Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

Science.gov (United States)

Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

2014-01-01

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

Science.gov (United States)

Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

2014-05-09

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

Investigation of genes encoding calcineurin B-like protein family in legumes and their expression analyses in chickpea (Cicer arietinum L.).

Science.gov (United States)

Meena, Mukesh Kumar; Ghawana, Sanjay; Sardar, Atish; Dwivedi, Vikas; Khandal, Hitaishi; Roy, Riti; Chattopadhyay, Debasis

2015-01-01

Calcium ion (Ca2+) is a ubiquitous second messenger that transmits various internal and external signals including stresses and, therefore, is important for plants' response process. Calcineurin B-like proteins (CBLs) are one of the plant calcium sensors, which sense and convey the changes in cytosolic Ca2+-concentration for response process. A search in four leguminous plant (soybean, Medicago truncatula, common bean and chickpea) genomes identified 9 to 15 genes in each species that encode CBL proteins. Sequence analyses of CBL peptides and coding sequences (CDS) suggested that there are nine original CBL genes in these legumes and some of them were multiplied during whole genome or local gene duplication. Coding sequences of chickpea CBL genes (CaCBL) were cloned from their cDNAs and sequenced, and their annotations in the genome assemblies were corrected accordingly. Analyses of protein sequences and gene structures of CBL family in plant kingdom indicated its diverse origin but showed a remarkable conservation in overall protein structure with appearance of complex gene structure in the course of evolution. Expression of CaCBL genes in different tissues and in response to different stress and hormone treatment were studied. Most of the CaCBL genes exhibited high expression in flowers. Expression profile of CaCBL genes in response to different abiotic stresses and hormones related to development and stresses (ABA, auxin, cytokinin, SA and JA) at different time intervals suggests their diverse roles in development and plant defence in addition to abiotic stress tolerance. These data not only contribute to a better understanding of the complex regulation of chickpea CBL gene family, but also provide valuable information for further research in chickpea functional genomics.

The ACBP gene family in Rhodnius prolixus

DEFF Research Database (Denmark)

Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

2016-01-01

The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

Investigation of genes encoding calcineurin B-like protein family in legumes and their expression analyses in chickpea (Cicer arietinum L..

Directory of Open Access Journals (Sweden)

Mukesh Kumar Meena

Full Text Available Calcium ion (Ca2+ is a ubiquitous second messenger that transmits various internal and external signals including stresses and, therefore, is important for plants' response process. Calcineurin B-like proteins (CBLs are one of the plant calcium sensors, which sense and convey the changes in cytosolic Ca2+-concentration for response process. A search in four leguminous plant (soybean, Medicago truncatula, common bean and chickpea genomes identified 9 to 15 genes in each species that encode CBL proteins. Sequence analyses of CBL peptides and coding sequences (CDS suggested that there are nine original CBL genes in these legumes and some of them were multiplied during whole genome or local gene duplication. Coding sequences of chickpea CBL genes (CaCBL were cloned from their cDNAs and sequenced, and their annotations in the genome assemblies were corrected accordingly. Analyses of protein sequences and gene structures of CBL family in plant kingdom indicated its diverse origin but showed a remarkable conservation in overall protein structure with appearance of complex gene structure in the course of evolution. Expression of CaCBL genes in different tissues and in response to different stress and hormone treatment were studied. Most of the CaCBL genes exhibited high expression in flowers. Expression profile of CaCBL genes in response to different abiotic stresses and hormones related to development and stresses (ABA, auxin, cytokinin, SA and JA at different time intervals suggests their diverse roles in development and plant defence in addition to abiotic stress tolerance. These data not only contribute to a better understanding of the complex regulation of chickpea CBL gene family, but also provide valuable information for further research in chickpea functional genomics.

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

DEFF Research Database (Denmark)

Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

2006-01-01

MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

The sieve element occlusion gene family in dicotyledonous plants.

Science.gov (United States)

Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

2011-01-01

Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

The ALMT Gene Family Performs Multiple Functions in Plants

Directory of Open Access Journals (Sweden)

Jie Liu

2018-02-01

Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

International Nuclear Information System (INIS)

Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

2003-01-01

The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.

Science.gov (United States)

Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C

2001-01-01

Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.

The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

Science.gov (United States)

Shukla, Avi; Chatterjee, Anirvan

2018-01-01

Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

Genomic sequence and organization of two members of a human lectin gene family

International Nuclear Information System (INIS)

Gitt, M.A.; Barondes, S.H.

1991-01-01

The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

PURA, the gene encoding Pur-alpha, member of an ancient nucleic acid-binding protein family with mammalian neurological functions.

Science.gov (United States)

Daniel, Dianne C; Johnson, Edward M

2018-02-15

The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

Directory of Open Access Journals (Sweden)

Mohammad H Dezfulian

Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

The Tomato Terpene Synthase Gene Family1[W][OA

Science.gov (United States)

Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

2011-01-01

Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

A lepidopteran-specific gene family encoding valine-rich midgut proteins.

Directory of Open Access Journals (Sweden)

Jothini Odman-Naresh

Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

KAUST Repository

Lawton, Jennifer

2012-03-29

Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

Directory of Open Access Journals (Sweden)

Lawton Jennifer

2012-03-01

Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

KAUST Repository

Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

2012-01-01

Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

Directory of Open Access Journals (Sweden)

Ashley L Waldron

Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

Directory of Open Access Journals (Sweden)

Craxton Molly

2007-07-01

Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

Science.gov (United States)

Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein

2015-01-01

Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

Identification and characterization of NF-YB family genes in tung tree.

Science.gov (United States)

Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

2015-12-01

The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

Directory of Open Access Journals (Sweden)

Wang Bo

2015-01-01

Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

Directory of Open Access Journals (Sweden)

Behzad Davarniya

Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families

Science.gov (United States)

Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein

2015-01-01

Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914

The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

Science.gov (United States)

Karn, Robert C; Laukaitis, Christina M

2012-01-01

Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

Directory of Open Access Journals (Sweden)

Iva Tomalova

Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

DEFF Research Database (Denmark)

Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

2014-01-01

The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

Repeat-associated plasticity in the Helicobacter pylori RD gene family.

Science.gov (United States)

Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

2009-11-01

The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

DEFF Research Database (Denmark)

Davis, Margaret R.; Andersson, Robin; Severin, Jessica

2014-01-01

in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

ngs (Notochord Granular Surface) Gene Encodes a Novel Type of Intermediate Filament Family Protein Essential for Notochord Maintenance in Zebrafish*

Science.gov (United States)

Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

2013-01-01

The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins. PMID:23132861

ngs (notochord granular surface) gene encodes a novel type of intermediate filament family protein essential for notochord maintenance in zebrafish.

Science.gov (United States)

Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

2013-01-25

The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins.

Molecular cloning of a Candida albicans gene (SSB1) coding for a protein related to the Hsp70 family.

Science.gov (United States)

Maneu, V; Cervera, A M; Martinez, J P; Gozalbo, D

1997-06-15

We have cloned and sequenced a Candida albicans gene (SSB1) encoding a potential member of the heat-shock protein seventy (hsp70) family. The protein encoded by this gene contains 613 amino acids and shows a high degree (85%) of sequence identity to the ssb subfamily (ssb1 and ssb2) of the Saccharomyces cerevisiae hsp70 family. The transcribed mRNA (2.1 kb) is present in similar amounts both in yeast and germ tube cells of C. albicans.

Evolution, functional differentiation, and co-expression of the RLK gene family revealed in Jilin ginseng, Panax ginseng C.A. Meyer.

Science.gov (United States)

Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping

2018-02-21

Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.

Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

DEFF Research Database (Denmark)

Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

2004-01-01

Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

A family of related proteins is encoded by the major Drosophila heat shock gene family

International Nuclear Information System (INIS)

Wadsworth, S.C.

1982-01-01

At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

Science.gov (United States)

Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

2013-01-01

EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

Science.gov (United States)

Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

2014-01-01

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

Directory of Open Access Journals (Sweden)

Preeti Arya

Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

Science.gov (United States)

Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K

2014-01-01

Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

Directory of Open Access Journals (Sweden)

Jie Luo

2018-01-01

Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

Directory of Open Access Journals (Sweden)

Nishida Mutsumi

2007-11-01

Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

Directory of Open Access Journals (Sweden)

Naoki Takata

Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Directory of Open Access Journals (Sweden)

Řičicová Markéta

2010-04-01

Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Metagenomic identification of a novel salt tolerance gene from the human gut microbiome which encodes a membrane protein with homology to a brp/blh-family β-carotene 15,15'-monooxygenase.

Directory of Open Access Journals (Sweden)

Eamonn P Culligan

Full Text Available The human gut microbiome consists of at least 3 million non-redundant genes, 150 times that of the core human genome. Herein, we report the identification and characterisation of a novel stress tolerance gene from the human gut metagenome. The locus, assigned brpA, encodes a membrane protein with homology to a brp/blh-family β-carotene monooxygenase. Cloning and heterologous expression of brpA in Escherichia coli confers a significant salt tolerance phenotype. Furthermore, when cultured in the presence of exogenous β-carotene, cell pellets adopt a red/orange pigmentation indicating the incorporation of carotenoids in the cell membrane.

The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

Science.gov (United States)

Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

2014-11-28

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

Science.gov (United States)

Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

2016-01-01

WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

Differential transcript abundance and genotypic variation of four putative allergen-encoding gene families in melting peach

NARCIS (Netherlands)

Yang, Z.; Ma, Y.; Chen, L.; Xie, R.; Zhang, X.; Zhang, B.; Lu, M.; Wu, S.; Gilissen, L.J.W.J.; Ree, van R.; Gao, Z.

2011-01-01

We analysed the temporal and spatial transcript expression of the panel of 18 putative isoallergens from four gene families (Pru p 1–4) in the peach fruit, anther and leaf of two melting cultivars, to gain insight into their expression profiles and to identify the key family members. Genotypic

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Phylogenetic analysis of the MS4A and TMEM176 gene families.

Directory of Open Access Journals (Sweden)

Jonathan Zuccolo

2010-02-01

Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

Gene cluster statistics with gene families.

Science.gov (United States)

Raghupathy, Narayanan; Durand, Dannie

2009-05-01

Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

[Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

Science.gov (United States)

Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

2014-01-01

Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

Science.gov (United States)

Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

2018-02-01

WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

Science.gov (United States)

Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

2011-11-01

The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

OpenAIRE

Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

2017-01-01

Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

Duplications and losses in gene families of rust pathogens highlight putative effectors.

Science.gov (United States)

Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

2014-01-01

Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

Genome-Wide Comparative Gene Family Classification

Science.gov (United States)

Frech, Christian; Chen, Nansheng

2010-01-01

Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Novel genetic variants in miR-191 gene and familial ovarian cancer

International Nuclear Information System (INIS)

Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

2010-01-01

Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

Science.gov (United States)

Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

2015-09-01

In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

Science.gov (United States)

Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

2012-01-01

Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

Directory of Open Access Journals (Sweden)

Peter K Busk

Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

DEFF Research Database (Denmark)

Brinch-Pedersen, H.; Galili, G.; Sørensen, K.

1996-01-01

In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...

Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

Directory of Open Access Journals (Sweden)

Parker Nadeene

2004-01-01

Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

Disruption and analysis of the clpB, clpC, and clpE genes in Lactococcus lactis: ClpE, a new Clp family in gram-positive bacteria

DEFF Research Database (Denmark)

Ingmer, Hanne; Vogensen, Finn K.; Hammer, Karin

1999-01-01

In the genome of the gram-positive bacterium Lactococcus lactis MG1363, we have identified three genes (clpC, clpE, and clpB) which encode Clp proteins containing two conserved ATP binding domains. The proteins encoded by two of the genes belong to the previously described ClpB and ClpC families....... The clpE gene, however, encodes a member of a new Clp protein family that is characterized by a short N-terminal domain including a putative zinc binding domain (-CX2CX22CX2C-). Expression of the 83-kDa ClpE protein as well as of the two proteins encoded by clpB was strongly induced by heat shock and...... was shown to participate in the degradation of randomly folded proteins in L. lactis, could be necessary for degrading proteins generated by certain types of stress....

Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

Science.gov (United States)

Vouille, V; Amiche, M; Nicolas, P

1997-09-01

We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

Mapping of the gene encoding the. beta. -amyloid precursor protein and its relationship to the Down syndrome region of chromosome 21

Energy Technology Data Exchange (ETDEWEB)

Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))

1988-11-01

The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Ixodes ticks belonging to the Ixodes ricinus complex encode a family of anticomplement proteins.

Science.gov (United States)

Daix, V; Schroeder, H; Praet, N; Georgin, J-P; Chiappino, I; Gillet, L; de Fays, K; Decrem, Y; Leboulle, G; Godfroid, E; Bollen, A; Pastoret, P-P; Gern, L; Sharp, P M; Vanderplasschen, A

2007-04-01

The alternative pathway of complement is an important innate defence against pathogens including ticks. This component of the immune system has selected for pathogens that have evolved countermeasures. Recently, a salivary protein able to inhibit the alternative pathway was cloned from the American tick Ixodes scapularis (Valenzuela et al., 2000; J. Biol. Chem. 275, 18717-18723). Here, we isolated two different sequences, similar to Isac, from the transcriptome of I. ricinus salivary glands. Expression of these sequences revealed that they both encode secreted proteins able to inhibit the complement alternative pathway. These proteins, called I. ricinus anticomplement (IRAC) protein I and II, are coexpressed constitutively in I. ricinus salivary glands and are upregulated during blood feeding. Also, we demonstrated that they are the products of different genes and not of alleles of the same locus. Finally, phylogenetic analyses demonstrate that ticks belonging to the Ixodes ricinus complex encode a family of relatively small anticomplement molecules undergoing diversification by positive Darwinian selection.

Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

Directory of Open Access Journals (Sweden)

Malcolm S Hill

Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

Science.gov (United States)

Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

2013-01-01

Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

Duplications and losses in gene families of rust pathogens highlight putative effectors

Directory of Open Access Journals (Sweden)

Amanda L. Pendleton

2014-06-01

Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

Science.gov (United States)

Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

2010-01-01

Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

Genome-wide analysis of WRKY gene family in Cucumis sativus.

Science.gov (United States)

Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan

2011-09-28

WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Cloning and Expression of Three New Azotobacter vinelandii Genes Closely Related to a Previously Described Gene Family Encoding Mannuronan C-5-Epimerases

OpenAIRE

Svanem, Britt Iren Glærum; Skjåk-Bræk, Gudmund; Ertesvåg, Helga; Valla, Svein

1999-01-01

The cloning and expression of a family of five modular-type mannuronan C-5-epimerase genes from Azotobacter vinelandii (algE1 to -5) has previously been reported. The corresponding proteins catalyze the Ca2+-dependent polymer-level epimerization of β-d-mannuronic acid to α-l-guluronic acid (G) in the commercially important polysaccharide alginate. Here we report the identification of three additional structurally similar genes, designated algE6, algE7, and algY. All three genes were sequenced...

Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

Science.gov (United States)

Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

2017-10-01

The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

A large and functionally diverse family of Fad2 genes in safflower (Carthamus tinctorius L.

Directory of Open Access Journals (Sweden)

Cao Shijiang

2013-01-01

Full Text Available Abstract Background The application and nutritional value of vegetable oil is highly dependent on its fatty acid composition, especially the relative proportion of its two major fatty acids, i.e oleic acid and linoleic acid. Microsomal oleoyl phosphatidylcholine desaturase encoded by FAD2 gene is known to introduce a double bond at the Δ12 position of an oleic acid on phosphatidylcholine and convert it to linoleic acid. The known plant FAD2 enzymes are encoded by small gene families consisting of 1-4 members. In addition to the classic oleate Δ12-desaturation activity, functional variants of FAD2 that are capable of undertaking additional or alternative acyl modifications have also been reported in a limited number of plant species. In this study, our objective was to identify FAD2 genes from safflower and analyse their differential expression profile and potentially diversified functionality. Results We report here the characterization and functional expression of an exceptionally large FAD2 gene family from safflower, and the temporal and spatial expression profiles of these genes as revealed through Real-Time quantitative PCR. The diversified functionalities of some of the safflower FAD2 gene family members were demonstrated by ectopic expression in yeast and transient expression in Nicotiana benthamiana leaves. CtFAD2-1 and CtFAD2-10 were demonstrated to be oleate desaturases specifically expressed in developing seeds and flower head, respectively, while CtFAD2-2 appears to have relatively low oleate desaturation activity throughout the plant. CtFAD2-5 and CtFAD2-8 are specifically expressed in root tissues, while CtFAD2-3, 4, 6, 7 are mostly expressed in the cotyledons and hypocotyls in young safflower seedlings. CtFAD2-9 was found to encode a novel desaturase operating on C16:1 substrate. CtFAD2-11 is a tri-functional enzyme able to introduce a carbon double bond in either cis or trans configuration, or a carbon triple (acetylenic bond

Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

Institute of Scientific and Technical Information of China (English)

Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

2007-01-01

The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

Isolation and expression analysis of four HD-ZIP III family genes targeted by microRNA166 in peach.

Science.gov (United States)

Zhang, C H; Zhang, B B; Ma, R J; Yu, M L; Guo, S L; Guo, L

2015-10-30

MicroRNA166 (miR166) is known to have highly conserved targets that encode proteins of the class III homeodomain-leucine zipper (HD-ZIP III) family, in a broad range of plant species. To further understand the relationship between HD-ZIP III genes and miR166, four HD-ZIP III family genes (PpHB14, PpHB15, PpHB8, and PpREV) were isolated from peach (Prunus persica) tissue and characterized. Spatio-temporal expression profiles of the genes were analyzed. Genes of the peach HD-ZIP III family were predicted to encode five conserved domains. Deduced amino acid sequences and tertiary structures of the four peach HD-ZIP III genes were highly conserved, with corresponding genes in Arabidopsis thaliana. The expression level of four targets displayed the opposite trend to that of miR166 throughout fruit development, with the exception of PpHB14 from 35 to 55 days after full bloom (DAFB). This finding indicates that miR166 may negatively regulate its four targets throughout fruit development. As for leaf and phloem, the same trend in expression level was observed between four targets and miR166 from 75 to 105 DAFB. However, the opposite trend was observed for the transcript level between four targets and miR166 from 35 to 55 DAFB. miRNA166 may negatively regulate four targets in some but not all developmental stages for a given tissue. The four genes studied were observed to have, exactly or generally, the same change tendency as individual tissue development, a finding that suggests genes of the HD-ZIP III family in peach may have complementary or cooperative functions in various tissues.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

Science.gov (United States)

Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

2009-01-01

There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

Isolation of MA-ACS Gene Family and Expression Study of MA-ACS1 Gene in Musa acuminata Cultivar Pisang Ambon Lumut

Directory of Open Access Journals (Sweden)

LISTYA UTAMI KARMAWAN

2009-03-01

Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Genome-wide analysis of the GRAS gene family in Prunus mume.

Science.gov (United States)

Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

2015-02-01

Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Natural killer cell receptor genes in the family Equidae: not only Ly49.

Directory of Open Access Journals (Sweden)

Jan Futas

Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

Science.gov (United States)

Futas, Jan; Horin, Petr

2013-01-01

Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Deletion of the Sm1 encoding motif in the lsm gene results in distinct changes in the transcriptome and enhanced swarming activity of Haloferax cells.

Science.gov (United States)

Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita

2015-10-01

Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

Directory of Open Access Journals (Sweden)

Jie Chen

2014-03-01

Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

Regulation Mechanism of the ald Gene Encoding Alanine Dehydrogenase in Mycobacterium smegmatis and Mycobacterium tuberculosis by the Lrp/AsnC Family Regulator AldR.

Science.gov (United States)

Jeong, Ji-A; Hyun, Jaekyung; Oh, Jeong-Il

2015-10-01

In the presence of alanine, AldR, which belongs to the Lrp/AsnC family of transcriptional regulators and regulates ald encoding alanine dehydrogenase in Mycobacterium smegmatis, changes its quaternary structure from a homodimer to an octamer with an open-ring conformation. Four AldR-binding sites (O2, O1, O4, and O3) with a consensus sequence of GA/T-N2-NWW/WWN-N2-A/TC were identified upstream of the M. smegmatis ald gene by means of DNase I footprinting analysis. O2, O1, and O4 are required for the induction of ald expression by alanine, while O3 is directly involved in the repression of ald expression. In addition to O3, both O1 and O4 are also necessary for full repression of ald expression in the absence of alanine, due to cooperative binding of AldR dimers to O1, O4, and O3. Binding of a molecule of the AldR octamer to the ald control region was demonstrated to require two AldR-binding sites separated by three helical turns between their centers and one additional binding site that is in phase with the two AldR-binding sites. The cooperative binding of AldR dimers to DNA requires three AldR-binding sites that are aligned with a periodicity of three helical turns. The aldR gene is negatively autoregulated independently of alanine. Comparative analysis of ald expression of M. smegmatis and Mycobacterium tuberculosis in conjunction with sequence analysis of both ald control regions led us to suggest that the expression of the ald genes in both mycobacterial species is regulated by the same mechanism. In mycobacteria, alanine dehydrogenase (Ald) is the enzyme required both to utilize alanine as a nitrogen source and to grow under hypoxic conditions by maintaining the redox state of the NADH/NAD(+) pool. Expression of the ald gene was reported to be regulated by the AldR regulator that belongs to the Lrp/AsnC (feast/famine) family, but the underlying mechanism was unknown. This study revealed the regulation mechanism of ald in Mycobacterium smegmatis and

Positive selection in the SLC11A1 gene in the family Equidae

DEFF Research Database (Denmark)

Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

2016-01-01

Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

Science.gov (United States)

Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

2012-07-30

In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

Science.gov (United States)

Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

2003-01-01

The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

Insights into the Evolution of a Snake Venom Multi-Gene Family from the Genomic Organization of Echis ocellatus SVMP Genes

Directory of Open Access Journals (Sweden)

Libia Sanz

2016-07-01

Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.

Science.gov (United States)

Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng

2014-04-18

The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

Science.gov (United States)

Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

2012-08-01

The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato.

Science.gov (United States)

Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther

2013-04-01

Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.

The claudin gene family: expression in normal and neoplastic tissues

International Nuclear Information System (INIS)

Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

2006-01-01

The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

Science.gov (United States)

Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

1993-09-15

Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

A large gene family in fission yeast encodes spore killers that subvert Mendel’s law

Science.gov (United States)

Hu, Wen; Jiang, Zhao-Di; Suo, Fang; Zheng, Jin-Xin; He, Wan-Zhong; Du, Li-Lin

2017-01-01

Spore killers in fungi are selfish genetic elements that distort Mendelian segregation in their favor. It remains unclear how many species harbor them and how diverse their mechanisms are. Here, we discover two spore killers from a natural isolate of the fission yeast Schizosaccharomyces pombe. Both killers belong to the previously uncharacterized wtf gene family with 25 members in the reference genome. These two killers act in strain-background-independent and genome-location-independent manners to perturb the maturation of spores not inheriting them. Spores carrying one killer are protected from its killing effect but not that of the other killer. The killing and protecting activities can be uncoupled by mutation. The numbers and sequences of wtf genes vary considerably between S. pombe isolates, indicating rapid divergence. We propose that wtf genes contribute to the extensive intraspecific reproductive isolation in S. pombe, and represent ideal models for understanding how segregation-distorting elements act and evolve. DOI: http://dx.doi.org/10.7554/eLife.26057.001 PMID:28631610

Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

Directory of Open Access Journals (Sweden)

Eliane Evanovich

2016-01-01

Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

Directory of Open Access Journals (Sweden)

Srivastava Satish

2003-07-01

Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

Science.gov (United States)

Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

2016-12-01

Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

Science.gov (United States)

Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

2015-11-14

FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

Science.gov (United States)

Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

2016-01-01

The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

Science.gov (United States)

Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

2017-11-01

Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

Directory of Open Access Journals (Sweden)

Maria V. Fernández

2018-04-01

Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

Science.gov (United States)

Tzagoloff, A; Shtanko, A

1995-06-01

Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

Genome wide identification and expression analysis of Homeodomain leucine zipper subfamily IV (HDZ IV gene family from Musa accuminata

Directory of Open Access Journals (Sweden)

Ashutosh ePandey

2016-02-01

Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Expression of three different mutations in the arginine vasopressin gene suggests genotype-phenotype correlation in familial neurohypophyseal diabetes insipidus kindreds

DEFF Research Database (Denmark)

Siggaard, Charlotte; Christensen, Jane Hvarregaard; Corydon, Thomas Juhl

2005-01-01

OBJECTIVE AND STUDY DESIGN: The autosomal dominant form of familial neurohypophyseal diabetes insipidus (adFNDI) is a rare disease characterized by a severe and progressive deficiency of AVP secondary to mutations in the gene encoding the AVP precursor. Whereas a number of studies have investigated...

Genome-wide identification, characterisation and expression analysis of the MADS-box gene family in Prunus mume.

Science.gov (United States)

Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia

2014-10-01

MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

In silico characterization and transcriptomic analysis of nif family genes from Anabaena sp. PCC7120.

Science.gov (United States)

Singh, Shilpi; Shrivastava, Alok Kumar

2017-10-01

In silico approaches in conjunction with morphology, nitrogenase activity, and qRT-PCR explore the impact of selected abiotic stressor such as arsenic, salt, cadmium, copper, and butachlor on nitrogen fixing (nif family) genes of diazotrophic cyanobacterium Anabaena sp. PCC7120. A total of 19 nif genes are present within the Anabaena genome that is involved in the process of nitrogen fixation. Docking studies revealed the interaction between these nif gene-encoded proteins and the selected abiotic stressors which were further validated through decreased heterocyst frequency, fragmentation of filaments, and downregulation of nitrogenase activity under these stresses indicating towards their toxic impact on nitrogen fixation potential of filamentous cyanobacterium Anabaena sp. PCC7120. Another appealing finding of this study is even though having similar binding energy and similar interacting residues between arsenic/salt and copper/cadmium to nif-encoded proteins, arsenic and cadmium are more toxic than salt and copper for nitrogenase activity of Anabaena which is crucial for growth and yield of rice paddy and soil reclamation.

Vibrio chromosome-specific families

DEFF Research Database (Denmark)

Lukjancenko, Oksana; Ussery, David

2014-01-01

We have compared chromosome-specific genes in a set of 18 finished Vibrio genomes, and, in addition, also calculated the pan- and core-genomes from a data set of more than 250 draft Vibrio genome sequences. These genomes come from 9 known species and 2 unknown species. Within the finished...... chromosomes, we find a core set of 1269 encoded protein families for chromosome 1, and a core of 252 encoded protein families for chromosome 2. Many of these core proteins are also found in the draft genomes (although which chromosome they are located on is unknown.) Of the chromosome specific core protein...... families, 1169 and 153 are uniquely found in chromosomes 1 and 2, respectively. Gene ontology (GO) terms for each of the protein families were determined, and the different sets for each chromosome were compared. A total of 363 different "Molecular Function" GO categories were found for chromosome 1...

Genome-wide identification and tissue-specific expression analysis of nucleotide binding site-leucine rich repeat gene family in Cicer arietinum (kabuli chickpea).

Science.gov (United States)

Sharma, Ranu; Rawat, Vimal; Suresh, C G

2017-12-01

The nucleotide binding site-leucine rich repeat (NBS-LRR) proteins play an important role in the defense mechanisms against pathogens. Using bioinformatics approach, we identified and annotated 104 NBS-LRR genes in chickpea. Phylogenetic analysis points to their diversification into two families namely TIR-NBS-LRR and non-TIR-NBS-LRR. Gene architecture revealed intron gain/loss events in this resistance gene family during their independent evolution into two families. Comparative genomics analysis elucidated its evolutionary relationship with other fabaceae species. Around 50% NBS-LRRs reside in macro-syntenic blocks underlining positional conservation along with sequence conservation of NBS-LRR genes in chickpea. Transcriptome sequencing data provided evidence for their transcription and tissue-specific expression. Four cis -regulatory elements namely WBOX, DRE, CBF, and GCC boxes, that commonly occur in resistance genes, were present in the promoter regions of these genes. Further, the findings will provide a strong background to use candidate disease resistance NBS-encoding genes and identify their specific roles in chickpea.

DAZ Family Proteins, Key Players for Germ Cell Development

Science.gov (United States)

Fu, Xia-Fei; Cheng, Shun-Feng; Wang, Lin-Qing; Yin, Shen; De Felici, Massimo; Shen, Wei

2015-01-01

DAZ family proteins are found almost exclusively in germ cells in distant animal species. Deletion or mutations of their encoding genes usually severely impair either oogenesis or spermatogenesis or both. The family includes Boule (or Boll), Dazl (or Dazla) and DAZ genes. Boule and Dazl are situated on autosomes while DAZ, exclusive of higher primates, is located on the Y chromosome. Deletion of DAZ gene is the most common causes of infertility in humans. These genes, encoding for RNA binding proteins, contain a highly conserved RNA recognition motif and at least one DAZ repeat encoding for a 24 amino acids sequence able to bind other mRNA binding proteins. Basically, Daz family proteins function as adaptors for target mRNA transport and activators of their translation. In some invertebrate species, BOULE protein play a pivotal role in germline specification and a conserved regulatory role in meiosis. Depending on the species, DAZL is expressed in primordial germ cells (PGCs) and/or pre-meiotic and meiotic germ cells of both sexes. Daz is found in fetal gonocytes, spermatogonia and spermatocytes of adult testes. Here we discuss DAZ family genes in a phylogenic perspective, focusing on the common and distinct features of these genes, and their pivotal roles during gametogenesis evolved during evolution. PMID:26327816

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Two siblings with early infantile myoclonic encephalopathy due to mutation in the gene encoding mitochondrial glutamate/H+ symporter SLC25A22.

Science.gov (United States)

Cohen, Rony; Basel-Vanagaite, Lina; Goldberg-Stern, Hadassah; Halevy, Ayelet; Shuper, Avinoam; Feingold-Zadok, Michal; Behar, Doron M; Straussberg, Rachel

2014-11-01

To characterize a new subset of early myoclonic encephalopathy usually associated with metabolic etiologies with a new genetic entity. We describe two siblings with early myoclonic encephalopathy born to consanguineous parents of Arab Muslim origin from Israel. We used homozygosity mapping and candidate gene sequencing to reveal the genetic basis of the myoclonic syndrome. We found a rare missense mutation in the gene encoding one of the two mitochondrial glutamate/H symporters, SLC25A22. The phenotype of early myoclonic encephalopathy was first linked to the same mutation in 2005 in patients of the same ethnicity as our family. Owing to the devastating nature of this encephalopathy, we focus attention on its clinical history, epileptic semiology, distinct electroencephalography features, and genetic basis. We provide the evidence that an integrated diagnostic strategy combining homozygosity mapping with candidate gene sequencing is efficient in consanguineous families with highly heterogeneous autosomal recessive diseases. Copyright © 2014 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

The zebrafish progranulin gene family and antisense transcripts

Directory of Open Access Journals (Sweden)

Baranowski David

2005-11-01

Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial

Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

You Wanhui

2012-04-01

Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

Streptomyces coelicolor Encodes a Urate-Responsive Transcriptional Regulator with Homology to PecS from Plant Pathogens

OpenAIRE

Huang, Hao; Mackel, Brian J.; Grove, Anne

2013-01-01

Many transcriptional regulators control gene activity by responding to specific ligands. Members of the multiple-antibiotic resistance regulator (MarR) family of transcriptional regulators feature prominently in this regard, and they frequently function as repressors in the absence of their cognate ligands. Plant pathogens such as Dickeya dadantii encode a MarR homolog named PecS that controls expression of a gene encoding the efflux pump PecM in addition to other virulence genes. We report h...

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Leiomodins: larger members of the tropomodulin (Tmod) gene family

Science.gov (United States)

Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

2001-01-01

The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Hypermutability of CpG dinucleotides in the propeptide-encoding sequence of the human albumin gene

International Nuclear Information System (INIS)

Brennan, S.O.; Peach, R.; Myles, T.; George, P.; Arai, Kunio; Madison, J.; Watkins, S.; Putnam, F.W.; Laurell, C.B.; Galliano, M.

1990-01-01

An electrophoretically slow albumin variant was detected with a phenotype frequency of about 1:1,000 in Sweden and was also found in a family of Scottish descent from Kaikoura, New Zealand, and in five families in Tradate, Italy. Structural study established that the major variant component was arginyl-albumin, in which arginine at the -1 position of the propeptide is still attached to the processed albumin. A minor component with the amino-terminal sequence of proalbumin was also present as 3-6% of the total albumin. After amplification of the gene segment encoding the prepro sequence of albumin, specific hybridization of DNA to an oligonucleotide probe encoding cysteine at position -2 indicated the mutation of arginine at the -2 position to cysteine (-2 Arg → Cys). This produced the propeptide sequence Arg-Gly-Val-Phe-Cys-Arg. This was confirmed by sequence analysis after pyridylethylation of the cysteine. This mutation produces an alternate signal peptidase cleavage site in the variant proalbumin precursor of arginyl-albumin giving rise to two possible products, arginyl-albumin and the variant proalbumin. Another plasma from Bremen had an alloalbumin with a previously described substitution (1 Asp → Val), which also affects propeptide cleavage. Hypermutability of two CpG dinucleotides in the codons for the diarginyl sequence may account for the frequency of mutations in the propeptide. Mutation at these two sites results in a series of recurrent proalbumin variants that have arisen independently in diverse populations

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

Omega-3 fatty acid desaturase gene family from two ω-3 sources, Salvia hispanica and Perilla frutescens: Cloning, characterization and expression.

Directory of Open Access Journals (Sweden)

Yufei Xue

Full Text Available Omega-3 fatty acid desaturase (ω-3 FAD, D15D is a key enzyme for α-linolenic acid (ALA biosynthesis. Both chia (Salvia hispanica and perilla (Perilla frutescens contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A tailing sites, and 7 introns. The 5'UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5'UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops.

Omega-3 fatty acid desaturase gene family from two ω-3 sources, Salvia hispanica and Perilla frutescens: Cloning, characterization and expression

Science.gov (United States)

Xue, Yufei; Chen, Baojun; Win, Aung Naing; Fu, Chun; Lian, Jianping; Liu, Xue; Wang, Rui; Zhang, Xingcui

2018-01-01

Omega-3 fatty acid desaturase (ω-3 FAD, D15D) is a key enzyme for α-linolenic acid (ALA) biosynthesis. Both chia (Salvia hispanica) and perilla (Perilla frutescens) contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous) genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A) tailing sites, and 7 introns. The 5’UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5’UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops. PMID:29351555

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

Science.gov (United States)

Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

2016-03-01

The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

Over-expression of a novel JAZ family gene from Glycine soja, increases salt and alkali stress tolerance.

Science.gov (United States)

Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming

2012-09-21

Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

Science.gov (United States)

Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

2013-01-01

The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

Over-expression of a novel JAZ family gene from Glycine soja, increases salt and alkali stress tolerance

International Nuclear Information System (INIS)

Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K.; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming

2012-01-01

Highlights: ► We isolated and characterized a novel JAZ family gene, GsJAZ2, from Glycine soja. ► Overexpression of GsJAZ2 enhanced plant tolerance to salt and alkali stress. ► The transcriptions of stress marker genes were higher in GsJAZ2 overexpression lines. ► GsJAZ2 was localized to nucleus. -- Abstract: Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals

Directory of Open Access Journals (Sweden)

Wentao Wu

2017-10-01

Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals.

Science.gov (United States)

Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli

2017-10-08

The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Genome-wide identification and analysis of the SBP-box family genes in apple (Malus × domestica Borkh.).

Science.gov (United States)

Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping

2013-09-01

SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

Science.gov (United States)

Roten, C A; Brandt, C; Karamata, D

1991-04-01

Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

KCNN Genes that Encode Small-Conductance Ca2+-Activated K+ Channels Influence Alcohol and Drug Addiction.

Science.gov (United States)

Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J

2015-07-01

Small-conductance Ca(2+)-activated K(+) (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction.

Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus).

Science.gov (United States)

Dong, Chun-Juan; Shang, Qing-Mao

2013-07-01

Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.

The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

Science.gov (United States)

Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

2013-05-29

Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

Directory of Open Access Journals (Sweden)

Serbielle Céline

2012-12-01

Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Transmissible familial Creutzfeldt-Jakob disease associated with five, seven, and eight extra octapeptide coding repeats in the PRNP gene

Energy Technology Data Exchange (ETDEWEB)

Goldfarb, L.G.; Brown, P.; McCombie, W.R.; Gibbs, C.J. Jr.; Gajdusek, D.C. (National Inst. of Health, Bethesda, MD (United States)); Goldgaber, D. (State Univ. of New York, Stony Brook (United States)); Swergold, G.D. (National Inst. of Health, Bethesda, MD (United States)); Wills, P.R. (Univ. of Auckland (New Zealand)); Cervenakova, L. (Inst. of Preventive and Clinical Medicine, Bratislava (Czechoslovakia)); Baron, H. (Searle Pharmaceuticals, Paris (France))

1991-12-01

The PRNP gene, encoding the amyloid precursor protein that is centrally involved in Creutzfeldt-Jakob disease (CJD), has an unstable region of five variant tandem octapeptide coding repeats between codons 51 and 91. The authors screened a total of 535 individuals for the presence of extra repeats in this region, including patients with sporadic and familial forms of spongiform encephalopathy, members of their families, other neurological and non-neurological patients, and normal controls. They identified three CJD families (in each of which the proband's disease was neuropathologically confirmed and experimentally transmitted to primates) that were heterozygous for alleles with 10, 12, or 13 repeats, some of which had wobble nucleotide substitutions. They also found one individual with 9 repeats and no nucleotide substitutions who had no evidence of neurological disease. These observations, together with data on published British patients with 11 and 14 repeats, strongly suggest that the occurrence of 10 or more octapeptide repeats in the encoded amyloid precursor protein predisposes to CJD.

Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

International Nuclear Information System (INIS)

Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin

2006-01-01

Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

Analysis of four achaete-scute homologs in Bombyx mori reveals new viewpoints of the evolution and functions of this gene family

OpenAIRE

Zhou, Qingxiang; Zhang, Tianyi; Xu, Weihua; Yu, Linlin; Yi, Yongzhu; Zhang, Zhifang

2008-01-01

Abstract Background achaete-scute complexe (AS-C) has been widely studied at genetic, developmental and evolutional levels. Genes of this family encode proteins containing a highly conserved bHLH domain, which take part in the regulation of the development of central nervous system and peripheral nervous system. Many AS-C homologs have been isolated from various vertebrates and invertebrates. Also, AS-C genes are duplicated during the evolution of Diptera. Functions besides neural development...

Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

Science.gov (United States)

Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

2010-10-07

PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

Identification of a fourth family of lycopene cyclases in photosynthetic bacteria

OpenAIRE

Maresca, Julia A.; Graham, Joel E.; Wu, Martin; Eisen, Jonathan A.; Bryant, Donald A.

2007-01-01

A fourth and large family of lycopene cyclases was identified in photosynthetic prokaryotes. The first member of this family, encoded by the cruA gene of the green sulfur bacterium Chlorobium tepidum, was identified in a complementation assay with a lycopene-producing strain of Escherichia coli. Orthologs of cruA are found in all available green sulfur bacterial genomes and in all cyanobacterial genomes that lack genes encoding CrtL- or CrtY-type lycopene cyclases. The cyanobacterium Synechoc...

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Positive selection in the SLC11A1 gene in the family Equidae.

Science.gov (United States)

Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

2016-05-01

Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

International Nuclear Information System (INIS)

Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin

2005-01-01

Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

Transcriptional Activity of Nuclear Factor κB Family Genes in Patients with Systemic Sclerosis.

Science.gov (United States)

Lis-Święty, Anna; Gola, Joanna; Mazurek, Urszula; Brzezińska-Wcisło, Ligia

2017-05-01

Systemic sclerosis (SSc) is a connective tissue disease of unknown etiology and unclear pathogenesis. Evaluation of the activation of nuclear factor κB (NF-κB) family genes IκBα, p50, p52, p65, and c-Rel, potentially involved in the regulation of immunity, inflammation, angiogenesis, and tissue remodeling in SSc, was carried out. The study included 19 patients with limited SSc, 11 patients with early SSc, and 10 healthy persons constituting the control group. Real-time QRT-PCR was used to evaluate the mRNAs in peripheral blood samples. The patients with early SSc showed a decrease in transcriptional activity of IκBα inhibitor and c-Rel subunit. Transcriptional activity decrease in the other patients with limited SSc included genes encoding c-Rel and p50, subunits of NF-κB factor. Deregulation of intracellular signal transduction by NF-κB takes place at the beginning of SSc and in its fibrosis stage. Associations between clinical variables and NF-κB related gene expression as well as the activation of NF-κB family members in SSc patients should be addressed in future studies. © 2017 by the Association of Clinical Scientists, Inc.

Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

Science.gov (United States)

Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

2014-08-28

The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway.

Science.gov (United States)

Bassler, B L; Wright, M; Silverman, M R

1994-07-01

Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.

Gene family expansions and contractions are associated with host range in plant pathogens of the genus Colletotrichum.

Science.gov (United States)

Baroncelli, Riccardo; Amby, Daniel Buchvaldt; Zapparata, Antonio; Sarrocco, Sabrina; Vannacci, Giovanni; Le Floch, Gaétan; Harrison, Richard J; Holub, Eric; Sukno, Serenella A; Sreenivasaprasad, Surapareddy; Thon, Michael R

2016-08-05

Many species belonging to the genus Colletotrichum cause anthracnose disease on a wide range of plant species. In addition to their economic impact, the genus Colletotrichum is a useful model for the study of the evolution of host specificity, speciation and reproductive behaviors. Genome projects of Colletotrichum species have already opened a new era for studying the evolution of pathogenesis in fungi. We sequenced and annotated the genomes of four strains in the Colletotrichum acutatum species complex (CAsc), a clade of broad host range pathogens within the genus. The four CAsc proteomes and secretomes along with those representing an additional 13 species (six Colletotrichum spp. and seven other Sordariomycetes) were classified into protein families using a variety of tools. Hierarchical clustering of gene family and functional domain assignments, and phylogenetic analyses revealed lineage specific losses of carbohydrate-active enzymes (CAZymes) and proteases encoding genes in Colletotrichum species that have narrow host range as well as duplications of these families in the CAsc. We also found a lineage specific expansion of necrosis and ethylene-inducing peptide 1 (Nep1)-like protein (NLPs) families within the CAsc. This study illustrates the plasticity of Colletotrichum genomes, and shows that major changes in host range are associated with relatively recent changes in gene content.

Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

Science.gov (United States)

Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

2014-12-13

The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

Gene family size conservation is a good indicator of evolutionary rates.

Science.gov (United States)

Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

2010-08-01

The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Deciphering the Origin, Evolution, and Physiological Function of the Subtelomeric Aryl-Alcohol Dehydrogenase Gene Family in the Yeast Saccharomyces cerevisiae.

Science.gov (United States)

Yang, Dong-Dong; de Billerbeck, Gustavo M; Zhang, Jin-Jing; Rosenzweig, Frank; Francois, Jean-Marie

2018-01-01

Homology searches indicate that Saccharomyces cerevisiae strain BY4741 contains seven redundant genes that encode putative aryl-alcohol dehydrogenases (AAD). Yeast AAD genes are located in subtelomeric regions of different chromosomes, and their functional role(s) remain enigmatic. Here, we show that two of these genes, AAD4 and AAD14 , encode functional enzymes that reduce aliphatic and aryl-aldehydes concomitant with the oxidation of cofactor NADPH, and that Aad4p and Aad14p exhibit different substrate preference patterns. Other yeast AAD genes are undergoing pseudogenization. The 5' sequence of AAD15 has been deleted from the genome. Repair of an AAD3 missense mutation at the catalytically essential Tyr 73 residue did not result in a functional enzyme. However, ancestral-state reconstruction by fusing Aad6 with Aad16 and by N-terminal repair of Aad10 restores NADPH-dependent aryl-alcohol dehydrogenase activities. Phylogenetic analysis indicates that AAD genes are narrowly distributed in wood-saprophyte fungi and in yeast that occupy lignocellulosic niches. Because yeast AAD genes exhibit activity on veratraldehyde, cinnamaldehyde, and vanillin, they could serve to detoxify aryl-aldehydes released during lignin degradation. However, none of these compounds induce yeast AAD gene expression, and Aad activities do not relieve aryl-aldehyde growth inhibition. Our data suggest an ancestral role for AAD genes in lignin degradation that is degenerating as a result of yeast's domestication and use in brewing, baking, and other industrial applications. IMPORTANCE Functional characterization of hypothetical genes remains one of the chief tasks of the postgenomic era. Although the first Saccharomyces cerevisiae genome sequence was published over 20 years ago, 22% of its estimated 6,603 open reading frames (ORFs) remain unverified. One outstanding example of this category of genes is the enigmatic seven-member AAD family. Here, we demonstrate that proteins encoded by two

Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

Science.gov (United States)

Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

2017-12-19

WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

Characterization of paralogous protein families in rice

Directory of Open Access Journals (Sweden)

Zhu Wei

2008-02-01

Full Text Available Abstract Background High gene numbers in plant genomes reflect polyploidy and major gene duplication events. Oryza sativa, cultivated rice, is a diploid monocotyledonous species with a ~390 Mb genome that has undergone segmental duplication of a substantial portion of its genome. This, coupled with other genetic events such as tandem duplications, has resulted in a substantial number of its genes, and resulting proteins, occurring in paralogous families. Results Using a computational pipeline that utilizes Pfam and novel protein domains, we characterized paralogous families in rice and compared these with paralogous families in the model dicotyledonous diploid species, Arabidopsis thaliana. Arabidopsis, which has undergone genome duplication as well, has a substantially smaller genome (~120 Mb and gene complement compared to rice. Overall, 53% and 68% of the non-transposable element-related rice and Arabidopsis proteins could be classified into paralogous protein families, respectively. Singleton and paralogous family genes differed substantially in their likelihood of encoding a protein of known or putative function; 26% and 66% of singleton genes compared to 73% and 96% of the paralogous family genes encode a known or putative protein in rice and Arabidopsis, respectively. Furthermore, a major skew in the distribution of specific gene function was observed; a total of 17 Gene Ontology categories in both rice and Arabidopsis were statistically significant in their differential distribution between paralogous family and singleton proteins. In contrast to mammalian organisms, we found that duplicated genes in rice and Arabidopsis tend to have more alternative splice forms. Using data from Massively Parallel Signature Sequencing, we show that a significant portion of the duplicated genes in rice show divergent expression although a correlation between sequence divergence and correlation of expression could be seen in very young genes. Conclusion

Pmr, a histone-like protein H1 (H-NS) family protein encoded by the IncP-7 plasmid pCAR1, is a key global regulator that alters host function.

Science.gov (United States)

Yun, Choong-Soo; Suzuki, Chiho; Naito, Kunihiko; Takeda, Toshiharu; Takahashi, Yurika; Sai, Fumiya; Terabayashi, Tsuguno; Miyakoshi, Masatoshi; Shintani, Masaki; Nishida, Hiromi; Yamane, Hisakazu; Nojiri, Hideaki

2010-09-01

Histone-like protein H1 (H-NS) family proteins are nucleoid-associated proteins (NAPs) conserved among many bacterial species. The IncP-7 plasmid pCAR1 is transmissible among various Pseudomonas strains and carries a gene encoding the H-NS family protein, Pmr. Pseudomonas putida KT2440 is a host of pCAR1, which harbors five genes encoding the H-NS family proteins PP_1366 (TurA), PP_3765 (TurB), PP_0017 (TurC), PP_3693 (TurD), and PP_2947 (TurE). Quantitative reverse transcription-PCR (qRT-PCR) demonstrated that the presence of pCAR1 does not affect the transcription of these five genes and that only pmr, turA, and turB were primarily transcribed in KT2440(pCAR1). In vitro pull-down assays revealed that Pmr strongly interacted with itself and with TurA, TurB, and TurE. Transcriptome comparisons of the pmr disruptant, KT2440, and KT2440(pCAR1) strains indicated that pmr disruption had greater effects on the host transcriptome than did pCAR1 carriage. The transcriptional levels of some genes that increased with pCAR1 carriage, such as the mexEF-oprN efflux pump genes and parI, reverted with pmr disruption to levels in pCAR1-free KT2440. Transcriptional levels of putative horizontally acquired host genes were not altered by pCAR1 carriage but were altered by pmr disruption. Identification of genome-wide Pmr binding sites by ChAP-chip (chromatin affinity purification coupled with high-density tiling chip) analysis demonstrated that Pmr preferentially binds to horizontally acquired DNA regions. The Pmr binding sites overlapped well with the location of the genes differentially transcribed following pmr disruption on both the plasmid and the chromosome. Our findings indicate that Pmr is a key factor in optimizing gene transcription on pCAR1 and the host chromosome.

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

Evolution and diversity of secretome genes in the apicomplexan parasite Theileria annulata

Directory of Open Access Journals (Sweden)

Shiels Brian R

2010-01-01

Full Text Available Abstract Background Little is known about how apicomplexan parasites have evolved to infect different host species and cell types. Theileria annulata and Theileria parva invade and transform bovine leukocytes but each species favours a different host cell lineage. Parasite-encoded proteins secreted from the intracellular macroschizont stage within the leukocyte represent a critical interface between host and pathogen systems. Genome sequencing has revealed that several Theileria-specific gene families encoding secreted proteins are positively selected at the inter-species level, indicating diversification between the species. We extend this analysis to the intra-species level, focusing on allelic diversity of two major secretome families. These families represent a well-characterised group of genes implicated in control of the host cell phenotype and a gene family of unknown function. To gain further insight into their evolution and function, this study investigates whether representative genes of these two families are diversifying or constrained within the T. annulata population. Results Strong evidence is provided that the sub-telomerically encoded SVSP family and the host-nucleus targeted TashAT family have evolved under contrasting pressures within natural T. annulata populations. SVSP genes were found to possess atypical codon usage and be evolving neutrally, with high levels of nucleotide substitutions and multiple indels. No evidence of geographical sub-structuring of allelic sequences was found. In contrast, TashAT family genes, implicated in control of host cell gene expression, are strongly conserved at the protein level and geographically sub-structured allelic sequences were identified among Tunisian and Turkish isolates. Although different copy numbers of DNA binding motifs were identified in alleles of TashAT proteins, motif periodicity was strongly maintained, implying conserved functional activity of these sites. Conclusions

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Baumgarten Andrew

2004-06-01

Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Genome-wide identification and characterization of the SBP-box gene family in Petunia.

Science.gov (United States)

Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

2018-03-12

SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

Definition of the low molecular weight glutenin subunit gene family members in a set of standard bread wheat (Triticum aestivum L.) varieties

Science.gov (United States)

Low-molecular-weight glutenin subunits (LMW-GS) are a class of seed storage proteins that play a major role in the determination of the viscoelastic properties of wheat dough. Most of the LMW-GSs are encoded by a multi-gene family located on the short arms of the homoeologous group 1 chromosomes, at...

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Analysis of Copy Number Variation in the Abp Gene Regions of Two House Mouse Subspecies Suggests Divergence during the Gene Family Expansions.

Science.gov (United States)

Pezer, Željka; Chung, Amanda G; Karn, Robert C; Laukaitis, Christina M

2017-06-01

The Androgen-binding protein ( Abp ) gene region of the mouse genome contains 64 genes, some encoding pheromones that influence assortative mating between mice from different subspecies. Using CNVnator and quantitative PCR, we explored copy number variation in this gene family in natural populations of Mus musculus domesticus ( Mmd ) and Mus musculus musculus ( Mmm ), two subspecies of house mice that form a narrow hybrid zone in Central Europe. We found that copy number variation in the center of the Abp gene region is very common in wild Mmd , primarily representing the presence/absence of the final duplications described for the mouse genome. Clustering of Mmd individuals based on this variation did not reflect their geographical origin, suggesting no population divergence in the Abp gene cluster. However, copy number variation patterns differ substantially between Mmd and other mouse taxa. Large blocks of Abp genes are absent in Mmm , Mus musculus castaneus and an outgroup, Mus spretus , although with differences in variation and breakpoint locations. Our analysis calls into question the reliance on a reference genome for interpreting the detailed organization of genes in taxa more distant from the Mmd reference genome. The polymorphic nature of the gene family expansion in all four taxa suggests that the number of Abp genes, especially in the central gene region, is not critical to the survival and reproduction of the mouse. However, Abp haplotypes of variable length may serve as a source of raw genetic material for new signals influencing reproductive communication and thus speciation of mice. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

Science.gov (United States)

Varmanen, P; Rantanen, T; Palva, A

1996-12-01

A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

A comparative gene analysis with rice identified orthologous group II HKT genes and their association with Na(+) concentration in bread wheat.

Science.gov (United States)

Ariyarathna, H A Chandima K; Oldach, Klaus H; Francki, Michael G

2016-01-19

Although the HKT transporter genes ascertain some of the key determinants of crop salt tolerance mechanisms, the diversity and functional role of group II HKT genes are not clearly understood in bread wheat. The advanced knowledge on rice HKT and whole genome sequence was, therefore, used in comparative gene analysis to identify orthologous wheat group II HKT genes and their role in trait variation under different saline environments. The four group II HKTs in rice identified two orthologous gene families from bread wheat, including the known TaHKT2;1 gene family and a new distinctly different gene family designated as TaHKT2;2. A single copy of TaHKT2;2 was found on each homeologous chromosome arm 7AL, 7BL and 7DL and each gene was expressed in leaf blade, sheath and root tissues under non-stressed and at 200 mM salt stressed conditions. The proteins encoded by genes of the TaHKT2;2 family revealed more than 93% amino acid sequence identity but ≤52% amino acid identity compared to the proteins encoded by TaHKT2;1 family. Specifically, variations in known critical domains predicted functional differences between the two protein families. Similar to orthologous rice genes on chromosome 6L, TaHKT2;1 and TaHKT2;2 genes were located approximately 3 kb apart on wheat chromosomes 7AL, 7BL and 7DL, forming a static syntenic block in the two species. The chromosomal region on 7AL containing TaHKT2;1 7AL-1 co-located with QTL for shoot Na(+) concentration and yield in some saline environments. The differences in copy number, genes sequences and encoded proteins between TaHKT2;2 homeologous genes and other group II HKT gene families within and across species likely reflect functional diversity for ion selectivity and transport in plants. Evidence indicated that neither TaHKT2;2 nor TaHKT2;1 were associated with primary root Na(+) uptake but TaHKT2;1 may be associated with trait variation for Na(+) exclusion and yield in some but not all saline environments.

Many Saccharomyces cerevisiae Cell Wall Protein Encoding Genes Are Coregulated by Mss11, but Cellular Adhesion Phenotypes Appear Only Flo Protein Dependent.

Science.gov (United States)

Bester, Michael C; Jacobson, Dan; Bauer, Florian F

2012-01-01

The outer cell wall of the yeast Saccharomyces cerevisiae serves as the interface with the surrounding environment and directly affects cell-cell and cell-surface interactions. Many of these interactions are facilitated by specific adhesins that belong to the Flo protein family. Flo mannoproteins have been implicated in phenotypes such as flocculation, substrate adhesion, biofilm formation, and pseudohyphal growth. Genetic data strongly suggest that individual Flo proteins are responsible for many specific cellular adhesion phenotypes. However, it remains unclear whether such phenotypes are determined solely by the nature of the expressed FLO genes or rather as the result of a combination of FLO gene expression and other cell wall properties and cell wall proteins. Mss11 has been shown to be a central element of FLO1 and FLO11 gene regulation and acts together with the cAMP-PKA-dependent transcription factor Flo8. Here we use genome-wide transcription analysis to identify genes that are directly or indirectly regulated by Mss11. Interestingly, many of these genes encode cell wall mannoproteins, in particular, members of the TIR and DAN families. To examine whether these genes play a role in the adhesion properties associated with Mss11 expression, we assessed deletion mutants of these genes in wild-type and flo11Δ genetic backgrounds. This analysis shows that only FLO genes, in particular FLO1/10/11, appear to significantly impact on such phenotypes. Thus adhesion-related phenotypes are primarily dependent on the balance of FLO gene expression.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

The Drosophila melanogaster DmCK2beta transcription unit encodes for functionally non-redundant protein isoforms.

Science.gov (United States)

Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas

2006-06-07

Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes encoding for CK2beta-like proteins are present. The X-linked DmCK2beta transcription unit encodes for several CK2beta protein isoforms due to alternative splicing of its primary transcript. We addressed the question whether CK2beta-like proteins are redundant in function. Our in vivo experiments show that variations of the very C-terminal tail of CK2beta isoforms encoded by the X-linked DmCK2beta transcription unit influence their functional properties. In addition, we find that CK2beta-like proteins encoded by the autosomal D. melanogaster genes CK2betates and CK2beta' cannot fully substitute for a loss of CK2beta isoforms encoded by DmCK2beta.

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Exercise intervention in a family with exercise intolerance and a novel mutation in the mitochondrial POLG gene

OpenAIRE

Morán, María; Blázquez, A.; Fiuza Luces, María del Carmen; Díez Bermejo, Jorge; Delmiro, Aitor; Docampo, J.; Serrano Lorenzo, Pablo; González Quintana, Adrián; Arenas, Joaquín; Laín Hernández, A.; Lucía Mulas, Alejandro; Domínguez González, C.; Martín, M.

2016-01-01

Mutations in the POLG gene, encoding the mitochondrial DNA (mtDNA) polymerase subunit gamma-1, have been identified in severe mtDNA depletion syndromes and mtDNA deletion disorders which include ataxia neuropathy spectrum disorders and AR and AD forms of progressive external ophthalmoplegia (PEO) and PEO-plus disorders. We report on a family with exercise intolerance. The proband was a 50-year-old man with severe muscle pain and premature fatigue after exercise of mild to moderate intensity. ...

Identification and Characterization of Cyprinid Herpesvirus-3 (CyHV-3 Encoded MicroRNAs.

Directory of Open Access Journals (Sweden)

Owen H Donohoe

Full Text Available MicroRNAs (miRNAs are a class of small non-coding RNAs involved in post-transcriptional gene regulation. Some viruses encode their own miRNAs and these are increasingly being recognized as important modulators of viral and host gene expression. Cyprinid herpesvirus 3 (CyHV-3 is a highly pathogenic agent that causes acute mass mortalities in carp (Cyprinus carpio carpio and koi (Cyprinus carpio koi worldwide. Here, bioinformatic analyses of the CyHV-3 genome suggested the presence of non-conserved precursor miRNA (pre-miRNA genes. Deep sequencing of small RNA fractions prepared from in vitro CyHV-3 infections led to the identification of potential miRNAs and miRNA-offset RNAs (moRNAs derived from some bioinformatically predicted pre-miRNAs. DNA microarray hybridization analysis, Northern blotting and stem-loop RT-qPCR were then used to definitively confirm that CyHV-3 expresses two pre-miRNAs during infection in vitro. The evidence also suggested the presence of an additional four high-probability and two putative viral pre-miRNAs. MiRNAs from the two confirmed pre-miRNAs were also detected in gill tissue from CyHV-3-infected carp. We also present evidence that one confirmed miRNA can regulate the expression of a putative CyHV-3-encoded dUTPase. Candidate homologues of some CyHV-3 pre-miRNAs were identified in CyHV-1 and CyHV-2. This is the first report of miRNA and moRNA genes encoded by members of the Alloherpesviridae family, a group distantly related to the Herpesviridae family. The discovery of these novel CyHV-3 genes may help further our understanding of the biology of this economically important virus and their encoded miRNAs may have potential as biomarkers for the diagnosis of latent CyHV-3.

Identification and Characterization of Cyprinid Herpesvirus-3 (CyHV-3) Encoded MicroRNAs

Science.gov (United States)

Donohoe, Owen H.; Henshilwood, Kathy; Way, Keith; Hakimjavadi, Roya; Stone, David M.; Walls, Dermot

2015-01-01

MicroRNAs (miRNAs) are a class of small non-coding RNAs involved in post-transcriptional gene regulation. Some viruses encode their own miRNAs and these are increasingly being recognized as important modulators of viral and host gene expression. Cyprinid herpesvirus 3 (CyHV-3) is a highly pathogenic agent that causes acute mass mortalities in carp (Cyprinus carpio carpio) and koi (Cyprinus carpio koi) worldwide. Here, bioinformatic analyses of the CyHV-3 genome suggested the presence of non-conserved precursor miRNA (pre-miRNA) genes. Deep sequencing of small RNA fractions prepared from in vitro CyHV-3 infections led to the identification of potential miRNAs and miRNA–offset RNAs (moRNAs) derived from some bioinformatically predicted pre-miRNAs. DNA microarray hybridization analysis, Northern blotting and stem-loop RT-qPCR were then used to definitively confirm that CyHV-3 expresses two pre-miRNAs during infection in vitro. The evidence also suggested the presence of an additional four high-probability and two putative viral pre-miRNAs. MiRNAs from the two confirmed pre-miRNAs were also detected in gill tissue from CyHV-3-infected carp. We also present evidence that one confirmed miRNA can regulate the expression of a putative CyHV-3-encoded dUTPase. Candidate homologues of some CyHV-3 pre-miRNAs were identified in CyHV-1 and CyHV-2. This is the first report of miRNA and moRNA genes encoded by members of the Alloherpesviridae family, a group distantly related to the Herpesviridae family. The discovery of these novel CyHV-3 genes may help further our understanding of the biology of this economically important virus and their encoded miRNAs may have potential as biomarkers for the diagnosis of latent CyHV-3. PMID:25928140

Genome-wide identification and evolution of the PIN-FORMED (PIN) gene family in Glycine max.

Science.gov (United States)

Liu, Yuan; Wei, Haichao

2017-07-01

Soybean (Glycine max) is one of the most important crop plants. Wild and cultivated soybean varieties have significant differences worth further investigation, such as plant morphology, seed size, and seed coat development; these characters may be related to auxin biology. The PIN gene family encodes essential transport proteins in cell-to-cell auxin transport, but little research on soybean PIN genes (GmPIN genes) has been done, especially with respect to the evolution and differences between wild and cultivated soybean. In this study, we retrieved 23 GmPIN genes from the latest updated G. max genome database; six GmPIN protein sequences were changed compared with the previous database. Based on the Plant Genome Duplication Database, 18 GmPIN genes have been involved in segment duplication. Three pairs of GmPIN genes arose after the second soybean genome duplication, and six occurred after the first genome duplication. The duplicated GmPIN genes retained similar expression patterns. All the duplicated GmPIN genes experienced purifying selection (K a /K s genome sequence of 17 wild and 14 cultivated soybean varieties. Our research provides useful and comprehensive basic information for understanding GmPIN genes.

Evolution of the Yellow/Major Royal Jelly Protein family and the emergence of social behavior in honey bees.

Science.gov (United States)

Drapeau, Mark David; Albert, Stefan; Kucharski, Robert; Prusko, Carsten; Maleszka, Ryszard

2006-11-01

The genomic architecture underlying the evolution of insect social behavior is largely a mystery. Eusociality, defined by overlapping generations, parental brood care, and reproductive division of labor, has most commonly evolved in the Hymenopteran insects, including the honey bee Apis mellifera. In this species, the Major Royal Jelly Protein (MRJP) family is required for all major aspects of eusocial behavior. Here, using data obtained from the A. mellifera genome sequencing project, we demonstrate that the MRJP family is encoded by nine genes arranged in an approximately 60-kb tandem array. Furthermore, the MRJP protein family appears to have evolved from a single progenitor gene that encodes a member of the ancient Yellow protein family. Five genes encoding Yellow-family proteins flank the genomic region containing the genes encoding MRJPs. We describe the molecular evolution of these protein families. We then characterize developmental-stage-specific, sex-specific, and caste-specific expression patterns of the mrjp and yellow genes in the honey bee. We review empirical evidence concerning the functions of Yellow proteins in fruit flies and social ants, in order to shed light on the roles of both Yellow and MRJP proteins in A. mellifera. In total, the available evidence suggests that Yellows and MRJPs are multifunctional proteins with diverse, context-dependent physiological and developmental roles. However, many members of the Yellow/MRJP family act as facilitators of reproductive maturation. Finally, it appears that MRJP protein subfamily evolution from the Yellow protein family may have coincided with the evolution of honey bee eusociality.

The miR-10 microRNA precursor family

DEFF Research Database (Denmark)

Tehler, Disa; Høyland-Kroghsbo, Nina Molin; Lund, Anders H

2011-01-01

The miR-10 microRNA precursor family encodes a group of short non-coding RNAs involved in gene regulation. The miR-10 family is highly conserved and has sparked the interest of many research groups because of the genomic localization in the vicinity of, coexpression with and regulation of the Hox...... gene developmental regulators. Here, we review the current knowledge of the evolution, physiological function and involvement in cancer of this family of microRNAs....

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Association of ALOX15 gene polymorphisms with obesity-related phenotypes in Chinese nuclear families with male offspring

Institute of Scientific and Technical Information of China (English)

Yao-hua KE; Chun WANG; Yun-qiu HU; Miao LI; Yu-juan LIU; Wen-zhen FU; Zhen-lin ZHANG; Wen-jin XIAO; Jin-wei HE; Hao ZHANG; Jin-bo YU; Wei-wei HU; Jie-mei GU; Gao GAO; Hua YUE

2012-01-01

Aim:Genetic variation in ALOX12,which encoded human 12-lipoxygenase,was found to be associated with fat mass in young Chinese men.The objective of this study was to investigate the relationship between single nucleotide polymorphisms (SNPs) and haplotypes in the ALOX15 gene and obesity-related phenotypes in Chinese nuclear families with male offspring.Methods:We recruited 1,296 subjects from 427 nuclear families with male offspring and genotyped five SNPs (rs9894225,rs748694,rs2619112,rs2619118,and rs916055) in the ALOX15 gene locus.The total fat mass (TFM),trunk fat mass (tFM),leg fat mass (LFM) and arm fat mass (AFM) were measured using dual-energy X-ray absorptiometry (DXA).The percentage of fat mass (PFM) was the ratio of TFM and body weight.The association between SNPs and haplotypes of ALOX15 and obesity-related phenotypic variation was measured using quantitative transmission disequilibrium test (QTDT).Results:Using QTDT to measure family-based genetic association,we found that rs916055 had a statistically significant association with PFM (P=0.038),whereas rs916055 had a marginal but statistically insignificant association with tFM (P=0.093).The multipleparameter 1000 permutations test agreed with the family-based association results:both showed that rs916055 had a statistically significant association with PFM (P=0.033).Conclusion:rs916055 in ALOX15 gene was significantly associated with the percentage of fat mass in Chinese nuclear families with male offspring in the family-based association study using QTDT approach.

Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

Science.gov (United States)

Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

2012-04-01

Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.

Directory of Open Access Journals (Sweden)

Giselle Sek Suan Nah

Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.

The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study

DEFF Research Database (Denmark)

Hedley, Paula L; Haundrup, Ole; Andersen, Paal S

2011-01-01

The gene family KCNE1-5, which encode modulating β-subunits of several repolarising K+-ion channels, has been associated with genetic cardiac diseases such as long QT syndrome, atrial fibrillation and Brugada syndrome. The minK peptide, encoded by KCNE1, is attached to the Z-disc of the sarcomere...... as well as the T-tubules of the sarcolemma. It has been suggested that minK forms part of an "electro-mechanical feed-back" which links cardiomyocyte stretching to changes in ion channel function. We examined whether mutations in KCNE genes were associated with hypertrophic cardiomyopathy (HCM), a genetic...

Absence of erythrocyte sequestration and lack of multicopy gene family expression in Plasmodium falciparum from a splenectomized malaria patient.

Directory of Open Access Journals (Sweden)

Anna Bachmann

Full Text Available BACKGROUND: To avoid spleen-dependent killing mechanisms parasite-infected erythrocytes (IE of Plasmodium falciparum malaria patients have the capacity to bind to endothelial receptors. This binding also known as sequestration, is mediated by parasite proteins, which are targeted to the erythrocyte surface. Candidate proteins are those encoded by P. falciparum multicopy gene families, such as var, rif, stevor or PfMC-2TM. However, a direct in vivo proof of IE sequestration and expression of multicopy gene families is still lacking. Here, we report on the analysis of IE from a black African immigrant, who received the diagnosis of a malignant lymphoproliferative disorder and subsequently underwent splenectomy. Three weeks after surgery, the patient experienced clinical falciparum malaria with high parasitemia and circulating developmental parasite stages usually sequestered to the vascular endothelium such as late trophozoites, schizonts or immature gametocytes. METHODOLOGY/PRINCIPAL FINDINGS: Initially, when isolated from the patient, the infected erythrocytes were incapable to bind to various endothelial receptors in vitro. Moreover, the parasites failed to express the multicopy gene families var, A-type rif and stevor but expression of B-type rif and PfMC-2TM genes were detected. In the course of in vitro cultivation, the parasites started to express all investigated multicopy gene families and concomitantly developed the ability to adhere to endothelial receptors such as CD36 and ICAM-1, respectively. CONCLUSION/SIGNIFICANCE: This case strongly supports the hypothesis that parasite surface proteins such as PfEMP1, A-type RIFIN or STEVOR are involved in interactions of infected erythrocytes with endothelial receptors mediating sequestration of mature asexual and immature sexual stages of P. falciparum. In contrast, multicopy gene families coding for B-type RIFIN and PfMC-2TM proteins may not be involved in sequestration, as these genes were

Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families.

Science.gov (United States)

Voloshanenko, Oksana; Gmach, Philipp; Winter, Jan; Kranz, Dominique; Boutros, Michael

2017-11-01

Signaling pathway modules are often encoded by several closely related paralogous genes that can have redundant roles and are therefore difficult to analyze by loss-of-function analysis. A typical example is the Wnt signaling pathway, which in mammals is mediated by 19 Wnt ligands that can bind to 10 Frizzled (FZD) receptors. Although significant progress in understanding Wnt-FZD receptor interactions has been made in recent years, tools to generate systematic interaction maps have been largely lacking. Here we generated cell lines with multiplex mutant alleles of FZD1 , FZD2 , and FZD7 and demonstrate that these cells are unresponsive to canonical Wnt ligands. Subsequently, we performed genetic rescue experiments with combinations of FZDs and canonical Wnts to create a functional ligand-receptor interaction map. These experiments showed that whereas several Wnt ligands, such as Wnt3a, induce signaling through a broad spectrum of FZD receptors, others, such as Wnt8a, act through a restricted set of FZD genes. Together, our results map functional interactions of FZDs and 10 Wnt ligands and demonstrate how multiplex targeting by clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 can be used to systematically elucidate the functions of multigene families.-Voloshanenko, O., Gmach, P., Winter, J., Kranz, D., Boutros, M. Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families. © The Author(s).

A family-based association study identified CYP17 as a candidate gene for obesity susceptibility in Caucasians.

Science.gov (United States)

Yan, H; Guo, Y; Yang, T-L; Zhao, L-J; Deng, H-W

2012-08-06

The cytochrome P450c17α gene (CYP17) encodes a key biosynthesis enzyme of estrogen, which is critical in regulating adipogenesis and adipocyte development in humans. We therefore hypothesized that CYP17 is a candidate gene for predicting obesity. In order to test this hypothesis, we performed a family-based association test to investigate the relationship between the CYP17 gene and obesity phenotypes in a large sample comprising 1873 subjects from 405 Caucasian nuclear families of European origin recruited by the Osteoporosis Research Center of Creighton University, USA. Both single SNPs and haplotypes were tested for associations with obesity-related phenotypes, including body mass index (BMI) and fat mass. We identified three SNPs to be significantly associated with BMI, including rs3740397, rs6163, and rs619824. We further characterized the linkage disequilibrium structure for CYP17 and found that the whole CYP17 gene was located in a single-linkage disequilibrium block. This block was observed to be significantly associated with BMI. A major haplotype in this block was significantly associated with both BMI and fat mass. In conclusion, we suggest that the CYP17 gene has an effect on obesity in the Caucasian population. Further independent studies will be needed to confirm our findings.

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

Structural and functional studies of a family of Dictyostelium discoideum developmentally regulated, prestalk genes coding for small proteins

Directory of Open Access Journals (Sweden)

Escalante Ricardo

2008-01-01

Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.

A novel missense mutation (402C-->T) in exon 1 in the EDA gene in a family with X-linked hypohidrotic ectodermal dysplasia

DEFF Research Database (Denmark)

Hertz, Jens Michael; Nørgaard Hansen, K; Juncker, I

1998-01-01

Hypohidrotic ectodermal dysplasia (EDA), or Christ-Siemens-Touraine syndrome, is clinically characterized by hypohidrosis, hypoodontia and hypotrichosis. The X-linked form of the disease has been mapped to Xq12-q13.1, and a gene from this region has recently been cloned. This gene encodes a predi...... in the protein. This mutation cosegregates with the disease in the family and is the first mutation described which affects the predicted transmembrane, hydrophobic domain of the protein.......Hypohidrotic ectodermal dysplasia (EDA), or Christ-Siemens-Touraine syndrome, is clinically characterized by hypohidrosis, hypoodontia and hypotrichosis. The X-linked form of the disease has been mapped to Xq12-q13.1, and a gene from this region has recently been cloned. This gene encodes...... a predicted transmembrane protein of 135 amino acids, which was found to be expressed in keratinocytes, hair follicles, and sweat glands. A variety of rearrangements in this gene have been found in patients with hypohidrotic ectodermal dysplasia. We have screened the probands from nine unrelated Danish...

Interferon induced IFIT family genes in host antiviral defense.

Science.gov (United States)

Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

2013-01-01

Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative

Energy Technology Data Exchange (ETDEWEB)

Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka; Pigli, Ying Z.; Boyle-Vavra, Susan; Rice , Phoebe A. (UC)

2016-08-29

Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-family replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.

Genome-wide analysis of WRKY gene family in the sesame genome and identification of the WRKY genes involved in responses to abiotic stresses.

Science.gov (United States)

Li, Donghua; Liu, Pan; Yu, Jingyin; Wang, Linhai; Dossa, Komivi; Zhang, Yanxin; Zhou, Rong; Wei, Xin; Zhang, Xiurong

2017-09-11

Sesame (Sesamum indicum L.) is one of the world's most important oil crops. However, it is susceptible to abiotic stresses in general, and to waterlogging and drought stresses in particular. The molecular mechanisms of abiotic stress tolerance in sesame have not yet been elucidated. The WRKY domain transcription factors play significant roles in plant growth, development, and responses to stresses. However, little is known about the number, location, structure, molecular phylogenetics, and expression of the WRKY genes in sesame. We performed a comprehensive study of the WRKY gene family in sesame and identified 71 SiWRKYs. In total, 65 of these genes were mapped to 15 linkage groups within the sesame genome. A phylogenetic analysis was performed using a related species (Arabidopsis thaliana) to investigate the evolution of the sesame WRKY genes. Tissue expression profiles of the WRKY genes demonstrated that six SiWRKY genes were highly expressed in all organs, suggesting that these genes may be important for plant growth and organ development in sesame. Analysis of the SiWRKY gene expression patterns revealed that 33 and 26 SiWRKYs respond strongly to waterlogging and drought stresses, respectively. Changes in the expression of 12 SiWRKY genes were observed at different times after the waterlogging and drought treatments had begun, demonstrating that sesame gene expression patterns vary in response to abiotic stresses. In this study, we analyzed the WRKY family of transcription factors encoded by the sesame genome. Insight was gained into the classification, evolution, and function of the SiWRKY genes, revealing their putative roles in a variety of tissues. Responses to abiotic stresses in different sesame cultivars were also investigated. The results of our study provide a better understanding of the structures and functions of sesame WRKY genes and suggest that manipulating these WRKYs could enhance resistance to waterlogging and drought.

Promoter of CaZF, a chickpea gene that positively regulates growth and stress tolerance, is activated by an AP2-family transcription factor CAP2.

Directory of Open Access Journals (Sweden)

Deepti Jain

Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.

Identification of novel missense mutations in the Norrie disease gene associated with one X-linked and four sporadic cases of familial exudative vitreoretinopathy.

Science.gov (United States)

Shastry, B S; Hejtmancik, J F; Trese, M T

1997-01-01

X-linked Familial Exudative Vitreoretinopathy (XLFEVR) is a hereditary eye disorder that affects both the retina and the vitreous body. It is characterized by an abnormal vascularization of the peripheral retina. It has been previously shown by linkage and candidate gene analysis that XLFEVR and Norrie disease are allelic. In this report we describe four novel mutations (R41K, H42R, K58N, and Y120C) in the Norrie disease gene associated with one X-linked and four sporadic cases of FEVR. One mutation (H42R) was found to be segregating with the disease in three generations (X-linked family), and the others are sporadic. These sequence alterations changed the encoded amino acids in the Norrie disease protein and were not found in 17 unaffected family members or in 36 randomly selected normal individuals. This study provides additional evidence that mutations in the same gene can result in FEVR and Norrie disease. It also demonstrates that it may be beneficial for clinical diagnosis to screen for mutations in the Norrie disease gene in sporadic FEVR cases.

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Genome-wide analysis and identification of cytokinin oxidase/dehydrogenase (CKX gene family in foxtail millet (Setaria italica

Directory of Open Access Journals (Sweden)

Yuange Wang

2014-08-01

Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC.1.5.99.12 regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.

Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

Science.gov (United States)

Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

2016-11-15

Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster

Science.gov (United States)

Robertson, Hugh M.; Warr, Coral G.; Carlson, John R.

2003-01-01

The insect chemoreceptor superfamily in Drosophila melanogaster is predicted to consist of 62 odorant receptor (Or) and 68 gustatory receptor (Gr) proteins, encoded by families of 60 Or and 60 Gr genes through alternative splicing. We include two previously undescribed Or genes and two previously undescribed Gr genes; two previously predicted Or genes are shown to be alternative splice forms. Three polymorphic pseudogenes and one highly defective pseudogene are recognized. Phylogenetic analysis reveals deep branches connecting multiple highly divergent clades within the Gr family, and the Or family appears to be a single highly expanded lineage within the superfamily. The genes are spread throughout the Drosophila genome, with some relatively recently diverged genes still clustered in the genome. The Gr5a gene on the X chromosome, which encodes a receptor for the sugar trehalose, has transposed from one such tandem cluster of six genes at cytological location 64, as has Gr61a, and all eight of these receptors might bind sugars. Analysis of intron evolution suggests that the common ancestor consisted of a long N-terminal exon encoding transmembrane domains 1-5 followed by three exons encoding transmembrane domains 6-7. As many as 57 additional introns have been acquired idiosyncratically during the evolution of the superfamily, whereas the ancestral introns and some of the older idiosyncratic introns have been lost at least 48 times independently. Altogether, these patterns of molecular evolution suggest that this is an ancient superfamily of chemoreceptors, probably dating back at least to the origin of the arthropods. PMID:14608037

Identification and in silico analysis of the Citrus HSP70 molecular chaperone gene family

Directory of Open Access Journals (Sweden)

Luciano G. Fietto

2007-01-01

Full Text Available The completion of the genome sequencing of the Arabidopsis thaliana model system provided a powerful molecular tool for comparative analysis of gene families present in the genome of economically relevant plant species. In this investigation, we used the sequences of the Arabidopsis Hsp70 gene family to identify and annotate the Citrus Hsp70 genes represented in the CitEST database. Based on sequence comparison analysis, we identified 18 clusters that were further divided into 5 subgroups encoding four mitochondrial mtHsp70s, three plastid csHsp70s, one ER luminal Hsp70 BiP, two HSP110/SSE-related proteins and eight cytosolic Hsp/Hsc70s. We also analyzed the expression profile by digital Northern of each Hsp70 transcript in different organs and in response to stress conditions. The EST database revealed a distinct population distribution of Hsp70 ESTs among isoforms and across the organs surveyed. The Hsp70-5 isoform was highly expressed in seeds, whereas BiP, mitochondrial and plastid HSp70 mRNAs displayed a similar expression profile in the organs analyzed, and were predominantly represented in flowers. Distinct Hsp70 mRNAs were also differentially expressed during Xylella infection and Citrus tristeza viral infection as well as during water deficit. This in silico study sets the groundwork for future investigations to fully characterize functionally the Citrus Hsp70 family and underscores the relevance of Hsp70s in response to abiotic and biotic stresses in Citrus.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation.

Science.gov (United States)

Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S

1996-01-01

we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

Science.gov (United States)

Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

2013-01-01

Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

Inherited variations in the SOD and GPX gene families and cancer risk.

Science.gov (United States)

Yuzhalin, Arseniy E; Kutikhin, Anton G

2012-05-01

Antioxidant defence enzymes are essential protectors of living organisms against oxidative stress. These enzymes are involved in the detoxification and decomposition of harmful chemical compounds called reactive oxygen species (ROS), which are, first and foremost, a source of intracellular oxidative stress. ROS directly promote the oxidative damage of genes resulting in aberrant regulation of many vital cell processes. As a consequence, the presence of ROS can lead to genomic instability, deregulation of transcription, induction of mitogenic signal transduction pathways and replication errors, all of which may increase the risk of cancer development. Single nucleotide polymorphisms of antioxidant defence genes may significantly modify the functional activity of the encoded proteins; therefore, certain alleles can be established as risk factors for particular cancer types. In the future, these risk alleles may be utilized as genomic markers of cancer predisposition to allow for early prevention measures among carriers of these alleles. The review is devoted to common single nucleotide polymorphisms of the superoxide dismutase (SOD) and glutathione peroxidase (GPX) gene families and their impact on carcinogenesis. The predictive significance of several polymorphisms was determined, and these polymorphisms were recommended for further in-depth research.

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

DEFF Research Database (Denmark)

Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

2007-01-01

from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

The arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier

Science.gov (United States)

Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.

1998-01-01

Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

Identification of WOX family genes in Selaginella kraussiana for studies on stem cells and regeneration in lycophytes

Directory of Open Access Journals (Sweden)

Yachao eGe

2016-02-01

Full Text Available Plant stem cells give rise to all tissues and organs and also serve as the source for plant regeneration. The organization of plant stem cells has undergone a progressive change from simple to complex during the evolution of vascular plants. Most studies on plant stem cells have focused on model angiosperms, the most recently diverged branch of vascular plants. However, our knowledge of stem cell function in other vascular plants is limited. Lycophytes and euphyllophytes (ferns, gymnosperms, and angiosperms are two existing branches of vascular plants that separated more than 400 million years ago. Lycophytes retain many of the features of early vascular plants. Based on genome and transcriptome data, we identified WUSCHEL-RELATED HOMEOBOX (WOX genes in Selaginella kraussiana, a model lycophyte that is convenient for in vitro culture and observations of organ formation and regeneration. WOX genes are key players controlling stem cells in plants. Our results showed that the S. kraussiana genome encodes at least eight members of the WOX family, which represent an early stage of WOX family evolution. Identification of WOX genes in S. kraussiana could be a useful tool for molecular studies on the function of stem cells in lycophytes.

Vast diversity of prokaryotic virus genomes encoding double jelly-roll major capsid proteins uncovered by genomic and metagenomic sequence analysis.

Science.gov (United States)

Yutin, Natalya; Bäckström, Disa; Ettema, Thijs J G; Krupovic, Mart; Koonin, Eugene V

2018-04-10

Analysis of metagenomic sequences has become the principal approach for the study of the diversity of viruses. Many recent, extensive metagenomic studies on several classes of viruses have dramatically expanded the visible part of the virosphere, showing that previously undetected viruses, or those that have been considered rare, actually are important components of the global virome. We investigated the provenance of viruses related to tail-less bacteriophages of the family Tectiviridae by searching genomic and metagenomics sequence databases for distant homologs of the tectivirus-like Double Jelly-Roll major capsid proteins (DJR MCP). These searches resulted in the identification of numerous genomes of virus-like elements that are similar in size to tectiviruses (10-15 kilobases) and have diverse gene compositions. By comparison of the gene repertoires, the DJR MCP-encoding genomes were classified into 6 distinct groups that can be predicted to differ in reproduction strategies and host ranges. Only the DJR MCP gene that is present by design is shared by all these genomes, and most also encode a predicted DNA-packaging ATPase; the rest of the genes are present only in subgroups of this unexpectedly diverse collection of DJR MCP-encoding genomes. Only a minority encode a DNA polymerase which is a hallmark of the family Tectiviridae and the putative family "Autolykiviridae". Notably, one of the identified putative DJR MCP viruses encodes a homolog of Cas1 endonuclease, the integrase involved in CRISPR-Cas adaptation and integration of transposon-like elements called casposons. This is the first detected occurrence of Cas1 in a virus. Many of the identified elements are individual contigs flanked by inverted or direct repeats and appear to represent complete, extrachromosomal viral genomes, whereas others are flanked by bacterial genes and thus can be considered as proviruses. These contigs come from metagenomes of widely different environments, some dominated by

A Gene Family Coding for Salivary Proteins (SHOT) of the Polyphagous Spider Mite Tetranychus urticae Exhibits Fast Host-Dependent Transcriptional Plasticity.

Science.gov (United States)

Jonckheere, Wim; Dermauw, Wannes; Khalighi, Mousaalreza; Pavlidi, Nena; Reubens, Wim; Baggerman, Geert; Tirry, Luc; Menschaert, Gerben; Kant, Merijn R; Vanholme, Bartel; Van Leeuwen, Thomas

2018-01-01

The salivary protein repertoire released by the herbivorous pest Tetranychus urticae is assumed to hold keys to its success on diverse crops. We report on a spider mite-specific protein family that is expanded in T. urticae. The encoding genes have an expression pattern restricted to the anterior podocephalic glands, while peptide fragments were found in the T. urticae secretome, supporting the salivary nature of these proteins. As peptide fragments were identified in a host-dependent manner, we designated this family as the SHOT (secreted host-responsive protein of Tetranychidae) family. The proteins were divided in three groups based on sequence similarity. Unlike TuSHOT3 genes, TuSHOT1 and TuSHOT2 genes were highly expressed when feeding on a subset of family Fabaceae, while expression was depleted on other hosts. TuSHOT1 and TuSHOT2 expression was induced within 24 h after certain host transfers, pointing toward transcriptional plasticity rather than selection as the cause. Transfer from an 'inducer' to a 'noninducer' plant was associated with slow yet strong downregulation of TuSHOT1 and TuSHOT2, occurring over generations rather than hours. This asymmetric on and off regulation points toward host-specific effects of SHOT proteins, which is further supported by the diversity of SHOT genes identified in Tetranychidae with a distinct host repertoire.

Analysis of four achaete-scute homologs in Bombyx mori reveals new viewpoints of the evolution and functions of this gene family.

Science.gov (United States)

Zhou, Qingxiang; Zhang, Tianyi; Xu, Weihua; Yu, Linlin; Yi, Yongzhu; Zhang, Zhifang

2008-03-06

achaete-scute complexe (AS-C) has been widely studied at genetic, developmental and evolutional levels. Genes of this family encode proteins containing a highly conserved bHLH domain, which take part in the regulation of the development of central nervous system and peripheral nervous system. Many AS-C homologs have been isolated from various vertebrates and invertebrates. Also, AS-C genes are duplicated during the evolution of Diptera. Functions besides neural development controlling have also been found in Drosophila AS-C genes. We cloned four achaete-scute homologs (ASH) from the lepidopteran model organism Bombyx mori, including three proneural genes and one neural precursor gene. Proteins encoded by them contained the characteristic bHLH domain and the three proneural ones were also found to have the C-terminal conserved motif. These genes regulated promoter activity through the Class A E-boxes in vitro. Though both Bm-ASH and Drosophila AS-C have four members, they are not in one by one corresponding relationships. Results of RT-PCR and real-time PCR showed that Bm-ASH genes were expressed in different larval tissues, and had well-regulated expressional profiles during the development of embryo and wing/wing disc. There are four achaete-scute homologs in Bombyx mori, the second insect having four AS-C genes so far, and these genes have multiple functions in silkworm life cycle. AS-C gene duplication in insects occurs after or parallel to, but not before the taxonomic order formation during evolution.

Fabry Disease in Families With Hypertrophic Cardiomyopathy

DEFF Research Database (Denmark)

Adalsteinsdottir, Berglind; Palsson, Runolfur; Desnick, Robert J

2017-01-01

BACKGROUND: The screening of Icelandic patients clinically diagnosed with hypertrophic cardiomyopathy resulted in identification of 8 individuals from 2 families with X-linked Fabry disease (FD) caused by GLA(α-galactosidase A gene) mutations encoding p.D322E (family A) or p.I232T (family B...... asymmetrical, and had similar late gadolinium enhancement patterns. Ischemic stroke and severe white matter lesions were more frequent among family A men, but neither family A nor family B men had overt renal disease. Family A and family B heterozygotes had less severe or no clinical manifestations...

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

Synthesis, antimicrobial activity and gene structure of a novel member of the dermaseptin B family.

Science.gov (United States)

Fleury, Y; Vouille, V; Beven, L; Amiche, M; Wróblewski, H; Delfour, A; Nicolas, P

1998-03-09

Dermaseptins are a family of cationic (Lys-rich) antimicrobial peptides that are abundant in the skin secretions of the arboreal frogs Phyllomedusa bicolor and P. sauvagii. In vitro, these peptides are microbicidal against a wide variety of microorganisms including Gram-positive and Gram-negative bacteria, yeasts, protozoa and fungi. To date, 6 dermaseptin B mature peptides, 24-34 residues long, 2 dermaseptin B cDNAs and 2 gene sequences have been identified in P. bicolor. To assess dermaseptin related genes further, we screened a P. bicolor genomic library with 32P-labeled cDNAs coding either for prepro-dermaseptins B1 or B2 (adenoregulin). A gene sequence was identified that coded a novel dermaseptin B, termed Drg3, which exhibits 23-42% amino acids identities with other members of the family. Analysis of the cDNAs coding precursors for several opioid and antimicrobial peptides originating from the skin of various amphibian species revealed that the 25-residue preproregion of these preproforms are all encoded by conserved nucleotides encompassed by the first coding exon of the Drg3 gene. Synthetic dermaseptin Drg3 exhibited a bactericidal activity towards several species of mollicutes (wall-less eubacteria), firmicutes (Gram-positive eubacteria), and gracilicutes (Gram-negative eubacteria), with minimal inhibitory concentrations (MICs) ranging from 6.25 to 100 microM. Experiments performed on Acholeplasma laidlawii cells revealed that this peptide is membranotropic and that if efficiently depolarizes the plasma membrane.

Structural and transcriptional characterization of a novel member of the soybean urease gene family.

Science.gov (United States)

Wiebke-Strohm, Beatriz; Ligabue-Braun, Rodrigo; Rechenmacher, Ciliana; De Oliveira-Busatto, Luisa Abruzzi; Carlini, Célia Regina; Bodanese-Zanettini, Maria Helena

2016-04-01

In plants, ureases have been related to urea degradation, to defense against pathogenic fungi and phytophagous insects, and to the soybean-Bradyrhizobium japonicum symbiosis. Two urease isoforms have been described for soybean: the embryo-specific, encoded by Eu1 gene, and the ubiquitous urease, encoded by Eu4. A third urease-encoding locus exists in the completed soybean genome. The gene was designated Eu5 and the putative product of its ORF as SBU-III. Phylogenetic analysis shows that 41 plant, moss and algal ureases have diverged from a common ancestor protein, but ureases from monocots, eudicots and ancient species have evolved independently. Genomes of ancient organisms present a single urease-encoding gene and urease-encoding gene duplication has occurred independently along the evolution of some eudicot species. SBU-III has a shorter amino acid sequence, since many gaps are found when compared to other sequences. A mutation in a highly conserved amino acid residue suggests absence of ureolytic activity, but the overall protein architecture remains very similar to the other ureases. The expression profile of urease-encoding genes in different organs and developmental stages was determined by RT-qPCR. Eu5 transcripts were detected in seeds one day after dormancy break, roots of young plants and embryos of developing seeds. Eu1 and Eu4 transcripts were found in all analyzed organs, but Eu4 expression was more prominent in seeds one day after dormancy break whereas Eu1 predominated in developing seeds. The evidence suggests that SBU-III may not be involved in nitrogen availability to plants, but it could be involved in other biological role(s). Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

Recurrent APC gene mutations in Polish FAP families

Directory of Open Access Journals (Sweden)

Pławski Andrzej

2007-12-01

Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

The IQD gene family in soybean: structure, phylogeny, evolution and expression.

Directory of Open Access Journals (Sweden)

Lin Feng

Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

Heterologous expression and transcript analysis of gibberellin biosynthetic genes of grasses reveals novel functionality in the GA3ox family.

Science.gov (United States)

Pearce, Stephen; Huttly, Alison K; Prosser, Ian M; Li, Yi-dan; Vaughan, Simon P; Gallova, Barbora; Patil, Archana; Coghill, Jane A; Dubcovsky, Jorge; Hedden, Peter; Phillips, Andrew L

2015-06-05

The gibberellin (GA) pathway plays a central role in the regulation of plant development, with the 2-oxoglutarate-dependent dioxygenases (2-ODDs: GA20ox, GA3ox, GA2ox) that catalyse the later steps in the biosynthetic pathway of particularly importance in regulating bioactive GA levels. Although GA has important impacts on crop yield and quality, our understanding of the regulation of GA biosynthesis during wheat and barley development remains limited. In this study we identified or assembled genes encoding the GA 2-ODDs of wheat, barley and Brachypodium distachyon and characterised the wheat genes by heterologous expression and transcript analysis. The wheat, barley and Brachypodium genomes each contain orthologous copies of the GA20ox, GA3ox and GA2ox genes identified in rice, with the exception of OsGA3ox1 and OsGA2ox5 which are absent in these species. Some additional paralogs of 2-ODD genes were identified: notably, a novel gene in the wheat B genome related to GA3ox2 was shown to encode a GA 1-oxidase, named as TaGA1ox-B1. This enzyme is likely to be responsible for the abundant 1β-hydroxylated GAs present in developing wheat grains. We also identified a related gene in barley, located in a syntenic position to TaGA1ox-B1, that encodes a GA 3,18-dihydroxylase which similarly accounts for the accumulation of unusual GAs in barley grains. Transcript analysis showed that some paralogs of the different classes of 2-ODD were expressed mainly in a single tissue or at specific developmental stages. In particular, TaGA20ox3, TaGA1ox1, TaGA3ox3 and TaGA2ox7 were predominantly expressed in developing grain. More detailed analysis of grain-specific gene expression showed that while the transcripts of biosynthetic genes were most abundant in the endosperm, genes encoding inactivation and signalling components were more highly expressed in the seed coat and pericarp. The comprehensive expression and functional characterisation of the multigene families encoding the 2-ODD

Survey of the rubber tree genome reveals a high number of cysteine protease-encoding genes homologous to Arabidopsis SAG12.

Science.gov (United States)

Zou, Zhi; Liu, Jianting; Yang, Lifu; Xie, Guishui

2017-01-01

Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea.

The UDP-glucuronate decarboxylase gene family in Populus: structure, expression, and association genetics.

Directory of Open Access Journals (Sweden)

Qingzhang Du

Full Text Available In woody crop plants, the oligosaccharide components of the cell wall are essential for important traits such as bioenergy content, growth, and structural wood properties. UDP-glucuronate decarboxylase (UXS is a key enzyme in the synthesis of UDP-xylose for the formation of xylans during cell wall biosynthesis. Here, we isolated a multigene family of seven members (PtUXS1-7 encoding UXS from Populus tomentosa, the first investigation of UXSs in a tree species. Analysis of gene structure and phylogeny showed that the PtUXS family could be divided into three groups (PtUXS1/4, PtUXS2/5, and PtUXS3/6/7, consistent with the tissue-specific expression patterns of each PtUXS. We further evaluated the functional consequences of nucleotide polymorphisms in PtUXS1. In total, 243 single-nucleotide polymorphisms (SNPs were identified, with a high frequency of SNPs (1/18 bp and nucleotide diversity (πT = 0.01033, θw = 0.01280. Linkage disequilibrium (LD analysis showed that LD did not extend over the entire gene (r (2<0.1, P<0.001, within 700 bp. SNP- and haplotype-based association analysis showed that nine SNPs (Q <0.10 and 12 haplotypes (P<0.05 were significantly associated with growth and wood property traits in the association population (426 individuals, with 2.70% to 12.37% of the phenotypic variation explained. Four significant single-marker associations (Q <0.10 were validated in a linkage mapping population of 1200 individuals. Also, RNA transcript accumulation varies among genotypic classes of SNP10 was further confirmed in the association population. This is the first comprehensive study of the UXS gene family in woody plants, and lays the foundation for genetic improvements of wood properties and growth in trees using genetic engineering or marker-assisted breeding.

Molecular characterization of edestin gene family in Cannabis sativa L.

Science.gov (United States)

Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

2014-11-01

Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Genome-Wide Identification, Phylogenetic and Expression Analyses of the Ubiquitin-Conjugating Enzyme Gene Family in Maize

Science.gov (United States)

Jue, Dengwei; Sang, Xuelian; Lu, Shengqiao; Dong, Chen; Zhao, Qiufang; Chen, Hongliang; Jia, Liqiang

2015-01-01

Background Ubiquitination is a post-translation modification where ubiquitin is attached to a substrate. Ubiquitin-conjugating enzymes (E2s) play a major role in the ubiquitin transfer pathway, as well as a variety of functions in plant biological processes. To date, no genome-wide characterization of this gene family has been conducted in maize (Zea mays). Methodology/Principal Findings In the present study, a total of 75 putative ZmUBC genes have been identified and located in the maize genome. Phylogenetic analysis revealed that ZmUBC proteins could be divided into 15 subfamilies, which include 13 ubiquitin-conjugating enzymes (ZmE2s) and two independent ubiquitin-conjugating enzyme variant (UEV) groups. The predicted ZmUBC genes were distributed across 10 chromosomes at different densities. In addition, analysis of exon-intron junctions and sequence motifs in each candidate gene has revealed high levels of conservation within and between phylogenetic groups. Tissue expression analysis indicated that most ZmUBC genes were expressed in at least one of the tissues, indicating that these are involved in various physiological and developmental processes in maize. Moreover, expression profile analyses of ZmUBC genes under different stress treatments (4°C, 20% PEG6000, and 200 mM NaCl) and various expression patterns indicated that these may play crucial roles in the response of plants to stress. Conclusions Genome-wide identification, chromosome organization, gene structure, evolutionary and expression analyses of ZmUBC genes have facilitated in the characterization of this gene family, as well as determined its potential involvement in growth, development, and stress responses. This study provides valuable information for better understanding the classification and putative functions of the UBC-encoding genes of maize. PMID:26606743

PlantTribes: a gene and gene family resource for comparative genomics in plants

OpenAIRE

Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

2007-01-01

The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

Organization and evolution of the rat tyrosine hydroxylase gene

International Nuclear Information System (INIS)

Brown, E.R.; Coker, G.T. III; O'Malley, K.L.

1987-01-01

This report describes the organization of the rat tyrosine hydroxylase (TH) gene and compares its structure with the human phenylalanine hydroxylase gene. Both genes are single copy and contain 13 exons separated by 12 introns. Remarkably, the positions of 10 out 12 intron/exon boundaries are identical for the two genes. These results support the idea that these hydroxylases genes are members of a gene family which has a common evolutionary origin. The authors predict that this ancestral gene would have encoded exons similar to those of TH prior to evolutionary drift to other members of this gene family

Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

International Nuclear Information System (INIS)

Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

2000-01-01

A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

Energy Technology Data Exchange (ETDEWEB)

Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

2000-09-18

A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

Homology-dependent Gene Silencing in Paramecium

Science.gov (United States)

Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

1998-01-01

Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

Genome-Wide Identification and Expression Analysis of the UGlcAE Gene Family in Tomato

Directory of Open Access Journals (Sweden)

Xing Ding

2018-05-01

Full Text Available The UGlcAE has the capability of interconverting UDP-d-galacturonic acid and UDP-d-glucuronic acid, and UDP-d-galacturonic acid is an activated precursor for the synthesis of pectins in plants. In this study, we identified nine UGlcAE protein-encoding genes in tomato. The nine UGlcAE genes that were distributed on eight chromosomes in tomato, and the corresponding proteins contained one or two trans-membrane domains. The phylogenetic analysis showed that SlUGlcAE genes could be divided into seven groups, designated UGlcAE1 to UGlcAE6, of which the UGlcAE2 were classified into two groups. Expression profile analysis revealed that the SlUGlcAE genes display diverse expression patterns in various tomato tissues. Selective pressure analysis indicated that all of the amino acid sites of SlUGlcAE proteins are undergoing purifying selection. Fifteen stress-, hormone-, and development-related elements were identified in the upstream regions (0.5 kb of these SlUGlcAE genes. Furthermore, we investigated the expression patterns of SlUGlcAE genes in response to three hormones (indole-3-acetic acid (IAA, gibberellin (GA, and salicylic acid (SA. We detected firmness, pectin contents, and expression levels of UGlcAE family genes during the development of tomato fruit. Here, we systematically summarize the general characteristics of the SlUGlcAE genes in tomato, which could provide a basis for further function studies of tomato UGlcAE genes.

Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

Directory of Open Access Journals (Sweden)

Philipp H. Schiffer

2016-08-01

Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

The ABC gene family in arthropods: comparative genomics and role in insecticide transport and resistance.

Science.gov (United States)

Dermauw, Wannes; Van Leeuwen, Thomas

2014-02-01

About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority of ABC proteins function as primary-active transporters that bind and hydrolyze ATP while transporting a large diversity of substrates across lipid membranes. Although extremely well studied in vertebrates for their role in drug resistance, less is known about the role of this family in the transport of endogenous and exogenous substances in arthropods. The ABC families of five insect species, a crustacean and a chelicerate have been annotated in some detail. We conducted a thorough phylogenetic analysis of the seven arthropod and human ABC protein subfamilies, to infer orthologous relationships that might suggest conserved function. Most orthologous relationships were found in the ABCB half transporter, ABCD, ABCE and ABCF subfamilies, but specific expansions within species and lineages are frequently observed and discussed. We next surveyed the role of ABC transporters in the transport of xenobiotics/plant allelochemicals and their involvement in insecticide resistance. The involvement of ABC transporters in xenobiotic resistance in arthropods is historically not well documented, but an increasing number of studies using unbiased differential gene expression analysis now points to their importance. We give an overview of methods that can be used to link ABC transporters to resistance. ABC proteins have also recently been implicated in the mode of action and resistance to Bt toxins in Lepidoptera. Given the enormous interest in Bt toxicology in transgenic crops, such findings will provide an impetus to further reveal the role of ABC transporters in arthropods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

Directory of Open Access Journals (Sweden)

Zuiter Afnan

2012-08-01

Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

The role of IL-4 gene 70 bp VNTR and ACE gene I/D variants in Familial Mediterranean fever.

Science.gov (United States)

Yigit, Serbülent; Tural, Sengul; Tekcan, Akın; Tasliyurt, Turker; Inanir, Ahmet; Uzunkaya, Süheyla; Kismali, Gorkem

2014-05-01

Familial Mediterranean fever (FMF) is characterized by recurrent attacks of fever and inflammation in the peritoneum, synovium, or pleura, accompanied by pain. It is an autosomal recessive disease caused by mutations in the MEFV (MEditerranean FeVer) gene. Patients with similar genotypes exhibit phenotypic diversity. As a result, the variations in different genes could be responsible for the clinical findings of this disease. In previous studies genes encoding Angiotensin-Converting Enzyme (ACE) and IL-4 (Interleukin-4) were found to be associated with rheumatologic and autoimmune diseases. In the present study we hypothesized whether ACE I/D or IL-4 70 bp variable tandem repeats (VNTR) genes are associated with FMF and its clinical findings in Turkish patients. Genomic DNA obtained from 670 persons (339 patients with FMF and 331 healthy controls) was used in the study. Genotypes for an ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR were determined by polymerase chain reaction with specific primers. To our knowledge, this is the first study examining ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR polymorphism in FMF patients. As a result, there was a statistically significant difference between the groups with respect to genotype distribution (pACE gene DD genotype was associated with an increased risk in FMF [pACE genotype frequencies according to the clinical characteristics, we found a statistically significant association between DD+ID genotype and fever (p=0.04). In addition IL-4 gene P1P1 genotype was associated with FMF (pACE gene and P1 allele or P1P1 genotype of IL-4 gene may be important molecular markers for susceptibility of FMF. Copyright © 2014 Elsevier Ltd. All rights reserved.

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

The SLC24 gene family of Na⁺/Ca²⁺-K⁺ exchangers: from sight and smell to memory consolidation and skin pigmentation.

Science.gov (United States)

Schnetkamp, Paul P M

2013-01-01

Members of the SLC24 gene family encode K(+)-dependent Na(+)/Ca(2+) exchangers (NCKX) that utilize both the inward Na(+) and outward K(+) gradients to extrude Ca(2+) from cells. There are five human SLC24 genes that play a role in biological process as diverse as vision in retinal rod and cone photoreceptors, olfaction, skin pigmentation and at least three of the five genes are also widely expressed in the brain. Here I review the functional, physiological and structural features of NCKX proteins that have emerged in the past few years. Copyright © 2012 Elsevier Ltd. All rights reserved.

Evolution of glutamate dehydrogenase genes: evidence for lateral gene transfer within and between prokaryotes and eukaryotes

Directory of Open Access Journals (Sweden)

Roger Andrew J

2003-06-01

Full Text Available Abstract Background Lateral gene transfer can introduce genes with novel functions into genomes or replace genes with functionally similar orthologs or paralogs. Here we present a study of the occurrence of the latter gene replacement phenomenon in the four gene families encoding different classes of glutamate dehydrogenase (GDH, to evaluate and compare the patterns and rates of lateral gene transfer (LGT in prokaryotes and eukaryotes. Results We extend the taxon sampling of gdh genes with nine new eukaryotic sequences and examine the phylogenetic distribution pattern of the various GDH classes in combination with maximum likelihood phylogenetic analyses. The distribution pattern analyses indicate that LGT has played a significant role in the evolution of the four gdh gene families. Indeed, a number of gene transfer events are identified by phylogenetic analyses, including numerous prokaryotic intra-domain transfers, some prokaryotic inter-domain transfers and several inter-domain transfers between prokaryotes and microbial eukaryotes (protists. Conclusion LGT has apparently affected eukaryotes and prokaryotes to a similar extent within the gdh gene families. In the absence of indications that the evolution of the gdh gene families is radically different from other families, these results suggest that gene transfer might be an important evolutionary mechanism in microbial eukaryote genome evolution.

Genome-Wide Identification, Evolution and Expression Analysis of the Grape (Vitis vinifera L. Zinc Finger-Homeodomain Gene Family

Directory of Open Access Journals (Sweden)

Hao Wang

2014-04-01

Full Text Available Plant zinc finger-homeodomain (ZHD genes encode a family of transcription factors that have been demonstrated to play an important role in the regulation of plant growth and development. In this study, we identified a total of 13 ZHD genes (VvZHD in the grape genome that were further classified into at least seven groups. Genome synteny analysis revealed that a number of VvZHD genes were present in the corresponding syntenic blocks of Arabidopsis, indicating that they arose before the divergence of these two species. Gene expression analysis showed that the identified VvZHD genes displayed distinct spatiotemporal expression patterns, and were differentially regulated under various stress conditions and hormone treatments, suggesting that the grape VvZHDs might be also involved in plant response to a variety of biotic and abiotic insults. Our work provides insightful information and knowledge about the ZHD genes in grape, which provides a framework for further characterization of their roles in regulation of stress tolerance as well as other aspects of grape productivity.

Analysis of four achaete-scute homologs in Bombyx mori reveals new viewpoints of the evolution and functions of this gene family

Directory of Open Access Journals (Sweden)

Yi Yongzhu

2008-03-01

Full Text Available Abstract Background achaete-scute complexe (AS-C has been widely studied at genetic, developmental and evolutional levels. Genes of this family encode proteins containing a highly conserved bHLH domain, which take part in the regulation of the development of central nervous system and peripheral nervous system. Many AS-C homologs have been isolated from various vertebrates and invertebrates. Also, AS-C genes are duplicated during the evolution of Diptera. Functions besides neural development controlling have also been found in Drosophila AS-C genes. Results We cloned four achaete-scute homologs (ASH from the lepidopteran model organism Bombyx mori, including three proneural genes and one neural precursor gene. Proteins encoded by them contained the characteristic bHLH domain and the three proneural ones were also found to have the C-terminal conserved motif. These genes regulated promoter activity through the Class A E-boxes in vitro. Though both Bm-ASH and Drosophila AS-C have four members, they are not in one by one corresponding relationships. Results of RT-PCR and real-time PCR showed that Bm-ASH genes were expressed in different larval tissues, and had well-regulated expressional profiles during the development of embryo and wing/wing disc. Conclusion There are four achaete-scute homologs in Bombyx mori, the second insect having four AS-C genes so far, and these genes have multiple functions in silkworm life cycle. AS-C gene duplication in insects occurs after or parallel to, but not before the taxonomic order formation during evolution.

cDNA for the human β2-adrenergic receptor: a protein with multiple membrane-spanning domains and encoded by a gene whose chromosomal location is shared with that of the receptor for platelet-derived growth factor

International Nuclear Information System (INIS)

Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.

1987-01-01

The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor

Raffinose family oligosaccharide utilisation by probiotic bacteria: insight into substrate recognition, molecular architecture and diversity of GH36 alpha-galactosidases

DEFF Research Database (Denmark)

Abou Hachem, Maher; Fredslund, Folmer; Andersen, Joakim Mark

2012-01-01

The organisation of genes conferring utilisation of raffinose family oligosaccharides (RFOs) has been analysed in several probiotic bacteria from the Bifidobacterium and Lactobacillus genera. Glycoside hydrolase family 36 (GH36) alpha-galatosidase encoding genes occur together with sugar transpor...

batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor.

Science.gov (United States)

Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L

2003-02-01

Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

International Nuclear Information System (INIS)

Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

1987-01-01

The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

The SPINK gene family and celiac disease susceptibility

NARCIS (Netherlands)

Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

2007-01-01

The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

The SPINK gene family and celiac disease susceptibility

NARCIS (Netherlands)

Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

A highly divergent gene cluster in honey bees encodes a novel silk family

OpenAIRE

Sutherland, Tara D.; Campbell, Peter M.; Weisman, Sarah; Trueman, Holly E.; Sriskantha, Alagacone; Wanjura, Wolfgang J.; Haritos, Victoria S.

2006-01-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1–4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-r...

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Characterization of a family of gamma-ray-induced CHO mutants demonstrates that the ldlA locus is diploid and encodes the low-density lipoprotein receptor

International Nuclear Information System (INIS)

Sege, R.D.; Kozarsky, K.F.; Krieger, M.

1986-01-01

The ldlA locus is one of four Chinese hamster ovary (CHO) cell loci which are known to be required for the synthesis of functional low-density lipoprotein (LDL) receptors. Previous studies have suggested that the ldlA locus is diploid and encodes the LDL receptor. To confirm this assignment, we have isolated a partial genomic clone of the Chinese hamster LDL receptor gene and used this and other nucleic acid and antibody probes to study a family of ldlA mutants isolated after gamma-irradiation. Our analysis suggests that there are two LDL receptor alleles in wild-type CHO cells. Each of the three mutants isolated after gamma-irradiation had detectable deletions affecting one of the two LDL receptor alleles. One of the mutants also had a disruption of the remaining allele, resulting in the synthesis of an abnormal receptor precursor which was not subject to Golgi-associated posttranslational glycoprotein processing. The correlation of changes in the expression, structure, and function of LDL receptors with deletions in the LDL receptor genes in these mutants directly demonstrated that the ldlA locus in CHO cells is diploid and encodes the LDL receptor. In addition, our analysis suggests that CHO cells in culture may contain a partial LDL receptor pseudogene

Familial cholestasis: progressive familial intrahepatic cholestasis, benign recurrent intrahepatic cholestasis and intrahepatic cholestasis of pregnancy

NARCIS (Netherlands)

van der Woerd, Wendy L.; van Mil, Saskia W. C.; Stapelbroek, Janneke M.; Klomp, Leo W. J.; van de Graaf, Stan F. J.; Houwen, Roderick H. J.

2010-01-01

Progressive familial intrahepatic cholestasis (PFIC) type 1, 2 and 3 are due to mutations in ATP8B1, ABCB11 and ABCB4, respectively. Each of these genes encodes a hepatocanalicular transporter, which is essential for the proper formation of bile. Mutations in ABCB4 can result in progressive

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Multigene families encode the major enzymes of antioxidant metabolism in Eucalyptus grandis L

Directory of Open Access Journals (Sweden)

Felipe Karam Teixeira

2005-01-01

Full Text Available Antioxidant metabolism protects cells from oxidative damage caused by reactive oxygen species (ROS. In plants, several enzymes act jointly to maintain redox homeostasis. Moreover, isoform diversity contributes to the fine tuning necessary for plant responses to both exogenous and endogenous signals influencing antioxidant metabolism. This study aimed to provide a comprehensive view of the major classes of antioxidant enzymes in the woody species Eucalyptus grandis. A careful survey of the FORESTs data bank revealed 36 clusters as encoding antioxidant enzymes: six clusters encoding ascorbate peroxidase (APx isozymes, three catalase (CAT proteins, three dehydroascorbate reductase (DHAR, two glutathione reductase (GR isozymes, four monodehydroascorbate reductase (MDHAR, six phospholipid hydroperoxide glutathione peroxidases (PhGPx, and 12 encoding superoxide dismutases (SOD isozymes. Phylogenetic analysis demonstrated that all clusters (identified herein grouped with previously characterized antioxidant enzymes, corroborating the analysis performed. With respect to enzymes involved in the ascorbate-glutathione cycle, both cytosolic and chloroplastic isoforms were putatively identified. These sequences were widely distributed among the different ESTs libraries indicating a broad gene expression pattern. Overall, the data indicate the importance of antioxidant metabolism in eucalyptus.

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

Science.gov (United States)

Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

2014-07-22

Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

Identification of a fourth locus (EVR4) for familial exudative vitreoretinopathy (FEVR).

Science.gov (United States)

Toomes, Carmel; Downey, Louise M; Bottomley, Helen M; Scott, Sheila; Woodruff, Geoffrey; Trembath, Richard C; Inglehearn, Chris F

2004-01-15

Familial exudative vitreoretinopathy (FEVR) is a genetically heterogeneous inherited blinding disorder of the retinal vascular system. To date three loci have been mapped: EVR1 on chromosome 11q, EVR2 on chromosome Xp, and EVR3 on chromosome 11p. The gene underlying EVR3 remains unidentified whilst the EVR2 gene, which encodes the Norrie disease protein (NDP), was identified over a decade ago. More recently, FZD4, the gene that encodes the Wnt receptor Frizzled-4, was identified as the mutated gene at the EVR1 locus. The purpose of this study was to screen FZD4 in a large family previously proven to be linked to the EVR1 locus. PCR products were generated using genomic DNA from affected family members with primers designed to amplify the coding sequence of FZD4. The PCR products were screened for mutations by direct sequencing. Genotyping was performed in all available family members using fluorescently labeled microsatellite markers from chromosome 11q. Sequencing of the EVR1 gene, FZD4, in this family identified no mutation. To investigate this family further we performed high-resolution genotyping with markers spanning chromosome 11q. Haplotype analysis excluded FZD4 as the mutated gene in this family and identified a candidate region approximately 10 cM centromeric to EVR1. This new FEVR locus is flanked by markers D11S1368 (centromeric) and D11S937 (telomeric) and spans approximately 15 cM. High-resolution genotyping and haplotype analysis excluded FZD4 as the defective gene in a family previously linked to the EVR1 locus. The results indicate that the gene mutated in this family lies centromeric to the EVR1 gene, FZD4, and is also genetically distinct from the EVR3 locus. This new locus has been designated EVR4 and is the fourth FEVR locus to be described.