WorldWideScience

Sample records for gene families including

  1. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  2. The first missense mutation of NHS gene in a Tunisian family with clinical features of NHS syndrome including cardiac anomaly.

    Science.gov (United States)

    Chograni, Manèl; Rejeb, Imen; Jemaa, Lamia Ben; Châabouni, Myriam; Bouhamed, Habiba Chaabouni

    2011-08-01

    Nance-Horan Syndrome (NHS) or X-linked cataract-dental syndrome is a disease of unknown gene action mechanism, characterized by congenital cataract, dental anomalies, dysmorphic features and, in some cases, mental retardation. We performed linkage analysis in a Tunisian family with NHS in which affected males and obligate carrier female share a common haplotype in the Xp22.32-p11.21 region that contains the NHS gene. Direct sequencing of NHS coding exons and flanking intronic sequences allowed us to identify the first missense mutation (P551S) and a reported SNP-polymorphism (L1319F) in exon 6, a reported UTR-SNP (c.7422 C>T) and a novel one (c.8239 T>A) in exon 8. Both variations P551S and c.8239 T>A segregate with NHS phenotype in this family. Although truncations, frame-shift and copy number variants have been reported in this gene, no missense mutations have been found to segregate previously. This is the first report of a missense NHS mutation causing NHS phenotype (including cardiac defects). We hypothesize also that the non-reported UTR-SNP of the exon 8 (3'-UTR) is specific to the Tunisian population.

  3. The Medicago truncatula lysine motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes

    NARCIS (Netherlands)

    Arrighi, J.F.; Barre, A.; Amor, Ben B.; Bersoult, A.; Campos Soriano, L.; Mirabella, R.; Carvalho-Niebel, de F.; Journet, E.P.; Ghérardi, M.; Huguet, T.; Geurts, R.; Dénarié, J.; Rougé, P.; Gough, C.

    2006-01-01

    Rhizobial Nod factors are key symbiotic signals responsible for starting the nodulation process in host legume plants. Of the six Medicago truncatula genes controlling a Nod factor signaling pathway, Nod Factor Perception (NFP) was reported as a candidate Nod factor receptor gene. Here, we provide

  4. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  5. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  6. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  7. Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

    Directory of Open Access Journals (Sweden)

    Anne Kathrin Hett

    Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.

  8. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  9. Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

    Directory of Open Access Journals (Sweden)

    Anne Kathrin Hett

    2011-03-01

    Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.Se presenta la primera descripción del cariotipo de Mugil incilis de Venezuela. El complemento cromosómico está compuesto por 48 cromosomas acrocéntricos uniformemente decrecientes en tamaño. Por lo tanto, los homólogos no pueden ser claramente identificados, con excepción de uno de los pares de mayor tamaño, clasificado como número 1, cuyos homólogos poseen una constricción secundaria subcentromérica, y el par de cromosomas número 24, considerablemente más pequeño que los otros. El bandeo-C reveló bloques heterocromáticos en las regiones centroméricas/pericentroméricas de todos los cromosomas, más conspicuas en el cromosoma 1 en el que las señales C

  10. Rare CNVs in Suicide Attempt include Schizophrenia-Associated Loci and Neurodevelopmental Genes: A Pilot Genome-Wide and Family-Based Study.

    Directory of Open Access Journals (Sweden)

    Marcus Sokolowski

    Full Text Available Suicidal behavior (SB has a complex etiology involving genes and environment. One of the genetic components in SB could be copy number variations (CNVs, as CNVs are implicated in neurodevelopmental disorders. However, a recently published genome-wide and case-control study did not observe any significant role of CNVs in SB. Here we complemented these initial observations by instead using a family-based trio-sample that is robust to control biases, having severe suicide attempt (SA in offspring as main outcome (n = 660 trios. We first tested for CNV associations on the genome-wide Illumina 1M SNP-array by using FBAT-CNV methodology, which allows for evaluating CNVs without reliance on CNV calling algorithms, analogous to a common SNP-based GWAS. We observed association of certain T-cell receptor markers, but this likely reflected inter-individual variation in somatic rearrangements rather than association with SA outcome. Next, we used the PennCNV software to call 385 putative rare (100 kb CNVs, observed in n = 225 SA offspring. Nine SA offspring had rare CNV calls in a set of previously schizophrenia-associated loci, indicating the importance of such CNVs in certain SA subjects. Several additional, very large (>1MB sized CNV calls in 15 other SA offspring also spanned pathogenic regions or other neural genes of interest. Overall, 45 SA had CNVs enriched for 65 medically relevant genes previously shown to be affected by CNVs, which were characterized by a neurodevelopmental biology. A neurodevelopmental implication was partly congruent with our previous SNP-based GWAS, but follow-up analysis here indicated that carriers of rare CNVs had a decreased burden of common SNP risk-alleles compared to non-carriers. In conclusion, while CNVs did not show genome-wide association by the FBAT-CNV methodology, our preliminary observations indicate rare pathogenic CNVs affecting neurodevelopmental functions in a subset of SA, who were distinct from SA having

  11. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  12. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  13. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  14. A framework for including family health spillovers in economic evaluation

    NARCIS (Netherlands)

    H. Al-Janabi (Hareth); N.J.A. van Exel (Job); W.B.F. Brouwer (Werner); J. Coast (Joanna)

    2016-01-01

    textabstractHealth care interventions may affect the health of patients' family networks. It has been suggested that these health spillovers? should be included in economic evaluation, but there is not a systematic method for doing this. In this article, we develop a framework for including health

  15. Understanding type 2 diabetes: including the family member's perspective.

    LENUS (Irish Health Repository)

    White, Patricia

    2012-02-01

    PURPOSE: The purpose of this study was to examine the relationship between psychological and social factors and diabetes outcomes in people with type 2 diabetes and their family members. METHODS: A total of 153 patients with type 2 diabetes were assessed at a diabetes outpatient clinic and postal questionnaires were sent to nominated family members. The measures examined were diabetes knowledge, social support, well-being, and illness perceptions. RESULTS: When compared with those with diabetes, family members reported lower positive well-being and lower levels of satisfaction with support. They also perceived diabetes as a more cyclical illness, which was controlled more by treatment than by the individual. Family members also reported that the person with diabetes was more emotionally distressed and knew more about diabetes than the patient had actually reported himself or herself. There were no differences between the family members of those in good or poor glycaemic control. CONCLUSIONS: This study reinforces the importance of understanding social context and illness beliefs in diabetes management. It also highlights the potential for including family members in discussions and education about diabetes management.

  16. A Framework for Including Family Health Spillovers in Economic Evaluation.

    Science.gov (United States)

    Al-Janabi, Hareth; van Exel, Job; Brouwer, Werner; Coast, Joanna

    2016-02-01

    Health care interventions may affect the health of patients' family networks. It has been suggested that these "health spillovers" should be included in economic evaluation, but there is not a systematic method for doing this. In this article, we develop a framework for including health spillovers in economic evaluation. We focus on extra-welfarist economic evaluations where the objective is to maximize health benefits from a health care budget (the "health care perspective"). Our framework involves adapting the conventional cost-effectiveness decision rule to include 2 multiplier effects to internalize the spillover effects. These multiplier effects express the ratio of total health effects (for patients and their family networks) to patient health effects. One multiplier effect is specified for health benefit generated from providing a new intervention, one for health benefit displaced by funding this intervention. We show that using multiplier effects to internalize health spillovers could change the optimal funding decisions and generate additional health benefits to society. © The Author(s) 2015.

  17. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  18. Identification of astrocytoma associated genes including cell surface markers

    International Nuclear Information System (INIS)

    Boon, Kathy; Edwards, Jennifer B; Eberhart, Charles G; Riggins, Gregory J

    2004-01-01

    Despite intense effort the treatment options for the invasive astrocytic tumors are still limited to surgery and radiation therapy, with chemotherapy showing little or no increase in survival. The generation of Serial Analysis of Gene Expression (SAGE) profiles is expected to aid in the identification of astrocytoma-associated genes and highly expressed cell surface genes as molecular therapeutic targets. SAGE tag counts can be easily added to public expression databases and quickly disseminated to research efforts worldwide. We generated and analyzed the SAGE transcription profiles of 25 primary grade II, III and IV astrocytomas [1]. These profiles were produced as part of the Cancer Genome Anatomy Project's SAGE Genie [2], and were used in an in silico search for candidate therapeutic targets by comparing astrocytoma to normal brain transcription. Real-time PCR and immunohistochemistry were used for the validation of selected candidate target genes in 2 independent sets of primary tumors. A restricted set of tumor-associated genes was identified for each grade that included genes not previously associated with astrocytomas (e.g. VCAM1, SMOC1, and thymidylate synthetase), with a high percentage of cell surface genes. Two genes with available antibodies, Aquaporin 1 and Topoisomerase 2A, showed protein expression consistent with transcript level predictions. This survey of transcription in malignant and normal brain tissues reveals a small subset of human genes that are activated in malignant astrocytomas. In addition to providing insights into pathway biology, we have revealed and quantified expression for a significant portion of cell surface and extra-cellular astrocytoma genes

  19. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  20. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  1. Two truncating USH3A mutations, including one novel, in a German family with Usher syndrome.

    Science.gov (United States)

    Ebermann, Inga; Wilke, Robert; Lauhoff, Thomas; Lübben, Dirk; Zrenner, Eberhart; Bolz, Hanno Jörn

    2007-08-30

    To identify the genetic defect in a German family with Usher syndrome (USH) and linkage to the USH3A locus. DNA samples of five family members (both parents and the three patients) were genotyped with polymorphic microsatellite markers specific for eight USH genes. Three affected family members underwent detailed ocular and audiologic characterization. Symptoms in the patients were compatible with Usher syndrome and show intrafamilial variation, for both hearing loss (ranging from severe to profound with non-linear progression) and vision. Genotyping of microsatellite markers for the different USH loci was in line with a defect in the USH3A gene on chromosome 3q25. Sequence analysis of the USH3A gene revealed two truncating mutations; c.149_152delCAGGinsTGTCCAAT, which has been described previously, and a novel mutation, c.502_503insA, segregating with the phenotype. To date, only 11 USH3A mutations have been described. This is the first description of a German family with USH due to USH3A mutations, including one novel. Our findings indicate that also in the Central European population, USH3A mutations should be considered in cases of USH.

  2. Supporting and including children from low income families

    OpenAIRE

    Benoist, FD

    2017-01-01

    This chapter explores: • What we mean by low income and poverty and how poverty is defined • The families living on low income in the UK today and the impact of low income and poverty on children’s well-being, development and learning • Supporting children from low income families • The attainment gap between children from low income backgrounds and their peers • The pupil premium and how schools have used the extra funding to raise attainment • Key aspects of good practice and what schools c...

  3. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  4. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  5. Kinetic models of gene expression including non-coding RNAs

    Energy Technology Data Exchange (ETDEWEB)

    Zhdanov, Vladimir P., E-mail: zhdanov@catalysis.r

    2011-03-15

    In cells, genes are transcribed into mRNAs, and the latter are translated into proteins. Due to the feedbacks between these processes, the kinetics of gene expression may be complex even in the simplest genetic networks. The corresponding models have already been reviewed in the literature. A new avenue in this field is related to the recognition that the conventional scenario of gene expression is fully applicable only to prokaryotes whose genomes consist of tightly packed protein-coding sequences. In eukaryotic cells, in contrast, such sequences are relatively rare, and the rest of the genome includes numerous transcript units representing non-coding RNAs (ncRNAs). During the past decade, it has become clear that such RNAs play a crucial role in gene expression and accordingly influence a multitude of cellular processes both in the normal state and during diseases. The numerous biological functions of ncRNAs are based primarily on their abilities to silence genes via pairing with a target mRNA and subsequently preventing its translation or facilitating degradation of the mRNA-ncRNA complex. Many other abilities of ncRNAs have been discovered as well. Our review is focused on the available kinetic models describing the mRNA, ncRNA and protein interplay. In particular, we systematically present the simplest models without kinetic feedbacks, models containing feedbacks and predicting bistability and oscillations in simple genetic networks, and models describing the effect of ncRNAs on complex genetic networks. Mathematically, the presentation is based primarily on temporal mean-field kinetic equations. The stochastic and spatio-temporal effects are also briefly discussed.

  6. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  7. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  8. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  9. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  10. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

     768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  11. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  12. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  13. IGSA: Individual Gene Sets Analysis, including Enrichment and Clustering.

    Science.gov (United States)

    Wu, Lingxiang; Chen, Xiujie; Zhang, Denan; Zhang, Wubing; Liu, Lei; Ma, Hongzhe; Yang, Jingbo; Xie, Hongbo; Liu, Bo; Jin, Qing

    2016-01-01

    Analysis of gene sets has been widely applied in various high-throughput biological studies. One weakness in the traditional methods is that they neglect the heterogeneity of genes expressions in samples which may lead to the omission of some specific and important gene sets. It is also difficult for them to reflect the severities of disease and provide expression profiles of gene sets for individuals. We developed an application software called IGSA that leverages a powerful analytical capacity in gene sets enrichment and samples clustering. IGSA calculates gene sets expression scores for each sample and takes an accumulating clustering strategy to let the samples gather into the set according to the progress of disease from mild to severe. We focus on gastric, pancreatic and ovarian cancer data sets for the performance of IGSA. We also compared the results of IGSA in KEGG pathways enrichment with David, GSEA, SPIA, ssGSEA and analyzed the results of IGSA clustering and different similarity measurement methods. Notably, IGSA is proved to be more sensitive and specific in finding significant pathways, and can indicate related changes in pathways with the severity of disease. In addition, IGSA provides with significant gene sets profile for each sample.

  14. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  15. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  16. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  17. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  18. Candidate genes for performance in horses, including monocarboxylate transporters

    Directory of Open Access Journals (Sweden)

    Inaê Cristina Regatieri

    Full Text Available ABSTRACT: Some horse breeds are highly selected for athletic activities. The athletic potential of each animal can be measured by its performance in sports. High athletic performance depends on the animal capacity to produce energy through aerobic and anaerobic metabolic pathways, among other factors. Transmembrane proteins called monocarboxylate transporters, mainly the isoform 1 (MCT1 and its ancillary protein CD147, can help the organism to adapt to physiological stress caused by physical exercise, transporting lactate and H+ ions. Horse breeds are selected for different purposes so we might expect differences in the amount of those proteins and in the genotypic frequencies for genes that play a significant role in the performance of the animals. The study of MCT1 and CD147 gene polymorphisms, which can affect the formation of the proteins and transport of lactate and H+, can provide enough information to be used for selection of athletic horses increasingly resistant to intense exercise. Two other candidate genes, the PDK4 and DMRT3, have been associated with athletic potential and indicated as possible markers for performance in horses. The oxidation of fatty acids is highly effective in generating ATP and is controlled by the expression of PDK4 (pyruvate dehydrogenase kinase, isozyme 4 in skeletal muscle during and after exercise. The doublesex and mab-3 related transcription factor 3 (DMRT3 gene encodes an important transcription factor in the setting of spinal cord circuits controlling movement in vertebrates and may be associated with gait performance in horses. This review describes how the monocarboxylate transporters work during physical exercise in athletic horses and the influence of polymorphisms in candidate genes for athletic performance in horses.

  19. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  20. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  1. Identification of metalloprotease gene families in sugarcane

    Directory of Open Access Journals (Sweden)

    O.H.P. Ramos

    2001-12-01

    Full Text Available Metalloproteases play a key role in many physiological processes in mammals such as cell migration, tissue remodeling and processing of growth factors. They have also been identified as important factors in the patho-physiology of a number of human diseases, including cancer and hypertension. Many bacterial pathogens rely on proteases in order to infect the host. Several classes of metalloproteases have been described in humans, bacteria, snake venoms and insects. However, the presence and characterization of plant metalloproteases have rarely been described in the literature. In our research, we searched the sugarcane expressed sequence tag (SUCEST DNA library in order to identify, by homology with sequences deposited in other databases, metalloprotease gene families expressed under different conditions. Protein sequences from Arabidopsis thaliana and Glycine max were used to search the SUCEST data bank. Conserved regions corresponding to different metalloprotease domains and sequence motifs were identified in the reads to characterize each group of enzymes. At least four classes of sugarcane metalloproteases have been identified, i.e. matrix metalloproteases, zincins, inverzincins, and ATP-dependent metalloproteases. Each enzyme class was analyzed for its expression in different conditions and tissues.Metaloproteases exercem papéis importantes em muitos processos fisiológicos em mamíferos tais como migração celular, remodelamento tecidual e processamento de fatores de crescimento. Estas enzimas estão envolvidas também na pato-fisiologia de um grande número de doenças humanas como hipertensão e câncer. Muitas bactérias patogênicas dependem de proteases para infectar o hospedeiro. Diversas classes de metaloproteases foram descritas em seres humanos, bactérias, venenos de serpentes e insetos. No entanto, a presença e a caracterização de metaloproteases em plantas estão pouco descritas na literatura. Neste trabalho, foi

  2. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  3. Msx homeobox gene family and craniofacial development.

    Science.gov (United States)

    Alappat, Sylvia; Zhang, Zun Yi; Chen, Yi Ping

    2003-12-01

    Vertebrate Msx genes are unlinked, homeobox-containing genes that bear homology to the Drosophila muscle segment homeobox gene. These genes are expressed at multiple sites of tissue-tissue interactions during vertebrate embryonic development. Inductive interactions mediated by the Msx genes are essential for normal craniofacial, limb and ectodermal organ morphogenesis, and are also essential to survival in mice, as manifested by the phenotypic abnormalities shown in knockout mice and in humans. This review summarizes studies on the expression, regulation, and functional analysis of Msx genes that bear relevance to craniofacial development in humans and mice. Key words: Msx genes, craniofacial, tooth, cleft palate, suture, development, transcription factor, signaling molecule.

  4. An Initial Look at the Quality of Life of Malaysian Families That Include Children with Disabilities

    Science.gov (United States)

    Clark, M.; Brown, R.; Karrapaya, R.

    2012-01-01

    Background: While there is a growing body of literature in the quality of life of families that include children with disabilities, the majority of research has been conducted in western countries. The present study provides an initial exploration of the quality of life of Malaysian families that include children with developmental/intellectual…

  5. 45 CFR 286.75 - What must be included in the Tribal Family Assistance Plan?

    Science.gov (United States)

    2010-10-01

    ... description of the employment opportunities available, in both the public and private sector, within and near... eligibility criteria the Tribe has established, which includes a definition of “needy family,” including income and resource limits and the Tribe's definition of “Tribal member family” or “Indian family.” (2) A...

  6. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  7. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  8. Molecular diagnostics for congenital hearing loss including 15 deafness genes using a next generation sequencing platform

    Directory of Open Access Journals (Sweden)

    De Keulenaer Sarah

    2012-05-01

    Full Text Available Abstract Background Hereditary hearing loss (HL can originate from mutations in one of many genes involved in the complex process of hearing. Identification of the genetic defects in patients is currently labor intensive and expensive. While screening with Sanger sequencing for GJB2 mutations is common, this is not the case for the other known deafness genes (> 60. Next generation sequencing technology (NGS has the potential to be much more cost efficient. Published methods mainly use hybridization based target enrichment procedures that are time saving and efficient, but lead to loss in sensitivity. In this study we used a semi-automated PCR amplification and NGS in order to combine high sensitivity, speed and cost efficiency. Results In this proof of concept study, we screened 15 autosomal recessive deafness genes in 5 patients with congenital genetic deafness. 646 specific primer pairs for all exons and most of the UTR of the 15 selected genes were designed using primerXL. Using patient specific identifiers, all amplicons were pooled and analyzed using the Roche 454 NGS technology. Three of these patients are members of families in which a region of interest has previously been characterized by linkage studies. In these, we were able to identify two new mutations in CDH23 and OTOF. For another patient, the etiology of deafness was unclear, and no causal mutation was found. In a fifth patient, included as a positive control, we could confirm a known mutation in TMC1. Conclusions We have developed an assay that holds great promise as a tool for screening patients with familial autosomal recessive nonsyndromal hearing loss (ARNSHL. For the first time, an efficient, reliable and cost effective genetic test, based on PCR enrichment, for newborns with undiagnosed deafness is available.

  9. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  10. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  11. 25 CFR 20.401 - What is included under Services to Children, Elderly, and Families?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false What is included under Services to Children, Elderly, and Families? 20.401 Section 20.401 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR HUMAN SERVICES FINANCIAL ASSISTANCE AND SOCIAL SERVICES PROGRAMS Services to Children, Elderly, and Families § 20.401 What...

  12. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  13. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  14. Characterisation of the legume SERK-NIK gene superfamily including splice variants: Implications for development and defence

    Directory of Open Access Journals (Sweden)

    Rose Ray J

    2011-03-01

    Full Text Available Abstract Background SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE (SERK genes are part of the regulation of diverse signalling events in plants. Current evidence shows SERK proteins function both in developmental and defence signalling pathways, which occur in response to both peptide and steroid ligands. SERKs are generally present as small gene families in plants, with five SERK genes in Arabidopsis. Knowledge gained primarily through work on Arabidopsis SERKs indicates that these proteins probably interact with a wide range of other receptor kinases and form a fundamental part of many essential signalling pathways. The SERK1 gene of the model legume, Medicago truncatula functions in somatic and zygotic embryogenesis, and during many phases of plant development, including nodule and lateral root formation. However, other SERK genes in M. truncatula and other legumes are largely unidentified and their functions unknown. Results To aid the understanding of signalling pathways in M. truncatula, we have identified and annotated the SERK genes in this species. Using degenerate PCR and database mining, eight more SERK-like genes have been identified and these have been shown to be expressed. The amplification and sequencing of several different PCR products from one of these genes is consistent with the presence of splice variants. Four of the eight additional genes identified are upregulated in cultured leaf tissue grown on embryogenic medium. The sequence information obtained from M. truncatula was used to identify SERK family genes in the recently sequenced soybean (Glycine max genome. Conclusions A total of nine SERK or SERK-like genes have been identified in M. truncatula and potentially 17 in soybean. Five M. truncatula SERK genes arose from duplication events not evident in soybean and Lotus. The presence of splice variants has not been previously reported in a SERK gene. Upregulation of four newly identified SERK genes (in addition to the

  15. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  16. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  17. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  18. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  19. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

    2006-01-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  20. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  1. Differential roles of TGIF family genes in mammalian reproduction

    Directory of Open Access Journals (Sweden)

    Renfree Marilyn B

    2011-09-01

    Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by

  2. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  3. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  4. Molecular evolution of the polyamine oxidase gene family in Metazoa

    Directory of Open Access Journals (Sweden)

    Polticelli Fabio

    2012-06-01

    Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

  5. A multimethod analysis of shared decision-making in hospice interdisciplinary team meetings including family caregivers.

    Science.gov (United States)

    Washington, Karla T; Oliver, Debra Parker; Gage, L Ashley; Albright, David L; Demiris, George

    2016-03-01

    Much of the existing research on shared decision-making in hospice and palliative care focuses on the provider-patient dyad; little is known about shared decision-making that is inclusive of family members of patients with advanced disease. We sought to describe shared decision-making as it occurred in hospice interdisciplinary team meetings that included family caregivers as participants using video-conferencing technology. We conducted a multimethod study in which we used content and thematic analysis techniques to analyze video-recordings of hospice interdisciplinary team meetings (n = 100), individual interviews of family caregivers (n = 73) and hospice staff members (n = 78), and research field notes. Participants in the original studies from which data for this analysis were drawn were hospice family caregivers and staff members employed by one of five different community-based hospice agencies located in the Midwestern United States. Shared decision-making occurred infrequently in hospice interdisciplinary team meetings that included family caregivers. Barriers to shared decision-making included time constraints, communication skill deficits, unaddressed emotional needs, staff absences, and unclear role expectations. The hospice philosophy of care, current trends in healthcare delivery, the interdisciplinary nature of hospice teams, and the designation of a team leader/facilitator supported shared decision-making. The involvement of family caregivers in hospice interdisciplinary team meetings using video-conferencing technology creates a useful platform for shared decision-making; however, steps must be taken to transform family caregivers from meeting attendees to shared decision-makers. © The Author(s) 2015.

  6. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  7. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  8. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  9. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  10. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  11. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  12. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    Directory of Open Access Journals (Sweden)

    Jan Futas

    Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

  13. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    Science.gov (United States)

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  14. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  15. Family History

    Science.gov (United States)

    Your family history includes health information about you and your close relatives. Families have many factors in common, including their genes, ... as heart disease, stroke, and cancer. Having a family member with a disease raises your risk, but ...

  16. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  17. Marfan syndrome with a complex chromosomal rearrangement including deletion of the FBN1 gene

    Directory of Open Access Journals (Sweden)

    Colovati Mileny ES

    2012-01-01

    Full Text Available Abstract Background The majority of Marfan syndrome (MFS cases is caused by mutations in the fibrillin-1 gene (FBN1, mapped to chromosome 15q21.1. Only few reports on deletions including the whole FBN1 gene, detected by molecular cytogenetic techniques, were found in literature. Results We report here on a female patient with clinical symptoms of the MFS spectrum plus craniostenosis, hypothyroidism and intellectual deficiency who presents a 1.9 Mb deletion, including the FBN1 gene and a complex rearrangement with eight breakpoints involving chromosomes 6, 12 and 15. Discussion This is the first report of MFS with a complex chromosome rearrangement involving a deletion of FBN1 and contiguous genes. In addition to the typical clinical findings of the Marfan syndrome due to FBN1 gene haploinsufficiency, the patient presents features which may be due to the other gene deletions and possibly to the complex chromosome rearrangement.

  18. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  19. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  20. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

  1. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  2. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  3. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  4. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  5. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Directory of Open Access Journals (Sweden)

    Yan Liangzhen

    2012-11-01

    Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

  6. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  7. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  8. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  9. Mutation of KREMEN1, a modulator of Wnt signaling, is responsible for ectodermal dysplasia including oligodontia in Palestinian families.

    Science.gov (United States)

    Issa, Yasmin A; Kamal, Lara; Rayyan, Amal Abu; Dweik, Dima; Pierce, Sarah; Lee, Ming K; King, Mary-Claire; Walsh, Tom; Kanaan, Moien

    2016-10-01

    Tooth development is controlled by the same processes that regulate formation of other ectodermal structures. Mutations in the genes underlying these processes may cause ectodermal dysplasia, including severe absence of primary or permanent teeth. Four consanguineous Palestinian families presented with oligodontia and hair and skin features of ectodermal dysplasia. Appearance of ectodermal dysplasia was consistent with autosomal recessive inheritance. Exome sequencing followed by genotyping of 56 informative relatives in the 4 families suggests that the phenotype is due to homozygosity for KREMEN1 p.F209S (c.626 T>C) on chromosome 22 at g.29,521,399 (hg19). The variant occurs in the highly conserved extracellular WSC domain of KREMEN1, which is known to be a high affinity receptor of Dickkopf-1, a component of the Dickkopf-Kremen-LRP6 complex, and a potent regulator of Wnt signaling. The Wnt signaling pathway is critical to development of ectodermal structures. Mutations in WNT10A, LRP6, EDA, and other genes in this pathway lead to tooth agenesis with or without other ectodermal anomalies. Our results implicate KREMEN1 for the first time in a human disorder and provide additional details on the role of the Wnt signaling in ectodermal and dental development.

  10. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  11. Alteration of gene expression profiling including GPR174 and GNG2 is associated with vasovagal syncope.

    Science.gov (United States)

    Huang, Yu-Juan; Zhou, Zai-wei; Xu, Miao; Ma, Qing-wen; Yan, Jing-bin; Wang, Jian-yi; Zhang, Quo-qin; Huang, Min; Bao, Liming

    2015-03-01

    Vasovagal syncope (VVS) causes accidental harm for susceptible patients. However, pathophysiology of this disorder remains largely unknown. In an effort to understanding of molecular mechanism for VVS, genome-wide gene expression profiling analyses were performed on VVS patients at syncope state. A total of 66 Type 1 VVS child patients and the same number healthy controls were enrolled in this study. Peripheral blood RNAs were isolated from all subjects, of which 10 RNA samples were randomly selected from each groups for gene expression profile analysis using Gene ST 1.0 arrays (Affymetrix). The results revealed that 103 genes were differently expressed between the patients and controls. Significantly, two G-proteins related genes, GPR174 and GNG2 that have not been related to VVS were among the differently expressed genes. The microarray results were confirmed by qRT-PCR in all the tested individuals. Ingenuity pathway analysis and gene ontology annotation study showed that the differently expressed genes are associated with stress response and apoptosis, suggesting that the alteration of some gene expression including G-proteins related genes is associated with VVS. This study provides new insight into the molecular mechanism of VVS and would be helpful to further identify new molecular biomarkers for the disease.

  12. Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

    Science.gov (United States)

    Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

    2017-11-07

    The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

  13. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  14. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  15. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  16. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  17. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    Science.gov (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  18. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  19. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  20. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  1. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  2. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  3. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  4. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    Science.gov (United States)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  5. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  6. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  7. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  8. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    Science.gov (United States)

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  9. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  10. Diagnostic Yield of Sequencing Familial Hypercholesterolemia Genes in Severe Hypercholesterolemia

    Science.gov (United States)

    Khera, Amit V.; Won, Hong-Hee; Peloso, Gina M.; Lawson, Kim S.; Bartz, Traci M.; Deng, Xuan; van Leeuwen, Elisabeth M.; Natarajan, Pradeep; Emdin, Connor A.; Bick, Alexander G.; Morrison, Alanna C.; Brody, Jennifer A.; Gupta, Namrata; Nomura, Akihiro; Kessler, Thorsten; Duga, Stefano; Bis, Joshua C.; van Duijn, Cornelia M.; Cupples, L. Adrienne; Psaty, Bruce; Rader, Daniel J.; Danesh, John; Schunkert, Heribert; McPherson, Ruth; Farrall, Martin; Watkins, Hugh; Lander, Eric; Wilson, James G.; Correa, Adolfo; Boerwinkle, Eric; Merlini, Piera Angelica; Ardissino, Diego; Saleheen, Danish; Gabriel, Stacey; Kathiresan, Sekar

    2017-01-01

    Background About 7% of US adults have severe hypercholesterolemia (untreated LDL cholesterol ≥190 mg/dl). Such high LDL levels may be due to familial hypercholesterolemia (FH), a condition caused by a single mutation in any of three genes. Lifelong elevations in LDL cholesterol in FH mutation carriers may confer CAD risk beyond that captured by a single LDL cholesterol measurement. Objectives Assess the prevalence of a FH mutation among those with severe hypercholesterolemia and determine whether CAD risk varies according to mutation status beyond the observed LDL cholesterol. Methods Three genes causative for FH (LDLR, APOB, PCSK9) were sequenced in 26,025 participants from 7 case-control studies (5,540 CAD cases, 8,577 CAD-free controls) and 5 prospective cohort studies (11,908 participants). FH mutations included loss-of-function variants in LDLR, missense mutations in LDLR predicted to be damaging, and variants linked to FH in ClinVar, a clinical genetics database. Results Among 8,577 CAD-free control participants, 430 had LDL cholesterol ≥190 mg/dl; of these, only eight (1.9%) carried a FH mutation. Similarly, among 11,908 participants from 5 prospective cohorts, 956 had LDL cholesterol ≥190 mg/dl and of these, only 16 (1.7%) carried a FH mutation. Within any stratum of observed LDL cholesterol, risk of CAD was higher among FH mutation carriers when compared with non-carriers. When compared to a reference group with LDL cholesterol <130 mg/dl and no mutation, participants with LDL cholesterol ≥190 mg/dl and no FH mutation had six-fold higher risk for CAD (OR 6.0; 95%CI 5.2–6.9) whereas those with LDL cholesterol ≥190 mg/dl as well as a FH mutation demonstrated twenty-two fold increased risk (OR 22.3; 95%CI 10.7–53.2). Conclusions Among individuals with LDL cholesterol ≥190 mg/dl, gene sequencing identified a FH mutation in <2%. However, for any given observed LDL cholesterol, FH mutation carriers are at substantially increased risk for CAD

  11. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  12. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  13. Molecular study of the perforin gene in familial hematological malignancies

    Directory of Open Access Journals (Sweden)

    El Abed Rim

    2011-09-01

    Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

  14. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  15. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  16. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  17. Repair of DNA damage in the human metallothionein gene family

    International Nuclear Information System (INIS)

    Leadon, S.A.; Snowden, M.M.

    1987-01-01

    In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab

  18. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  19. Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

    Science.gov (United States)

    Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

    2010-01-01

    Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

  20. Genome-wide identification and characterization of the SBP-box gene family in Petunia.

    Science.gov (United States)

    Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

    2018-03-12

    SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

  1. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  2. The Effects of a Family Support Program Including Respite Care on Parenting Stress and Family Quality of Life Perceived by Primary Caregivers of Children with Disabilities in Korea

    Science.gov (United States)

    Sung, Minjung; Park, Jiyeon

    2012-01-01

    In this study, a family support program was carried out for primary caregivers of children with disabilities. The program included respite care, recreation programs, counseling, and social support coordination based on individual needs of each family. In order to verify the intervention effects, parenting stress and family quality of life were…

  3. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  4. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  5. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.

    Science.gov (United States)

    Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G

    2015-07-14

    Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.

  6. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  7. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  8. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  9. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  10. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  11. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  12. Molecular phylogeny of moth-specialized spider sub-family Cyrtarachninae, which includes bolas spiders.

    Science.gov (United States)

    Tanikawa, Akio; Shinkai, Akira; Miyashita, Tadashi

    2014-11-01

    The evolutionary process of the unique web architectures of spiders of the sub-family Cyrtarachninae, which includes the triangular web weaver, bolas spider, and webless spider, is thought to be derived from reduction of orbicular 'spanning-thread webs' resembling ordinal orb webs. A molecular phylogenetic analysis was conducted to explore this hypothesis using orbicular web spiders Cyrtarachne, Paraplectana, Poecilopachys, triangular web spider Pasilobus, bolas spiders Ordgarius and Mastophora, and webless spider Celaenia. The phylogeny inferred from partial sequences of mt-COI, nuclear 18S-rRNA and 28S-rRNA showed that the common ancestor of these spiders diverged into two clades: a spanning-thread web clade and a bolas or webless clade. This finding suggests that the triangular web evolved by reduction of an orbicular spanning web, but that bolas spiders evolved in the early stage, which does not support the gradual web reduction hypothesis.

  13. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  14. Gender in childhood obesity: family environment, hormones, and genes.

    Science.gov (United States)

    Wisniewski, Amy B; Chernausek, Steven D

    2009-01-01

    The prevalence of obesity among children in the United States represents a pool of latent morbidity. Though the prevalence of obesity has increased in both boys and girls, the causes and consequences differ between the sexes. Thus, interventions proposed to treat and prevent childhood obesity will need to account for these differences. This review examines gender differences in the presentation of obesity in children and describes environmental, hormonal, and genetic factors that contribute to observed gender differences. A search of peer-reviewed, published literature was performed with PubMed for articles published from January 1974 through October 2008. Search terms used were obesity, sex, gender, hormones, family environment, body composition, adiposity, and genes. Studies of children aged 0 to 18 years were included, and only articles published in English were reviewed for consideration. Articles that illustrated gender differences in either the presentation or underlying mechanisms of obesity in children were reviewed for content, and their bibliographies were used to identify other relevant literature. Gender differences in childhood obesity have been understudied partially because of how we define the categories of overweight and obesity. Close examination of studies revealed that gender differences were common, both before and during puberty. Boys and girls differ in body composition, patterns of weight gain, hormone biology, and the susceptibility to certain social, ethnic, genetic, and environmental factors. Our understanding of how gender differences in pediatric populations relate to the pathogenesis of obesity and the subsequent development of associated comorbid states is critical to developing and implementing both therapeutic and preventive interventions.

  15. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.

    Science.gov (United States)

    He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan

    2012-07-01

    WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.

  16. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  17. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  18. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Directory of Open Access Journals (Sweden)

    Ogunjumo Oluwasanmi

    2004-06-01

    Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.

  19. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Science.gov (United States)

    Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A

    2004-01-01

    Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903

  20. Expression analysis of the CLCA gene family in mouse and human with emphasis on the nervous system

    NARCIS (Netherlands)

    M. Piirsoo (Marko); D. Meijer (Daniëlle); T. Timmusk (Tnis)

    2009-01-01

    textabstractBackground. Members of the calcium-activated chloride channel (CLCA) gene family have been suggested to possess a variety of functions including cell adhesion and tumor suppression. Expression of CLCA family members has mostly been analyzed in non-neural tissues. Here we describe the

  1. Extending “Continuity of Care” to include the Contribution of Family Carers

    Directory of Open Access Journals (Sweden)

    Cecilia Wong-Cornall

    2017-06-01

    Full Text Available Background: Family carers, as a “shadow workforce”, are foundational to the day-to-day integration of health service delivery for older family members living with complex health needs. This paper utilises Haggerty’s model of continuity of care to explore the contribution of family carers’ to the provision of care and support for an older family member’s chronic condition within the context of health service delivery.  Methods: We analysed data from interviews of 13 family carers in a case study of primary health care in New Zealand – a Maori Provider Organisation – to determine the alignment of family caregiving with the three levels of continuity of care (relational continuity, informational continuity, and management continuity.  Results: We found alignment of family caregiving tasks, responsibilities, and relationships with the three levels of continuity of care. Family carers 1 partnered with providers to extend chronic care to the home; 2 transferred and contributed information from one provider/service to another; 3 supported consistent and flexible management of care.  Discussion: The Maori Provider Organisation supported family carer-provider partnership enabled by shared Maori cultural values and social mandate of building family-centred wellbeing. Relational continuity was the most important level of continuity of care; it sets precedence for family carers and providers to establish the other levels – informational and management – continuity of care for their family member cared for. Family carers need to be considered as active partners working alongside responsive primary health care providers and organisation in the implementation of chronic care.

  2. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  3. Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng

    2015-03-10

    Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification.

  4. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  5. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  6. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

  7. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  8. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi

    2007-01-01

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated

  9. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  10. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  11. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  12. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  13. Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.

    Directory of Open Access Journals (Sweden)

    Giselle Sek Suan Nah

    Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.

  14. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  15. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

    Science.gov (United States)

    Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

    2013-01-01

    Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

  16. Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.

    Science.gov (United States)

    Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang

    2015-06-30

    Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.

  17. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  19. Identification of ALK as the Major Familial Neuroblastoma Predisposition Gene

    Science.gov (United States)

    Mossë, Yalë P; Laudenslager, Marci; Longo, Luca; Cole, Kristina A; Wood, Andrew; Attiyeh, Edward F; Laquaglia, Michael J; Sennett, Rachel; Lynch, Jill E; Perri, Patrizia; Laureys, Geneviève; Speleman, Frank; Hakonarson, Hakon; Torkamani, Ali; Schork, Nicholas J; Brodeur, Garrett M; Tonini, Gian Paolo; Rappaport, Eric; Devoto, Marcella; Maris, John M

    2009-01-01

    SUMMARY Survival rates for the childhood cancer neuroblastoma have not substantively improved despite dramatic escalation in chemotherapy intensity. Like most human cancers, this embryonal malignancy can be inherited, but the genetic etiology of familial and sporadically occurring neuroblastoma was largely unknown. Here we show that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas, and that activating mutations can also be somatically acquired. We first identified a significant linkage signal at the short arm of chromosome 2 (maximum nonparametric LOD=4.23 at rs1344063) using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate missense mutations in the tyrosine kinase domain of ALK (G1128A, R1192P and R1275Q) that segregated with the disease in eight separate families. Examination of 491 sporadically occurring human neuroblastoma samples showed that the ALK locus was gained in 22.8%, and highly amplified in an additional 3.3%, and that these aberrations were highly associated with death from disease (P=0.0003). Resequencing of 194 high-risk neuroblastoma samples showed somatically acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation consistent with activation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of 4 of 4 cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. Our results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy. PMID:18724359

  20. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.

    2016-01-01

    -causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared...

  1. Microsatellite polymorphisms associated with human behavioural and psychological phenotypes including a gene-environment interaction.

    Science.gov (United States)

    Bagshaw, Andrew T M; Horwood, L John; Fergusson, David M; Gemmell, Neil J; Kennedy, Martin A

    2017-02-03

    The genetic and environmental influences on human personality and behaviour are a complex matter of ongoing debate. Accumulating evidence indicates that short tandem repeats (STRs) in regulatory regions are good candidates to explain heritability not accessed by genome-wide association studies. We tested for associations between the genotypes of four selected repeats and 18 traits relating to personality, behaviour, cognitive ability and mental health in a well-studied longitudinal birth cohort (n = 458-589) using one way analysis of variance. The repeats were a highly conserved poly-AC microsatellite in the upstream promoter region of the T-box brain 1 (TBR1) gene and three previously studied STRs in the activating enhancer-binding protein 2-beta (AP2-β) and androgen receptor (AR) genes. Where significance was found we used multiple regression to assess the influence of confounding factors. Carriers of the shorter, most common, allele of the AR gene's GGN microsatellite polymorphism had fewer anxiety-related symptoms, which was consistent with previous studies, but in our study this was not significant following Bonferroni correction. No associations with two repeats in the AP2-β gene withstood this correction. A novel finding was that carriers of the minor allele of the TBR1 AC microsatellite were at higher risk of conduct problems in childhood at age 7-9 (p = 0.0007, which did pass Bonferroni correction). Including maternal smoking during pregnancy (MSDP) in models controlling for potentially confounding influences showed that an interaction between TBR1 genotype and MSDP was a significant predictor of conduct problems in childhood and adolescence (p behaviour up to age 25 years (p ≤ 0.02). This interaction remained significant after controlling for possible confounders including maternal age at birth, socio-economic status and education, and offspring birth weight. The potential functional importance of the TBR1 gene's promoter microsatellite

  2. Gene Structures, Evolution, Classification and Expression Profiles of the Aquaporin Gene Family in Castor Bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Zhi Zou

    Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.

  3. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    OpenAIRE

    Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

  4. Genome-wide analysis of the MYB gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Zhou, Changpin; Chen, Yanbo; Wu, Zhenying; Lu, Wenjia; Han, Jinli; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2015-11-01

    The MYB proteins comprise one of the largest transcription factor families in plants, and play key roles in regulatory networks controlling development, metabolism, and stress responses. A total of 125 MYB genes (JcMYB) have been identified in the physic nut (Jatropha curcas L.) genome, including 120 2R-type MYB, 4 3R-MYB, and 1 4R-MYB genes. Based on exon-intron arrangement of MYBs from both lower (Physcomitrella patens) and higher (physic nut, Arabidopsis, and rice) plants, we can classify plant MYB genes into ten groups (MI-X), except for MIX genes which are nonexistent in higher plants. We also observed that MVIII genes may be one of the most ancient MYB types which consist of both R2R3- and 3R-MYB genes. Most MYB genes (76.8% in physic nut) belong to the MI group which can be divided into 34 subgroups. The JcMYB genes were nonrandomly distributed on its 11 linkage groups (LGs). The expansion of MYB genes across several subgroups was observed and resulted from genome triplication of ancient dicotyledons and from both ancient and recent tandem duplication events in the physic nut genome. The expression patterns of several MYB duplicates in the physic nut showed differences in four tissues (root, stem, leaf, and seed), and 34 MYB genes responded to at least one abiotic stressor (drought, salinity, phosphate starvation, and nitrogen starvation) in leaves and/or roots based on the data analysis of digital gene expression tags. Overexpression of the JcMYB001 gene in Arabidopsis increased its sensitivity to drought and salinity stresses. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon

    Directory of Open Access Journals (Sweden)

    Qing XU

    2018-01-01

    Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis

  6. Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions

    Science.gov (United States)

    Rodríguez-Luna, Stefany Daniela; Cruz Vázquez, Angélica Patricia; Jiménez Suárez, Verónica; Rodríguez-Sanoja, Romina; Alvarez-Buylla, Elena R.; Sánchez, Sergio

    2018-01-01

    Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions. PMID:29447216

  7. Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions.

    Directory of Open Access Journals (Sweden)

    Corina Diana Ceapă

    Full Text Available Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions.

  8. 45 CFR 400.208 - Claims involving family units which include both refugees and nonrefugees.

    Science.gov (United States)

    2010-10-01

    ... refugees and nonrefugees. 400.208 Section 400.208 Public Welfare Regulations Relating to Public Welfare OFFICE OF REFUGEE RESETTLEMENT, ADMINISTRATION FOR CHILDREN AND FAMILIES, DEPARTMENT OF HEALTH AND HUMAN SERVICES REFUGEE RESETTLEMENT PROGRAM Federal Funding Federal Funding for Expenditures for Determining...

  9. Simulation of E. coli gene regulation including overlapping cell cycles, growth, division, time delays and noise.

    Directory of Open Access Journals (Sweden)

    Ruoyu Luo

    Full Text Available Due to the complexity of biological systems, simulation of biological networks is necessary but sometimes complicated. The classic stochastic simulation algorithm (SSA by Gillespie and its modified versions are widely used to simulate the stochastic dynamics of biochemical reaction systems. However, it has remained a challenge to implement accurate and efficient simulation algorithms for general reaction schemes in growing cells. Here, we present a modeling and simulation tool, called 'GeneCircuits', which is specifically developed to simulate gene-regulation in exponentially growing bacterial cells (such as E. coli with overlapping cell cycles. Our tool integrates three specific features of these cells that are not generally included in SSA tools: 1 the time delay between the regulation and synthesis of proteins that is due to transcription and translation processes; 2 cell cycle-dependent periodic changes of gene dosage; and 3 variations in the propensities of chemical reactions that have time-dependent reaction rates as a consequence of volume expansion and cell division. We give three biologically relevant examples to illustrate the use of our simulation tool in quantitative studies of systems biology and synthetic biology.

  10. Including α s1 casein gene information in genomic evaluations of French dairy goats.

    Science.gov (United States)

    Carillier-Jacquin, Céline; Larroque, Hélène; Robert-Granié, Christèle

    2016-08-04

    Genomic best linear unbiased prediction methods assume that all markers explain the same fraction of the genetic variance and do not account effectively for genes with major effects such as the α s1 casein polymorphism in dairy goats. In this study, we investigated methods to include the available α s1 casein genotype effect in genomic evaluations of French dairy goats. First, the α s1 casein genotype was included as a fixed effect in genomic evaluation models based only on bucks that were genotyped at the α s1 casein locus. Less than 1 % of the females with phenotypes were genotyped at the α s1 casein gene. Thus, to incorporate these female phenotypes in the genomic evaluation, two methods that allowed for this large number of missing α s1 casein genotypes were investigated. Probabilities for each possible α s1 casein genotype were first estimated for each female of unknown genotype based on iterative peeling equations. The second method is based on a multiallelic gene content approach. For each model tested, we used three datasets each divided into a training and a validation set: (1) two-breed population (Alpine + Saanen), (2) Alpine population, and (3) Saanen population. The α s1 casein genotype had a significant effect on milk yield, fat content and protein content. Including an α s1 casein effect in genetic and genomic evaluations based only on male known α s1 casein genotypes improved accuracies (from 6 to 27 %). In genomic evaluations based on all female phenotypes, the gene content approach performed better than the other tested methods but the improvement in accuracy was only slightly better (from 1 to 14 %) than that of a genomic model without the α s1 casein effect. Including the α s1 casein effect in a genomic evaluation model for French dairy goats is possible and useful to improve accuracy. Difficulties in predicting the genotypes for ungenotyped animals limited the improvement in accuracy of the obtained estimated breeding values.

  11. Transcriptome-wide survey of mouse CNS-derived cells reveals monoallelic expression within novel gene families.

    Directory of Open Access Journals (Sweden)

    Sierra M Li

    Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.

  12. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  13. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  14. Evolution and expression analysis of the grape (Vitis vinifera L.) WRKY gene family.

    Science.gov (United States)

    Guo, Chunlei; Guo, Rongrong; Xu, Xiaozhao; Gao, Min; Li, Xiaoqin; Song, Junyang; Zheng, Yi; Wang, Xiping

    2014-04-01

    WRKY proteins comprise a large family of transcription factors that play important roles in plant defence regulatory networks, including responses to various biotic and abiotic stresses. To date, no large-scale study of WRKY genes has been undertaken in grape (Vitis vinifera L.). In this study, a total of 59 putative grape WRKY genes (VvWRKY) were identified and renamed on the basis of their respective chromosome distribution. A multiple sequence alignment analysis using all predicted grape WRKY genes coding sequences, together with those from Arabidopsis thaliana and tomato (Solanum lycopersicum), indicated that the 59 VvWRKY genes can be classified into three main groups (I-III). An evaluation of the duplication events suggested that several WRKY genes arose before the divergence of the grape and Arabidopsis lineages. Moreover, expression profiles derived from semiquantitative PCR and real-time quantitative PCR analyses showed distinct expression patterns in various tissues and in response to different treatments. Four VvWRKY genes showed a significantly higher expression in roots or leaves, 55 responded to varying degrees to at least one abiotic stress treatment, and the expression of 38 were altered following powdery mildew (Erysiphe necator) infection. Most VvWRKY genes were downregulated in response to abscisic acid or salicylic acid treatments, while the expression of a subset was upregulated by methyl jasmonate or ethylene treatments.

  15. Validating the 5Fs mnemonic for cholelithiasis: time to include family history.

    LENUS (Irish Health Repository)

    Bass, Gary

    2013-11-01

    The time-honoured mnemonic of \\'5Fs\\' is a reminder to students that patients with upper abdominal pain and who conform to a profile of \\'fair, fat, female, fertile and forty\\' are likely to have cholelithiasis. We feel, however, that a most important \\'F\\'-that for \\'family history\\'-is overlooked and should be introduced to enhance the value of a useful aide memoire.

  16. De novo mutations in synaptic transmission genes including DNM1 cause epileptic encephalopathies

    DEFF Research Database (Denmark)

    2014-01-01

    in five individuals and de novo mutations in GABBR2, FASN, and RYR3 in two individuals each. Unlike previous studies, this cohort is sufficiently large to show a significant excess of de novo mutations in epileptic encephalopathy probands compared to the general population using a likelihood analysis (p...... = 8.2 × 10(-4)), supporting a prominent role for de novo mutations in epileptic encephalopathies. We bring statistical evidence that mutations in DNM1 cause epileptic encephalopathy, find suggestive evidence for a role of three additional genes, and show that at least 12% of analyzed individuals have...... analyzed exome-sequencing data of 356 trios with the "classical" epileptic encephalopathies, infantile spasms and Lennox Gastaut syndrome, including 264 trios previously analyzed by the Epi4K/EPGP consortium. In this expanded cohort, we find 429 de novo mutations, including de novo mutations in DNM1...

  17. miR-92a family and their target genes in tumorigenesis and metastasis

    Energy Technology Data Exchange (ETDEWEB)

    Li, Molin, E-mail: molin_li@hotmail.com [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Guan, Xingfang; Sun, Yuqiang [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Mi, Jun [Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Shu, Xiaohong [College of Pharmacy, Dalian Medical University Cancer Center, Dalian 116044 (China); Liu, Fang [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China); Li, Chuangang, E-mail: li_chuangang@sina.com [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China)

    2014-04-15

    The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis.

  18. miR-92a family and their target genes in tumorigenesis and metastasis

    International Nuclear Information System (INIS)

    Li, Molin; Guan, Xingfang; Sun, Yuqiang; Mi, Jun; Shu, Xiaohong; Liu, Fang; Li, Chuangang

    2014-01-01

    The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis

  19. Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

    Science.gov (United States)

    Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

    2015-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

  20. A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

    Science.gov (United States)

    He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

    2017-08-23

    The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

  1. The zebrafish progranulin gene family and antisense transcripts

    Directory of Open Access Journals (Sweden)

    Baranowski David

    2005-11-01

    Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial

  2. Neurexin gene family variants as risk factors for autism spectrum disorder.

    Science.gov (United States)

    Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran

    2018-01-01

    Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  3. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  4. Calcitonin gene related family peptides: importance in normal placental and fetal development.

    Science.gov (United States)

    Yallampalli, Chandra; Chauhan, Madhu; Endsley, Janice; Sathishkumar, Kunju

    2014-01-01

    Synchronized molecular and cellular events occur between the uterus and the implanting embryo to facilitate successful pregnancy outcome. Nevertheless, the molecular signaling network that coordinates strategies for successful decidualization, placentation and fetal growth are not well understood. The discovery of calcitonin/calcitonin gene-related peptides (CT/CGRP) highlighted new signaling mediators in various physiological processes, including reproduction. It is known that CGRP family peptides including CGRP, adrenomedulin and intermedin play regulatory functions during implantation, trophoblast proliferation and invasion, and fetal organogenesis. In addition, all the CGRP family peptides and their receptor components are found to be expressed in decidual, placental and fetal tissues. Additionally, plasma levels of peptides of the CGRP family were found to fluctuate during normal gestation and to induce placental cellular differentiation, proliferation, and critical hormone signaling. Moreover, aberrant signaling of these CGRP family peptides during gestation has been associated with pregnancy disorders. It indicates the existence of a possible regulatory role for these molecules during decidualization and placentation processes, which are known to be particularly vulnerable. In this review, the influence of the CGRP family peptides in these critical processes is explored and discussed.

  5. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  6. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  7. Benign familial fleck retina: multimodal imaging including optical coherence tomography angiography.

    Science.gov (United States)

    Garcia, Jose Mauricio Botto de Barros; Isaac, David Leonardo Cruvinel; Sardeiro, Tainara; Aquino, Érika; Avila, Marcos

    2017-01-01

    This report presents multimodal imaging of a 27-year-old woman diagnosed with benign familial fleck retina (OMIM 228980), an uncommon disorder. Fundus photographs revealed retinal flecks that affected her post-equatorial retina but spared the macular area. Fundus autofluorescence and infrared imaging demonstrated a symmetrical pattern of yellow-white fleck lesions that affected both eyes. Her full-field electroretinogram and electrooculogram were normal. An optical coherence tomography B-scan was performed for both eyes, revealing increased thickness of the retinal pigmented epithelium leading to multiple small pigmented epithelium detachments. The outer retina remained intact in both eyes. Spectral-domain optical coherence tomography angiography with split-spectrum amplitude decorrelation algorithm and 3 × 3 mm structural en face optical coherence tomography did not show macular lesions. Benign familial fleck retina belongs to a heterogenous group of so-called flecked retina syndromes, and should be considered in patients with yellowish-white retinal lesions without involvement of the macula.

  8. Benign familial fleck retina: multimodal imaging including optical coherence tomography angiography

    Directory of Open Access Journals (Sweden)

    Jose Mauricio Botto de Barros Garcia

    Full Text Available ABSTRACT This report presents multimodal imaging of a 27-year-old woman diagnosed with benign familial fleck retina (OMIM 228980, an uncommon disorder. Fundus photographs revealed retinal flecks that affected her post-equatorial retina but spared the macular area. Fundus autofluorescence and infrared imaging demonstrated a symmetrical pattern of yellow-white fleck lesions that affected both eyes. Her full-field electroretinogram and electrooculogram were normal. An optical coherence tomography B-scan was performed for both eyes, revealing increased thickness of the retinal pigmented epithelium leading to multiple small pigmented epithelium detachments. The outer retina remained intact in both eyes. Spectral-domain optical coherence tomography angiography with split-spectrum amplitude decorrelation algorithm and 3 × 3 mm structural en face optical coherence tomography did not show macular lesions. Benign familial fleck retina belongs to a heterogenous group of so-called flecked retina syndromes, and should be considered in patients with yellowish-white retinal lesions without involvement of the macula.

  9. Genomic and expression analysis of the flax (Linum usitatissimum) family of glycosyl hydrolase 35 genes.

    Science.gov (United States)

    Hobson, Neil; Deyholos, Michael K

    2013-05-23

    Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require

  10. Molecular characterization of edestin gene family in Cannabis sativa L.

    Science.gov (United States)

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  11. GDNF gene is associated with tourette syndrome in a family study.

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo

    2015-07-01

    Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

  12. GDNF Gene Is Associated With Tourette Syndrome in a Family Study

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

    2016-01-01

    Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

  13. Synthesis, antimicrobial activity and gene structure of a novel member of the dermaseptin B family.

    Science.gov (United States)

    Fleury, Y; Vouille, V; Beven, L; Amiche, M; Wróblewski, H; Delfour, A; Nicolas, P

    1998-03-09

    Dermaseptins are a family of cationic (Lys-rich) antimicrobial peptides that are abundant in the skin secretions of the arboreal frogs Phyllomedusa bicolor and P. sauvagii. In vitro, these peptides are microbicidal against a wide variety of microorganisms including Gram-positive and Gram-negative bacteria, yeasts, protozoa and fungi. To date, 6 dermaseptin B mature peptides, 24-34 residues long, 2 dermaseptin B cDNAs and 2 gene sequences have been identified in P. bicolor. To assess dermaseptin related genes further, we screened a P. bicolor genomic library with 32P-labeled cDNAs coding either for prepro-dermaseptins B1 or B2 (adenoregulin). A gene sequence was identified that coded a novel dermaseptin B, termed Drg3, which exhibits 23-42% amino acids identities with other members of the family. Analysis of the cDNAs coding precursors for several opioid and antimicrobial peptides originating from the skin of various amphibian species revealed that the 25-residue preproregion of these preproforms are all encoded by conserved nucleotides encompassed by the first coding exon of the Drg3 gene. Synthetic dermaseptin Drg3 exhibited a bactericidal activity towards several species of mollicutes (wall-less eubacteria), firmicutes (Gram-positive eubacteria), and gracilicutes (Gram-negative eubacteria), with minimal inhibitory concentrations (MICs) ranging from 6.25 to 100 microM. Experiments performed on Acholeplasma laidlawii cells revealed that this peptide is membranotropic and that if efficiently depolarizes the plasma membrane.

  14. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  15. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  16. The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding.

    Science.gov (United States)

    Ayadi, M; Hanana, M; Kharrat, N; Merchaoui, H; Marzoug, R Ben; Lauvergeat, V; Rebaï, A; Mzid, R

    2016-10-01

    WRKY transcription factors belong to a large family of plant transcriptional regulators whose members have been reported to be involved in a wide range of biological roles including plant development, adaptation to environmental constraints and response to several diseases. However, little or poor information is available about WRKY's in Citrus. The recent release of completely assembled genomes sequences of Citrus sinensis and Citrus clementina and the availability of ESTs sequences from other citrus species allowed us to perform a genome survey for Citrus WRKY proteins. In the present study, we identified 100 WRKY members from C. sinensis (51), C. clementina (48) and Citrus unshiu (1), and analyzed their chromosomal distribution, gene structure, gene duplication, syntenic relation and phylogenetic analysis. A phylogenetic tree of 100 Citrus WRKY sequences with their orthologs from Arabidopsis has distinguished seven groups. The CsWRKY genes were distributed across all ten sweet orange chromosomes. A comprehensive approach and an integrative analysis of Citrus WRKY gene expression revealed variable profiles of expression within tissues and stress conditions indicating functional diversification. Thus, candidate Citrus WRKY genes have been proposed as potentially involved in fruit acidification, essential oil biosynthesis and abiotic/biotic stress tolerance. Our results provided essential prerequisites for further WRKY genes cloning and functional analysis with an aim of citrus crop improvement.

  17. Genetic analysis of Chinese families reveals a novel truncation allele of the retinitis pigmentosa GTPase regulator gene

    Directory of Open Access Journals (Sweden)

    Fang Hu

    2014-10-01

    Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.

  18. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  19. Two novel mutations of CLCN7 gene in Chinese families with autosomal dominant osteopetrosis (type II).

    Science.gov (United States)

    Zheng, Hui; Shao, Chong; Zheng, Yan; He, Jin-Wei; Fu, Wen-Zhen; Wang, Chun; Zhang, Zhen-Lin

    2016-07-01

    Autosomal dominant osteopetrosis type II (ADO-II) is a heritable bone disorder characterized by osteosclerosis, predominantly involving the spine (vertebral end-plate thickening, or rugger-jersey spine), the pelvis ("bone-within-bone" structures) and the skull base. Chloride channel 7 (CLCN7) has been reported to be the causative gene. In this study, we aimed to identify the pathogenic mutation in four Chinese families with ADO-II. All 25 exons of the CLCN7 gene, including the exon-intron boundaries, were amplified and sequenced directly in four probands from the Chinese families with ADO-II. The mutation site was then identified in other family members and 250 healthy controls. In family 1, a known missense mutation c.296A>G in exon 4 of CLCN7 was identified in the proband, resulting in a tyrosine (UAU) to cysteine (UGU) substitution at p.99 (Y99C); the mutation was also identified in his affected father. In family 2, a novel missense mutation c.865G>C in exon 10 was identified in the proband, resulting in a valine (GUC) to leucine (CUC) substitution at p.289 (V289L); the mutation was also identified in her healthy mother and sister. In family 3, a novel missense mutation c.1625C>T in exon 17 of CLCN7 was identified in the proband, resulting in an alanine (GCG) to valine (GUG) substitution at p.542 (A542V); the mutation was also identified in her father. In family 4, a hot spot, R767W (c.2299C>T, CGG>TGG), in exon 24 was found in the proband which once again proved the susceptibility of the site or the similar genetic background in different races. Moreover, two novel mutations, V289L and A542V, occurred at a highly conserved position, found by a comparison of the protein sequences from eight vertebrates, and were predicted to have a pathogenic effect by PolyPhen-2 software, which showed "probably damaging" with a score of approximately 1. These mutation sites were not identified in 250 healthy controls. Our present findings suggest that the novel missense

  20. Soybean (Glycine max) SWEET gene family: insights through comparative genomics, transcriptome profiling and whole genome re-sequence analysis.

    Science.gov (United States)

    Patil, Gunvant; Valliyodan, Babu; Deshmukh, Rupesh; Prince, Silvas; Nicander, Bjorn; Zhao, Mingzhe; Sonah, Humira; Song, Li; Lin, Li; Chaudhary, Juhi; Liu, Yang; Joshi, Trupti; Xu, Dong; Nguyen, Henry T

    2015-07-11

    SWEET (MtN3_saliva) domain proteins, a recently identified group of efflux transporters, play an indispensable role in sugar efflux, phloem loading, plant-pathogen interaction and reproductive tissue development. The SWEET gene family is predominantly studied in Arabidopsis and members of the family are being investigated in rice. To date, no transcriptome or genomics analysis of soybean SWEET genes has been reported. In the present investigation, we explored the evolutionary aspect of the SWEET gene family in diverse plant species including primitive single cell algae to angiosperms with a major emphasis on Glycine max. Evolutionary features showed expansion and duplication of the SWEET gene family in land plants. Homology searches with BLAST tools and Hidden Markov Model-directed sequence alignments identified 52 SWEET genes that were mapped to 15 chromosomes in the soybean genome as tandem duplication events. Soybean SWEET (GmSWEET) genes showed a wide range of expression profiles in different tissues and developmental stages. Analysis of public transcriptome data and expression profiling using quantitative real time PCR (qRT-PCR) showed that a majority of the GmSWEET genes were confined to reproductive tissue development. Several natural genetic variants (non-synonymous SNPs, premature stop codons and haplotype) were identified in the GmSWEET genes using whole genome re-sequencing data analysis of 106 soybean genotypes. A significant association was observed between SNP-haplogroup and seed sucrose content in three gene clusters on chromosome 6. Present investigation utilized comparative genomics, transcriptome profiling and whole genome re-sequencing approaches and provided a systematic description of soybean SWEET genes and identified putative candidates with probable roles in the reproductive tissue development. Gene expression profiling at different developmental stages and genomic variation data will aid as an important resource for the soybean research

  1. The human genome and sport, including epigenetics, gene doping, and athleticogenomics.

    Science.gov (United States)

    Sharp, N C Craig

    2010-03-01

    Hugh Montgomery's discovery of the first of more than 239 fitness genes together with rapid advances in human gene therapy have created a prospect of using genes, genetic elements, and cells that have the capacity to enhance athletic performance (to paraphrase the World Anti-Doping Agency's definition of gene doping). This brief overview covers the main areas of interface between genetics and sport, attempts to provide a context against which gene doping may be viewed, and predicts a futuristic legitimate use of genomic (and possibly epigenetic) information in sport. Copyright 2010 Elsevier Inc. All rights reserved.

  2. Detection systems for carbapenemase gene identification should include the SME serine carbapenemase.

    Science.gov (United States)

    Bush, Karen; Pannell, Megan; Lock, John L; Queenan, Anne Marie; Jorgensen, James H; Lee, Ryan M; Lewis, James S; Jarrett, Deidre

    2013-01-01

    Carbapenemase detection has become a major problem in hospitals that encounter outbreaks of infections caused by carbapenem-resistant Gram-negative bacteria. Rapid detection systems have been reported using multiplex PCR analyses and DNA microarray assays. Major carbapenemases that are detected by these systems include the KPC and OXA serine carbapenemases, and the IMP, VIM and NDM families of metallo-β-lactamases. However, increasing numbers of the SME serine carbapenemase are being reported from Serratia marcescens, especially from North and South America. These organisms differ from many of the other carbapenemase-producing pathogens in that they are generally susceptible to the expanded-spectrum cephalosporins ceftazidime and cefepime while retaining resistance to almost all other β-lactam antibiotics. Thus, multiplex PCR assays or DNA microarray testing of carbapenem-resistant S. marcescens isolates should include analyses for production of the SME carbapenemase. Confirmation of the presence of this enzyme may provide reassurance that oxyimino-cephalosporins can be considered for treatment of infections caused by these carbapenem-resistant pathogens. Copyright © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  3. Association between SNP and haplotypes in PPARGCl and adiponectin genes and bone mineral density in Chinese nuclear families

    Institute of Scientific and Technical Information of China (English)

    Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU

    2007-01-01

    Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.

  4. Transcriptional Activity of Nuclear Factor κB Family Genes in Patients with Systemic Sclerosis.

    Science.gov (United States)

    Lis-Święty, Anna; Gola, Joanna; Mazurek, Urszula; Brzezińska-Wcisło, Ligia

    2017-05-01

    Systemic sclerosis (SSc) is a connective tissue disease of unknown etiology and unclear pathogenesis. Evaluation of the activation of nuclear factor κB (NF-κB) family genes IκBα, p50, p52, p65, and c-Rel, potentially involved in the regulation of immunity, inflammation, angiogenesis, and tissue remodeling in SSc, was carried out. The study included 19 patients with limited SSc, 11 patients with early SSc, and 10 healthy persons constituting the control group. Real-time QRT-PCR was used to evaluate the mRNAs in peripheral blood samples. The patients with early SSc showed a decrease in transcriptional activity of IκBα inhibitor and c-Rel subunit. Transcriptional activity decrease in the other patients with limited SSc included genes encoding c-Rel and p50, subunits of NF-κB factor. Deregulation of intracellular signal transduction by NF-κB takes place at the beginning of SSc and in its fibrosis stage. Associations between clinical variables and NF-κB related gene expression as well as the activation of NF-κB family members in SSc patients should be addressed in future studies. © 2017 by the Association of Clinical Scientists, Inc.

  5. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  6. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  7. Prevalence of deleterious germline variants in risk genes including BRCA1/2 in consecutive ovarian cancer patients (AGO-TR-1.

    Directory of Open Access Journals (Sweden)

    Philipp Harter

    Full Text Available Identification of families at risk for ovarian cancer offers the opportunity to consider prophylactic surgery thus reducing ovarian cancer mortality. So far, identification of potentially affected families in Germany was solely performed via family history and numbers of affected family members with breast or ovarian cancer. However, neither the prevalence of deleterious variants in BRCA1/2 in ovarian cancer in Germany nor the reliability of family history as trigger for genetic counselling has ever been evaluated.Prospective counseling and germline testing of consecutive patients with primary diagnosis or with platinum-sensitive relapse of an invasive epithelial ovarian cancer. Testing included 25 candidate and established risk genes. Among these 25 genes, 16 genes (ATM, BRCA1, BRCA2, CDH1, CHEK2, MLH1, MSH2, MSH6, NBN, PMS2, PTEN, PALB2, RAD51C, RAD51D, STK11, TP53 were defined as established cancer risk genes. A positive family history was defined as at least one relative with breast cancer or ovarian cancer or breast cancer in personal history.In total, we analyzed 523 patients: 281 patients with primary diagnosis of ovarian cancer and 242 patients with relapsed disease. Median age at primary diagnosis was 58 years (range 16-93 and 406 patients (77.6% had a high-grade serous ovarian cancer. In total, 27.9% of the patients showed at least one deleterious variant in all 25 investigated genes and 26.4% in the defined 16 risk genes. Deleterious variants were most prevalent in the BRCA1 (15.5%, BRCA2 (5.5%, RAD51C (2.5% and PALB2 (1.1% genes. The prevalence of deleterious variants did not differ significantly between patients at primary diagnosis and relapse. The prevalence of deleterious variants in BRCA1/2 (and in all 16 risk genes in patients <60 years was 30.2% (33.2% versus 10.6% (18.9% in patients ≥60 years. Family history was positive in 43% of all patients. Patients with a positive family history had a prevalence of deleterious variants

  8. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  9. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica

    NARCIS (Netherlands)

    Pessina, S.; Pavan, S.N.C.; Catalano, D.; Gallotta, A.; Visser, R.G.F.; Bai, Y.; Malnoy, M.; Schouten, H.J.

    2014-01-01

    Background Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO

  10. Lineage-specific evolution of the vertebrate Otopetrin gene family revealed by comparative genomic analyses

    Directory of Open Access Journals (Sweden)

    Ryan Joseph F

    2011-01-01

    Full Text Available Abstract Background Mutations in the Otopetrin 1 gene (Otop1 in mice and fish produce an unusual bilateral vestibular pathology that involves the absence of otoconia without hearing impairment. The encoded protein, Otop1, is the only functionally characterized member of the Otopetrin Domain Protein (ODP family; the extended sequence and structural preservation of ODP proteins in metazoans suggest a conserved functional role. Here, we use the tools of sequence- and cytogenetic-based comparative genomics to study the Otop1 and the Otop2-Otop3 genes and to establish their genomic context in 25 vertebrates. We extend our evolutionary study to include the gene mutated in Usher syndrome (USH subtype 1G (Ush1g, both because of the head-to-tail clustering of Ush1g with Otop2 and because Otop1 and Ush1g mutations result in inner ear phenotypes. Results We established that OTOP1 is the boundary gene of an inversion polymorphism on human chromosome 4p16 that originated in the common human-chimpanzee lineage more than 6 million years ago. Other lineage-specific evolutionary events included a three-fold expansion of the Otop genes in Xenopus tropicalis and of Ush1g in teleostei fish. The tight physical linkage between Otop2 and Ush1g is conserved in all vertebrates. To further understand the functional organization of the Ushg1-Otop2 locus, we deduced a putative map of binding sites for CCCTC-binding factor (CTCF, a mammalian insulator transcription factor, from genome-wide chromatin immunoprecipitation-sequencing (ChIP-seq data in mouse and human embryonic stem (ES cells combined with detection of CTCF-binding motifs. Conclusions The results presented here clarify the evolutionary history of the vertebrate Otop and Ush1g families, and establish a framework for studying the possible interaction(s of Ush1g and Otop in developmental pathways.

  11. Innate immune genes including a mucin-like gene, mul-1, induced by ionizing radiation in Caenorhabditis elegans.

    Science.gov (United States)

    Kimura, Takafumi; Takanami, Takako; Sakashita, Tetsuya; Wada, Seiichi; Kobayashi, Yasuhiko; Higashitani, Atsushi

    2012-10-01

    The effect of radiation on the intestine has been studied for more than one hundred years. It remains unclear, however, whether this organ uses specific defensive mechanisms against ionizing radiation. The infection with Pseudomonas aeruginosa (PA14) in Caenorhabditis elegans induces up-regulation of innate immune response genes. Here, we found that exposure to ionizing radiation also induces certain innate immune response genes such as F49F1.6 (termed mul-1), clec-4, clec-67, lys-1 and lys-2 in the intestine. Moreover, pre-treatment with ionizing radiation before seeding on PA14 lawn plate significantly increased survival rate in the nematode. We also studied transcription pathway of the mul-1 in response to ionizing radiation. Induction of mul-1 gene was highly dependent on the ELT-2 transcription factor and p38 MAPK. Moreover, the insulin/IGF-1 signal pathway works to enhance induction of this gene. The mul-1 gene showed a different induction pattern from the DNA damage response gene, ced-13, which implies that the expression of this gene might be triggered as an indirect effect of radiation. Silencing of the mul-1 gene led to growth retardation after treatment with ionizing radiation. We describe the cross-tolerance between the response to radiation exposure and the innate immune system.

  12. Structural and functional studies of a family of Dictyostelium discoideum developmentally regulated, prestalk genes coding for small proteins

    Directory of Open Access Journals (Sweden)

    Escalante Ricardo

    2008-01-01

    Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.

  13. Genome-wide identification and expression profiling of tomato Hsp20 gene family in response to biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    jiahong yu

    2016-08-01

    Full Text Available The Hsp20 genes are involved in the response of plants to environment stresses including heat shock and also play a vital role in plant growth and development. They represent the most abundant small heat shock proteins (sHsps in plants, but little is known about this family in tomato (Solanum lycopersicum, an important vegetable crop in the world. Here, we characterized heat shock protein 20 (SlHsp20 gene family in tomato through integration of gene structure, chromosome location, phylogenetic relationship and expression profile. Using bioinformatics-based methods, we identified at least 42 putative SlHsp20 genes in tomato. Sequence analysis revealed that most of SlHsp20 genes possessed no intron or a relatively short intron in length. Chromosome mapping indicated that inter-arm and intra-chromosome duplication events contributed remarkably to the expansion of SlHsp20 genes. Phylogentic tree of Hsp20 genes from tomato and other plant species revealed that SlHsp20 genes were grouped into 13 subfamilies, indicating that these genes may have a common ancestor that generated diverse subfamilies prior to the mono-dicot split. In addition, expression analysis using RNA-seq in various tissues and developmental stages of cultivated tomato and the wild relative Solanum pimpinellifolium revealed that most of these genes (83% were expressed in at least one stage from at least one genotype. Out of 42 genes, 4 genes were expressed constitutively in almost all the tissues analyzed, implying that these genes might have specific housekeeping function in tomato cell under normal growth conditions. Two SlHsp20 genes displayed differential expression levels between cultivated tomato and S. pimpinellifolium in vegetative (leaf and root and reproductive organs (floral bud and flower, suggesting inter-species diversification for functional specialization during the process of domestication. Based on genome-wide microarray analysis, we showed that the transcript

  14. Genome-Wide Identification and Expression Profiling of Tomato Hsp20 Gene Family in Response to Biotic and Abiotic Stresses.

    Science.gov (United States)

    Yu, Jiahong; Cheng, Yuan; Feng, Kun; Ruan, Meiying; Ye, Qingjing; Wang, Rongqing; Li, Zhimiao; Zhou, Guozhi; Yao, Zhuping; Yang, Yuejian; Wan, Hongjian

    2016-01-01

    The Hsp20 genes are involved in the response of plants to environment stresses including heat shock and also play a vital role in plant growth and development. They represent the most abundant small heat shock proteins (sHsps) in plants, but little is known about this family in tomato (Solanum lycopersicum), an important vegetable crop in the world. Here, we characterized heat shock protein 20 (SlHsp20) gene family in tomato through integration of gene structure, chromosome location, phylogenetic relationship, and expression profile. Using bioinformatics-based methods, we identified at least 42 putative SlHsp20 genes in tomato. Sequence analysis revealed that most of SlHsp20 genes possessed no intron or a relatively short intron in length. Chromosome mapping indicated that inter-arm and intra-chromosome duplication events contributed remarkably to the expansion of SlHsp20 genes. Phylogentic tree of Hsp20 genes from tomato and other plant species revealed that SlHsp20 genes were grouped into 13 subfamilies, indicating that these genes may have a common ancestor that generated diverse subfamilies prior to the mono-dicot split. In addition, expression analysis using RNA-seq in various tissues and developmental stages of cultivated tomato and the wild relative Solanum pimpinellifolium revealed that most of these genes (83%) were expressed in at least one stage from at least one genotype. Out of 42 genes, 4 genes were expressed constitutively in almost all the tissues analyzed, implying that these genes might have specific housekeeping function in tomato cell under normal growth conditions. Two SlHsp20 genes displayed differential expression levels between cultivated tomato and S. pimpinellifolium in vegetative (leaf and root) and reproductive organs (floral bud and flower), suggesting inter-species diversification for functional specialization during the process of domestication. Based on genome-wide microarray analysis, we showed that the transcript levels of SlHsp20

  15. Molecular analysis of the NDP gene in two families with Norrie disease.

    Science.gov (United States)

    Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

    2005-04-01

    To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

  16. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  17. Bringing Value-Based Perspectives to Care: Including Patient and Family Members in Decision-Making Processes

    Directory of Open Access Journals (Sweden)

    Graeme Kohler

    2017-11-01

    Full Text Available n a gap in consistent application of system-level strategies that can effectively translate organizational policies around patient and family engagement into practice. Methods The broad objective of this initiative was to develop a system-level implementation strategy to include patient and family advisors (PFAs at decision-making points in primary healthcare (PHC based on wellestablished evidence and literature. In this opportunity sponsored by the Canadian Foundation for Healthcare Improvement (CFHI a co-design methodology, also well-established was applied in identifying and developing a suitable implementation strategy to engage PFAs as members of quality teams in PHC. Diabetes management centres (DMCs was selected as the pilot site to develop the strategy. Key steps in the process included review of evidence, review of the current state in PHC through engagement of key stakeholders and a co-design approach. Results The project team included a diverse representation of members from the PHC system including patient advisors, DMC team members, system leads, providers, Public Engagement team members and CFHI improvement coaches. Key outcomes of this 18-month long initiative included development of a working definition of patient and family engagement, development of a Patient and Family Engagement Resource Guide and evaluation of the resource guide. Conclusion This novel initiative provided us an opportunity to develop a supportive system-wide implementation plan and a strategy to include PFAs in decision-making processes in PHC. The well-established co-design methodology further allowed us to include value-based (customer driven quality and experience of care perspectives of several important stakeholders including patient advisors. The next step will be to implement the strategy within DMCs, spread the strategy PHC, both locally and provincially with a focus on sustainability.

  18. Phylogeny and historical biogeography of the cocosoid palms (Arecaceae, Arecoideae, Cocoseae) inferred from sequences of six WRKY gene family loci

    Science.gov (United States)

    Arecaceae tribe Cocoseae is the most economically important tribe of palms, including both coconut and African oil palm. It is mostly represented in the Neotropics, with one and two genera endemic to South Africa and Madagascar, respectively. Using primers for six single copy WRKY gene family loci...

  19. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  20. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  1. Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

    Science.gov (United States)

    Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong

    2016-04-01

    Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. No linkage and association of atopy to chromosome 16 including the interleukin-4 receptor gene

    DEFF Research Database (Denmark)

    Haagerup, A; Bjerke, T; Schiøtz, P O

    2001-01-01

    BACKGROUND: Several susceptibility genes for atopy have been suggested in recent years. Few have been investigated as intensively as the interleukin-4-receptor alpha (IL4Ralpha) gene on chromosome 16. The results remain in dispute. Therefore, in a robust design, we tested for association of type ...

  3. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  4. batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor.

    Science.gov (United States)

    Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L

    2003-02-01

    Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

  5. The lipoxygenase gene family: a genomic fossil of shared polyploidy between Glycine max and Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Choi Beom-Soon

    2008-12-01

    Full Text Available Abstract Background Soybean lipoxygenases (Lxs play important roles in plant resistance and in conferring the distinct bean flavor. Lxs comprise a multi-gene family that includes GmLx1, GmLx2 and GmLx3, and many of these genes have been characterized. We were interested in investigating the relationship between the soybean lipoxygenase isozymes from an evolutionary perspective, since soybean has undergone two rounds of polyploidy. Here we report the tetrad genome structure of soybean Lx regions produced by ancient and recent polyploidy. Also, comparative genomics with Medicago truncatula was performed to estimate Lxs in the common ancestor of soybean and Medicago. Results Two Lx regions in Medicago truncatula showing synteny with soybean were analyzed. Differential evolutionary rates between soybean and Medicago were observed and the median Ks values of Mt-Mt, Gm-Mt, and Gm-Gm paralogs were determined to be 0.75, 0.62, and 0.46, respectively. Thus the comparison of Gm-Mt paralogs (Ks = 0.62 and Gm-Mt orthologs (Ks = 0.45 supports the ancient duplication of Lx regions in the common ancestor prior to the Medicago-Glycine split. After speciation, no Lx regions generated by another polyploidy were identified in Medicago. Instead tandem duplication of Lx genes was observed. On the other hand, a lineage-specific duplication occurred in soybean resulting in two pairs of Lx regions. Each pair of soybean regions was co-orthologous to one Lx region in Medicago. A total of 34 Lx genes (15 MtLxs and 19 GmLxs were divided into two groups by phylogenetic analysis. Our study shows that the Lx gene family evolved from two distinct Lx genes in the most recent common ancestor. Conclusion This study analyzed two pairs of Lx regions generated by two rounds of polyploidy in soybean. Each pair of soybean homeologous regions is co-orthologous to one region of Medicago, demonstrating the quartet structure of the soybean genome. Differential evolutionary rates between

  6. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  7. Characterization of cytokinin signaling and homeostasis gene families in two hardwood tree species: Populus trichocarpa and Prunus persica.

    Science.gov (United States)

    Immanen, Juha; Nieminen, Kaisa; Duchens Silva, Héctor; Rodríguez Rojas, Fernanda; Meisel, Lee A; Silva, Herman; Albert, Victor A; Hvidsten, Torgeir R; Helariutta, Ykä

    2013-12-16

    Through the diversity of cytokinin regulated processes, this phytohormone has a profound impact on plant growth and development. Cytokinin signaling is involved in the control of apical and lateral meristem activity, branching pattern of the shoot, and leaf senescence. These processes influence several traits, including the stem diameter, shoot architecture, and perennial life cycle, which define the development of woody plants. To facilitate research about the role of cytokinin in regulation of woody plant development, we have identified genes associated with cytokinin signaling and homeostasis pathways from two hardwood tree species. Taking advantage of the sequenced black cottonwood (Populus trichocarpa) and peach (Prunus persica) genomes, we have compiled a comprehensive list of genes involved in these pathways. We identified genes belonging to the six families of cytokinin oxidases (CKXs), isopentenyl transferases (IPTs), LONELY GUY genes (LOGs), two-component receptors, histidine containing phosphotransmitters (HPts), and response regulators (RRs). All together 85 Populus and 45 Prunus genes were identified, and compared to their Arabidopsis orthologs through phylogenetic analyses. In general, when compared to Arabidopsis, differences in gene family structure were often seen in only one of the two tree species. However, one class of genes associated with cytokinin signal transduction, the CKI1-like family of two-component histidine kinases, was larger in both Populus and Prunus than in Arabidopsis.

  8. A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

    Directory of Open Access Journals (Sweden)

    Hewitt Jane E

    2010-11-01

    Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

  9. Transferrin Family Genes in the Brown Planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) in Response to Three Insecticides.

    Science.gov (United States)

    Wu, Shun-Fan; Li, Jian; Zhang, Yong; Gao, Cong-Fen

    2018-02-09

    Transferrins are involved in iron metabolism, immunity, xenobiotics tolerance, and development in eukaryotic organisms including insects. However, little is known about the relationship between transferrins and insecticide toxicology and resistance. Three transferrin family genes, NlTsf1, NlTsf2, and NlTsf3, of the brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae)a major insect pest of rice field in Asia, had been identified and characterized in this study. Quantitative polymerase chain reaction results demonstrated that NlTsf1 was significantly higher than the other two genes in different tissues. All of them were expressed at higher levels in abdomen and head than in antenna, leg, stylet, and thorax. Compared with the control, the expression of three N. lugens transferrin family genes decreased dramatically 24 h after treatment with buprofezin, pymetrozine and imidacloprid. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  10. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  11. Professionals' positive perceptions of fathers are associated with more favourable attitudes towards including them in family interventions.

    Science.gov (United States)

    de Montigny, Francine; Gervais, Christine; Meunier, Sophie; Dubeau, Diane

    2017-12-01

    This Université du Québec en Outaouais study examined professionals' attitudes towards fathers, their perceived self-efficacy when working with them and their perceptions of the importance of including fathers in family interventions. Professionals in Québec, Canada, working in childcare fields such as education, social services, health, community services and management answered a self-report questionnaire between 2013 and 2015. The 296 respondents (90% females) had a mean age of 39 (20-65), were from urban, semi-urban and rural settings and provided services to families with children up to five years of age. Social service professionals perceived fathers more negatively than did other professionals. Even though male professionals perceived fathers more negatively, they felt more confident working with them than did their female counterparts. Positive perceptions of fathers were associated with more favourable attitudes towards including them in family interventions, and this association was mediated by the professionals' perceptions of their own self-efficacy. The most negative attitudes were reported by social service professionals. Male professionals viewed fathers more negatively but were more confident working with them than were female colleagues. Improving professionals' perceptions of fathers could help to promote their inclusion in family interventions. ©2017 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  12. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  13. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  14. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  15. Comprehensive analysis of the soybean (Glycine max GmLAX auxin transporter gene family

    Directory of Open Access Journals (Sweden)

    Chenglin eChai

    2016-03-01

    Full Text Available The phytohormone auxin plays a critical role in regulation of plant growth and development as well as plant responses to abiotic stresses. This is mainly achieved through its uneven distribution in plants via a polar auxin transport process. Auxin transporters are major players in polar auxin transport. The AUXIN RESISTANT 1 ⁄ LIKE AUX1 (AUX⁄LAX auxin influx carriers belong to the amino acid permease family of proton-driven transporters and function in the uptake of indole-3-acetic acid (IAA. In this study, genome-wide comprehensive analysis of the soybean AUX⁄LAX (GmLAX gene family, including phylogenic relationships, chromosome localization, and gene structure, were carried out. A total of 15 GmLAX genes, including seven duplicated gene pairs, were identified in the soybean genome. They were distributed on 10 chromosomes. Despite their higher percentage identities at the protein level, GmLAXs exhibited versatile tissue-specific expression patterns, indicating coordinated functioning during plant growth and development. Most GmLAXs were responsive to drought and dehydration stresses and auxin and abscisic acid (ABA stimuli, in a tissue- and/or time point- sensitive mode. Several GmLAX members were involved in responding to salt stress. Sequence analysis revealed that promoters of GmLAXs contained different combinations of stress-related cis-regulatory elements. These studies suggest that the soybean GmLAXs were under control of a very complex regulatory network, responding to various internal and external signals. This study helps to identity candidate GmLAXs for further analysis of their roles in soybean development and adaption to adverse environments.

  16. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    International Nuclear Information System (INIS)

    Vanderslice, P.; Ballinger, S.M.; Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H.

    1990-01-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the ∼1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family

  17. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  18. Integrative Analysis of Gene Expression Data Including an Assessment of Pathway Enrichment for Predicting Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Pingzhao Hu

    2006-01-01

    Full Text Available Background: Microarray technology has been previously used to identify genes that are differentially expressed between tumour and normal samples in a single study, as well as in syntheses involving multiple studies. When integrating results from several Affymetrix microarray datasets, previous studies summarized probeset-level data, which may potentially lead to a loss of information available at the probe-level. In this paper, we present an approach for integrating results across studies while taking probe-level data into account. Additionally, we follow a new direction in the analysis of microarray expression data, namely to focus on the variation of expression phenotypes in predefined gene sets, such as pathways. This targeted approach can be helpful for revealing information that is not easily visible from the changes in the individual genes. Results: We used a recently developed method to integrate Affymetrix expression data across studies. The idea is based on a probe-level based test statistic developed for testing for differentially expressed genes in individual studies. We incorporated this test statistic into a classic random-effects model for integrating data across studies. Subsequently, we used a gene set enrichment test to evaluate the significance of enriched biological pathways in the differentially expressed genes identified from the integrative analysis. We compared statistical and biological significance of the prognostic gene expression signatures and pathways identified in the probe-level model (PLM with those in the probeset-level model (PSLM. Our integrative analysis of Affymetrix microarray data from 110 prostate cancer samples obtained from three studies reveals thousands of genes significantly correlated with tumour cell differentiation. The bioinformatics analysis, mapping these genes to the publicly available KEGG database, reveals evidence that tumour cell differentiation is significantly associated with many

  19. Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

    Directory of Open Access Journals (Sweden)

    Srivastava Satish

    2003-07-01

    Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

  20. Adverse events in families with hypertrophic or dilated cardiomyopathy and mutations in the MYBPC3 gene

    Directory of Open Access Journals (Sweden)

    Lehrke Stephanie

    2008-10-01

    Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.

  1. CRDB: database of chemosensory receptor gene families in vertebrate.

    Directory of Open Access Journals (Sweden)

    Dong Dong

    Full Text Available Chemosensory receptors (CR are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of 'birth-and-death' evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates.

  2. Clinical and molecular analysis of the enamelin gene ENAM in Colombian families with autosomal dominant amelogenesis imperfecta

    Directory of Open Access Journals (Sweden)

    Sandra Gutiérrez

    2012-01-01

    Full Text Available In this study, we analyzed the phenotype, clinical characteristics and presence of mutations in the enamelin gene ENAM in five Colombian families with autosomal dominant amelogenesis imperfecta (ADAI. 22 individuals (15 affected and seven unaffected belonging to five Colombian families with ADAI and eight individuals (three affected and five unaffected belonging to three Colombian families with autosomal recessive amelogenesis imperfecta (ARAI that served as controls for molecular alterations and inheritance patterns were studied. Clinical, radiographic and genetic evaluations were done in all individuals. Eight exons and three intron-exon boundaries were sequenced for mutation analysis. Two of the five families with ADAI had the hypoplasic phenotype, two had the hypocalcified phenotype and one had the hypomaturative phenotype. Anterior open bite and mandibular retrognathism were the most frequent skeletal abnormalities in the families with ADAI. No mutations were found. These findings suggest that ADAI in these Colombian families was unrelated to previously described mutations in the ENAM gene. These results also indicate that other regions not included in this investigation, such as the promoter region, introns and other genes should be considered as potential ADAI candidates.

  3. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  4. Repeat-associated plasticity in the Helicobacter pylori RD gene family.

    Science.gov (United States)

    Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

    2009-11-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

  5. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  6. The NAC transcription factor family in maritime pine (Pinus Pinaster): molecular regulation of two genes involved in stress responses.

    Science.gov (United States)

    Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción

    2015-10-24

    NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.

  7. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  8. The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

    Directory of Open Access Journals (Sweden)

    Daniel Menendez

    2011-03-01

    Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

  9. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

  10. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    Madhu Sudhan

    2007-03-29

    Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...

  11. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  12. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    Science.gov (United States)

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  13. Cephamycins, a New Family of β-Lactam Antibiotics I. Production by Actinomycetes, Including Streptomyces lactamdurans sp. n1

    Science.gov (United States)

    Stapley, E. O.; Jackson, M.; Hernandez, S.; Zimmerman, S. B.; Currie, S. A.; Mochales, S.; Mata, J. M.; Woodruff, H. B.; Hendlin, D.

    1972-01-01

    A number of actinomycetes isolated from soil were found to produce one or more members of a new family of antibiotics, the cephamycins, which are structurally related to cephalosporin C. The cephamycins were produced in submerged fermentation in a wide variety of media by one or more of eight different species of Streptomyces, including a newly described species, S. lactamdurans. These antibiotics exhibit antibacterial activity against a broad spectrum of bacteria which includes many that are resistant to the cephalosporins and penicillins. PMID:4790552

  14. Bringing Value-Based Perspectives to Care: Including Patient and Family Members in Decision-Making Processes.

    Science.gov (United States)

    Kohler, Graeme; Sampalli, Tara; Ryer, Ashley; Porter, Judy; Wood, Les; Bedford, Lisa; Higgins-Bowser, Irene; Edwards, Lynn; Christian, Erin; Dunn, Susan; Gibson, Rick; Ryan Carson, Shannon; Vallis, Michael; Zed, Joanna; Tugwell, Barna; Van Zoost, Colin; Canfield, Carolyn; Rivoire, Eleanor

    2017-03-06

    Recent evidence shows that patient engagement is an important strategy in achieving a high performing healthcare system. While there is considerable evidence of implementation initiatives in direct care context, there is limited investigation of implementation initiatives in decision-making context as it relates to program planning, service delivery and developing policies. Research has also shown a gap in consistent application of system-level strategies that can effectively translate organizational policies around patient and family engagement into practice. The broad objective of this initiative was to develop a system-level implementation strategy to include patient and family advisors (PFAs) at decision-making points in primary healthcare (PHC) based on wellestablished evidence and literature. In this opportunity sponsored by the Canadian Foundation for Healthcare Improvement (CFHI) a co-design methodology, also well-established was applied in identifying and developing a suitable implementation strategy to engage PFAs as members of quality teams in PHC. Diabetes management centres (DMCs) was selected as the pilot site to develop the strategy. Key steps in the process included review of evidence, review of the current state in PHC through engagement of key stakeholders and a co-design approach. The project team included a diverse representation of members from the PHC system including patient advisors, DMC team members, system leads, providers, Public Engagement team members and CFHI improvement coaches. Key outcomes of this 18-month long initiative included development of a working definition of patient and family engagement, development of a Patient and Family Engagement Resource Guide and evaluation of the resource guide. This novel initiative provided us an opportunity to develop a supportive system-wide implementation plan and a strategy to include PFAs in decision-making processes in PHC. The well-established co-design methodology further allowed us to

  15. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  16. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  17. The Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.: Bioinformatic Analysis and Expression Patterns

    Directory of Open Access Journals (Sweden)

    Yazhong eJin

    2016-05-01

    Full Text Available Alcohol dehydrogenases (ADH, encoded by multigene family in plants, play a critical role in plant growth, development, adaptation, fruit ripening and aroma production. Thirteen ADH genes were identified in melon genome, including 12 ADHs and one formaldehyde dehydrogenease (FDH, designated CmADH1-12 and CmFDH1, in which CmADH1 and CmADH2 have been isolated in Cantaloupe. ADH genes shared a lower identity with each other at the protein level and had different intron-exon structure at nucleotide level. No typical signal peptides were found in all CmADHs, and CmADH proteins might locate in the cytoplasm. The phylogenetic tree revealed that 13 ADH genes were divided into 3 groups respectively, namely long-, medium- and short-chain ADH subfamily, and CmADH1,3-11, which belongs to the medium-chain ADH subfamily, fell into 6 medium-chain ADH subgroups. CmADH12 may belong to the long-chain ADH subfamily, while CmFDH1 may be a Class III ADH and serve as an ancestral ADH in melon. Expression profiling revealed that CmADH1, CmADH2, CmADH10 and CmFDH1 were moderately or strongly expressed in different vegetative tissues and fruit at medium and late developmental stages, while CmADH8 and CmADH12 were highly expressed in fruit after 20 days. CmADH3 showed preferential expression in young tissues. CmADH4 only had slight expression in root. Promoter analysis revealed several motifs of CmADH genes involved in the gene expression modulated by various hormones, and the response pattern of CmADH genes to ABA, IAA and ethylene were different. These CmADHs were divided into ethylene-sensitive and –insensitive groups, and the functions of CmADHs were discussed.

  18. Use of an activated beta-catenin to identify Wnt pathway target genes in caenorhabditis elegans, including a subset of collagen genes expressed in late larval development.

    Science.gov (United States)

    Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M

    2014-04-16

    The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.

  19. Targeted Enrichment of Large Gene Families for Phylogenetic Inference: Phylogeny and Molecular Evolution of Photosynthesis Genes in the Portullugo Clade (Caryophyllales).

    Science.gov (United States)

    Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J

    2018-05-01

    Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.

  20. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  1. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  2. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  3. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  4. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

    Science.gov (United States)

    Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

    2012-04-01

    Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

  5. a photoreceptor gene mutation in an indigenous black african family

    African Journals Online (AJOL)

    MUTATION IN AN INDIGENOUS. BLACK AFRICAN FAMILY WITH. RETINITIS PIGMENTOSA. IDENTIFIED USING A RAPID. SCREENING APPROACH FOR. COMMON RHODOPSIN. MUTATIONS. JGreenberg, T Franz, R Goliath, R Ramesar. Hereditary retinal degenerations may be subdivided into those affecting ...

  6. Gene-ontology enrichment analysis in two independent family-based samples highlights biologically plausible processes for autism spectrum disorders.

    LENUS (Irish Health Repository)

    Anney, Richard J L

    2012-02-01

    Recent genome-wide association studies (GWAS) have implicated a range of genes from discrete biological pathways in the aetiology of autism. However, despite the strong influence of genetic factors, association studies have yet to identify statistically robust, replicated major effect genes or SNPs. We apply the principle of the SNP ratio test methodology described by O\\'Dushlaine et al to over 2100 families from the Autism Genome Project (AGP). Using a two-stage design we examine association enrichment in 5955 unique gene-ontology classifications across four groupings based on two phenotypic and two ancestral classifications. Based on estimates from simulation we identify excess of association enrichment across all analyses. We observe enrichment in association for sets of genes involved in diverse biological processes, including pyruvate metabolism, transcription factor activation, cell-signalling and cell-cycle regulation. Both genes and processes that show enrichment have previously been examined in autistic disorders and offer biologically plausibility to these findings.

  7. [Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

    Science.gov (United States)

    Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-05-01

    The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

  8. Identification of the WRKY gene family and functional analysis of two genes in Caragana intermedia.

    Science.gov (United States)

    Wan, Yongqing; Mao, Mingzhu; Wan, Dongli; Yang, Qi; Yang, Feiyun; Mandlaa; Li, Guojing; Wang, Ruigang

    2018-02-09

    WRKY transcription factors, one of the largest families of transcriptional regulators in plants, play important roles in plant development and various stress responses. The WRKYs of Caragana intermedia are still not well characterized, although many WRKYs have been identified in various plant species. We identified 53 CiWRKY genes from C. intermedia transcriptome data, 28 of which exhibited complete open reading frames (ORFs). These CiWRKYs were divided into three groups via phylogenetic analysis according to their WRKY domains and zinc finger motifs. Conserved domain analysis showed that the CiWRKY proteins contain a highly conserved WRKYGQK motif and two variant motifs (WRKYGKK and WKKYEEK). The subcellular localization of CiWRKY26 and CiWRKY28-1 indicated that these two proteins localized exclusively to nuclei, supporting their role as transcription factors. The expression patterns of the 28 CiWRKYs with complete ORFs were examined through quantitative real-time PCR (qRT-PCR) in various tissues and under different abiotic stresses (drought, cold, salt, high-pH and abscisic acid (ABA)). The results showed that each CiWRKY responded to at least one stress treatment. Furthermore, overexpression of CiWRKY75-1 and CiWRKY40-4 in Arabidopsis thaliana suppressed the drought stress tolerance of the plants and delayed leaf senescence, respectively. Fifty-three CiWRKY genes from the C. intermedia transcriptome were identified and divided into three groups via phylogenetic analysis. The expression patterns of the 28 CiWRKYs under different abiotic stresses suggested that each CiWRKY responded to at least one stress treatment. Overexpression of CiWRKY75-1 and CiWRKY40-4 suppressed the drought stress tolerance of Arabidopsis and delayed leaf senescence, respectively. These results provide a basis for the molecular mechanism through which CiWRKYs mediate stress tolerance.

  9. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  10. High proportion of genetic cases in patients with advanced cardiomyopathy including a novel homozygous Plakophilin 2-gene mutation.

    Directory of Open Access Journals (Sweden)

    Baerbel Klauke

    Full Text Available Cardiomyopathies might lead to end-stage heart disease with the requirement of drastic treatments like bridging up to transplant or heart transplantation. A not precisely known proportion of these diseases are genetically determined. We genotyped 43 index-patients (30 DCM, 10 ARVC, 3 RCM with advanced or end stage cardiomyopathy using a gene panel which covered 46 known cardiomyopathy disease genes. Fifty-three variants with possible impact on disease in 33 patients were identified. Of these 27 (51% were classified as likely pathogenic or pathogenic in the MYH7, MYL2, MYL3, NEXN, TNNC1, TNNI3, DES, LMNA, PKP2, PLN, RBM20, TTN, and CRYAB genes. Fifty-six percent (n = 24 of index-patients carried a likely pathogenic or pathogenic mutation. Of these 75% (n = 18 were familial and 25% (n = 6 sporadic cases. However, severe cardiomyopathy seemed to be not characterized by a specific mutation profile. Remarkably, we identified a novel homozygous PKP2-missense variant in a large consanguineous family with sudden death in early childhood and several members with heart transplantation in adolescent age.

  11. carboxylate synthase gene family in Arabidopsis, rice, grapevine

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

  12. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  13. Germline heterozygous variants in genes associated with familial hemophagocytic lymphohistiocytosis as a cause of increased bleeding

    DEFF Research Database (Denmark)

    Fager Ferrari, Marcus; Leinoe, Eva; Rossing, Maria

    2018-01-01

    Familial hemophagocytic lymphohistiocytosis (FHL) is caused by biallelic variants in genes regulating granule secretion in cytotoxic lymphocytes. In FHL3-5, the affected genes UNC13D, STX11 and STXBP2 have further been shown to regulate the secretion of platelet granules, giving rise to compromised...

  14. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  15. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  16. Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

    DEFF Research Database (Denmark)

    Riess, O; Weber, B; Nørremølle, Anne

    1992-01-01

    as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

  17. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  18. Genome-Wide Analysis of the Musa WRKY Gene Family: Evolution and Differential Expression during Development and Stress.

    Science.gov (United States)

    Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H

    2016-01-01

    The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.

  19. Genome-wide analysis of the Musa WRKY gene family: evolution and differential expression during development and stress

    Directory of Open Access Journals (Sweden)

    Ridhi eGoel

    2016-03-01

    Full Text Available The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/ development including fruit ripening process respectively.

  20. Identification of Two Disease-causing Genes TJP2 and GJB2 in a Chinese Family with Unconditional Autosomal Dominant Nonsyndromic Hereditary Hearing Impairment

    Directory of Open Access Journals (Sweden)

    Hong-Yang Wang

    2015-01-01

    Full Text Available Background: There are more than 300 genetic loci that have been found to be related to hereditary hearing impairment (HHI, including 92 causative genes for nonsyndromic hearing loss, among which 34 genes are related to autosomal dominant nonsyndromic HHI (ADNSHHI. Traditional linkage analysis and candidate gene sequencing are not effective at detecting the ADNSHHI, especially for the unconditional families that may have more than one pathogenic cause. This study identified two disease-causing genes TJP2 and GJB2 in a Chinese family with unconditional ADNSHHI. Methods: To decipher the genetic code of a Chinese family (family 686 with ADNSHHI, different gene screening techniques have been performed, including linkage analysis, candidate genes screening, high-throughput sequencing and Sanger sequencing. These techniques were done on samples obtained from this family over a period of 10 years. Results: We identified a pathogenic missense mutation, c. 2081G>A (p.G694E, in TJP2, a gene that plays a crucial role in apoptosis and age-related hearing loss (ARHL. The mutation was co-segregated in this pedigree in all, but not in the two patients who presented with different phenotypes from the other affected family members. In one of the two patients, we confirmed that the compound heterozygosity for p.Y136FNx01 and p.G45E in the GJB2 gene may account for the phenotype shown in this patient. Conclusions: We identified the co-occurrence of two genetic causes in family 686. The possible disease-causing missense mutation of TJP2 in family 686 presents an opportunity for further investigation into ARHL. It is necessary to combine various genes screening methods, especially for some unconventional cases.

  1. Characterization of resistance gene analogues (RGAs in apple (Malus × domestica Borkh. and their evolutionary history of the Rosaceae family.

    Directory of Open Access Journals (Sweden)

    Michele Perazzolli

    Full Text Available The family of resistance gene analogues (RGAs with a nucleotide-binding site (NBS domain accounts for the largest number of disease resistance genes and is one of the largest gene families in plants. We have identified 868 RGAs in the genome of the apple (Malus × domestica Borkh. cultivar 'Golden Delicious'. This represents 1.51% of the total number of predicted genes for this cultivar. Several evolutionary features are pronounced in M. domestica, including a high fraction (80% of RGAs occurring in clusters. This suggests frequent tandem duplication and ectopic translocation events. Of the identified RGAs, 56% are located preferentially on six chromosomes (Chr 2, 7, 8, 10, 11, and 15, and 25% are located on Chr 2. TIR-NBS and non-TIR-NBS classes of RGAs are primarily exclusive of different chromosomes, and 99% of non-TIR-NBS RGAs are located on Chr 11. A phylogenetic reconstruction was conducted to study the evolution of RGAs in the Rosaceae family. More than 1400 RGAs were identified in six species based on their NBS domain, and a neighbor-joining analysis was used to reconstruct the phylogenetic relationships among the protein sequences. Specific phylogenetic clades were found for RGAs of Malus, Fragaria, and Rosa, indicating genus-specific evolution of resistance genes. However, strikingly similar RGAs were shared in Malus, Pyrus, and Prunus, indicating high conservation of specific RGAs and suggesting a monophyletic origin of these three genera.

  2. Characterization of Resistance Gene Analogues (RGAs) in Apple (Malus × domestica Borkh.) and Their Evolutionary History of the Rosaceae Family

    Science.gov (United States)

    Baldo, Angela; Righetti, Laura; Bailey, Aubrey; Fontana, Paolo; Velasco, Riccardo; Malnoy, Mickael

    2014-01-01

    The family of resistance gene analogues (RGAs) with a nucleotide-binding site (NBS) domain accounts for the largest number of disease resistance genes and is one of the largest gene families in plants. We have identified 868 RGAs in the genome of the apple (Malus × domestica Borkh.) cultivar ‘Golden Delicious’. This represents 1.51% of the total number of predicted genes for this cultivar. Several evolutionary features are pronounced in M. domestica, including a high fraction (80%) of RGAs occurring in clusters. This suggests frequent tandem duplication and ectopic translocation events. Of the identified RGAs, 56% are located preferentially on six chromosomes (Chr 2, 7, 8, 10, 11, and 15), and 25% are located on Chr 2. TIR-NBS and non-TIR-NBS classes of RGAs are primarily exclusive of different chromosomes, and 99% of non-TIR-NBS RGAs are located on Chr 11. A phylogenetic reconstruction was conducted to study the evolution of RGAs in the Rosaceae family. More than 1400 RGAs were identified in six species based on their NBS domain, and a neighbor-joining analysis was used to reconstruct the phylogenetic relationships among the protein sequences. Specific phylogenetic clades were found for RGAs of Malus, Fragaria, and Rosa, indicating genus-specific evolution of resistance genes. However, strikingly similar RGAs were shared in Malus, Pyrus, and Prunus, indicating high conservation of specific RGAs and suggesting a monophyletic origin of these three genera. PMID:24505246

  3. Characterization of resistance gene analogues (RGAs) in apple (Malus × domestica Borkh.) and their evolutionary history of the Rosaceae family.

    Science.gov (United States)

    Perazzolli, Michele; Malacarne, Giulia; Baldo, Angela; Righetti, Laura; Bailey, Aubrey; Fontana, Paolo; Velasco, Riccardo; Malnoy, Mickael

    2014-01-01

    The family of resistance gene analogues (RGAs) with a nucleotide-binding site (NBS) domain accounts for the largest number of disease resistance genes and is one of the largest gene families in plants. We have identified 868 RGAs in the genome of the apple (Malus × domestica Borkh.) cultivar 'Golden Delicious'. This represents 1.51% of the total number of predicted genes for this cultivar. Several evolutionary features are pronounced in M. domestica, including a high fraction (80%) of RGAs occurring in clusters. This suggests frequent tandem duplication and ectopic translocation events. Of the identified RGAs, 56% are located preferentially on six chromosomes (Chr 2, 7, 8, 10, 11, and 15), and 25% are located on Chr 2. TIR-NBS and non-TIR-NBS classes of RGAs are primarily exclusive of different chromosomes, and 99% of non-TIR-NBS RGAs are located on Chr 11. A phylogenetic reconstruction was conducted to study the evolution of RGAs in the Rosaceae family. More than 1400 RGAs were identified in six species based on their NBS domain, and a neighbor-joining analysis was used to reconstruct the phylogenetic relationships among the protein sequences. Specific phylogenetic clades were found for RGAs of Malus, Fragaria, and Rosa, indicating genus-specific evolution of resistance genes. However, strikingly similar RGAs were shared in Malus, Pyrus, and Prunus, indicating high conservation of specific RGAs and suggesting a monophyletic origin of these three genera.

  4. Genome-Wide Characterization and Expression Profiling of the AUXIN RESPONSE FACTOR (ARF) Gene Family in Eucalyptus grandis

    Science.gov (United States)

    Yu, Hong; Soler, Marçal; Mila, Isabelle; San Clemente, Hélène; Savelli, Bruno; Dunand, Christophe; Paiva, Jorge A. P.; Myburg, Alexander A.; Bouzayen, Mondher; Grima-Pettenati, Jacqueline; Cassan-Wang, Hua

    2014-01-01

    Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF) are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation. PMID:25269088

  5. Genome-wide characterization and expression profiling of the AUXIN RESPONSE FACTOR (ARF gene family in Eucalyptus grandis.

    Directory of Open Access Journals (Sweden)

    Hong Yu

    Full Text Available Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation.

  6. Characterization of the lipoxygenase (LOX) gene family in the Chinese white pear (Pyrus bretschneideri) and comparison with other members of the Rosaceae.

    Science.gov (United States)

    Li, Meng; Li, Leiting; Dunwell, Jim M; Qiao, Xin; Liu, Xing; Zhang, Shaoling

    2014-06-07

    Lipoxygenases (LOXs), a type of non-haem iron-containing dioxygenase, are ubiquitous enzymes in plants and participate in the formation of fruit aroma which is a very important aspect of fruit quality. Amongst the various aroma volatiles, saturated and unsaturated alcohols and aldehydes provide the characteristic aroma of the fruit. These compounds are formed from unsaturated fatty acids through oxidation, pyrolysis and reduction steps. This biosynthetic pathway involves at least four enzymes, including LOX, the enzyme responsible for lipid oxidation. Although some studies have been conducted on the LOX gene family in several species including Arabidopsis, soybean, cucumber and apple, there is no information from pear; and the evolutionary history of this gene family in the Rosaceae is still not resolved. In this study we identified 107 LOX homologous genes from five Rosaceous species (Pyrus bretschneideri, Malus × domestica, Fragaria vesca, Prunus mume and Prunus persica); 23 of these sequences were from pear. By using structure analysis, phylogenic analysis and collinearity analysis, we identified variation in gene structure and revealed the phylogenetic evolutionary relationship of this gene family. Expression of certain pear LOX genes during fruit development was verified by analysis of transcriptome data. 23 LOX genes were identified in pear and these genes were found to have undergone a duplication 30-45 MYA; most of these 23 genes are functional. Specific gene duplication was found on chromosome4 in the pear genome. Useful information was provided for future research on the evolutionary history and transgenic research on LOX genes.

  7. The PIN gene family in cotton (Gossypium hirsutum): genome-wide identification and gene expression analyses during root development and abiotic stress responses.

    Science.gov (United States)

    He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui

    2017-07-03

    Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.

  8. Cloning of synthetic gene including antigens against Urinary Tract Infections in pET28a+ vector

    Directory of Open Access Journals (Sweden)

    Zohreh Haghri

    2017-12-01

    Full Text Available There are many different bacterial infections in the world that patients are suffering from and research teams are trying to find suitable ways to prevent and treat them. Urinary Tract Infections (UTIs are most important infections in the world , and they are more common among women because vaginal cavity is near to urethral opening. The aim of this study is cloning of synthetic gene include antigens against UTIs in pET28a+ vector. Antibiotic resistant has been increasing because of antibiotic overuse recently, so It shows the necessity of developing a vaccine against these infections. There for, it will be imperative to develop a vaccine instead of antibiotics. This infection causes by many organisms, most important of which are Uropathogenic Escherichia coli (UPEC, Proteus mirabilis and Klebsiella pneumoniae Uropathogenic Escherichia .coli is the most important microorganism that causes these infections more than other bacteria, so in developing a vaccine it is the most important one, that have to be considered. The synthetic Gene which was designed against these three bacteria including antigens which are important and common to cause these infections. This gene has involved 1293bp. It was ordered to Gene Ray Biotechnology. Primers were designed by Gene Runner. Gene and pET28a+ vector was checked by SnappGene. Synthetic gene was multiplied by PCR and cloned in pET28a+ vector. Construct was transformed into E. coli TOP10.The clone was confirmed by PCR, Digestion. This data indicates that this gene can be expressed and it might be a vaccine candidate to protect people from these infections in the future.

  9. Interleukin-6 Gene Promoter Polymorphisms and Cardiovascular Risk Factors. A family study

    Directory of Open Access Journals (Sweden)

    Iris Paola Guzmán-Guzmán

    2010-01-01

    Full Text Available Interleukin-6 (IL-6 is a cytokine involved in inflammatory process, as well as in glucose and lipid metabolism. Several studies of the biological relevance of IL-6 gene polymorphisms have indicated a relationship with cardiovascular disease. The aim of this study was to assess whether the –174 G/C and –572 G/C of IL-6 gene polymorphisms are associated with cardiovascular risk factors in Mexican families. Ninety members of 30 Mexican families, in which an index case (proband had obesity, were included in the study. We evaluated the body composition by bioelectrical impedance. Peripheral blood samples were collected to determine biochemical and hematological parameters. High sensitivity C- reactive protein levels were measurement for nephelometric analysis. Screening for both polymorphisms studied was performed by PCR-RFLP. In the parents, both polymorphisms were in Hardy-Weinberg's equilibrium. The genotypes –174 GC/CC were associated with T2D (OR = 1.23, IC95% 1.01–1.5 and highest levels of hsCRP (p = 0.02, whereas genotype –572 GG was associated with T2D (OR = 1.24, IC95% 1.04–1.47 with an inflammatory state determined by the increase in the leukocyte count (OR = 1.24, IC95% 1.02–1.51. The genotypes –174 GC/CC and –572 GG may confer susceptibility for the development of subclinical inflammation and type 2 diabetes in Mexican families.

  10. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  11. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  12. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  13. Multi-gene phylogeny of jacks and pompanos (Carangidae), including placement of monotypic vadigo Campogramma glaycos.

    Science.gov (United States)

    Damerau, M; Freese, M; Hanel, R

    2018-01-01

    In this study, the phylogenetic trees of jacks and pompanos (Carangidae), an ecologically and morphologically diverse, globally distributed fish family, are inferred from a complete, concatenated data set of two mitochondrial (cytochrome c oxidase I, cytochrome b) loci and one nuclear (myosin heavy chain 6) locus. Maximum likelihood and Bayesian inferences are largely congruent and show a clear separation of Carangidae into the four subfamilies: Scomberoidinae, Trachinotinae, Naucratinae and Caranginae. The inclusion of the carangid sister lineages Coryphaenidae (dolphinfishes) and Rachycentridae (cobia), however, render Carangidae paraphyletic. The phylogenetic trees also show with high statistical support that the monotypic vadigo Campogramma glaycos is the sister to all other species within the Naucratinae. © 2017 The Fisheries Society of the British Isles.

  14. Genome-wide identification and functional analysis of the TIFY gene family in response to drought in cotton.

    Science.gov (United States)

    Zhao, Ge; Song, Yun; Wang, Caixiang; Butt, Hamama Islam; Wang, Qianhua; Zhang, Chaojun; Yang, Zuoren; Liu, Zhao; Chen, Eryong; Zhang, Xueyan; Li, Fuguang

    2016-12-01

    Jasmonates control many aspects of plant biological processes. They are important for regulating plant responses to various biotic and abiotic stresses, including drought, which is one of the most serious threats to sustainable agricultural production. However, little is known regarding how jasmonate ZIM-domain (JAZ) proteins mediate jasmonic acid signals to improve stress tolerance in cotton. This represents the first comprehensive comparative study of TIFY transcription factors in both diploid A, D and tetraploid AD cotton species. In this study, we identified 21 TIFY family members in the genome of Gossypium arboretum, 28 members from Gossypium raimondii and 50 TIFY genes in Gossypium hirsutum. The phylogenetic analyses indicated the TIFY gene family could be divided into the following four subfamilies: TIFY, PPD, ZML, and JAZ subfamilies. The cotton TIFY genes have expanded through tandem duplications and segmental duplications compared with other plant species. Gene expression profile revealed temporal and tissue specificities for TIFY genes under simulated drought conditions in Gossypium arboretum. The JAZ subfamily members were the most highly expressed genes, suggesting that they have a vital role in responses to drought stress. Over-expression of GaJAZ5 gene decreased water loss, stomatal openings, and the accumulation of H 2 O 2 in Arabidopsis thaliana. Additionally, the results of drought tolerance assays suggested that this subfamily might be involved in increasing drought tolerance. Our study provides new data regarding the genome-wide analysis of TIFY gene families and their important roles in drought tolerance in cotton species. These data may form the basis of future studies regarding the relationship between drought and jasmonic acid.

  15. Genome-Wide Identification, Phylogenetic and Expression Analyses of the Ubiquitin-Conjugating Enzyme Gene Family in Maize

    Science.gov (United States)

    Jue, Dengwei; Sang, Xuelian; Lu, Shengqiao; Dong, Chen; Zhao, Qiufang; Chen, Hongliang; Jia, Liqiang

    2015-01-01

    Background Ubiquitination is a post-translation modification where ubiquitin is attached to a substrate. Ubiquitin-conjugating enzymes (E2s) play a major role in the ubiquitin transfer pathway, as well as a variety of functions in plant biological processes. To date, no genome-wide characterization of this gene family has been conducted in maize (Zea mays). Methodology/Principal Findings In the present study, a total of 75 putative ZmUBC genes have been identified and located in the maize genome. Phylogenetic analysis revealed that ZmUBC proteins could be divided into 15 subfamilies, which include 13 ubiquitin-conjugating enzymes (ZmE2s) and two independent ubiquitin-conjugating enzyme variant (UEV) groups. The predicted ZmUBC genes were distributed across 10 chromosomes at different densities. In addition, analysis of exon-intron junctions and sequence motifs in each candidate gene has revealed high levels of conservation within and between phylogenetic groups. Tissue expression analysis indicated that most ZmUBC genes were expressed in at least one of the tissues, indicating that these are involved in various physiological and developmental processes in maize. Moreover, expression profile analyses of ZmUBC genes under different stress treatments (4°C, 20% PEG6000, and 200 mM NaCl) and various expression patterns indicated that these may play crucial roles in the response of plants to stress. Conclusions Genome-wide identification, chromosome organization, gene structure, evolutionary and expression analyses of ZmUBC genes have facilitated in the characterization of this gene family, as well as determined its potential involvement in growth, development, and stress responses. This study provides valuable information for better understanding the classification and putative functions of the UBC-encoding genes of maize. PMID:26606743

  16. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  17. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  18. A novel mutation in two Hmong families broadens the range of STRA6-related malformations to include contractures and camptodactyly.

    Science.gov (United States)

    Marcadier, Julien L; Mears, Alan J; Woods, Elizabeth A; Fisher, Jamie; Airheart, Cory; Qin, Wen; Beaulieu, Chandree L; Dyment, David A; Innes, A Micheil; Curry, Cynthia J

    2016-01-01

    PDAC (also termed Matthew Wood) syndrome is a rare, autosomal recessive disorder characterized by pulmonary hypoplasia/aplasia, diaphragmatic defects, bilateral anophthalmia, and cardiac malformations. The disorder is caused by mutations in STRA6, an important regulator of vitamin A and retinoic acid metabolism. We describe six cases from four families of Hmong ancestry, seen over a 30 years period in California. These include: (i) consanguineous siblings with a combination of bilateral anophthalmia, diaphragmatic abnormalities, truncus arteriosus, and/or pulmonary agenesis/hypoplasia; (ii) a singleton fetus with bilateral anophthalmia, pulmonary agenesis, cardiac malformation, and renal hypoplasia; (iii) a sibling pair with a combination of antenatal contractures, camptodactyly, fused palpebral fissures, pulmonary agenesis, and/or truncus arteriosus; (iv) a fetus with bilateral anophthalmia, bushy eyebrows, pulmonary agenesis, heart malformation, and abnormal hand positioning. The phenotypic spectrum of PDAC syndrome has until now not included contractures or camptodactyly. Sequencing of STRA6 in unrelated members of families three and four identified a novel, shared homozygous splice site alteration (c.113 + 3_4delAA) that is predicted to be pathogenic. We hypothesize this may represent a unique disease allele in the Hmong. We also provide a focused review of all published PDAC syndrome cases with confirmed or inferred STRA6 mutations, illustrating the phenotypic and molecular variability that characterizes this disorder. © 2015 Wiley Periodicals, Inc.

  19. Full-Length Sequence of Mouse Acupuncture-Induced 1-L (Aig1l Gene Including Its Transcriptional Start Site

    Directory of Open Access Journals (Sweden)

    Mika Ohta

    2011-01-01

    Full Text Available We have been investigating the molecular efficacy of electroacupuncture (EA, which is one type of acupuncture therapy. In our previous molecular biological study of acupuncture, we found an EA-induced gene, named acupuncture-induced 1-L (Aig1l, in mouse skeletal muscle. The aims of this study consisted of identification of the full-length cDNA sequence of Aig1l including the transcriptional start site, determination of the tissue distribution of Aig1l and analysis of the effect of EA on Aig1l gene expression. We determined the complete cDNA sequence including the transcriptional start site via cDNA cloning with the cap site hunting method. We then analyzed the tissue distribution of Aig1l by means of northern blot analysis and real-time quantitative polymerase chain reaction. We used the semiquantitative reverse transcriptase-polymerase chain reaction to examine the effect of EA on Aig1l gene expression. Our results showed that the complete cDNA sequence of Aig1l was 6073 bp long, and the putative protein consisted of 962 amino acids. All seven tissues that we analyzed expressed the Aig1l gene. In skeletal muscle, EA induced expression of the Aig1l gene, with high expression observed after 3 hours of EA. Our findings thus suggest that the Aig1l gene may play a key role in the molecular mechanisms of EA efficacy.

  20. The majority of genes in the pathogenic Neisseria species are present in non-pathogenic Neisseria lactamica, including those designated as 'virulence genes'

    Directory of Open Access Journals (Sweden)

    Saunders Nigel J

    2006-05-01

    Full Text Available Abstract Background Neisseria meningitidis causes the life-threatening diseases meningococcal meningitis and meningococcal septicemia. Neisseria gonorrhoeae is closely related to the meningococcus, but is the cause of the very different infection, gonorrhea. A number of genes have been implicated in the virulence of these related yet distinct pathogens, but the genes that define and differentiate the species and their behaviours have not been established. Further, a related species, Neisseria lactamica is not associated with either type of infection in normally healthy people, and lives as a harmless commensal. We have determined which of the genes so far identified in the genome sequences of the pathogens are also present in this non-pathogenic related species. Results Thirteen unrelated strains of N. lactamica were investigated using comparative genome hybridization to the pan-Neisseria microarray-v2, which contains 2845 unique gene probes. The presence of 127 'virulence genes' was specifically addressed; of these 85 are present in N. lactamica. Of the remaining 42 'virulence genes' only 11 are present in all four of the sequenced pathogenic Neisseria. Conclusion Assessment of the complete dataset revealed that the vast majority of genes present in the pathogens are also present in N. lactamica. Of the 1,473 probes to genes shared by all four pathogenic genome sequences, 1,373 hybridize to N. lactamica. These shared genes cannot include genes that are necessary and sufficient for the virulence of the pathogens, since N. lactamica does not share this behaviour. This provides an essential context for the interpretation of gene complement studies of the pathogens.

  1. Diverse expression of sucrose transporter gene family in Zea mays

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... In this study, we identified four sucrose transporter genes. (ZmSUT1 .... strand synthesis was done with forward and reverse primers designed at .... Qazi H. A., Paranjpe S. and Bhargava S. 2012 Stem sugar accu- mulation in ...

  2. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S; Larsen, Line H G; Johannesen, Katrine M

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis o...

  3. Genetic diversity of bitter taste receptor gene family in Sichuan ...

    Indian Academy of Sciences (India)

    Previous research had revealed that chicken has only three bitter taste receptor genes (Tas2r1, ... Journal of Genetics, DOI 10.1007/s12041-016-0684-4, Vol. ..... between red-winged blackbirds and European starlings. ... Academic Press,.

  4. Phylogenomic analysis of UDP glycosyltransferase 1 multigene family in Linum usitatissimum identified genes with varied expression patterns

    Science.gov (United States)

    2012-01-01

    Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT) family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L.) is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT) genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT) genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N). Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST), microarray data and reverse transcription quantitative real time PCR (RT-qPCR). Seventy-three per cent of these genes (100 out of 137) showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot genomes indicated that

  5. Phylogenomic analysis of UDP glycosyltransferase 1 multigene family in Linum usitatissimum identified genes with varied expression patterns

    Directory of Open Access Journals (Sweden)

    Barvkar Vitthal T

    2012-05-01

    Full Text Available Abstract Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L. is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N. Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST, microarray data and reverse transcription quantitative real time PCR (RT-qPCR. Seventy-three per cent of these genes (100 out of 137 showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot

  6. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Science.gov (United States)

    Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

    2013-01-01

    As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  7. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Directory of Open Access Journals (Sweden)

    Joachim W Bargsten

    Full Text Available As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes. The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  8. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  9. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  10. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  11. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    Science.gov (United States)

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  13. Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

    Science.gov (United States)

    Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

    1992-01-01

    Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

  14. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  15. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  16. Isolation and Characterization of Vaccine Candidate Genes Including CSP and MSP1 in Plasmodium yoelii.

    Science.gov (United States)

    Kim, Seon-Hee; Bae, Young-An; Seoh, Ju-Young; Yang, Hyun-Jong

    2017-06-01

    Malaria is an infectious disease affecting humans, which is transmitted by the bite of Anopheles mosquitoes harboring sporozoites of parasitic protozoans belonging to the genus Plasmodium . Despite past achievements to control the protozoan disease, malaria still remains a significant health threat up to now. In this study, we cloned and characterized the full-unit Plasmodium yoelii genes encoding merozoite surface protein 1 (MSP1), circumsporozoite protein (CSP), and Duffy-binding protein (DBP), each of which can be applied for investigations to obtain potent protective vaccines in the rodent malaria model, due to their specific expression patterns during the parasite life cycle. Recombinant fragments corresponding to the middle and C-terminal regions of PyMSP1 and PyCSP, respectively, displayed strong reactivity against P. yoelii -infected mice sera. Specific native antigens invoking strong humoral immune response during the primary and secondary infections of P. yoelii were also abundantly detected in experimental ICR mice. The low or negligible parasitemia observed in the secondary infected mice was likely to result from the neutralizing action of the protective antibodies. Identification of these antigenic proteins might provide the necessary information and means to characterize additional vaccine candidate antigens, selected solely on their ability to produce the protective antibodies.

  17. I Have a Dream: Organic Movements Include Gene Manipulation to Improve Sustainable Farming

    Directory of Open Access Journals (Sweden)

    Gerhart U. Ryffel

    2017-03-01

    Full Text Available Several papers in a Special Issue of Sustainability have recently discussed various aspects to evaluate whether organic farming and gene manipulation are compatible. A special emphasis was given to new plant breeding techniques (NPBTs. These new approaches allow the most predictable genetic alterations of crop plants in ways that the genetically modified plant is identical to a plant generated by conventional breeding. The articles of the Special Issue present the arguments pro and contra the inclusion of the plants generated by NPBTs in organic farming. Organic movements have not yet made a final decision whether some of these techniques should be accepted or banned. In my view these novel genetically manipulated (GM crops could be used in such a way as to respect the requirements for genetically manipulated organisms (GMOs formulated by the International Federation of Organic Movements (IFOAM. Reviewing the potential benefits of disease-resistant potatoes and bananas, it seems possible that these crops support organic farming. To this end, I propose specific requirements that the organic movements should proactively formulate as their standards to accept specific GM crops.

  18. Gene expression profiling in the stress control brain region hypothalamic paraventricular nucleus reveals a novel gene network including Amyloid beta Precursor Protein

    Directory of Open Access Journals (Sweden)

    Deussing Jan M

    2010-10-01

    Full Text Available Abstract Background The pivotal role of stress in the precipitation of psychiatric diseases such as depression is generally accepted. This study aims at the identification of genes that are directly or indirectly responding to stress. Inbred mouse strains that had been evidenced to differ in their stress response as well as in their response to antidepressant treatment were chosen for RNA profiling after stress exposure. Gene expression and regulation was determined by microarray analyses and further evaluated by bioinformatics tools including pathway and cluster analyses. Results Forced swimming as acute stressor was applied to C57BL/6J and DBA/2J mice and resulted in sets of regulated genes in the paraventricular nucleus of the hypothalamus (PVN, 4 h or 8 h after stress. Although the expression changes between the mouse strains were quite different, they unfolded in phases over time in both strains. Our search for connections between the regulated genes resulted in potential novel signalling pathways in stress. In particular, Guanine nucleotide binding protein, alpha inhibiting 2 (GNAi2 and Amyloid β (A4 precursor protein (APP were detected as stress-regulated genes, and together with other genes, seem to be integrated into stress-responsive pathways and gene networks in the PVN. Conclusions This search for stress-regulated genes in the PVN revealed its impact on interesting genes (GNAi2 and APP and a novel gene network. In particular the expression of APP in the PVN that is governing stress hormone balance, is of great interest. The reported neuroprotective role of this molecule in the CNS supports the idea that a short acute stress can elicit positive adaptational effects in the brain.

  19. A family-based association study identified CYP17 as a candidate gene for obesity susceptibility in Caucasians.

    Science.gov (United States)

    Yan, H; Guo, Y; Yang, T-L; Zhao, L-J; Deng, H-W

    2012-08-06

    The cytochrome P450c17α gene (CYP17) encodes a key biosynthesis enzyme of estrogen, which is critical in regulating adipogenesis and adipocyte development in humans. We therefore hypothesized that CYP17 is a candidate gene for predicting obesity. In order to test this hypothesis, we performed a family-based association test to investigate the relationship between the CYP17 gene and obesity phenotypes in a large sample comprising 1873 subjects from 405 Caucasian nuclear families of European origin recruited by the Osteoporosis Research Center of Creighton University, USA. Both single SNPs and haplotypes were tested for associations with obesity-related phenotypes, including body mass index (BMI) and fat mass. We identified three SNPs to be significantly associated with BMI, including rs3740397, rs6163, and rs619824. We further characterized the linkage disequilibrium structure for CYP17 and found that the whole CYP17 gene was located in a single-linkage disequilibrium block. This block was observed to be significantly associated with BMI. A major haplotype in this block was significantly associated with both BMI and fat mass. In conclusion, we suggest that the CYP17 gene has an effect on obesity in the Caucasian population. Further independent studies will be needed to confirm our findings.

  20. Targeted next generation sequencing identifies functionally deleterious germline mutations in novel genes in early-onset/familial prostate cancer.

    Directory of Open Access Journals (Sweden)

    Paula Paulo

    2018-04-01

    Full Text Available Considering that mutations in known prostate cancer (PrCa predisposition genes, including those responsible for hereditary breast/ovarian cancer and Lynch syndromes, explain less than 5% of early-onset/familial PrCa, we have sequenced 94 genes associated with cancer predisposition using next generation sequencing (NGS in a series of 121 PrCa patients. We found monoallelic truncating/functionally deleterious mutations in seven genes, including ATM and CHEK2, which have previously been associated with PrCa predisposition, and five new candidate PrCa associated genes involved in cancer predisposing recessive disorders, namely RAD51C, FANCD2, FANCI, CEP57 and RECQL4. Furthermore, using in silico pathogenicity prediction of missense variants among 18 genes associated with breast/ovarian cancer and/or Lynch syndrome, followed by KASP genotyping in 710 healthy controls, we identified "likely pathogenic" missense variants in ATM, BRIP1, CHEK2 and TP53. In conclusion, this study has identified putative PrCa predisposing germline mutations in 14.9% of early-onset/familial PrCa patients. Further data will be necessary to confirm the genetic heterogeneity of inherited PrCa predisposition hinted in this study.

  1. The Vein Patterning 1 (VEP1 gene family laterally spread through an ecological network.

    Directory of Open Access Journals (Sweden)

    Rosa Tarrío

    Full Text Available Lateral gene transfer (LGT is a major evolutionary mechanism in prokaryotes. Knowledge about LGT--particularly, multicellular--eukaryotes has only recently started to accumulate. A widespread assumption sees the gene as the unit of LGT, largely because little is yet known about how LGT chances are affected by structural/functional features at the subgenic level. Here we trace the evolutionary trajectory of VEin Patterning 1, a novel gene family known to be essential for plant development and defense. At the subgenic level VEP1 encodes a dinucleotide-binding Rossmann-fold domain, in common with members of the short-chain dehydrogenase/reductase (SDR protein family. We found: i VEP1 likely originated in an aerobic, mesophilic and chemoorganotrophic α-proteobacterium, and was laterally propagated through nets of ecological interactions, including multiple LGTs between phylogenetically distant green plant/fungi-associated bacteria, and five independent LGTs to eukaryotes. Of these latest five transfers, three are ancient LGTs, implicating an ancestral fungus, the last common ancestor of land plants and an ancestral trebouxiophyte green alga, and two are recent LGTs to modern embryophytes. ii VEP1's rampant LGT behavior was enabled by the robustness and broad utility of the dinucleotide-binding Rossmann-fold, which provided a platform for the evolution of two unprecedented departures from the canonical SDR catalytic triad. iii The fate of VEP1 in eukaryotes has been different in different lineages, being ubiquitous and highly conserved in land plants, whereas fungi underwent multiple losses. And iv VEP1-harboring bacteria include non-phytopathogenic and phytopathogenic symbionts which are non-randomly distributed with respect to the type of harbored VEP1 gene. Our findings suggest that VEP1 may have been instrumental for the evolutionary transition of green plants to land, and point to a LGT-mediated 'Trojan Horse' mechanism for the evolution of

  2. The role of IL-4 gene 70 bp VNTR and ACE gene I/D variants in Familial Mediterranean fever.

    Science.gov (United States)

    Yigit, Serbülent; Tural, Sengul; Tekcan, Akın; Tasliyurt, Turker; Inanir, Ahmet; Uzunkaya, Süheyla; Kismali, Gorkem

    2014-05-01

    Familial Mediterranean fever (FMF) is characterized by recurrent attacks of fever and inflammation in the peritoneum, synovium, or pleura, accompanied by pain. It is an autosomal recessive disease caused by mutations in the MEFV (MEditerranean FeVer) gene. Patients with similar genotypes exhibit phenotypic diversity. As a result, the variations in different genes could be responsible for the clinical findings of this disease. In previous studies genes encoding Angiotensin-Converting Enzyme (ACE) and IL-4 (Interleukin-4) were found to be associated with rheumatologic and autoimmune diseases. In the present study we hypothesized whether ACE I/D or IL-4 70 bp variable tandem repeats (VNTR) genes are associated with FMF and its clinical findings in Turkish patients. Genomic DNA obtained from 670 persons (339 patients with FMF and 331 healthy controls) was used in the study. Genotypes for an ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR were determined by polymerase chain reaction with specific primers. To our knowledge, this is the first study examining ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR polymorphism in FMF patients. As a result, there was a statistically significant difference between the groups with respect to genotype distribution (pACE gene DD genotype was associated with an increased risk in FMF [pACE genotype frequencies according to the clinical characteristics, we found a statistically significant association between DD+ID genotype and fever (p=0.04). In addition IL-4 gene P1P1 genotype was associated with FMF (pACE gene and P1 allele or P1P1 genotype of IL-4 gene may be important molecular markers for susceptibility of FMF. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  4. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  5. Structure, evolution and functional inference on the Mildew Locus O (MLO) gene family in three cultivated Cucurbitaceae spp.

    Science.gov (United States)

    Iovieno, Paolo; Andolfo, Giuseppe; Schiavulli, Adalgisa; Catalano, Domenico; Ricciardi, Luigi; Frusciante, Luigi; Ercolano, Maria Raffaella; Pavan, Stefano

    2015-12-29

    The powdery mildew disease affects thousands of plant species and arguably represents the major fungal threat for many Cucurbitaceae crops, including melon (Cucumis melo L.), watermelon (Citrullus lanatus L.) and zucchini (Cucurbita pepo L.). Several studies revealed that specific members of the Mildew Locus O (MLO) gene family act as powdery mildew susceptibility factors. Indeed, their inactivation, as the result of gene knock-out or knock-down, is associated with a peculiar form of resistance, referred to as mlo resistance. We exploited recently available genomic information to provide a comprehensive overview of the MLO gene family in Cucurbitaceae. We report the identification of 16 MLO homologs in C. melo, 14 in C. lanatus and 18 in C. pepo genomes. Bioinformatic treatment of data allowed phylogenetic inference and the prediction of several ortholog pairs and groups. Comparison with functionally characterized MLO genes and, in C. lanatus, gene expression analysis, resulted in the detection of candidate powdery mildew susceptibility factors. We identified a series of conserved amino acid residues and motifs that are likely to play a major role for the function of MLO proteins. Finally, we performed a codon-based evolutionary analysis indicating a general high level of purifying selection in the three Cucurbitaceae MLO gene families, and the occurrence of regions under diversifying selection in candidate susceptibility factors. Results of this study may help to address further biological questions concerning the evolution and function of MLO genes. Moreover, data reported here could be conveniently used by breeding research, aiming to select powdery mildew resistant cultivars in Cucurbitaceae.

  6. POWERDRESS and diversified expression of the MIR172 gene family bolster the floral stem cell network.

    Directory of Open Access Journals (Sweden)

    Rae Eden Yumul

    Full Text Available Termination of the stem cells in the floral meristem (also known as floral determinacy is critical for the reproductive success of plants, and the molecular activities regulating floral determinacy are precisely orchestrated during the course of floral development. In Arabidopsis thaliana, regulators of floral determinacy include several transcription factor genes, such as APETALA2 (AP2, AGAMOUS (AG, SUPERMAN (SUP, and CRABSCLAW (CRC, as well as a microRNA (miRNA, miR172, which targets AP2. How the transcription factor and miRNA genes are coordinately regulated to achieve floral determinacy is unknown. A mutation in POWERDRESS (PWR, a previously uncharacterized gene encoding a SANT-domain-containing protein, was isolated in this study as an enhancer of the weakly indeterminate ag-10 allele. PWR was found to promote the transcription of CRC, MIR172a, b, and c and/or enhance Pol II occupancy at their promoters, without affecting MIR172d or e. A mutation in mature miR172d was additionally found to enhance the determinacy defects of ag-10 in an AP2-dependent manner, providing direct evidence that miR172d is functional in repressing AP2 and thereby contributes to floral determinacy. Thus, while PWR promotes floral determinacy by enhancing the expression of three of the five MIR172 members as well as CRC, MIR172d, whose expression is PWR-independent, also functions in floral stem cell termination. Taken together, these findings demonstrate how transcriptional diversification and functional redundancy of a miRNA family along with PWR-mediated co-regulation of miRNA and transcription factor genes contribute to the robustness of the floral determinacy network.

  7. The Mycobacterium leprae antigen 85 complex gene family: identification of the genes for the 85A, 85C, and related MPT51 proteins

    NARCIS (Netherlands)

    Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.

    1993-01-01

    The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes

  8. GWAS of clinically defined gout and subtypes identifies multiple susceptibility loci that include urate transporter genes

    NARCIS (Netherlands)

    Nakayama, A.; Nakaoka, H.; Yamamoto, K.; Sakiyama, M.; Shaukat, A.; Toyoda, Y.; Okada, Y.; Kamatani, Y.; Nakamura, T.; Takada, T.; Inoue, K.; Yasujima, T.; Yuasa, H.; Shirahama, Y.; Nakashima, H.; Shimizu, S.; Higashino, T.; Kawamura, Y.; Ogata, H.; Kawaguchi, M.; Ohkawa, Y.; Danjoh, I.; Tokumasu, A.; Ooyama, K.; Ito, T.; Kondo, T.; Wakai, K.; Stiburkova, B.; Pavelka, K.; Stamp, L.K.; Dalbeth, N.; Sakurai, Y.; Suzuki, H; Hosoyamada, M.; Fujimori, S.; Yokoo, T.; Hosoya, T.; Inoue, I.; Takahashi, A.; Kubo, M.; Ooyama, H.; Shimizu, T.; Ichida, K.; Shinomiya, N.; Merriman, T.R.; Matsuo, H.; Andres, M; Joosten, L.A.; Janssen, M.C.H.; Jansen, T.L.; Liote, F.; Radstake, T.R.; Riches, P.L.; So, A.; Tauches, A.K.

    2017-01-01

    OBJECTIVE: A genome-wide association study (GWAS) of gout and its subtypes was performed to identify novel gout loci, including those that are subtype-specific. METHODS: Putative causal association signals from a GWAS of 945 clinically defined gout cases and 1213 controls from Japanese males were

  9. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  10. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  11. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  12. Zebrafish homologs of genes within 16p11.2, a genomic region associated with brain disorders, are active during brain development, and include two deletion dosage sensor genes

    Directory of Open Access Journals (Sweden)

    Alicia Blaker-Lee

    2012-11-01

    Deletion or duplication of one copy of the human 16p11.2 interval is tightly associated with impaired brain function, including autism spectrum disorders (ASDs, intellectual disability disorder (IDD and other phenotypes, indicating the importance of gene dosage in this copy number variant region (CNV. The core of this CNV includes 25 genes; however, the number of genes that contribute to these phenotypes is not known. Furthermore, genes whose functional levels change with deletion or duplication (termed ‘dosage sensors’, which can associate the CNV with pathologies, have not been identified in this region. Using the zebrafish as a tool, a set of 16p11.2 homologs was identified, primarily on chromosomes 3 and 12. Use of 11 phenotypic assays, spanning the first 5 days of development, demonstrated that this set of genes is highly active, such that 21 out of the 22 homologs tested showed loss-of-function phenotypes. Most genes in this region were required for nervous system development – impacting brain morphology, eye development, axonal density or organization, and motor response. In general, human genes were able to substitute for the fish homolog, demonstrating orthology and suggesting conserved molecular pathways. In a screen for 16p11.2 genes whose function is sensitive to hemizygosity, the aldolase a (aldoaa and kinesin family member 22 (kif22 genes were identified as giving clear phenotypes when RNA levels were reduced by ∼50%, suggesting that these genes are deletion dosage sensors. This study leads to two major findings. The first is that the 16p11.2 region comprises a highly active set of genes, which could present a large genetic target and might explain why multiple brain function, and other, phenotypes are associated with this interval. The second major finding is that there are (at least two genes with deletion dosage sensor properties among the 16p11.2 set, and these could link this CNV to brain disorders such as ASD and IDD.

  13. Genome-wide identification of sweet orange (Citrus sinensis) histone modification gene families and their expression analysis during the fruit development and fruit-blue mold infection process.

    Science.gov (United States)

    Xu, Jidi; Xu, Haidan; Liu, Yuanlong; Wang, Xia; Xu, Qiang; Deng, Xiuxin

    2015-01-01

    In eukaryotes, histone acetylation and methylation have been known to be involved in regulating diverse developmental processes and plant defense. These histone modification events are controlled by a series of histone modification gene families. To date, there is no study regarding genome-wide characterization of histone modification related genes in citrus species. Based on the two recent sequenced sweet orange genome databases, a total of 136 CsHMs (Citrus sinensis histone modification genes), including 47 CsHMTs (histone methyltransferase genes), 23 CsHDMs (histone demethylase genes), 50 CsHATs (histone acetyltransferase genes), and 16 CsHDACs (histone deacetylase genes) were identified. These genes were categorized to 11 gene families. A comprehensive analysis of these 11 gene families was performed with chromosome locations, phylogenetic comparison, gene structures, and conserved domain compositions of proteins. In order to gain an insight into the potential roles of these genes in citrus fruit development, 42 CsHMs with high mRNA abundance in fruit tissues were selected to further analyze their expression profiles at six stages of fruit development. Interestingly, a numbers of genes were expressed highly in flesh of ripening fruit and some of them showed the increasing expression levels along with the fruit development. Furthermore, we analyzed the expression patterns of all 136 CsHMs response to the infection of blue mold (Penicillium digitatum), which is the most devastating pathogen in citrus post-harvest process. The results indicated that 20 of them showed the strong alterations of their expression levels during the fruit-pathogen infection. In conclusion, this study presents a comprehensive analysis of the histone modification gene families in sweet orange and further elucidates their behaviors during the fruit development and the blue mold infection responses.

  14. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    Directory of Open Access Journals (Sweden)

    Tianyu Zhou

    2015-01-01

    Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

  16. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    Science.gov (United States)

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

  17. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  18. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  19. GWAS of clinically defined gout and subtypes identifies multiple susceptibility loci that include urate transporter genes

    OpenAIRE

    Nakayama, Akiyoshi; Nakaoka, Hirofumi; Yamamoto, Ken; Sakiyama, Masayuki; Shaukat, Amara; Toyoda, Yu; Okada, Yukinori; Kamatani, Yoichiro; Nakamura, Takahiro; Takada, Tappei; Inoue, Katsuhisa; Yasujima, Tomoya; Yuasa, Hiroaki; Shirahama, Yuko; Nakashima, Hiroshi

    2016-01-01

    Objective A genome-wide association study (GWAS) of gout and its subtypes was performed to identify novel gout loci, including those that are subtype-specific. Methods Putative causal association signals from a GWAS of 945 clinically defined gout cases and 1213 controls from Japanese males were replicated with 1396 cases and 1268 controls using a custom chip of 1961 single nucleotide polymorphisms (SNPs). We also first conducted GWASs of gout subtypes. Replication with Caucasian and New Zeala...

  20. AtTZF gene family localizes to cytoplasmic foci

    OpenAIRE

    Pomeranz, Marcelo; Lin, Pei-Chi; Finer, John; Jang, Jyan-Chyun

    2010-01-01

    In eukaryotes, mRNA turnover and translational repression represent important regulatory steps in gene expression. Curiously, when under cellular stresses, factors involved in these processes aggregate into cytoplasmic foci known as Processing bodies (P-bodies) and Stress Granules (SGs). In animals, CCCH Tandem Zinc Finger (TZF) proteins play important roles in mRNA decay within P-bodies. TTP, a P-body localized mammalian TZF, can bind to the 3'UTRs of mRNAs containing AU-rich elements (AREs)...

  1. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  2. Identification of a missense mutation in the tyrosinase gene in a Chinese family with oculocutaneous albinism type 1.

    Science.gov (United States)

    Lu, Qian; Yuan, Lamei; Xu, Hongbo; Huang, Xiangjun; Yang, Zhijian; Yi, Junhui; Ni, Bin; Chen, Yong; Deng, Hao

    2017-03-01

    Oculocutaneous albinism (OCA) is a group of heterogeneous and autosomal recessive disorders characterized by a reduction or complete loss of melanin biosynthesis in melanocytes. OCA type 1 (OCA1) is the most severe and common form of OCA, and is caused by mutations in the tyrosinase gene (TYR). The present study aimed to identify the genetic cause of OCA1 in a four‑generation consanguineous Chinese Han family. Complete physical examinations were performed and blood samples were collected from five members of the family and 100 unrelated healthy controls. Exome sequencing was conducted in the proband, followed by verification in other family members, using Sanger sequencing. Patients in the family presented with typical OCA1 features, including hypopigmentation of the skin and hair, and distinctive ocular changes. A homozygous missense variant, c.896G>A (p.R299H), in the TYR gene was identified in two patients, which co‑segregated with disease in the family. This variant was not present in the 100 healthy controls. These results expand the number of mutations identified to be responsible for OCA1 in the Chinese Han population, and may have implications for genetic counseling and clinical management of the disease.

  3. Generation Scotland: the Scottish Family Health Study; a new resource for researching genes and heritability

    Directory of Open Access Journals (Sweden)

    Ralston Stuart H

    2006-10-01

    Full Text Available Abstract Background Generation Scotland: the Scottish Family Health Study aims to identify genetic variants accounting for variation in levels of quantitative traits underlying the major common complex diseases (such as cardiovascular disease, cognitive decline, mental illness in Scotland. Methods/Design Generation Scotland will recruit a family-based cohort of up to 50,000 individuals (comprising siblings and parent-offspring groups across Scotland. It will be a six-year programme, beginning in Glasgow and Tayside in the first two years (Phase 1 before extending to other parts of Scotland in the remaining four years (Phase 2. In Phase 1, individuals aged between 35 and 55 years, living in the East and West of Scotland will be invited to participate, along with at least one (and preferably more siblings and any other first degree relatives aged 18 or over. The total initial sample size will be 15,000 and it is planned that this will increase to 50,000 in Phase 2. All participants will be asked to contribute blood samples from which DNA will be extracted and stored for future investigation. The information from the DNA, along with answers to a life-style and medical history questionnaire, clinical and biochemical measurements taken at the time of donation, and subsequent health developments over the life course (traced through electronic health records will be stored and used for research purposes. In addition, a detailed public consultation process will begin that will allow respondents' views to shape and develop the study. This is an important aspect to the research, and forms the continuation of a long-term parallel engagement process. Discussion As well as gene identification, the family-based study design will allow measurement of the heritability and familial aggregation of relevant quantitative traits, and the study of how genetic effects may vary by parent-of-origin. Long-term potential outcomes of this research include the targeting of

  4. Genome-wide analysis and identification of stress-responsive genes of the NAM-ATAF1,2-CUC2 transcription factor family in apple.

    Science.gov (United States)

    Su, Hongyan; Zhang, Shizhong; Yuan, Xiaowei; Chen, Changtian; Wang, Xiao-Fei; Hao, Yu-Jin

    2013-10-01

    NAC (NAM, ATAF1,2, and CUC2) proteins constitute one of the largest families of plant-specific transcription factors. To date, little is known about the NAC genes in the apple (Malus domestica). In this study, a total of 180 NAC genes were identified in the apple genome and were phylogenetically clustered into six groups (I-VI) with the NAC genes from Arabidopsis and rice. The predicted apple NAC genes were distributed across all of 17 chromosomes at various densities. Additionally, the gene structure and motif compositions of the apple NAC genes were analyzed. Moreover, the expression of 29 selected apple NAC genes was analyzed in different tissues and under different abiotic stress conditions. All of the selected genes, with the exception of four genes, were expressed in at least one of the tissues tested, which indicates that the NAC genes are involved in various aspects of the physiological and developmental processes of the apple. Encouragingly, 17 of the selected genes were found to respond to one or more of the abiotic stress treatments, and these 17 genes included not only the expected 7 genes that were clustered with the well-known stress-related marker genes in group IV but also 10 genes located in other subgroups, none of which contains members that have been reported to be stress-related. To the best of our knowledge, this report describes the first genome-wide analysis of the apple NAC gene family, and the results should provide valuable information for understanding the classification and putative functions of this family. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  5. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  6. Members of the HCMV US12 family of predicted heptaspanning membrane proteins have unique intracellular distributions, including association with the cytoplasmic virion assembly complex

    International Nuclear Information System (INIS)

    Das, Subhendu; Pellett, Philip E.

    2007-01-01

    The human cytomegalovirus (HCMV) US12 gene family is a group of 10 predicted seven-transmembrane domain proteins that have some features in common with G-protein-coupled receptors. Little is known of their patterns of expression, localization, or functional interactions. Here, we studied the intracellular localization of three US12 family members, US14, US17, and US18, with respect to various intracellular markers and the cytoplasmic virion assembly compartment (AC). The three proteins have distinct patterns of expression, which include associations with the AC. US14 is often distributed in a uniform granular manner throughout the cytoplasm, concentrating in the AC in some cells. US17 is expressed in a segmented manner, with its N-terminal domain localizing to the periphery of what we show here to be the AC and the C-terminal domain localizing to nuclei and the cytoplasm [Das, S., Skomorovska-Prokvolit, Y., Wang, F. Z., Pellett, P.E., 2006. Infection-dependent nuclear localization of US17, a member of the US12 family of human cytomegalovirus-encoded seven-transmembrane proteins. J. Virol. 80, 1191-1203]. Here, we show that the C-terminal domain is present at the center of the AC, in close association with markers of early endosomes; the N-terminal staining corresponds to an area stained by markers for the Golgi and trans-Golgi. US18 is distributed throughout the cytoplasm, concentrating in the AC at later stages of infection; it is localized more to the periphery of the AC than are US14 and US17C, in association with markers of the trans-Golgi. Although not detected in virions, their structures and localization in various zones within the AC suggest possible roles for these proteins in the process of virion maturation and egress

  7. BRCA1 and TP53 Gene-Mutations: Family Predisposition and Radioecological Risk of Developing Breast Cancer.

    Science.gov (United States)

    Apsalikov, Bakytbek; Manambaeva, Zukhra; Ospanov, Erlan; Massabayeva, Meruyert; Zhabagin, Kuantkan; Zhagiparova, Zhanar; Maximov, Vladymir; Voropaeva, Elena; Apsalikov, Kazbek; Belikhina, Tatiana; Abdrahmanov, Ramil; Cherepkova, Elena; Tanatarov, Sayat; Massadykov, Adilzhan; Urazalina, Naylia

    2016-01-01

    Frequencies of polymorphisms of genes BRCA1 and TP53 in breast cancer (BC) patients with a BC family history and radiation history were assessed and compared in the Semey region of Kazakhstan. The study included 60 women directly irradiated by the activities of the Semipalatinsk test site with a calculated effective equivalent dose of 500 mSv and their first generation descendants (group BC+Her+Exp); 65 women with family BC and absence of radiological history - the effective equivalent dose due to anthropogenic sources not exceeding 50 mSv (group BC+Her-Exp). The comparison group consisted of 65 women patients with breast cancer without family and radiological history (BC-Her-Exp). The control group comprised 60 women without breast cancer and without family and radiological history (nonBC). We carried out the genotyping of the polymorphisms c.2311T>C, c.4308T>C and 5382insC of the BRCA1 gene and rs1042522 of the TP53 gene. The frequency of the polymorphism c.2311T>C was significantly higher in patients of the group BC+Her+Exp than in healthy women, and of the polymorphism 5382insC in BC+Her+Exp compared to all other groups. The frequency of the rs1042522 polymorphism of TP53 was significantly higher in all groups of patients with breast cancer compared with the control group. Differences between groups of women with breast cancer were significant only in BC+Her+Exp vs. BC+Her-Exp. Combinations of polymorphisms of the genes BRCA1 and TP53 predominated in women with a family and radiological history.

  8. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes.

    Science.gov (United States)

    Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo

    2014-02-01

    The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  9. Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

    Directory of Open Access Journals (Sweden)

    Jakub Piotr Fichna

    Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

  10. Members of a large retroposon family are determinants of post-transcriptional gene expression in Leishmania.

    Directory of Open Access Journals (Sweden)

    Frédéric Bringaud

    2007-09-01

    Full Text Available Trypanosomatids are unicellular protists that include the human pathogens Leishmania spp. (leishmaniasis, Trypanosoma brucei (sleeping sickness, and Trypanosoma cruzi (Chagas disease. Analysis of their recently completed genomes confirmed the presence of non-long-terminal repeat retrotransposons, also called retroposons. Using the 79-bp signature sequence common to all trypanosomatid retroposons as bait, we identified in the Leishmania major genome two new large families of small elements--LmSIDER1 (785 copies and LmSIDER2 (1,073 copies--that fulfill all the characteristics of extinct trypanosomatid retroposons. LmSIDERs are approximately 70 times more abundant in L. major compared to T. brucei and are found almost exclusively within the 3'-untranslated regions (3'UTRs of L. major mRNAs. We provide experimental evidence that LmSIDER2 act as mRNA instability elements and that LmSIDER2-containing mRNAs are generally expressed at lower levels compared to the non-LmSIDER2 mRNAs. The considerable expansion of LmSIDERs within 3'UTRs in an organism lacking transcriptional control and their role in regulating mRNA stability indicate that Leishmania have probably recycled these short retroposons to globally modulate the expression of a number of genes. To our knowledge, this is the first example in eukaryotes of the domestication and expansion of a family of mobile elements that have evolved to fulfill a critical cellular function.

  11. Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

    Science.gov (United States)

    Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

    2014-01-01

    Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

  12. Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

    Science.gov (United States)

    Shastry, B S; Trese, M T

    2000-01-01

    Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

  13. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Directory of Open Access Journals (Sweden)

    Naoki Takata

    Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  14. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Science.gov (United States)

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  15. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  16. GWAS of clinically defined gout and subtypes identifies multiple susceptibility loci that include urate transporter genes.

    Science.gov (United States)

    Nakayama, Akiyoshi; Nakaoka, Hirofumi; Yamamoto, Ken; Sakiyama, Masayuki; Shaukat, Amara; Toyoda, Yu; Okada, Yukinori; Kamatani, Yoichiro; Nakamura, Takahiro; Takada, Tappei; Inoue, Katsuhisa; Yasujima, Tomoya; Yuasa, Hiroaki; Shirahama, Yuko; Nakashima, Hiroshi; Shimizu, Seiko; Higashino, Toshihide; Kawamura, Yusuke; Ogata, Hiraku; Kawaguchi, Makoto; Ohkawa, Yasuyuki; Danjoh, Inaho; Tokumasu, Atsumi; Ooyama, Keiko; Ito, Toshimitsu; Kondo, Takaaki; Wakai, Kenji; Stiburkova, Blanka; Pavelka, Karel; Stamp, Lisa K; Dalbeth, Nicola; Sakurai, Yutaka; Suzuki, Hiroshi; Hosoyamada, Makoto; Fujimori, Shin; Yokoo, Takashi; Hosoya, Tatsuo; Inoue, Ituro; Takahashi, Atsushi; Kubo, Michiaki; Ooyama, Hiroshi; Shimizu, Toru; Ichida, Kimiyoshi; Shinomiya, Nariyoshi; Merriman, Tony R; Matsuo, Hirotaka

    2017-05-01

    A genome-wide association study (GWAS) of gout and its subtypes was performed to identify novel gout loci, including those that are subtype-specific. Putative causal association signals from a GWAS of 945 clinically defined gout cases and 1213 controls from Japanese males were replicated with 1396 cases and 1268 controls using a custom chip of 1961 single nucleotide polymorphisms (SNPs). We also first conducted GWASs of gout subtypes. Replication with Caucasian and New Zealand Polynesian samples was done to further validate the loci identified in this study. In addition to the five loci we reported previously, further susceptibility loci were identified at a genome-wide significance level (pgout cases, and NIPAL1 and FAM35A for the renal underexcretion gout subtype. While NIPAL1 encodes a magnesium transporter, functional analysis did not detect urate transport via NIPAL1, suggesting an indirect association with urate handling. Localisation analysis in the human kidney revealed expression of NIPAL1 and FAM35A mainly in the distal tubules, which suggests the involvement of the distal nephron in urate handling in humans. Clinically ascertained male patients with gout and controls of Caucasian and Polynesian ancestries were also genotyped, and FAM35A was associated with gout in all cases. A meta-analysis of the three populations revealed FAM35A to be associated with gout at a genome-wide level of significance (p meta =3.58×10 -8 ). Our findings including novel gout risk loci provide further understanding of the molecular pathogenesis of gout and lead to a novel concept for the therapeutic target of gout/hyperuricaemia. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  17. Novel gene PUS3 c.A212G mutation in Ukrainian family with intellectual disability

    Directory of Open Access Journals (Sweden)

    Gulkovskyi R. V.

    2015-04-01

    Full Text Available Aim. To evaluate a possible role of a novel c.A212G substitution in the PUS3 gene at intellectual disability (ID. Methods. The observed group consisted of the ID Ukrainian family members (parents and two affected children and the control group – of 300 healthy individuals from general population of Ukraine. Sanger sequencing of the PUS3 gene exon 1 was performed for the family members. Polymorphic variants of c.A212G were analyzed using ARMS PCR. The homology models of wild type and p.Y71C mutant catalytic domains of human Pus3 were generated using the crystal structure of the human Pus1 catalytic domain (PDB ID: 4NZ6 as a template. Results. It was shown that the father of the affected siblings was the c.A212G substitution heterozygous carrier whereas the mother was a wild type allele homozygote, and the exom sequencing result was confirmed – the affected children are 212G homozygotes. We supposed de novo mutation in the maternal germ line. A low frequency of 212G allele (0.0017 was shown in the population of Ukraine. Homology modelling of the wild type and p.Y71C mutant catalytic domain of human Pus3 revealed that substitution p.Y71C is located in close proximity to its active site. Conclusions. The absence of hypoproteinemia in our patients, homozygous for the 212C allele allows us to assume that the mutation c.A212G PUS3 is rather neutral and cannot be the major cause of ID. However, considering a low frequency of the 212G allele in the population and close localization of p.Y71C substitution to the active site of hPus3 we cannot exclude that the c.A212G mutation in PUS3 may be a modifier for some pathologies including syndromic ID.

  18. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

    Science.gov (United States)

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

    2009-11-01

    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  19. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  20. The KDM5 family is required for activation of pro-proliferative cell cycle genes during adipocyte differentiation

    DEFF Research Database (Denmark)

    Brier, Ann-Sofie B; Loft, Anne; Madsen, Jesper G S

    2017-01-01

    The KDM5 family of histone demethylases removes the H3K4 tri-methylation (H3K4me3) mark frequently found at promoter regions of actively transcribed genes and is therefore generally considered to contribute to corepression. In this study, we show that knockdown (KD) of all expressed members...... of the KDM5 family in white and brown preadipocytes leads to deregulated gene expression and blocks differentiation to mature adipocytes. KDM5 KD leads to a considerable increase in H3K4me3 at promoter regions; however, these changes in H3K4me3 have a limited effect on gene expression per se. By contrast......, genome-wide analyses demonstrate that KDM5A is strongly enriched at KDM5-activated promoters, which generally have high levels of H3K4me3 and are associated with highly expressed genes. We show that KDM5-activated genes include a large set of cell cycle regulators and that the KDM5s are necessary...

  1. Multiple ETS family proteins regulate PF4 gene expression by binding to the same ETS binding site.

    Directory of Open Access Journals (Sweden)

    Yoshiaki Okada

    Full Text Available In previous studies on the mechanism underlying megakaryocyte-specific gene expression, several ETS motifs were found in each megakaryocyte-specific gene promoter. Although these studies suggested that several ETS family proteins regulate megakaryocyte-specific gene expression, only a few ETS family proteins have been identified. Platelet factor 4 (PF4 is a megakaryocyte-specific gene and its promoter includes multiple ETS motifs. We had previously shown that ETS-1 binds to an ETS motif in the PF4 promoter. However, the functions of the other ETS motifs are still unclear. The goal of this study was to investigate a novel functional ETS motif in the PF4 promoter and identify proteins binding to the motif. In electrophoretic mobility shift assays and a chromatin immunoprecipitation assay, FLI-1, ELF-1, and GABP bound to the -51 ETS site. Expression of FLI-1, ELF-1, and GABP activated the PF4 promoter in HepG2 cells. Mutation of a -51 ETS site attenuated FLI-1-, ELF-1-, and GABP-mediated transactivation of the promoter. siRNA analysis demonstrated that FLI-1, ELF-1, and GABP regulate PF4 gene expression in HEL cells. Among these three proteins, only FLI-1 synergistically activated the promoter with GATA-1. In addition, only FLI-1 expression was increased during megakaryocytic differentiation. Finally, the importance of the -51 ETS site for the activation of the PF4 promoter during physiological megakaryocytic differentiation was confirmed by a novel reporter gene assay using in vitro ES cell differentiation system. Together, these data suggest that FLI-1, ELF-1, and GABP regulate PF4 gene expression through the -51 ETS site in megakaryocytes and implicate the differentiation stage-specific regulation of PF4 gene expression by multiple ETS factors.

  2. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  3. New mutation of the MPZ gene in a family with the Dejerine-Sottas disease phenotype.

    Science.gov (United States)

    Floroskufi, Paraskewi; Panas, Marios; Karadima, Georgia; Vassilopoulos, Demetris

    2007-05-01

    Charcot-Marie-Tooth disease type 1B is associated with mutations in the myelin protein zero gene. In the present study a new myelin protein zero gene mutation (c.89T>C,Ile30Thr) was detected in a family with the Dejerine-Sottas disease phenotype. The results support the hypothesis that severe, early-onset neuropathy may be related to either an alteration of a conserved amino acid or a disruption of the tertiary structure of myelin protein zero.

  4. Genome-wide analysis of the GRAS gene family in Prunus mume.

    Science.gov (United States)

    Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

    2015-02-01

    Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

  5. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  6. Evolutionary study of vertebrate and invertebrate members of the dystrophin and utrophin gene family

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, R.G.; Nicholson, L.; Bobrow, M. [Paediatric Research Unit, London (United Kingdom)] [and others

    1994-09-01

    Vertebrates express two members of the dystrophin gene family. The prototype, dystrophin, is expressed in muscle and neural tissue, and is defective in the human disorders Duchenne and Becker muscular dystrophy (DMD, BMD). The dystrophin homologue utrophin is more generally expressed but has not yet been associated with a genetic disorder. The function of neither protein is clear. A comparison of human utrophin with the known dystrophins (human, mouse, chicken, Torpedo) suggests that dystrophin and utrophin diverged before the vertebrate radiation. We have used reverse-transcript PCR (RT-PCR) directed by degenerate primers to characterize dystrophin and utrophin transcripts from a range of vertebrate and invertebrate animals. Our results suggest that the duplication leading to distinct dystrophin and utrophin genes occurred close to the point of divergence of urochordates from the cephalochordate-vertebrate lineage. This divergence may have occurred to fulfill a novel role which arose at this point, or may reflect a need for separate regulation of the neuromuscular and other functions of the ancient dystrophin. Our data include sequences of the first non-human utrophins to be characterized, and show these to be substantially more divergent than their cognate dystrophins. In addition, our results provide a large body of information regarding the tolerance of amino acid positions in the cysteine-rich and C-terminal domains to substitution. This will aid the interpretations of DMD and BMD missense mutations in these regions.

  7. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum.

    Science.gov (United States)

    Broehan, Gunnar; Kroeger, Tobias; Lorenzen, Marcé; Merzendorfer, Hans

    2013-01-16

    The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control.

  8. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  9. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  10. Assembled Plastid and Mitochondrial Genomes, as well as Nuclear Genes, Place the Parasite Family Cynomoriaceae in the Saxifragales.

    Science.gov (United States)

    Bellot, Sidonie; Cusimano, Natalie; Luo, Shixiao; Sun, Guiling; Zarre, Shahin; Gröger, Andreas; Temsch, Eva; Renner, Susanne S

    2016-08-03

    Cynomoriaceae, one of the last unplaced families of flowering plants, comprise one or two species or subspecies of root parasites that occur from the Mediterranean to the Gobi Desert. Using Illumina sequencing, we assembled the mitochondrial and plastid genomes as well as some nuclear genes of a Cynomorium specimen from Italy. Selected genes were also obtained by Sanger sequencing from individuals collected in China and Iran, resulting in matrices of 33 mitochondrial, 6 nuclear, and 14 plastid genes and rDNAs enlarged to include a representative angiosperm taxon sampling based on data available in GenBank. We also compiled a new geographic map to discern possible discontinuities in the parasites' occurrence. Cynomorium has large genomes of 13.70-13.61 (Italy) to 13.95-13.76 pg (China). Its mitochondrial genome consists of up to 49 circular subgenomes and has an overall gene content similar to that of photosynthetic angiosperms, while its plastome retains only 27 of the normally 116 genes. Nuclear, plastid and mitochondrial phylogenies place Cynomoriaceae in Saxifragales, and we found evidence for several horizontal gene transfers from different hosts, as well as intracellular gene transfers. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Rapid expansion of the protein disulfide isomerase gene family facilitates the folding of venom peptides

    DEFF Research Database (Denmark)

    Safavi-Hemami, Helena; Li, Qing; Jackson, Ronneshia L.

    2016-01-01

    Formation of correct disulfide bonds in the endoplasmic reticulum is a crucial step for folding proteins destined for secretion. Protein disulfide isomerases (PDIs) play a central role in this process. We report a previously unidentified, hypervariable family of PDIs that represents the most...... diverse gene family of oxidoreductases described in a single genus to date. These enzymes are highly expressed specifically in the venom glands of predatory cone snails, animals that synthesize a remarkably diverse set of cysteine-rich peptide toxins (conotoxins). Enzymes in this PDI family, termed...

  12. The nuclear IκB family of proteins controls gene regulation and immune homeostasis.

    Science.gov (United States)

    MaruYama, Takashi

    2015-10-01

    The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.

    Science.gov (United States)

    Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan

    2015-09-08

    WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought

  14. N-Myc regulates expression of pluripotency genes in neuroblastoma including lif, klf2, klf4, and lin28b.

    Directory of Open Access Journals (Sweden)

    Rebecca Cotterman

    2009-06-01

    Full Text Available myc genes are best known for causing tumors when overexpressed, but recent studies suggest endogenous myc regulates pluripotency and self-renewal of stem cells. For example, N-myc is associated with a number of tumors including neuroblastoma, but also plays a central role in the function of normal neural stem and precursor cells (NSC. Both c- and N-myc also enhance the production of induced pluripotent stem cells (iPSC and are linked to neural tumor stem cells. The mechanisms by which myc regulates normal and neoplastic stem-related functions remain largely open questions. Here from a global, unbiased search for N-Myc bound genes using ChIP-chip assays in neuroblastoma, we found lif as a putative N-Myc bound gene with a number of strong N-Myc binding peaks in the promoter region enriched for E-boxes. Amongst putative N-Myc target genes in expression microarray studies in neuroblastoma we also found lif and three additional important embryonic stem cell (ESC-related factors that are linked to production of iPSC: klf2, klf4, and lin28b. To examine the regulation of these genes by N-Myc, we measured their expression using neuroblastoma cells that contain a Tet-regulatable N-myc transgene (TET21N as well as NSC with a nestin-cre driven N-myc knockout. N-myc levels closely correlated with the expression of all of these genes in neuroblastoma and all but lif in NSC. Direct ChIP assays also indicate that N-Myc directly binds the lif promoter. N-Myc regulates trimethylation of lysine 4 of histone H3 in the promoter of lif and possibly in the promoters of several other stem-related genes. Together these findings indicate that N-Myc regulates overlapping stem-related gene expression programs in neuroblastoma and NSC, supporting a novel model by which amplification of the N-myc gene may drive formation of neuroblastoma. They also suggest mechanisms by which Myc proteins more generally contribute to maintenance of pluripotency and self-renewal of ESC as

  15. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  16. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    Science.gov (United States)

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  17. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  18. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  19. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  20. The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization.

    Directory of Open Access Journals (Sweden)

    Qian Yan

    Full Text Available Basic/helix-loop-helix (bHLH proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum, a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062 showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus.

  1. A new polymorphic and multicopy MHC gene family related to nonmammalian class I

    Energy Technology Data Exchange (ETDEWEB)

    Leelayuwat, C.; Degli-Esposti, M.A.; Abraham, L.J. [Univ. of Western Australia, Perth (Australia); Townend, D.C. [Sir Charles Gairdner Hospital, Perth (Australia); Dawkins, R.L. [Royal Perth Hospital, Perth (Australia)]|[Univ. of Western Australia, Perth (Australia)]|[Sir Charles Gairdner Hospital, Perth (Australia)

    1994-12-31

    The authors have used genomic analysis to characterize a region of the central major histocompatibility complex (MHC) spanning {approximately} 300 kilobases (kb) between TNF and HLA-B. This region has been suggested to carry genetic factors relevant to the development of autoimmune diseases such as myasthenia gravis (MG) and insulin dependent diabetes mellitus (IDDM). Genomic sequence was analyzed for coding potential, using two neural network programs, GRAIL and GeneParser. A genomic probe, JAB, containing putative coding sequences (PERB11) located 60 kb centromeric of HLA-B, was used for northern analysis of human tissues. Multiple transcripts were detected. Southern analysis of genomic DNA and overlapping YAC clones, covering the region from BAT1 to HLA-F, indicated that there are at least five copies of PERB11, four of which are located within this region of the MHC. The partial cDNA sequence of PERB11 was obtained from poly-A RNA derived from skeletal muscle. The putative amino acid sequence of PERB11 shares {approximately} 30% identity to MHC class I molecules from various species, including reptiles, chickens, and frogs, as well as to other MHC class I-like molecules, such as the IgG FcR of the mouse and rat and the human Zn-{alpha}2-glycoprotein. From direct comparison of amino acid sequences, it is concluded that PERB11 is a distinct molecule more closely related to nonmammalian than known mammalian MHC class I molecules. Genomic sequence analysis of PERB11 from five MHC ancestral haplotypes (AH) indicated that the gene is polymorphic at both DNA and protein level. The results suggest that the authors have identified a novel polymorphic gene family with multiple copies within the MHC. 48 refs., 10 figs., 2 tabs.

  2. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  3. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    OpenAIRE

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

  4. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  5. Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

    Science.gov (United States)

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

    2013-02-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

  6. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  7. Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W

    2015-12-29

    GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

  8. Novel glucokinase gene mutation in the first Macedonian family tested for MODY.

    Science.gov (United States)

    Kocova, M; Elblova, L; Pruhova, S; Lebl, J; Dusatkova, P

    2017-08-01

    We present a boy with mild hyperglycemia detected during an upper respiratory infection. Novel splicing mutation in the intron 1 of the GCK gene (c.45+1G>A) was detected, and was subsequently confirmed in his father. This is the first case of genetically confirmed Macedonian family with MODY. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  10. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  11. The role of retrotransposons in gene family expansions in the human and mouse genomes

    Czech Academy of Sciences Publication Activity Database

    Janoušek, Václav; Laukaitis, C. M.; Yanchukov, Alexey; Karn, R. C.

    2016-01-01

    Roč. 8, č. 9 (2016), s. 2632-2650 ISSN 1759-6653 R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 Keywords : gene families * transposable elements * retrotransposons * LINE * LTR * SINE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.979, year: 2016

  12. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  13. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  14. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  15. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

    Science.gov (United States)

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

    2018-04-24

    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

  16. Genome-wide identification and characterization of stress-associated protein (SAP gene family encoding A20/AN1 zinc-finger proteins in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Zhou Yong

    2018-01-01

    Full Text Available Stress associated proteins (SAPs play important roles in developmental processes, responses to various stresses and hormone stimulation in plants. However, little is known about the SAP gene family in Medicago truncatula. In this study, a total of 17 MtSAP genes encoding A20/AN1 zinc-finger proteins were characterized. Out of these 17 genes, 15 were distributed over all 8 chromosomes at different densities, and two segmental duplication events were detected. The phylogenetic analysis of these proteins and their orthologs from Arabidopsis and rice suggested that they could be classified into five out of the seven groups of SAP family genes, with genes in the same group showing similar structures and conserved domains. The cis-elements of the MtSAP promoters were studied, and many cis-elements related to stress and plant hormone responses were identified. We also investigated the stress-responsive expression patterns of the MtSAP genes under various stresses, including drought, exposure to NaCl and cold. The qRT-PCR results showed that numerous MtSAP genes exhibited transcriptional responses to multiple abiotic stresses. These results lay the foundation for further functional characterization of SAP genes. To the best of our knowledge, this is the first report of a genome-wide analysis of the SAP gene family in M. truncatula.

  17. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  18. Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays

    Directory of Open Access Journals (Sweden)

    Toub Omid

    2010-10-01

    Full Text Available Abstract Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS were predicted by in silico analysis of the grapevine (Vitis vinifera genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information

  19. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    Science.gov (United States)

    Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

    2016-01-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

  20. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  1. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

  2. Genome-wide analysis of WRKY gene family in Cucumis sativus.

    Science.gov (United States)

    Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan

    2011-09-28

    WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.

  3. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  4. Genome-wide identification and characterization of WRKY gene family in peanut

    Directory of Open Access Journals (Sweden)

    Hui eSong

    2016-04-01

    Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  5. Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun

    2016-01-01

    WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  6. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  7. Heterozygous deletion at the SOX10 gene locus in two patients from a Chinese family with Waardenburg syndrome type II.

    Science.gov (United States)

    Wenzhi, He; Ruijin, Wen; Jieliang, Li; Xiaoyan, Ma; Haibo, Liu; Xiaoman, Wang; Jiajia, Xian; Shaoying, Li; Shuanglin, Li; Qing, Li

    2015-10-01

    Waardenburg syndrome (WS) is a rare disease characterized by sensorineural deafness and pigment disturbance. To date, almost 100 mutations have been reported, but few reports on cases with SOX10 gene deletion. The inheritance pattern of SOX10 gene deletion is still unclear. Our objective was to identify the genetic causes of Waardenburg syndrome type II in a two-generation Chinese family. Clinical evaluations were conducted in both of the patients. Microarray analysis and multiplex ligation-dependent probe amplification (MLPA) were performed to identify disease-related copy number variants (CNVs). DNA sequencing of the SOX10, MITF and SNAI2 genes was performed to identify the pathogenic mutation responsible for WS2. A 280kb heterozygous deletion at the 22q13.1 chromosome region (including SOX10) was detected in both of the patients. No mutation was found in the patients, unaffected family members and 30 unrelated healthy controls. This report is the first to describe SOX10 heterozygous deletions in Chinese WS2 patients. Our result conform the thesis that heterozygous deletions at SOX10 is an important pathogenicity for WS, and present as autosomal dominant inheritance. Nevertheless, heterozygous deletion of the SOX10 gene would be worth investigating to understand their functions and contributions to neurologic phenotypes. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Attenuated familial adenomatous polyposis and Muir-Torre syndrome linked to compound biallelic constitutional MYH gene mutations.

    Science.gov (United States)

    Ponti, G; Ponz de Leon, M; Maffei, S; Pedroni, M; Losi, L; Di Gregorio, C; Gismondi, V; Scarselli, A; Benatti, P; Roncari, B; Seidenari, S; Pellacani, G; Varotti, C; Prete, E; Varesco, L; Roncucci, L

    2005-11-01

    Attenuated familial adenomatous polyposis and Muir-Torre syndrome linked to compound biallelic constitutional MYH gene mutations.Peculiar dermatologic manifestations are present in several heritable gastrointestinal disorders. Muir-Torre syndrome (MTS) is a genodermatosis whose peculiar feature is the presence of sebaceous gland tumors associated with visceral malignancies. We describe one patient in whom multiple sebaceous gland tumors were associated with early onset colon and thyroid cancers and attenuated polyposis coli. Her family history was positive for colonic adenomas. She had a daughter presenting with yellow papules in the forehead region developed in the late infancy. Skin and visceral neoplasms were tested for microsatellite instability and immunohistochemical status of mismatch repair (MMR), APC and MYH proteins. The proband colon and skin tumors were microsatellite stable and showed normal expression of MMR proteins. Cytoplasmic expression of MYH protein was revealed in colonic cancer cells. Compound heterozygosity due to biallelic mutations in MYH, R168H and 379delC, was identified in the proband. The 11-year-old daughter was carrier of the monoallelic constitutional mutation 379delC in the MYH gene; in the sister, the R168H MYH gene mutation was detected. This report presents an interesting case of association between MYH-associated polyposis and sebaceous gland tumors. These findings suggest that patients with MTS phenotype that include colonic polyposis should be screened for MYH gene mutations.

  9. Novel and recurrent NDP gene mutations in familial cases of Norrie disease and X-linked exudative vitreoretinopathy.

    Science.gov (United States)

    Pelcastre, Erika L; Villanueva-Mendoza, Cristina; Zenteno, Juan C

    2010-05-01

    To present the results of molecular analysis of the NDP gene in Mexican families with Norrie disease (ND) and X-linked familial exudative vitreoretinopathy (XL-FEVR). Two unrelated families with ND and two with XL-FEVR were studied. Clinical diagnosis was suspected on the basis of a complete ophthalmologic examination. Molecular methods included DNA isolation from peripheral blood leucocytes, polymerase chain reaction amplification and direct nucleotide sequencing analysis of the complete coding region and exon-intron junctions of NDP. Haplotype analysis using NDP-linked microsatellites markers was performed in both ND families. A novel Norrin missense mutation, p.Arg41Thr, was identified in two apparently unrelated families with ND. Haplotype analysis demonstrated that affected males in these two families shared the same ND-linked haplotype, suggesting a common origin for this novel mutation. The previously reported p.Arg121Trp and p.Arg121Gln Norrin mutations were identified in the two families with XL-FEVR. Our results expand the mutational spectrum in ND. This is the first report of ND resulting from mutation at arginine position 41 of Norrin. Interestingly, mutations at the same residue but resulting in a different missense change were previously described in subjects with XL-FEVR (p.Arg41Lys) or persistent fetal vasculature syndrome (p.Arg41Ser), indicating that the novel p.Arg41Thr change causes a more severe retinal phenotype. Preliminary data suggest a founder effect for the ND p.Arg41Thr mutation in these two Mexican families.

  10. Differential evolution of members of the rhomboid gene family with conservative and divergent patterns.

    Science.gov (United States)

    Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong

    2015-04-01

    Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  11. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  12. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  13. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)

    1995-11-06

    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  14. The evolutionary history of the SAL1 gene family in eutherian mammals

    Directory of Open Access Journals (Sweden)

    Callebaut Isabelle

    2011-05-01

    Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.

  15. Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.

    Science.gov (United States)

    Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi

    2008-07-01

    Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.

  16. Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

    1995-12-01

    T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

  17. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  18. [Genome-wide identification and expression analysis of the WRKY gene family in peach].

    Science.gov (United States)

    Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long

    2016-03-01

    The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

  19. Genome-wide identification and expression analysis of the CIPK gene family in cassava

    Directory of Open Access Journals (Sweden)

    Wei eHu

    2015-10-01

    Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.

  20. Genome-Wide Identification and Transcriptome-Based Expression Profiling of the Sox Gene Family in the Nile Tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Wei, Ling; Yang, Chao; Tao, Wenjing; Wang, Deshou

    2016-02-23

    The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG) box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus), and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.

  1. Genome-Wide Identification and Transcriptome-Based Expression Profiling of the Sox Gene Family in the Nile Tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Ling Wei

    2016-02-01

    Full Text Available The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus, and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.

  2. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

  3. Isolation, structural analysis, and expression characteristics of the maize nuclear factor Y gene families

    International Nuclear Information System (INIS)

    Zhang, Zhongbao; Li, Xianglong; Zhang, Chun; Zou, Huawen; Wu, Zhongyi

    2016-01-01

    NUCLEAR FACTOR-Y (NF-Y) has been shown to play an important role in growth, development, and response to environmental stress. A NF-Y complex, which consists of three subunits, NF-YA, NF-YB, and, NF-YC, binds to CCAAT sequences in a promoter to control the expression of target genes. Although NF-Y proteins have been reported in Arabidopsis and rice, a comprehensive and systematic analysis of ZmNF-Y genes has not yet been performed. To examine the functions of ZmNF-Y genes in this family, we isolated and characterized 50 ZmNF-Y (14 ZmNF-YA, 18 ZmNF-YB, and 18 ZmNF-YC) genes in an analysis of the maize genome. The 50 ZmNF-Y genes were distributed on all 10 maize chromosomes, and 12 paralogs were identified. Multiple alignments showed that maize ZmNF-Y family proteins had conserved regions and relatively variable N-terminal or C-terminal domains. The comparative syntenic map illustrated 40 paralogous NF-Y gene pairs among the 10 maize chromosomes. Microarray data showed that the ZmNF-Y genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results suggested that ZmNF-YB2, 4, 8, 10, 13, and 16 and ZmNF-YC6, 8, and 15 were induced, while ZmNF-YA1, 3, 4, 6, 7, 10, 12, and 13, ZmNF-YB15, and ZmNF-YC3 and 9 were suppressed by drought stress. ZmNF-YA3, ZmNF-YA8 and ZmNF-YA12 were upregulated after infection by the three pathogens, while ZmNF-YA1 and ZmNF-YB2 were suppressed. These results indicate that the ZmNF-Ys may have significant roles in the response to abiotic and biotic stresses. - Highlights: • We indicated a total of 50 members of ZmNF-Y gene family in maize genome. • We analyzed gene structure, protein architecture of ZmNF-Y genes. • Evolution pattern and phylogenic relationships were analyzed among 50 ZmNF-Y genes. • Expression pattern of ZmNF-Ys were detected in various maize tissues. • Transcript levels of ZmNF-Ys were measured under various abiotic and biotic stresses.

  4. An Efficient Test for Gene-Environment Interaction in Generalized Linear Mixed Models with Family Data.

    Science.gov (United States)

    Mazo Lopera, Mauricio A; Coombes, Brandon J; de Andrade, Mariza

    2017-09-27

    Gene-environment (GE) interaction has important implications in the etiology of complex diseases that are caused by a combination of genetic factors and environment variables. Several authors have developed GE analysis in the context of independent subjects or longitudinal data using a gene-set. In this paper, we propose to analyze GE interaction for discrete and continuous phenotypes in family studies by incorporating the relatedness among the relatives for each family into a generalized linear mixed model (GLMM) and by using a gene-based variance component test. In addition, we deal with collinearity problems arising from linkage disequilibrium among single nucleotide polymorphisms (SNPs) by considering their coefficients as random effects under the null model estimation. We show that the best linear unbiased predictor (BLUP) of such random effects in the GLMM is equivalent to the ridge regression estimator. This equivalence provides a simple method to estimate the ridge penalty parameter in comparison to other computationally-demanding estimation approaches based on cross-validation schemes. We evaluated the proposed test using simulation studies and applied it to real data from the Baependi Heart Study consisting of 76 families. Using our approach, we identified an interaction between BMI and the Peroxisome Proliferator Activated Receptor Gamma ( PPARG ) gene associated with diabetes.

  5. [Genome-wide identification, phylogenetic analysis and expression profiling of the WOX family genes in Solanum lycopersicum].

    Science.gov (United States)

    Li, Xiao-xu; Liu, Cheng; Li, Wei; Zhang, Zeng-lin; Gao, Xiao-ming; Zhou, Hui; Guo, Yong-feng

    2016-05-01

    Members of the plant-specific WOX transcription factor family have been reported to play important roles in cell to cell communication as well as other physiological and developmental processes. In this study, ten members of the WOX transcription factor family were identified in Solanum lycopersicum with HMMER. Neighbor-joining phylogenetic tree, maximum-likelihood tree and Bayesian-inference tree were constructed and similar topologies were shown using the protein sequences of the homeodomain. Phylogenetic study revealed that the 25 WOX family members from Arabidopsis and tomato fall into three clades and nine subfamilies. The patterns of exon-intron structures and organization of conserved domains in Arabidopsis and tomato were consistent based on the phylogenetic results. Transcriptome analysis showed that the expression patterns of SlWOXs were different in different tissue types. Gene Ontology (GO) analysis suggested that, as transcription factors, the SlWOX family members could be involved in a number of biological processes including cell to cell communication and tissue development. Our results are useful for future studies on WOX family members in tomato and other plant species.

  6. Gene structure, transcripts and calciotropic effects of the PTH family of peptides in Xenopus and chicken

    Directory of Open Access Journals (Sweden)

    Power Deborah M

    2010-12-01

    Full Text Available Abstract Background Parathyroid hormone (PTH and PTH-related peptide (PTHrP belong to a family of endocrine factors that share a highly conserved N-terminal region (amino acids 1-34 and play key roles in calcium homeostasis, bone formation and skeletal development. Recently, PTH-like peptide (PTH-L was identified in teleost fish raising questions about the evolution of these proteins. Although PTH and PTHrP have been intensively studied in mammals their function in other vertebrates is poorly documented. Amphibians and birds occupy unique phylogenetic positions, the former at the transition of aquatic to terrestrial life and the latter at the transition to homeothermy. Moreover, both organisms have characteristics indicative of a complex system in calcium regulation. This study investigated PTH family evolution in vertebrates with special emphasis on Xenopus and chicken. Results The PTH-L gene is present throughout the vertebrates with the exception of placental mammals. Gene structure of PTH and PTH-L seems to be conserved in vertebrates while PTHrP gene structure is divergent and has acquired new exons and alternative promoters. Splice variants of PTHrP and PTH-L are common in Xenopus and chicken and transcripts of the former have a widespread tissue distribution, although PTH-L is more restricted. PTH is widely expressed in fish tissue but from Xenopus to mammals becomes largely restricted to the parathyroid gland. The N-terminal (1-34 region of PTH, PTHrP and PTH-L in Xenopus and chicken share high sequence conservation and the capacity to modify calcium fluxes across epithelia suggesting a conserved role in calcium metabolism possibly via similar receptors. Conclusions The parathyroid hormone family contains 3 principal members, PTH, PTHrP and the recently identified PTH-L. In teleosts there are 5 genes which encode PTHrP (2, PTH (2 and PTH-L and in tetrapods there are 3 genes (PTHrP, PTH and PTH-L, the exception is placental mammals which

  7. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  8. Multifunctionality and diversity of GDSL esterase/lipase gene family in rice (Oryza sativa L. japonica genome: new insights from bioinformatics analysis

    Directory of Open Access Journals (Sweden)

    Chepyshko Hanna

    2012-07-01

    Full Text Available Abstract Background GDSL esterases/lipases are a newly discovered subclass of lipolytic enzymes that are very important and attractive research subjects because of their multifunctional properties, such as broad substrate specificity and regiospecificity. Compared with the current knowledge regarding these enzymes in bacteria, our understanding of the plant GDSL enzymes is very limited, although the GDSL gene family in plant species include numerous members in many fully sequenced plant genomes. Only two genes from a large rice GDSL esterase/lipase gene family were previously characterised, and the majority of the members remain unknown. In the present study, we describe the rice OsGELP (Oryza sativa GDSL esterase/lipase protein gene family at the genomic and proteomic levels, and use this knowledge to provide insights into the multifunctionality of the rice OsGELP enzymes. Results In this study, an extensive bioinformatics analysis identified 114 genes in the rice OsGELP gene family. A complete overview of this family in rice is presented, including the chromosome locations, gene structures, phylogeny, and protein motifs. Among the OsGELPs and the plant GDSL esterase/lipase proteins of known functions, 41 motifs were found that represent the core secondary structure elements or appear specifically in different phylogenetic subclades. The specification and distribution of identified putative conserved clade-common and -specific peptide motifs, and their location on the predicted protein three dimensional structure may possibly signify their functional roles. Potentially important regions for substrate specificity are highlighted, in accordance with protein three-dimensional model and location of the phylogenetic specific conserved motifs. The differential expression of some representative genes were confirmed by quantitative real-time PCR. The phylogenetic analysis, together with protein motif architectures, and the expression profiling were

  9. Personalized Nutrition-Genes, Diet, and Related Interactive Parameters as Predictors of Cancer in Multiethnic Colorectal Cancer Families.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Lie, Amanda; Yu, Chong Ho

    2018-06-20

    To personalize nutrition, the purpose of this study was to examine five key genes in the folate metabolism pathway, and dietary parameters and related interactive parameters as predictors of colorectal cancer (CRC) by measuring the healthy eating index (HEI) in multiethnic families. The five genes included methylenetetrahydrofolate reductase ( MTHFR ) 677 and 1298, methionine synthase ( MTR ) 2756, methionine synthase reductase ( MTRR 66), and dihydrofolate reductase ( DHFR ) 19bp , and they were used to compute a total gene mutation score. We included 53 families, 53 CRC patients and 53 paired family friend members of diverse population groups in Southern California. We measured multidimensional data using the ensemble bootstrap forest method to identify variables of importance within domains of genetic, demographic, and dietary parameters to achieve dimension reduction. We then constructed predictive generalized regression (GR) modeling with a supervised machine learning validation procedure with the target variable (cancer status) being specified to validate the results to allow enhanced prediction and reproducibility. The results showed that the CRC group had increased total gene mutation scores compared to the family members ( p < 0.05). Using the Akaike's information criterion and Leave-One-Out cross validation GR methods, the HEI was interactive with thiamine (vitamin B1), which is a new finding for the literature. The natural food sources for thiamine include whole grains, legumes, and some meats and fish which HEI scoring included as part of healthy portions (versus limiting portions on salt, saturated fat and empty calories). Additional predictors included age, as well as gender and the interaction of MTHFR 677 with overweight status (measured by body mass index) in predicting CRC, with the cancer group having more men and overweight cases. The HEI score was significant when split at the median score of 77 into greater or less scores, confirmed through

  10. A case report of novel mutation in PRF1 gene, which causes familial autosomal recessive hemophagocytic lymphohistiocytosis.

    Science.gov (United States)

    Bordbar, Mohammad Reza; Modarresi, Farzaneh; Farazi Fard, Mohammad Ali; Dastsooz, Hassan; Shakib Azad, Nader; Faghihi, Mohammad Ali

    2017-05-03

    Hemophagocytic Lymphohistiocytosis (HLH) is a life-threatening immunodeficiency and multi-organ disease that affects people of all ages and ethnic groups. Common symptoms and signs of this disease are high fever, hepatosplenomegaly, and cytopenias. Familial form of HLH disease, which is an autosomal recessive hematological disorder is due to disease-causing mutations in several genes essential for NK and T-cell granule-mediated cytotoxic function. For an effective cytotoxic response from cytotoxic T lymphocyte or NK cell encountering an infected cell or tumor cell, different processes are required, including trafficking, docking, priming, membrane fusion, and entry of cytotoxic granules into the target cell leading to apoptosis. Therefore, genes involved in these steps play important roles in the pathogenesis of HLH disease which include PRF1, UNC13D (MUNC13-4), STX11, and STXBP2 (MUNC18-2). Here, we report a novel missense mutation in an 8-year-old boy suffered from hepatosplenomegaly, hepatitis, epilepsy and pancytopenia. The patient was born to a first-cousin parents with no previous documented disease in his parents. To identify mutated gene in the proband, Whole Exome Sequencing (WES) utilizing next generation sequencing was used on an Illumina HiSeq 2000 platform on DNA sample from the patient. Results showed a novel deleterious homozygous missense mutation in PRF1 gene (NM_001083116: exon3: c. 1120 T > G, p.W374G) in the patient and then using Sanger sequencing it was confirmed in the proband and his parents. Since his parents were heterozygous for the identified mutation, autosomal recessive pattern of inheritance was confirmed in the family. Our study identified a rare new pathogenic missense mutation in PRF1 gene in patient with HLH disease and it is the first report of mutation in PRF1 in Iranian patients with this disease.

  11. Phylogenetic analysis of members of the Phycodnaviridae virus family, using amplified fragments of the major capsid protein gene.

    Science.gov (United States)

    Larsen, J B; Larsen, A; Bratbak, G; Sandaa, R-A

    2008-05-01

    Algal viruses are considered ecologically important by affecting host population dynamics and nutrient flow in aquatic food webs. Members of the family Phycodnaviridae are also interesting due to their extrao