In this study, 30 members of close-knit family with SAD, 30 age- and sex-matched controls of the same caste with no prior history of psychiatric illness and 30 age- and sex-matched controls belonging to 17 different castes with no prior history of psychiatric illness were genotyped for five different single nucleotide polymorphisms (SNPs) in ARNTL gene by TaqMan allele-specific genotyping assay. Statistical significance was assessed by more powerful quasi-likelihood score test-XM. Most of the family members carried the risk alleles and we observed a highly significant SNP rs2279287 (A/G) in ARNTL gene with an allelic frequency of 0.75. Polymorphisms in ARNTL gene disrupt circadian rhythms causing SAD and genetic predisposition becomes more deleterious in the presence of adverse environment.

  6. Experiences of the families concerning organ donation of a family member with brain death.

    Science.gov (United States)

    Yousefi, Hojatollah; Roshani, Asieh; Nazari, Fatemeh

    2014-05-01

    In recent years, the lack of organ for transplantation has resulted in health planners and authorities in all countries, including Iran, paying serious attention to the issue. Despite the above-mentioned fact, families with a member affected by brain death are not interested in organ donation. This study is aimed at making an investigation into the decision-making process of organ donation in families with brain death. Also, the research is aimed at investigating how the deterrent and facilitating factors in the process of organ donation can be made. The current research is a qualitative study with descriptive exploratory approach. Data were collected through unstructured interviews with 10 family members who gave consent to organ donation of their family members in 2012. Purposeful sampling processes began in March 2012 and lasted up to June 2012. Simultaneously, thematic approach was used in analyzing the data. Data analysis led to finding 24 categories and 11 themes, which fell into two categories: facilitating and deterrent factors. The five main deterrent themes included the five themes of prohibiting factors that were shock, hope for recovery, unknown process, and conflict of opinions, and worrying association. The six main facilitating themes included humanistic desires, immortality, culture making, satisfaction of the deceased, assurance, and eternal honor. The findings indicated that there is ambiguity and different interpretations on brain death. The research also showed that using the experiences of donator families can provide practical and applied solutions to facilitate the process of organ donation and solve the problems faced by the health care system.

  7. Being a close family member of a person with dementia living in a nursing home.

    Science.gov (United States)

    Seiger Cronfalk, Berit; Ternestedt, Britt-Marie; Norberg, Astrid

    2017-11-01

    To illuminate how family members of persons with dementia describe their own experiences, before and after placing their relative in a nursing home. In the Western world and with a growing population of older people, the number of persons with dementia increases. Family members often become carers in their own homes creating stressful and exhausting situation that eventually leads to relocating the person to a nursing home. This may lead to troubled conscience among family members. This is a qualitative study with descriptive design based on interviews with ten family members to residents with dementia at one small nursing home ward. Data were analysed using content analysis. Five categories were derived from data: relocating a person with dementia - a responsibility; visiting the resident - a relief or a burden; the participants taking part in and monitoring the residents' care needs; participants meeting their own needs; and thoughts about the future and resident's death. The result shows both positive and negative aspects of being a family member to persons with dementia. Family members described feeling relief as well as having a troubled conscience when placing a relative in a nursing home. They held themselves responsible for monitoring and evaluating the quality of the care. Family members expressed fearing a slow death for the person with dementia as well as for their own sake. Most felt well treated by the staff. Family members were responsible for relocating the residents to the nursing home. This in itself was found to cause feelings of moral concerns and generating troubled conscience. Staff at nursing homes needs to exercise family-centred care to benefit the persons with dementia, their family members and the staff themselves. © 2017 John Wiley & Sons Ltd.

  8. Knock-down of transcript abundance of a family of Kunitz proteinase inhibitor genes in white clover (Trifolium repens) reveals a redundancy and diversity of gene function.

    Science.gov (United States)

    Islam, Afsana; Leung, Susanna; Burgess, Elisabeth P J; Laing, William A; Richardson, Kim A; Hofmann, Rainer W; Dijkwel, Paul P; McManus, Michael T

    2015-12-01

    The transcriptional regulation of four phylogenetically distinct members of a family of Kunitz proteinase inhibitor (KPI) genes isolated from white clover (Trifolium repens; designated Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5) has been investigated to determine their wider functional role. The four genes displayed differential transcription during seed germination, and in different tissues of the mature plant, and transcription was also ontogenetically regulated. Heterologous over-expression of Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5 in Nicotiana tabacum retarded larval growth of the herbivore Spodoptera litura, and an increase in the transcription of the pathogenesis-related genes PR1 and PR4 was observed in the Tr-KPI1 and Tr-KPI4 over-expressing lines. RNA interference (RNAi) knock-down lines in white clover displayed significantly altered vegetative growth phenotypes with inhibition of shoot growth and a stimulation of root growth, while knock-down of Tr-KPI1, Tr-KPI2 and Tr-KPI5 transcript abundance also retarded larval growth of S. litura. Examination of these RNAi lines revealed constitutive stress-associated phenotypes as well as altered transcription of cellular signalling genes. These results reveal a functional redundancy across members of the KPI gene family. Further, the regulation of transcription of at least one member of the family, Tr-KPI2, may occupy a central role in the maintenance of a cellular homeostasis. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  9. The needs of patient family members in the intensive care unit in ...

    African Journals Online (AJOL)

    Background. The admission of a relative to an intensive care unit (ICU) is a stressful experience for family members. There has been limited research addressing this issue in Kigali, Rwanda. Objective. To explore the needs of patient family members admitted into an ICU in Kigali, Rwanda. Methods. This study used a ...

  10. The needs of patient family members in the intensive care unit in Kigali Rwanda

    Directory of Open Access Journals (Sweden)

    Petra Brysiewicz

    2014-07-01

    Full Text Available Background. The admission of a relative to an intensive care unit (ICU is a stressful experience for family members. There has been limited research addressing this issue in Kigali, Rwanda.Objective. To explore the needs of patient family members admitted into an ICU in Kigali, Rwanda.Methods. This study used a quantitative exploratory design focused on exploring the needs of patient family members in ICU at one hospital in Kigali, Rwanda. Family members (N=40 were recruited using the convenience sampling strategy. The Critical Care Family Needs Inventory was used to collect relevant data.Results. The participants identified various needs to be met for the family during the patient’s admission in ICU. The most important was the need for assurance, followed by the need for comfort, information, proximity and lastly support. Three additional needs specific to this sample group were also identified, related to resource constraints present in the hospital where the study was carried out.Conclusion. These results offer insight for nurses and other healthcare professionals as to what the important needs are that must be considered for the patient family members in ICUs within a resource-constrained environment.

  11. Family members' informal roles in end-of-life decision making in adult intensive care units.

    Science.gov (United States)

    Quinn, Jill R; Schmitt, Madeline; Baggs, Judith Gedney; Norton, Sally A; Dombeck, Mary T; Sellers, Craig R

    2012-01-01

    To support the process of effective family decision making, it is important to recognize and understand informal roles that various family members may play in the end-of-life decision-making process. To describe some informal roles consistently enacted by family members involved in the process of end-of-life decision making in intensive care units. Ethnographic study. Data were collected via participant observation with field notes and semistructured interviews on 4 intensive care units in an academic health center in the mid-Atlantic United States from 2001 to 2004. The units studied were a medical, a surgical, a burn and trauma, and a cardiovascular intensive care unit. Health care clinicians, patients, and family members. Informal roles for family members consistently observed were primary caregiver, primary decision maker, family spokesperson, out-of-towner, patient's wishes expert, protector, vulnerable member, and health care expert. The identified informal roles were part of families' decision-making processes, and each role was part of a potentially complicated family dynamic for end-of-life decision making within the family system and between the family and health care domains. These informal roles reflect the diverse responses to demands for family decision making in what is usually a novel and stressful situation. Identification and description of these informal roles of family members can help clinicians recognize and understand the functions of these roles in families' decision making at the end of life and guide development of strategies to support and facilitate increased effectiveness of family discussions and decision-making processes.

  12. 29 CFR 825.124 - Needed to care for a family member or covered servicemember.

    Science.gov (United States)

    2010-07-01

    ..., DEPARTMENT OF LABOR OTHER LAWS THE FAMILY AND MEDICAL LEAVE ACT OF 1993 Coverage Under the Family and Medical Leave Act § 825.124 Needed to care for a family member or covered servicemember. (a) The medical... serious health condition, the family member is unable to care for his or her own basic medical, hygienic...

  13. Female children with incarcerated adult family members at risk for life-long neurological decline

    OpenAIRE

    Brewer-Smyth, Kathleen; Pohlig, Ryan T.; Bucurescu, Gabriel

    2016-01-01

    A secondary analysis of data from adult female prison inmates in the mid-Atlantic United States defined relationships between having incarcerated adult family members during childhood and neurological outcomes. Of 135 inmates, 99(73%) had one or more incarcerated adult family members during childhood. Regression analyses revealed that having incarcerated adult family members was related to greater frequency and severity of childhood abuse and higher incidence of neurological deficits in adult...

  14. A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

    Directory of Open Access Journals (Sweden)

    Hewitt Jane E

    2010-11-01

    Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

  15. An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

    Energy Technology Data Exchange (ETDEWEB)

    Damiani, R.D. Jr.; Wessler, S.R. (Univ. of Georgia, Athens, GA (United States))

    1993-09-01

    The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open reading frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.

  16. A possibility for strengthening family life and health: Family members' lived experience when a sick child receives home care in Sweden.

    Science.gov (United States)

    Castor, Charlotte; Landgren, Kajsa; Hansson, Helena; Kristensson Hallström, Inger

    2018-03-01

    Families often prefer home care to hospital care, and home-care services for ill children are increasing worldwide with limited knowledge of families' needs during curative and palliative home care. The aim of this study was to elucidate family members' lived experience when a sick child received home care from county-based primary healthcare services. A descriptive qualitative design was chosen and 12 families including sick children receiving home care and their mothers, fathers and siblings in the south of Sweden were interviewed between December 2015 and January 2017. The transcribed interviews were analysed using a hermeneutic phenomenological approach. The family members' lived experience was described in three essential themes: "Strengthening family life" relates to how home care induced freedom and luxury in a strained period of life and supported the families' everyday life. Usual social activities and relations were maintained as time and energy was saved when receiving home care. "Promoting health" relates to how the family members' burden of illness decreased as the child's signs of illness alleviated and the well-being of the whole family increased when the child received care in the home. This provided a peaceful respite for family members' psychosocial recovery. The third theme, "Creating alliances," relates to the importance of creating trustful alliances for communicating participation in care. If trustful alliances were not created, parents felt an overwhelming responsibility and family members became anxious. The findings suggest that care in the family's home is a useful complement to hospital care. Home care should be given with close attention to family members' needs and conditions, as positive effects of home care might be jeopardised when expectations and possibilities are not successfully shared. © 2017 The Authors. Health and Social Care in the Community Published by John Wiley & Sons Ltd.

  17. Resident and family member perceptions of cultural diversity in aged care homes.

    Science.gov (United States)

    Xiao, Lily Dongxia; Willis, Eileen; Harrington, Ann; Gillham, David; De Bellis, Anita; Morey, Wendy; Jeffers, Lesley

    2017-03-01

    Similar to many developed nations, older people living in residential aged care homes in Australia and the staff who care for them have become increasingly multicultural. This cultural diversity adds challenges for residents in adapting to the care home. This study explores: (i) residents' and family members' perceptions about staff and cultural diversity, and (ii) culturally and linguistically diverse residents' and family members' experiences. An interpretive study design employing a thematic analysis was applied. Twenty-three residents and seven family members participated in interviews. Four themes were identified from interpreting residents and family members' perceptions of the impact of cultural diversity on their adaptation to aged care homes: (i) perceiving diversity as an attraction; (ii) adapting to cross-cultural communication; (iii) adjusting to diet in the residential care home; and (iv) anticipating individualized psychosocial interactions. The findings have implications for identifying strategies to support staff from all cultural backgrounds in order to create a caring environment that facilitates positive relationships with residents and supports residents to adjust to the care home. © 2016 John Wiley & Sons Australia, Ltd.

  18. A Novel WT1 Gene Mutation in a Three-Generation Family with Progressive Isolated Focal Segmental Glomerulosclerosis

    Science.gov (United States)

    Caridi, Gianluca; Malaventura, Cristina; Dagnino, Monica; Leonardi, Emanuela; Artifoni, Lina; Ghiggeri, Gian Marco; Tosatto, Silvio C.E.; Murer, Luisa

    2010-01-01

    Background and objectives: Wilms tumor-suppressor gene-1 (WT1) plays a key role in kidney development and function. WT1 mutations usually occur in exons 8 and 9 and are associated with Denys-Drash, or in intron 9 and are associated with Frasier syndrome. However, overlapping clinical and molecular features have been reported. Few familial cases have been described, with intrafamilial variability. Sporadic cases of WT1 mutations in isolated diffuse mesangial sclerosis or focal segmental glomerulosclerosis have also been reported. Design, setting, participants, & measurements: Molecular analysis of WT1 exons 8 and 9 was carried out in five members on three generations of a family with late-onset isolated proteinuria. The effect of the detected amino acid substitution on WT1 protein's structure was studied by bioinformatics tools. Results: Three family members reached end-stage renal disease in full adulthood. None had genital abnormalities or Wilms tumor. Histologic analysis in two subjects revealed focal segmental glomerulosclerosis. The novel sequence variant c.1208G>A in WT1 exon 9 was identified in all of the affected members of the family. Conclusions: The lack of Wilms tumor or other related phenotypes suggests the expansion of WT1 gene analysis in patients with focal segmental glomerulosclerosis, regardless of age or presence of typical Denys-Drash or Frasier syndrome clinical features. Structural analysis of the mutated protein revealed that the mutation hampers zinc finger-DNA interactions, impairing target gene transcription. This finding opens up new issues about WT1 function in the maintenance of the complex gene network that regulates normal podocyte function. PMID:20150449

  19. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  20. Comprehensive Identification of Krüppel-Like Factor Family Members Contributing to the Self-Renewal of Mouse Embryonic Stem Cells and Cellular Reprogramming.

    Directory of Open Access Journals (Sweden)

    Hyojung Jeon

    Full Text Available Pluripotency is maintained in mouse embryonic stem (ES cells and is induced from somatic cells by the activation of appropriate transcriptional regulatory networks. Krüppel-like factor gene family members, such as Klf2, Klf4 and Klf5, have important roles in maintaining the undifferentiated state of mouse ES cells as well as in cellular reprogramming, yet it is not known whether other Klf family members exert self-renewal and reprogramming functions when overexpressed. In this study, we examined whether overexpression of any representative Klf family member, such as Klf1-Klf10, would be sufficient for the self-renewal of mouse ES cells. We found that only Klf2, Klf4, and Klf5 produced leukemia inhibitory factor (LIF-independent self-renewal, although most KLF proteins, if not all, have the ability to occupy the regulatory regions of Nanog, a critical Klf target gene. We also examined whether overexpression of any of Klf1-Klf10 would be sufficient to convert epiblast stem cells into a naïve pluripotent state and found that Klf5 had such reprogramming ability, in addition to Klf2 and Klf4. We also delineated the functional domains of the Klf2 protein for LIF-independent self-renewal and reprogramming. Interestingly, we found that both the N-terminal transcriptional activation and C-terminal zinc finger domains were indispensable for this activity. Taken together, our comprehensive analysis provides new insight into the contribution of Klf family members to mouse ES self-renewal and cellular reprogramming.

  1. Comprehensive Identification of Krüppel-Like Factor Family Members Contributing to the Self-Renewal of Mouse Embryonic Stem Cells and Cellular Reprogramming.

    Science.gov (United States)

    Jeon, Hyojung; Waku, Tsuyoshi; Azami, Takuya; Khoa, Le Tran Phuc; Yanagisawa, Jun; Takahashi, Satoru; Ema, Masatsugu

    2016-01-01

    Pluripotency is maintained in mouse embryonic stem (ES) cells and is induced from somatic cells by the activation of appropriate transcriptional regulatory networks. Krüppel-like factor gene family members, such as Klf2, Klf4 and Klf5, have important roles in maintaining the undifferentiated state of mouse ES cells as well as in cellular reprogramming, yet it is not known whether other Klf family members exert self-renewal and reprogramming functions when overexpressed. In this study, we examined whether overexpression of any representative Klf family member, such as Klf1-Klf10, would be sufficient for the self-renewal of mouse ES cells. We found that only Klf2, Klf4, and Klf5 produced leukemia inhibitory factor (LIF)-independent self-renewal, although most KLF proteins, if not all, have the ability to occupy the regulatory regions of Nanog, a critical Klf target gene. We also examined whether overexpression of any of Klf1-Klf10 would be sufficient to convert epiblast stem cells into a naïve pluripotent state and found that Klf5 had such reprogramming ability, in addition to Klf2 and Klf4. We also delineated the functional domains of the Klf2 protein for LIF-independent self-renewal and reprogramming. Interestingly, we found that both the N-terminal transcriptional activation and C-terminal zinc finger domains were indispensable for this activity. Taken together, our comprehensive analysis provides new insight into the contribution of Klf family members to mouse ES self-renewal and cellular reprogramming.

  2. A novel mutation in the WFS1 gene identified in a Taiwanese family with low-frequency hearing impairment

    Directory of Open Access Journals (Sweden)

    Chung Shing-Fang

    2007-05-01

    Full Text Available Abstract Background Wolfram syndrome gene 1 (WFS1 accounts for most of the familial nonsyndromic low-frequency sensorineural hearing loss (LFSNHL which is characterized by sensorineural hearing losses equal to and below 2000 Hz. The current study aimed to contribute to our understanding of the molecular basis of LFSNHL in an affected Taiwanese family. Methods The Taiwanese family with LFSNHL was phenotypically characterized using audiologic examination and pedigree analysis. Genetic characterization was performed by direct sequencing of WFS1 and mutation analysis. Results Pure tone audiometry confirmed that the family members affected with LFSNHL had a bilateral sensorineural hearing loss equal to or below 2000 Hz. The hearing loss threshold of the affected members showed no progression, a characteristic that was consistent with a mutation in the WFS1 gene located in the DFNA6/14/38 locus. Pedigree analysis showed a hereditarily autosomal dominant pattern characterized by a full penetrance. Among several polymorphisms, a missense mutation Y669H (2005T>C in exon 8 of WFS1 was identified in members of a Taiwanese family diagnosed with LFSNHL but not in any of the control subjects. Conclusion We discovered a novel heterozygous missense mutation in exon 8 of WFS1 (i.e., Y669H which is likely responsible for the LFSNHL phenotype in this particular Taiwanese family.

  3. Experience and needs of family members of patients treated with extracorporeal membrane oxygenation.

    Science.gov (United States)

    Tramm, Ralph; Ilic, Dragan; Murphy, Kerry; Sheldrake, Jayne; Pellegrino, Vincent; Hodgson, Carol

    2017-06-01

    To explore the experiences of family members of patients treated with extracorporeal membrane oxygenation. Sudden onset of an unexpected and severe illness is associated with an increased stress experience of family members. Only one study to date has explored the experience of family members of patients who are at high risk of dying and treated with extracorporeal membrane oxygenation. A qualitative descriptive research design was used. A total of 10 family members of patients treated with extracorporeal membrane oxygenation were recruited through a convenient sampling approach. Data were collected using open-ended semi-structured interviews. A six-step process was applied to analyse the data thematically. Four criteria were employed to evaluate methodological rigour. Family members of extracorporeal membrane oxygenation patients experienced psychological distress and strain during and after admission. Five main themes (Going Downhill, Intensive Care Unit Stress and Stressors, Carousel of Roles, Today and Advice) were identified. These themes were explored from the four roles of the Carousel of Roles theme (decision-maker, carer, manager and recorder) that participants experienced. Nurses and other staff involved in the care of extracorporeal membrane oxygenation patients must pay attention to individual needs of the family and activate all available support systems to help them cope with stress and strain. An information and recommendation guide for families and staff caring for extracorporeal membrane oxygenation patients was developed and needs to be applied cautiously to the individual clinical setting. © 2016 John Wiley & Sons Ltd.

  4. Radiation dose to family members of hyperthyroidism and thyroid cancer patients treated with 131I

    International Nuclear Information System (INIS)

    Pant, G. S.; Sharma, S. K.; Bal, C. S.; Kumar, R.; Rath, G. K.

    2006-01-01

    The thermoluminescence dosemeter (TLD) was used for measuring radiation dose to family members of thyrotoxicosis and thyroid cancer patients treated with 131 I using CaSO 4 :Dy discs. There were 45 family members of thyrotoxicosis patients, who were divided into two groups with 22 in the first and 23 in the second group. Radiation safety instructions were the same for both the groups except in the second group where the patients were advised to use a separate bed at home for the first 3 d of dose administration. An activity ranging from 185 to 500 MBq was administered to these patients. The whole-body dose to family members ranged from 0.4 to 2.4 mSv (mean 1.1 mSv) in the first group and 0-1.9 mSv (mean 0.6 mSv) in the second group. A total of 297 family members of thyroid cancer patients were studied for whole-body dose estimation. An activity ranging from 0.925 to 7.4 GBq was administered to the thyroid cancer patients. The family members were divided into three groups depending upon the mode of transport and facilities available at home to avoid close proximity with the patient. Group A with 25 family members received a dose ranging from 0 to 0.9 mSv (mean 0.4 mSv), group B with 96 family members received a dose ranging from 0 to 8.5 mSv (mean 0.8 mSv) and group C with 176 family members received a dose ranging from 0 to 5.0 mSv (mean 0.8 mSv). The thyroid monitoring was also done in 103 family members who attended the patients in isolation wards for >2 d. Thyroid dose in them ranged from 0 to 2.5 mGy (mean 0.1 mGy). (authors)

  5. Psychiatric worker and family members: pathways towards co-operation networks within psychiatric assistance services

    Directory of Open Access Journals (Sweden)

    Silvia Carbone

    2014-03-01

    Full Text Available The family’s role in patient care was greatly altered by Law 180. This law, introduced in Italy in 1978, led to a gradual phasing out of custodial treatment for psychiatric patients. This different mindset, which views the family as an alternative to institutionalization, leads to it being seen as an essential entity in the setting up of community service dynamics. We interviewed health professionals in order to understand obstacles of collaboration between family members and mental health care workers. The goal was to uncover actions that promote collaboration and help build alliances between families and psychiatric workers. Results showed that health professionals view the family as a therapeutic resource. Despite this view, family members were rarely included in patient treatment. The reasons is: the structures have a theoretical orientation of collaboration with the family but, for nurses not are organized a few meeting spaces with family members. Services should create moments, such as multi-family groups or groups of information, managed by nurses and not only by doctors. These occasions it might facilitate the knowledge between professionals and family members.

  6. Impact of family history assessment on communication with family members and health care providers: A report from the Family Healthware™ Impact Trial (FHITr).

    Science.gov (United States)

    Wang, Catharine; Sen, Ananda; Plegue, Melissa; Ruffin, Mack T; O'Neill, Suzanne M; Rubinstein, Wendy S; Acheson, Louise S

    2015-08-01

    This study examines the impact of Family Healthware™ on communication behaviors; specifically, communication with family members and health care providers about family health history. A total of 3786 participants were enrolled in the Family Healthware™ Impact Trial (FHITr) in the United States from 2005-7. The trial employed a two-arm cluster-randomized design, with primary care practices serving as the unit of randomization. Using generalized estimating equations (GEE), analyses focused on communication behaviors at 6month follow-up, adjusting for age, site and practice clustering. A significant interaction was observed between study arm and baseline communication status for the family communication outcomes (p'scommunicating at baseline and those who were not. Among participants who were not communicating at baseline, intervention participants had higher odds of communicating with family members about family history risk (OR=1.24, p=0.042) and actively collecting family history information at follow-up (OR=2.67, p=0.026). Family Healthware™ did not have a significant effect on family communication among those already communicating at baseline, or on provider communication, regardless of baseline communication status. Greater communication was observed among those at increased familial risk for a greater number of diseases. Family Healthware™ prompted more communication about family history with family members, among those who were not previously communicating. Efforts are needed to identify approaches to encourage greater sharing of family history information, particularly with health care providers. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Nuclear transfer alters placental gene expression and associated histone modifications of the placental-specific imprinted gene pleckstrin homology-like domain, family A, member 2 (PHLDA2) in cattle.

    Science.gov (United States)

    Arnold, Daniel R; Gaspar, Roberta C; da Rocha, Carlos V; Sangalli, Juliano R; de Bem, Tiago H C; Corrêa, Carolina A P; Penteado, João C T; Meirelles, Flavio V; Lopes, Flavia L

    2017-03-01

    Abnormal placental development is frequent in nuclear transfer (NT) pregnancies and is likely to be associated with altered epigenetic reprogramming. In the present study, fetal and placental measurements were taken on Day 60 of gestation in cows with pregnancies produced by AI, IVF and NT. Placentas were collected and subjected to histological evaluation, the expression of genes important in trophoblast differentiation and expression of the placental imprinted gene pleckstrin homology-like domain, family A, member 2 (PHLDA2), as well as chromatin immunoprecipitation (ChIP) for histone marks within the promoter of PHLDA2. Fewer binucleated cells were observed in NT cotyledons, followed by IVF and AI cotyledons (P<0.05). Expression of heart and neural crest derivatives expressed 1 (HAND1), placental lactogen (PL), pregnancy-associated glycoprotein 9 (PAG-9) and PHLDA2 was elevated in NT cotyledons compared with AI cotyledons. Expression of PHLDA2 was higher in IVF than AI samples (P<0.05). ChIP revealed an increase in the permissive mark dimethylation of lysine 4 on histone H3 (H3K4me2), surprisingly associated with the silent allele of PHLDA2, and a decrease in the inhibitory mark H3K9me2 in NT samples. Thus, genes critical for placental development were altered in NT placentas, including an imprinted gene. Allele-specific changes in the permissive histone mark in the PHLDA2 promoter indicate misregulation of imprinting in clones. Abnormal trophoblast differentiation could have resulted in lower numbers of binucleated cells following NT. These results suggest that the altered expression of imprinted genes associated with NT are also caused by changes in histone modifications.

  8. Two members of the Ustilago maydis velvet family influence teliospore development and virulence on maize seedlings.

    Science.gov (United States)

    Karakkat, Brijesh B; Gold, Scott E; Covert, Sarah F

    2013-12-01

    Members of the fungal-specific velvet protein family regulate sexual and asexual spore production in the Ascomycota. We predicted, therefore, that velvet homologs in the basidiomycetous plant pathogen Ustilago maydis would regulate sexual spore development, which is also associated with plant disease progression in this fungus. To test this hypothesis, we studied the function of three U. maydis velvet genes, umv1, umv2 and umv3. Using a gene replacement strategy, deletion mutants were made in all three genes in compatible haploid strains, and additionally for umv1 and umv2 in the solopathogenic strain, SG200. None of the mutants showed novel morphological phenotypes during yeast-like, in vitro growth. However, the Δumv1 mutants failed to induce galls or teliospores in maize. Chlorazol black E staining of leaves infected with Δumv1 dikaryons revealed that the Δumv1 hyphae did not proliferate normally and were blocked developmentally before teliospore formation. The Δumv2 mutants were able to induce galls and teliospores in maize, but were slow to do so and thus reduced in virulence. The Δumv3 mutants were not affected in teliospore formation or disease progression. Complementation of the Δumv1 and Δumv2 mutations in the SG200 background produced disease indices similar to those of SG200. These results indicate that two U. maydis velvet family members, umv1 and umv2, are important for normal teliospore development and disease progression in maize seedlings. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Plant, animal, and fungal micronutrient queuosine is salvaged by members of the DUF2419 protein family.

    Science.gov (United States)

    Zallot, Rémi; Brochier-Armanet, Céline; Gaston, Kirk W; Forouhar, Farhad; Limbach, Patrick A; Hunt, John F; de Crécy-Lagard, Valérie

    2014-08-15

    Queuosine (Q) is a modification found at the wobble position of tRNAs with GUN anticodons. Although Q is present in most eukaryotes and bacteria, only bacteria can synthesize Q de novo. Eukaryotes acquire queuine (q), the free base of Q, from diet and/or microflora, making q an important but under-recognized micronutrient for plants, animals, and fungi. Eukaryotic type tRNA-guanine transglycosylases (eTGTs) are composed of a catalytic subunit (QTRT1) and a homologous accessory subunit (QTRTD1) forming a complex that catalyzes q insertion into target tRNAs. Phylogenetic analysis of eTGT subunits revealed a patchy distribution pattern in which gene losses occurred independently in different clades. Searches for genes co-distributing with eTGT family members identified DUF2419 as a potential Q salvage protein family. This prediction was experimentally validated in Schizosaccharomyces pombe by confirming that Q was present by analyzing tRNA(Asp) with anticodon GUC purified from wild-type cells and by showing that Q was absent from strains carrying deletions in the QTRT1 or DUF2419 encoding genes. DUF2419 proteins occur in most Eukarya with a few possible cases of horizontal gene transfer to bacteria. The universality of the DUF2419 function was confirmed by complementing the S. pombe mutant with the Zea mays (maize), human, and Sphaerobacter thermophilus homologues. The enzymatic function of this family is yet to be determined, but structural similarity with DNA glycosidases suggests a ribonucleoside hydrolase activity.

  10. Support needs and experiences of family members of wounded, injured or sick UK service personnel.

    Science.gov (United States)

    Verey, Anna; Keeling, M; Thandi, G; Stevelink, S; Fear, N

    2017-12-01

    When a service person has been wounded, injured or sick (WIS), family members may provide care during their recovery in an unpaid capacity. This may occur in diverse environments including hospitals, inpatient rehabilitation centres, in the community and at home. Thirty-seven family members of WIS personnel were interviewed regarding their support needs, family relationships and use of UK support services. Semistructured, in-depth telephone interviews were used, with data analysis undertaken using a thematic approach. 'Family member involvement' was the main theme under which four subthemes were situated: 'continuity of support', 'proactive signposting and initiating contact', 'psychoeducation and counselling' and 'higher risk groups'. Family members felt they might benefit from direct, consistent and continuous care regardless of the WIS person's injury or engagement type, and whether the WIS person was being treated in a hospital, rehabilitative centre or at home. The findings of this study suggest that family members of WIS personnel value proactive, direct and sustained communication from support service providers. We suggest that families of UK service personnel may benefit from family care coordinators, who could provide continuous and consistent care to family members of WIS personnel. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  11. Hope: A further dimension for engaging family members of people with ABI.

    Science.gov (United States)

    Kuipers, Pim; Doig, Emmah; Kendall, Melissa; Turner, Ben; Mitchell, Marion; Fleming, Jennifer

    2014-01-01

    Family member engagement is increasingly recognised as an influential factor in the rehabilitation continuum following Acquired Brain Injury, including the inpatient setting and longer-term community integration phases. To explore the experiences of patients and family members about their involvement in brain injury rehabilitation. This study comprised individual and group interviews with 14 ex-patients and family members. Interviews explored effects of inpatient rehabilitation on family relationships. Interview audio recordings were analysed using an interpretive approach by two independent researchers. Findings clearly confirmed the significance of engaging family members in inpatient rehabilitation, and specifically reinforced the importance of informational, emotional, practical and peer support. However, the key finding of the study was the importance of hope, and the need for rehabilitation professionals to foster hope. Despite not having included any questions on this topic, all interviewees noted the importance of hope, some saw it as fundamental to positive outcomes, and many were unconvinced of rehabilitation professionals' concern to avoid false hope. Various dimensions of hope are explored. The study notes that hope has been identified as highly important in many areas beyond brain injury rehabilitation. Based on this small preliminary study, the issue of hope is seen as a key focus for future research.

  12. Targeted cardiopulmonary resuscitation training focused on the family members of high-risk patients at a regional medical center: A comparison between family members of high-risk and no-risk patients.

    Science.gov (United States)

    Han, Kap Su; Lee, Ji Sung; Kim, Su Jin; Lee, Sung Woo

    2018-05-01

    We developed a hospital-based cardiopulmonary resuscitation (CPR) training model focused on the target population (family members of patients with potential risks for cardiac arrest) and compared the outcome of CPR training between target and non-target populations for validity. Family members of patients in training were divided into three groups on the basis of patients' diseases, as follows: 1) the cardio-specific (CS) risk group, including family members of patients with cardiac disease at risk of cardiac arrest; 2) the cardiovascular (CV) risk group, including family members of patients with risk factors for cardiovascular disease; and 3) the no-risk group. Pre- and posttraining surveys and skill tests as well as a post-training 3-month telephone survey were conducted. Educational outcomes were analyzed. A total of 203 family members were enrolled into 21 CPR training classes. The CS group (n=88) included elderly persons and housewives with a lower level of education compared with the CV (n=79) and no-risk groups (n=36). The CS group was motivated by healthcare professionals and participated in the training course. The CS, CV, and no-risk groups showed improvements in knowledge, willingness to perform CPR, and skills. Despite the older age and lower level of education in the CS group, the effects of education were similar to those in the other groups. A high rate of response and secondary propagation of CPR training were observed in the CS group. Family members of patients with heart disease could be an appropriate target population for CPR training, particularly in terms of recruitment and secondary propagation. Targeted intervention may be an effective training strategy to improve bystander CPR rates.

  13. Genomic and expression analysis of the flax (Linum usitatissimum) family of glycosyl hydrolase 35 genes.

    Science.gov (United States)

    Hobson, Neil; Deyholos, Michael K

    2013-05-23

    Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require

  14. Experiences of the families concerning organ donation of a family member with brain death

    Science.gov (United States)

    Yousefi, Hojatollah; Roshani, Asieh; Nazari, Fatemeh

    2014-01-01

    Background: In recent years, the lack of organ for transplantation has resulted in health planners and authorities in all countries, including Iran, paying serious attention to the issue. Despite the above-mentioned fact, families with a member affected by brain death are not interested in organ donation. Objective: This study is aimed at making an investigation into the decision-making process of organ donation in families with brain death. Also, the research is aimed at investigating how the deterrent and facilitating factors in the process of organ donation can be made. Materials and Methods: The current research is a qualitative study with descriptive exploratory approach. Data were collected through unstructured interviews with 10 family members who gave consent to organ donation of their family members in 2012. Purposeful sampling processes began in March 2012 and lasted up to June 2012. Simultaneously, thematic approach was used in analyzing the data. Results: Data analysis led to finding 24 categories and 11 themes, which fell into two categories: facilitating and deterrent factors. The five main deterrent themes included the five themes of prohibiting factors that were shock, hope for recovery, unknown process, and conflict of opinions, and worrying association. The six main facilitating themes included humanistic desires, immortality, culture making, satisfaction of the deceased, assurance, and eternal honor. Conclusion: The findings indicated that there is ambiguity and different interpretations on brain death. The research also showed that using the experiences of donator families can provide practical and applied solutions to facilitate the process of organ donation and solve the problems faced by the health care system. PMID:24949074

  15. Differential expression of members of the E2F family of transcription factors in rodent testes

    Directory of Open Access Journals (Sweden)

    Toppari Jorma

    2006-12-01

    Full Text Available Abstract Background The E2F family of transcription factors is required for the activation or repression of differentially expressed gene programs during the cell cycle in normal and abnormal development of tissues. We previously determined that members of the retinoblastoma protein family that interacts with the E2F family are differentially expressed and localized in almost all the different cell types and tissues of the testis and in response to known endocrine disruptors. In this study, the cell-specific and stage-specific expression of members of the E2F proteins has been elucidated. Methods We used immunohistochemical (IHC analysis of tissue sections and Western blot analysis of proteins, from whole testis and microdissected stages of seminiferous tubules to study the differential expression of the E2F proteins. Results For most of the five E2F family members studied, the localizations appear conserved in the two most commonly studied rodent models, mice and rats, with some notable differences. Comparisons between wild type and E2F-1 knockout mice revealed that the level of E2F-1 protein is stage-specific and most abundant in leptotene to early pachytene spermatocytes of stages IX to XI of mouse while strong staining of E2F-1 in some cells close to the basal lamina of rat tubules suggest that it may also be expressed in undifferentiated spermatogonia. The age-dependent development of a Sertoli-cell-only phenotype in seminiferous tubules of E2F-1 knockout males corroborates this, and indicates that E2F-1 is required for spermatogonial stem cell renewal. Interestingly, E2F-3 appears in both terminally differentiated Sertoli cells, as well as spermatogonial cells in the differentiative pathway, while the remaining member of the activating E2Fs, E2F-2 is most concentrated in spermatocytes of mid to late prophase of meiosis. Comparisons between wildtype and E2F-4 knockout mice demonstrated that the level of E2F-4 protein displays a distinct

  16. The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

    Directory of Open Access Journals (Sweden)

    Iva Tomalova

    Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

  17. Caring for a family member with intellectual disability and epilepsy: practical, social and emotional perspectives.

    Science.gov (United States)

    Thompson, Rose; Kerr, Mike; Glynn, Mike; Linehan, Christine

    2014-11-01

    To examine the caregiving impact of those who support a family member with intellectual disability and epilepsy. An online, qualitative international survey was conducted via the auspices of the International Bureau of Epilepsy with various stakeholders who support individuals who have intellectual disability and epilepsy. Qualitative comments were analyzed from respondents who identified themselves as family members (n=48; 36%) who referred specifically to the impact of supporting a family member with these combined disabilities. Four main domains, which were comprised of ten themes, were derived from the qualitative data using Braun and Clarke's qualitative framework. These domains comprised (1) practical concerns, (2) disrupted family dynamics, (3) emotional burden and (4) positive experiences. In combination these themes illustrate the pervasive impact on family life for those supporting an individual with complex needs. Financial concerns, coordination and responsibility of care, diverted attention from other family members and social isolation all contributed a significant burden of care for family members. Positive aspects were, however, also cited including the closeness of the family unit and a fostering of altruistic behavior. The study provides an insight into an under-researched area. The burden of caring for a family member across the lifespan has a largely negative and pervasive impact. Targeted service provision could contribute to an amelioration of the challenges faced by these families. Copyright © 2014 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  18. Complex Determinants in Specific Members of the Mannose Receptor Family Govern Collagen Endocytosis

    DEFF Research Database (Denmark)

    Jürgensen, Henrik J; Johansson, Kristina; Madsen, Daniel H

    2014-01-01

    Members of the well-conserved mannose receptor (MR) protein family have been functionally implicated in diverse biological and pathological processes. Importantly, a proposed common function is the internalization of collagen for intracellular degradation occurring during bone development, cancer...... invasion, and fibrosis protection. This functional relationship is suggested by a common endocytic capability and a candidate collagen-binding domain. Here we conducted a comparative investigation of each member's ability to facilitate intracellular collagen degradation. As expected, the family members u......PARAP/Endo180 and MR bound collagens in a purified system and internalized collagens for degradation in cellular settings. In contrast, the remaining family members, PLA2R and DEC-205, showed no collagen binding activity and were unable to mediate collagen internalization. To pinpoint the structural elements...

  19. A new member of a family of ATPases is essential for assembly of mitochondrial respiratory chain and ATP synthetase complexes in Saccharomyces cerevisiae.

    Science.gov (United States)

    Tzagoloff, A; Yue, J; Jang, J; Paul, M F

    1994-10-21

    Respiration-defective pet mutants of Saccharomyces cerevisiae, assigned to complementation group G25, are grossly deficient in mitochondrial respiratory and ATPase complexes. This phenotype is usually found in strains impaired in mitochondrial protein synthesis. The G25 mutants, however, synthesize all of the proteins encoded by mitochondrial DNA. The mutants are also able to import and process cytoplasmically derived subunits of these enzymes. These results are most compatible with the idea that the gene defined by G25 mutants (RCA1) codes for a protein essential for the assembly of functional respiratory and ATPase complexes. The RCA1 gene has been cloned by complementation of an rca1 mutant with a yeast genomic library. The sequence of the encoded product shows Rca1 protein to be a new member of a recently described family of ATPases. The Rca1 protein is a mitochondrial membrane protein and is the third known member of this family implicated to function in the biogenesis of mitochondria. The primary structure of Rca1 protein indicates several distinct domains in addition to the common purine nucleotide binding region shared by all members of this protein family. One, located in the amino-terminal half, contains two hydrophobic stretches of sufficient length to span a membrane lipid bilayer.

  20. A follow-up meeting post death is appreciated by family members of deceased patients.

    Science.gov (United States)

    Kock, M; Berntsson, C; Bengtsson, A

    2014-08-01

    A practice with a follow-up meeting post death (FUMPD) with physician and staff for family members of patients who died in the intensive care unit (ICU) was started as a quality project to improve the support of families in post-ICU bereavement. A quality improvement control was conducted after 4 years. The quality improvement control was made retrospectively as an anonymous non-coded questionnaire. Part A related to the FUMPD. Part B inquired if we could contact the family member again for a research project to evaluate family support post-ICU bereavement. The questionnaires were sent to 84 family members of 56 deceased patients. Part A: 46 out of 84 family members answered and had attended a FUMPD. Ninety-one percent of the family members thought that we should continue to offer FUMPD. Seventy-eight percent were satisfied with their meeting. Eighty percent felt that they understood the cause of death. The majority wanted the meeting to take place within 6 weeks of death. Ninety-one percent rated the physician as important to be present at the meeting. The social worker was rated more important to attend the meeting than the assistant nurse. Ninety-one percent wanted to discuss the cause of death.Part B: 54 out of 84 family members answered. Twenty out of 54 did not want us to contact them again. A routine with a Follow-Up Meeting Post Death with the ICU team for the families of the patients who die in the ICU is appreciated. The presence of the physician is important. © 2014 The Acta Anaesthesiologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  1. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  2. Polymorphic light eruption and IL-1 family members: any difference with allergic contact dermatitis?

    Science.gov (United States)

    Lembo, S; Caiazzo, G; Balato, N; Monfrecola, G; Patra, V; Wolf, P; Balato, A

    2017-09-13

    Polymorphic light eruption (PLE) is described as a delayed-type hypersensitivity reaction (DTHR) toward a de novo light-induced antigen, yet to be identified. In effect, the inflammatory pathways of PLE and allergic contact dermatitis (ACD) share common patterns in terms of the mediators involved from the innate and adaptive immune system participating in the DTHR. As we have previously highlighted the role of interleukin (IL)-1 family members in ACD, we hypothesised that the same mediators could have similar functions in PLE. Our research aimed to assess the expression of certain IL-1family members in PLE patients vs. controls, and to compare it with ACD. The study population comprised 17 patients with PLE, 5 affected by ACD and 10 healthy controls in the same age range. Lesional and healthy skin samples were collected respectively from patients and donors. IL-36α, IL-36β, IL-36γ, IL-36 receptor antagonist (Ra), IL-1β, IL-33 gene and protein expressions were evaluated through RT-PCR and immunohistochemistry. Circulating proteins in the PLE patients were analysed by using western blot. The IL-36γ gene expression was significantly increased in PLE lesions compared to that in healthy controls and ACD lesions (***p PLE lesions compared to those of the healthy samples (***p PLE patients vs. controls (*p PLE with distinct differences from those in ACD, in particular with regard to IL-36γ mRNA regulation. Their role as activators of the local, and perhaps systemic, immune response, or as inhibitors of the immune tolerance machinery, needs further investigation.

  3. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  4. Family History

    Science.gov (United States)

    Your family history includes health information about you and your close relatives. Families have many factors in common, including their genes, ... as heart disease, stroke, and cancer. Having a family member with a disease raises your risk, but ...

  5. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  6. Stress and Depressive Symptoms in Cancer Survivors and Their Family Members: Korea Community Health Survey, 2012.

    Science.gov (United States)

    Han, Mi Ah

    2017-09-01

    This study examined the prevalence of perceived stress and depressive symptoms in cancer survivors and their family members compared with subjects without cancer and without family members with cancer. The subjects of this cross-sectional study were adults ≥19 years old who participated in the 2012 Korea Community Health Survey. Stress and depressive symptoms in cancer survivors and their family members were assessed and compared to symptoms in control groups by chi-square tests and multiple logistic regression analyses. Of the 6783 cancer survivors, 26.9% and 8.7% reported having stress and depressive symptoms, respectively, and 27.7% and 5.9% of family members of cancer survivors reported having stress and depressive symptoms, respectively. Cancer survivors showed higher adjusted odds ratio (aOR) for stress (aOR = 1.26, 95% confidence interval (CI) = 1.16-1.37) and depressive symptoms (aOR = 1.82, 95% CI = 1.57-2.11) than subjects without cancer history. Family members of cancer survivors showed a higher OR for stress and depressive symptoms than subjects without a family member who survived cancer. Cancer survivors and family members of cancer survivors had more stress and depressive symptoms than controls. Careful management for cancer patients and their family members should include screening for stress and depression to improve mental health associated with cancer survivorship.

  7. Family members' experience of the pre-diagnostic phase of dementia: a synthesis of qualitative evidence.

    Science.gov (United States)

    Rogers, Kirrily; Coleman, Honor; Brodtmann, Amy; Darby, David; Anderson, Vicki

    2017-09-01

    Most research on family members' experience of dementia has focused on the time after diagnosis. Yet, once people reach clinical attention, families have already been living with the changes for some time. These pre-diagnosis experiences can influence later caregiving. We aimed to synthesize qualitative research exploring family members' experiences of the pre-diagnostic phase of dementia to inform clinical practice. We conducted a thematic synthesis of 11 studies that met our inclusion criteria following a comprehensive literature search. An overarching theme, sense-making, captured the primary process that family members engage in throughout the pre-diagnostic period. Within this, four major analytic themes were extracted as central concepts in understanding family members' experiences of the pre-diagnostic phase of dementia: the nature of change; appraisals of change; reactions to change; and the influence of others. Relevant features of the family experience of dementia onset can be characterized within several major themes. These findings highlight the complex process of recognizing early symptoms of dementia for people living with this condition and their families. Our findings also provide the foundation for developing theoretical frameworks that will ultimately assist with improving recognition of dementia onset, clinical communication with family members, and interventions to reduce family burden.

  8. A survey of family members' satisfaction with the services provided by hospice palliative care volunteers.

    Science.gov (United States)

    Claxton-Oldfield, Stephen; Gosselin, Natasha; Schmidt-Chamberlain, Kirsten; Claxton-Oldfield, Jane

    2010-05-01

    A total of 22 family members, whose deceased loved ones had used the services of a hospice palliative care volunteer, responded to a brief survey designed to assess the importance of the different kinds of support offered to them (family members) by the volunteer, their impressions of the volunteers' personal qualities/characteristics, their general experiences with the volunteer, and their overall satisfaction with the volunteer services. The kind of support that received the highest importance rating from family members was the opportunity to take a much-needed break from the demands of caring for their loved one, closely followed by emotional support, the volunteer spending time with them, and the volunteer providing them with information. Family members rated volunteers highly on a list of qualities/characteristics that exemplify individuals who are effective in this role. In all, 85% of the family members felt that their volunteer was well trained and 95% did not feel that their or their loved one's privacy had been invaded by having a volunteer. Overall, family members were very satisfied with the volunteer support they received. Some limitations of the study are discussed.

  9. Perception of family emotional climate by family members of persons with schizophrenia.

    Science.gov (United States)

    Gandhi, Sailaxmi; Pavalur, Rajitha; Thirthalli, Jagadisha; Phillip, Mariamma

    2016-08-01

    There is a dearth of instruments to assess schizophrenia persons' Family Emotional Climate (FEC). This study aims to explore the relation between family members' personality traits and FEC. We invited a convenience sample of 50 both gender family members who were accompanying the person with schizophrenia for out-patient department (OPD) consultation to provide data on a socio-demographic proforma and the researcher prepared 'Emotional climate assessment questionnaire - caregivers' version' (ECAQ-C) as well as the Eysenck personality questionnaire. Caregivers' extroversion traits (r = .427, p = .002) were positively correlated and neuroticism traits were negatively correlated (r = -.330, p = .019) with their positive perception of FEC. There was a higher perception of positive FEC (mean scores = 65.5 ± 10.5) while caregivers seemed to perceive less negative FEC (mean scores = 36.5 ± 10.2). Caregivers with education above 11th std perceived less (χ(2) = 8.6, p = .013) of negative FEC. The findings highlight that caregivers' personality traits seem to influence the FEC. While caregivers' perception of FEC is positive in this study, those in the higher education group seem to have a better perception of FEC indicating that education also may influence FEC. © The Author(s) 2016.

  10. Patients' and family members' views on patient-centered communication during cancer care.

    Science.gov (United States)

    Mazor, Kathleen M; Beard, Reneé L; Alexander, Gwen L; Arora, Neeraj K; Firneno, Cassandra; Gaglio, Bridget; Greene, Sarah M; Lemay, Celeste A; Robinson, Brandi E; Roblin, Douglas W; Walsh, Kathleen; Street, Richard L; Gallagher, Thomas H

    2013-11-01

    To explore patients' and family members' views on communication during cancer care and to identify those aspects of clinician-patient communication which were most important to patients and family members. We conducted a secondary data analysis of qualitative data from 137 patients with cancer and family members of patients with cancer. We used a modified version of the constant comparative method and coding paradigm of grounded theory. Patients want sensitive, caring clinicians who provide information that they need, when they need it, in a way that they can understand; who listen and respond to questions and concerns, and who attempt to understand the patient's experience. Effective information exchange and a positive interpersonal relationship with the clinician were of fundamental importance to patients and family members. These were interrelated; for instance, failure to provide information a patient needed could damage the relationship, whereas excellent listening could foster the relationship. Information exchange and relationship were also integral to decision-making, managing uncertainty, responding to emotions, and self-management. Clinicians who were responsive to patients' needs beyond the immediate medical encounter were valued. The complexity of cancer care today suggests that efforts to improve communication must be multilevel, acknowledging and addressing patient, clinician, organizational and policy barriers, and facilitators. Measurement tools are needed to assess cancer patients' and family members' experiences with communication over the course of cancer care to provide meaningful, actionable feedback to those seeking to optimize their effectiveness in communicating with patients with cancer. Copyright © 2013 John Wiley & Sons, Ltd.

  11. Isolation, structure, synthesis, and activity of a new member of the calcitonin gene-related peptide family from frog skin and molecular cloning of its precursor.

    Science.gov (United States)

    Seon, A A; Pierre, T N; Redeker, V; Lacombe, C; Delfour, A; Nicolas, P; Amiche, M

    2000-02-25

    Calcitonin gene-related peptide has been extracted from the skin exudate of a single living specimen of the frog Phyllomedusa bicolor and purified to homogeneity by a two-step protocol. A total volume of 250 microl of exudate yielded 380 microg of purified peptide. Mass spectrometric analysis and gas phase sequencing of the purified peptide as well as chemical synthesis and cDNA analysis were consistent with the structure SCDTSTCATQRLADFLSRSGGIGSPDFVPTDVSANSF amide and the presence of a disulfide bridge linking Cys(2) and Cys(7). The skin peptide, named skin calcitonin gene-related peptide, differs significantly from all other members of the calcitonin gene-related peptide family of peptides at nine positions but binds with high affinity to calcitonin gene-related peptide receptors in the rat brain and acts as an agonist in the rat vas deferens bioassay with potencies equal to those of human CGRP. Reverse transcriptase-polymerase chain reaction coupled with cDNA cloning and sequencing demonstrated that skin calcitonin gene-related peptide isolated in the skin is identical to that present in the frog's central and enteric nervous systems. These data, which indicate for the first time the existence of calcitonin gene-related peptide in the frog skin, add further support to the brain-skin-gut triangle hypothesis as a useful tool in the identification and/or isolation of mammalian peptides that are present in the brain and other tissues in only minute quantities.

  12. Perspectives of family members on planning end-of-life care for terminally ill and frail older people.

    Science.gov (United States)

    van Eechoud, Ineke J; Piers, Ruth D; Van Camp, Sigrid; Grypdonck, Mieke; Van Den Noortgate, Nele J; Deveugele, Myriam; Verbeke, Natacha C; Verhaeghe, Sofie

    2014-05-01

    Advance care planning (ACP) is the process by which patients, together with their physician and loved ones, establish preferences for future care. Because previous research has shown that relatives play a considerable role in end-of-life care decisions, it is important to understand how family members are involved in this process. To gain understanding of the involvement of family members in ACP for older people near the end of life by exploring their views and experiences concerning this process. This was a qualitative research study, done with semistructured interviews. Twenty-one family members were recruited from three geriatric settings in Flanders, Belgium. The data were analyzed using the constant comparative method as proposed by the grounded theory. Family members took different positions in the ACP process depending on how much responsibility the family member wanted to take and to what extent the family member felt the patient expected him/her to play a part. The position of family members on these two dimensions was influenced by several factors, namely acknowledgment of the imminent death, experiences with death and dying, opinion about the benefits of ACP, burden of initiating conversations about death and dying, and trust in health care providers. Furthermore, the role of family members in ACP was embedded in the existing relationship patterns. This study provides insight into the different positions of family members in the end-of-life care planning of older patients with a short life expectancy. It is important for health care providers to understand the position of a family member in the ACP of the patient, take into account that family members may experience an active role in ACP as burdensome, and consider existing relationship patterns. Copyright © 2014 U.S. Cancer Pain Relief Committee. Published by Elsevier Inc. All rights reserved.

  13. Isolation of MA-ACS Gene Family and Expression Study of MA-ACS1 Gene in Musa acuminata Cultivar Pisang Ambon Lumut

    Directory of Open Access Journals (Sweden)

    LISTYA UTAMI KARMAWAN

    2009-03-01

    Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.

  14. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  15. Stigma by association and family burden among family members of people with mental illness: the mediating role of coping.

    Science.gov (United States)

    van der Sanden, Remko L M; Pryor, John B; Stutterheim, Sarah E; Kok, Gerjo; Bos, Arjan E R

    2016-09-01

    When someone has a mental illness, family members may share the experience of stigma. Past research has established that family members' experiences of stigma by association predict psychological distress and lower quality-of-life. The present study, conducted with 503 family members of people with mental illness examined the prevalence of 14 different coping strategies. Of greater importance, we examined the role of these coping strategies as mediators of the relationships between stigma by association and family burden, on the one hand, and outcomes, such as psychological distress and quality-of-life, on the other. The results showed that both perceived stigma by association and family burden are associated with greater psychological distress and lower quality-of-life, and that most coping strategies mediate these relationships. Adaptive coping strategies were related to reduced negative outcomes, while most maladaptive coping strategies were related to enhanced negative outcomes. Implications for intervention development are discussed.

  16. TRAF Family Member-Associated NF-κB Activator (TANK) Induced by RANKL Negatively Regulates Osteoclasts Survival and Function

    OpenAIRE

    Mengrui Wu, Yiping Wang, Lianfu Deng, Wei Chen, Yi-Ping Li

    2012-01-01

    Osteoclasts are the principle bone-resorbing cells. Precise control of balanced osteoclast activity is indispensable for bone homeostasis. Osteoclast activation mediated by RANK-TRAF6 axis has been clearly identified. However, a negative regulation-machinery in osteoclast remains unclear. TRAF family member-associated NF-κB activator (TANK) is induced by about 10 folds during osteoclastogenesis, according to a genome-wide analysis of gene expression before and after osteoclast maturation...

  17. TRAF Family Member-Associated NF-κB Activator (TANK) Induced by RANKL Negatively Regulates Osteoclasts Survival and Function

    OpenAIRE

    Wu, Mengrui; Wang, Yiping; Deng, Lianfu; Chen, Wei; Li, Yi-Ping

    2012-01-01

    Osteoclasts are the principle bone-resorbing cells. Precise control of balanced osteoclast activity is indispensable for bone homeostasis. Osteoclast activation mediated by RANK-TRAF6 axis has been clearly identified. However, a negative regulation-machinery in osteoclast remains unclear. TRAF family member-associated NF-κB activator (TANK) is induced by about 10 folds during osteoclastogenesis, according to a genome-wide analysis of gene expression before and after osteoclast maturation, and...

  18. [Identification of novel compound heterozygous mutations of USH2A gene in a family with Usher syndrome type II].

    Science.gov (United States)

    Jiang, Haiou; Ge, Chuanqin; Wang, Yiwang; Tang, Genyun; Quan, Qingli

    2015-06-01

    To identify potential mutations in a Chinese family with Usher syndrome type II. Genomic DNA was obtained from two affected and four unaffected members of the family and subjected to amplification of the entire coding sequence and splicing sites of USH2A gene. Mutation detection was conducted by direct sequencing of the PCR products. A total of 100 normal unrelated individuals were used as controls. The patients were identified to be a compound heterozygote for two mutations: c.8272G>T (p.E2758X) in exon 42 from his mother and c.12376-12378ACT>TAA(p.T4126X) in exon 63 of the USH2A gene from his father. Both mutations were not found in either of the two unaffected family members or 100 unrelated controls, and had completely co-segregated with the disease phenotype in the family. Neither mutation has been reported in the HGMD database. The novel compound heterozygous mutations c.8272G>T and c.12376-12378ACT>TAA within the USH2A gene may be responsible for the disease. This result may provide new clues for molecular diagnosis of this disease.

  19. A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

    Science.gov (United States)

    He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

    2017-08-23

    The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

  20. Classification and evolutionary analysis of the basic helix-loop-helix gene family in the green anole lizard, Anolis carolinensis.

    Science.gov (United States)

    Liu, Ake; Wang, Yong; Zhang, Debao; Wang, Xuhua; Song, Huifang; Dang, Chunwang; Yao, Qin; Chen, Keping

    2013-08-01

    Helix-loop-helix (bHLH) proteins play essential regulatory roles in a variety of biological processes. These highly conserved proteins form a large transcription factor superfamily, and are commonly identified in large numbers within animal, plant, and fungal genomes. The bHLH domain has been well studied in many animal species, but has not yet been characterized in non-avian reptiles. In this study, we identified 102 putative bHLH genes in the genome of the green anole lizard, Anolis carolinensis. Based on phylogenetic analysis, these genes were classified into 43 families, with 43, 24, 16, 3, 10, and 3 members assigned into groups A, B, C, D, E, and F, respectively, and 3 members categorized as "orphans". Within-group evolutionary relationships inferred from the phylogenetic analysis were consistent with highly conserved patterns observed for introns and additional domains. Results from phylogenetic analysis of the H/E(spl) family suggest that genome and tandem gene duplications have contributed to this family's expansion. Our classification and evolutionary analysis has provided insights into the evolutionary diversification of animal bHLH genes, and should aid future studies on bHLH protein regulation of key growth and developmental processes.

  1. Characterization of the lipoxygenase (LOX) gene family in the Chinese white pear (Pyrus bretschneideri) and comparison with other members of the Rosaceae.

    Science.gov (United States)

    Li, Meng; Li, Leiting; Dunwell, Jim M; Qiao, Xin; Liu, Xing; Zhang, Shaoling

    2014-06-07

    Lipoxygenases (LOXs), a type of non-haem iron-containing dioxygenase, are ubiquitous enzymes in plants and participate in the formation of fruit aroma which is a very important aspect of fruit quality. Amongst the various aroma volatiles, saturated and unsaturated alcohols and aldehydes provide the characteristic aroma of the fruit. These compounds are formed from unsaturated fatty acids through oxidation, pyrolysis and reduction steps. This biosynthetic pathway involves at least four enzymes, including LOX, the enzyme responsible for lipid oxidation. Although some studies have been conducted on the LOX gene family in several species including Arabidopsis, soybean, cucumber and apple, there is no information from pear; and the evolutionary history of this gene family in the Rosaceae is still not resolved. In this study we identified 107 LOX homologous genes from five Rosaceous species (Pyrus bretschneideri, Malus × domestica, Fragaria vesca, Prunus mume and Prunus persica); 23 of these sequences were from pear. By using structure analysis, phylogenic analysis and collinearity analysis, we identified variation in gene structure and revealed the phylogenetic evolutionary relationship of this gene family. Expression of certain pear LOX genes during fruit development was verified by analysis of transcriptome data. 23 LOX genes were identified in pear and these genes were found to have undergone a duplication 30-45 MYA; most of these 23 genes are functional. Specific gene duplication was found on chromosome4 in the pear genome. Useful information was provided for future research on the evolutionary history and transgenic research on LOX genes.

  2. Isolation, characterization, and expression of Le-msx, a maternally expressed member of the msx gene family from the glossiphoniid leech, Helobdella.

    Science.gov (United States)

    Master, V A; Kourakis, M J; Martindale, M Q

    1996-12-01

    The msx gene family is one of the most highly conserved of the nonclustered homeobox-containing genes. We have isolated an msx homolog (Le-msx) from the glossiphoniid leech, Helobdella robusta, and characterized its pattern of expression by whole mount in situ hybridization. In situ expression and reverse transcription polymerase chain reaction (RT-PCR) data results show that Le-msx is a maternal transcript initially uniformly distributed in the cortex of immature oocytes that becomes asymmetrically localized to the polar regions of the uncleaved zygote. This is the earliest reported expression for the msx gene family and the first maternally expressed homeodomain-containing transcription factor reported in annelids. During embryonic development, Le-msx is expressed in all 10 embryonic stem cells and their segmental founder cell descendants. At midembryonic stages, Le-msx is expressed in the expanding germinal plate. Le-msx is confined to the central nervous system and nephridia at late (stage 9) stages and subsequently disappears from nephridia. In addition, we present a phylogenetic hypothesis for the evolution of the msx gene family, including the identification of a putative C. elegans msx homolog and the realignment of the sponge msx homolog to the NK class of homeodomain genes.

  3. Elevated expression and potential roles of human Sp5, a member of Sp transcription factor family, in human cancers

    International Nuclear Information System (INIS)

    Chen Yongxin; Guo Yingqiu; Ge Xijin; Itoh, Hirotaka; Watanabe, Akira; Fujiwara, Takeshi; Kodama, Tatsuhiko; Aburatani, Hiroyuki

    2006-01-01

    In this report, we describe the expression and function of human Sp5, a member of the Sp family of zinc finger transcription factors. Like other family members, the Sp5 protein contains a Cys2His2 zinc finger DNA binding domain at the C-terminus. Our experiments employing Gal4-Sp5 fusion proteins reveal multiple transcriptional domains, including a N-terminal activity domain, an intrinsic repressive element, and a C-terminal synergistic domain. Elevated expression of Sp5 was noted in several human tumors including hepatocellular carcinoma, gastric cancer, and colon cancer. To study the effects of the Sp5 protein on growth properties of human cancer cells and facilitate the identification of its downstream genes, we combined an inducible gene expression system with microarray analysis to screen for its transcriptional targets. Transfer of Sp5 into MCF-7 cells that expressed no detectable endogenous Sp5 protein elicited significant growth promotion activity. Several of the constitutively deregulated genes have been associated with tumorigenesis (CDC25C, CEACAM6, TMPRSS2, XBP1, MYBL1, ABHD2, and CXCL12) and Wnt/β-Catenin signaling pathways (BAMBI, SIX1, IGFBP5, AES, and p21 WAF1 ). This information could be utilized for further mechanistic research and for devising optimized therapeutic strategies against human cancers

  4. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  5. Family members facilitating community re-integration and return to productivity following traumatic brain injury - motivations, roles and challenges.

    Science.gov (United States)

    Gagnon, Alicia; Lin, Jenny; Stergiou-Kita, Mary

    2016-01-01

    This study explores the experiences of family members in supporting community re-integration and return to productive occupations of the traumatic brain injury (TBI) survivor in order to: (i) describe family members' supportive roles, (ii) determine challenges family members experience in supporting the TBI survivor; and (iii) identify supports that family members require to maintain and enhance their roles. This qualitative descriptive study involved 14 interviews with immediate family members of TBI survivors. Data was analyzed using thematic analysis. Family members expressed strong motivation and engaged in six key roles to support TBI survivors: researcher, case manager, advocate, coach, activities of daily living (ADL)/instrumental ADLs and emotional supporter. Personal and family stressors and challenges navigating the health care system were perceived as challenges in meeting demands of their supportive roles. Stigma also presented a barrier to successful community and vocational re-integration. Subsequently, family members desired more education related to the functional implications of TBI, to be connected to health care and community resources, and sought a greater family-centred care approach. Family members require on-going counseling and community supports to prevent burnout and allow for their continued engagement in their supportive roles. Further education on how to navigate the health care system, access community programs and rights to workplace accommodation is also warranted. Family members are strongly motivated to support survivors' return to productive occupation following a traumatic brain injury, but require counseling and community support to enable their on-going engagement and prevent burnout. Family members can be further empowered through the implementation of family-centred care. Family members requested further education on the long-term functional implications of TBI, how to navigate the health care system, how to access community

  6. Nurses' views of forensic care in emergency departments and their attitudes, and involvement of family members.

    Science.gov (United States)

    Linnarsson, Josefin Rahmqvist; Benzein, Eva; Årestedt, Kristofer

    2015-01-01

    To describe Nurses' views of forensic care provided for victims of violence and their families in EDs, to identify factors associated with Nurses' attitudes towards families in care and to investigate if these attitudes were associated with the involvement of patients' families in care. Interpersonal violence has serious health consequences for individuals and family members. Emergency departments provide care for victims of violence, and nurses play a key role in forensic care. However, there is limited knowledge of their views and their involvement of family members. A cross-sectional design was used with a sample of all registered nurses (n = 867) in 28 emergency departments in Sweden. A self-report questionnaire, including the instrument Families' Importance in Nursing Care - Nurses' Attitudes, was used to collect data. Descriptive statistics, multiple linear regression and ordinal regression were used to analyse data. Four hundred and fifty-seven nurses completed the questionnaire (53%). Most nurses provided forensic care, but few had specific education for this task. Policy documents and routines existed for specific patient groups. Most nurses involved family members in care although education and policy documents rarely included them. Being a woman, policy documents and own experience of a critically ill family member were associated with a positive attitude towards family. A positive attitude towards family members was associated with involving patients' families in care. Many emergency department nurses provided forensic care without having specific education, and policy documents only concerned women and children. Nurses' positive attitude to family members was not reflected in policies or education. These results can inspire clinical forensic care interventions in emergency departments. Educational efforts for nurses and policies for all groups of victims of violence are needed. Emergency departments may need to rethink how family members are included

  7. Family Connections versus optimised treatment-as-usual for family members of individuals with borderline personality disorder: non-randomised controlled study.

    LENUS (Irish Health Repository)

    Flynn, Daniel

    2017-01-01

    Borderline personality disorder (BPD) is challenging for family members who are often required to fulfil multiple roles such as those of advocate, caregiver, coach and guardian. To date, two uncontrolled studies by the treatment developers suggest that Family Connections (FC) is an effective programme to support, educate and teach skills to family members of individuals with BPD. However, such studies have been limited by lack of comparison to other treatment approaches. This study aimed to compare the effectiveness of FC with an optimised treatment-as-usual (OTAU) programme for family members of individuals with BPD. A secondary aim was to introduce a long term follow-up to investigate if positive gains from the intervention would be maintained following programme completion.

  8. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  9. Radiation exposure to family members of patients with thyrotoxicosis treated with iodine-131

    International Nuclear Information System (INIS)

    Cappelen, Tone; Amundsen, Anne Lise; Kravdal, Gunnhild; Unhjem, Jan Frede; Foelling, Ivar

    2006-01-01

    The purpose of this study was twofold: (1) to measure the radiation exposure to family members of out-patients with thyrotoxicosis treated with radioiodine, 131 I, using the recommendations from the European Commission (EC) guidance and age-specific periods for behaviour restrictions; (2) to use the results to identify necessary restrictions to ensure recommended dose constraints. The study population comprised 76 family members (46 adults and 30 children below the age of 18) of 42 patients. The patients were treated with an average activity of 417 MBq (range 260-600 MBq). They received oral and written EC recommendations about behaviour restrictions (translated into Norwegian). On the day of treatment we repeated the oral instructions to the patient and an adult family member. The time periods for restrictions were 14 days for children aged 0-10 years, 7 days for persons aged 11-59 years and 3 days for persons aged 60 years and older. Family members wore a thermoluminescent dosimeter (TLD) on each wrist day and night for 2 weeks. The doses received were adjusted to give an estimate of the expected values if the TLDs had been worn indefinitely. Radiation doses well below the recommended dose constraints were measured for all adult family members and children, except one 2-year-old child; in the latter case the mother probably did not comply with the instructions given. The radiation dose to family members of thyrotoxic patients treated with up to 600 MBq of radioiodine is well below recommended dose constraints if EC instructions are given and compliance is adequate. The duration of restrictions for various age groups used in this study may be considered when establishing guidelines in Norway. (orig.)

  10. Assessing the place of neurobiological explanations in accounts of a family member's addiction.

    Science.gov (United States)

    Meurk, Carla; Fraser, Doug; Weier, Megan; Lucke, Jayne; Carter, Adrian; Hall, Wayne

    2016-07-01

    The brain disease model of addiction posits that addiction is a persistent form of neural dysfunction produced by chronic drug use, which makes it difficult for addicted persons to become and remain abstinent. As part of an anticipatory policy analysis of addiction neuroscience, we engaged family members of addicted individuals to assess their views on the place and utility of brain-based accounts of addiction. Fifteen in-depth qualitative interviews were conducted and used to develop a quantitative online survey that was completed by 55 family members. This article reports responses on what addiction is and how it is caused and responses to explanations of the brain disease model of addiction. Participants gave multiple reasons for their family members developing an addiction and there was no single dominant belief about the best way to describe addiction. Participants emphasised the importance of both scientific and non-scientific perspectives on addiction by providing multifactorial explanations of their family members' addictions. Most family members acknowledged that repeated drug use can cause changes to the brain, but they varied in their reactions to labelling addiction a 'brain disease'. They believed that understanding addiction, and how it is caused, could help them support their addicted relative. Participants' beliefs about neurobiological information and the brain disease model of addiction appeared to be driven by empathetic, utilitarian considerations rather than rationalist ones. We discuss the importance of providing information about the nature and causes of addiction. [Meurk C, Fraser D, Weier M, Lucke J, Carter A, Hall W. Assessing the place of neurobiological explanations in accounts of a family member's addiction. Drug Alcohol Rev 2016;35:461-469]. © 2015 Australasian Professional Society on Alcohol and other Drugs.

  11. Caregiving for Dementia in Family Members: Caregiving Burden and Prospects for Effective Intervention.

    Science.gov (United States)

    Maiden, Robert J.; And Others

    Caring for a family member with dementia is a major source of stress for the caregiver. To assess the impact of caring for an impaired family member and to evaluate the effectiveness of intervention programs, 34 caregivers of relatives with dementia completed an amended form of the Philadelphia Geriatric Center's Caregiver Survey and two…

  12. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

    Science.gov (United States)

    Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

    2012-04-01

    treatments even though at least one stress-related cis-element was identified in their promoter regions. In conclusion, our comparative analysis provides an insight into the evolution and expression patterns in various tissues and in response to auxin or stresses of the Aux/IAA family members in tomato, which will provide a very useful reference for cloning and functional analysis of each member of AUX/IAA gene family in Solanaceae crops.

  13. A novel heterozygous mutation in the Indian hedgehog gene (IHH) is associated with brachydactyly type A1 in a Chinese family.

    Science.gov (United States)

    Liu, Mugen; Wang, Xu; Cai, Zhou; Tang, Zhaohui; Cao, Kangsheng; Liang, Bo; Ren, Xiang; Liu, Jing Yu; Wang, Qing K

    2006-01-01

    Brachydactyly type A1 (BDA1) is caused by mutations in the Indian hedgehog gene, IHH, on chromosome 2q35-36. In this study, a large five-generation Chinese family with BDA1 was identified and characterized. All affected family members demonstrated significant homogeneous phenotype and some unique clinical features different from those associated with the reported BDA1 mutations in IHH. Linkage analysis showed that the BDA1 gene in the family was linked to marker D2S126 close to IHH with a LOD score of 4.74 at a recombination fraction of 0. DNA sequence analysis revealed a heterozygous C to T transition at nucleotide 461 of IHH, resulting in a novel T154I substitution. The T154I mutation co-segregated with all affected individuals in the family, and was not present in normal family members or 200 normal controls. These results expand the spectrum of clinical phenotype associated with IHH mutations.

  14. Comprehensive Analysis of ETS Family Members in Melanoma by Fluorescence In Situ Hybridization Reveals Recurrent ETV1 Amplification

    Science.gov (United States)

    Mehra, Rohit; Dhanasekaran, Saravana M; Palanisamy, Nallasivam; Vats, Pankaj; Cao, Xuhong; Kim, Jung H; Kim, David SL; Johnson, Timothy; Fullen, Douglas R; Chinnaiyan, Arul M

    2013-01-01

    E26 transformation-specific (ETS) transcription factors are known to be involved in gene aberrations in various malignancies including prostate cancer; however, their role in melanoma oncogenesis has yet to be fully explored. We have completed a comprehensive fluorescence in situ hybridization (FISH)-based screen for all 27 members of the ETS transcription factor family on two melanoma tissue microarrays, representing 223 melanomas, 10 nevi, and 5 normal skin tissues. None of the melanoma cases demonstrated ETS fusions; however, 6 of 114 (5.3%) melanomas were amplified for ETV1 using a break-apart FISH probe. For the six positive cases, locus-controlled FISH probes revealed that two of six cases were amplified for the ETV1 region, whereas four cases showed copy gains of the entire chromosome 7. The remaining 26 ETS family members showed no chromosomal aberrations by FISH. Quantitative polymerase chain reaction showed an average 3.4-fold (P value = .00218) increased expression of ETV1 in melanomas, including the FISH ETV1-amplified cases, when compared to other malignancies (prostate, breast, and bladder carcinomas). These data suggest that a subset of melanomas overexpresses ETV1 and amplification of ETV1 may be one mechanism for achieving high gene expression. PMID:23908683

  15. Home support workers perceptions of family members of their older clients: a qualitative study.

    Science.gov (United States)

    Sims-Gould, Joanie; Byrne, Kerry; Tong, Catherine; Martin-Matthews, Anne

    2015-12-12

    Health care discourse is replete with references to building partnerships between formal and informal care systems of support, particularly in community and home based health care. Little work has been done to examine the relationship between home health care workers and family caregivers of older clients. The purpose of this study is to examine home support workers' (HSWs) perceptions of their interactions with their clients' family members. The goal of this research is to improve client care and better connect formal and informal care systems. A qualitative study, using in-depth interviews was conducted with 118 home support workers in British Columbia, Canada. Framework analysis was used and a number of strategies were employed to ensure rigor including: memo writing and analysis meetings. Interviews were transcribed verbatim and sent to a professional transcription agency. Nvivo 10 software was used to manage the data. Interactions between HSWs and family members are characterized in terms both of complementary labour (family members providing informational and instrumental support to HSWs), and disrupted labour (family members creating emotion work and additional instrumental work for HSWs). Two factors, the care plan and empathic awareness, further impact the relationship between HSWs and family caregivers. HSWs and family members work to support one another instrumentally and emotionally through interdependent interactions and empathic awareness. Organizational Care Plans that are too rigid or limited in their scope are key factors constraining interactions.

  16. Determining the satisfaction levels of the family members of patients with advanced-stage cancer.

    Science.gov (United States)

    Ozcelik, Hanife; Cakmak, Deniz Ezgi; Fadiloglu, Cicek; Yildirim, Yasemin; Uslu, Ruchan

    2015-06-01

    The objective of our study was to determine the satisfaction levels of family members of patients with advanced-stage cancer. This descriptive study was conducted in the palliative care and medical oncology clinics of a university hospital in the province of Izmir between April of 2011 and January of 2012. The study sample consisted of a total of 145 family members, who were selected from among the family members of patients with advanced-stage cancer receiving palliative treatment. The study data were obtained using the Patient Description Form and Family Satisfaction Scale during face-to-face interviews with patients. Some 67% of patients were female and 33% male, 70% were married, 35% were high school graduates, and 34.5% were housewives. The average total family satisfaction score was 76.87 ± 1.14, and the average scores for the component variables were as follows: information giving 74.37 ± 1.28, availability of care 78.40 ± 1.17, physical care 78.99 ± 1.09, and psychosocial care 74.52 ± 1.30. We found a relationship between the level of satisfaction of family members and (1) gender, (2) occupation, (3) presence of someone supporting the care, and (4) possession of sufficient information about the patient (p Satisfaction levels of participants were determined to be high. We found that family member satisfaction levels were affected by gender and occupation, the existence of someone supporting the care, and possession of sufficient information about the patient.

  17. Caregiver burden in Danish family members of patients with severe brain injury

    DEFF Research Database (Denmark)

    Doser, Karoline; Norup, Anne

    2016-01-01

    OBJECTIVE: To investigate caregiver burden and factors associated with caregiver burden among family members of patients with severe brain injury in the chronic phase. Additionally, the study aimed at investigating differences in burden between parents and spouses. METHODS: Forty-four Danish...... caregivers of patients with severe brain injury were contacted 3-6 years post-injury and asked to complete a measure of caregiver burden. RESULTS: Medium, high and low levels of burden were observed in 45%, 16% and 39% of family members, respectively. Higher burden was seen in caregivers of patients...... with more severe injuries, who spent more time on caregiving and reported more unmet needs. Overall, spouses spent significantly more time taking care of their family member than parents and reported higher levels of burden. CONCLUSIONS: The findings emphasized the continuing consequences of brain injury...

  18. A large and functionally diverse family of Fad2 genes in safflower (Carthamus tinctorius L.

    Directory of Open Access Journals (Sweden)

    Cao Shijiang

    2013-01-01

    Full Text Available Abstract Background The application and nutritional value of vegetable oil is highly dependent on its fatty acid composition, especially the relative proportion of its two major fatty acids, i.e oleic acid and linoleic acid. Microsomal oleoyl phosphatidylcholine desaturase encoded by FAD2 gene is known to introduce a double bond at the Δ12 position of an oleic acid on phosphatidylcholine and convert it to linoleic acid. The known plant FAD2 enzymes are encoded by small gene families consisting of 1-4 members. In addition to the classic oleate Δ12-desaturation activity, functional variants of FAD2 that are capable of undertaking additional or alternative acyl modifications have also been reported in a limited number of plant species. In this study, our objective was to identify FAD2 genes from safflower and analyse their differential expression profile and potentially diversified functionality. Results We report here the characterization and functional expression of an exceptionally large FAD2 gene family from safflower, and the temporal and spatial expression profiles of these genes as revealed through Real-Time quantitative PCR. The diversified functionalities of some of the safflower FAD2 gene family members were demonstrated by ectopic expression in yeast and transient expression in Nicotiana benthamiana leaves. CtFAD2-1 and CtFAD2-10 were demonstrated to be oleate desaturases specifically expressed in developing seeds and flower head, respectively, while CtFAD2-2 appears to have relatively low oleate desaturation activity throughout the plant. CtFAD2-5 and CtFAD2-8 are specifically expressed in root tissues, while CtFAD2-3, 4, 6, 7 are mostly expressed in the cotyledons and hypocotyls in young safflower seedlings. CtFAD2-9 was found to encode a novel desaturase operating on C16:1 substrate. CtFAD2-11 is a tri-functional enzyme able to introduce a carbon double bond in either cis or trans configuration, or a carbon triple (acetylenic bond

  19. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  20. Identification of SACE_7040, a member of TetR family related to the morphological differentiation of Saccharopolyspora erythraea.

    Science.gov (United States)

    Han, Shu; Song, Ping; Ren, Ting; Huang, Xunduan; Cao, Cheng; Zhang, Buchang

    2011-08-01

    SACE_7040 is presumed to be a member of the TetR family of transcriptional regulators in Saccharopolyspora erythraea, but its biological function is unknown. It was shown that the SACE_7040 gene knockout mutant formed aerial mycelium earlier than its original strain, and this phenotype could be restored by complementation of a single copy of SACE_7040 gene, demonstrating that SACE_7040 is an important regulator of the morphological differentiation of Sac. erythraea. When SACE_7040 gene was disrupted in the bldD mutant, we intriguingly found that the defect in aerial development exhibited by the bldD mutant could be overcome, suggesting a crosstalk between SACE_7040 and BldD in Sac. erythraea morphogenesis. These findings provide novel insights toward the Sac. erythraea developmental biology.

  1. Distribution of transglutaminase family members in mouse whole body sections.

    Science.gov (United States)

    Tatsukawa, Hideki; Abe, Natsumi; Ohashi, Shintaro; Hitomi, Kiyotaka

    2015-11-27

    Transglutaminases (TGs) comprise a protein family in which the members catalyze the formation of isopeptide bonds between glutamine and lysine residues in various proteins. Eight enzymes have been identified and designated as factor XIII (FXIII) and TG1-7. Expression studies of four major members, i.e., FXIII, TG1, TG2, and TG3, have been performed in a relatively large number of mammalian tissues in comparison with those on the other isozymes. The structural and biochemical characteristics of these individual isozymes and expression analyses of TG family in some tissue extracts have been reported, but there have been no simultaneous comparative analyses of both their mRNA and protein expression patterns in tissues distributions. Thus, we developed novel experimental systems for in situ hybridization using cryofilm attached to whole body sections of neonatal mice, thereby obtaining data regarding the tissue distributions of the major TG isozymes. In this study, we performed the first detailed comparative analysis of the mRNA and protein distribution studies of TG family members in a wide range of mouse tissues. These data will be helpful for elucidating the unknown physiological and pathological functions of TGs. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. A qualitative study on communication between nursing students and the family members of patients.

    Science.gov (United States)

    Chan, Zenobia C Y

    2017-12-01

    When caring for a family as a unit, it is as crucial to communicate with the family members of a patient as it is with the patient. However, there is a lack of research on the views of nursing students on communicating with the family members of patients, and little has been mentioned in the nursing curriculum on this topic. The aim of this study was to explore nursing students' experiences of communicating with the family members of patients. A qualitative descriptive study. A total of 42 nursing students (21 undergraduate year-two students and 21 were master's year-one students) from one school of nursing in Hong Kong participated in in-depth individual interviews. Content analysis was adopted. The trustworthiness of this study was ensured by enhancing its credibility, confirmability, and dependability. Two main themes were discerned. The first, "inspirations gained from nursing student-family communication", included the following sub-themes: (a) responding to enquiries clearly, (b) avoiding sensitive topics, (c) listening to the patient's family, and (d) sharing one's own experiences. The second, "emotions aroused from nursing student-family communication", had the following sub-themes: (a) happiness, (b) anger, (c) sadness, and (d) anxiety. More studies on the perspectives of nursing students on communicating with family members should be conducted, to strengthen the contents and learning outcomes of nursing student-family communication in the existing nursing curriculum. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts.

    Science.gov (United States)

    Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T

    2015-11-27

    Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. In our own voice-family companion: reducing self-stigma of family members of persons with serious mental illness.

    Science.gov (United States)

    Perlick, Deborah A; Nelson, Ann H; Mattias, Kate; Selzer, James; Kalvin, Carla; Wilber, Charles H; Huntington, Brittney; Holman, Caroline S; Corrigan, Patrick W

    2011-12-01

    This article reports preliminary findings from a novel, family peer-based intervention designed to reduce self-stigma among family members of people with serious mental illness. A total of 158 primary caregivers of patients with schizophrenia were recruited from a large urban mental health facility (93 caregivers) or from a family and consumer advocacy organization (65 caregivers). Caregivers (N=122) who reported they perceived at least a moderate level of mental illness-related stigma were evaluated on measures of self-stigma, withdrawal, secrecy, anxiety, and social comparison and randomly assigned to receive one of two, one-session group interventions: a peer-led intervention (In Our Own Voice-Family Companion [IOOV-FC]) designed to stimulate group discussion or a clinician-led family education session, which delivered information about mental illness in a structured, didactic format. IOOV-FC consisted of playing a videotape of family members who describe their experiences coping with stigma, which was followed by a discussion led by two family peers who modeled sharing their own experiences and facilitated group sharing. Of 24 family members and ten consumers, 96% rated the videotape above a predetermined acceptability threshold on a 19-item scale assessing cultural sensitivity, respect for different stakeholders, relevance of content, and technical quality (α=.92). Caregivers receiving IOOV-FC with low to moderate pretreatment anxiety reported a substantial reduction in self-stigma (effect size=.50) relative to those receiving clinician-led family education (p=.017) as well as significant reductions in secrecy (p=.031). Peer-led group interventions may be more effective in reducing family self-stigma than clinician-led education, at least for persons reporting experiencing low to moderate anxiety levels on a standard questionnaire

  5. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  6. A Comparative Study on the Meaning in Life of Patients with Cancer and Their Family Members.

    Science.gov (United States)

    Hassankhani, Hadi; Soheili, Amin; Hosseinpour, Issa; Eivazi Ziaei, Jamal; Nahamin, Mina

    2017-12-01

    Introduction: The overwhelming effects of cancer could be catastrophic for the patients and their family members, putting them at risk of experiencing uncertainty, loss, and an interruption in life. Also, it can influence their sense of meaning, a fundamental need equated with the purpose in life. Accordingly, this study aimed to compare the meaning in life (MiL) of patients with cancer and their family members. Methods: This descriptive comparative study was conducted on 400 patients with cancer and their family members admitted to university hospitals in Tabriz and Ardebil provinces, Iran. The participants were sampled conveniently and the Life Evaluation Questionnaire (LEQ) were used for collecting data analyzed through descriptive and inferential statistics in SPSS ver. 13 Software. Results: The mean score for the MiL of the patients with cancer and their family members was 119 (16.92) and 146.2 (17.07), respectively. There was a significant difference between patients with cancer and their family members in terms of MiL. Conclusion: The MiL of patients with cancer is lower than that of their family members, which indicates the need for further attention to the psychological processes and their modification in Iranian healthcare systems.

  7. Truncating mutation in the NHS gene: phenotypic heterogeneity of Nance-Horan syndrome in an asian Indian family.

    Science.gov (United States)

    Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy

    2005-01-01

    A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.

  8. Family members' needs and experiences of driving disruption over time following an acquired brain injury: an evolving issue.

    Science.gov (United States)

    Liang, Phyllis; Gustafsson, Louise; Liddle, Jacki; Fleming, Jennifer

    2017-07-01

    Family members often assume the role of driver for individuals who are not driving post-acquired brain injury (ABI). Given that return to driving can be unpredictable and uncertain, the impact of driving disruption on family members may vary at different stages post-injury. This study aims to understand the needs and experiences of family members over time during driving disruption following an ABI. A qualitative prospective longitudinal research design was used with semi-structured interviews at recruitment to study, 3 and 6 months later. Fourteen family members completed 41 interviews. The longitudinal data revealed four phases of driving disruption: (1) Wait and see, (2) Holding onto a quick fix, (3) No way out, and (4) Resolution and adjustment. The phases described a process of building tension and a need for support and resolution over time. Holding onto a quick fix is a pivotal phase whereby supports, such as engagement in realistic goal setting, are essential to facilitate family members' resolution of driving disruption issues. Family members who see no way out might not actively seek help and these points to a need for long-term and regular follow-ups. Future research can explore ways to support family members at these key times. Implications for rehabilitation Health professionals need to facilitate the process of fostering hope in family members to set realistic expectations of return to driving and the duration of driving disruption. It is necessary to follow-up with family members even years after ABI as the issue of driving disruption could escalate to be a crisis and family members might not actively seek help. Health professionals can consider both practical support for facilitating transport and emotional support when addressing the issue of driving disruption with family members.

  9. Molecular cloning of a Candida albicans gene (SSB1) coding for a protein related to the Hsp70 family.

    Science.gov (United States)

    Maneu, V; Cervera, A M; Martinez, J P; Gozalbo, D

    1997-06-15

    We have cloned and sequenced a Candida albicans gene (SSB1) encoding a potential member of the heat-shock protein seventy (hsp70) family. The protein encoded by this gene contains 613 amino acids and shows a high degree (85%) of sequence identity to the ssb subfamily (ssb1 and ssb2) of the Saccharomyces cerevisiae hsp70 family. The transcribed mRNA (2.1 kb) is present in similar amounts both in yeast and germ tube cells of C. albicans.

  10. Genome-wide analysis of the SBP-box gene family in Chinese cabbage (Brassica rapa subsp. pekinensis).

    Science.gov (United States)

    Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin

    2015-11-01

    The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.

  11. Genome-wide comparative analysis of papain-like cysteine protease family genes in castor bean and physic nut.

    Science.gov (United States)

    Zou, Zhi; Huang, Qixing; Xie, Guishui; Yang, Lifu

    2018-01-10

    Papain-like cysteine proteases (PLCPs) are a class of proteolytic enzymes involved in many plant processes. Compared with the extensive research in Arabidopsis thaliana, little is known in castor bean (Ricinus communis) and physic nut (Jatropha curcas), two Euphorbiaceous plants without any recent whole-genome duplication. In this study, a total of 26 or 23 PLCP genes were identified from the genomes of castor bean and physic nut respectively, which can be divided into nine subfamilies based on the phylogenetic analysis: RD21, CEP, XCP, XBCP3, THI, SAG12, RD19, ALP and CTB. Although most of them harbor orthologs in Arabidopsis, several members in subfamilies RD21, CEP, XBCP3 and SAG12 form new groups or subgroups as observed in other species, suggesting specific gene loss occurred in Arabidopsis. Recent gene duplicates were also identified in these two species, but they are limited to the SAG12 subfamily and were all derived from local duplication. Expression profiling revealed diverse patterns of different family members over various tissues. Furthermore, the evolution characteristics of PLCP genes were also compared and discussed. Our findings provide a useful reference to characterize PLCP genes and investigate the family evolution in Euphorbiaceae and species beyond.

  12. Identification of TPS family members in apple (Malus x domestica Borkh.) and the effect of sucrose sprays on TPS expression and floral induction.

    Science.gov (United States)

    Du, Lisha; Qi, Siyan; Ma, Juanjuan; Xing, Libo; Fan, Sheng; Zhang, Songwen; Li, Youmei; Shen, Yawen; Zhang, Dong; Han, Mingyu

    2017-11-01

    Trehalose (α-D-glucopyranosyl α-D-glucopyranoside) is a non-reducing disaccharide that serves as a carbon source and stress protectant in apple trees. Trehalose-6-phosphate (T6P) is the biosynthetic precursor of trehalose. It functions as a crucial signaling molecule involved in the regulation of floral induction, and is closely related to sucrose. Trehalose-6-phosphate synthase (TPS) family members are pivotal components of the T6P biosynthetic pathway. The present study identified 13 apple TPS family members and characterized their expression patterns in different tissues and in response to exogenous application of sucrose during floral induction. 'Fuji' apple trees were sprayed with sucrose prior to the onset of floral induction. Bud growth, flowering rate, and endogenous sugar levels were then monitored. The expression of genes associated with sucrose metabolism and flowering were also characterized by RT-quantitative PCR. Results revealed that sucrose applications significantly improved flower production and increased bud size and fresh weight, as well as the sucrose content in buds and leaves. Furthermore, the expression of MdTPS1, 2, 4, 10, and 11 was rapidly and significantly up-regulated in response to the sucrose treatments. In addition, the expression levels of flowering-related genes (e.g., SPL genes, FT1, and AP1) also increased in response to the sucrose sprays. In summary, apple TPS family members were identified that may influence the regulation of floral induction and other responses to sucrose. The relationship between sucrose and T6P or TPS during the regulation of floral induction in apple trees is discussed. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  13. Family members' involvement in psychiatric care: experiences of the healthcare professionals' approach and feeling of alienation.

    Science.gov (United States)

    Ewertzon, M; Lützén, K; Svensson, E; Andershed, B

    2010-06-01

    The involvement of family members in psychiatric care is important for the recovery of persons with psychotic disorders and subsequently reduces the burden on the family. Earlier qualitative studies suggest that the participation of family members can be limited by how they experience the professionals' approach, which suggests a connection to the concept of alienation. Thus, the aim of this study was in a national sample investigate family members' experiences of the psychiatric health care professionals' approach. Data were collected by the Family Involvement and Alienation Questionnaire. The median level and quartiles were used to describe the distributions and data were analysed with non-parametric statistical methods. Seventy family members of persons receiving psychiatric care participated in the study. The results indicate that a majority of the participants respond that they have experiencing a negative approach from the professionals, indicating lack of confirmation and cooperation. The results also indicate that a majority of the participants felt powerlessness and social isolation in the care being provided, indicating feelings of alienation. A significant but weak association was found between the family members' experiences of the professionals' approach and their feelings of alienation.

  14. Impact of prior ICU experience on ICU patient family members' psychological distress: A descriptive study.

    Science.gov (United States)

    Lewis, Chrystal L; Taylor, Jessica Z

    2017-12-01

    To determine if current levels of anxiety, depression and acute stress disorder symptoms differ significantly among family members of intensive-care-unit patients depending upon previous intensive-care experience. This study used a prospective, descriptive study design. Family members (N=127) from patients admitted within a 72-hour timeframe to the medical, surgical, cardiac and neurological intensive care units were recruited from waiting rooms at a medium-sized community hospital in the Southeastern United States. Participants completed the Hospital Anxiety and Depression Scale, the Impact of Events Scale-Revised, the Acute Stress Disorder Scale and a demographic questionnaire. A multivariate analysis revealed that family members of intensive-care-unit patients with a prior intensive-care experience within the past two years (n=56) were significantly more likely to report anxiety, depression and acute stress symptoms, Λ=0.92, F [4122]=2.70, p=0.034, partial η 2 =0.08, observed power=0.74. Results of this study show that family members' psychological distress is higher with previous familial or personal intensive-care experience. Nurses need to assess for psychological distress in ICU family members and identify those who could benefit from additional support services provided in collaboration with multidisciplinary support professionals. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  16. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  17. Disruption of the APC gene by t(5;7) translocation in a Turcot family.

    Science.gov (United States)

    Sahnane, Nora; Bernasconi, Barbara; Carnevali, Ileana; Furlan, Daniela; Viel, Alessandra; Sessa, Fausto; Tibiletti, Maria Grazia

    2016-03-01

    Turcot syndrome (TS) refers to the combination of colorectal polyps and primary tumours of the central nervous system. TS is a heterogeneous genetic condition due to APC and/or mismatch repair germline mutations. When APC is involved the vast majority of mutations are truncating, but in approximately 20%-30% of patients with familial polyposis no germline mutation can be found. A 30-year-old Caucasian woman with a positive pedigree for TS was referred to our Genetic Counselling Service. She was negative for APC and MUTYH but showed a reciprocal balanced translocation t(5;7)(q22;p15) at chromosome analysis. FISH analysis using specific BAC probes demonstrated that 5q22 breakpoint disrupted the APC gene. Transcript analysis by MLPA and digital PCR revealed that the cytogenetic rearrangement involving the 3' end of the APC gene caused a defective expression of a truncated transcript. This result allowed cytogenetic analysis to be offered to all the other family members and segregation analysis clearly demonstrated that all the carriers were affected, whereas non-carriers did not have the polyposis. A cytogenetic approach permitted the identification of the mutation-causing disease in this family, and the segregation analysis together with the transcript study supported the pathogenetic role of this mutation. Karyotype analysis was used as a predictive test in all members of this family. This family suggests that clinically positive TS and FAP cases, which test negative with standard molecular analysis, could be easily and cost-effectively resolved by a classical and molecular cytogenetic approach. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. In Asian americans, is having a family member diagnosed with cancer associated with fatalistic beliefs?

    Directory of Open Access Journals (Sweden)

    Carolee Polek

    2016-01-01

    Full Text Available Objective: Cancer can evoke long-held cultural beliefs which either facilitate or impede efforts to expand the health literacy of families. Among these beliefs is fatalism which holds that controlling ones′ outcome is not possible, and that ones′ outcome is predestined. Some fatalistic beliefs are broadly held within the Asian American (AA community and may be challenged or reinforced by the experience of having a family member diagnosed with cancer. This study evaluated the relationship between having a family member diagnosed with cancer and selected demographics in AAs on fatalistic beliefs. Methods: Data from 519 AA subjects from the Centers for Disease Control and Prevention Health Information Trends Survey were used to complete a secondary analysis. Descriptive statistics characterize fatalistic beliefs. Four models using four questions assessed fatalistic beliefs as dependent variables and independent variables of having or not having a family member diagnosed with cancer, completing college or not, sex, and age were assessed using ordinal regression. Results: All of the fatalistic beliefs examined were endorsed by large portions of the subjects. When considering the role of being exposed to having a family member with cancer, it was associated with an increase in the likelihood in a belief that one is likely to get cancer, and everything can cause cancer. Being exposed to a family member diagnosed with cancer was not significantly associated with believing, there was little one could do to control their cancer risk. This belief was broadly rejected. While the belief that there are so many different recommendations about preventing cancer, it is hard to know what to do, was broadly endorsed and not associated with having a family member diagnosed with cancer. Conclusions: The major practice implications within oncology nursing suggest the importance in assessing cancer health literacy and providing corrective knowledge in families

  19. COMBINING WORK WITH CARING FOR ELDERLY FAMILY MEMBER IN POLAND (CHOSEN ISSUES

    Directory of Open Access Journals (Sweden)

    Lukasz Jurek

    2016-07-01

    Full Text Available The problem of combining work with caring for elderly family members is becoming an increasingly important matter due to demographic (population ageing and social (increasing economic activity of women changes that are currently in progress. The aim of the article is to present selected issues related to the professional situation of people taking care for their elderly family members. The primary focus of the study is reasons for not working of non-working caregivers, and professional problems of working caregivers

  20. Stromal-dependent tumor promotion by MIF family members.

    Science.gov (United States)

    Mitchell, Robert A; Yaddanapudi, Kavitha

    2014-12-01

    Solid tumors are composed of a heterogeneous population of cells that interact with each other and with soluble and insoluble factors that, when combined, strongly influence the relative proliferation, differentiation, motility, matrix remodeling, metabolism and microvessel density of malignant lesions. One family of soluble factors that is becoming increasingly associated with pro-tumoral phenotypes within tumor microenvironments is that of the migration inhibitory factor family which includes its namesake, MIF, and its only known family member, D-dopachrome tautomerase (D-DT). This review seeks to highlight our current understanding of the relative contributions of a variety of immune and non-immune tumor stromal cell populations and, within those contexts, will summarize the literature associated with MIF and/or D-DT. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Evolution of the vertebrate Pax4/6 class of genes with focus on its novel member, the Pax10 gene.

    Science.gov (United States)

    Feiner, Nathalie; Meyer, Axel; Kuraku, Shigehiro

    2014-06-19

    The members of the paired box (Pax) family regulate key developmental pathways in many metazoans as tissue-specific transcription factors. Vertebrate genomes typically possess nine Pax genes (Pax1-9), which are derived from four proto-Pax genes in the vertebrate ancestor that were later expanded through the so-called two-round (2R) whole-genome duplication. A recent study proposed that pax6a genes of a subset of teleost fishes (namely, acanthopterygians) are remnants of a paralog generated in the 2R genome duplication, to be renamed pax6.3, and reported one more group of vertebrate Pax genes (Pax6.2), most closely related to the Pax4/6 class. We propose to designate this new member Pax10 instead and reconstruct the evolutionary history of the Pax4/6/10 class with solid phylogenetic evidence. Our synteny analysis showed that Pax4, -6, and -10 originated in the 2R genome duplications early in vertebrate evolution. The phylogenetic analyses of relationships between teleost pax6a and other Pax4, -6, and -10 genes, however, do not support the proposed hypothesis of an ancient origin of the acanthopterygian pax6a genes in the 2R genome duplication. Instead, we confirmed the traditional scenario that the acanthopterygian pax6a is derived from the more recent teleost-specific genome duplication. Notably, Pax6 is present in all vertebrates surveyed to date, whereas Pax4 and -10 were lost multiple times in independent vertebrate lineages, likely because of their restricted expression patterns: Among Pax6-positive domains, Pax10 has retained expression in the adult retina alone, which we documented through in situ hybridization and quantitative reverse transcription polymerase chain reaction experiments on zebrafish, Xenopus, and anole lizard. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Members of the LBD Family of Transcription Factors Repress Anthocyanin Synthesis and Affect Additional Nitrogen Responses in Arabidopsis

    OpenAIRE

    Rubin, G.; Tohge, T.; Matsuda, F.; Saito, K.; Scheible, W.

    2009-01-01

    Nitrogen (N) and nitrate (NO3-) per se regulate many aspects of plant metabolism, growth, and development. N/NO3- also suppresses parts of secondary metabolism, including anthocyanin synthesis. Molecular components for this repression are unknown. We report that three N/NO3--induced members of the LATERAL ORGAN BOUNDARY DOMAIN (LBD) gene family of transcription factors (LBD37, LBD38, and LBD39) act as negative regulators of anthocyanin biosynthesis in Arabidopsis thaliana. Overexpression of e...

  3. Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.

    Science.gov (United States)

    Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin

    2018-03-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.

  4. Osteochondritis Dissecans Lesions in Family Members: Does a Positive Family History Impact Phenotypic Potency?

    Science.gov (United States)

    Gornitzky, Alex L; Mistovich, R Justin; Atuahuene, Brittany; Storey, Eileen P; Ganley, Theodore J

    2017-06-01

    Although repetitive microtrauma and athletic overuse patterns are most commonly associated with osteochondritis dissecans (OCD), recent studies have identified a potential genetic predisposition for OCD. Several case series have documented family pedigrees that support autosomal-dominant inheritance, but the families in these studies were all selected as a result of unique histories that may not accurately represent OCD inheritance patterns at large. Because there has been little investigation beyond these case reports, we aimed to describe a broader, more representative pattern of OCD inheritance applicable to all affected patients. (1) What proportion of patients treated for OCD of the knee have one or more immediate and/or extended family members with a history of OCD lesions? (2) Do patients with more phenotypically potent lesions, which we defined as patients with bilateral OCD lesions or patients who have undergone multiple procedures for OCD, have a higher frequency of affected relatives than those with less potent lesions? This retrospective study queried patient databases, diagnosis codes (International Classification of Diseases, 9th Revision), and surgical logs at a regional, tertiary care children's hospital to identify all patients treated over a 10-year period (March 2004-March 2014) by the senior author for OCD of the knee. All patients aged 0-18 years at the time of diagnosis were included. At our institution, patients with intact lesions are treated with a trial of conservative therapy; conversely, patients with a break in the articular cartilage and/or loose fragments of bone/cartilage are treated surgically. There were no OCD-specific contraindications to surgery. This search identified 543 patients. After patient identification, a questionnaire was designed that asked for the number, age, and gender of all immediate family members and the history of OCD lesions in any family member (immediate or extended). For all positive family members

  5. Repair of DNA damage in the human metallothionein gene family

    International Nuclear Information System (INIS)

    Leadon, S.A.; Snowden, M.M.

    1987-01-01

    In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab

  6. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  7. Comparative genomics of CytR, an unusual member of the LacI family of transcription factors.

    Directory of Open Access Journals (Sweden)

    Natalia V Sernova

    Full Text Available CytR is a transcription regulator from the LacI family, present in some gamma-proteobacteria including Escherichia coli and known not only for its cellular role, control of transport and utilization of nucleosides, but for a number of unusual structural properties. The present study addressed three related problems: structure of CytR-binding sites and motifs, their evolutionary conservation, and identification of new members of the CytR regulon. While the majority of CytR-binding sites are imperfect inverted repeats situated between binding sites for another transcription factor, CRP, other architectures were observed, in particular, direct repeats. While the similarity between sites for different genes in one genome is rather low, and hence the consensus motif is weak, there is high conservation of orthologous sites in different genomes (mainly in the Enterobacteriales arguing for the presence of specific CytR-DNA contacts. On larger evolutionary distances candidate CytR sites may migrate but the approximate distance between flanking CRP sites tends to be conserved, which demonstrates that the overall structure of the CRP-CytR-DNA complex is gene-specific. The analysis yielded candidate CytR-binding sites for orthologs of known regulon members in less studied genomes of the Enterobacteriales and Vibrionales and identified a new candidate member of the CytR regulon, encoding a transporter named NupT (YcdZ.

  8. Genome-wide analysis and identification of cytokinin oxidase/dehydrogenase (CKX gene family in foxtail millet (Setaria italica

    Directory of Open Access Journals (Sweden)

    Yuange Wang

    2014-08-01

    Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC.1.5.99.12 regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.

  9. Understanding Response Rates to Surveys About Family Members' Psychological Symptoms After Patients' Critical Illness.

    Science.gov (United States)

    Long, Ann C; Downey, Lois; Engelberg, Ruth A; Nielsen, Elizabeth; Ciechanowski, Paul; Curtis, J Randall

    2017-07-01

    Achieving adequate response rates from family members of critically ill patients can be challenging, especially when assessing psychological symptoms. To identify factors associated with completion of surveys about psychological symptoms among family members of critically ill patients. Using data from a randomized trial of an intervention to improve communication between clinicians and families of critically ill patients, we examined patient-level and family-level predictors of the return of usable surveys at baseline, three months, and six months (n = 181, 171, and 155, respectively). Family-level predictors included baseline symptoms of psychological distress, decisional independence preference, and attachment style. We hypothesized that family with fewer symptoms of psychological distress, a preference for less decisional independence, and secure attachment style would be more likely to return questionnaires. We identified several predictors of the return of usable questionnaires. Better self-assessed family member health status was associated with a higher likelihood and stronger agreement with a support-seeking attachment style with a lower likelihood, of obtaining usable baseline surveys. At three months, family-level predictors of return of usable surveys included having usable baseline surveys, status as the patient's legal next of kin, and stronger agreement with a secure attachment style. The only predictor of receipt of surveys at six months was the presence of usable surveys at three months. We identified several predictors of the receipt of surveys assessing psychological symptoms in family of critically ill patients, including family member health status and attachment style. Using these characteristics to inform follow-up mailings and reminders may enhance response rates. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

  10. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  11. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

    Science.gov (United States)

    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

    2012-01-01

    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

  12. Low-income families' perceptions on the use of drugs by one of their members.

    Science.gov (United States)

    Martins, Mayra; Santos, Manoel Antonio Dos; Pillon, Sandra Cristina

    2008-01-01

    Families who are socially excluded are vulnerable to problems related to the use of psychoactive substances. This study aimed to identify the perception regarding drugs use among families that lived in extreme poverty and participated in a social-educational group in the suburbs of a city in the interior of São Paulo State. A survey-like quantitative study was conducted involving 70 members of families who participated in the social-educational groups of the Program for Integral Assistance to the Family. Results indicated that 67 (95.7%) of the subjects were married, at an average age of 37, most of them had not completed grade school, and were unemployed. Fifty five (78.6%) had a family member who used alcohol, fifty two (74,3%) smoked, and twenty three (32.9%) used some kind of illicit drug. The results also showed that living with a relative who was a drug user was perceived as problem that elicited feelings resentment, but also conformism on the part of other family members.

  13. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  14. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Genome-wide characterization of pectin methyl esterase genes reveals members differentially expressed in tolerant and susceptible wheats in response to Fusarium graminearum.

    Science.gov (United States)

    Zega, Alessandra; D'Ovidio, Renato

    2016-11-01

    Pectin methyl esterase (PME) genes code for enzymes that are involved in structural modifications of the plant cell wall during plant growth and development. They are also involved in plant-pathogen interaction. PME genes belong to a multigene family and in this study we report the first comprehensive analysis of the PME gene family in bread wheat (Triticum aestivum L.). Like in other species, the members of the TaPME family are dispersed throughout the genome and their encoded products retain the typical structural features of PMEs. qRT-PCR analysis showed variation in the expression pattern of TaPME genes in different tissues and revealed that these genes are mainly expressed in flowering spikes. In our attempt to identify putative TaPME genes involved in wheat defense, we revealed a strong variation in the expression of the TaPME following Fusarium graminearum infection, the causal agent of Fusarium head blight (FHB). Particularly interesting was the finding that the expression profile of some PME genes was markedly different between the FHB-resistant wheat cultivar Sumai3 and the FHB-susceptible cultivar Bobwhite, suggesting a possible involvement of these PME genes in FHB resistance. Moreover, the expression analysis of the TaPME genes during F. graminearum progression within the spike revealed those genes that responded more promptly to pathogen invasion. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  16. Payment or Reimbursement for Certain Medical Expenses for Camp Lejeune Family Members. Final rule.

    Science.gov (United States)

    2017-05-05

    The Department of Veterans Affairs (VA) adopts as final an interim final rule addressing payment or reimbursement of certain medical expenses for family members of Camp Lejeune veterans. Under this rule, VA reimburses family members, or pays providers, for medical expenses incurred as a result of certain illnesses and conditions that may be associated with contaminants present in the base water supply at U.S. Marine Corps Base Camp Lejeune (Camp Lejeune), North Carolina, from August 1, 1953, to December 31, 1987. Payment or reimbursement is made within the limitations set forth in statute and Camp Lejeune family members receive hospital care and medical services that are consistent with the manner in which we provide hospital care and medical services to Camp Lejeune veterans. The statutory authority has since been amended to also include certain veterans' family members who resided at Camp Lejeune, North Carolina, for no less than 30 days (consecutive or nonconsecutive) between August 1, 1953, and December 31, 1987. This final rule will reflect that statutory change and will address public comments received in response to the interim final rule.

  17. Guilt, censure, and concealment of active smoking status among cancer patients and family members after diagnosis: a nationwide study.

    Science.gov (United States)

    Shin, Dong Wook; Park, Jong Hyock; Kim, So Young; Park, Eal Whan; Yang, Hyung Kook; Ahn, Eunmi; Park, Seon Mee; Lee, Young Joon; Lim, Myong Cheol; Seo, Hong Gwan

    2014-05-01

    We aimed to identify the prevalence of feelings of guilt, censure, and concealment of smoking status among cancer patients and their family members who continued to smoke after the patient's diagnosis. Among 990 patient-family member dyads, 45 patients and 173 family members who continued to smoke for at least 1 month after the patients' diagnoses were administered questions examining feelings of guilt, censure, and smoking concealment. Most patients who continued to smoke reported experiencing feelings of guilt toward their families (75.6%) and censure from their family members (77.8%), and many concealed their smoking from their family members (44.4%) or healthcare professionals (46.7%). Family members who continued to smoke also reported feelings of guilt with respect to the patient (63.6%) and that the patient was critical of them (68.9%), and many concealed their smoking from the patient (28.5%) or healthcare professionals (9.3%). Patients' feeling of guilt was associated with concealment of smoking from family members (55.9% vs. 10.0%) or health care professionals (55.9% vs. 20.0%). Family members who reported feeling guilty (36.5% vs. 16.3%) or censured (34.5% vs. 16.7%) were more likely to conceal smoking from patients. Many patients and family members continue to smoke following cancer diagnosis, and the majority of them experience feelings of guilt and censure, which can lead to the concealment of smoking status from families or health care professionals. Feelings of guilt, censure, and concealment of smoking should be considered in the development and implementation of smoking cessation programs for cancer patients and family members. Copyright © 2013 John Wiley & Sons, Ltd.

  18. CHIS - Information concerning the health insurance of frontalier workers who are family members of a CHIS main member

    CERN Multimedia

    2014-01-01

    We recently informed you that the Organization was still in discussions with the Host State authorities to clarify the situation regarding the health insurance of frontalier workers who are family members (as defined in the Staff Rules and Regulations) of a CHIS main member, and that we were hoping to arrive at a solution soon.   After extensive exchanges, we finally obtained a response a few days ago from the Swiss authorities, with which we are fully satisfied and which we can summarise as follows: 1) Frontalier workers who are currently using the CHIS as their basic health insurance can continue to do so. 2) Family members who become frontalier workers, or those who have not yet exercised their “right to choose” (droit d’option) can opt to use the CHIS as their basic health insurance. To this end, they must complete the form regarding the health insurance of frontaliers, ticking the LAMal box and submitting their certificate of CHIS membership (available from U...

  19. Experiences of Family Members of Dying Patients Receiving Palliative Sedation.

    Science.gov (United States)

    Tursunov, Olga; Cherny, Nathan I; Ganz, Freda DeKeyser

    2016-11-01

    To describe the experience of family members of patients receiving palliative sedation at the initiation of treatment and after the patient has died and to compare these experiences over time.
. Descriptive comparative study.
. Oncology ward at Shaare Zedek Medical Center in Jerusalem, Israel.
. A convenience sample of 34 family members of dying patients receiving palliative sedation. 
. A modified version of a questionnaire describing experiences of family members with palliative sedation was administered during palliative sedation and one to four months after the patient died. Descriptive statistics were used to describe the results of the questionnaire, and appropriate statistical analyses were conducted for comparisons over time.
. Experiences of family members and time.
. Most relatives were satisfied with the sedation and staff support. Palliative sedation was experienced as an ethical way to relieve suffering. However, one-third felt that it shortened the patient's life. An explanation of the treatment was given less than half of the time and was usually given on the same day treatment was started. This explanation was given by physicians and nurses. Many felt that they were not ready for changes in the patient's condition and wanted increased opportunities to discuss the treatment with oncology care providers. No statistically significant differences in experiences were found over time. 
. Relatives' experiences of palliative sedation were generally positive and stable over time. Important experiences included timing of the initiation of sedation, timing and quality of explanations, and communication.
. Nurses should attempt to initiate discussions of the possible role of sedation in the event of refractory symptoms and follow through with continued discussions. The management of refractory symptoms at the end of life, the role of sedation, and communication skills associated with decision making related to palliative sedation should be a

  20. Identification of a missense mutation in the tyrosinase gene in a Chinese family with oculocutaneous albinism type 1.

    Science.gov (United States)

    Lu, Qian; Yuan, Lamei; Xu, Hongbo; Huang, Xiangjun; Yang, Zhijian; Yi, Junhui; Ni, Bin; Chen, Yong; Deng, Hao

    2017-03-01

    Oculocutaneous albinism (OCA) is a group of heterogeneous and autosomal recessive disorders characterized by a reduction or complete loss of melanin biosynthesis in melanocytes. OCA type 1 (OCA1) is the most severe and common form of OCA, and is caused by mutations in the tyrosinase gene (TYR). The present study aimed to identify the genetic cause of OCA1 in a four‑generation consanguineous Chinese Han family. Complete physical examinations were performed and blood samples were collected from five members of the family and 100 unrelated healthy controls. Exome sequencing was conducted in the proband, followed by verification in other family members, using Sanger sequencing. Patients in the family presented with typical OCA1 features, including hypopigmentation of the skin and hair, and distinctive ocular changes. A homozygous missense variant, c.896G>A (p.R299H), in the TYR gene was identified in two patients, which co‑segregated with disease in the family. This variant was not present in the 100 healthy controls. These results expand the number of mutations identified to be responsible for OCA1 in the Chinese Han population, and may have implications for genetic counseling and clinical management of the disease.

  1. Experiences of family members of patients with colostomies and expectations about professional intervention

    Directory of Open Access Journals (Sweden)

    Augusto Ferreira-Umpiérrez

    2014-04-01

    Full Text Available OBJECTIVE: the objective was to understand the experience of a group of family members of patients with colostomies, revealing their expectations regarding the intervention of health professionals.METHOD: qualitative research, with the social phenomenological approach of Alfred Schütz, conducted in Montevideo in 2012; twelve family members of patients with colostomies participated, from an ostomy service of a health institution.RESULTS: the following categories were identified: family ties, trust in the health care team, the nurse as the articulator of the process, the desire to humanize care, and adaptation to new family life.CONCLUSIONS: knowing the experience and expectations of the families of colostomy patients was achieved, emphasizing the previous family relationships to build upon them, and the trust in the health team, emphasizing the nurse as articulator of the process. Expectations focused on the desire for humanized care, enhancing adaptation of the nuclear family to the new way of life, restoring and enhancing its strengths, and collaborating in overcoming its weaknesses.

  2. Stress experiences of family members of registered sex offenders.

    Science.gov (United States)

    Tewksbury, Richard; Levenson, Jill

    2009-01-01

    The collateral consequences of sex offender registration and notification (SORN) have been well established, although little evidence has supported the efficacy of SORN. Based on the belief that family members provide some of the most consistent, important, and intense forms of support for criminal offenders in general and registered sex offenders (RSOs) more specifically, the experiences of sanctions, losses, and stresses of these individuals is examined. Using survey responses from 584 individuals known to visit online support and advocacy groups for RSOs and their loved ones, this study identifies the stress levels and stressors experienced by this population. Findings show that family members of RSOs experience high levels of social isolation, fear, shame, property damage, and forced residential relocation. Perceived stress is significantly higher for those who are of lower economic means, feel isolated, have high levels of fear and shame/embarrassment, or were forced to move. (c) 2009 John Wiley & Sons, Ltd.

  3. Striving to be prepared for the painful: Management strategies following a family member's diagnosis of advanced cancer

    Directory of Open Access Journals (Sweden)

    Hedberg Berith

    2011-10-01

    Full Text Available Abstract Background Cancer has consequences not only for the sick person but also for those who have a close relationship with that person. Greater knowledge about how family members manage the situation in the period immediately following the diagnosis means greater opportunity to provide the best possible support for the family. The purpose of this study was to explore management strategies that family members use when the patient is in the early stage of treatment for advanced cancer. Methods Twenty family members of cancer patients were included in the study shortly after the diagnosis. The patients had been diagnosed 8-14 weeks earlier with advanced lung cancer or gastrointestinal cancer. The data were collected in interviews with family members and subjected to qualitative latent content analysis. Through the identification of similarities and dissimilarities in the units of meaning, abstraction into codes and sub-themes became possible. The sub-themes were then brought together in one overarching theme. Results The overall function of management strategies is expressed in the theme Striving to be prepared for the painful. The family members prepare themselves mentally for the anticipated tragedy. Family relationships become increasingly important, and family members want to spend all their time together. They try to banish thoughts of the impending death and want to live as normal a life as possible. It becomes important to family members to live in the present and save their energy for the time when they will need it the most. How participants handle their worries, anxiety and sadness can be categorized into seven sub-themes or management strategies: Making things easier in everyday life, Banishing thoughts about the approaching loss, Living in the present, Adjusting to the sick person's situation, Distracting oneself by being with others, Shielding the family from grief, and Attempting to maintain hope. Conclusions The findings revealed

  4. Genetic analysis of a Chinese family with members affected with Usher syndrome type II and Waardenburg syndrome type IV.

    Science.gov (United States)

    Wang, Xueling; Lin, Xiao-Jiang; Tang, Xiangrong; Chai, Yong-Chuan; Yu, De-Hong; Chen, Dong-Ye; Wu, Hao

    2017-11-01

    The purpose of this study was to identify the genetic causes of a family presenting with multiple symptoms overlapping Usher syndrome type II (USH2) and Waardenburg syndrome type IV (WS4). Targeted next-generation sequencing including the exon and flanking intron sequences of 79 deafness genes was performed on the proband. Co-segregation of the disease phenotype and the detected variants were confirmed in all family members by PCR amplification and Sanger sequencing. The affected members of this family had two different recessive disorders, USH2 and WS4. By targeted next-generation sequencing, we identified that USH2 was caused by a novel missense mutation, p.V4907D in GPR98; whereas WS4 due to p.V185M in EDNRB. This is the first report of homozygous p.V185M mutation in EDNRB in patient with WS4. This study reported a Chinese family with multiple independent and overlapping phenotypes. In condition, molecular level analysis was efficient to identify the causative variant p.V4907D in GPR98 and p.V185M in EDNRB, also was helpful to confirm the clinical diagnosis of USH2 and WS4. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. [Music in human terminality: the family members' conceptions].

    Science.gov (United States)

    Sales, Catarina Aparecida; da Silva, Vladimir Araujo; Pilger, Calíope; Marcon, Sonia Silva

    2011-03-01

    This qualitative study was performed using the multiple case study method and Heidegger's existential phenomenology for data analysis. The objective was to understand how family members perceive the influence of musical experiences on the physical and mental health of a relative living with a terminal illness. Participants were seven individuals belonging to two families. Data collection was performed through interviews and observation from May to June 2009. Results showed that using music while providing care to beings living with cancer can provide well-being to patients as well as their caregivers. Considering the deficit of leisure and the monotony of the home environment, using music contemplates the philosophical and humanitarian precepts of palliative care, thus being characterized as a complementary resource to nursing care, as besides being a communication resource, it improves the interpersonal relationship between patients and their families.

  6. The incidence of tuberculosis transmission among family members and outside households.

    Science.gov (United States)

    Kozińska, Monika; Augustynowicz-Kopeć, Ewa

    2016-01-01

    The risk of Mycobacterium tuberculosis complex (MTBC) infection is correlated with the concentration of infectious particles and exposure time. In closed populations, healthy people staying in very frequent, close and prolonged contact with a smear-positive person, become infected and represent another link in the chain of transmission of the disease. Therefore, in the fight against tuberculosis, an important element is quick identification of the patient and potentially infected people from his environment. In epidemiological investigation of tuberculosis (TB), family members are brought under special control as they are particularly exposed to transmission of infectious diseases. The study included 150 patients with bacteriologically confirmed tuberculosis who were members of 59 families. In the years 2003-2013 this population represented all TB cases detected in Poland in a family environment.Three PCR-based genotyping methods: spoligotyping, IS6110-Mtb1-Mtb2 PCR and MIRU-VNTR typing were used. Of 150 patients, 138 could be assigned to intra-household transmission on the basis of identical DNA fingerprints upon a combined typing approach. For 12 patients in 6 households, the M. tuberculosis isolates were clearly distinct in individual analysis - IS6110-Mtb1-Mtb2 PCR, spoligotyping or MIRU-VNTR typing or in three genotyping methods, suggesting that these patients were infected by the sources in the community. The analysis confirmed the transmission of tuberculosis among members of 53 families. In the remaining 6 families the source of infection were people outside the households. In all families with young children, strains isolated from them have identical DNA patterns as strains obtained from their adult caregivers. To confirm the transmission of TB in the study population of patients, epidemiological analysis required the addition of a genotyping methods characterised by high discriminatory power.

  7. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  8. Distribution and origins of members of the Family Portulacaceae ...

    African Journals Online (AJOL)

    The present day distribution of members of the family Portulacaceae shows that whilst some genera such as Portulaca L., and to some extent Montia L. and Talinum Adanson are cosmopolitan in distribution, others such as Ceraria Pearson and Stephens, Lyallia Hooker fil., Portulacaria Jacquin, Silvaea Philippi and ...

  9. Resilience in family members of persons with autism spectrum disorder: a review of the literature.

    Science.gov (United States)

    Bekhet, Abir K; Johnson, Norah L; Zauszniewski, Jaclene A

    2012-10-01

    Worldwide, caregivers find caring for children with Autism Spectrum Disorder (ASD) challenging. Family members must manage many aspects of care giving, which is demanding, overwhelming, and can affect the family members' mental health. However learning how to be resilient may help family members overcome the stress and burden associated with caring for a person with ASD. A search was completed in Medline, PsycINFO, Proquest, Web of Science, and CINAHL using the key words "autism," "caregivers," "mothers," and "fathers," alone and in combination. Inclusion criteria were English language articles reporting studies with samples of children with ASD, as distinct from children with other intellectual or developmental disabilities. Fifty-eight articles that met these inclusion criteria were summarized and, from those, the authors selected 22 articles that included indicators of resilience. This integrative review highlights current research on resilience in adult family members of persons with ASD. Indicators of resilience, risk factors, protective factors, and outcomes of resilience were identified. The review indicates that parents of children with ASD who possess indicators of resilience are better able to manage the adversity associated with caring for children with ASD. Thus, enhancing resilience among family members of persons with autism may be beneficial to both the caregivers and care recipients.

  10. Factors affecting frequency of communication about family health history with family members and doctors in a medically underserved population.

    Science.gov (United States)

    Kaphingst, Kimberly A; Goodman, Melody; Pandya, Chintan; Garg, Priyanka; Stafford, Jewel; Lachance, Christina

    2012-08-01

    Family history contributes to risk for many common chronic diseases. Little research has investigated patient factors affecting communication of this information. 1061 adult community health center patients were surveyed. We examined factors related to frequency of discussions about family health history (FHH) with family members and doctors. Patients who talked frequently with family members about FHH were more likely to report a family history of cancer (p =.012) and heart disease (p history of heart disease (p = .011), meet physical activity recommendations (p = .022), seek health information frequently in newspapers (p history of some diseases, those not meeting physical activity recommendations, and those who do not frequently seek health information may not have ongoing FHH discussions. Interventions are needed to encourage providers to update patients' family histories systematically and assist patients in initiating FHH conversations in order to use this information for disease prevention and control. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  11. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  12. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Science.gov (United States)

    Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

    2013-01-01

    As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  13. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  14. Arabidopsis RecQsim, a plant-specific member of the RecQ helicase family, can suppress the MMS hypersensitivity of the yeast sgs1 mutant

    NARCIS (Netherlands)

    Bagherieh-Najjar, MB; de Vries, OMH; Kroon, JTM; Wright, EL; Elborough, KM; Hille, J; Dijkwel, PP

    The Arabidopsis genome contains seven genes that belong to the RecQ family of ATP-dependent DNA helicases. RecQ members in Saccharomyces cerevisiae (SGS1) and man (WRN, BLM and RecQL4) are involved in DNA recombination, repair and genome stability maintenance, but little is known about the function

  15. Genome wide identification and expression analysis of Homeodomain leucine zipper subfamily IV (HDZ IV gene family from Musa accuminata

    Directory of Open Access Journals (Sweden)

    Ashutosh ePandey

    2016-02-01

    Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.

  16. Protecting the privacy of family members in survey and pedigree research.

    Science.gov (United States)

    Botkin, J

    2001-01-10

    The recent controversy at Virginia Commonwealth University involving research ethics raises important and complex issues in survey and pedigree research. The primary questions are whether family members of survey respondents themselves become subjects of the project and if they are subjects whether informed consent must be obtained for investigators to retain private information on these individuals. This article provides an analysis of the ethical issues and regulatory standards involved in this debate for consideration by investigators and institutional review boards. The analysis suggests that strong protections for the rights and welfare of subjects and their family members can be incorporated into survey and pedigree research protocols without hindering projects with extensive consent requirements.

  17. Adaptive coping strategies of affected family members of a relative with substance misuse: A qualitative study.

    Science.gov (United States)

    McCann, Terence V; Lubman, Dan I

    2018-01-01

    To explore the coping strategies used by affected family members of a relative with substance misuse. Families play an important role in supporting a relative with substance misuse. However, the experience often has an adverse effect on their general well-being, the extent of which depends largely on their coping strategies. An interpretative phenomenological analysis study. Data were collected between January - December 2015. Semistructured, audio-recorded qualitative interviews were conducted with 31 affected family members. Three main themes and related subthemes were abstracted from the data illustrating how participants coped with their relative's substance misuse: (1) Seeking timely access to evidence-based information; (2) Enhancing personal coping strategies and (3) Accessing informal and formal support. Greater investment is needed in support services for affected family members, particularly in regional and rural areas. A wide range of accessible evidence-based information and informal and formal support, including telephone and online support, is needed to assist them to cope in this crucial support-giving role. Affected family members need to adopt a flexible set of coping strategies while supporting a relative with substance misuse. Family and friends, alcohol and other drug services, mental health nurses and other clinicians have a critical role providing emotional, instrumental and educational support to affected family members to enhance their adaptive coping strategies. © 2017 John Wiley & Sons Ltd.

  18. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  19. Cancer Research Advance in CKLF-like MARVEL Transmembrane Domain Containing Member Family (Review).

    Science.gov (United States)

    Lu, Jia; Wu, Qian-Qian; Zhou, Ya-Bo; Zhang, Kai-Hua; Pang, Bing-Xin; Li, Liang; Sun, Nan; Wang, Heng-Shu; Zhang, Song; Li, Wen-Jian; Zheng, Wei; Liu, Wei

    2016-01-01

    CKLF-like MARVEL transmembrane domain-containing family (CMTM) is a novel family of genes first reported at international level by Peking University Human Disease Gene Research Center. The gene products are between chemokines and the transmembrane-4 superfamily. Loaceted in several human chromosomes, CMTMs, which are unregulated in kinds of tumors, are potential tumor suppressor genes consisting of CKLF and CMTM1 to CMTM8. CMTMs play important roles in immune, male reproductive and hematopoietic systems. Also, it has been approved that CMTM family has strong connection with diseases of autoimmunity, haematopoietic system and haematopoietic system. The in-depth study in recent years found the close relation between CMTMs and umorigenesis, tumor development and metastasis. CMTM family has a significant clinical value in diagnosis and treatment to the diseases linking to tumor and immune system.

  20. Social worker involvement in identifying problems and needs of families with mentally ill members

    Directory of Open Access Journals (Sweden)

    Kovalčíková N.

    2016-01-01

    Full Text Available The aim of the current study was to explore the impact of schizophrenia on the life of the patient and his family, in particular, which problems people with schizophrenia and their families face. We applied a qualitative research strategy and method of semi-structured interview. Qualitative analysis of the data demonstrated barriers in the working and financial areas of life of people with schizophrenia. In addition, schizophrenia negatively affects social interactions of patients which lead to their social isolation which is also derived from barriers at work. Families with this kind of patient suffer mainly in the economic sphere of life with the necessity to leave the job and take care of an ill member. These families also suffer from isolation, restriction of social contacts, reduction of free-time activities, and many other problems included within the barriers in social interactions. Family members suffer psychological stress and they badly cope with the situation if the ill member is hospitalized. In addition, the family meets with the structural discrimination in the form of lack of information about the disease, lack of day care centres network and similar barriers in communication with physicians and the other professionals.

  1. Familial idiopathic pulmonary fibrosis. Evidence of lung inflammation in unaffected family members

    International Nuclear Information System (INIS)

    Bitterman, P.B.; Rennard, S.I.; Keogh, B.A.; Wewers, M.D.; Adelberg, S.; Crystal, R.G.

    1986-01-01

    We evaluated 17 clinically unaffected members of three families with an autosomal dominant form of idiopathic pulmonary fibrosis for evidence of alveolar inflammation. Each person in the study was examined by gallium-67 scanning for a general estimate of pulmonary inflammation, and by bronchoalveolar lavage for characterization of the types of recovered cells and their state of activation. Eight of the 17 subjects had evidence of alveolar inflammation on the lavage studies. Supporting data included increased numbers of neutrophils and activated macrophages that released one or more neutrophil chemoattractants, and growth factors for lung fibroblasts--findings similar to those observed in patients with overt idiopathic pulmonary fibrosis. Four of these eight also had a positive gallium scan; in all the other clinically unaffected subjects the scan was normal. During a follow-up of two to four years in seven of the eight subjects who had evidence of inflammation, no clinical evidence of pulmonary fibrosis has appeared. These results indicate that alveolar inflammation occurs in approximately half the clinically unaffected family members at risk of inheriting autosomal dominant idiopathic pulmonary fibrosis. Whether these persons with evidence of pulmonary inflammation but no fibrosis will proceed to have clinically evident pulmonary fibrosis is not yet known

  2. Torn between dual roles: the experiences of nurse-family members when a loved one is hospitalised in a critical condition.

    Science.gov (United States)

    Giles, Tracey M; Williamson, Victoria

    2015-11-01

    To understand and interpret the experiences of nurse-family members when a family member or loved one is hospitalised in a critical condition. Having a family member hospitalised with a critical illness is a traumatic stressor, often with long-term sequelae. Providing holistic care for family members who are also nurses makes the provision of care more complex because of their professional expertise; yet few studies have explored this issue. In this descriptive study, qualitative data were collected using a questionnaire and analysed using van Manen's (Researching Lived Experience: Human Science for an Action Sensitive Pedagogy, 1990, State University of New York Press, London, ON) six-step approach. Twenty nurse-family members completed an online questionnaire in June 2013. Qualitative findings from 19 participants were included in the analysis. The phenomenological analysis approach described by van Manen (Researching Lived Experience: Human Science for an Action Sensitive Pedagogy, 1990, State University of New York Press, London, ON) was used to describe and interpret nurse-family member experiences. Nurse-family members experience significant dual role conflicts between their personal and professional personas due to their specialised knowledge, need for watchfulness and competing expectations. Our findings describe how dual role conflicts developed and were managed, and reveal the resultant emotional toll and psychological distress as nurse-family members struggled to resolve these conflicts. Nurse-family members require a different type of care than general public family members, yet their unique needs are often unmet, leading to increased anxiety and distress that could potentially be minimised. An increased awareness and emphasis on the nurse-family member experience can ensure health care professionals are better placed to provide appropriate and targeted care to minimise distressing dual role conflicts. There is a need for targeted and specialised

  3. The effect of an anger management program for family members of patients with alcohol use disorders.

    Science.gov (United States)

    Son, Ju-Young; Choi, Yun-Jung

    2010-02-01

    This study was aimed to test the structured anger management nursing program for the family members of patients with alcohol use disorders (AUDs). Families with the AUDs suffer from the dysfunctional family dynamic caused by the patients' deteriorative disease processes of alcohol dependence. Family members of AUDs feel bitter and angry about the uncontrolled behaviors and relapses of the patients in spite of great effort for a long time. This chronic anger threatens the optimal function of the family as well as obstructs the family to help the patients who are suffering from AUDs. Sixty three subjects were participated who were referred from community mental health centers, alcohol consultation centers, and an alcohol hospital in Korea. Pre-post scores of the Korean Anger Expression Inventory were used to test the program. An anger management program was developed and implemented to promote anger expression and anger management for the family members of the patients with AUDs. The total anger expression score of the experimental group was significantly more reduced as compared with that of the control group. Subjects in the experimental group reported after the program that they felt more comfortable and their life was changed in a better way. The anger management program was effective to promote anger expression and anger management for family members of AUDs. Nurses need to include family members in their nursing process as well as to care of patients with AUDs to maximize nursing outcome and patient satisfaction. 2010 Elsevier Inc. All rights reserved.

  4. Stress Reduction in Postcardiac Surgery Family Members: Implementation of a Postcardiac Surgery Tool Kit.

    Science.gov (United States)

    Breisinger, Lauren; Macci Bires, Angela; Cline, Thomas W

    The intensive care unit (ICU) can be a place of stress, anxiety, and emotional instability for both patients and families. Medical and nursing care during this acute time is patient focused, and family members are often left in the dark. Unintentional exclusion from information results in high levels of stress, anxiety, and uncertainty for families. Due to the acuity of illness, family members of cardiac surgery patients experience the highest levels of stress. Spouses may experience intense psychosomatic symptoms such as depression, anxiety, and fear for several months after the surgery. The purpose of this study was aimed at decreasing those feelings of anxiety in family members with postcardiac surgery through the use of a cardiac surgery tool kit. The study was a quality improvement project utilizing a convenience sample of 83 participants 18 years and older. Participants were asked to use the State Trait Anxiety Inventory (STAI) Form Y-1 (state anxiety) to rate their anxiety level preintervention and then again postintervention. Data were collected over a 6-month period. Descriptive data including age, education level, ethnicity, relationship, experience in the ICU, and active diagnoses of mental disorders did not affect the changes in the pre- and posttest data. A paired t test was conducted on the sample to assess changes in state anxiety, using the STAI Form Y-1. The results were statistically significant (t = 11.97, df = 81, P family members of postcardiac surgery patients.

  5. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    International Nuclear Information System (INIS)

    Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.

    2015-01-01

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  6. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)

    2015-11-27

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  7. Perspectives of Family Members on Using Technology in Youth Mental Health Care: A Qualitative Study.

    Science.gov (United States)

    Lal, Shalini; Daniel, Winnie; Rivard, Lysanne

    2017-06-23

    Information and communication technologies (ICTs) are increasingly recognized as having an important role in the delivery of mental health services for youth. Recent studies have evaluated young people's access and use of technology, as well as their perspectives on using technology to receive mental health information, services, and support; however, limited attention has been given to the perspectives of family members in this regard. The aim of this study was to explore the perspectives of family members on the use of ICTs to deliver mental health services to youth within the context of specialized early intervention for a first-episode psychosis (FEP). Six focus groups were conducted with family members recruited from an early intervention program for psychosis. Twelve family members participated in the study (target sample was 12-18, and recruitment efforts took place over the duration of 1 year). A 12-item semistructured focus group guide was developed to explore past experiences of technology and recommendations for the use of technology in youth mental health service delivery. A qualitative thematic analysis guided the identification and organization of common themes and patterns identified across the dataset. Findings were organized by the following themes: access and use of technology, potential negative impacts of technology on youth in recovery, potential benefits of using technology to deliver mental health services to youth, and recommendations to use technology for (1) providing quality information in a manner that is accessible to individuals of diverse socioeconomic backgrounds, (2) facilitating communication with health care professionals and services, and (3) increasing access to peer support. To our knowledge, this is among the first (or the first) to explore the perspectives of family members of youth being treated for FEP on the use of technology for mental health care. Our results highlight the importance of considering diverse experiences

  8. Simultaneous Presence of Macular Corneal Dystrophy and Retinitis Pigmentosa in Three Members of a Family

    Directory of Open Access Journals (Sweden)

    Farhad Nejat

    2018-03-01

    Full Text Available Macular corneal dystrophy (MCD is an autosomal recessive hereditary disease. In most cases, various mutations in carbohydrate sulfotransferase 6 (CHST6 gene are the main cause of MCD. These mutations lead to a defect in keratan sulfate synthesis. Retinitis pigmentosa (RP is another eye disorder with nyctalopia as its common symptom. It has been shown that more than 65 genes have been implicated in different forms of RP. Herein, we report on a 9-member family with 2 girls and 5 boys. Both parents, one of the girls and one of the boys had normal eye vision and another boy had keratoconus. Other children (1 girl and 2 boys suffered from both MCD and RP. Corneal transplantation and medical supplements were used for MCD and RP during the follow-up period, respectively. Based on the family tree, it seems that the inheritance of both diseases is autosomal recessive. Based on our search of databases, there is no report on the simultaneous presence of MCD and RP. To the best of our knowledge, the present article is the first case report on this topic. Molecular genetic investigation is needed to clarify the mechanism of concurrent MCD and RP.

  9. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  10. Cardiopulmonary resuscitation training of family members before hospital discharge using video self-instruction: a feasibility trial.

    Science.gov (United States)

    Blewer, Audrey L; Leary, Marion; Decker, Christopher S; Andersen, James C; Fredericks, Amanda C; Bobrow, Bentley J; Abella, Benjamin S

    2011-09-01

    Bystander cardiopulmonary resuscitation (CPR) is a crucial therapy for sudden cardiac arrest (SCA), yet rates of bystander CPR are low. This is especially the case for SCA occurring in the home setting, as family members of at-risk patients are often not CPR trained. To evaluate the feasibility of a novel hospital-based CPR education program targeted to family members of patients at increased risk for SCA. Prospective, multicenter, cohort study. Inpatient wards at 3 hospitals. Family members of inpatients admitted with cardiac-related diagnoses. Family members were offered CPR training via a proctored video-self instruction (VSI) program. After training, CPR skills and participant perspectives regarding their training experience were assessed. Surveys were conducted one month postdischarge to measure the rate of "secondary training" of other individuals by enrolled family members. At the 3 study sites, 756 subjects were offered CPR instruction; 280 agreed to training and 136 underwent instruction using the VSI program. Of these, 78 of 136 (57%) had no previous CPR training. After training, chest compression performance was generally adequate (mean compression rate 90 ± 26/minute, mean depth 37 ± 12 mm). At 1 month, 57 of 122 (47%) of subjects performed secondary training for friends or family members, with a calculated mean of 2.1 persons trained per kit distributed. The hospital setting offers a unique "point of capture" to provide CPR instruction to an important, undertrained population in contact with at-risk individuals. Copyright © 2010 Society of Hospital Medicine.

  11. The Relationship Between the Perceived Risk of Harm by a Family Member with Mental Illness and the Family Experience.

    Science.gov (United States)

    Katz, Judith; Medoff, Deborah; Fang, Li Juan; Dixon, Lisa B

    2015-10-01

    Family members of people with serious mental illness (SMI) at times report that they act to stop their ill relative from self harm or harming others. This study examines the relationship between the perception of risk of harm and family distress, burden, empowerment, coping, physical and mental health, appraisal of the caregiving experience, family communication, and family functioning. The study is a secondary analysis of baseline data collected for a randomized study of the family-to-family peer driven education program (FTF). Four hundred thirty-four enrolled individuals who were seeking to participate in FTF completed survey items that asked if they had tried to stop or prevent their ill family member from harming themselves or others in the last 30 days. Participants who perceived a recent risk of harm by their ill relative reported more negative appraisals of caregiving, greater psychological distress, poorer mental health and greater objective burden compared with those who did not perceive a recent risk of harm. The results suggest that families of persons with SMI should be asked about perceived risk of harm to self and others, and the presence of perceived risk of harm should serve as a red flag indicating the need for further evaluation of the family experience and additional support for the family.

  12. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  13. Size distributions of member asteroids in seven Hirayama families

    International Nuclear Information System (INIS)

    Mikami, Takao; Ishida, Keiichi.

    1990-01-01

    The size distributions of asteroids in the seven Hirayama families are studied for newly assigned member asteroids in the diameter range of about 10 to 100 km. The size distributions for the different families are expressed by the power-law functions with distinctly different power-law indices. The power-law indices for families with small mean orbital inclinations are about 2.5 to 3.0. On the other hand, the power-law indices for families with large mean orbital inclinations are significantly smaller than 2.5. This indicates that the smaller asteroids were removed preferentially from these families after their formation. It is thought that the smaller asteroids left behind the families were dispersed into the main belt. It is consistent with the fact that the power-law index for the size distribution of asteroids with diameters smaller than 25 km in the main belt is larger than the power-law indices for the size distributions of asteroids in the families. This segregation due to the asteroid size can be caused by a drag force caused by the ambient matter deposited on the invariable place of the solar system during the early evolutionary stage. (author)

  14. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  15. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  16. "You Needed to Rehab...Families as Well": Family Members' Own Goals for Aphasia Rehabilitation

    Science.gov (United States)

    Howe, Tami; Davidson, Bronwyn; Worrall, Linda; Hersh, Deborah; Ferguson, Alison; Sherratt, Sue; Gilbert, Jocelyn

    2012-01-01

    Background: Aphasia affects family members in addition to the individuals with the communication disorder. In order to develop appropriate services for the relatives of people with aphasia post-stroke, their rehabilitation goals need to be identified. Aim: The aim of the current investigation was to identify the rehabilitation goals that family…

  17. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  18. Effect of doxorubicin, oxaliplatin, and methotrexate administration on the transcriptional activity of BCL-2 family gene members in stomach cancer cells.

    Science.gov (United States)

    Florou, Dimitra; Patsis, Christos; Ardavanis, Alexandros; Scorilas, Andreas

    2013-07-01

    Defective apoptosis comprises the main reason for tumor aggressiveness and chemotherapy tolerance in solid neoplasias. Among the BCL-2 family members, whose mRNA or protein expression varies considerably in different human malignancies, BCL2L12 is the one for which we have recently shown its propitious prognostic value in gastric cancer. The purpose of the current work was to investigate the expression behavior of BCL2L12, BAX, and BCL-2 in human stomach adenocarcinoma cells following their exposure to anti-tumor substances. The 3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide and trypan blue methods assessed the impact of doxorubicin, oxaliplatin and methotrexate on AGS cells' viability and growth. Following isolation from cells, total RNA was reverse-transcribed to cDNA. Quantification of target genes' expression was performed with real-time PCR using SYBR Green detection system. The relative changes in their mRNA levels between drug-exposed and untreated cells were calculated with the comparative Ct method (2(-ddCt)). All three drugs, as a result of their administration to AGS cancer cells for particular time intervals, provoked substantial fluctuations in the transcriptional levels of the apoptosis-related genes studied. While BAX was principally upregulated, striking similar were the notable changes regarding BCL-2 and BCL2L12 expression in our cellular system. Our findings indicate the growth suppressive effects of doxorubicin, oxaliplatin and methotrexate treatment on stomach carcinoma cells and the implication of BCL2L12, BAX, and BCL-2 expression profiles in the molecular signaling pathways triggered by chemotherapy.

  19. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  20. Patients' experiences of care and support at home after a family member's participation in an intervention during palliative care.

    Science.gov (United States)

    Norinder, Maria; Goliath, Ida; Alvariza, Anette

    2017-06-01

    Patients who receive palliative home care are in need of support from family members, who take on great responsibility related to caregiving but who often feel unprepared for this task. Increasing numbers of interventions aimed at supporting family members in palliative care have been described and evaluated. It is not known whether and how these interventions actually affect the care or support provided to a patient, even though it has been suggested that family members would be likely to provide better care and support and thus allow for positive experiences for patients. However, this has not been studied from the perspective of the patients themselves. The objective of our study was to explore patients' experiences of care and support at home after family members' participation in a psychoeducational intervention during palliative care. Our study took a qualitative approach, and interviews were conducted with 11 patients whose family members had participated in a psychoeducational intervention during palliative home care. The interviews were analyzed employing interpretive description. Patients' experiences were represented by three themes: "safe at home," "facilitated and more honest communication," and "feeling like a unit of care." Patients felt that their needs were better met and that family members became more confident at home without risking their own health. Patients felt relieved when family members were given the opportunity to talk and reflect with others and hoped that the intervention would contribute to more honest communications between themselves and their family members. Further, it was of great importance to patients that family members receive attention from and be confirmed and supported by healthcare professionals. Our findings show how an intervention targeted at family members during palliative home care also benefits the patients.

  1. Predictors of posttraumatic stress and quality of life in family members of chronically critically ill patients after intensive care.

    Science.gov (United States)

    Wintermann, Gloria-Beatrice; Weidner, Kerstin; Strauß, Bernhard; Rosendahl, Jenny; Petrowski, Katja

    2016-12-01

    Prolonged mechanical ventilation for acute medical conditions increases the risk of chronic critical illness (CCI). Close family members are confronted with the life-threatening condition of the CCI patients and are prone to develop posttraumatic stress disorder affecting their health-related quality of life (HRQL). Main aim of the present study was to investigate patient- and family-related risk factors for posttraumatic stress and decreased HRQL in family members of CCI patients. In a cross-sectional design nested within a prospective longitudinal cohort study, posttraumatic stress symptoms and quality of life were assessed in family members of CCI patients (n = 83, aged between 18 and 72 years) up to 6 months after transfer from ICU at acute care hospital to post-acute rehabilitation. Patients admitted a large rehabilitation hospital for ventilator weaning. The Posttraumatic Stress Scale-10 and the Euro-Quality of life-5D-3L were applied in both patients and their family members via telephone interview. A significant proportion of CCI patients and their family members (14.5 and 15.7 %, respectively) showed clinically relevant scores of posttraumatic stress. Both CCI patients and family members reported poorer HRQL than a normative sample. Factors independently associated with posttraumatic stress in family members were the time following ICU discharge (β = .256, 95 % confidence interval .053-.470) and the patients' diagnosis of PTSD (β = .264, 95 % confidence interval .045-.453). Perceived satisfaction with the relationship turned out to be a protective factor for posttraumatic stress in family members of CCI patients (β = -.231, 95 % confidence interval -.423 to -.015). Regarding HRQL in family members, patients' acute posttraumatic stress at ICU (β = -.290, 95 % confidence interval -.360 to -.088) and their own posttraumatic stress 3 to 6 months post-transfer (β = -.622, 95 % confidence interval -.640 to -.358) turned out to be

  2. Use of augmentative and alternative communication strategies by family members in the intensive care unit.

    Science.gov (United States)

    Broyles, Lauren M; Tate, Judith A; Happ, Mary Beth

    2012-03-01

    Little is known about communication between patients and their family members during critical illness and mechanical ventilation in the intensive care unit, including use of augmentative and alternative communication tools and strategies. To identify (1) which augmentative and alternative communication tools families use with nonspeaking intensive care patients and how they are used, and (2) what families and nurses say about communication of family members with nonspeaking intensive care patients. A qualitative secondary analysis was conducted of existing data from a clinical trial testing interventions to improve communication between nurses and intensive care patients. Narrative study data (field notes, intervention logs, nurses' interviews) from 127 critically ill adults were reviewed for evidence of family involvement with augmentative and alternative communication tools. Qualitative content analysis was applied for thematic description of family members' and nurses' accounts of patient-family communication. Family involvement with augmentative and alternative communication tools was evident in 44% of the 93 patients who completed the parent study protocol. Spouses or significant others communicated with patients most often. Main themes describing patient-family communication included (1) families being unprepared and unaware, (2) families' perceptions of communication effectiveness, (3) nurses deferring to or guiding patient-family communication, (4) patients' communication characteristics, and (5) families' experience with and interest in augmentative and alternative communication tools. Assessment by skilled bedside clinicians can reveal patients' communication potential and facilitate useful augmentative and alternative communication tools and strategies for patients and their families.

  3. Involvement of Family Members and Professionals in Older Women's Post-Fall Decision Making.

    Science.gov (United States)

    Bergeron, Caroline D; Hilfinger Messias, DeAnne K; Friedman, Daniela B; Spencer, S Melinda; Miller, Susan C

    2018-03-01

    This exploratory, descriptive study examined involvement of family members and professionals in older women's post-fall decision making. We conducted semistructured interviews with 17 older women who had recently fallen and 11 individuals these women identified as being engaged in their post-fall decision-making processes. Qualitative data analysis involved open and axial coding and development of themes. After experiencing a fall, these older women's openness to others' opinions and advice; their assessments of types and credibility of potential information sources; and the communication practices they established with these sources influenced how they accessed, accepted, or rejected information from family members and professionals. Increased awareness of the involvement of others in post-fall decision making could enhance communication with older women who fall. Developing and implementing practical strategies to help family members and professionals initiate and engage in conversations about falls and their consequences could lead to more open decision making and improved post-fall quality of life among older women.

  4. The willingness and actual situation of Chinese cancer patients and their family members participating in medical decision-making.

    Science.gov (United States)

    Zhang, Jie; Yang, Dan; Deng, Yaotiao; Wang, Ying; Deng, Lei; Luo, Xinmei; Zhong, Wuning; Liu, Jie; Wang, Yuqing; Jiang, Yu

    2015-12-01

    In China, not only patients and physicians are involved in medical decision-making (MDM) but also the patients' family members. The objective is to investigate the willingness and actual situation of cancer patients and their family members participating in the MDM process. In this cross-sectional study, questionnaires were administered to 247 pairs of cancer inpatients and their relatives. Information regarding participants' willingness and actual experience during the decision-making process was documented. Eligible participants were cancer inpatients or their relatives, 18 years of age or older, and informed of the cancer diagnosis. All the patients should have received chemotherapy. The effective response rate was 72.9% (180/247). Over half of the patients (53.3%) and family members (57.8%) were willing to be part of the MDM process. In contrast, only 35.0% of patients and 46.1% of family members actually experienced this process (p = 0.001 and p = 0.011, respectively). Fewer family members (42.2%) than patients (53.3%) believed that patients should be involved in the MDM process (p family (odds ratio 2.577, 95% CI 1.198-5.556, p = 0.015) experienced more involvement in MDM. Although more than half of Chinese cancer patients and family members wanted to be part of MDM, the actual participation was below their expectation. Majority of family members do not want the patients to be involved in the process of MDM. Copyright © 2015 John Wiley & Sons, Ltd.

  5. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    OpenAIRE

    Shamim Saleha; Muhammad Ajmal; Muhammad Jamil

    2016-01-01

    AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype...

  6. Niakha virus: a novel member of the family Rhabdoviridae isolated from phlebotomine sandflies in Senegal.

    Science.gov (United States)

    Vasilakis, Nikos; Widen, Steven; Mayer, Sandra V; Seymour, Robert; Wood, Thomas G; Popov, Vsevolov; Guzman, Hilda; Travassos da Rosa, Amelia P A; Ghedin, Elodie; Holmes, Edward C; Walker, Peter J; Tesh, Robert B

    2013-09-01

    Members of the family Rhabdoviridae have been assigned to eight genera but many remain unassigned. Rhabdoviruses have a remarkably diverse host range that includes terrestrial and marine animals, invertebrates and plants. Transmission of some rhabdoviruses often requires an arthropod vector, such as mosquitoes, midges, sandflies, ticks, aphids and leafhoppers, in which they replicate. Herein we characterize Niakha virus (NIAV), a previously uncharacterized rhabdovirus isolated from phebotomine sandflies in Senegal. Analysis of the 11,124 nt genome sequence indicates that it encodes the five common rhabdovirus proteins with alternative ORFs in the M, G and L genes. Phylogenetic analysis of the L protein indicate that NIAV's closest relative is Oak Vale rhabdovirus, although in this analysis NIAV is still so phylogenetically distinct that it might be classified as distinct from the eight currently recognized Rhabdoviridae genera. This observation highlights the vast, and yet not fully recognized diversity, of this family. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Niakha virus: A novel member of the family Rhabdoviridae isolated from phlebotomine sandflies in Senegal

    Science.gov (United States)

    Vasilakis, Nikos; Widen, Steven; Mayer, Sandra V.; Seymour, Robert; Wood, Thomas G.; Popov, Vsevolov; Guzman, Hilda; da Rosa, Amelia P.A. Travassos; Ghedin, Elodie; Holmes, Edward C.; Walker, Peter J.; Tesh, Robert B.

    2013-01-01

    Members of the family Rhabdoviridae have been assigned to eight genera but many remain unassigned. Rhabdoviruses have a remarkably diverse host range that includes terrestrial and marine animals, invertebrates and plants. Transmission of some rhabdoviruses often requires an arthropod vector, such as mosquitoes, midges, sandflies, ticks, aphids and leafhoppers, in which they replicate. Herein we characterize Niakha virus (NIAV), a previously uncharacterized rhabdovirus isolated from phebotomine sandflies in Senegal. Analysis of the 11,124 nt genome sequence indicates that it encodes the five common rhabdovirus proteins with alternative ORFs in the M, G and L genes. Phylogenetic analysis of the L protein indicate that NIAV’s closest relative is Oak Vale rhabdovirus, although in this analysis NIAV is still so phylogenetically distinct that it might be classified as distinct from the eight currently recognized Rhabdoviridae genera. This observation highlights the vast, and yet not fully recognized diversity, of this family. PMID:23773405

  8. Genome-Wide Identification and Transcriptome-Based Expression Profiling of the Sox Gene Family in the Nile Tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Wei, Ling; Yang, Chao; Tao, Wenjing; Wang, Deshou

    2016-02-23

    The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG) box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus), and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.

  9. Genome-Wide Identification and Transcriptome-Based Expression Profiling of the Sox Gene Family in the Nile Tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Ling Wei

    2016-02-01

    Full Text Available The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus, and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.

  10. The challenges of reintegration for service members and their families.

    Science.gov (United States)

    Danish, Steven J; Antonides, Bradley J

    2013-10-01

    The ongoing wars in Afghanistan and Iraq have posed a number of reintegration challenges to service members. Much of the research focuses on those service members experiencing psychological problems and being treated at the VA. In this article, we contend that much of the distress service members experience occurs following deployment and is a consequence of the difficulties encountered during their efforts to successfully reintegrate into their families and communities. We propose a new conceptual framework for intervening in this reintegration distress that is psycho-educational in nature as well as a new delivery model for providing such services. An example of this new intervention framework is presented. © 2013 American Orthopsychiatric Association.

  11. Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

    Science.gov (United States)

    Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

    2005-05-13

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

  12. [Family members' experiences of caring for persons with dementia and outreach counseling--an interpretative phenomenological study].

    Science.gov (United States)

    Vögeli, Samuel; Frei, Irena Anna; Spichiger, Elisabeth

    2016-01-01

    Almost two-thirds of the 110,000 people living with dementia in Switzerland receive home care from family members. Outreach counselling can reduce the burden for family caregivers and delay nursing home placement. However, little is known of how this works and how caregivers experience the counselling. The Canton of Aargau Alzheimer's Association has been conducting a pilot project to demonstrate the necessity, effectiveness and practicability of outreach counselling in (their canton). As a part of the evaluation of the project this study explored how family members experience the process of caring for a relative with dementia and outreach counselling. Interpretive phenomenology–a qualitative approach–was used to analyse data from interviews with twelve family caregivers. Most family members felt supported in caregiving by outreach counselling. Three aspects of the counselling were especially important to the participants: being understood and taken seriously by the counsellor; receiving answers to their most pressing questions concerning the illness and being supported when difficult decision had to be taken; regaining personal time and learning how to better interact with the person with dementia. Two participants would have wished for more help by the counsellor. To meet the needs of the family members, consultants should have sufficient experience in dementia patient care and should be strongly networked across the local health and welfare system. This study shows that family members can experience outreach counselling as a great support in their caregiving roles.

  13. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  14. Embryonal Fyn-associated substrate (EFS) and CASS4: The lesser-known CAS protein family members.

    Science.gov (United States)

    Deneka, Alexander; Korobeynikov, Vladislav; Golemis, Erica A

    2015-10-01

    The CAS (Crk-associated substrate) adaptor protein family consists of four members: CASS1/BCAR1/p130Cas, CASS2/NEDD9/HEF1/Cas-L, CASS3/EFS/Sin and CASS4/HEPL. While CAS proteins lack enzymatic activity, they contain specific recognition and binding sites for assembly of larger signaling complexes that are essential for cell proliferation, survival, migration, and other processes. All family members are intermediates in integrin-dependent signaling pathways mediated at focal adhesions, and associate with FAK and SRC family kinases to activate downstream effectors regulating the actin cytoskeleton. Most studies of CAS proteins to date have been focused on the first two members, BCAR1 and NEDD9, with altered expression of these proteins now appreciated as influencing disease development and prognosis for cancer and other serious pathological conditions. For these family members, additional mechanisms of action have been defined in receptor tyrosine kinase (RTK) signaling, estrogen receptor signaling or cell cycle progression, involving discrete partner proteins such as SHC, NSP proteins, or AURKA. By contrast, EFS and CASS4 have been less studied, although structure-function analyses indicate they conserve many elements with the better-known family members. Intriguingly, a number of recent studies have implicated these proteins in immune system function, and the pathogenesis of developmental disorders, autoimmune disorders including Crohn's disease, Alzheimer's disease, cancer and other diseases. In this review, we summarize the current understanding of EFS and CASS4 protein function in the context of the larger CAS family group. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Perceived Intrafamilial Connectedness and Autonomy in Families with and without an Anxious Family Member: A Multiple Informant Approach

    Science.gov (United States)

    de Albuquerque, Jiske E. G.; Schneider, Silvia

    2012-01-01

    Perceived intrafamilial "emotional connectedness" and "autonomy" were investigated within families with and without an anxious family member using a multiple informant approach. The sample consisted of 32 mothers with a current anxiety disorder and 56 controls, their partners, and their anxious and nonanxious teenage children. No differences were…

  16. IGSF9 Family Proteins

    DEFF Research Database (Denmark)

    Hansen, Maria; Walmod, Peter Schledermann

    2013-01-01

    The Drosophila protein Turtle and the vertebrate proteins immunoglobulin superfamily (IgSF), member 9 (IGSF9/Dasm1) and IGSF9B are members of an evolutionarily ancient protein family. A bioinformatics analysis of the protein family revealed that invertebrates contain only a single IGSF9 family gene......, the longest isoforms of the proteins have the same general organization as the neural cell adhesion molecule family of cell adhesion molecule proteins, and like this family of proteins, IGSF9 family members are expressed in the nervous system. A review of the literature revealed that Drosophila Turtle...... facilitates homophilic cell adhesion. Moreover, IGSF9 family proteins have been implicated in the outgrowth and branching of neurites, axon guidance, synapse maturation, self-avoidance, and tiling. However, despite the few published studies on IGSF9 family proteins, reports on the functions of both Turtle...

  17. FGFR Family Members Protein Expression as Prognostic Markers in Oral Cavity and Oropharyngeal Squamous Cell Carcinoma

    NARCIS (Netherlands)

    Koole, Koos; Clausen, Martijn J. A. M.; van Es, Robert J. J.; van Kempen, Pauline M. W.; Melchers, Lieuwe J.; Koole, Ron; Langendijk, Johannes A.; van Diest, Paul J.; Roodenburg, Jan L. N.; Schuuring, Ed; Willems, Stefan M.

    Introduction Fibroblast growth factor receptor family member proteins (FGFR1-4) have been identified as promising novel therapeutic targets and prognostic markers in a wide spectrum of solid tumors. The present study investigates the expression and prognostic value of four FGFR family member

  18. Marriage & Family Therapy Faculty Memberâ s Balance of Work and Personal Life

    OpenAIRE

    Matheson, Jennifer L.

    2002-01-01

    This mixed-method study examines the work and personal life balance of Marriage & Family Therapy faculty members across the U.S., 16 of whom were interviewed to gain a deeper understanding of their work and personal life balance issues. Of those, six felt they had good balance, six felt they had poor balance, and four were â middle of the road.â More men than women felt they had good balance. Faculty members indicated external and internal indicators such as family and workplace message...

  19. Quotidian of accompanying family members in an environment of care: the emergence of hospital tribes

    Directory of Open Access Journals (Sweden)

    Silvia da Silva Santos Passos

    2016-06-01

    Full Text Available ABSTRACT OBJECTIVE Understand the quotidian relationships of accompanying family members in an environment of care, which are close to the metaphor of a tribe in hospital environment. METHODQualitative study with data gathered from semi-structured interviews and observations with 16 family members accompanying hospitalized individuals with dependence on self-care. Data were submitted to thematic analysis, and analyzed through the metaphor of "tribe" proposed by comprehensive sociology. RESULTS Family members build up social clusters around caring, where we find traits typical of tribes: emotional ambience; solidarity based on links of sympathy and mutual assistance; an affectual nebula in the process of interaction; a logic of fusion in tactile relations; and communion/religiosity in the process of connecting in a collective identity. CONCLUSION In the presence of tragedy, families build social clusters similar to tribes having care as a totem.

  20. The Importance of Situational Awareness: A Qualitative Study of Family Members' and Nurses' Perspectives on Teaching During Family-Centered Rounds.

    Science.gov (United States)

    Beck, Jimmy; Meyer, Rebecca; Kind, Terry; Bhansali, Priti

    2015-10-01

    Family-centered rounds (FCR) has become a leading model for pediatric inpatient rounding. During FCR, faculty must balance trainees' educational needs with patient care priorities. Investigators have examined trainees' views on effective teaching during FCR, but none have evaluated what family members and nurses consider to be effective teaching behaviors of attending physicians. The authors sought to explore family members' and nurses' perspectives on effective teaching behaviors during FCR. The authors conducted (2012-2013) a qualitative study of families and nurses at an academic children's hospital where FCR is the standard model for inpatient rounds. Nurses and families familiar with FCR participated in separate focus groups. The authors reviewed focus group transcripts using techniques of qualitative content analysis; they generated codes and developed categories, supported by illustrative quotations. Fifteen nurses and 13 family members participated in the focus groups. The unifying theme was that situational awareness on behalf of the attending physician is essential for FCR to be educational for all participants. The authors identified four categories of awareness-(1) cognitive factors, (2) logistics and time management, (3) physical environment, (4) emotional state-and developed a set of effective teaching strategies based on participants' comments. The findings of this study support previous work identifying effective FCR teaching strategies, but this study is the first to include the perspectives of families and nurses. The inclusion of these participants provides a framework for faculty development and training to improve the educational value of FCR.

  1. Transcriptome-wide survey of mouse CNS-derived cells reveals monoallelic expression within novel gene families.

    Directory of Open Access Journals (Sweden)

    Sierra M Li

    Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.

  2. Influence of Posttraumatic Stress Disorder of the Fathers on other Family MembersInfluence of Posttraumatic Stress Disorder of the Fathers on other Family Members

    Directory of Open Access Journals (Sweden)

    Amra Zalihić

    2008-02-01

    Full Text Available The purpose of this work is to analyze the frequency of depression and anxiety and children behaviour in families whose heads of the family (father suffer from post-traumatic stress disorder (PTSD. The study was conducted from September 2005 until July 2006, with patients living in Mostar. The frequency of depression and anxiety in family members older than 18 years, and changes of the behaviour in children younger than 18 years of age were measured. The data were collected from 60 men and their families who had been diagnosed with PTSD by their psychiatrist. The control group was formed using matching criteria (age of the head of the family, his education, religion, family income and number of children. In this study, three questionnaires were used: one specially designed for this study, covering general information about family members, and a personal opinion of each family member about the family situation and relations within the family; Hopkins symptoms checklist - 25 (HSCL-25 for evaluation of depression and anxiety for subjects older than 18; and General Health Questionnaire (GHQ for children 5 to 18 years of age, which was completed by their mothers.More wives from the PTSD families had depression than wives from the controlled group (χ2=21,099; df=1; P<0,050. There was no difference between groups in frequency of depression and anxiety (χ2=0,003; df=1; P=0,959 for children older than 18 years. No difference in answers between groups of children younger than 18 years were found in the General Health Questionnaire. However, we found significant differences in separate questions. Mothers, who filled the questionnaire form, reported that children from fathers who had PTSD experienced stomach pain more often (χ2=10,474;df=2; P=0,005, eating problems (χ2=14,204;df=2; P=0,001 and breathing problems (χ2=9,748;df=2; P=0,008, than children from fathers who did not have PTSD. Children from fathers with PTSD were more easily upset (χ2

  3. Decision-Making of Patients With Implantable Cardioverter-Defibrillators at End of Life: Family Members' Experiences.

    Science.gov (United States)

    Lee, Mei Ching; Sulmasy, Daniel P; Gallo, Joseph; Kub, Joan; Hughes, Mark T; Russell, Stuart; Kellogg, Anela; Owens, Sharon G; Terry, Peter; Nolan, Marie T

    2017-07-01

    Many patients with advanced heart failure (HF) experience the life-extending benefits of implantable cardioverter-defibrillators (ICD), but at the end stage of HF, patients may experience shocks with increasing frequency and change the plan for end-of-life (EOL) care including the deactivation of the ICD. This report describes family members' experiences of patients with ICD making decisions at EOL. Understanding the decision-making of patients with ICD at EOL can promote informed decision-making and improve the quality of EOL care. This pilot study used a mixed methods approach to test the effects of a nurse-guided discussion in decision-making about ICD deactivation (turning off the defibrillation function) at the EOL. Interviews were conducted, audiotaped, and transcribed in 2012 to 2013 with 6 family members of patients with advanced HF and ICDs. Three researchers coded the data and identified themes in 2014. Three main themes described family members' experiences related to patients having HF with ICDs making health-care decision at EOL: decision-making preferences, patients' perception on ICD deactivation, and communication methods. Health-care providers need to have knowledge of patients' decision-making preferences. Preferences for decision-making include the allowing of appropriate people to involve and encourages direct conversation with family members even when advance directives is completed. Information of ICD function and the option of deactivation need to be clearly delivered to patients and family members. Education and guidelines will facilitate the communication of the preferences of EOL care.

  4. Genome-wide analysis and heavy metal-induced expression profiling of the HMA gene family in Populus trichocarpa

    Directory of Open Access Journals (Sweden)

    Dandan eLi

    2015-12-01

    Full Text Available The heavy metal ATPase (HMA family plays an important role in transition metal transport in plants. However, this gene family has not been extensively studied in Populus trichocarpa. We identified 17 HMA genes in P. trichocarpa (PtHMAs, of which PtHMA1–PtHMA4 belonged to the zinc (Zn/cobalt (Co/cadmium (Cd/lead (Pb subgroup, and PtHMA5–PtHMA8 were members of the copper (Cu/silver (Ag subgroup. Most of the genes were localized to chromosomes I and III. Gene structure, gene chromosomal location, and synteny analyses of PtHMAs indicated that tandem and segmental duplications likely contributed to the expansion and evolution of the PtHMAs. Most of the HMA genes contained abiotic stress-related cis-elements. Tissue-specific expression of PtHMA genes showed that PtHMA1 and PtHMA4 had relatively high expression levels in the leaves, whereas Cu/Ag subgroup (PtHMA5.1- PtHMA8 genes were upregulated in the roots. High concentrations of Cu, Ag, Zn, Cd, Co, Pb and Mn differentially regulated the expression of PtHMAs in various tissues. The preliminary results of the present study generated basic information on the HMA family of Populus that may serve as foundation for future functional studies.

  5. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Directory of Open Access Journals (Sweden)

    Joachim W Bargsten

    Full Text Available As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes. The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  6. Patient and family member perspectives on searching for cancer clinical trials: A qualitative interview study.

    Science.gov (United States)

    Ridgeway, Jennifer L; Asiedu, Gladys B; Carroll, Katherine; Tenney, Meaghan; Jatoi, Aminah; Radecki Breitkopf, Carmen

    2017-02-01

    Clinical trials are vital in the context of ovarian cancer and may offer further treatment options during disease recurrence, yet enrollment remains low. Understanding patient and family member experiences with identifying trials can inform engagement and education efforts. Interviews were conducted with 33 patients who had experience with clinical trial conversations and 39 nominated family members. Thematic analysis examined experiences and generated findings for clinical practice. Trial conversations with providers at diagnosis were uncommon and often overwhelming. Most participants delayed engagement until later in the disease course. With hindsight, though, some wished they considered trials earlier. Difficulty identifying appropriate trials led some to defer searching to providers, but then they worried about missed opportunities. Most family members felt unqualified to search. Trial conversations during clinical encounters should start early and include specifying search responsibilities of providers, patients, and family. Patients and family members can be engaged in searches but need guidance. Trials should be discussed throughout the disease course, even if patients are not ready to participate or are not making a treatment decision. Education should focus on identifying trials that meet search criteria. Transparency regarding each individual's role in identifying trials is critical. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Family members' experiences with intensive care unit diaries when the patient does not survive.

    Science.gov (United States)

    Johansson, Maria; Wåhlin, Ingrid; Magnusson, Lennart; Runeson, Ingrid; Hanson, Elizabeth

    2018-03-01

    The aim of the study was to explore how family members experienced the use of a diary when a relative does not survive the stay in the intensive care unit (ICU). A qualitative method with a hermeneutic approach was used. Nine participants who read/wrote eight diaries in total were interviewed. The collected data were analysed using a hermeneutic technique inspired by Geanellos. The analysis revealed an overall theme 'the diary was experienced as a bridge connecting the past with the future', which was a metaphor referring to the temporal aspect where there was the period with the diary up until the patient's death and then the postbereavement period. The diary contributed to both a rational and emotional understanding of the death of the patient and disclosed glimmers of light that still existed before the illness deteriorated. Further, the diary bridged the space between family members themselves and between family and nursing staff. It helped to maintain a feeling of togetherness and engagement in the care of the patient which family members found comforting. Family members of nonsurvivors had a need to have the ICU time explained and expressed. The diary might work as a form of 'survival kit' to gain coherence and understanding; to meet their needs during the hospital stay; and, finally, to act as a bereavement support by processing the death of the patient. © 2017 Nordic College of Caring Science.

  8. The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding.

    Science.gov (United States)

    Ayadi, M; Hanana, M; Kharrat, N; Merchaoui, H; Marzoug, R Ben; Lauvergeat, V; Rebaï, A; Mzid, R

    2016-10-01

    WRKY transcription factors belong to a large family of plant transcriptional regulators whose members have been reported to be involved in a wide range of biological roles including plant development, adaptation to environmental constraints and response to several diseases. However, little or poor information is available about WRKY's in Citrus. The recent release of completely assembled genomes sequences of Citrus sinensis and Citrus clementina and the availability of ESTs sequences from other citrus species allowed us to perform a genome survey for Citrus WRKY proteins. In the present study, we identified 100 WRKY members from C. sinensis (51), C. clementina (48) and Citrus unshiu (1), and analyzed their chromosomal distribution, gene structure, gene duplication, syntenic relation and phylogenetic analysis. A phylogenetic tree of 100 Citrus WRKY sequences with their orthologs from Arabidopsis has distinguished seven groups. The CsWRKY genes were distributed across all ten sweet orange chromosomes. A comprehensive approach and an integrative analysis of Citrus WRKY gene expression revealed variable profiles of expression within tissues and stress conditions indicating functional diversification. Thus, candidate Citrus WRKY genes have been proposed as potentially involved in fruit acidification, essential oil biosynthesis and abiotic/biotic stress tolerance. Our results provided essential prerequisites for further WRKY genes cloning and functional analysis with an aim of citrus crop improvement.

  9. Wheat Brassinosteroid-Insensitive1 (TaBRI1 Interacts with Members of TaSERK Gene Family and Cause Early Flowering and Seed Yield Enhancement in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Akanksha Singh

    Full Text Available Brassinosteroids (BRs hormones are important for plant growth, development and immune responses. They are sensed by the transmembrane receptor kinase Brassinosteroid-Insensitive 1 (BRI1 when they bind to its extracellular Leu-rich repeat (LRR domain. We cloned and characterized the TaBRI1 from T. aestivum and raised overexpression transgenics in Arabidopsis to decipher its functional role. TaBRI1 protein consists of a putative signal peptide followed by 25 leucine rich repeats (LRR, a transmembrane domain and a C-terminal kinase domain. The analysis determined the interaction of TaBRI1 with five members of the wheat Somatic Embryogenesis Receptor Kinase (TaSERKs gene family (TaSERK1, TaSERK2, TaSERK3, TaSERK4 and TaSERK5, at the plasma membrane. Furthermore, overexpression of TaBRI1 in Arabidopsis leads to the early flowering, increased silique size and seed yield. Root growth analysis of TaBRI1 overexpressing transgenic plants showed hypersensitivity to epi-brassinolide (epi-BL hormone in a dose-dependent manner. Interestingly, transgenic Arabidopsis plants show thermotolerance phenotype at the seedling stages as revealed by chlorophyll content, photosystem II activity and membrane stability. The transcriptome profiling on the basis of microarray analysis indicates up-regulation of several genes related to brassinosteroid signaling pathway, abiotic stress response, defense response and transcription factors. These studies predict the possible role of TaBRI1 gene in plant growth and development imparting tolerance to thermal stress.

  10. Genome-wide evolutionary characterization and expression analyses of major latex protein (MLP) family genes in Vitis vinifera.

    Science.gov (United States)

    Zhang, Ningbo; Li, Ruimin; Shen, Wei; Jiao, Shuzhen; Zhang, Junxiang; Xu, Weirong

    2018-04-27

    The major latex protein/ripening-related protein (MLP/RRP) subfamily is known to be involved in a wide range of biological processes of plant development and various stress responses. However, the biological function of MLP/RRP proteins is still far from being clear and identification of them may provide important clues for understanding their roles. Here, we report a genome-wide evolutionary characterization and gene expression analysis of the MLP family in European Vitis species. A total of 14 members, was found in the grape genome, all of which are located on chromosome 1, where are predominantly arranged in tandem clusters. We have noticed, most surprisingly, promoter-sharing by several non-identical but highly similar gene members to a greater extent than expected by chance. Synteny analysis between the grape and Arabidopsis thaliana genomes suggested that 3 grape MLP genes arose before the divergence of the two species. Phylogenetic analysis provided further insights into the evolutionary relationship between the genes, as well as their putative functions, and tissue-specific expression analysis suggested distinct biological roles for different members. Our expression data suggested a couple of candidate genes involved in abiotic stresses and phytohormone responses. The present work provides new insight into the evolution and regulation of Vitis MLP genes, which represent targets for future studies and inclusion in tolerance-related molecular breeding programs.

  11. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  12. A novel c.240_241insGG mutation in NDP gene in a family with Norrie disease.

    Science.gov (United States)

    Andarva, Monavvar; Jamshidi, Javad; Ghaedi, Hamid; Daftarian, Narsis; Emamalizadeh, Babak; Alehabib, Elham; Taghavi, Shaghyegh; Pouriran, Ramin; Darvish, Hossein

    2018-03-01

    Norrie disease (ND) is a rare, X-linked recessive disorder with the main characteristic of early childhood blindness. The aim of the present study was to identify the genetic cause of the disease and the phenotypic characteristics of the patients in an Iranian family with four affected males with ND. Norrie disease pseudoglioma (NDP) gene was sequenced and clinical examination was performed on patients. A GG dinucleotide insertion in exon 3 (c.240_241insGG) of NDP was detected in all patients. The mutation caused a frameshift and an early stop codon (p.Phe81Glyfs*23). A novel mutation was found in the NDP gene in the affected males of the family. As the mutation was absent in the normal male members of the family, it should be the genetic cause of the disease. © 2017 Optometry Australia.

  13. Gene structure, expression pattern and interaction of Nuclear Factor-Y family in castor bean (Ricinus communis).

    Science.gov (United States)

    Wang, Yue; Xu, Wei; Chen, Zexi; Han, Bing; Haque, Mohammad E; Liu, Aizhong

    2018-03-01

    Nuclear Factor-Y transcription factors, which function in regulating seed development (including storage reservoir accumulation) and responding to abiotic stresses, were identified and characterized in castor bean. Nuclear Factor-Y (NF-Y) transcription factors in plants contain three subunits (NF-YA, NF-YB and NF-YC), and function as a heterodimer or heterotrimer complex in regulating plant growth, development and response to stresses. Castor bean (Ricinus communis, Euphorbiaceae) one of the most economically important non-edible oilseed crops, able to grow in diverse soil conditions and displays high tolerance to abiotic stresses. Due to increasing demands for its seed oils, it is necessary to elucidate the molecular mechanism underlying the regulation of growth and development. Based on the available genome data, we identified 25 RcNF-Y members including six RcNF-YAs, 12 RcNF-YBs and seven RcNF-YCs, and characterized their gene structures. Yeast two-hybrid assays confirmed the protein-protein interactions among three subunits. Using transcriptomic data from different tissues, we found that six members were highly or specifically expressed in endosperms (in particular, two LEC1-type members RcNF-YB2 and RcNF-YB12), implying their involvement in regulating seed development and storage reservoir accumulation. Further, we investigated the expression changes of RcNF-Y members in two-week-old seedlings under drought, cold, hot and salt stresses. We found that the expression levels of 20 RcNF-Y members tested were changed and three RcNF-Y members might function in response to abiotic stresses. This study is the first reported on genomic characterization of NF-Y transcription factors in the family Euphorbiaceae. Our results provide the basis for improved understanding of how NF-Y genes function in the regulation of seed development and responses to abiotic stresses in both castor bean and other plants in this family.

  14. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  15. The SWEET gene family in Hevea brasiliensis - its evolution and expression compared with four other plant species.

    Science.gov (United States)

    Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong

    2017-12-01

    SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.

  16. Comprehensive genome-wide analysis of Glutathione S-transferase gene family in potato (Solanum tuberosum L.) and their expression profiling in various anatomical tissues and perturbation conditions.

    Science.gov (United States)

    Islam, Md Shiful; Choudhury, Mouraj; Majlish, Al-Nahian Khan; Islam, Tahmina; Ghosh, Ajit

    2018-01-10

    Glutathione S-transferases (GSTs) are ubiquitous enzymes which play versatile functions including cellular detoxification and stress tolerance. In this study, a comprehensive genome-wide identification of GST gene family was carried out in potato (Solanum tuberosum L.). The result demonstrated the presence of at least 90 GST genes in potato which is greater than any other reported species. According to the phylogenetic analyses of Arabidopsis, rice and potato GST members, GSTs could be subdivided into ten different classes and each class is found to be highly conserved. The largest class of potato GST family is tau with 66 members, followed by phi and lambda. The chromosomal localization analysis revealed the highly uneven distribution of StGST genes across the potato genome. Transcript profiling of 55 StGST genes showed the tissue-specific expression for most of the members. Moreover, expression of StGST genes were mainly repressed in response to abiotic stresses, while largely induced in response to biotic and hormonal elicitations. Further analysis of StGST gene's promoter identified the presence of various stress responsive cis-regulatory elements. Moreover, one of the highly stress responsive StGST members, StGSTU46, showed strong affinity towards flurazole with lowest binding energy of -7.6kcal/mol that could be used as antidote to protect crop against herbicides. These findings will facilitate the further functional and evolutionary characterization of GST genes in potato. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Genome-wide identification and analysis of the SBP-box family genes in apple (Malus × domestica Borkh.).

    Science.gov (United States)

    Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping

    2013-09-01

    SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  18. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  19. Predicting the number and sizes of IBD regions among family members and evaluating the family size requirement for linkage studies.

    Science.gov (United States)

    Yang, Wanling; Wang, Zhanyong; Wang, Lusheng; Sham, Pak-Chung; Huang, Peng; Lau, Yu Lung

    2008-12-01

    With genotyping of high-density single nucleotide polymorphisms (SNPs) replacing that of microsatellite markers in linkage studies, it becomes possible to accurately determine the genomic regions shared identity by descent (IBD) by family members. In addition to evaluating the likelihood of linkage for a region with the underlining disease (the LOD score approach), an appropriate question to ask is what would be the expected number and sizes of IBD regions among the affecteds, as there could be more than one region reaching the maximum achievable LOD score for a given family. Here, we introduce a computer program to allow the prediction of the total number of IBD regions among family members and their sizes. Reversely, it can be used to predict the portion of the genome that can be excluded from consideration according to the family size and user-defined inheritance mode and penetrance. Such information has implications on the feasibility of conducting linkage analysis on a given family of certain size and structure or on a few small families when interfamily homogeneity can be assumed. It can also help determine the most relevant members to be genotyped for such a study. Simulation results showed that the IBD regions containing true mutations are usually larger than regions IBD due to random chance. We have made use of this feature in our program to allow evaluation of the identified IBD regions based on Bayesian probability calculation and simulation results.

  20. Psychological crisis intervention for the family members of patients in a vegetative state

    Directory of Open Access Journals (Sweden)

    Ya-Hong Li

    2012-01-01

    Full Text Available OBJECTIVES: Family members of patients in a vegetative state have relatively high rates of anxiety and distress. It is important to recognize the problems faced by this population and apply psychological interventions to help them. This exploratory study describes the psychological stress experienced by family members of patients in a vegetative state. We discuss the effectiveness of a psychological crisis intervention directed at this population and offer suggestions for future clinical work. METHODS: A total of 107 family members of patients in a vegetative state were included in the study. The intervention included four steps: acquisition of facts about each family, sharing their first thoughts concerning the event, assessment of their emotional reactions and developing their coping abilities. The Symptom Check List-90 was used to evaluate the psychological distress of the participants at baseline and one month after the psychological intervention. Differences between the Symptom Check List-90 scores at the baseline and follow-up evaluations were analyzed. RESULTS: All participants in the study had significantly higher Symptom Check List-90 factor scores than the national norms at baseline. There were no significant differences between the intervention group and the control group at baseline. Most of the Symptom Check List-90 factor scores at the one-month follow-up evaluation were significantly lower than those at baseline for both groups; however, the intervention group improved significantly more than the control group on most subscales, including somatization, obsessive-compulsive behavior, depression, and anxiety. CONCLUSION: The results of this study indicate that the four-step intervention method effectively improves the mental health of the family members who received this treatment and lessens the psychological symptoms of somatization, obsessive-compulsive behavior, depression and anxiety.

  1. The impact of disease on family members: a critical aspect of medical care.

    Science.gov (United States)

    Golics, Catherine Jane; Basra, Mohammad Khurshid Azam; Finlay, Andrew Yule; Salek, Sam

    2013-10-01

    Most existing health-related quality of life research concerns the impact of disease on patients. However, in several medical specialties including dermatology, oncology, and physical and mental disability, studies have been carried out investigating the impact of disease on the lives of families of patients. The aim of this paper is to review the literature which relates to the impact of disease on family members of patients. The OVIDSP Medline was selected as the primary database, Searches were limited to sources published in English. 158 papers were identified for review. The definition of "family" varied across the literature, and a broad definition was accepted in this review. This review shows that a wide variety of aspects of family members' lives can be affected, including emotional, financial, family relationships, education and work, leisure time, and social activities. Many of these themes are linked to one another, with themes including financial impact and social impact being linked to emotional impact. Some positive aspects were also identified from the literature, including family relationships growing stronger. Several instruments exist to measure the impact of illness on the family, and most are disease or specialty- specific. The impact of disease on families of patients is often unrecognised and underestimated. Taking into account the quality of life of families as well as patients can offer the clinician a unique insight into issues such as family relationships and the effect of treatment decisions on the patient's close social group of partner and family.

  2. The spiritual struggle of anger toward God: a study with family members of hospice patients.

    Science.gov (United States)

    Exline, Julie J; Prince-Paul, Maryjo; Root, Briana L; Peereboom, Karen S

    2013-04-01

    Anger toward God is a common form of spiritual struggle, one that people often experience when they see God as responsible for severe harm or suffering. The aim of this study was to assess the prevalence, correlates, and preferred coping strategies associated with anger toward God among family members of hospice patients. Teams from a large hospice in the midwestern United States distributed surveys, one per household, to family members of home-care patients. The survey assessed feelings toward God (anger/disappointment and positive feelings), depressive symptoms, religiosity, and perceived meaning. Participants also rated their interest in various strategies for coping with conflicts with God. Surveys (n=134) indicated that 43% of participants reported anger/disappointment toward God, albeit usually at low levels of intensity. Anger toward God was associated with more depressive symptoms, lower religiosity, more difficulty finding meaning, and belief that the patient was experiencing greater pain. Prayer was the most highly endorsed strategy for managing conflicts with God. Other commonly endorsed strategies included reading sacred texts; handling the feelings on one's own; and conversations with friends, family, clergy, or hospice staff. Self-help resources and therapy were less popular options. Anger toward God is an important spiritual issue among family members of hospice patients, one that is commonly experienced and linked with depressive symptoms. It is valuable for hospice staff to be informed about the issue of anger toward God, especially because many family members reported interest in talking with hospice team members about such conflicts.

  3. Relationship between the depression status of patients with resectable non-small cell lung cancer and their family members in China.

    Science.gov (United States)

    Wu, Xian-Ning; Su, Dan; Li, Hui-Ping; Wang, Wei-Li; Wu, Wei-Qin; Yang, Ya-Juan; Yu, Feng-Lei; Zhang, Jing-Ping

    2013-10-01

    Less work on depression status has been done with family members of patients with non-small cell lung cancer (NSCLC). This study investigated depression status of patients and their family members; and the relationship of the depression status between these two groups. This cross-sectional study enrolled 194 patients diagnosed with non-small cell lung cancer as well as their family members. In this study, a self-administered General Information Questionnaire was used to collect general information and the Self-rating Depression Scale (SDS) to assess depression status. Linear correlation analysis was used to probe the relationship of the depression status between patients and their family members. Of the 194 patients, 148 (76.3%) showed symptoms of depression. 148 (76.3%) family members had depression symptoms. The severity of depression in patients was positively correlated with that of family members (r = 0.577, p family members suffered depression, and the two were correlated. A prospective study might prove helpful in determining the real relationship existing between the two groups' mental status and whether early detection and intervention might ameliorate this current situation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Rapid isolation of gene homologs across taxa: Efficient identification and isolation of gene orthologs from non-model organism genomes, a technical report

    Directory of Open Access Journals (Sweden)

    Heffer Alison

    2011-03-01

    Full Text Available Abstract Background Tremendous progress has been made in the field of evo-devo through comparisons of related genes from diverse taxa. While the vast number of species in nature precludes a complete analysis of the molecular evolution of even one single gene family, this would not be necessary to understand fundamental mechanisms underlying gene evolution if experiments could be designed to systematically sample representative points along the path of established phylogenies to trace changes in regulatory and coding gene sequence. This isolation of homologous genes from phylogenetically diverse, representative species can be challenging, especially if the gene is under weak selective pressure and evolving rapidly. Results Here we present an approach - Rapid Isolation of Gene Homologs across Taxa (RIGHT - to efficiently isolate specific members of gene families. RIGHT is based upon modification and a combination of degenerate polymerase chain reaction (PCR and gene-specific amplified fragment length polymorphism (AFLP. It allows targeted isolation of specific gene family members from any organism, only requiring genomic DNA. We describe this approach and how we used it to isolate members of several different gene families from diverse arthropods spanning millions of years of evolution. Conclusions RIGHT facilitates systematic isolation of one gene from large gene families. It allows for efficient gene isolation without whole genome sequencing, RNA extraction, or culturing of non-model organisms. RIGHT will be a generally useful method for isolation of orthologs from both distant and closely related species, increasing sample size and facilitating the tracking of molecular evolution of gene families and regulatory networks across the tree of life.

  5. A novel mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail ectodermal dysplasia (ECTD9) in a Pakistani family.

    Science.gov (United States)

    Khan, Anwar Kamal; Muhammad, Noor; Aziz, Abdul; Khan, Sher Alam; Shah, Khadim; Nasir, Abdul; Khan, Muzammil Ahmad; Khan, Saadullah

    2017-04-12

    Pure hair and nail ectodermal dysplasia (PHNED) is a congenital disorder of hair abnormalities and nail dysplasia. Both autosomal recessive and dominant inheritance fashion of PHNED occurs. In literature, to date, five different forms of PHNED have been reported at molecular level, having three genes known and two loci with no gene yet. In this study, a four generations consanguineous family of Pakistani origin with autosomal recessive PHNED was investigated. Affected members exhibited PHNED phenotypes with involvement of complete hair loss and nail dysplasia. To screen for mutation in the genes (HOXC13, KRT74, KRT85), its coding exons and exons-intron boundaries were sequenced. The 3D models of normal and mutated HOXC13 were predicted by using homology modeling. Through investigating the family to known loci, the family was mapped to ectodermal dysplasia 9 (ECTD9) loci with genetic address of 12q13.13. Mutation screening revealed a novel missense mutation (c.929A > C; p.Asn310Thr) in homeobox DNA binding domain of HOXC13 gene in affected members of the family. Due to mutation, loss of hydrogen bonding and difference in potential energy occurs, which may resulting in alteration of protein function. This is the first mutation reported in homeodomain, while 5 th mutation reported in HOXC13 gene causing PHNED.

  6. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  7. Difficult relationships--interactions between family members and staff in long-term care.

    Science.gov (United States)

    Norris, S

    2000-01-01

    Staff of long-term care facilities and family members have a common responsibility to ensure the best course of treatment and everyday care for residents who often cannot speak for themselves. Understanding the difference between instrumental and preservative care, and who the proper agent is to provide care in each category will not only improve staff/family interactions, but residential care in general. The Resident Enrichment and Activity Program improves the family/staff relationship obliquely by involving family in social activities; the Family Involvement in Care program, and the Patterns in Caregiving program directly target the relationship and involve the facility's administration to effect policy change.

  8. Genome-Wide Characterization and Expression Profiling of the AUXIN RESPONSE FACTOR (ARF) Gene Family in Eucalyptus grandis

    Science.gov (United States)

    Yu, Hong; Soler, Marçal; Mila, Isabelle; San Clemente, Hélène; Savelli, Bruno; Dunand, Christophe; Paiva, Jorge A. P.; Myburg, Alexander A.; Bouzayen, Mondher; Grima-Pettenati, Jacqueline; Cassan-Wang, Hua

    2014-01-01

    Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF) are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation. PMID:25269088

  9. Genome-wide characterization and expression profiling of the AUXIN RESPONSE FACTOR (ARF gene family in Eucalyptus grandis.

    Directory of Open Access Journals (Sweden)

    Hong Yu

    Full Text Available Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation.

  10. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development

    International Nuclear Information System (INIS)

    Gao, Junpeng; Cao, Xiaoli; Shi, Shandang; Ma, Yuling; Wang, Kai; Liu, Shengjie; Chen, Dan; Chen, Qin; Ma, Haoli

    2016-01-01

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. - Highlights: • A systematic analysis of the potato AUX/IAA gene family were performed. • StIAA genes were related to auxin perception and signal transduction. • Candidate StIAA genes likely related to tuber initiation and expansion were screened.

  11. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Junpeng [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Innovation Experimental College, Northwest A& F University, Yangling, Shaanxi 712100 (China); Cao, Xiaoli; Shi, Shandang [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Ma, Yuling [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Innovation Experimental College, Northwest A& F University, Yangling, Shaanxi 712100 (China); Wang, Kai; Liu, Shengjie [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Chen, Dan [School of Life Sciences and Technology, Xidian University, Xi' an, Shaanxi 710071 (China); Chen, Qin [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Ma, Haoli, E-mail: mahaoli@nwsuaf.edu.cn [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China)

    2016-03-04

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. - Highlights: • A systematic analysis of the potato AUX/IAA gene family were performed. • StIAA genes were related to auxin perception and signal transduction. • Candidate StIAA genes likely related to tuber initiation and expansion were screened.

  12. Post-Traumatic Stress Symptoms in Post-ICU Family Members: Review and Methodological Challenges.

    Science.gov (United States)

    Petrinec, Amy B; Daly, Barbara J

    2016-01-01

    Family members of intensive care unit (ICU) patients are at risk for symptoms of post-traumatic stress disorder (PTSD) following ICU discharge. The aim of this systematic review is to examine the current literature regarding post-ICU family PTSD symptoms with an emphasis on methodological issues in conducting research on this challenging phenomenon. An extensive review of the literature was performed confining the search to English language studies reporting PTSD symptoms in adult family members of adult ICU patients. Ten studies were identified for review published from 2004 to 2012. Findings demonstrate a significant prevalence of family PTSD symptoms in the months following ICU hospitalization. However, there are several methodological challenges to the interpretation of existing studies and to the conduct of future research including differences in sampling, identification of risk factors and covariates of PTSD, and lack of consensus regarding the most appropriate PTSD symptom measurement tools and timing. © The Author(s) 2014.

  13. Expression of activator protein-1 (AP-1) family members in breast cancer

    International Nuclear Information System (INIS)

    Kharman-Biz, Amirhossein; Gao, Hui; Ghiasvand, Reza; Zhao, Chunyan; Zendehdel, Kazem; Dahlman-Wright, Karin

    2013-01-01

    The activator protein-1 (AP-1) transcription factor is believed to be important in tumorigenesis and altered AP-1 activity was associated with cell transformation. We aimed to assess the potential role of AP-1 family members as novel biomarkers in breast cancer. We studied the expression of AP-1 members at the mRNA level in 72 primary breast tumors and 37 adjacent non-tumor tissues and evaluated its correlation with clinicopathological parameters including estrogen receptor (ER), progesterone receptor (PR) and HER2/neu status. Expression levels of Ubiquitin C (UBC) were used for normalization. Protein expression of AP-1 members was assessed using Western blot analysis in a subset of tumors. We used student’s t-test, one-way ANOVA, logistic regression and Pearson’s correlation coefficient for statistical analyses. We found significant differences in the expression of AP-1 family members between tumor and adjacent non-tumor tissues for all AP-1 family members except Fos B. Fra-1, Fra-2, Jun-B and Jun-D mRNA levels were significantly higher in tumors compared to adjacent non-tumor tissues (p < 0.001), whilst c-Fos and c-Jun mRNA levels were significantly lower in tumors compared with adjacent non-tumor tissues (p < 0.001). In addition, Jun-B overexpression had outstanding discrimination ability to differentiate tumor tissues from adjacent non-tumor tissues as determined by ROC curve analysis. Moreover, Fra-1 was significantly overexpressed in the tumors biochemically classified as ERα negative (p = 0.012) and PR negative (p = 0.037). Interestingly, Fra-1 expression was significantly higher in triple-negative tumors compared with luminal carcinomas (p = 0.01). Expression levels of Fra-1 and Jun-B might be possible biomarkers for prognosis of breast cancer

  14. The needs of family members of intensive care unit patients: A ...

    African Journals Online (AJOL)

    ARTICLE. 44 SAJCC November 2016, Vol. 32, No. 2. The needs of family members of intensive care unit patients: A ... loved one will be survival, disability or death.[1] .... the participants of this study (the constructivist paradigm, which was.

  15. The evolutionary history of the SAL1 gene family in eutherian mammals

    Directory of Open Access Journals (Sweden)

    Callebaut Isabelle

    2011-05-01

    Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.

  16. Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

    Science.gov (United States)

    Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

    2010-01-01

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

  17. The Importance of Older Family Members in Providing Social Resources and Promoting Cancer Screening in Families with a Hereditary Cancer Syndrome

    Science.gov (United States)

    Ashida, Sato; Hadley, Donald W.; Goergen, Andrea F.; Skapinsky, Kaley F.; Devlin, Hillary C.; Koehly, Laura M.

    2011-01-01

    Purpose: This study evaluates the role of older family members as providers of social resources within familial network systems affected by an inherited cancer susceptibility syndrome. Design and Methods: Respondents who previously participated in a study that involved genetic counseling and testing for Lynch syndrome and their family network…

  18. Marriage and family therapy faculty members' balance of work and personal life.

    Science.gov (United States)

    Matheson, Jennifer L; Rosen, Karen H

    2012-04-01

    A sense of imbalance is common among both professors and therapists, though few studies have been published examining the work and personal life balance of those who work in both professions simultaneously. Using in-depth telephone interviews, this study examined the work and personal life balance of 16 marriage and family therapy (MFT) faculty members. Results showed that six were satisfied with their balance, six were dissatisfied, and four were "middle of the road." Men, older participants, and those who were in their career longer were more likely to report feeling satisfied with their balance. Internal indicators of their balance included family and workplace messages, health indicators, feelings of contentment, and congruence with personal values. Child and relationship status, tenure status, and gender issues also impacted their sense of balance. Specific balance enhancers and reducers were highlighted, and participants discussed coping strategies and recommendations for other MFT faculty members. Clinical, training, and career implications are discussed. © 2010 American Association for Marriage and Family Therapy.

  19. Most important needs of family members of critical patients in light of the critical care family needs inventory.

    Science.gov (United States)

    Padilla Fortunatti, Cristóbal Felipe

    2014-01-01

    This work sought to identify the most important needs for family members of adult critical patients as described in the literature pursuant to the dimensions established in the "Critical Care Family Needs Inventory" (CCFNI) by Molter and Leske. A literature review was carried out by using the CCFNI instrument. The databases used were: Pubmed, CINAHL, Proquest Nursing & Allied Health Source, Proquest Psychology Journals, LILACS, Science Direct, Ovid SP, PsyicINFO, and SciELO. The following limitations for the search were identified: adult patients, articles in English and Spanish, with abstract and complete text available and which had been published from 2003 to June 2013; 15 articles were included. The family's hope on desired results and sincere communication with the healthcare staff turned out to be the most relevant needs, while the least important were related to comfort and having support structures or systems. Most of the studies were conducted in Asia and North America revealing differences in the order of importance assigned to each necessity. Certain sociodemographic and cultural characteristics impact upon how family members rank their needs; this also occurs with the nature of the most important needs for the family and the factors determining their prioritization. The articles included in this review mention the frequent interaction with the family and their holistic view of the person beyond the illness, determine that nurses are the most appropriate professionals to know and satisfy the family needs of critical patients.

  20. Most Important Needs of Family Members of Critical Patients in Light of the Critical Care Family Needs Inventory

    Directory of Open Access Journals (Sweden)

    Cristóbal Felipe Padilla Fortunatti

    2014-07-01

    Full Text Available Objective. This work sought to identify the most important needs for family members of adult critical patients as described in the literature pursuant to the dimensions established in the "Critical Care Family Needs Inventory" (CCFNI by Molter and Leske. Methodology. A literature review was carried out by using the CCFNI instrument. The databases used were: Pubmed, CINAHL, Proquest Nursing & Allied Health Source, Proquest Psychology Journals, LILACS, Science Direct, Ovid SP, PsyicINFO, and SciELO. The following limitations for the search were identified: adult patients, articles in English and Spanish, with abstract and complete text available and which had been published from 2003 to June 2013; 15 articles were included. Results. The family's hope on desired results and sincere communication with the healthcare staff turned out to be the most relevant needs, while the least important were related to comfort and having support structures or systems. Most of the studies were conducted in Asia and North America revealing differences in the order of importance assigned to each necessity. Certain sociodemographic and cultural characteristics impact upon how family members rank their needs; this also occurs with the nature of the most important needs for the family and the factors determining their prioritization. Conclusion. The articles included in this review mention the frequent interaction with the family and their holistic view of the person beyond the illness, determine that nurses are the most appropriate professionals to know and satisfy the family needs of critical patients.

  1. Using a genetic test result in the care of family members: how does the duty of confidentiality apply?

    Science.gov (United States)

    Parker, Michael; Lucassen, Anneke

    2018-04-27

    The use of genetic and genomic testing is becoming more widespread in healthcare and more inherited explanations for family history of diseases or conditions are being uncovered. Currently, relevant genetic information is not always used in the care of family members who might benefit from it, because of health professionals' fears of inappropriately breaching another family member's confidence. Such examples are likely to increase as testing possibilities expand. Here we present the case for use of familial information in the care and treatment of family members. We argue that whilst a clinical diagnosis in person A is confidential, the discovery of a familial factor that led to this diagnosis should be available for use in depersonalised form by health professionals to inform the testing and clinical care of other family members. The possibility of such use should be made clear in clinical practice at the time of initial testing, but should not require consent from the person in whom the familial factor was first identified. We call for further debate on these questions in the wake of high profile non-disclosure of genetic information cases, and forthcoming Data Protection legislation changes.

  2. The KDM5 family is required for activation of pro-proliferative cell cycle genes during adipocyte differentiation

    DEFF Research Database (Denmark)

    Brier, Ann-Sofie B; Loft, Anne; Madsen, Jesper G S

    2017-01-01

    The KDM5 family of histone demethylases removes the H3K4 tri-methylation (H3K4me3) mark frequently found at promoter regions of actively transcribed genes and is therefore generally considered to contribute to corepression. In this study, we show that knockdown (KD) of all expressed members...... of the KDM5 family in white and brown preadipocytes leads to deregulated gene expression and blocks differentiation to mature adipocytes. KDM5 KD leads to a considerable increase in H3K4me3 at promoter regions; however, these changes in H3K4me3 have a limited effect on gene expression per se. By contrast......, genome-wide analyses demonstrate that KDM5A is strongly enriched at KDM5-activated promoters, which generally have high levels of H3K4me3 and are associated with highly expressed genes. We show that KDM5-activated genes include a large set of cell cycle regulators and that the KDM5s are necessary...

  3. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  4. A genetic diagnosis of maturity-onset diabetes of the young (MODY): experiences of patients and family members.

    Science.gov (United States)

    Bosma, A R; Rigter, T; Weinreich, S S; Cornel, M C; Henneman, L

    2015-10-01

    Genetic testing for maturity-onset diabetes of the young (MODY) facilitates a correct diagnosis, enabling treatment optimization and allowing monitoring of asymptomatic family members. To date, the majority of people with MODY remain undiagnosed. To identify patients' needs and areas for improving care, this study explores the experiences of patients and family members who have been genetically tested for MODY. Fourteen semi-structured interviews with patients and the parents of patients, and symptomatic and asymptomatic family members were conducted. Atlas.ti was used for thematic analysis. Most people with MODY were initially misdiagnosed with Type 1 or Type 2 diabetes; they had been seeking for the correct diagnosis for a long time. Reasons for having a genetic test included reassurance, removing the uncertainty of developing diabetes (in asymptomatic family members) and informing relatives. Reasons against testing were the fear of genetic discrimination and not having symptoms. Often a positive genetic test result did not come as a surprise. Both patients and family members were satisfied with the decision to get tested because it enabled them to adjust their lifestyle and treatment accordingly. All participants experienced a lack of knowledge of MODY among healthcare professionals, in their social environment and in patient organizations. Additionally, problems with the reimbursement of medical expenses were reported. Patients and family members are generally positive about genetic testing for MODY. More education of healthcare professionals and attention on the part of diabetes organizations is needed to increase awareness and optimize care and support for people with MODY. © 2015 The Authors. Diabetic Medicine © 2015 Diabetes UK.

  5. Asking the Stakeholders: Perspectives of Individuals With Aphasia, Their Family Members, and Physicians Regarding Communication in Medical Interactions.

    Science.gov (United States)

    Burns, Michael; Baylor, Carolyn; Dudgeon, Brian J; Starks, Helene; Yorkston, Kathryn

    2015-08-01

    The purpose of this study was to explore the experiences of patients with aphasia, their family members, and physicians related to communication during medical interactions. Face-to-face, semistructured interviews were conducted with 18 participants—6 patients with aphasia, 6 family members involved in patient care, and 6 practicing physicians. A qualitative description approach was used to collect and summarize narratives from participants' perspectives and experiences. Participants were asked about experiences with communication during medical interactions in which the family member accompanied the patient. Interviews were audio- and/or video-recorded, transcribed, and then coded to identify main themes. Patients and family members generally described their communication experiences as positive, yet all participants discussed challenges and frustrations. Three themes emerged: (a) patients and family members work as a team, (b) patients and family members want physicians to "just try" to communicate with the patient, and (c) physicians want to interact with patients but may not know how. Participants discussed the need for successful accommodation, or changing how one communicates, to help facilitate the patients' increased understanding and ability to express themselves. Over- and underaccommodation with communication were commonly reported as problems. Speech-language pathologists have a role to play in helping to improve communication during medical interactions. Implications for current speech-language pathologist practice and future directions of research are discussed.

  6. Family Members' Views on Seeking Placement in State-Supported Living Centers in Texas

    Science.gov (United States)

    Colvin, Alex D.; Larke, Patricia J.

    2013-01-01

    This study investigated the factors that influence family members' decisions to seek placement for relatives with intellectual and/or developmental disabilities (ID/DD) into state-supported living centers in Texas. The sample included 51 family caregivers between the ages of 26 and 95. Using descriptive statistics, correlation, and inferential…

  7. Screening of a healthy newborn identifies three adult family members with symptomatic glutaric aciduria type I

    Directory of Open Access Journals (Sweden)

    MCH Janssen

    2014-06-01

    Full Text Available We report three adult sibs (one female, two males with symptomatic glutaric acidura type I, who were diagnosed after a low carnitine level was found by newborn screening in a healthy newborn of the women. All three adults had low plasma carnitine, elevated glutaric acid levels and pronounced 3-hydroxyglutaric aciduria. The diagnosis was confirmed by undetectable glutaryl-CoA dehydrogenase activity in lymphocytes and two pathogenic heterozygous mutations in the GCDH gene (c.1060A>G, c.1154C>T. These results reinforce the notion that abnormal metabolite levels in newborns may lead to the diagnosis of adult metabolic disease in the mother and potentially other family members.

  8. Microevolution of Virulence-Related Genes in Helicobacter pylori Familial Infection.

    Directory of Open Access Journals (Sweden)

    Yoshikazu Furuta

    Full Text Available Helicobacter pylori, a bacterial pathogen that can infect human stomach causing gastritis, ulcers and cancer, is known to have a high degree of genome/epigenome diversity as the result of mutation and recombination. The bacteria often infect in childhood and persist for the life of the host. One of the reasons of the rapid evolution of H. pylori is that it changes its genome drastically for adaptation to a new host. To investigate microevolution and adaptation of the H. pylori genome, we undertook whole genome sequencing of the same or very similar sequence type in multi-locus sequence typing (MLST with seven genes in members of the same family consisting of parents and children in Japan. Detection of nucleotide substitutions revealed likely transmission pathways involving children. Nonsynonymous (amino acid changing mutations were found in virulence-related genes (cag genes, vacA, hcpDX, tnfα, ggt, htrA and the collagenase gene, outer membrane protein (OMP genes and other cell surface-related protein genes, signal transduction genes and restriction-modification genes. We reconstructed various pathways by which H. pylori can adapt to a new human host, and our results raised the possibility that the mutational changes in virulence-related genes have a role in adaptation to a child host. Changes in restriction-modification genes might remodel the methylome and transcriptome to help adaptation. This study has provided insights into H. pylori transmission and virulence and has implications for basic research as well as clinical practice.

  9. Interprofessional collaboration and family member involvement in intensive care units: emerging themes from a multi-sited ethnography.

    Science.gov (United States)

    Reeves, Scott; McMillan, Sarah E; Kachan, Natasha; Paradis, Elise; Leslie, Myles; Kitto, Simon

    2015-05-01

    This article presents emerging findings from the first year of a two-year study, which employed ethnographic methods to explore the culture of interprofessional collaboration (IPC) and family member involvement in eight North American intensive care units (ICUs). The study utilized a comparative ethnographic approach - gathering observation, interview and documentary data relating to the behaviors and attitudes of healthcare providers and family members across several sites. In total, 504 hours of ICU-based observational data were gathered over a 12-month period in four ICUs based in two US cities. In addition, 56 semi-structured interviews were undertaken with a range of ICU staff (e.g. nurses, doctors and pharmacists) and family members. Documentary data (e.g. clinical guidelines and unit policies) were also collected to help develop an insight into how the different sites engaged organizationally with IPC and family member involvement. Directed content analysis enabled the identification and categorization of major themes within the data. An interprofessional conceptual framework was utilized to help frame the coding for the analysis. The preliminary findings presented in this paper illuminate a number of issues related to the nature of IPC and family member involvement within an ICU context. These findings are discussed in relation to the wider interprofessional and health services literature.

  10. Organization and evolution of the rat tyrosine hydroxylase gene

    International Nuclear Information System (INIS)

    Brown, E.R.; Coker, G.T. III; O'Malley, K.L.

    1987-01-01

    This report describes the organization of the rat tyrosine hydroxylase (TH) gene and compares its structure with the human phenylalanine hydroxylase gene. Both genes are single copy and contain 13 exons separated by 12 introns. Remarkably, the positions of 10 out 12 intron/exon boundaries are identical for the two genes. These results support the idea that these hydroxylases genes are members of a gene family which has a common evolutionary origin. The authors predict that this ancestral gene would have encoded exons similar to those of TH prior to evolutionary drift to other members of this gene family

  11. Cartilage acidic protein 1, a new member of the beta-propeller protein family with amyloid propensity.

    Science.gov (United States)

    Anjos, Liliana; Morgado, Isabel; Guerreiro, Marta; Cardoso, João C R; Melo, Eduardo P; Power, Deborah M

    2017-02-01

    Cartilage acidic protein1 (CRTAC1) is an extracellular matrix protein of chondrogenic tissue in humans and its presence in bacteria indicate it is of ancient origin. Structural modeling of piscine CRTAC1 reveals it belongs to the large family of beta-propeller proteins that in mammals have been associated with diseases, including amyloid diseases such as Alzheimer's. In order to characterize the structure/function evolution of this new member of the beta-propeller family we exploited the unique characteristics of piscine duplicate genes Crtac1a and Crtac1b and compared their structural and biochemical modifications with human recombinant CRTAC1. We demonstrate that CRTAC1 has a beta-propeller structure that has been conserved during evolution and easily forms high molecular weight thermo-stable aggregates. We reveal for the first time the propensity of CRTAC1 to form amyloid-like structures, and hypothesize that the aggregating property of CRTAC1 may be related to its disease-association. We further contribute to the general understating of CRTAC1's and beta-propeller family evolution and function. Proteins 2017; 85:242-255. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. Payment or reimbursement for certain medical expenses for Camp Lejeune family members. Interim final rule.

    Science.gov (United States)

    2014-09-24

    The Department of Veterans Affairs (VA) is promulgating regulations to implement statutory authority to provide payment or reimbursement for hospital care and medical services provided to certain veterans' family members who resided at Camp Lejeune, North Carolina, for at least 30 days during the period beginning on January 1, 1957, and ending on December 31, 1987. Under this rule, VA will reimburse family members, or pay providers, for medical expenses incurred as a result of certain illnesses and conditions that may be attributed to exposure to contaminated drinking water at Camp Lejeune during this time period. Payment or reimbursement will be made within the limitations set forth in statute and Camp Lejeune family members will receive hospital care and medical services that are consistent with the manner in which we provide hospital care and medical services to Camp Lejeune veterans.

  13. Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

    Science.gov (United States)

    Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

    2010-01-01

    Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

  14. Care and caring in the intensive care unit: Family members' distress and perceptions about staff skills, communication, and emotional support.

    Science.gov (United States)

    Carlson, Eve B; Spain, David A; Muhtadie, Luma; McDade-Montez, Liz; Macia, Kathryn S

    2015-06-01

    Family members of intensive care unit (ICU) patients are sometimes highly distressed and report lower satisfaction with communication and emotional support from staff. Within a study of emotional responses to traumatic stress, associations between family distress and satisfaction with aspects of ICU care were investigated. In 29 family members of trauma patients who stayed in an ICU, we assessed symptoms of depression and posttraumatic stress disorder (PTSD) during ICU care. Later, family members rated staff communication, support, and skills and their overall satisfaction with ICU care. Ratings of staff competence and skills were significantly higher than ratings of frequency of communication, information needs being met, and support. Frequency of communication and information needs being met were strongly related to ratings of support (rs = .75-.77) and staff skills (rs = .77-.85), and aspects of satisfaction and communication showed negative relationships with symptoms of depression (rs = -.31 to -.55) and PTSD (rs = -.17 to -.43). Although satisfaction was fairly high, family member distress was negatively associated with several satisfaction variables. Increased understanding of the effects of traumatic stress on family members may help staff improve communication and increase satisfaction of highly distressed family members. Published by Elsevier Inc.

  15. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  16. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  17. The process of death imminence awareness by family members of patients in adult critical care.

    Science.gov (United States)

    Baumhover, Nancy C

    2015-01-01

    A focus on cost-effective quality end-of-life care remains a high priority in adult critical care given an aging population, high prevalence of death, and aggressive technologies used to extend or sustain life in this setting. A Glaserian grounded theory design was used to conduct this retrospective study to yield a substantive middle-range theory. The data source was semistructured interviews with 14 family members of decedents who died 6 to 60 months prior to the study. The purpose of this study was to generate a theory on how family members of patients in adult critical care come to realize that their loved one is dying. The Process of Death Imminence Awareness by Family Members of Patients in Adult Critical Care middle-range theory contained 6 phases: (1) patient's near-death awareness, (2) dying right in front of me, (3) turning points in the patient's condition, (4) no longer the person I once knew, (5) doing right by them, and (6) time to let go. Patient's near-death awareness preceded all other phases, if communicated by the decedent with their family. Then, family members iteratively moved through all the other key phases in the process until a time to let go became evident. This substantive middle-range theory will guide nursing education, practice, and research aimed at providing quality and cost-effective end-of-life care in adult critical care.

  18. A novel missense mutation of the paired box 3 gene in a Turkish family with Waardenburg syndrome type 1.

    Science.gov (United States)

    Hazan, Filiz; Ozturk, A Taylan; Adibelli, Hamit; Unal, Nurettin; Tukun, Ajlan

    2013-01-01

    Screening of mutations in the paired box 3 (PAX3) gene in three generations of a Turkish family with Waardenburg syndrome type 1 (WS1). WS1 was diagnosed in a 13-month-old girl according to the WS Consortium criteria. Detailed family history of the proband revealed eight affected members in three generations. Routine clinical and audiological examination and ophthalmologic evaluation were performed on eight affected and five healthy members of the study family. Dystopia canthorum was detected in all affected patients; however, a brilliant blue iris was present in five patients who also had mild retinal hypopigmentation. Genomic DNA was extracted from the peripheral blood of affected and unaffected individuals in the family as well as 50 unrelated healthy volunteers. All coding exons and adjacent intronic regions of PAX3 were sequenced directly. A novel missense heterozygous c.788T>G mutation was identified in eight patients. This nucleotide alteration was not found in unaffected members of the study family or in the 50 unrelated control subjects. The mutation causes V263G amino-acid substitution in the homeodomain of the PAX3 protein, which represents the 45(th) residue of helix 3. We identified a novel missense c.788T>G mutation in PAX3 in a family with Waardenburg syndrome with intrafamilial phenotypic heterogeneity.

  19. Defining the Medical Intensive Care Unit in the Words of Patients and Their Family Members: A Freelisting Analysis.

    Science.gov (United States)

    Auriemma, Catherine L; Lyon, Sarah M; Strelec, Lauren E; Kent, Saida; Barg, Frances K; Halpern, Scott D

    2015-07-01

    No validated conceptual framework exists for understanding the outcomes of patient- and family-centered care in critical care. To explore the meaning of intensive care unit among patients and their families by using freelisting. The phrase intensive care unit was used to prompt freelisting among intensive care unit patients and patients' family members. Freelisting is an anthropological technique in which individuals define a domain by listing all words that come to mind in response to a topic. Salience scores, derived from the frequency with which a word was mentioned, the order in which it was mentioned, and the length of each list, were calculated and analyzed. Among the 45 participants, many words were salient to both patients and patients' family members. Words salient solely for patients included consciousness, getting better, noisy, and personal care. Words salient solely for family members included sadness, busy, professional, and hope. The words suffering, busy, and team were salient solely for family members of patients who lived, whereas sadness, professionals, and hope were salient solely for family members of patients who died. The words caring and death were salient for both groups. Intensive care unit patients and their families define intensive care unit by using words to describe sickness, caring, medical staff, emotional states, and physical qualities of the unit. The results validate the importance of these topics among patients and their families in the intensive care unit and illustrate the usefulness of freelisting in critical care research. ©2015 American Association of Critical-Care Nurses.

  20. Family members' caregiving situations in palliative home care when sitting service is received: The understanding of multiple realities.

    Science.gov (United States)

    Wallerstedt, Birgitta; Andershed, Birgitta; Benzein, Eva

    2014-12-01

    To deepen the understanding of the variation of complexity in family members' caregiving situations, when the private home is the place for care, dying, and sitting service. Seven relatives to a deceased family member from four different families were interviewed twice. Data were analyzed by direct interpretation and categorical aggregation. Various patterns of becoming a caregiver were showed, but family members' willingness to become family caregivers was strongly related to fulfilling the dying persons' wishes to be cared for in their own homes. Important factors for coping with the caregiving situation were their needs of support, the possibility to prepare for death related to a need of communication and planning, the length and predictability of the illness trajectory, and experiences of losses and grief. Sitting service was experienced as supportive for family caregivers when they had possibility to hand over care responsibilities, but as non-supportive when expected help not was received. Family members' experiences of caregiving and their degree of vulnerability must be different, depending on whether it is a self-selected position or an imposed task. In general, family members in this study were willing to participate in caregiving for end-of life care, but subject to their own conditions. One way to decrease vulnerability is to assess the resources and competence in relation to the responsibility the person is expected to assume. The support and other efforts to help family caregivers must be related to their specific needs and reality, not only to what the care organization can offer as a standard solution.

  1. Qualitative systematic review: the unique experiences of the nurse-family member when a loved one is admitted with a critical illness.

    Science.gov (United States)

    Giles, Tracey M; Hall, Karen L

    2014-07-01

    To interpret and synthesize nurse-family member experiences when a critically ill loved one is admitted to hospital. Having a family member hospitalized in a critical condition is an important stressor. When the family member is also a nurse, the provision of care is more complex, yet little research exists on this issue. Systematic review using Thomas and Harden's approach to thematic synthesis of qualitative research. Primary studies were located by searching CINAHL, Proquest, Journals@Ovid, SCOPUS, Cochrane Library and Google Scholar. No date restrictions were applied due to a lack of relevant literature. All studies that met inclusion criteria were retrieved (n = 1717) and seven met the review aim. Following critical appraisal, seven studies from 1999-2011 describing the nurse-family member's experience were reviewed and synthesized. Six characteristics of the nurse-family member experience were identified: specialized knowledge; dual-role conflicts; competing expectations; building relationships; being 'let in'; and healthcare setting. Nurse-family members experience important stressors that can negatively affect their psychological health and experience as a healthcare consumer. Nurse-family members want a different type of care than other healthcare consumers. Acknowledging nurse-family members' specialized knowledge and dual role, keeping them fully informed and allowing them to be with the patient and feel in control can reduce their fear and anxiety. Further research is needed to develop a deeper understanding of the unique experiences, challenges and needs of nurse-family members to provide them with an enhanced level of care. © 2013 John Wiley & Sons Ltd.

  2. Preferences of Current and Potential Patients and Family Members Regarding Implementation of Electronic Communication Portals in Intensive Care Units.

    Science.gov (United States)

    Brown, Samuel M; Bell, Sigall K; Roche, Stephanie D; Dente, Erica; Mueller, Ariel; Kim, Tae-Eun; O'Reilly, Kristin; Lee, Barbara Sarnoff; Sands, Ken; Talmor, Daniel

    2016-03-01

    The quality of communication with patients and family members in intensive care units (ICUs) is a focus of current interest for clinical care improvement. Electronic communication portals are commonly used in other healthcare settings to improve communication. We do not know whether patients and family members desire such portals in ICUs, and if so, what functionality they should provide. To define interest in and desired elements of an electronic communication portal among current and potential ICU patients and their family members. We surveyed, via an Internet panel, 1,050 English-speaking adults residing in the United States with a personal or family history of an ICU admission within 10 years (cohort A) and 1,050 individuals without a history of such admission (cohort B). We also administered a survey instrument in person to 105 family members of patients currently admitted to ICUs at an academic medical center in Boston (cohort C). Respondents, especially current ICU family members, supported an electronic communication portal, including access via an electronic tablet. They wanted at least daily updates, one-paragraph summaries of family meetings including a list of key decisions made, and knowledge of the role and experience of treating clinicians. Overall, they preferred detailed rather than "big picture" information. Respondents were generally comfortable sharing information with their family members. Preferences regarding a communication portal varied significantly by age, sex, ethnicity, and prior experience with ICU hospitalization. Electronic communication portals appear welcome in contemporary ICUs. Frequent updates, knowledge about the professional qualifications of clinicians, detailed medical information, and documentation of family meetings are particularly desired.

  3. Members of a large retroposon family are determinants of post-transcriptional gene expression in Leishmania.

    Directory of Open Access Journals (Sweden)

    Frédéric Bringaud

    2007-09-01

    Full Text Available Trypanosomatids are unicellular protists that include the human pathogens Leishmania spp. (leishmaniasis, Trypanosoma brucei (sleeping sickness, and Trypanosoma cruzi (Chagas disease. Analysis of their recently completed genomes confirmed the presence of non-long-terminal repeat retrotransposons, also called retroposons. Using the 79-bp signature sequence common to all trypanosomatid retroposons as bait, we identified in the Leishmania major genome two new large families of small elements--LmSIDER1 (785 copies and LmSIDER2 (1,073 copies--that fulfill all the characteristics of extinct trypanosomatid retroposons. LmSIDERs are approximately 70 times more abundant in L. major compared to T. brucei and are found almost exclusively within the 3'-untranslated regions (3'UTRs of L. major mRNAs. We provide experimental evidence that LmSIDER2 act as mRNA instability elements and that LmSIDER2-containing mRNAs are generally expressed at lower levels compared to the non-LmSIDER2 mRNAs. The considerable expansion of LmSIDERs within 3'UTRs in an organism lacking transcriptional control and their role in regulating mRNA stability indicate that Leishmania have probably recycled these short retroposons to globally modulate the expression of a number of genes. To our knowledge, this is the first example in eukaryotes of the domestication and expansion of a family of mobile elements that have evolved to fulfill a critical cellular function.

  4. Chemotherapy treatment decision-making experiences of older adults with cancer, their family members, oncologists and family physicians: a mixed methods study.

    Science.gov (United States)

    Puts, Martine T E; Sattar, Schroder; McWatters, Kara; Lee, Katherine; Kulik, Michael; MacDonald, Mary-Ellen; Jang, Raymond; Amir, Eitan; Krzyzanowska, Monika K; Leighl, Natasha; Fitch, Margaret; Joshua, Anthony M; Warde, Padraig; Tourangeau, Ann E; Alibhai, Shabbir M H

    2017-03-01

    Although comorbidities, frailty, and functional impairment are common in older adults (OA) with cancer, little is known about how these factors are considered during the treatment decision-making process by OAs, their families, and health care providers. Our aim was to better understand the treatment decision process from all these perspectives. A mixed methods multi-perspective longitudinal study using semi-structured interviews and surveys with 29 OAs aged ≥70 years with advanced prostate, breast, colorectal, or lung cancer, 24 of their family members,13 oncologists, and 15 family physicians was conducted. The sample was stratified on age (70-79 and 80+). All interviews were analyzed using thematic analysis. There was no difference in the treatment decision-making experience based on age. Most OAs felt that they should have the final say in the treatment decision, but strongly valued their oncologists' opinion. "Trust in my oncologist" and "chemotherapy as the last resort to prolong life" were the most important reasons to accept treatment. Families indicated a need to improve communication between them, the patient and the specialist, particularly around goals of treatment. Comorbidity and potential side-effects did not play a major role in the treatment decision-making for patients, families, or oncologists. Family physicians reported no involvement in decisions but desired to be more involved. This first study using multiple perspectives showed neither frailty nor comorbidity played a role in the treatment decision-making process. Efforts to improve communication were identified as an opportunity that may enhance quality of care. In a mixed methods study multiple perspective study with older adults with cancer, their family members, their oncologist and their family physician we explored the treatment decision making process and found that most older adults were satisfied with their decision. Comorbidity, functional status and frailty did not impact the

  5. Mutation analysis of GJB2 gene and prenatal diagnosis in a non-syndromic deafness family

    Directory of Open Access Journals (Sweden)

    Xiao-hua CHEN

    2014-08-01

    Full Text Available Objective To identify the pathogenic gene in a non-syndromic deafness family, provide an accurate genetic consultation and early intervention for deaf family to reduce the incidence of congenital deafness. Methods Mutation analysis was carried out by polymerase chain reaction followed by DNA sequencing of coding region of GJB2 gene. The fetal DNA was extracted from the amniotic fluid cells by amniocentesis at 20 weeks during pregnancy. The genotype of the fetus was characterized for predicting the status of hearing. Results Complex heterozygous mutations 235delC and 176-191del16bp were detected in the proband of the family, heterozygous mutation 176-191del16bp was detected in the father, and 235delC was detected in the mother. Fetus carried 235delC heterozygous mutation inherited from his mother. Conclusions The proband's hearing loss is resulted from the complex heterozygous mutations 235delC and 176-191del16bp in GJB2 gene. Fetus is a heterozygous mutation 235delC carrier. Prenatal diagnosis for deafness assisted by genetic test can provide efficient guidance about offspring's hearing condition, and prevent another deaf-mute member from birth. DOI: 10.11855/j.issn.0577-7402.2014.07.09

  6. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  7. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Study of American and Chinese family members' evaluations on institutionalized care for their older parents: potential development in the future.

    Science.gov (United States)

    Li, Yushi; Buechel, Annie

    2007-01-01

    The evaluations on institutionalized care facilities from family members, after their loved ones moved into such services, are very different from culture to culture, family to family and person to person. According to a recent survey in the United States and China, it is found that different cultures and the different health conditions of the residents strongly influence family member's viewpoints on institutionalized care services. It is also found that the availability of the institutionalized care facilities plays a significant role, which strongly affects family members' evaluations on nursing home services.

  9. A compendium of transcription factor and Transcriptionally active protein coding gene families in cowpea (Vigna unguiculata L.).

    Science.gov (United States)

    Misra, Vikram A; Wang, Yu; Timko, Michael P

    2017-11-22

    Cowpea (Vigna unguiculata (L.) Walp.) is the most important food and forage legume in the semi-arid tropics of sub-Saharan Africa where approximately 80% of worldwide production takes place primarily on low-input, subsistence farm sites. Among the major goals of cowpea breeding and improvement programs are the rapid manipulation of agronomic traits for seed size and quality and improved resistance to abiotic and biotic stresses to enhance productivity. Knowing the suite of transcription factors (TFs) and transcriptionally active proteins (TAPs) that control various critical plant cellular processes would contribute tremendously to these improvement aims. We used a computational approach that employed three different predictive pipelines to data mine the cowpea genome and identified over 4400 genes representing 136 different TF and TAP families. We compare the information content of cowpea to two evolutionarily close species common bean (Phaseolus vulgaris), and soybean (Glycine max) to gauge the relative informational content. Our data indicate that correcting for genome size cowpea has fewer TF and TAP genes than common bean (4408 / 5291) and soybean (4408/ 11,065). Members of the GROWTH-REGULATING FACTOR (GRF) and Auxin/indole-3-acetic acid (Aux/IAA) gene families appear to be over-represented in the genome relative to common bean and soybean, whereas members of the MADS (Minichromosome maintenance deficient 1 (MCM1), AGAMOUS, DEFICIENS, and serum response factor (SRF)) and C2C2-YABBY appear to be under-represented. Analysis of the AP2-EREBP APETALA2-Ethylene Responsive Element Binding Protein (AP2-EREBP), NAC (NAM (no apical meristem), ATAF1, 2 (Arabidopsis transcription activation factor), CUC (cup-shaped cotyledon)), and WRKY families, known to be important in defense signaling, revealed changes and phylogenetic rearrangements relative to common bean and soybean that suggest these groups may have evolved different functions. The availability of detailed

  10. Characterization of the soybean GmALMT family genes and the function of GmALMT5 in response to phosphate starvation.

    Science.gov (United States)

    Peng, Wenting; Wu, Weiwei; Peng, Junchu; Li, Jiaojiao; Lin, Yan; Wang, Yanan; Tian, Jiang; Sun, Lili; Liang, Cuiyue; Liao, Hong

    2018-03-01

    A potential mechanism to enhance utilization of sparingly soluble forms of phosphorus (P) is the root secretion of malate, which is mainly mediated by the ALMT gene family in plants. In this study, a total of 34 GmALMT genes were identified in the soybean genome. Expression patterns diverged considerably among GmALMTs in response to phosphate (Pi) starvation in leaves, roots and flowers, with expression altered by P availability in 26 of the 34 GmALMTs. One root-specific GmALMT whose expression was significantly enhanced by Pi-starvation, GmALMT5, was studied in more detail to determine its possible role in soybean P nutrition. Analysis of GmALMT5 tissue expression patterns, subcellular localization, and malate exudation from transgenic soybean hairy roots overexpressing GmALMT5, demonstrated that GmALMT5 is a plasma membrane protein that mediates malate efflux from roots. Furthermore, both growth and P content of transgenic Arabidopsis overexpressing GmALMT5 were significantly increased when sparingly soluble Ca-P was used as the external P source. Taken together, these results indicate that members of the soybean GmALMT gene family exhibit diverse responses to Pi starvation. One member of this family, GmALMT5, might contribute to soybean P efficiency by enhancing utilization of sparingly soluble P sources under P limited conditions. © 2017 Institute of Botany, Chinese Academy of Sciences.

  11. 76 FR 67363 - Extending Religious and Family Member FICA and FUTA Exceptions to Disregarded Entities

    Science.gov (United States)

    2011-11-01

    ... unless the requisite family relationship exists between the employee and each of the partners comprising... the exceptions from employment that apply because of the existence of a family relationship between...(c). The inability of these entities to benefit from the exceptions for family employees and members...

  12. Development of FGI-106 as a broad-spectrum therapeutic with activity against members of the family Bunyaviridae

    Directory of Open Access Journals (Sweden)

    Darci R Smith

    2010-02-01

    Full Text Available Darci R Smith1, Monica Ogg1, Aura Garrison1, Abdul Yunus2, Anna Honko1, Josh Johnson1, Gene Olinger1, Lisa E Hensley1, Michael S Kinch1United States Army Medical Research Institute of Infectious Diseases (USAMRII D, Fort Detrick, MD, USA; 2Functional Genetics, Inc., Gaithersburg, MD, USAAbstract: The family Bunyaviridae is a diverse group of negative-strand RNA viruses that infect a wide range of arthropod vectors and animal hosts. Based on the continuing need for new therapeutics to treat bunyavirus infections, we evaluated the potential efficacy of FGI-106, a small-molecular compound that previously demonstrated activity against different RNA viruses. FGI-106 displayed substantial antiviral activity in cell-based assays of different bunyavirus family members, including Asian and South American hantaviruses (Hantaan virus and Andes virus, Crimean-Congo hemorrhagic fever virus, La Crosse virus, and Rift Valley fever virus. The pharmacokinetic profile of FGI-106 revealed sufficient exposure of the drug to critical target organs (lung, liver, kidney, and spleen, which are frequently the sites of bunyavirus replication. Consistent with these findings, FGI-106 treatment delivered via intraperitoneal injection prior to virus exposure was sufficient to delay the onset of Rift Valley fever virus infection in mouse-based models and to enhance survival in the face of an otherwise lethal infection. Altogether, these results suggest a potential opportunity for the use of FGI-106 to treat infections by members of the family Bunyaviridae.Keywords: Rift Valley fever virus, bunyavirus, hantavirus, antiviral, therapeutic

  13. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  14. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  15. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  16. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  17. Development and Examination of a Family Triadic Measure to Examine Quality of Life Family Congruence in Nursing Home Residents and Two Family Members.

    Science.gov (United States)

    Aalgaard Kelly, Gina

    2015-01-01

    Objective: The overall purpose of this study was to propose and test a conceptual model and apply family analyses methods to understand quality of life family congruence in the nursing home setting. Method: Secondary data for this study were from a larger study, titled Measurement, Indicators and Improvement of the Quality of Life (QOL) in Nursing Homes . Research literature, family systems theory and human ecological assumptions, fostered the conceptual model empirically testing quality of life family congruence. Results: The study results supported a model examining nursing home residents and two family members on quality of life family congruence. Specifically, family intergenerational dynamic factors, resident personal and social-psychological factors, and nursing home family input factors were examined to identify differences in quality of life family congruence among triad families. Discussion: Formal family involvement and resident cognitive functioning were found as the two most influential factors to quality of life family congruence (QOLFC).

  18. Experiences of adults with high-care needs and their family members with housing and support pathways in Australia.

    Science.gov (United States)

    McIntyre, Deborah; Fleming, Jennifer; Foster, Michele; Tweedy, Sean

    2017-09-01

    Many adults aged less than 65 years with high-care needs resulting from acquired disabilities are unable to access age-appropriate housing and support, and reside in residential aged care or live with family members who may struggle to navigate the disability support system. This qualitative study aimed to investigate the experiences of adults with high-care needs and their family members regarding pathways related to housing and support. Two in-depth semi-structured interviews were conducted six months apart with 21 people aged 18 to 65 with high-care needs of varying etiology and living in different housing settings. Nineteen family members involved in decision-making about housing and supports were also interviewed. Thematic data analysis yielded five themes: (1) Traveling in different directions; (2) "the fight, the battle and the war"; (3) willing but wanting; (4) uncertainty and vulnerability; and (5) redefining social roles and relationships. Current disability policy is not satisfying the housing and support requirements of adults with high-care needs and their families. The findings provide rigorous, empirical evidence which indicate the urgent need to improve access to affordable, individualized housing and support packages, including financial, practical and informational support for family members involved in caring roles. Implications for Rehabilitation Individual preferences are an important consideration in housing and support arrangements for younger people with high-care needs alongside needs-based solutions. Individualized funding approaches may provide flexibility of care and choice in housing and support for people with disability. Family members willingly provide substantial informal care, support and advocacy for younger people with high needs but perceive their role as a constant "battle". Payment of family members in recognition of caring work was perceived as a solution to relieve family hardship and ensure optimal care.

  19. Chromosomal locations of members of a family of novel endogenous human retroviral genomes

    International Nuclear Information System (INIS)

    Horn, T.M.; Huebner, K.; Croce, C.; Callahan, R.

    1986-01-01

    Human cellular DNA contains two distinguishable families of retroviral related sequences. One family shares extensive nucleotide sequence homology with infectious mammalian type C retroviral genomes. The other family contains major regions of homology with the pol genes of infectious type A and B and avian type C and D retroviral genomes. Analysis of the human recombinant clone HLM-2 has shown that the pol gene in the latter family is located within an endogenous proviral genome. The authors show that the proviral genome in HLM-2 and the related recombinant clone HLM-25 are located, respectively, on human chromosomes 1 and 5. Other related proviral genomes are located on chromosomes 7, 8, 11, 14, and 17

  20. Members of the LBD family of transcription factors repress anthocyanin synthesis and affect additional nitrogen responses in Arabidopsis.

    Science.gov (United States)

    Rubin, Grit; Tohge, Takayuki; Matsuda, Fumio; Saito, Kazuki; Scheible, Wolf-Rüdiger

    2009-11-01

    Nitrogen (N) and nitrate (NO(3)(-)) per se regulate many aspects of plant metabolism, growth, and development. N/NO(3)(-) also suppresses parts of secondary metabolism, including anthocyanin synthesis. Molecular components for this repression are unknown. We report that three N/NO(3)(-)-induced members of the LATERAL ORGAN BOUNDARY DOMAIN (LBD) gene family of transcription factors (LBD37, LBD38, and LBD39) act as negative regulators of anthocyanin biosynthesis in Arabidopsis thaliana. Overexpression of each of the three genes in the absence of N/NO(3)(-) strongly suppresses the key regulators of anthocyanin synthesis PAP1 and PAP2, genes in the anthocyanin-specific part of flavonoid synthesis, as well as cyanidin- but not quercetin- or kaempferol-glycoside production. Conversely, lbd37, lbd38, or lbd39 mutants accumulate anthocyanins when grown in N/NO(3)(-)-sufficient conditions and show constitutive expression of anthocyanin biosynthetic genes. The LBD genes also repress many other known N-responsive genes, including key genes required for NO(3)(-) uptake and assimilation, resulting in altered NO(3)(-) content, nitrate reductase activity/activation, protein, amino acid, and starch levels, and N-related growth phenotypes. The results identify LBD37 and its two close homologs as novel repressors of anthocyanin biosynthesis and N availability signals in general. They also show that, besides being developmental regulators, LBD genes fulfill roles in metabolic regulation.