
Sample records for gene expression fingerprint

  1. An inflammatory gene-expression fingerprint in monocytes of autoimmune thyroid disease patients

    NARCIS (Netherlands)

    L. Heul-Nieuwenhuijsen (Leonie); R.C. Padmos (Roos); R.C. Drexhage (Roos); H.J. de Wit (Harm); A. Berghout (Arie)


    textabstractContext: In monocytes of patients with autoimmune diabetes, we recently identified a gene expression fingerprint of two partly overlapping gene clusters, a PDE4B-associated cluster (consisting of 12 core proinflammatory cytokine/compound genes), a FABP5-associated cluster (three core gen

  2. A gene expression fingerprint of C. elegans embryonic motor neurons

    Directory of Open Access Journals (Sweden)

    Dupuy Denis


    Full Text Available Abstract Background Differential gene expression specifies the highly diverse cell types that constitute the nervous system. With its sequenced genome and simple, well-defined neuroanatomy, the nematode C. elegans is a useful model system in which to correlate gene expression with neuron identity. The UNC-4 transcription factor is expressed in thirteen embryonic motor neurons where it specifies axonal morphology and synaptic function. These cells can be marked with an unc-4::GFP reporter transgene. Here we describe a powerful strategy, Micro-Array Profiling of C. elegans cells (MAPCeL, and confirm that this approach provides a comprehensive gene expression profile of unc-4::GFP motor neurons in vivo. Results Fluorescence Activated Cell Sorting (FACS was used to isolate unc-4::GFP neurons from primary cultures of C. elegans embryonic cells. Microarray experiments detected 6,217 unique transcripts of which ~1,000 are enriched in unc-4::GFP neurons relative to the average nematode embryonic cell. The reliability of these data was validated by the detection of known cell-specific transcripts and by expression in UNC-4 motor neurons of GFP reporters derived from the enriched data set. In addition to genes involved in neurotransmitter packaging and release, the microarray data include transcripts for receptors to a remarkably wide variety of signaling molecules. The added presence of a robust array of G-protein pathway components is indicative of complex and highly integrated mechanisms for modulating motor neuron activity. Over half of the enriched genes (537 have human homologs, a finding that could reflect substantial overlap with the gene expression repertoire of mammalian motor neurons. Conclusion We have described a microarray-based method, MAPCeL, for profiling gene expression in specific C. elegans motor neurons and provide evidence that this approach can reveal candidate genes for key roles in the differentiation and function of these cells

  3. Gene expression fingerprints of largemouth bass (Micropterus salmoides) exposed to pulp and paper mill effluents (United States)

    Denslow, N.D.; Kocerha, J.; Sepulveda, M.S.; Gross, Timothy; Holm, S.E.


    Effluents from pulp and paper mills that historically have used elemental chlorine in the bleaching process have been implicated in inhibiting reproduction in fish. Compounds with estrogenic and androgenic binding affinities have been found in these effluents, suggesting that the impairment of reproduction is through an endocrine-related mode of action. To date, a great deal of attention has been paid to phytoestrogens and resin acids that are present in mill process streams as a result of pulping trees. Estrogen and estrogen mimics interact directly with the estrogen receptor and have near immediate effects on gene transcription by turning on the expression of a unique set of genes. Using differential display (DD) RT-PCR, we examined changes in gene expression induced by exposure to paper mill effluents. Largemouth bass were exposed to 0, 10, 20, 40, and 80% paper mill effluent concentrations in large flow-through tanks for varied periods of time including 7, 28 or 56 days. Plasma hormone levels in males and females and plasma vitellogenin (Vtg) in females decreased with dose and time. Measurements of changes in gene expression using DD RT-PCR suggest that the gene expression patterns of male fish do not change much with exposure, except for the induction of a few genes including CYP 1A, a protein that is induced through the action of the Ah receptor in response to dioxin and similar polyaromatic hydrocarbons. However, in the case of females, exposure to these effluents resulted in an up-regulation of CYP 1A that was accompanied by a generalized down-regulation of genes normally expressed during the reproductive season. These antiestrogenic changes are in agreement with previous studies in bass exposed to these effluents, and could result in decreased reproductive success in affected populations. ?? 2004 Elsevier B.V. All rights reserved.

  4. RAP-PCR fingerprinting reveals time-dependent expression of development-related genes following differentiation process of Bacillus thuringiensis. (United States)

    Huang, Tianpei; Yu, Xiaomin; Gelbič, Ivan; Guan, Xiong


    Gene expression profiles are important data to reveal the functions of genes putatively involved in crucial biological processes. RNA arbitrarily primed polymerase chain reaction (RAP-PCR) and specifically primed reverse transcription polymerase chain reaction (RT-PCR) were combined to screen differentially expressed genes following development of a commercial Bacillus thuringiensis subsp. kurstaki strain 8010 (serotype 3a3b). Six differentially expressed transcripts (RAP1 to RAP6) were obtained. RAP1 encoded a putative triple helix repeat-containing collagen or an exosporium protein H related to spore pathogenicity. RAP2 was homologous to a ClpX protease and an ATP-dependent protease La (LonB), which likely acted as virulence factors. RAP3 was homologous to a beta subunit of propionyl-CoA carboxylase required for the development of Myxococcus xanthus. RAP4 had homology to a quinone oxidoreductase involved in electron transport and ATP formation. RAP5 showed significant homology to a uridine kinase that mediates phosphorylation of uridine and azauridine. RAP6 shared high sequence identity with 3-methyl-2-oxobutanoate-hydroxymethyltransferase (also known as ketopantoate hydroxymethyltransferase or PanB) involved in the operation of the tricarboxylic acid cycle. The findings described here would help to elucidate the molecular mechanisms underlying the differentiation process of B. thuringiensis and unravel novel pathogenic genes.

  5. PPAR{alpha} does not suppress muscle-associated gene expression in brown adipocytes but does influence expression of factors that fingerprint the brown adipocyte

    Energy Technology Data Exchange (ETDEWEB)

    Walden, Tomas B.; Petrovic, Natasa [The Wenner-Gren Institute, The Arrhenius Laboratories F3, Stockholm University, SE-106 91 Stockholm (Sweden); Nedergaard, Jan, E-mail: [The Wenner-Gren Institute, The Arrhenius Laboratories F3, Stockholm University, SE-106 91 Stockholm (Sweden)


    Brown adipocytes and myocytes develop from a common adipomyocyte precursor. PPAR{alpha} is a nuclear receptor important for lipid and glucose metabolism. It has been suggested that in brown adipose tissue, PPAR{alpha} represses the expression of muscle-associated genes, in this way potentially acting to determine cell fate in brown adipocytes. To further understand the possible role of PPAR{alpha} in these processes, we measured expression of muscle-associated genes in brown adipose tissue and brown adipocytes from PPAR{alpha}-ablated mice, including structural genes (Mylpf, Tpm2, Myl3 and MyHC), regulatory genes (myogenin, Myf5 and MyoD) and a myomir (miR-206). However, in our hands, the expression of these genes was not influenced by the presence or absence of PPAR{alpha}, nor by the PPAR{alpha} activator Wy-14,643. Similarly, the expression of genes common for mature brown adipocyte and myocytes (Tbx15, Meox2) were not affected. However, the brown adipocyte-specific regulatory genes Zic1, Lhx8 and Prdm16 were affected by PPAR{alpha}. Thus, it would not seem that PPAR{alpha} represses muscle-associated genes, but PPAR{alpha} may still play a role in the regulation of the bifurcation of the adipomyocyte precursor into a brown adipocyte or myocyte phenotype.

  6. Tumor-specific gene expression patterns with gene expression profiles

    Institute of Scientific and Technical Information of China (English)

    RUAN Xiaogang; LI Yingxin; LI Jiangeng; GONG Daoxiong; WANG Jinlian


    Gene expression profiles of 14 common tumors and their counterpart normal tissues were analyzed with machine learning methods to address the problem of selection of tumor-specific genes and analysis of their differential expressions in tumor tissues. First, a variation of the Relief algorithm, "RFE_Relief algorithm" was proposed to learn the relations between genes and tissue types. Then, a support vector machine was employed to find the gene subset with the best classification performance for distinguishing cancerous tissues and their counterparts. After tissue-specific genes were removed, cross validation experiments were employed to demonstrate the common deregulated expressions of the selected gene in tumor tissues. The results indicate the existence of a specific expression fingerprint of these genes that is shared in different tumor tissues, and the hallmarks of the expression patterns of these genes in cancerous tissues are summarized at the end of this paper.

  7. Using Ontology Fingerprints to disambiguate gene name entities in the biomedical literature. (United States)

    Chen, Guocai; Zhao, Jieyi; Cohen, Trevor; Tao, Cui; Sun, Jingchun; Xu, Hua; Bernstam, Elmer V; Lawson, Andrew; Zeng, Jia; Johnson, Amber M; Holla, Vijaykumar; Bailey, Ann M; Lara-Guerra, Humberto; Litzenburger, Beate; Meric-Bernstam, Funda; Jim Zheng, W


    Ambiguous gene names in the biomedical literature are a barrier to accurate information extraction. To overcome this hurdle, we generated Ontology Fingerprints for selected genes that are relevant for personalized cancer therapy. These Ontology Fingerprints were used to evaluate the association between genes and biomedical literature to disambiguate gene names. We obtained 93.6% precision for the test gene set and 80.4% for the area under a receiver-operating characteristics curve for gene and article association. The core algorithm was implemented using a graphics processing unit-based MapReduce framework to handle big data and to improve performance. We conclude that Ontology Fingerprints can help disambiguate gene names mentioned in text and analyse the association between genes and articles. Database URL: © The Author(s) 2015. Published by Oxford University Press.

  8. Finding pathway-modulating genes from a novel Ontology Fingerprint-derived gene network. (United States)

    Qin, Tingting; Matmati, Nabil; Tsoi, Lam C; Mohanty, Bidyut K; Gao, Nan; Tang, Jijun; Lawson, Andrew B; Hannun, Yusuf A; Zheng, W Jim


    To enhance our knowledge regarding biological pathway regulation, we took an integrated approach, using the biomedical literature, ontologies, network analyses and experimental investigation to infer novel genes that could modulate biological pathways. We first constructed a novel gene network via a pairwise comparison of all yeast genes' Ontology Fingerprints--a set of Gene Ontology terms overrepresented in the PubMed abstracts linked to a gene along with those terms' corresponding enrichment P-values. The network was further refined using a Bayesian hierarchical model to identify novel genes that could potentially influence the pathway activities. We applied this method to the sphingolipid pathway in yeast and found that many top-ranked genes indeed displayed altered sphingolipid pathway functions, initially measured by their sensitivity to myriocin, an inhibitor of de novo sphingolipid biosynthesis. Further experiments confirmed the modulation of the sphingolipid pathway by one of these genes, PFA4, encoding a palmitoyl transferase. Comparative analysis showed that few of these novel genes could be discovered by other existing methods. Our novel gene network provides a unique and comprehensive resource to study pathway modulations and systems biology in general. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Gene Expression Omnibus (GEO) (United States)

    U.S. Department of Health & Human Services — Gene Expression Omnibus is a public functional genomics data repository supporting MIAME-compliant submissions of array- and sequence-based data. Tools are provided...

  10. Genetic Fingerprinting of Wheat and Its Progenitors by Mitochondrial Gene orf256

    Directory of Open Access Journals (Sweden)

    Mona M. Elseehy


    Full Text Available orf256 is a wheat mitochondrial gene associated with cytoplasmic male sterility (CMS that has different organization in various species. This study exploited the orf256 gene as a mitochondrial DNA marker to study the genetic fingerprint of Triticum and Aegilops species. PCR followed by sequencing of common parts of the orf256 gene were employed to determine the fingerprint and molecular evolution of Triticum and Aegilops species. Although many primer pairs were used, two pairs of orf256 specific primers (5:-94/C: 482, 5:253/C: 482, amplified DNA fragments of 576 bp and 230 bp respectively in all species were tested. A common 500 bp of nine species of Triticum and Aegilops were aligned and showed consistent results with that obtained from other similar chloroplast or nuclear genes. Base alignment showed that there were various numbers of base substitutions in all species compared to S. cereal (Sc (the outgroup species. Phylogenetic relationship revealed similar locations and proximity on phylogenetic trees established using plastid and nuclear genes. The results of this study open a good route to use unknown function genes of mitochondria in studying the molecular relationships and evolution of wheat and complex plant genomes.

  11. Analysis of genes differentially expressed during potato tuber life cycle and isolation of their promoter regions

    NARCIS (Netherlands)

    Trindade, L.M.; Horvath, B.M.; Berloo, van R.; Visser, R.G.F.


    The potato tuber life cycle involves several developmental stages including tuberisation, tuber growth, dormancy and sprouting. Gene expression during the potato tuber life cycle has been monitored using a RNA fingerprinting technique termed cDNA-AFLP The expression profile of the nearly 2000 transc

  12. Improving oligonucleotide fingerprinting of rRNA genes by implementation of polony microarray technology (United States)

    Ruegger, Paul M.; Bent, Elizabeth; Li, Wei; Jeske, Daniel R.; Cui, Xinping; Braun, Jonathan; Jiang, Tao; Borneman, James


    Improvements to oligonucleotide fingerprinting of rRNA genes (OFRG) were obtained by implementing polony microarray technology. OFRG is an array-based method for analyzing microbial community composition. Polonies are discrete clusters of DNA, produced by solid-phase PCR in hydrogels, and derived from individual, spatially isolated DNA molecules. The advantages of a polony-based OFRG method include higher throughput and reductions in the PCR-induced errors and compositional skew inherent in all other PCR-based community composition methods, including high throughput sequencing of rRNA genes. Given the similarities between polony microarrays and certain aspects of sequencing methods such as the Illumina platform, we suggest that if concepts presented in this study were implemented in high throughput sequencing protocols, a reduction of PCR-induced errors and compositional skew may be realized. PMID:22640891

  13. The flow of gene expression. (United States)

    Misteli, Tom


    Gene expression is a highly interconnected multistep process. A recent meeting in Iguazu Falls, Argentina, highlighted the need to uncover both the molecular details of each single step as well as the mechanisms of coordination among processes in order to fully understand the expression of genes.

  14. Ascidian gene-expression profiles


    Jeffery, William R.


    With the advent of gene-expression profiling, a large number of genes can now be investigated simultaneously during critical stages of development. This approach will be particularly informative in studies of ascidians, basal chordates whose genomes and embryology are uniquely suited for mapping developmental gene networks.

  15. Metabolite Fingerprinting in Transgenic Nicotiana tabacum Altered by the Escherichia coli Glutamate Dehydrogenase Gene

    Directory of Open Access Journals (Sweden)

    R. Mungur


    Full Text Available With about 200 000 phytochemicals in existence, identifying those of biomedical significance is a mammoth task. In the postgenomic era, relating metabolite fingerprints, abundances, and profiles to genotype is also a large task. Ion analysis using Fourier transformed ion cyclotron resonance mass spectrometry (FT-ICR-MS may provide a high-throughput approach to measure genotype dependency of the inferred metabolome if reproducible techniques can be established. Ion profile inferred metabolite fingerprints are coproducts. We used FT-ICR-MS-derived ion analysis to examine gdhA (glutamate dehydrogenase (GDH; EC transgenic Nicotiana tabacum (tobacco carrying out altered glutamate, amino acid, and carbon metabolisms, that fundamentally alter plant productivity. Cause and effect between gdhA expression, glutamate metabolism, and plant phenotypes was analyzed by 13NH4+ labeling of amino acid fractions, and by FT-ICR-MS analysis of metabolites. The gdhA transgenic plants increased 13N labeling of glutamate and glutamine significantly. FT-ICR-MS detected 2 012 ions reproducible in 2 to 4 ionization protocols. There were 283 ions in roots and 98 ions in leaves that appeared to significantly change abundance due to the measured GDH activity. About 58% percent of ions could not be used to infer a corresponding metabolite. From the 42% of ions that inferred known metabolites we found that certain amino acids, organic acids, and sugars increased and some fatty acids decreased. The transgene caused increased ammonium assimilation and detectable ion variation. Thirty-two compounds with biomedical significance were altered in abundance by GDH including 9 known carcinogens and 14 potential drugs. Therefore, the GDH transgene may lead to new uses for crops like tobacco.

  16. Human Lacrimal Gland Gene Expression (United States)

    Aakalu, Vinay Kumar; Parameswaran, Sowmya; Maienschein-Cline, Mark; Bahroos, Neil; Shah, Dhara; Ali, Marwan; Krishnakumar, Subramanian


    Background The study of human lacrimal gland biology and development is limited. Lacrimal gland tissue is damaged or poorly functional in a number of disease states including dry eye disease. Development of cell based therapies for lacrimal gland diseases requires a better understanding of the gene expression and signaling pathways in lacrimal gland. Differential gene expression analysis between lacrimal gland and other embryologically similar tissues may be helpful in furthering our understanding of lacrimal gland development. Methods We performed global gene expression analysis of human lacrimal gland tissue using Affymetrix ® gene expression arrays. Primary data from our laboratory was compared with datasets available in the NLM GEO database for other surface ectodermal tissues including salivary gland, skin, conjunctiva and corneal epithelium. Results The analysis revealed statistically significant difference in the gene expression of lacrimal gland tissue compared to other ectodermal tissues. The lacrimal gland specific, cell surface secretory protein encoding genes and critical signaling pathways which distinguish lacrimal gland from other ectodermal tissues are described. Conclusions Differential gene expression in human lacrimal gland compared with other ectodermal tissue types revealed interesting patterns which may serve as the basis for future studies in directed differentiation among other areas. PMID:28081151

  17. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen


    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  18. The transcriptomic fingerprint of glucoamylase over-expression in Aspergillus niger

    Directory of Open Access Journals (Sweden)

    Kwon Min Jin


    Full Text Available Abstract Background Filamentous fungi such as Aspergillus niger are well known for their exceptionally high capacity for secretion of proteins, organic acids, and secondary metabolites and they are therefore used in biotechnology as versatile microbial production platforms. However, system-wide insights into their metabolic and secretory capacities are sparse and rational strain improvement approaches are therefore limited. In order to gain a genome-wide view on the transcriptional regulation of the protein secretory pathway of A. niger, we investigated the transcriptome of A. niger when it was forced to overexpression the glaA gene (encoding glucoamylase, GlaA and secrete GlaA to high level. Results An A. niger wild-type strain and a GlaA over-expressing strain, containing multiple copies of the glaA gene, were cultivated under maltose-limited chemostat conditions (specific growth rate 0.1 h-1. Elevated glaA mRNA and extracellular GlaA levels in the over-expressing strain were accompanied by elevated transcript levels from 772 genes and lowered transcript levels from 815 genes when compared to the wild-type strain. Using GO term enrichment analysis, four higher-order categories were identified in the up-regulated gene set: i endoplasmic reticulum (ER membrane translocation, ii protein glycosylation, iii vesicle transport, and iv ion homeostasis. Among these, about 130 genes had predicted functions for the passage of proteins through the ER and those genes included target genes of the HacA transcription factor that mediates the unfolded protein response (UPR, e.g. bipA, clxA, prpA, tigA and pdiA. In order to identify those genes that are important for high-level secretion of proteins by A. niger, we compared the transcriptome of the GlaA overexpression strain of A. niger with six other relevant transcriptomes of A. niger. Overall, 40 genes were found to have either elevated (from 36 genes or lowered (from 4 genes transcript levels under all

  19. Gene expression in colorectal cancer

    DEFF Research Database (Denmark)

    Birkenkamp-Demtroder, Karin; Christensen, Lise Lotte; Olesen, Sanne Harder


    Understanding molecular alterations in colorectal cancer (CRC) is needed to define new biomarkers and treatment targets. We used oligonucleotide microarrays to monitor gene expression of about 6,800 known genes and 35,000 expressed sequence tags (ESTs) on five pools (four to six samples in each p...... with a high frequency of loss of heterozygosity. The genes and ESTs presented in this study encode new potential tumor markers as well as potential novel therapeutic targets for prevention or therapy of CRC.......Understanding molecular alterations in colorectal cancer (CRC) is needed to define new biomarkers and treatment targets. We used oligonucleotide microarrays to monitor gene expression of about 6,800 known genes and 35,000 expressed sequence tags (ESTs) on five pools (four to six samples in each...... pool) of total RNA from left-sided sporadic colorectal carcinomas. We compared normal tissue to carcinoma tissue from Dukes' stages A-D (noninvasive to distant metastasis) and identified 908 known genes and 4,155 ESTs that changed remarkably from normal to tumor tissue. Based on intensive filtering 226...

  20. Development of genomic SSR markers for fingerprinting lettuce (Lactuca sativa L.) cultivars and mapping genes. (United States)

    Rauscher, Gilda; Simko, Ivan


    Lettuce (Lactuca sativa L.) is the major crop from the group of leafy vegetables. Several types of molecular markers were developed that are effectively used in lettuce breeding and genetic studies. However only a very limited number of microsattelite-based markers are publicly available. We have employed the method of enriched microsatellite libraries to develop 97 genomic SSR markers. Testing of newly developed markers on a set of 36 Lactuca accession (33 L. sativa, and one of each L. serriola L., L. saligna L., and L. virosa L.) revealed that both the genetic heterozygosity (UHe = 0.56) and the number of loci per SSR (Na = 5.50) are significantly higher for genomic SSR markers than for previously developed EST-based SSR markers (UHe = 0.32, Na = 3.56). Fifty-four genomic SSR markers were placed on the molecular linkage map of lettuce. Distribution of markers in the genome appeared to be random, with the exception of possible cluster on linkage group 6. Any combination of 32 genomic SSRs was able to distinguish genotypes of all 36 accessions. Fourteen of newly developed SSR markers originate from fragments with high sequence similarity to resistance gene candidates (RGCs) and RGC pseudogenes. Analysis of molecular variance (AMOVA) of L. sativa accessions showed that approximately 3% of genetic diversity was within accessions, 79% among accessions, and 18% among horticultural types. The newly developed genomic SSR markers were added to the pool of previously developed EST-SSRs markers. These two types of SSR-based markers provide useful tools for lettuce cultivar fingerprinting, development of integrated molecular linkage maps, and mapping of genes.

  1. Zipf's Law in Gene Expression

    CERN Document Server

    Furusawa, C; Furusawa, Chikara; Kaneko, Kunihiko


    Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1, i.e., they obey Zipf's law. Furthermore, by simulations of a simple model with an intra-cellular reaction network, we found that Zipf's law of chemical abundance is a universal feature of cells where such a network optimizes the efficiency and faithfulness of self-reproduction. These findings provide novel insights into the nature of the organization of reaction dynamics in living cells.

  2. Zipf's Law in Gene Expression (United States)

    Furusawa, Chikara; Kaneko, Kunihiko


    Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1; i.e., they obey Zipf’s law. Furthermore, by simulations of a simple model with an intracellular reaction network, we found that Zipf’s law of chemical abundance is a universal feature of cells where such a network optimizes the efficiency and faithfulness of self-reproduction. These findings provide novel insights into the nature of the organization of reaction dynamics in living cells.

  3. Correction of gene expression data

    DEFF Research Database (Denmark)

    Darbani Shirvanehdeh, Behrooz; Stewart, C. Neal, Jr.; Noeparvar, Shahin;


    This report investigates for the first time the potential inter-treatment bias source of cell number for gene expression studies. Cell-number bias can affect gene expression analysis when comparing samples with unequal total cellular RNA content or with different RNA extraction efficiencies...... an analytical approach to examine the suitability of correction methods by considering the inter-treatment bias as well as the inter-replicate variance, which allows use of the best correction method with minimum residual bias. Analyses of RNA sequencing and microarray data showed that the efficiencies...

  4. Homeobox gene expression in Brachiopoda

    DEFF Research Database (Denmark)

    Altenburger, Andreas; Martinez, Pedro; Wanninger, Andreas


    The molecular control that underlies brachiopod ontogeny is largely unknown. In order to contribute to this issue we analyzed the expression pattern of two homeobox containing genes, Not and Cdx, during development of the rhynchonelliform (i.e., articulate) brachiopod Terebratalia transversa. Not...

  5. Vascular Gene Expression: A Hypothesis

    Directory of Open Access Journals (Sweden)

    Angélica Concepción eMartínez-Navarro


    Full Text Available The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a primitive vascular tissue (a lycophyte, as well as from others that lack a true vascular tissue (a bryophyte, and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non- vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants.

  6. Neighboring Genes Show Correlated Evolution in Gene Expression (United States)

    Ghanbarian, Avazeh T.; Hurst, Laurence D.


    When considering the evolution of a gene’s expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. PMID:25743543

  7. Gene Expression in Trypanosomatid Parasites

    Directory of Open Access Journals (Sweden)

    Santiago Martínez-Calvillo


    Full Text Available The parasites Leishmania spp., Trypanosoma brucei, and Trypanosoma cruzi are the trypanosomatid protozoa that cause the deadly human diseases leishmaniasis, African sleeping sickness, and Chagas disease, respectively. These organisms possess unique mechanisms for gene expression such as constitutive polycistronic transcription of protein-coding genes and trans-splicing. Little is known about either the DNA sequences or the proteins that are involved in the initiation and termination of transcription in trypanosomatids. In silico analyses of the genome databases of these parasites led to the identification of a small number of proteins involved in gene expression. However, functional studies have revealed that trypanosomatids have more general transcription factors than originally estimated. Many posttranslational histone modifications, histone variants, and chromatin modifying enzymes have been identified in trypanosomatids, and recent genome-wide studies showed that epigenetic regulation might play a very important role in gene expression in this group of parasites. Here, we review and comment on the most recent findings related to transcription initiation and termination in trypanosomatid protozoa.

  8. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal


    The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene ...

  9. Quantum fingerprinting

    CERN Document Server

    Buhrman, H; Watrous, J; De Wolf, R; Buhrman, Harry; Cleve, Richard; Watrous, John; Wolf, Ronald de


    Classical fingerprinting associates with each string a shorter string (its fingerprint), such that, with high probability, any two distinct strings can be distinguished by comparing their fingerprints alone. The fingerprints can be exponentially smaller than the original strings if the parties preparing the fingerprints share a random key, but not if they only have access to uncorrelated random sources. In this paper we show that fingerprints consisting of quantum information can be made exponentially smaller than the original strings without any correlations or entanglement between the parties: we give a scheme where the quantum fingerprints are exponentially shorter than the original strings and we give a test that distinguishes any two unknown quantum fingerprints with high probability. Our scheme implies an exponential quantum/classical gap for the equality problem in the simultaneous message passing model of communication complexity. We optimize several aspects of our scheme.

  10. Fingerprint recognition


    Diefenderfer, Graig T.


    The use of biometrics is an evolving component in today's society. Fingerprint recognition continues to be one of the most widely used biometric systems. This thesis explores the various steps present in a fingerprint recognition system. The study develops a working algorithm to extract fingerprint minutiae from an input fingerprint image. This stage incorporates a variety of image pre-processing steps necessary for accurate minutiae extraction and includes two different methods of ridge thin...

  11. Classification with binary gene expressions


    Tuna, Salih; Niranjan, Mahesan


    Microarray gene expression measurements are reported, used and archived usually to high numerical precision. However, properties of mRNA molecules, such as their low stability and availability in small copy numbers, and the fact that measurements correspond to a population of cells, rather than a single cell, makes high precision meaningless. Recent work shows that reducing measurement precision leads to very little loss of information, right down to binary levels. In this paper we show how p...

  12. The Gene Expression Omnibus database (United States)

    Clough, Emily; Barrett, Tanya


    The Gene Expression Omnibus (GEO) database is an international public repository that archives and freely distributes high-throughput gene expression and other functional genomics data sets. Created in 2000 as a worldwide resource for gene expression studies, GEO has evolved with rapidly changing technologies and now accepts high-throughput data for many other data applications, including those that examine genome methylation, chromatin structure, and genome–protein interactions. GEO supports community-derived reporting standards that specify provision of several critical study elements including raw data, processed data, and descriptive metadata. The database not only provides access to data for tens of thousands of studies, but also offers various Web-based tools and strategies that enable users to locate data relevant to their specific interests, as well as to visualize and analyze the data. This chapter includes detailed descriptions of methods to query and download GEO data and use the analysis and visualization tools. The GEO homepage is at PMID:27008011

  13. Gene expression throughout a vertebrate's embryogenesis

    Directory of Open Access Journals (Sweden)

    Hinton David E


    Full Text Available Abstract Background Describing the patterns of gene expression during embryonic development has broadened our understanding of the processes and patterns that define morphogenesis. Yet gene expression patterns have not been described throughout vertebrate embryogenesis. This study presents statistical analyses of gene expression during all 40 developmental stages in the teleost Fundulus heteroclitus using four biological replicates per stage. Results Patterns of gene expression for 7,000 genes appear to be important as they recapitulate developmental timing. Among the 45% of genes with significant expression differences between pairs of temporally adjacent stages, significant differences in gene expression vary from as few as five to more than 660. Five adjacent stages have disproportionately more significant changes in gene expression (> 200 genes relative to other stages: four to eight and eight to sixteen cell stages, onset of circulation, pre and post-hatch, and during complete yolk absorption. The fewest differences among adjacent stages occur during gastrulation. Yet, at stage 16, (pre-mid-gastrulation the largest number of genes has peak expression. This stage has an over representation of genes in oxidative respiration and protein expression (ribosomes, translational genes and proteases. Unexpectedly, among all ribosomal genes, both strong positive and negative correlations occur. Similar correlated patterns of expression occur among all significant genes. Conclusions These data provide statistical support for the temporal dynamics of developmental gene expression during all stages of vertebrate development.

  14. Developmental expression and gene/enzyme identifications in the alpha esterase gene cluster of Drosophila melanogaster. (United States)

    Campbell, P M; de Q Robin, G C; Court, L N; Dorrian, S J; Russell, R J; Oakeshott, J G


    Here we show how the 10 genes of the alpha esterase cluster of Drosophila melanogaster have diverged substantially in their expression profiles. Together with previously described sequence divergence this suggests substantial functional diversification. By peptide mass fingerprinting and in vitro gene expression we have also shown that two of the genes encode the isozymes EST9 (formerly ESTC) and EST23. EST9 is the major 'alpha staining' esterase in zymograms of gut tissues in feeding stages while orthologues of EST23 confer resistance to organophosphorus insecticides in other higher Diptera. The results for EST9 and EST23 concur with previous suggestions that the products of the alpha esterase cluster function in digestion and detoxification of xenobiotic esters. However, many of the other genes in the cluster show developmental or tissue-specific expression that seems inconsistent with such roles. Furthermore, there is generally poor correspondence between the mRNA expression patterns of the remaining eight genes and isozymes previously characterized by standard techniques of electrophoresis and staining, suggesting that the alpha cluster might only account for a small minority of the esterase isozyme profile.

  15. Differential Gene Expression of Fibroblasts: Keloid versus Normal

    Directory of Open Access Journals (Sweden)

    Michael F. Angel


    Full Text Available Abstract: This study investigated gene regulation and unique gene products in both keloid (KDF and normal (NDF dermal fibroblasts in established cell lines. For gene regulation, NDF versus KDF were compared using Clontech's Atlas™ Human cDNA Expression Array while unique gene products were studied using RNA Fingerprinting Kit. RNA from each sample was converted to cDNA using oligo-dT primers. Down-regulated genes using Atlas Array in KDF were 1 60 S ribosomal protein, 2 Thioredoxin dependent peroxidase, 3 Nuclease sensitive element DNA binding protein, 4 c-myc purine-binding transcription factor, 5 c-AMP dependent protein kinase, and, 6 Heat Shock Protein 90 kDa. Genes that are up regulated in KDF were 1 Tubulin and 2 Heat Shock Protein 27 kDa. With the differential display, we found 17 bands unique to both KDF and NDF. The specific gene and the manner in which they were differentially regulated have direct implications to understanding keloid fibroblast proliferation.

  16. Antisense expression increases gene expression variability and locus interdependency


    Xu, Zhenyu; Wei, Wu; Gagneur, Julien; Clauder-Münster, Sandra; Smolik, Miłosz; Huber, Wolfgang; Steinmetz, Lars M.


    Genome-wide transcription profiling has revealed extensive expression of non-coding RNAs antisense to genes, yet their functions, if any, remain to be understood. In this study, we perform a systematic analysis of sense–antisense expression in response to genetic and environmental changes in yeast. We find that antisense expression is associated with genes of larger expression variability. This is characterized by more ‘switching off' at low levels of expression for genes with antisense compa...

  17. Gene expression analysis identifies global gene dosage sensitivity in cancer

    DEFF Research Database (Denmark)

    Fehrmann, Rudolf S. N.; Karjalainen, Juha M.; Krajewska, Malgorzata;


    expression. We reanalyzed 77,840 expression profiles and observed a limited set of 'transcriptional components' that describe well-known biology, explain the vast majority of variation in gene expression and enable us to predict the biological function of genes. On correcting expression profiles...... for these components, we observed that the residual expression levels (in 'functional genomic mRNA' profiling) correlated strongly with copy number. DNA copy number correlated positively with expression levels for 99% of all abundantly expressed human genes, indicating global gene dosage sensitivity. By applying...

  18. Noise in eukaryotic gene expression (United States)

    Blake, William J.; KÆrn, Mads; Cantor, Charles R.; Collins, J. J.


    Transcription in eukaryotic cells has been described as quantal, with pulses of messenger RNA produced in a probabilistic manner. This description reflects the inherently stochastic nature of gene expression, known to be a major factor in the heterogeneous response of individual cells within a clonal population to an inducing stimulus. Here we show in Saccharomyces cerevisiae that stochasticity (noise) arising from transcription contributes significantly to the level of heterogeneity within a eukaryotic clonal population, in contrast to observations in prokaryotes, and that such noise can be modulated at the translational level. We use a stochastic model of transcription initiation specific to eukaryotes to show that pulsatile mRNA production, through reinitiation, is crucial for the dependence of noise on transcriptional efficiency, highlighting a key difference between eukaryotic and prokaryotic sources of noise. Furthermore, we explore the propagation of noise in a gene cascade network and demonstrate experimentally that increased noise in the transcription of a regulatory protein leads to increased cell-cell variability in the target gene output, resulting in prolonged bistable expression states. This result has implications for the role of noise in phenotypic variation and cellular differentiation.

  19. Identification of four soybean reference genes for gene expression normalization (United States)

    Gene expression analysis requires the use of reference genes stably expressed independently of specific tissues or environmental conditions. Housekeeping genes (e.g., actin, tubulin, ribosomal, polyubiquitin and elongation factor 1-alpha) are commonly used as reference genes with the assumption tha...

  20. Gene expression profiling of breast cancer in Lebanese women (United States)

    Makoukji, Joelle; Makhoul, Nadine J.; Khalil, Maya; El-Sitt, Sally; Aldin, Ehab Saad; Jabbour, Mark; Boulos, Fouad; Gadaleta, Emanuela; Sangaralingam, Ajanthah; Chelala, Claude; Boustany, Rose-Mary; Tfayli, Arafat


    Breast cancer is commonest cancer in women worldwide. Elucidation of underlying biology and molecular pathways is necessary for improving therapeutic options and clinical outcomes. Molecular alterations in breast cancer are complex and involve cross-talk between multiple signaling pathways. The aim of this study is to extract a unique mRNA fingerprint of breast cancer in Lebanese women using microarray technologies. Gene-expression profiles of 94 fresh breast tissue samples (84 cancerous/10 non-tumor adjacent samples) were analyzed using GeneChip Human Genome U133 Plus 2.0 arrays. Quantitative real-time PCR was employed to validate candidate genes. Differentially expressed genes between breast cancer and non-tumor tissues were screened. Significant differences in gene expression were established for COL11A1/COL10A1/MMP1/COL6A6/DLK1/S100P/CXCL11/SOX11/LEP/ADIPOQ/OXTR/FOSL1/ACSBG1 and C21orf37. Pathways/diseases representing these genes were retrieved and linked using PANTHER®/Pathway Studio®. Many of the deregulated genes are associated with extracellular matrix, inflammation, angiogenesis, metastasis, differentiation, cell proliferation and tumorigenesis. Characteristics of breast cancers in Lebanese were compared to those of women from Western populations to explain why breast cancer is more aggressive and presents a decade earlier in Lebanese victims. Delineating molecular mechanisms of breast cancer in Lebanese women led to key genes which could serve as potential biomarkers and/or novel drug targets for breast cancer. PMID:27857161

  1. MRI of Transgene Expression: Correlation to Therapeutic Gene Expression

    Directory of Open Access Journals (Sweden)

    Tomotsugu Ichikawa


    Full Text Available Magnetic resonance imaging (MRI can provide highresolution 3D maps of structural and functional information, yet its use of mapping in vivo gene expression has only recently been explored. A potential application for this technology is to noninvasively image transgene expression. The current study explores the latter using a nonregulatable internalizing engineered transferrin receptor (ETR whose expression can be probed for with a superparamagnetic Tf-CLIO probe. Using an HSV-based amplicon vector system for transgene delivery, we demonstrate that: 1 ETR is a sensitive MR marker gene; 2 several transgenes can be efficiently expressed from a single amplicon; 3 expression of each transgene results in functional gene product; and 4 ETR gene expression correlates with expression of therapeutic genes when the latter are contained within the same amplicon. These data, taken together, suggest that MRI of ETR expression can serve as a surrogate for measuring therapeutic transgene expression.

  2. Correlating Expression Data with Gene Function Using Gene Ontology

    Institute of Scientific and Technical Information of China (English)

    LIU,Qi; DENG,Yong; WANG,Chuan; SHI,Tie-Liu; LI,Yi-Xue


    Clustering is perhaps one of the most widely used tools for microarray data analysis. Proposed roles for genes of unknown function are inferred from clusters of genes similarity expressed across many biological conditions.However, whether function annotation by similarity metrics is reliable or not and to what extent the similarity in gene expression patterns is useful for annotation of gene functions, has not been evaluated. This paper made a comprehensive research on the correlation between the similarity of expression data and of gene functions using Gene Ontology. It has been found that although the similarity in expression patterns and the similarity in gene functions are significantly dependent on each other, this association is rather weak. In addition, among the three categories of Gene Ontology, the similarity of expression data is more useful for cellular component annotation than for biological process and molecular function. The results presented are interesting for the gene functions prediction research area.

  3. Adaptive Evolution of Gene Expression in Drosophila

    Directory of Open Access Journals (Sweden)

    Armita Nourmohammad


    Full Text Available Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis.

  4. Brain Fingerprinting

    Directory of Open Access Journals (Sweden)

    Ravi Kumar


    Full Text Available Brain Fingerprinting is a scientific technique to determine whether or not specific information is stored in an individual's brain by measuring a electrical brain wave response to Word, phrases, or picture that are presented on computer screen. Brain Fingerprinting is a controversial forensic science technique that uses electroencephalography (EEG to determine whether specific information is stored in a subject's brain.

  5. Brain Fingerprinting

    Directory of Open Access Journals (Sweden)

    ravi kumar


    Full Text Available Brain Fingerprinting is a scientific technique to determine whether or not specific information is stored in an individual's brain by measuring a electrical brain wave response to Word, phrases, or picture that are presented on computer screen. Brain Fingerprinting is a controversial forensic science technique that uses electroencephalograph y (EEG to determine whether specific information is stored in a subject's brain

  6. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy (Davis, CA); Bachkirova, Elena (Davis, CA); Rey, Michael (Davis, CA)


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  7. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy; Bachkirova, Elena; Rey, Michael


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  8. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy [Davis, CA; Bachkirova, Elena [Davis, CA; Rey, Michael [Davis, CA


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  9. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy; Bachkirova, Elena; Rey, Michael


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  10. Amplification of kinetic oscillations in gene expression (United States)

    Zhdanov, V. P.


    Because of the feedbacks between the DNA transcription and mRNA translation, the gene expression in cells may exhibit bistability and oscillations. The deterministic and stochastic calculations presented illustrate how the bistable kinetics of expression of one gene in a cell can be influenced by the kinetic oscillations in the expression of another gene. Due to stability of the states of the bistable kinetics of gene 1 and the relatively small difference between the maximum and minimum protein amounts during the oscillations of gene 2, the induced oscillations of gene 1 are found to typically be related either to the low-or high-reactive state of this gene. The quality of the induced oscillations may be appreciably better than that of the inducing oscillations. This means that gene 1 can serve as an amplifier of the kinetic oscillations of gene 2.

  11. cis sequence effects on gene expression

    Directory of Open Access Journals (Sweden)

    Jacobs Kevin


    Full Text Available Abstract Background Sequence and transcriptional variability within and between individuals are typically studied independently. The joint analysis of sequence and gene expression variation (genetical genomics provides insight into the role of linked sequence variation in the regulation of gene expression. We investigated the role of sequence variation in cis on gene expression (cis sequence effects in a group of genes commonly studied in cancer research in lymphoblastoid cell lines. We estimated the proportion of genes exhibiting cis sequence effects and the proportion of gene expression variation explained by cis sequence effects using three different analytical approaches, and compared our results to the literature. Results We generated gene expression profiling data at N = 697 candidate genes from N = 30 lymphoblastoid cell lines for this study and used available candidate gene resequencing data at N = 552 candidate genes to identify N = 30 candidate genes with sufficient variance in both datasets for the investigation of cis sequence effects. We used two additive models and the haplotype phylogeny scanning approach of Templeton (Tree Scanning to evaluate association between individual SNPs, all SNPs at a gene, and diplotypes, with log-transformed gene expression. SNPs and diplotypes at eight candidate genes exhibited statistically significant (p cis sequence effects in our study, respectively. Conclusion Based on analysis of our results and the extant literature, one in four genes exhibits significant cis sequence effects, and for these genes, about 30% of gene expression variation is accounted for by cis sequence variation. Despite diverse experimental approaches, the presence or absence of significant cis sequence effects is largely supported by previously published studies.

  12. Deriving Trading Rules Using Gene Expression Programming

    Directory of Open Access Journals (Sweden)

    Adrian VISOIU


    Full Text Available This paper presents how buy and sell trading rules are generated using gene expression programming with special setup. Market concepts are presented and market analysis is discussed with emphasis on technical analysis and quantitative methods. The use of genetic algorithms in deriving trading rules is presented. Gene expression programming is applied in a form where multiple types of operators and operands are used. This gives birth to multiple gene contexts and references between genes in order to keep the linear structure of the gene expression programming chromosome. The setup of multiple gene contexts is presented. The case study shows how to use the proposed gene setup to derive trading rules encoded by Boolean expressions, using a dataset with the reference exchange rates between the Euro and the Romanian leu. The conclusions highlight the positive results obtained in deriving useful trading rules.

  13. Gene Expression Profiling of Gastric Cancer (United States)

    Marimuthu, Arivusudar; Jacob, Harrys K.C.; Jakharia, Aniruddha; Subbannayya, Yashwanth; Keerthikumar, Shivakumar; Kashyap, Manoj Kumar; Goel, Renu; Balakrishnan, Lavanya; Dwivedi, Sutopa; Pathare, Swapnali; Dikshit, Jyoti Bajpai; Maharudraiah, Jagadeesha; Singh, Sujay; Sameer Kumar, Ghantasala S; Vijayakumar, M.; Veerendra Kumar, Kariyanakatte Veeraiah; Premalatha, Chennagiri Shrinivasamurthy; Tata, Pramila; Hariharan, Ramesh; Roa, Juan Carlos; Prasad, T.S.K; Chaerkady, Raghothama; Kumar, Rekha Vijay; Pandey, Akhilesh


    Gastric cancer is the second leading cause of cancer death worldwide, both in men and women. A genomewide gene expression analysis was carried out to identify differentially expressed genes in gastric adenocarcinoma tissues as compared to adjacent normal tissues. We used Agilent’s whole human genome oligonucleotide microarray platform representing ~41,000 genes to carry out gene expression analysis. Two-color microarray analysis was employed to directly compare the expression of genes between tumor and normal tissues. Through this approach, we identified several previously known candidate genes along with a number of novel candidate genes in gastric cancer. Testican-1 (SPOCK1) was one of the novel molecules that was 10-fold upregulated in tumors. Using tissue microarrays, we validated the expression of testican-1 by immunohistochemical staining. It was overexpressed in 56% (160/282) of the cases tested. Pathway analysis led to the identification of several networks in which SPOCK1 was among the topmost networks of interacting genes. By gene enrichment analysis, we identified several genes involved in cell adhesion and cell proliferation to be significantly upregulated while those corresponding to metabolic pathways were significantly downregulated. The differentially expressed genes identified in this study are candidate biomarkers for gastric adenoacarcinoma. PMID:27030788

  14. Modulation of gene expression made easy

    DEFF Research Database (Denmark)

    Solem, Christian; Jensen, Peter Ruhdal


    A new approach for modulating gene expression, based on randomization of promoter (spacer) sequences, was developed. The method was applied to chromosomal genes in Lactococcus lactis and shown to generate libraries of clones with broad ranges of expression levels of target genes. In one example...... beta-glucuronidase, resulting in an operon structure in which both genes are transcribed from a common promoter. We show that there is a linear correlation between the expressions of the two genes, which facilitates screening for mutants with suitable enzyme activities. In a second example, we show......, overexpression was achieved by introducing an additional gene copy into a phage attachment site on the chromosome. This resulted in a series of strains with phosphofructokinase activities from 1.4 to 11 times the wild-type activity level. In this example, the pfk gene was cloned upstream of a gusA gene encoding...

  15. Gene expression profiling during murine tooth development

    Directory of Open Access Journals (Sweden)

    Maria A dos Santos silva Landin


    Full Text Available The aim of this study was to describe the expression of genes, including ameloblastin (Ambn, amelogenin X chromosome (Amelx and enamelin (Enam during early (pre-secretory tooth development. The expression of these genes has predominantly been studied at post-secretory stages. Deoxyoligonucleotide microarrays were used to study gene expression during development of the murine first molar tooth germ at 24h intervals, starting at the eleventh embryonic day (E11.5 and up to the seventh day after birth (P7. The profile search function of Spotfire software was used to select genes with similar expression profile as the enamel genes (Ambn, Amelx and Enam. Microarray results where validated using real-time Reverse Transcription-Polymerase Chain Reaction (real-time RT-PCR, and translated proteins identified by Western blotting. In situ localisation of the Ambn, Amelx and Enam mRNAs were monitored from E12.5 to E17.5 using deoxyoligonucleotide probes. Bioinformatics analysis was used to associate biological functions with differentially (p ≤0.05 expressed (DE genes.Microarray results showed a total of 4362 genes including Ambn, Amelx and Enam to be significant differentially expressed throughout the time-course. The expression of the three enamel genes was low at pre-natal stages (E11.5-P0 increasing after birth (P1-P7. Profile search lead to isolation of 87 genes with significantly similar expression to the three enamel proteins. The mRNAs expressed in dental epithelium and epithelium derived cells. Although expression of Ambn, Amelx and Enam were lower during early tooth development compared to secretory stages enamel proteins were detectable by Western blotting. Bioinformatic analysis associated the 87 genes with multiple biological functions. Around thirty-five genes were associated with fifteen transcription factors.

  16. Gene Expression Patterns in Ovarian Carcinomas (United States)

    Schaner, Marci E.; Ross, Douglas T.; Ciaravino, Giuseppe; Sørlie, Therese; Troyanskaya, Olga; Diehn, Maximilian; Wang, Yan C.; Duran, George E.; Sikic, Thomas L.; Caldeira, Sandra; Skomedal, Hanne; Tu, I-Ping; Hernandez-Boussard, Tina; Johnson, Steven W.; O'Dwyer, Peter J.; Fero, Michael J.; Kristensen, Gunnar B.; Børresen-Dale, Anne-Lise; Hastie, Trevor; Tibshirani, Robert; van de Rijn, Matt; Teng, Nelson N.; Longacre, Teri A.; Botstein, David; Brown, Patrick O.; Sikic, Branimir I.


    We used DNA microarrays to characterize the global gene expression patterns in surface epithelial cancers of the ovary. We identified groups of genes that distinguished the clear cell subtype from other ovarian carcinomas, grade I and II from grade III serous papillary carcinomas, and ovarian from breast carcinomas. Six clear cell carcinomas were distinguished from 36 other ovarian carcinomas (predominantly serous papillary) based on their gene expression patterns. The differences may yield insights into the worse prognosis and therapeutic resistance associated with clear cell carcinomas. A comparison of the gene expression patterns in the ovarian cancers to published data of gene expression in breast cancers revealed a large number of differentially expressed genes. We identified a group of 62 genes that correctly classified all 125 breast and ovarian cancer specimens. Among the best discriminators more highly expressed in the ovarian carcinomas were PAX8 (paired box gene 8), mesothelin, and ephrin-B1 (EFNB1). Although estrogen receptor was expressed in both the ovarian and breast cancers, genes that are coregulated with the estrogen receptor in breast cancers, including GATA-3, LIV-1, and X-box binding protein 1, did not show a similar pattern of coexpression in the ovarian cancers. PMID:12960427

  17. Microanalysis of gene expression in cultured cells

    NARCIS (Netherlands)

    E. van der Veer (Eveliene)


    textabstractIn this thesis two aspects of gene expression in cultured cells have been studied: the heterogeneity in gene expression in relation with the development and application of microchemical techniques for the prenatal diagnosis of inborn errors of metabolism and the possibility of inducing g

  18. Arabidopsis gene expression patterns during spaceflight (United States)

    Paul, A.-L.; Ferl, R. J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments resulted in the differential expression of hundreds of genes. A 5 day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β -Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on two fronts. First, expression patterns visualized with the Adh/GUS transgene were used to address specifically the possibility that spaceflight induces a hypoxic stress response, and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. (Paul et al., Plant Physiol. 2001, 126:613). Second, genome-wide patterns of native gene expression were evaluated utilizing the Affymetrix ATH1 GeneChip? array of 8,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes identified with the arrays was further characterized with quantitative Real-Time RT PCR (ABI - TaqmanTM). Comparison of the patterns of expression for arrays of hybridized with RNA isolated from plants exposed to spaceflight compared to the control arrays revealed hundreds of genes that were differentially expressed in response to spaceflight, yet most genes that are hallmarks of hypoxic stress were unaffected. These results will be discussed in light of current models for plant responses to the spaceflight environment, and with regard to potential future flight opportunities.

  19. Expression of Sox genes in tooth development. (United States)

    Kawasaki, Katsushige; Kawasaki, Maiko; Watanabe, Momoko; Idrus, Erik; Nagai, Takahiro; Oommen, Shelly; Maeda, Takeyasu; Hagiwara, Nobuko; Que, Jianwen; Sharpe, Paul T; Ohazama, Atsushi


    Members of the Sox gene family play roles in many biological processes including organogenesis. We carried out comparative in situ hybridization analysis of seventeen sox genes (Sox1-14, 17, 18, 21) during murine odontogenesis from the epithelial thickening to the cytodifferentiation stages. Localized expression of five Sox genes (Sox6, 9, 13, 14 and 21) was observed in tooth bud epithelium. Sox13 showed restricted expression in the primary enamel knots. At the early bell stage, three Sox genes (Sox8, 11, 17 and 21) were expressed in pre-ameloblasts, whereas two others (Sox5 and 18) showed expression in odontoblasts. Sox genes thus showed a dynamic spatio-temporal expression during tooth development.

  20. Expression of Sox genes in tooth development (United States)



    Members of the Sox gene family play roles in many biological processes including organogenesis. We carried out comparative in situ hybridization analysis of seventeen sox genes (Sox1-14, 17, 18, 21) during murine odontogenesis from the epithelial thickening to the cytodifferentiation stages. Localized expression of five Sox genes (Sox6, 9, 13, 14 and 21) was observed in tooth bud epithelium. Sox13 showed restricted expression in the primary enamel knots. At the early bell stage, three Sox genes (Sox8, 11, 17 and 21) were expressed in pre-ameloblasts, whereas two others (Sox5 and 18) showed expression in odontoblasts. Sox genes thus showed a dynamic spatio-temporal expression during tooth development. PMID:26864488

  1. Gene set analysis for longitudinal gene expression data

    Directory of Open Access Journals (Sweden)

    Piepho Hans-Peter


    Full Text Available Abstract Background Gene set analysis (GSA has become a successful tool to interpret gene expression profiles in terms of biological functions, molecular pathways, or genomic locations. GSA performs statistical tests for independent microarray samples at the level of gene sets rather than individual genes. Nowadays, an increasing number of microarray studies are conducted to explore the dynamic changes of gene expression in a variety of species and biological scenarios. In these longitudinal studies, gene expression is repeatedly measured over time such that a GSA needs to take into account the within-gene correlations in addition to possible between-gene correlations. Results We provide a robust nonparametric approach to compare the expressions of longitudinally measured sets of genes under multiple treatments or experimental conditions. The limiting distributions of our statistics are derived when the number of genes goes to infinity while the number of replications can be small. When the number of genes in a gene set is small, we recommend permutation tests based on our nonparametric test statistics to achieve reliable type I error and better power while incorporating unknown correlations between and within-genes. Simulation results demonstrate that the proposed method has a greater power than other methods for various data distributions and heteroscedastic correlation structures. This method was used for an IL-2 stimulation study and significantly altered gene sets were identified. Conclusions The simulation study and the real data application showed that the proposed gene set analysis provides a promising tool for longitudinal microarray analysis. R scripts for simulating longitudinal data and calculating the nonparametric statistics are posted on the North Dakota INBRE website Raw microarray data is available in Gene Expression Omnibus (National Center for Biotechnology Information with

  2. FARO server: Meta-analysis of gene expression by matching gene expression signatures to a compendium of public gene expression data

    DEFF Research Database (Denmark)

    Manijak, Mieszko P.; Nielsen, Henrik Bjørn


    BACKGROUND: Although, systematic analysis of gene annotation is a powerful tool for interpreting gene expression data, it sometimes is blurred by incomplete gene annotation, missing expression response of key genes and secondary gene expression responses. These shortcomings may be partially...... circumvented by instead matching gene expression signatures to signatures of other experiments. FINDINGS: To facilitate this we present the Functional Association Response by Overlap (FARO) server, that match input signatures to a compendium of 242 gene expression signatures, extracted from more than 1700...

  3. Organization, expression and evolution of a disease resistance gene cluster in soybean. (United States)

    Graham, Michelle A; Marek, Laura Fredrick; Shoemaker, Randy C


    PCR amplification was previously used to identify a cluster of resistance gene analogues (RGAs) on soybean linkage group J. Resistance to powdery mildew (Rmd-c), Phytophthora stem and root rot (Rps2), and an ineffective nodulation gene (Rj2) map within this cluster. BAC fingerprinting and RGA-specific primers were used to develop a contig of BAC clones spanning this region in cultivar "Williams 82" [rps2, Rmd (adult onset), rj2]. Two cDNAs with homology to the TIR/NBD/LRR family of R-genes have also been mapped to opposite ends of a BAC in the contig Gm_Isb001_091F11 (BAC 91F11). Sequence analyses of BAC 91F11 identified 16 different resistance-like gene (RLG) sequences with homology to the TIR/NBD/LRR family of disease resistance genes. Four of these RLGs represent two potentially novel classes of disease resistance genes: TIR/NBD domains fused inframe to a putative defense-related protein (NtPRp27-like) and TIR domains fused inframe to soybean calmodulin Ca(2+)-binding domains. RT-PCR analyses using gene-specific primers allowed us to monitor the expression of individual genes in different tissues and developmental stages. Three genes appeared to be constitutively expressed, while three were differentially expressed. Analyses of the R-genes within this BAC suggest that R-gene evolution in soybean is a complex and dynamic process. PMID:12524363

  4. The functional landscape of mouse gene expression

    Directory of Open Access Journals (Sweden)

    Zhang Wen


    Full Text Available Abstract Background Large-scale quantitative analysis of transcriptional co-expression has been used to dissect regulatory networks and to predict the functions of new genes discovered by genome sequencing in model organisms such as yeast. Although the idea that tissue-specific expression is indicative of gene function in mammals is widely accepted, it has not been objectively tested nor compared with the related but distinct strategy of correlating gene co-expression as a means to predict gene function. Results We generated microarray expression data for nearly 40,000 known and predicted mRNAs in 55 mouse tissues, using custom-built oligonucleotide arrays. We show that quantitative transcriptional co-expression is a powerful predictor of gene function. Hundreds of functional categories, as defined by Gene Ontology 'Biological Processes', are associated with characteristic expression patterns across all tissues, including categories that bear no overt relationship to the tissue of origin. In contrast, simple tissue-specific restriction of expression is a poor predictor of which genes are in which functional categories. As an example, the highly conserved mouse gene PWP1 is widely expressed across different tissues but is co-expressed with many RNA-processing genes; we show that the uncharacterized yeast homolog of PWP1 is required for rRNA biogenesis. Conclusions We conclude that 'functional genomics' strategies based on quantitative transcriptional co-expression will be as fruitful in mammals as they have been in simpler organisms, and that transcriptional control of mammalian physiology is more modular than is generally appreciated. Our data and analyses provide a public resource for mammalian functional genomics.

  5. Differential gene expression during Trypanosoma cruzi metacyclogenesis

    Directory of Open Access Journals (Sweden)

    Marco Aurelio Krieger


    Full Text Available The transformation of epimastigotes into metacyclic trypomastigotes involves changes in the pattern of expressed genes, resulting in important morphological and functional differences between these developmental forms of Trypanosoma cruzi. In order to identify and characterize genes involved in triggering the metacyclogenesis process and in conferring to metacyclic trypomastigotes their stage specific biological properties, we have developed a method allowing the isolation of genes specifically expressed when comparing two close related cell populations (representation of differential expression or RDE. The method is based on the PCR amplification of gene sequences selected by hybridizing and subtracting the populations in such a way that after some cycles of hybridization-amplification genes specific to a given population are highly enriched. The use of this method in the analysis of differential gene expression during T. cruzi metacyclogenesis (6 hr and 24 hr of differentiation and metacyclic trypomastigotes resulted in the isolation of several clones from each time point. Northern blot analysis showed that some genes are transiently expressed (6 hr and 24 hr differentiating cells, while others are present in differentiating cells and in metacyclic trypomastigotes. Nucleotide sequencing of six clones characterized so far showed that they do not display any homology to gene sequences available in the GeneBank.

  6. Multivariate search for differentially expressed gene combinations

    Directory of Open Access Journals (Sweden)

    Klebanov Lev


    Full Text Available Abstract Background To identify differentially expressed genes, it is standard practice to test a two-sample hypothesis for each gene with a proper adjustment for multiple testing. Such tests are essentially univariate and disregard the multidimensional structure of microarray data. A more general two-sample hypothesis is formulated in terms of the joint distribution of any sub-vector of expression signals. Results By building on an earlier proposed multivariate test statistic, we propose a new algorithm for identifying differentially expressed gene combinations. The algorithm includes an improved random search procedure designed to generate candidate gene combinations of a given size. Cross-validation is used to provide replication stability of the search procedure. A permutation two-sample test is used for significance testing. We design a multiple testing procedure to control the family-wise error rate (FWER when selecting significant combinations of genes that result from a successive selection procedure. A target set of genes is composed of all significant combinations selected via random search. Conclusions A new algorithm has been developed to identify differentially expressed gene combinations. The performance of the proposed search-and-testing procedure has been evaluated by computer simulations and analysis of replicated Affymetrix gene array data on age-related changes in gene expression in the inner ear of CBA mice.

  7. Gene Expression Profiling in Porcine Fetal Thymus

    Institute of Scientific and Technical Information of China (English)

    Yanjiong Chen; Shengbin Li; Lin Ye; Jianing Geng; Yajun Deng; Songnian Hu


    obtain an initial overview of gene diversity and expression pattern in porcinethymus, 11,712 ESTs (Expressed Sequence Tags) from 100-day-old porcine thymus(FTY) were sequenced and 7,071 cleaned ESTs were used for gene expressionanalysis. Clustered by the PHRAP program, 959 contigs and 3,074 singlets wereobtained. Blast search showed that 806 contigs and 1,669 singlets (totally 5,442ESTs) had homologues in GenBank and 1,629 ESTs were novel. According to theGene Ontology classification, 36.99% ESTs were cataloged into the gene expressiongroup, indicating that although the functional gene (18.78% in defense group) ofthymus is expressed in a certain degree, the 100-day-old porcine thymus still existsin a developmental stage. Comparative analysis showed that the gene expressionpattern of the 100-day-old porcine thymus is similar to that of the human infantthymus.

  8. Phytochrome-regulated Gene Expression

    Institute of Scientific and Technical Information of China (English)

    Peter H. Quail


    Identification of all genes involved in the phytochrome (phy)-mediated responses of plants to their light environment is an important goal in providing an overall understanding of light-regulated growth and development. This article highlights and integrates the central findings of two recent comprehensive studies in Arabidopsis that have identified the genome-wide set of phy-regulated genes that respond rapidly to red-light signals upon first exposure of dark-grown seedlings, and have tested the functional relevance to normal seedling photomorphogenesis of an initial subset of these genes. The data: (a) reveal considerable complexity in the channeling of the light signals through the different phy-family members (phyA to phyE) to responsive genes; (b) identify a diversity of transcription-factor-encoding genes as major early, if not primary, targets of phy signaling, and, therefore, as potentially important regulators in the transcriptional-network hierarchy; and (c) identify auxin-related genes as the dominant class among rapidly-regulated, hormone-related genes. However, reverse-genetic functional profiling of a selected subset of these genes reveals that only a limited fraction are necessary for optimal phy-induced seedling deetiolation.

  9. Nucleosome repositioning underlies dynamic gene expression. (United States)

    Nocetti, Nicolas; Whitehouse, Iestyn


    Nucleosome repositioning at gene promoters is a fundamental aspect of the regulation of gene expression. However, the extent to which nucleosome repositioning is used within eukaryotic genomes is poorly understood. Here we report a comprehensive analysis of nucleosome positions as budding yeast transit through an ultradian cycle in which expression of >50% of all genes is highly synchronized. We present evidence of extensive nucleosome repositioning at thousands of gene promoters as genes are activated and repressed. During activation, nucleosomes are relocated to allow sites of general transcription factor binding and transcription initiation to become accessible. The extent of nucleosome shifting is closely related to the dynamic range of gene transcription and generally related to DNA sequence properties and use of the coactivators TFIID or SAGA. However, dynamic gene expression is not limited to SAGA-regulated promoters and is an inherent feature of most genes. While nucleosome repositioning occurs pervasively, we found that a class of genes required for growth experience acute nucleosome shifting as cells enter the cell cycle. Significantly, our data identify that the ATP-dependent chromatin-remodeling enzyme Snf2 plays a fundamental role in nucleosome repositioning and the expression of growth genes. We also reveal that nucleosome organization changes extensively in concert with phases of the cell cycle, with large, regularly spaced nucleosome arrays being established in mitosis. Collectively, our data and analysis provide a framework for understanding nucleosome dynamics in relation to fundamental DNA-dependent transactions.

  10. Digital gene expression signatures for maize development. (United States)

    Eveland, Andrea L; Satoh-Nagasawa, Namiko; Goldshmidt, Alexander; Meyer, Sandra; Beatty, Mary; Sakai, Hajime; Ware, Doreen; Jackson, David


    Genome-wide expression signatures detect specific perturbations in developmental programs and contribute to functional resolution of key regulatory networks. In maize (Zea mays) inflorescences, mutations in the RAMOSA (RA) genes affect the determinacy of axillary meristems and thus alter branching patterns, an important agronomic trait. In this work, we developed and tested a framework for analysis of tag-based, digital gene expression profiles using Illumina's high-throughput sequencing technology and the newly assembled B73 maize reference genome. We also used a mutation in the RA3 gene to identify putative expression signatures specific to stem cell fate in axillary meristem determinacy. The RA3 gene encodes a trehalose-6-phosphate phosphatase and may act at the interface between developmental and metabolic processes. Deep sequencing of digital gene expression libraries, representing three biological replicate ear samples from wild-type and ra3 plants, generated 27 million 20- to 21-nucleotide reads with frequencies spanning 4 orders of magnitude. Unique sequence tags were anchored to 3'-ends of individual transcripts by DpnII and NlaIII digests, which were multiplexed during sequencing. We mapped 86% of nonredundant signature tags to the maize genome, which associated with 37,117 gene models and unannotated regions of expression. In total, 66% of genes were detected by at least nine reads in immature maize ears. We used comparative genomics to leverage existing information from Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) in functional analyses of differentially expressed maize genes. Results from this study provide a basis for the analysis of short-read expression data in maize and resolved specific expression signatures that will help define mechanisms of action for the RA3 gene.

  11. Gene expression profile of sprinter's muscle. (United States)

    Yoshioka, M; Tanaka, H; Shono, N; Shindo, M; St-Amand, J


    We have characterized the global gene expression profile in left vastus lateralis muscles of sprinters and sedentary men. The gene expression profile was analyzed by using serial analysis of gene expression (SAGE) method. The abundantly expressed transcripts in the sprinter's muscle were mainly involved in contraction and energy metabolism, whereas six transcripts were corresponding to potentially novel transcripts. Thirty-eight transcripts were differentially expressed between the sprinter and sedentary individuals. Moreover, sprinters showed higher expressions of both uncharacterized and potentially novel transcripts. Sprinters also highly expressed seven transcripts, such as glycine-rich protein, myosin heavy polypeptide (MYH) 2, expressed sequence tag similar to (EST) fructose-bisphosphate aldolase 1 isoform A (ALDOA), glyceraldehyde-3-phosphate dehydrogenase and ATP synthase F0 subunit 6. On the other hand, 20 transcripts such as MYH1, tropomyosin 2 and 3, troponin C slow, C2 fast, I slow, T1 slow and T3 fast, myoglobin, creatine kinase, ALDOA, glycogen phosphorylase, cytochrome c oxidase II and III, and NADH dehydrogenase 1 and 2 showed lower expression levels in the sprinters than the sedentary controls. The current study has characterized the global gene expressions in sprinters and identified a number of transcripts that can be subjected to further mechanistic analysis.

  12. Widespread ectopic expression of olfactory receptor genes

    Directory of Open Access Journals (Sweden)

    Yanai Itai


    Full Text Available Abstract Background Olfactory receptors (ORs are the largest gene family in the human genome. Although they are expected to be expressed specifically in olfactory tissues, some ectopic expression has been reported, with special emphasis on sperm and testis. The present study systematically explores the expression patterns of OR genes in a large number of tissues and assesses the potential functional implication of such ectopic expression. Results We analyzed the expression of hundreds of human and mouse OR transcripts, via EST and microarray data, in several dozens of human and mouse tissues. Different tissues had specific, relatively small OR gene subsets which had particularly high expression levels. In testis, average expression was not particularly high, and very few highly expressed genes were found, none corresponding to ORs previously implicated in sperm chemotaxis. Higher expression levels were more common for genes with a non-OR genomic neighbor. Importantly, no correlation in expression levels was detected for human-mouse orthologous pairs. Also, no significant difference in expression levels was seen between intact and pseudogenized ORs, except for the pseudogenes of subfamily 7E which has undergone a human-specific expansion. Conclusion The OR superfamily as a whole, show widespread, locus-dependent and heterogeneous expression, in agreement with a neutral or near neutral evolutionary model for transcription control. These results cannot reject the possibility that small OR subsets might play functional roles in different tissues, however considerable care should be exerted when offering a functional interpretation for ectopic OR expression based only on transcription information.

  13. Regulation of Gene Expression in Protozoa Parasites

    Directory of Open Access Journals (Sweden)

    Consuelo Gomez


    Full Text Available Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

  14. Expression of polarity genes in human cancer. (United States)

    Lin, Wan-Hsin; Asmann, Yan W; Anastasiadis, Panos Z


    Polarity protein complexes are crucial for epithelial apical-basal polarity and directed cell migration. Since alterations of these processes are common in cancer, polarity proteins have been proposed to function as tumor suppressors or oncogenic promoters. Here, we review the current understanding of polarity protein functions in epithelial homeostasis, as well as tumor formation and progression. As most previous studies focused on the function of single polarity proteins in simplified model systems, we used a genomics approach to systematically examine and identify the expression profiles of polarity genes in human cancer. The expression profiles of polarity genes were distinct in different human tissues and classified cancer types. Additionally, polarity expression profiles correlated with disease progression and aggressiveness, as well as with identified cancer types, where specific polarity genes were commonly altered. In the case of Scribble, gene expression analysis indicated its common amplification and upregulation in human cancer, suggesting a tumor promoting function.

  15. Regulation of meiotic gene expression in plants

    Directory of Open Access Journals (Sweden)

    Adele eZhou


    Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

  16. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis. (United States)

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana


    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.

  17. Gene expression profiling in autoimmune diseases

    DEFF Research Database (Denmark)

    Bovin, Lone Frier; Brynskov, Jørn; Hegedüs, Laszlo


    A central issue in autoimmune disease is whether the underlying inflammation is a repeated stereotypical process or whether disease specific gene expression is involved. To shed light on this, we analysed whether genes previously found to be differentially regulated in rheumatoid arthritis (RA...

  18. Bayesian modeling of differential gene expression. (United States)

    Lewin, Alex; Richardson, Sylvia; Marshall, Clare; Glazier, Anne; Aitman, Tim


    We present a Bayesian hierarchical model for detecting differentially expressing genes that includes simultaneous estimation of array effects, and show how to use the output for choosing lists of genes for further investigation. We give empirical evidence that expression-level dependent array effects are needed, and explore different nonlinear functions as part of our model-based approach to normalization. The model includes gene-specific variances but imposes some necessary shrinkage through a hierarchical structure. Model criticism via posterior predictive checks is discussed. Modeling the array effects (normalization) simultaneously with differential expression gives fewer false positive results. To choose a list of genes, we propose to combine various criteria (for instance, fold change and overall expression) into a single indicator variable for each gene. The posterior distribution of these variables is used to pick the list of genes, thereby taking into account uncertainty in parameter estimates. In an application to mouse knockout data, Gene Ontology annotations over- and underrepresented among the genes on the chosen list are consistent with biological expectations.

  19. Perspectives: Gene Expression in Fisheries Management (United States)

    Nielsen, Jennifer L.; Pavey, Scott A.


    Functional genes and gene expression have been connected to physiological traits linked to effective production and broodstock selection in aquaculture, selective implications of commercial fish harvest, and adaptive changes reflected in non-commercial fish populations subject to human disturbance and climate change. Gene mapping using single nucleotide polymorphisms (SNPs) to identify functional genes, gene expression (analogue microarrays and real-time PCR), and digital sequencing technologies looking at RNA transcripts present new concepts and opportunities in support of effective and sustainable fisheries. Genomic tools have been rapidly growing in aquaculture research addressing aspects of fish health, toxicology, and early development. Genomic technologies linking effects in functional genes involved in growth, maturation and life history development have been tied to selection resulting from harvest practices. Incorporating new and ever-increasing knowledge of fish genomes is opening a different perspective on local adaptation that will prove invaluable in wild fish conservation and management. Conservation of fish stocks is rapidly incorporating research on critical adaptive responses directed at the effects of human disturbance and climate change through gene expression studies. Genomic studies of fish populations can be generally grouped into three broad categories: 1) evolutionary genomics and biodiversity; 2) adaptive physiological responses to a changing environment; and 3) adaptive behavioral genomics and life history diversity. We review current genomic research in fisheries focusing on those that use microarrays to explore differences in gene expression among phenotypes and within or across populations, information that is critically important to the conservation of fish and their relationship to humans.

  20. Gene Expression Profiles of Inflammatory Myopathies

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap


    Full Text Available The simultaneous expression of 10,000 genes was measured, using Affymetrix GeneChip microarrays, in muscle specimens from 45 patients with various myopathies (dystrophy, congenital myopathy, and inflammatory myopathy examined at Brigham and Women’s Hospital, and Children’s Hospital, Harvard Medical School, Boston, MA.

  1. Translational control of gene expression and disease

    NARCIS (Netherlands)

    Calkhoven, Cornelis F; Müller, Christine; Leutz, Achim


    In the past decade, translational control has been shown to be crucial in the regulation of gene expression. Research in this field has progressed rapidly, revealing new control mechanisms and adding constantly to the list of translationally regulated genes. There is accumulating evidence that trans

  2. Inferring gene networks from discrete expression data

    KAUST Repository

    Zhang, L.


    The modeling of gene networks from transcriptional expression data is an important tool in biomedical research to reveal signaling pathways and to identify treatment targets. Current gene network modeling is primarily based on the use of Gaussian graphical models applied to continuous data, which give a closedformmarginal likelihood. In this paper,we extend network modeling to discrete data, specifically data from serial analysis of gene expression, and RNA-sequencing experiments, both of which generate counts of mRNAtranscripts in cell samples.We propose a generalized linear model to fit the discrete gene expression data and assume that the log ratios of the mean expression levels follow a Gaussian distribution.We restrict the gene network structures to decomposable graphs and derive the graphs by selecting the covariance matrix of the Gaussian distribution with the hyper-inverse Wishart priors. Furthermore, we incorporate prior network models based on gene ontology information, which avails existing biological information on the genes of interest. We conduct simulation studies to examine the performance of our discrete graphical model and apply the method to two real datasets for gene network inference. © The Author 2013. Published by Oxford University Press. All rights reserved.

  3. Gene expression studies using microarrays

    NARCIS (Netherlands)

    Burgess, Janette


    1. The rapid progression of the collaborative sequencing programmes that are unravelling the complete genome sequences of many organisms are opening pathways for new approaches to gene analysis. As the sequence data become available, the bottleneck in biological research will shift to understanding

  4. Insulin gene: organisation, expression and regulation. (United States)

    Dumonteil, E; Philippe, J


    Insulin, a major hormone of the endocrine pancreas, plays a key role in the control of glucose homeostasis. This review discusses the mechanisms of cell-specific expression and regulation of the insulin gene. Whereas expression is restricted to islet beta-cells in adults, the insulin gene is more widely expressed at several embryonic stages, although the role of extrapancreatic expression is still unclear. beta-cell-specific expression relies on the interactions of 5'-flanking sequence motifs of the promoter with a number of ubiquitous and islet-specific transcription factors. IEF1 and IPF-1, by their binding to the E and A boxes, respectively, of the insulin gene promoter, appear to be the major determinants of beta-cell-specific expression. IEF1 is a heterodimer of the basic helix-loop-helix family of transcription factors, whereas IPF-1 belongs to the homeodomain-containing family. beta-cell specific determinants are conserved throughout evolution, although the human insulin gene 5'-flanking sequence also contains a polymorphic minisatellite which is unique to primates and may play a role in insulin gene regulation. Glucose modulates insulin gene transcription, with multiple elements of the promoter involved in glucose responsiveness. Remarkably, IPF-1 and IEF1 are involved in both beta-cell-specific expression and glucose regulation of the insulin gene. cAMP also regulates insulin gene transcription through a CRE, in response to various hormonal stimuli. On the whole, recent studies have provided a better understanding of beta-cell differentiation and function.

  5. Application of multidisciplinary analysis to gene expression.

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xuefel (University of New Mexico, Albuquerque, NM); Kang, Huining (University of New Mexico, Albuquerque, NM); Fields, Chris (New Mexico State University, Las Cruces, NM); Cowie, Jim R. (New Mexico State University, Las Cruces, NM); Davidson, George S.; Haaland, David Michael; Sibirtsev, Valeriy (New Mexico State University, Las Cruces, NM); Mosquera-Caro, Monica P. (University of New Mexico, Albuquerque, NM); Xu, Yuexian (University of New Mexico, Albuquerque, NM); Martin, Shawn Bryan; Helman, Paul (University of New Mexico, Albuquerque, NM); Andries, Erik (University of New Mexico, Albuquerque, NM); Ar, Kerem (University of New Mexico, Albuquerque, NM); Potter, Jeffrey (University of New Mexico, Albuquerque, NM); Willman, Cheryl L. (University of New Mexico, Albuquerque, NM); Murphy, Maurice H. (University of New Mexico, Albuquerque, NM)


    Molecular analysis of cancer, at the genomic level, could lead to individualized patient diagnostics and treatments. The developments to follow will signal a significant paradigm shift in the clinical management of human cancer. Despite our initial hopes, however, it seems that simple analysis of microarray data cannot elucidate clinically significant gene functions and mechanisms. Extracting biological information from microarray data requires a complicated path involving multidisciplinary teams of biomedical researchers, computer scientists, mathematicians, statisticians, and computational linguists. The integration of the diverse outputs of each team is the limiting factor in the progress to discover candidate genes and pathways associated with the molecular biology of cancer. Specifically, one must deal with sets of significant genes identified by each method and extract whatever useful information may be found by comparing these different gene lists. Here we present our experience with such comparisons, and share methods developed in the analysis of an infant leukemia cohort studied on Affymetrix HG-U95A arrays. In particular, spatial gene clustering, hyper-dimensional projections, and computational linguistics were used to compare different gene lists. In spatial gene clustering, different gene lists are grouped together and visualized on a three-dimensional expression map, where genes with similar expressions are co-located. In another approach, projections from gene expression space onto a sphere clarify how groups of genes can jointly have more predictive power than groups of individually selected genes. Finally, online literature is automatically rearranged to present information about genes common to multiple groups, or to contrast the differences between the lists. The combination of these methods has improved our understanding of infant leukemia. While the complicated reality of the biology dashed our initial, optimistic hopes for simple answers from

  6. Fingerprint detection

    Energy Technology Data Exchange (ETDEWEB)

    Saunders, G.C.


    This patent describes a method for detection and visualization of latent fingerprints. It comprises contacting a substrate containing a latent print thereon the a colloidal metal composition at a pH from about 2.5 to about 4.0 for time sufficient to allow reaction of the colloidal metal composition with the latent print; and, preserving or recording the observable print.

  7. Gene expression profiling: can we identify the right target genes?

    Directory of Open Access Journals (Sweden)

    J. E. Loyd


    Full Text Available Gene expression profiling allows the simultaneous monitoring of the transcriptional behaviour of thousands of genes, which may potentially be involved in disease development. Several studies have been performed in idiopathic pulmonary fibrosis (IPF, which aim to define genetic links to the disease in an attempt to improve the current understanding of the underlying pathogenesis of the disease and target pathways for intervention. Expression profiling has shown a clear difference in gene expression between IPF and normal lung tissue, and has identified a wide range of candidate genes, including those known to encode for proteins involved in extracellular matrix formation and degradation, growth factors and chemokines. Recently, familial pulmonary fibrosis cohorts have been examined in an attempt to detect specific genetic mutations associated with IPF. To date, these studies have identified families in which IPF is associated with mutations in the gene encoding surfactant protein C, or with mutations in genes encoding components of telomerase. Although rare and clearly not responsible for the disease in all individuals, the nature of these mutations highlight the importance of the alveolar epithelium in disease pathogenesis and demonstrate the potential for gene expression profiling in helping to advance the current understanding of idiopathic pulmonary fibrosis.

  8. Regulation of immunoglobulin gene rearrangement and expression. (United States)

    Taussig, M J; Sims, M J; Krawinkel, U


    The molecular genetic events leading to Ig expression and their control formed the topic of a recent EMBO workshop. This report by Michael Taussig, Martin Sims and Ulrich Krawinkel discusses contributions dealing with genes expressed in early pre-B cells, the mechanism of rearrangement, aberrant rearrangements seen in B cells of SCID mice, the feedback control of rearrangement as studied in transgenic mice, the control of Ig expression at the transcriptional and post-transcriptional levels, and class switching.

  9. Vitamin D-mediated gene expression. (United States)

    Lowe, K E; Maiyar, A C; Norman, A W


    The steroid hormone 1,25(OH)2D3 modulates the expression of a wide variety of genes in a tissue- and developmentally specific manner. It is well established that 1,25(OH)2D3 can up- or downregulate the expression of genes involved in cell proliferation, differentiation, and mineral homeostasis. The hormone exerts its genomic effects via interactions with the vitamin D receptor or VDR, a member of the superfamily of hormone-activated nuclear receptors which can regulate eukaryotic gene expression. The ligand-bound receptor acts as a transcription factor that binds to specific DNA sequences, HREs, in target gene promoters. The DNA-binding domains of the steroid hormone receptors are highly conserved and contain two zinc-finger motifs that recognize the HREs. The spacing and orientation of the HRE half-sites, as well as the HRE sequence, are critical for proper discrimination by the various receptors. Other nuclear factors such as fos and jun can influence vitamin D-mediated gene expression. A wide range of experimental techniques has been used to increase our understanding of how 1,25(OH)2D3 and its receptor play a central role in gene expression.

  10. Modulation of imprinted gene expression following superovulation. (United States)

    Fortier, Amanda L; McGraw, Serge; Lopes, Flavia L; Niles, Kirsten M; Landry, Mylène; Trasler, Jacquetta M


    Although assisted reproductive technologies increase the risk of low birth weight and genomic imprinting disorders, the precise underlying causes remain unclear. Using a mouse model, we previously showed that superovulation alters the expression of imprinted genes in the placenta at 9.5days (E9.5) of gestation. Here, we investigate whether effects of superovulation on genomic imprinting persisted at later stages of development and assess the surviving fetuses for growth and morphological abnormalities. Superovulation, followed by embryo transfer at E3.5, as compared to spontaneous ovulation (controls), resulted in embryos of normal size and weight at 14.5 and 18.5days of gestation. The normal monoallelic expression of the imprinted genes H19, Snrpn and Kcnq1ot1 was unaffected in either the placentae or the embryos from the superovulated females at E14.5 or E18.5. However, for the paternally expressed imprinted gene Igf2, superovulation generated placentae with reduced production of the mature protein at E9.5 and significantly more variable mRNA levels at E14.5. We propose that superovulation results in the ovulation of abnormal oocytes with altered expression of imprinted genes, but that the coregulated genes of the imprinted gene network result in modulated expression. Copyright © 2014. Published by Elsevier Ireland Ltd.

  11. Gene expression of the endolymphatic sac. (United States)

    Friis, Morten; Martin-Bertelsen, Tomas; Friis-Hansen, Lennart; Winther, Ole; Henao, Ricardo; Sørensen, Mads Sølvsten; Qvortrup, Klaus


    The endolymphatic sac is part of the membranous inner ear and is thought to play a role in the fluid homeostasis and immune defense of the inner ear; however, the exact function of the endolymphatic sac is not fully known. Many of the detected mRNAs in this study suggest that the endolymphatic sac has multiple and diverse functions in the inner ear. The objective of this study was to provide a comprehensive review of the genes expressed in the endolymphatic sac in the rat and perform a functional characterization based on measured mRNA abundance. Microarray technology was used to investigate the gene expression of the endolymphatic sac with the surrounding dura. Characteristic and novel endolymphatic sac genes were determined by comparing with expressions in pure dura. In all, 463 genes were identified specific for the endolymphatic sac. Functional annotation clustering revealed 29 functional clusters.

  12. Regulation of gene expression in human tendinopathy (United States)


    Background Chronic tendon injuries, also known as tendinopathies, are common among professional and recreational athletes. These injuries result in a significant amount of morbidity and health care expenditure, yet little is known about the molecular mechanisms leading to tendinopathy. Methods We have used histological evaluation and molecular profiling to determine gene expression changes in 23 human patients undergoing surgical procedures for the treatment of chronic tendinopathy. Results Diseased tendons exhibit altered extracellular matrix, fiber disorientation, increased cellular content and vasculature, and the absence of inflammatory cells. Global gene expression profiling identified 983 transcripts with significantly different expression patterns in the diseased tendons. Global pathway analysis further suggested altered expression of extracellular matrix proteins and the lack of an appreciable inflammatory response. Conclusions Identification of the pathways and genes that are differentially regulated in tendinopathy samples will contribute to our understanding of the disease and the development of novel therapeutics. PMID:21539748

  13. Noise minimization in eukaryotic gene expression.

    Directory of Open Access Journals (Sweden)

    Hunter B Fraser


    Full Text Available All organisms have elaborate mechanisms to control rates of protein production. However, protein production is also subject to stochastic fluctuations, or "noise." Several recent studies in Saccharomyces cerevisiae and Escherichia coli have investigated the relationship between transcription and translation rates and stochastic fluctuations in protein levels, or more generally, how such randomness is a function of intrinsic and extrinsic factors. However, the fundamental question of whether stochasticity in protein expression is generally biologically relevant has not been addressed, and it remains unknown whether random noise in the protein production rate of most genes significantly affects the fitness of any organism. We propose that organisms should be particularly sensitive to variation in the protein levels of two classes of genes: genes whose deletion is lethal to the organism and genes that encode subunits of multiprotein complexes. Using an experimentally verified model of stochastic gene expression in S. cerevisiae, we estimate the noise in protein production for nearly every yeast gene, and confirm our prediction that the production of essential and complex-forming proteins involves lower levels of noise than does the production of most other genes. Our results support the hypothesis that noise in gene expression is a biologically important variable, is generally detrimental to organismal fitness, and is subject to natural selection.

  14. Noise minimization in eukaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Fraser, Hunter B.; Hirsh, Aaron E.; Giaever, Guri; Kumm, Jochen; Eisen, Michael B.


    All organisms have elaborate mechanisms to control rates of protein production. However, protein production is also subject to stochastic fluctuations, or noise. Several recent studies in Saccharomyces cerevisiae and Escherichia coli have investigated the relationship between transcription and translation rates and stochastic fluctuations in protein levels, or more generally, how such randomness is a function of intrinsic and extrinsic factors. However, the fundamental question of whether stochasticity in protein expression is generally biologically relevant has not been addressed, and it remains unknown whether random noise in the protein production rate of most genes significantly affects the fitness of any organism. We propose that organisms should be particularly sensitive to variation in the protein levels of two classes of genes: genes whose deletion is lethal to the organism and genes that encode subunits of multiprotein complexes. Using an experimentally verified model of stochastic gene expression in S. cerevisiae, we estimate the noise in protein production for nearly every yeast gene, and confirm our prediction that the production of essential and complex-forming proteins involves lower levels of noise than does the production of most other genes. Our results support the hypothesis that noise in gene expression is a biologically important variable, is generally detrimental to organismal fitness, and is subject to natural selection.

  15. Paternally expressed genes predominate in the placenta. (United States)

    Wang, Xu; Miller, Donald C; Harman, Rebecca; Antczak, Douglas F; Clark, Andrew G


    The discovery of genomic imprinting through studies of manipulated mouse embryos indicated that the paternal genome has a major influence on placental development. However, previous research has not demonstrated paternal bias in imprinted genes. We applied RNA sequencing to trophoblast tissue from reciprocal hybrids of horse and donkey, where genotypic differences allowed parent-of-origin identification of most expressed genes. Using this approach, we identified a core group of 15 ancient imprinted genes, of which 10 were paternally expressed. An additional 78 candidate imprinted genes identified by RNA sequencing also showed paternal bias. Pyrosequencing was used to confirm the imprinting status of six of the genes, including the insulin receptor (INSR), which may play a role in growth regulation with its reciprocally imprinted ligand, histone acetyltransferase-1 (HAT1), a gene involved in chromatin modification, and lymphocyte antigen 6 complex, locus G6C, a newly identified imprinted gene in the major histocompatibility complex. The 78 candidate imprinted genes displayed parent-of-origin expression bias in placenta but not fetus, and most showed less than 100% silencing of the imprinted allele. Some displayed variability in imprinting status among individuals. This variability results in a unique epigenetic signature for each placenta that contributes to variation in the intrauterine environment and thus presents the opportunity for natural selection to operate on parent-of-origin differential regulation. Taken together, these features highlight the plasticity of imprinting in mammals and the central importance of the placenta as a target tissue for genomic imprinting.

  16. Gene expression profiling of solitary fibrous tumors.

    Directory of Open Access Journals (Sweden)

    François Bertucci

    Full Text Available BACKGROUND: Solitary fibrous tumors (SFTs are rare spindle-cell tumors. Their cell-of-origin and molecular basis are poorly known. They raise several clinical problems. Differential diagnosis may be difficult, prognosis is poorly apprehended by histoclinical features, and no effective therapy exists for advanced stages. METHODS: We profiled 16 SFT samples using whole-genome DNA microarrays and analyzed their expression profiles with publicly available profiles of 36 additional SFTs and 212 soft tissue sarcomas (STSs. Immunohistochemistry was applied to validate the expression of some discriminating genes. RESULTS: SFTs displayed whole-genome expression profiles more homogeneous and different from STSs, but closer to genetically-simple than genetically-complex STSs. The SFTs/STSs comparison identified a high percentage (∼30% of genes as differentially expressed, most of them without any DNA copy number alteration. One of the genes most overexpressed in SFTs encoded the ALDH1 stem cell marker. Several upregulated genes and associated ontologies were also related to progenitor/stem cells. SFTs also overexpressed genes encoding therapeutic targets such as kinases (EGFR, ERBB2, FGFR1, JAK2, histone deacetylases, or retinoic acid receptors. Their overexpression was found in all SFTs, regardless the anatomical location. Finally, we identified a 31-gene signature associated with the mitotic count, containing many genes related to cell cycle/mitosis, including AURKA. CONCLUSION: We established a robust repertoire of genes differentially expressed in SFTs. Certain overexpressed genes could provide new diagnostic (ALDH1A1, prognostic (AURKA and/or therapeutic targets.

  17. Soybean physiology and gene expression during drought. (United States)

    Stolf-Moreira, R; Medri, M E; Neumaier, N; Lemos, N G; Pimenta, J A; Tobita, S; Brogin, R L; Marcelino-Guimarães, F C; Oliveira, M C N; Farias, J R B; Abdelnoor, R V; Nepomuceno, A L


    Soybean genotypes MG/BR46 (Conquista) and BR16, drought-tolerant and -sensitive, respectively, were compared in terms of morphophysiological and gene-expression responses to water stress during two stages of development. Gene-expression analysis showed differential responses in Gmdreb1a and Gmpip1b mRNA expression within 30 days of water-deficit initiation in MG/BR46 (Conquista) plants. Within 45 days of initiating stress, Gmp5cs and Gmpip1b had relatively higher expression. Initially, BR16 showed increased expression only for Gmdreb1a, and later (45 days) for Gmp5cs, Gmdefensin and Gmpip1b. Only BR16 presented down-regulated expression of genes, such as Gmp5cs and Gmpip1b, 30 days after the onset of moisture stress, and Gmgols after 45 days of stress. The faster perception of water stress in MG/BR46 (Conquista) and the better maintenance of up-regulated gene expression than in the sensitive BR16 genotype imply mechanisms by which the former is better adapted to tolerate moisture deficiency.

  18. Fingerprint recognition using standardized fingerprint model

    CERN Document Server

    Thai, Le Hoang


    Fingerprint recognition is one of most popular and accuracy Biometric technologies. Nowadays, it is used in many real applications. However, recognizing fingerprints in poor quality images is still a very complex problem. In recent years, many algorithms, models...are given to improve the accuracy of recognition system. This paper discusses on the standardized fingerprint model which is used to synthesize the template of fingerprints. In this model, after pre-processing step, we find the transformation between templates, adjust parameters, synthesize fingerprint, and reduce noises. Then, we use the final fingerprint to match with others in FVC2004 fingerprint database (DB4) to show the capability of the model.

  19. Early gene expression changes with rush immunotherapy

    Directory of Open Access Journals (Sweden)

    Barnett Sherry


    Full Text Available Abstract Background To examine whether whole genome expression profiling could reveal changes in mRNA expression of peripheral blood mononuclear cells (PBMC from allergic patients undergoing rush immunotherapy (RIT that might be manifest within the first few months of treatment. Methods For this study, PBMC from three allergic patients undergoing RIT were assessed at four timepoints: prior to RIT, at 1 week and 7 week post-RIT, during build-up and at 4 months, after establishment of a maintenance dose. PBMC mRNA gene expression changes over time were determined by oligonucleotide microarrays using the Illumina Human-6 BeadChip Platform, which simultaneously interrogates expression profiles of > 47,000 transcripts. Differentially expressed genes were identified using well-established statistical analysis for microarrays. In addition, we analyzed peripheral blood basophil high-affinity IgE receptor (Fc epsilon RI expression and T-regulatory cell frequency as detected by expression of CD3+CD4+CD25bright cells at each timepoint using flow cytometry. Results In comparing the initial 2 timepoints with the final 2 timepoints and analyzing for genes with ≥1.5-fold expression change (p less than or equal to 0.05, BH-FDR, we identified 507 transcripts. At a 2-fold change (p less than or equal to 0.05, BH-FDR, we found 44 transcripts. Of these, 28 were up-regulated and 16 were down-regulated genes. From these datasets, we have identified changes in immunologically relevant genes from both the innate and adaptive response with upregulation of expressed genes for molecules including IL-1β, IL-8, CD40L, BTK and BCL6. At the 4 month timepoint, we noted a downward trend in Fc epsilon RI expression in each of the three patients and increased allergen-specific IgG4 levels. No change was seen in the frequency of peripheral T-regulatory cells expressed over the four timepoints. Conclusions We observed significant changes in gene expression early in peripheral

  20. Historeceptomic fingerprints for drug-like compounds

    Directory of Open Access Journals (Sweden)

    Evgeny eShmelkov


    Full Text Available Most drugs exert their beneficial and adverse effects through their combined action on several different molecular targets (polypharmacology. The true molecular fingerprint of the direct action of a drug has two components: the ensemble of all the receptors upon which a drug acts and their level of expression in organs/tissues. Conversely, the fingerprint of the adverse effects of a drug may derive from its action in bystander tissues. The ensemble of targets is almost always only partially known. Here we describe an approach improving upon and integrating both components: in silico identification of a more comprehensive ensemble of targets for any drug weighted by the expression of those receptors in relevant tissues. Our system combines more than 300K experimentally determined bioactivity values from the ChEMBL database and 4.2 billion generated molecular docking scores. We integrated these scores with gene expression data for human receptors across a panel of human tissues to produce drug-specific tissue-receptor (historeceptomics scores. A statistical model was designed to identify significant scores, which define an improved fingerprint representing the unique activity of any drug. These multi-dimensional historeceptomic fingerprints describe, in a novel, intuitive, and easy to interpret style, the holistic picture of the mechanism of any drug’s action. Valuable applications in drug discovery and personalized medicine, including the identification of molecular signatures for drugs with polypharmacologic modes of action, detection of tissue-specific adverse effects of drugs, matching molecular signatures of a disease to drugs, target identification for bioactive compounds with unknown receptors, and hypothesis generation for drug/compound phenotypes may be enabled by this approach. The system has been deployed at for access through a user-friendly web site.

  1. Alternative-splicing-mediated gene expression (United States)

    Wang, Qianliang; Zhou, Tianshou


    Alternative splicing (AS) is a fundamental process during gene expression and has been found to be ubiquitous in eukaryotes. However, how AS impacts gene expression levels both quantitatively and qualitatively remains to be fully explored. Here, we analyze two common models of gene expression, each incorporating a simple splice mechanism that a pre-mRNA is spliced into two mature mRNA isoforms in a probabilistic manner. In the constitutive expression case, we show that the steady-state molecular numbers of two mature mRNA isoforms follow mutually independent Poisson distributions. In the bursting expression case, we demonstrate that the tail decay of the steady-state distribution for both mature mRNA isoforms that in general are not mutually independent can be characterized by the product of mean burst size and splicing probability. In both cases, we find that AS can efficiently modulate both the variability (measured by variance) and the noise level of the total mature mRNA, and in particular, the latter is always lower than the noise level of the pre-mRNA, implying that AS always reduces the noise. These results altogether reveal that AS is a mechanism of efficiently controlling the gene expression noise.

  2. Gene expression profiling for targeted cancer treatment. (United States)

    Yuryev, Anton


    There is certain degree of frustration and discontent in the area of microarray gene expression data analysis of cancer datasets. It arises from the mathematical problem called 'curse of dimensionality,' which is due to the small number of samples available in training sets, used for calculating transcriptional signatures from the large number of differentially expressed (DE) genes, measured by microarrays. The new generation of causal reasoning algorithms can provide solutions to the curse of dimensionality by transforming microarray data into activity of a small number of cancer hallmark pathways. This new approach can make feature space dimensionality optimal for mathematical signature calculations. The author reviews the reasons behind the current frustration with transcriptional signatures derived from DE genes in cancer. He also provides an overview of the novel methods for signature calculations based on differentially variable genes and expression regulators. Furthermore, the authors provide perspectives on causal reasoning algorithms that use prior knowledge about regulatory events described in scientific literature to identify expression regulators responsible for the differential expression observed in cancer samples. The author advocates causal reasoning methods to calculate cancer pathway activity signatures. The current challenge for these algorithms is in ensuring quality of the knowledgebase. Indeed, the development of cancer hallmark pathway collections, together with statistical algorithms to transform activity of expression regulators into pathway activity, are necessary for causal reasoning to be used in cancer research.

  3. Predicting metastasized seminoma using gene expression. (United States)

    Ruf, Christian G; Linbecker, Michael; Port, Matthias; Riecke, Armin; Schmelz, Hans U; Wagner, Walter; Meineke, Victor; Abend, Michael


    Treatment options for testis cancer depend on the histological subtype as well as on the clinical stage. An accurate staging is essential for correct treatment. The 'golden standard' for staging purposes is CT, but occult metastasis cannot be detected with this method. Currently, parameters such as primary tumour size, vessel invasion or invasion of the rete testis are used for predicting occult metastasis. Last year the association of these parameters with metastasis could not be validated in a new independent cohort. Gene expression analysis in testis cancer allowed discrimination between the different histological subtypes (seminoma and non-seminoma) as well as testis cancer and normal testis tissue. In a two-stage study design we (i) screened the whole genome (using human whole genome microarrays) for candidate genes associated with the metastatic stage in seminoma and (ii) validated and quantified gene expression of our candidate genes (real-time quantitative polymerase chain reaction) on another independent group. Gene expression measurements of two of our candidate genes (dopamine receptor D1 [DRD1] and family with sequence similarity 71, member F2 [FAM71F2]) examined in primary testis cancers made it possible to discriminate the metastasis status in seminoma. The discriminative ability of the genes exceeded the predictive significance of currently used histological/pathological parameters. Based on gene expression analysis the present study provides suggestions for improved individual decision making either in favour of early adjuvant therapy or increased surveillance. To evaluate the usefulness of gene expression profiling for predicting metastatic status in testicular seminoma at the time of first diagnosis compared with established clinical and pathological parameters. Total RNA was isolated from testicular tumours of metastasized patients (12 patients, clinical stage IIa-III), non-metastasized patients (40, clinical stage I) and adjacent 'normal' tissue

  4. Gene expression profiles in skeletal muscle after gene electrotransfer

    DEFF Research Database (Denmark)

    Hojman, Pernille; Zibert, John R; Gissel, Hanne;


    with the control muscles. Most interestingly, no changes in the expression of proteins involved in inflammatory responses or muscle regeneration was detected, indicating limited muscle damage and regeneration. Histological analysis revealed structural changes with loss of cell integrity and striation pattern......BACKGROUND: Gene transfer by electroporation (DNA electrotransfer) to muscle results in high level long term transgenic expression, showing great promise for treatment of e.g. protein deficiency syndromes. However little is known about the effects of DNA electrotransfer on muscle fibres. We have......) followed by a long low voltage pulse (LV, 100 V/cm, 400 ms); a pulse combination optimised for efficient and safe gene transfer. Muscles were transfected with green fluorescent protein (GFP) and excised at 4 hours, 48 hours or 3 weeks after treatment. RESULTS: Differentially expressed genes were...

  5. Gene expression analysis of flax seed development

    Directory of Open Access Journals (Sweden)

    Sharpe Andrew


    Full Text Available Abstract Background Flax, Linum usitatissimum L., is an important crop whose seed oil and stem fiber have multiple industrial applications. Flax seeds are also well-known for their nutritional attributes, viz., omega-3 fatty acids in the oil and lignans and mucilage from the seed coat. In spite of the importance of this crop, there are few molecular resources that can be utilized toward improving seed traits. Here, we describe flax embryo and seed development and generation of comprehensive genomic resources for the flax seed. Results We describe a large-scale generation and analysis of expressed sequences in various tissues. Collectively, the 13 libraries we have used provide a broad representation of genes active in developing embryos (globular, heart, torpedo, cotyledon and mature stages seed coats (globular and torpedo stages and endosperm (pooled globular to torpedo stages and genes expressed in flowers, etiolated seedlings, leaves, and stem tissue. A total of 261,272 expressed sequence tags (EST (GenBank accessions LIBEST_026995 to LIBEST_027011 were generated. These EST libraries included transcription factor genes that are typically expressed at low levels, indicating that the depth is adequate for in silico expression analysis. Assembly of the ESTs resulted in 30,640 unigenes and 82% of these could be identified on the basis of homology to known and hypothetical genes from other plants. When compared with fully sequenced plant genomes, the flax unigenes resembled poplar and castor bean more than grape, sorghum, rice or Arabidopsis. Nearly one-fifth of these (5,152 had no homologs in sequences reported for any organism, suggesting that this category represents genes that are likely unique to flax. Digital analyses revealed gene expression dynamics for the biosynthesis of a number of important seed constituents during seed development. Conclusions We have developed a foundational database of expressed sequences and collection of plasmid

  6. Lithium ions induce prestalk-associated gene expression and inhibit prespore gene expression in Dictyostelium discoideum

    NARCIS (Netherlands)

    Peters, Dorien J.M.; Lookeren Campagne, Michiel M. van; Haastert, Peter J.M. van; Spek, Wouter; Schaap, Pauline


    We investigated the effect of Li+ on two types of cyclic AMP-regulated gene expression and on basal and cyclic AMP-stimulated inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) levels. Li+ effectively inhibits cyclic AMP-induced prespore gene expression, half-maximal inhibition occurring at about 2mM-LiCl.

  7. Polyandry and sex-specific gene expression. (United States)

    Mank, Judith E; Wedell, Nina; Hosken, David J


    Polyandry is widespread in nature, and has important evolutionary consequences for the evolution of sexual dimorphism and sexual conflict. Although many of the phenotypic consequences of polyandry have been elucidated, our understanding of the impacts of polyandry and mating systems on the genome is in its infancy. Polyandry can intensify selection on sexual characters and generate more intense sexual conflict. This has consequences for sequence evolution, but also for sex-biased gene expression, which acts as a link between mating systems, sex-specific selection and the evolution of sexual dimorphism. We discuss this and the remarkable confluence of sexual-conflict theory and patterns of gene expression, while also making predictions about transcription patterns, mating systems and sexual conflict. Gene expression is a key link in the genotype-phenotype chain, and although in its early stages, understanding the sexual selection-transcription relationship will provide significant insights into this critical association.

  8. Visualizing Gene Expression In Situ

    Energy Technology Data Exchange (ETDEWEB)

    Burlage, R.S.


    Visualizing bacterial cells and describing their responses to the environment are difficult tasks. Their small size is the chief reason for the difficulty, which means that we must often use many millions of cells in a sample in order to determine what the average response of the bacteria is. However, an average response can sometimes mask important events in bacterial physiology, which means that our understanding of these organisms will suffer. We have used a variety of instruments to visualize bacterial cells, all of which tell us something different about the sample. We use a fluorescence activated cell sorter to sort cells based on the fluorescence provided by bioreporter genes, and these can be used to select for particular genetic mutations. Cells can be visualized by epifluorescent microscopy, and sensitive photodetectors can be added that allow us to find a single bacterial cell that is fluorescent or bioluminescent. We have also used standard photomultipliers to examine cell aggregates as field bioreporter microorganisms. Examples of each of these instruments show how our understanding of bacterial physiology has changed with the technology.

  9. Gene expression profiles in irradiated cancer cells (United States)

    Minafra, L.; Bravatà, V.; Russo, G.; Ripamonti, M.; Gilardi, M. C.


    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses.

  10. Gene expression profiles in irradiated cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Minafra, L.; Bravatà, V.; Russo, G.; Ripamonti, M.; Gilardi, M. C. [IBFM CNR - LATO, Cefalù, Segrate (Italy)


    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses.

  11. Gene Expression in the Human Endolymphatic Sac

    DEFF Research Database (Denmark)

    Møller, Martin Nue; Kirkeby, Svend; Vikeså, Jonas


    OBJECTIVES/HYPOTHESIS: The purpose of the present study is to explore, demonstrate, and describe the expression of genes related to the solute carrier (SLC) molecules of ion transporters in the human endolymphatic sac. STUDY DESIGN: cDNA microarrays and immunohistochemistry were used for analyses...... of fresh human endolymphatic sac tissue samples. METHODS: Twelve tissue samples of the human endolymphatic sac were obtained during translabyrinthine surgery for vestibular schwannoma. Microarray technology was used to investigate tissue sample expression of solute carrier family genes, using adjacent dura...... mater as control. Immunohistochemistry was used for verification of translation of selected genes, as well as localization of the specific protein within the sac. RESULTS: An extensive representation of the SLC family genes were upregulated in the human endolymphatic sac, including SLC26a4 Pendrin, SLC4...

  12. Cognitive Fingerprints (United States)


    approaches vary but most involve machine learning and data mining techniques and specific computational methods will be highlighted. Digital traces from...dynamics (which are a behavioral biometric) with linguistic features (Juola et al. 2013). Linguistic features include lexical statis- tics (e.g., word...concerning aggregated features suggesting the possibility of similar computational approaches in cap- turing a cognitive fingerprint. Prior work in Web

  13. Fingerprint Segmentation


    Jomaa, Diala


    In this thesis, a new algorithm has been proposed to segment the foreground of the fingerprint from the image under consideration. The algorithm uses three features, mean, variance and coherence. Based on these features, a rule system is built to help the algorithm to efficiently segment the image. In addition, the proposed algorithm combine split and merge with modified Otsu. Both enhancements techniques such as Gaussian filter and histogram equalization are applied to enhance and improve th...

  14. Extracting expression modules from perturbational gene expression compendia

    Directory of Open Access Journals (Sweden)

    Van Dijck Patrick


    Full Text Available Abstract Background Compendia of gene expression profiles under chemical and genetic perturbations constitute an invaluable resource from a systems biology perspective. However, the perturbational nature of such data imposes specific challenges on the computational methods used to analyze them. In particular, traditional clustering algorithms have difficulties in handling one of the prominent features of perturbational compendia, namely partial coexpression relationships between genes. Biclustering methods on the other hand are specifically designed to capture such partial coexpression patterns, but they show a variety of other drawbacks. For instance, some biclustering methods are less suited to identify overlapping biclusters, while others generate highly redundant biclusters. Also, none of the existing biclustering tools takes advantage of the staple of perturbational expression data analysis: the identification of differentially expressed genes. Results We introduce a novel method, called ENIGMA, that addresses some of these issues. ENIGMA leverages differential expression analysis results to extract expression modules from perturbational gene expression data. The core parameters of the ENIGMA clustering procedure are automatically optimized to reduce the redundancy between modules. In contrast to the biclusters produced by most other methods, ENIGMA modules may show internal substructure, i.e. subsets of genes with distinct but significantly related expression patterns. The grouping of these (often functionally related patterns in one module greatly aids in the biological interpretation of the data. We show that ENIGMA outperforms other methods on artificial datasets, using a quality criterion that, unlike other criteria, can be used for algorithms that generate overlapping clusters and that can be modified to take redundancy between clusters into account. Finally, we apply ENIGMA to the Rosetta compendium of expression profiles for

  15. Sequencing and Gene Expression Analysis of Leishmania tropica LACK Gene.

    Directory of Open Access Journals (Sweden)

    Nour Hammoudeh


    Full Text Available Leishmania Homologue of receptors for Activated C Kinase (LACK antigen is a 36-kDa protein, which provokes a very early immune response against Leishmania infection. There are several reports on the expression of LACK through different life-cycle stages of genus Leishmania, but only a few of them have focused on L.tropica.The present study provides details of the cloning, DNA sequencing and gene expression of LACK in this parasite species. First, several local isolates of Leishmania parasites were typed in our laboratory using PCR technique to verify of Leishmania parasite species. After that, LACK gene was amplified and cloned into a vector for sequencing. Finally, the expression of this molecule in logarithmic and stationary growth phase promastigotes, as well as in amastigotes, was evaluated by Reverse Transcription-PCR (RT-PCR technique.The typing result confirmed that all our local isolates belong to L.tropica. LACK gene sequence was determined and high similarity was observed with the sequences of other Leishmania species. Furthermore, the expression of LACK gene in both promastigotes and amastigotes forms was confirmed.Overall, the data set the stage for future studies of the properties and immune role of LACK gene products.

  16. Mechanical Feedback and Arrest in Gene Expression (United States)

    Sevier, Stuart; Levine, Herbert

    The ability to watch biochemical events at the single-molecule level has increasingly revealed that stochasticity plays a leading role in many biological phenomena. One important and well know example is the noisy, ``bursty'' manner of transcription. Recent experiments have revealed relationships between the level and noise in gene expression hinting at deeper stochastic connections. In this talk we will discuss how the mechanical nature of transcription can explain this relationship and examine the limits that the physical aspects of transcription place on gene expression.

  17. Argudas: arguing with gene expression information

    CERN Document Server

    McLeod, Kenneth; Burger, Albert


    In situ hybridisation gene expression information helps biologists identify where a gene is expressed. However, the databases that republish the experimental information are often both incomplete and inconsistent. This paper examines a system, Argudas, designed to help tackle these issues. Argudas is an evolution of an existing system, and so that system is reviewed as a means of both explaining and justifying the behaviour of Argudas. Throughout the discussion of Argudas a number of issues will be raised including the appropriateness of argumentation in biology and the challenges faced when integrating apparently similar online biological databases.

  18. Optogenetics for gene expression in mammalian cells. (United States)

    Müller, Konrad; Naumann, Sebastian; Weber, Wilfried; Zurbriggen, Matias D


    Molecular switches that are controlled by chemicals have evolved as central research instruments in mammalian cell biology. However, these tools are limited in terms of their spatiotemporal resolution due to freely diffusing inducers. These limitations have recently been addressed by the development of optogenetic, genetically encoded, and light-responsive tools that can be controlled with the unprecedented spatiotemporal precision of light. In this article, we first provide a brief overview of currently available optogenetic tools that have been designed to control diverse cellular processes. Then, we focus on recent developments in light-controlled gene expression technologies and provide the reader with a guideline for choosing the most suitable gene expression system.

  19. Genes Expressed in Human Tumor Endothelium (United States)

    St. Croix, Brad; Rago, Carlo; Velculescu, Victor; Traverso, Giovanni; Romans, Katharine E.; Montgomery, Elizabeth; Lal, Anita; Riggins, Gregory J.; Lengauer, Christoph; Vogelstein, Bert; Kinzler, Kenneth W.


    To gain a molecular understanding of tumor angiogenesis, we compared gene expression patterns of endothelial cells derived from blood vessels of normal and malignant colorectal tissues. Of over 170 transcripts predominantly expressed in the endothelium, 79 were differentially expressed, including 46 that were specifically elevated in tumor-associated endothelium. Several of these genes encode extracellular matrix proteins, but most are of unknown function. Most of these tumor endothelial markers were expressed in a wide range of tumor types, as well as in normal vessels associated with wound healing and corpus luteum formation. These studies demonstrate that tumor and normal endothelium are distinct at the molecular level, a finding that may have significant implications for the development of anti-angiogenic therapies.

  20. [Imprinting genes and it's expression in Arabidopsis]. (United States)

    Zhang, Hong-Yu; Xu, Pei-Zhou; Yang, Hua; Wu, Xian-Jun


    Genomic imprinting refers to the phenomenon that the expression of a gene copy depends on its parent of origin. The Arabidopsis imprinted FIS (Fertilisation-independent seed) genes, mea, fis2, and fie, play essential roles in the repression of central cell and the regulation of early endosperm development. fis mutants display two phenotypes: autonomous diploid endosperm development when fertilization is absent and un-cellularised endosperm formation when fertilization occurs. The FIS Polycomb protein complex including the above three FIS proteins catalyzes histone H3 K27 tri-methylation on target loci. DME (DEMETER), a DNA glycosylase, and AtMET1 (Methyltransferase1), a DNA methyltransferase, are involved in the regulation of imprinted expression of both mea and fis2. This review summarizes the studies on the Arabidopsis imprinted FIS genes and other related genes. Recent works have shown that the insertion of transposons may affect nearby gene expression, which may be the main driving force behind the evolution of genomic imprinting. This summary covers the achievements on Arabidopsis imprinted genes will provide important information for studies on genomic imprinting in the important crops such as rice and maize.

  1. Designing genes for successful protein expression. (United States)

    Welch, Mark; Villalobos, Alan; Gustafsson, Claes; Minshull, Jeremy


    DNA sequences are now far more readily available in silico than as physical DNA. De novo gene synthesis is an increasingly cost-effective method for building genetic constructs, and effectively removes the constraint of basing constructs on extant sequences. This allows scientists and engineers to experimentally test their hypotheses relating sequence to function. Molecular biologists, and now synthetic biologists, are characterizing and cataloging genetic elements with specific functions, aiming to combine them to perform complex functions. However, the most common purpose of synthetic genes is for the expression of an encoded protein. The huge number of different proteins makes it impossible to characterize and catalog each functional gene. Instead, it is necessary to abstract design principles from experimental data: data that can be generated by making predictions followed by synthesizing sequences to test those predictions. Because of the degeneracy of the genetic code, design of gene sequences to encode proteins is a high-dimensional problem, so there is no single simple formula to guarantee success. Nevertheless, there are several straightforward steps that can be taken to greatly increase the probability that a designed sequence will result in expression of the encoded protein. In this chapter, we discuss gene sequence parameters that are important for protein expression. We also describe algorithms for optimizing these parameters, and troubleshooting procedures that can be helpful when initial attempts fail. Finally, we show how many of these methods can be accomplished using the synthetic biology software tool Gene Designer.

  2. Genes of periodontopathogens expressed during human disease. (United States)

    Song, Yo-Han; Kozarov, Emil V; Walters, Sheila M; Cao, Sam Linsen; Handfield, Martin; Hillman, Jeffrey D; Progulske-Fox, Ann


    Since many bacterial genes are environmentally regulated, the screening for virulence-associated factors using classical genetic and molecular biology approaches can be biased under laboratory growth conditions of a given pathogen, because the required conditions for expression of many virulence factors may not occur during in vitro growth. Thus, technologies have been developed during the past several years to identify genes that are expressed during disease using animal models of human disease. However, animal models are not always truly representative of human disease, and with many pathogens, there is no appropriate animal model. A new technology, in vivo-induced antigen technology (IVIAT) was thus engineered and tested in our laboratory to screen for genes of pathogenic organisms induced specifically in humans, without the use of animal or artificial models of infection. This technology uses pooled sera from patients to probe for genes expressed exclusively in vivo (or ivi, in vivo-induced genes). IVIAT was originally designed for the study of Actinobacillus actinomycetemcomitans pathogenesis, but we have now extended it to other oral pathogens including Porphyromonas gingivalis. One hundred seventy-one thousand (171,000) clones from P. gingivalis strain W83 were screened and 144 were confirmed positive. Over 300,000 A. actinomycetemcomitans clones were probed, and 116 were confirmed positive using a quantitative blot assay. MAT has proven useful in identifying previously unknown in vivo-induced genes that are likely involved in virulence and are thus excellent candidates for use in diagnostic : and therapeutic strategies, including vaccine design.

  3. Sequence and gene expression evolution of paralogous genes in willows. (United States)

    Harikrishnan, Srilakshmy L; Pucholt, Pascal; Berlin, Sofia


    Whole genome duplications (WGD) have had strong impacts on species diversification by triggering evolutionary novelties, however, relatively little is known about the balance between gene loss and forces involved in the retention of duplicated genes originating from a WGD. We analyzed putative Salicoid duplicates in willows, originating from the Salicoid WGD, which took place more than 45 Mya. Contigs were constructed by de novo assembly of RNA-seq data derived from leaves and roots from two genotypes. Among the 48,508 contigs, 3,778 pairs were, based on fourfold synonymous third-codon transversion rates and syntenic positions, predicted to be Salicoid duplicates. Both copies were in most cases expressed in both tissues and 74% were significantly differentially expressed. Mean Ka/Ks was 0.23, suggesting that the Salicoid duplicates are evolving by purifying selection. Gene Ontology enrichment analyses showed that functions related to DNA- and nucleic acid binding were over-represented among the non-differentially expressed Salicoid duplicates, while functions related to biosynthesis and metabolism were over-represented among the differentially expressed Salicoid duplicates. We propose that the differentially expressed Salicoid duplicates are regulatory neo- and/or subfunctionalized, while the non-differentially expressed are dose sensitive, hence, functionally conserved. Multiple evolutionary processes, thus drive the retention of Salicoid duplicates in willows.

  4. Reshaping of global gene expression networks and sex‐biased gene expression by integration of a young gene

    National Research Council Canada - National Science Library

    Chen, Sidi; Ni, Xiaochun; Krinsky, Benjamin H; Zhang, Yong E; Vibranovski, Maria D; White, Kevin P; Long, Manyuan


    ...‐biased gene expression in Drosophila . This 4–6 million‐year‐old factor, named Zeus for its role in male fecundity, originated through retroposition of a highly conserved housekeeping gene, Caf40...

  5. The TRANSFAC system on gene expression regulation. (United States)

    Wingender, E; Chen, X; Fricke, E; Geffers, R; Hehl, R; Liebich, I; Krull, M; Matys, V; Michael, H; Ohnhäuser, R; Prüss, M; Schacherer, F; Thiele, S; Urbach, S


    The TRANSFAC database on transcription factors and their DNA-binding sites and profiles ( has been quantitatively extended and supplemented by a number of modules. These modules give information about pathologically relevant mutations in regulatory regions and transcription factor genes (PathoDB), scaffold/matrix attached regions (S/MARt DB), signal transduction (TRANSPATH) and gene expression sources (CYTOMER). Altogether, these distinct database modules constitute the TRANSFAC system. They are accompanied by a number of program routines for identifying potential transcription factor binding sites or for localizing individual components in the regulatory network of a cell.

  6. The frustrated gene: origins of eukaryotic gene expression


    Madhani, Hiten D.


    Eukarytotic gene expression is frustrated by a series of steps that are generally not observed in prokaryotes and are therefore not essential for the basic chemistry of transcription and translation. Their evolution may have been driven by the need to defend against parasitic nucleic acids.

  7. Fingerprint Feature Extraction Algorithm

    Directory of Open Access Journals (Sweden)

    Mehala. G


    Full Text Available The goal of this paper is to design an efficient Fingerprint Feature Extraction (FFE algorithm to extract the fingerprint features for Automatic Fingerprint Identification Systems (AFIS. FFE algorithm, consists of two major subdivisions, Fingerprint image preprocessing, Fingerprint image postprocessing. A few of the challenges presented in an earlier are, consequently addressed, in this paper. The proposed algorithm is able to enhance the fingerprint image and also extracting true minutiae.

  8. Fingerprint Feature Extraction Algorithm


    Mehala. G


    The goal of this paper is to design an efficient Fingerprint Feature Extraction (FFE) algorithm to extract the fingerprint features for Automatic Fingerprint Identification Systems (AFIS). FFE algorithm, consists of two major subdivisions, Fingerprint image preprocessing, Fingerprint image postprocessing. A few of the challenges presented in an earlier are, consequently addressed, in this paper. The proposed algorithm is able to enhance the fingerprint image and also extractin...

  9. The Low Noise Limit in Gene Expression.

    Directory of Open Access Journals (Sweden)

    Roy D Dar

    Full Text Available Protein noise measurements are increasingly used to elucidate biophysical parameters. Unfortunately noise analyses are often at odds with directly measured parameters. Here we show that these inconsistencies arise from two problematic analytical choices: (i the assumption that protein translation rate is invariant for different proteins of different abundances, which has inadvertently led to (ii the assumption that a large constitutive extrinsic noise sets the low noise limit in gene expression. While growing evidence suggests that transcriptional bursting may set the low noise limit, variability in translational bursting has been largely ignored. We show that genome-wide systematic variation in translational efficiency can-and in the case of E. coli does-control the low noise limit in gene expression. Therefore constitutive extrinsic noise is small and only plays a role in the absence of a systematic variation in translational efficiency. These results show the existence of two distinct expression noise patterns: (1 a global noise floor uniformly imposed on all genes by expression bursting; and (2 high noise distributed to only a select group of genes.

  10. Identification of genes expressed during myocardial development

    Institute of Scientific and Technical Information of China (English)

    陈小圆; 陈健宏; 张碧琪; 梁瑛; 梁平


    Objective To identify genes expressed in the fetal heart that are potentially important for myocardial development and cardiomyocyte proliferation.Methods mRNAs from fetal (29 weeks) and adult cardiomyocytes were use for suppression subtractive hybridization (SSH). Both forward (fetal as tester) and reverse (adult as driver) subtractions were performed. Clones confirmed by dot-blot analysis to be differentially expressed were sequenced and analyzed.Results Differential expressions were detected for 39 out of 96 (41%) clones on forward subtraction and 24 out of 80 (30%) clones on reverse. For fetal dominating genes, 28 clones matched to 10 known genes (COL1A2, COL3A1, endomucin, HBG1, HBG2, PCBP2, LOC51144, TGFBI, vinculin and PND), 9 clones to 5 cDNAs of unknown functions (accession AK021715, AF085867, AB040948, AB051460 and AB051512) and 2 clones had homology to hEST sequences. For the reverse subtraction, all clones showed homology to mitochondrial transcripts.Conclusions We successfully applied SSH to detect those genes differentially expressed in fetal cardiac myocytes, some of which have not been shown relative to myocardial development.

  11. Stochastic gene expression conditioned on large deviations (United States)

    Horowitz, Jordan M.; Kulkarni, Rahul V.


    The intrinsic stochasticity of gene expression can give rise to large fluctuations and rare events that drive phenotypic variation in a population of genetically identical cells. Characterizing the fluctuations that give rise to such rare events motivates the analysis of large deviations in stochastic models of gene expression. Recent developments in non-equilibrium statistical mechanics have led to a framework for analyzing Markovian processes conditioned on rare events and for representing such processes by conditioning-free driven Markovian processes. We use this framework, in combination with approaches based on queueing theory, to analyze a general class of stochastic models of gene expression. Modeling gene expression as a Batch Markovian Arrival Process (BMAP), we derive exact analytical results quantifying large deviations of time-integrated random variables such as promoter activity fluctuations. We find that the conditioning-free driven process can also be represented by a BMAP that has the same form as the original process, but with renormalized parameters. The results obtained can be used to quantify the likelihood of large deviations, to characterize system fluctuations conditional on rare events and to identify combinations of model parameters that can give rise to dynamical phase transitions in system dynamics.

  12. Trigger finger, tendinosis, and intratendinous gene expression. (United States)

    Lundin, A-C; Aspenberg, P; Eliasson, P


    The pathogenesis of trigger finger has generally been ascribed to primary changes in the first annular ligament. In contrast, we recently found histological changes in the tendons, similar to the findings in Achilles tendinosis or tendinopathy. We therefore hypothesized that trigger finger tendons would show differences in gene expression in comparison to normal tendons in a pattern similar to what is published for Achilles tendinosis. We performed quantitative real-time polymerase chain reaction on biopsies from finger flexor tendons, 13 trigger fingers and 13 apparently healthy control tendons, to assess the expression of 10 genes which have been described to be differently expressed in tendinosis (collagen type 1a1, collagen 3a1, MMP-2, MMP-3, ADAMTS-5, TIMP-3, aggrecan, biglycan, decorin, and versican). In trigger finger tendons, collagen types 1a1 and 3a1, aggrecan and biglycan were all up-regulated, and MMP-3and TIMP-3 were down-regulated. These changes were statistically significant and have been previously described for Achilles tendinosis. The remaining four genes were not significantly altered. The changes in gene expression support the hypothesis that trigger finger is a form of tendinosis. Because trigger finger is a common condition, often treated surgically, it could provide opportunities for clinical research on tendinosis. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Cluster Analysis of Gene Expression Data

    CERN Document Server

    Domany, E


    The expression levels of many thousands of genes can be measured simultaneously by DNA microarrays (chips). This novel experimental tool has revolutionized research in molecular biology and generated considerable excitement. A typical experiment uses a few tens of such chips, each dedicated to a single sample - such as tissue extracted from a particular tumor. The results of such an experiment contain several hundred thousand numbers, that come in the form of a table, of several thousand rows (one for each gene) and 50 - 100 columns (one for each sample). We developed a clustering methodology to mine such data. In this review I provide a very basic introduction to the subject, aimed at a physics audience with no prior knowledge of either gene expression or clustering methods. I explain what genes are, what is gene expression and how it is measured by DNA chips. Next I explain what is meant by "clustering" and how we analyze the massive amounts of data from such experiments, and present results obtained from a...

  14. Annotation of gene function in citrus using gene expression information and co-expression networks. (United States)

    Wong, Darren C J; Sweetman, Crystal; Ford, Christopher M


    The genus Citrus encompasses major cultivated plants such as sweet orange, mandarin, lemon and grapefruit, among the world's most economically important fruit crops. With increasing volumes of transcriptomics data available for these species, Gene Co-expression Network (GCN) analysis is a viable option for predicting gene function at a genome-wide scale. GCN analysis is based on a "guilt-by-association" principle whereby genes encoding proteins involved in similar and/or related biological processes may exhibit similar expression patterns across diverse sets of experimental conditions. While bioinformatics resources such as GCN analysis are widely available for efficient gene function prediction in model plant species including Arabidopsis, soybean and rice, in citrus these tools are not yet developed. We have constructed a comprehensive GCN for citrus inferred from 297 publicly available Affymetrix Genechip Citrus Genome microarray datasets, providing gene co-expression relationships at a genome-wide scale (33,000 transcripts). The comprehensive citrus GCN consists of a global GCN (condition-independent) and four condition-dependent GCNs that survey the sweet orange species only, all citrus fruit tissues, all citrus leaf tissues, or stress-exposed plants. All of these GCNs are clustered using genome-wide, gene-centric (guide) and graph clustering algorithms for flexibility of gene function prediction. For each putative cluster, gene ontology (GO) enrichment and gene expression specificity analyses were performed to enhance gene function, expression and regulation pattern prediction. The guide-gene approach was used to infer novel roles of genes involved in disease susceptibility and vitamin C metabolism, and graph-clustering approaches were used to investigate isoprenoid/phenylpropanoid metabolism in citrus peel, and citric acid catabolism via the GABA shunt in citrus fruit. Integration of citrus gene co-expression networks, functional enrichment analysis and gene

  15. Gene expression profiling of human erythroid progenitors by micro-serial analysis of gene expression. (United States)

    Fujishima, Naohito; Hirokawa, Makoto; Aiba, Namiko; Ichikawa, Yoshikazu; Fujishima, Masumi; Komatsuda, Atsushi; Suzuki, Yoshiko; Kawabata, Yoshinari; Miura, Ikuo; Sawada, Ken-ichi


    We compared the expression profiles of highly purified human CD34+ cells and erythroid progenitor cells by micro-serial analysis of gene expression (microSAGE). Human CD34+ cells were purified from granulocyte colony-stimulating factor-mobilized blood stem cells, and erythroid progenitors were obtained by cultivating these cells in the presence of stem cell factor, interleukin 3, and erythropoietin. Our 10,202 SAGE tags allowed us to identify 1354 different transcripts appearing more than once. Erythroid progenitor cells showed increased expression of LRBA, EEF1A1, HSPCA, PILRB, RANBP1, NACA, and SMURF. Overexpression of HSPCA was confirmed by real-time polymerase chain reaction analysis. MicroSAGE revealed an unexpected preferential expression of several genes in erythroid progenitor cells in addition to the known functional genes, including hemoglobins. Our results provide reference data for future studies of gene expression in various hematopoietic disorders, including myelodysplastic syndrome and leukemia.

  16. Gene Expression Commons: an open platform for absolute gene expression profiling.

    Directory of Open Access Journals (Sweden)

    Jun Seita

    Full Text Available Gene expression profiling using microarrays has been limited to comparisons of gene expression between small numbers of samples within individual experiments. However, the unknown and variable sensitivities of each probeset have rendered the absolute expression of any given gene nearly impossible to estimate. We have overcome this limitation by using a very large number (>10,000 of varied microarray data as a common reference, so that statistical attributes of each probeset, such as the dynamic range and threshold between low and high expression, can be reliably discovered through meta-analysis. This strategy is implemented in a web-based platform named "Gene Expression Commons" ( which contains data of 39 distinct highly purified mouse hematopoietic stem/progenitor/differentiated cell populations covering almost the entire hematopoietic system. Since the Gene Expression Commons is designed as an open platform, investigators can explore the expression level of any gene, search by expression patterns of interest, submit their own microarray data, and design their own working models representing biological relationship among samples.

  17. Gene Expression Commons: an open platform for absolute gene expression profiling. (United States)

    Seita, Jun; Sahoo, Debashis; Rossi, Derrick J; Bhattacharya, Deepta; Serwold, Thomas; Inlay, Matthew A; Ehrlich, Lauren I R; Fathman, John W; Dill, David L; Weissman, Irving L


    Gene expression profiling using microarrays has been limited to comparisons of gene expression between small numbers of samples within individual experiments. However, the unknown and variable sensitivities of each probeset have rendered the absolute expression of any given gene nearly impossible to estimate. We have overcome this limitation by using a very large number (>10,000) of varied microarray data as a common reference, so that statistical attributes of each probeset, such as the dynamic range and threshold between low and high expression, can be reliably discovered through meta-analysis. This strategy is implemented in a web-based platform named "Gene Expression Commons" ( which contains data of 39 distinct highly purified mouse hematopoietic stem/progenitor/differentiated cell populations covering almost the entire hematopoietic system. Since the Gene Expression Commons is designed as an open platform, investigators can explore the expression level of any gene, search by expression patterns of interest, submit their own microarray data, and design their own working models representing biological relationship among samples.

  18. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve


    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  19. Regulation of noise in gene expression. (United States)

    Sanchez, Alvaro; Choubey, Sandeep; Kondev, Jane


    The biochemical processes leading to the synthesis of new proteins are random, as they typically involve a small number of diffusing molecules. They lead to fluctuations in the number of proteins in a single cell as a function of time and to cell-to-cell variability of protein abundances. These in turn can lead to phenotypic heterogeneity in a population of genetically identical cells. Phenotypic heterogeneity may have important consequences for the development of multicellular organisms and the fitness of bacterial colonies, raising the question of how it is regulated. Here we review the experimental evidence that transcriptional regulation affects noise in gene expression, and discuss how the noise strength is encoded in the architecture of the promoter region. We discuss how models based on specific molecular mechanisms of gene regulation can make experimentally testable predictions for how changes to the promoter architecture are reflected in gene expression noise.

  20. Fluid Mechanics, Arterial Disease, and Gene Expression. (United States)

    Tarbell, John M; Shi, Zhong-Dong; Dunn, Jessilyn; Jo, Hanjoong


    This review places modern research developments in vascular mechanobiology in the context of hemodynamic phenomena in the cardiovascular system and the discrete localization of vascular disease. The modern origins of this field are traced, beginning in the 1960s when associations between flow characteristics, particularly blood flow-induced wall shear stress, and the localization of atherosclerotic plaques were uncovered, and continuing to fluid shear stress effects on the vascular lining endothelial) cells (ECs), including their effects on EC morphology, biochemical production, and gene expression. The earliest single-gene studies and genome-wide analyses are considered. The final section moves from the ECs lining the vessel wall to the smooth muscle cells and fibroblasts within the wall that are fluid me chanically activated by interstitial flow that imposes shear stresses on their surfaces comparable with those of flowing blood on EC surfaces. Interstitial flow stimulates biochemical production and gene expression, much like blood flow on ECs.

  1. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve


    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  2. Topological features in cancer gene expression data. (United States)

    Lockwood, S; Krishnamoorthy, B


    We present a new method for exploring cancer gene expression data based on tools from algebraic topology. Our method selects a small relevant subset from tens of thousands of genes while simultaneously identifying nontrivial higher order topological features, i.e., holes, in the data. We first circumvent the problem of high dimensionality by dualizing the data, i.e., by studying genes as points in the sample space. Then we select a small subset of the genes as landmarks to construct topological structures that capture persistent, i.e., topologically significant, features of the data set in its first homology group. Furthermore, we demonstrate that many members of these loops have been implicated for cancer biogenesis in scientific literature. We illustrate our method on five different data sets belonging to brain, breast, leukemia, and ovarian cancers.

  3. Coevolution of gene expression among interacting proteins

    Energy Technology Data Exchange (ETDEWEB)

    Fraser, Hunter B.; Hirsh, Aaron E.; Wall, Dennis P.; Eisen,Michael B.


    Physically interacting proteins or parts of proteins are expected to evolve in a coordinated manner that preserves proper interactions. Such coevolution at the amino acid-sequence level is well documented and has been used to predict interacting proteins, domains, and amino acids. Interacting proteins are also often precisely coexpressed with one another, presumably to maintain proper stoichiometry among interacting components. Here, we show that the expression levels of physically interacting proteins coevolve. We estimate average expression levels of genes from four closely related fungi of the genus Saccharomyces using the codon adaptation index and show that expression levels of interacting proteins exhibit coordinated changes in these different species. We find that this coevolution of expression is a more powerful predictor of physical interaction than is coevolution of amino acid sequence. These results demonstrate previously uncharacterized coevolution of gene expression, adding a different dimension to the study of the coevolution of interacting proteins and underscoring the importance of maintaining coexpression of interacting proteins over evolutionary time. Our results also suggest that expression coevolution can be used for computational prediction of protein protein interactions.

  4. Fingerprint recognition using standardized fingerprint model


    Le Hoang Thai; Ha Nhat Tam


    Fingerprint recognition is one of most popular and accuracy Biometric technologies. Nowadays, it is used in many real applications. However, recognizing fingerprints in poor quality images is still a very complex problem. In recent years, many algorithms, models are given to improve the accuracy of recognition system. This paper discusses on the standardized fingerprint model which is used to synthesize the template of fingerprints. In this model, after pre-processing step, we find the transf...

  5. Transcriptome-Level Signatures in Gene Expression and Gene Expression Variability during Bacterial Adaptive Evolution (United States)

    Erickson, Keesha E.; Otoupal, Peter B.


    ABSTRACT Antibiotic-resistant bacteria are an increasingly serious public health concern, as strains emerge that demonstrate resistance to almost all available treatments. One factor that contributes to the crisis is the adaptive ability of bacteria, which exhibit remarkable phenotypic and gene expression heterogeneity in order to gain a survival advantage in damaging environments. This high degree of variability in gene expression across biological populations makes it a challenging task to identify key regulators of bacterial adaptation. Here, we research the regulation of adaptive resistance by investigating transcriptome profiles of Escherichia coli upon adaptation to disparate toxins, including antibiotics and biofuels. We locate potential target genes via conventional gene expression analysis as well as using a new analysis technique examining differential gene expression variability. By investigating trends across the diverse adaptation conditions, we identify a focused set of genes with conserved behavior, including those involved in cell motility, metabolism, membrane structure, and transport, and several genes of unknown function. To validate the biological relevance of the observed changes, we synthetically perturb gene expression using clustered regularly interspaced short palindromic repeat (CRISPR)-dCas9. Manipulation of select genes in combination with antibiotic treatment promotes adaptive resistance as demonstrated by an increased degree of antibiotic tolerance and heterogeneity in MICs. We study the mechanisms by which identified genes influence adaptation and find that select differentially variable genes have the potential to impact metabolic rates, mutation rates, and motility. Overall, this work provides evidence for a complex nongenetic response, encompassing shifts in gene expression and gene expression variability, which underlies adaptive resistance. IMPORTANCE Even initially sensitive bacteria can rapidly thwart antibiotic treatment

  6. Gene expression regulation in roots under drought. (United States)

    Janiak, Agnieszka; Kwaśniewski, Mirosław; Szarejko, Iwona


    Stress signalling and regulatory networks controlling expression of target genes are the basis of plant response to drought. Roots are the first organs exposed to water deficiency in the soil and are the place of drought sensing. Signalling cascades transfer chemical signals toward the shoot and initiate molecular responses that lead to the biochemical and morphological changes that allow plants to be protected against water loss and to tolerate stress conditions. Here, we present an overview of signalling network and gene expression regulation pathways that are actively induced in roots under drought stress. In particular, the role of several transcription factor (TF) families, including DREB, AP2/ERF, NAC, bZIP, MYC, CAMTA, Alfin-like and Q-type ZFP, in the regulation of root response to drought are highlighted. The information provided includes available data on mutual interactions between these TFs together with their regulation by plant hormones and other signalling molecules. The most significant downstream target genes and molecular processes that are controlled by the regulatory factors are given. These data are also coupled with information about the influence of the described regulatory networks on root traits and root development which may translate to enhanced drought tolerance. This is the first literature survey demonstrating the gene expression regulatory machinery that is induced by drought stress, presented from the perspective of roots.

  7. Predicting gene expression from sequence: a reexamination.

    Directory of Open Access Journals (Sweden)

    Yuan Yuan


    Full Text Available Although much of the information regarding genes' expressions is encoded in the genome, deciphering such information has been very challenging. We reexamined Beer and Tavazoie's (BT approach to predict mRNA expression patterns of 2,587 genes in Saccharomyces cerevisiae from the information in their respective promoter sequences. Instead of fitting complex Bayesian network models, we trained naïve Bayes classifiers using only the sequence-motif matching scores provided by BT. Our simple models correctly predict expression patterns for 79% of the genes, based on the same criterion and the same cross-validation (CV procedure as BT, which compares favorably to the 73% accuracy of BT. The fact that our approach did not use position and orientation information of the predicted binding sites but achieved a higher prediction accuracy, motivated us to investigate a few biological predictions made by BT. We found that some of their predictions, especially those related to motif orientations and positions, are at best circumstantial. For example, the combinatorial rules suggested by BT for the PAC and RRPE motifs are not unique to the cluster of genes from which the predictive model was inferred, and there are simpler rules that are statistically more significant than BT's ones. We also show that CV procedure used by BT to estimate their method's prediction accuracy is inappropriate and may have overestimated the prediction accuracy by about 10%.

  8. Expression of MTLC gene in gastric carcinoma

    Institute of Scientific and Technical Information of China (English)

    Guang-Bin Qiu; Li-Guo Gong; Dong-Mei Hao; Zhi-Hong Zhen; Kai-Lai Sun


    AIM: To investigate the expression of c-myc target from laryngeal cancer cells (MTLC) gene in gastric carcinoma (GC)tissues and the effect of MTLC over-expression on gastric carcinoma cell line BGC823.METHODS: RT-PCR was performed to determine the expression of MTLC mRNA in GC and matched control tissues.BGC823 cells were transfected with an expression vector pcDNA3.1-MTLC by liposome and screened by G418. Growth of cells expressing MTLC was observed daily by manual counting. Apoptotic cells were determined by TdT-mediated dUTP nick-end labeling (TUNEL) assay.RESULTS: The expression of MTLC mRNAs was downregulated in 9(60%) of 15 cases of GC tissues. The growth rates of the BGC823 cells expressing MTLC were indistinguishable from that of control cells. A marked acceleration of apoptosis was observed in MTLC-expressing cells.CONCLUSION: MTLC was down-regulated in the majority of GC tissues and could promote apoptosis of GC cell lines,which suggests that MTLC may play an important role in the carcinogenesis of gastric carcinoma.

  9. Toward stable gene expression in CHO cells (United States)

    Mariati; Koh, Esther YC; Yeo, Jessna HM; Ho, Steven CL; Yang, Yuansheng


    Maintaining high gene expression level during long-term culture is critical when producing therapeutic recombinant proteins using mammalian cells. Transcriptional silencing of promoters, most likely due to epigenetic events such as DNA methylation and histone modifications, is one of the major mechanisms causing production instability. Previous studies demonstrated that the core CpG island element (IE) from the hamster adenine phosphoribosyltransferase gene is effective to prevent DNA methylation. We generated one set of modified human cytomegalovirus (hCMV) promoters by insertion of one or two copies of IE in either forward or reverse orientations into different locations of the hCMV promoter. The modified hCMV with one copy of IE inserted between the hCMV enhancer and core promoter in reverse orientation (MR1) was most effective at enhancing expression stability in CHO cells without comprising expression level when compared with the wild type hCMV. We also found that insertion of IE into a chimeric murine CMV (mCMV) enhancer and human elongation factor-1α core (hEF) promoter in reverse orientation did not enhance expression stability, indicating that the effect of IE on expression stability is possibly promoter specific. PMID:25482237

  10. Gene expression in Pseudomonas aeruginosa swarming motility

    Directory of Open Access Journals (Sweden)

    Déziel Eric


    Full Text Available Abstract Background The bacterium Pseudomonas aeruginosa is capable of three types of motilities: swimming, twitching and swarming. The latter is characterized by a fast and coordinated group movement over a semi-solid surface resulting from intercellular interactions and morphological differentiation. A striking feature of swarming motility is the complex fractal-like patterns displayed by migrating bacteria while they move away from their inoculation point. This type of group behaviour is still poorly understood and its characterization provides important information on bacterial structured communities such as biofilms. Using GeneChip® Affymetrix microarrays, we obtained the transcriptomic profiles of both bacterial populations located at the tip of migrating tendrils and swarm center of swarming colonies and compared these profiles to that of a bacterial control population grown on the same media but solidified to not allow swarming motility. Results Microarray raw data were corrected for background noise with the RMA algorithm and quantile normalized. Differentially expressed genes between the three conditions were selected using a threshold of 1.5 log2-fold, which gave a total of 378 selected genes (6.3% of the predicted open reading frames of strain PA14. Major shifts in gene expression patterns are observed in each growth conditions, highlighting the presence of distinct bacterial subpopulations within a swarming colony (tendril tips vs. swarm center. Unexpectedly, microarrays expression data reveal that a minority of genes are up-regulated in tendril tip populations. Among them, we found energy metabolism, ribosomal protein and transport of small molecules related genes. On the other hand, many well-known virulence factors genes were globally repressed in tendril tip cells. Swarm center cells are distinct and appear to be under oxidative and copper stress responses. Conclusions Results reported in this study show that, as opposed to

  11. Engineering genes for predictable protein expression. (United States)

    Gustafsson, Claes; Minshull, Jeremy; Govindarajan, Sridhar; Ness, Jon; Villalobos, Alan; Welch, Mark


    The DNA sequence used to encode a polypeptide can have dramatic effects on its expression. Lack of readily available tools has until recently inhibited meaningful experimental investigation of this phenomenon. Advances in synthetic biology and the application of modern engineering approaches now provide the tools for systematic analysis of the sequence variables affecting heterologous expression of recombinant proteins. We here discuss how these new tools are being applied and how they circumvent the constraints of previous approaches, highlighting some of the surprising and promising results emerging from the developing field of gene engineering.

  12. Fingerprint recognition with identical twin fingerprints.

    Directory of Open Access Journals (Sweden)

    Xunqiang Tao

    Full Text Available Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6 images. Compared to the previous work, our contributions are summarized as follows: (1 Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2 Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3 A larger sample (83 pairs was collected. (4 A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5 A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

  13. Annotation of gene function in citrus using gene expression information and co-expression networks


    Wong, Darren CJ; Sweetman, Crystal; Ford, Christopher M.


    Background The genus Citrus encompasses major cultivated plants such as sweet orange, mandarin, lemon and grapefruit, among the world’s most economically important fruit crops. With increasing volumes of transcriptomics data available for these species, Gene Co-expression Network (GCN) analysis is a viable option for predicting gene function at a genome-wide scale. GCN analysis is based on a “guilt-by-association” principle whereby genes encoding proteins involved in similar and/or related bi...

  14. Annotation of gene function in citrus using gene expression information and co-expression networks


    Wong, Darren CJ; Sweetman, Crystal; Ford, Christopher M.


    Background The genus Citrus encompasses major cultivated plants such as sweet orange, mandarin, lemon and grapefruit, among the world’s most economically important fruit crops. With increasing volumes of transcriptomics data available for these species, Gene Co-expression Network (GCN) analysis is a viable option for predicting gene function at a genome-wide scale. GCN analysis is based on a “guilt-by-association” principle whereby genes encoding proteins involved in similar and/or related bi...

  15. Global gene expression in Escherichia coli biofilms

    DEFF Research Database (Denmark)

    Schembri, Mark; Kjærgaard, K.; Klemm, Per


    in expression have no current defined function. These genes, as well as those induced by stresses relevant to biofilm growth such as oxygen and nutrient limitation, may be important factors that trigger enhanced resistance mechanisms of sessile communities to antibiotics and hydrodynamic shear forces.......It is now apparent that microorganisms undergo significant changes during the transition from planktonic to biofilm growth. These changes result in phenotypic adaptations that allow the formation of highly organized and structured sessile communities, which possess enhanced resistance...... to antimicrobial treatments and host immune defence responses. Escherichia coli has been used as a model organism to study the mechanisms of growth within adhered communities. In this study, we use DNA microarray technology to examine the global gene expression profile of E. coli during sessile growth compared...

  16. Aberrant Gene Expression in Acute Myeloid Leukaemia

    DEFF Research Database (Denmark)

    Bagger, Frederik Otzen

    model to investigate the role of telomerase in AML, we were able to translate the observed effect into human AML patients and identify specific genes involved, which also predict survival patterns in AML patients. During these studies we have applied methods for investigating differentially expressed......Summary Acute Myeloid Leukaemia (AML) is an aggressive cancer of the bone marrow, affecting formation of blood cells during haematopoiesis. This thesis presents investigation of AML using mRNA gene expression profiles (GEP) of samples extracted from the bone marrow of healthy and diseased subjects....... Here GEPs from purified healthy haematopoietic populations, with different levels of differentiation, form the basis for comparison with diseased samples. We present a mathematical transformation of mRNA microarray data to make it possible to compare AML samples, carrying expanded aberrant...

  17. Combinatorial engineering for heterologous gene expression. (United States)

    Zwick, Friederike; Lale, Rahmi; Valla, Svein


    Tools for strain engineering with predictable outcome are of crucial importance for the nascent field of synthetic biology. The success of combining different DNA biological parts is often restricted by poorly understood factors deriving from the complexity of the systems. We have previously identified variants for different regulatory elements of the expression cassette XylS/Pm. When such elements are combined they act in a manner consistent with their individual behavior, as long as they affect different functions, such as transcription and translation. Interestingly, sequence context does not seem to influence the final outcome significantly. Expression of reporter gene bla could be increased up to 75 times at the protein level by combining three variants in one cassette. For other tested reporter genes similar results were obtained, except that the stimulatory effect was quantitatively less. Combination of individually characterized DNA parts thus stands as suitable method to achieve a desired phenotype.

  18. Structure, expression and functions of MTA genes. (United States)

    Kumar, Rakesh; Wang, Rui-An


    Metastatic associated proteins (MTA) are integrators of upstream regulatory signals with the ability to act as master coregulators for modifying gene transcriptional activity. The MTA family includes three genes and multiple alternatively spliced variants. The MTA proteins neither have their own enzymatic activity nor have been shown to directly interact with DNA. However, MTA proteins interact with a variety of chromatin remodeling factors and complexes with enzymatic activities for modulating the plasticity of nucleosomes, leading to the repression or derepression of target genes or other extra-nuclear and nucleosome remodeling and histone deacetylase (NuRD)-complex independent activities. The functions of MTA family members are driven by the steady state levels and subcellular localization of MTA proteins, the dynamic nature of modifying signals and enzymes, the structural features and post-translational modification of protein domains, interactions with binding proteins, and the nature of the engaged and resulting features of nucleosomes in the proximity of target genes. In general, MTA1 and MTA2 are the most upregulated genes in human cancer and correlate well with aggressive phenotypes, therapeutic resistance, poor prognosis and ultimately, unfavorable survival of cancer patients. Here we will discuss the structure, expression and functions of the MTA family of genes in the context of cancer cells.

  19. Aerogel Fingerprint Media

    Energy Technology Data Exchange (ETDEWEB)

    Miller, Fred S.; Andresen, Brian D.


    A fingerprint medium which is made of an aerogel having a predetermined density. The fingerprint medium may have a midrange density for forming plates or may be crushed forming a powder. The fingerprint medium may further include at least one of a metal and metal oxide to enhance characteristics desirable in a fingerprint medium.

  20. Proteomic and gene expression patterns of keratoconus

    Directory of Open Access Journals (Sweden)

    Arkasubhra Ghosh


    Full Text Available Keratoconus is a progressive corneal thinning disease associated with significant tissue remodeling activities and activation of a variety of signaling networks. However, it is not understood how differential gene and protein expression direct function in keratoconus corneas to drive the underlying pathology, ectasia. Research in the field has focused on discovering differentially expressed genes and proteins and quantifying their levels and activities in keratoconus patient samples. In this study, both microarray analysis of total ribonucleic acid (RNA and whole proteome analyses are carried out using corneal epithelium and tears from keratoconus patients and compared to healthy controls. A number of structural proteins, signaling molecules, cytokines, proteases, and enzymes have been found to be deregulated in keratoconus corneas. Together, the data provide clues to the complex process of corneal degradation which suggest novel ways to clinically diagnose and manage the disease. This review will focus on discussing these recent advances in the knowledge of keratoconus biology from a gene expression and function point-of-view.

  1. Analysis of gene expression in rabbit muscle

    Directory of Open Access Journals (Sweden)

    Alena Gálová


    Full Text Available Increasing consumer knowledge of the link between diet and health has raised the demand for high quality food. Meat and meat products may be considered as irreplaceable in human nutrition. Breeding livestock to higher content of lean meat and the use of modern hybrids entails problems with the quality of meat. Analysing of livestock genomes could get us a great deal of important information, which may significantly affect the improvement process. Domestic animals are invaluable resources for study of the molecular architecture of complex traits. Although the mapping of quantitative trait loci (QTL responsible for economically important traits in domestic animals has achieved remarkable results in recent decades, not all of the genetic variation in the complex traits has been captured because of the low density of markers used in QTL mapping studies. The genome wide association study (GWAS, which utilizes high-density single-nucleotide polymorphism (SNP, provides a new way to tackle this issue. New technologies now allow producing microarrays containing thousands of hybridization probes on a single membrane or other solid support. We used microarray analysis to study gene expression in rabbit muscle during different developmental age stages. The outputs from GeneSpring GX sotware are presented in this work. After the evaluation of gene expression in rabbits, will be selected genes of interest in relation to meat quality parameters and will be further analyzed by the available methods of molecular biology and genetics.

  2. Reduced expression of Autographa californica nucleopolyhedrovirus ORF34, an essential gene, enhances heterologous gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Salem, Tamer Z. [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbial Molecular Biology, AGERI, Agricultural Research Center, Giza 12619 (Egypt); Division of Biomedical Sciences, Zewail University, Zewail City of Science and Technology, Giza 12588 (Egypt); Zhang, Fengrui [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Thiem, Suzanne M., E-mail: [Department of Entomology, Michigan State University, East Lansing, MI 48824 (United States); Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI 48824 (United States)


    Autographa californica multiple nucleopolyhedrovirus ORF34 is part of a transcriptional unit that includes ORF32, encoding a viral fibroblast growth factor (FGF) and ORF33. We identified ORF34 as a candidate for deletion to improve protein expression in the baculovirus expression system based on enhanced reporter gene expression in an RNAi screen of virus genes. However, ORF34 was shown to be an essential gene. To explore ORF34 function, deletion (KO34) and rescue bacmids were constructed and characterized. Infection did not spread from primary KO34 transfected cells and supernatants from KO34 transfected cells could not infect fresh Sf21 cells whereas the supernatant from the rescue bacmids transfection could recover the infection. In addition, budded viruses were not observed in KO34 transfected cells by electron microscopy, nor were viral proteins detected from the transfection supernatants by western blots. These demonstrate that ORF34 is an essential gene with a possible role in infectious virus production.

  3. Improved Adaptive Fingerprint Binarization


    Bartunek, Josef Ström; Nilsson, Mikael; Nordberg, Jörgen; Claesson, Ingvar


    In this paper improvements to a previous work are presented. Removing the redundant artifacts in the fingerprint mask is introduced enhancing the final result. The proposed method is entirely adaptive process adjusting to each fingerprint without any further supervision of the user. Hence, the algorithm is insensitive to the characteristics of the fingerprint sensor and the various physical appearances of the fingerprints. Further, a detailed description of fingerprint mask generation not ful...

  4. Screening of differentially expressed genes in pathological scar tissues using expression microarray. (United States)

    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S


    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  5. Identification of common prognostic gene expression signatures with biological meanings from microarray gene expression datasets.

    Directory of Open Access Journals (Sweden)

    Jun Yao

    Full Text Available Numerous prognostic gene expression signatures for breast cancer were generated previously with few overlap and limited insight into the biology of the disease. Here we introduce a novel algorithm named SCoR (Survival analysis using Cox proportional hazard regression and Random resampling to apply random resampling and clustering methods in identifying gene features correlated with time to event data. This is shown to reduce overfitting noises involved in microarray data analysis and discover functional gene sets linked to patient survival. SCoR independently identified a common poor prognostic signature composed of cell proliferation genes from six out of eight breast cancer datasets. Furthermore, a sequential SCoR analysis on highly proliferative breast cancers repeatedly identified T/B cell markers as favorable prognosis factors. In glioblastoma, SCoR identified a common good prognostic signature of chromosome 10 genes from two gene expression datasets (TCGA and REMBRANDT, recapitulating the fact that loss of one copy of chromosome 10 (which harbors the tumor suppressor PTEN is linked to poor survival in glioblastoma patients. SCoR also identified prognostic genes on sex chromosomes in lung adenocarcinomas, suggesting patient gender might be used to predict outcome in this disease. These results demonstrate the power of SCoR to identify common and biologically meaningful prognostic gene expression signatures.

  6. Identification of common prognostic gene expression signatures with biological meanings from microarray gene expression datasets. (United States)

    Yao, Jun; Zhao, Qi; Yuan, Ying; Zhang, Li; Liu, Xiaoming; Yung, W K Alfred; Weinstein, John N


    Numerous prognostic gene expression signatures for breast cancer were generated previously with few overlap and limited insight into the biology of the disease. Here we introduce a novel algorithm named SCoR (Survival analysis using Cox proportional hazard regression and Random resampling) to apply random resampling and clustering methods in identifying gene features correlated with time to event data. This is shown to reduce overfitting noises involved in microarray data analysis and discover functional gene sets linked to patient survival. SCoR independently identified a common poor prognostic signature composed of cell proliferation genes from six out of eight breast cancer datasets. Furthermore, a sequential SCoR analysis on highly proliferative breast cancers repeatedly identified T/B cell markers as favorable prognosis factors. In glioblastoma, SCoR identified a common good prognostic signature of chromosome 10 genes from two gene expression datasets (TCGA and REMBRANDT), recapitulating the fact that loss of one copy of chromosome 10 (which harbors the tumor suppressor PTEN) is linked to poor survival in glioblastoma patients. SCoR also identified prognostic genes on sex chromosomes in lung adenocarcinomas, suggesting patient gender might be used to predict outcome in this disease. These results demonstrate the power of SCoR to identify common and biologically meaningful prognostic gene expression signatures.

  7. Coding and Noncoding Gene Expression Biomarkers in Mood Disorders and Schizophrenia

    Directory of Open Access Journals (Sweden)

    Firoza Mamdani


    Full Text Available Mood disorders and schizophrenia are common and complex disorders with consistent evidence of genetic and environmental influences on predisposition. It is generally believed that the consequences of disease, gene expression, and allelic heterogeneity may be partly the explanation for the variability observed in treatment response. Correspondingly, while effective treatments are available for some patients, approximately half of the patients fail to respond to current neuropsychiatric treatments. A number of peripheral gene expression studies have been conducted to understand these brain-based disorders and mechanisms of treatment response with the aim of identifying suitable biomarkers and perhaps subgroups of patients based upon molecular fingerprint. In this review, we summarize the results from blood-derived gene expression studies implemented with the aim of discovering biomarkers for treatment response and classification of disorders. We include data from a biomarker study conducted in first-episode subjects with schizophrenia, where the results provide insight into possible individual biological differences that predict antipsychotic response. It is concluded that, while peripheral studies of expression are generating valuable results in pathways involving immune regulation and response, larger studies are required which hopefully will lead to robust biomarkers for treatment response and perhaps underlying variations relevant to these complex disorders.

  8. Gravity-Induced Gene Expression in Plants. (United States)

    Sederoff, Heike; Heber, Steffen; Howard, Brian; Myburg-Nichols, Henrietta; Hammond, Rebecca; Salinas-Mondragon, Raul; Brown, Christopher S.

    Plants sense changes in their orientation towards the vector of gravity and respond with directional growth. Several metabolites in the signal transduction cascade have been identified. However, very little is known about the interaction between these sensing and signal transduction events and even less is known about their role in the differential growth response. Gravity induced changes in transcript abundance have been identified in Arabidopsis whole seedlings and root apices (Moseyko et al. 2002; Kimbrough et al. 2004). Gravity induced transcript abundance changes can be observed within less than 1 min after stimulation (Salinas-Mondragon et al. 2005). Gene expression however requires not only transcription but also translation of the mRNA. Translation can only occur when mRNA is associated with ribosomes, even though not all mRNA associated with ribosomes is actively translated. To approximate translational capacity we quantified whole genome transcript abundances in corn stem pulvini during the first hour after gravity stimulation in total and poly-ribosomal fractions. As in Arabidopsis root apices, transcript abundances of several clusters of genes responded to gravity stimulation. The vast majority of these transcripts were also found to associate with polyribosomes in the same temporal and quantitative pattern. These genes are transcriptionally regulated by gravity stimulation, but do not exhibit translational regulation. However, a small group of genes showed increased transcriptional regulation after gravity stimulation, but no association with polysomes. These transcripts likely are translationally repressed. The mechanism of translational repression for these transcripts is unknown. Based on the hypothesis that the genes essential for gravitropic responses should be expressed in most or all species, we compared the temporal gravity induced expression pattern of all orthologs identified between maize and Arabidopsis. A small group of genes showed high

  9. Gene expression regulators--MicroRNAs

    Institute of Scientific and Technical Information of China (English)

    CHEN Fang; YIN Q. James


    A large class of non-coding RNAs found in small molecule RNAs are closely associated with the regulation of gene expression, which are called microRNA (miRNA). MiRNAs are coded in intergenic or intronic regions and can be formed into foldback hairpin RNAs. These transcripts are cleaved by Dicer, generating mature miRNAs that can silence their target genes in different modes of action. Now, research on small molecule RNAs has gotten breakthrough advance in biology. To discover miRNA genes and their target genes has become hot topics in RNA research. This review attempts to look back the history of miRNA discovery, to introduce the methods of screening miRNAs, to localize miRNA loci in genome, to seek miRNA target genes and the biological function, and to discuss the working mechanisms of miRNAs. Finally, we will discuss the potential important roles of miRNAs in modulating the genesis, development, growth, and differentiation of organisms. Thus, it can be predicted that a complete understanding of miRNA functions will bring us some new concepts, approaches and strategies for the study of living beings.

  10. Cholinergic regulation of VIP gene expression in human neuroblastoma cells

    DEFF Research Database (Denmark)

    Kristensen, Bo; Georg, Birgitte; Fahrenkrug, Jan


    Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing......Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing...

  11. Gene Expression Profiling of Xeroderma Pigmentosum

    Directory of Open Access Journals (Sweden)

    Bowden Nikola A


    Full Text Available Abstract Xeroderma pigmentosum (XP is a rare recessive disorder that is characterized by extreme sensitivity to UV light. UV light exposure results in the formation of DNA damage such as cyclobutane dimers and (6-4 photoproducts. Nucleotide excision repair (NER orchestrates the removal of cyclobutane dimers and (6-4 photoproducts as well as some forms of bulky chemical DNA adducts. The disease XP is comprised of 7 complementation groups (XP-A to XP-G, which represent functional deficiencies in seven different genes, all of which are believed to be involved in NER. The main clinical feature of XP is various forms of skin cancers; however, neurological degeneration is present in XPA, XPB, XPD and XPG complementation groups. The relationship between NER and other types of DNA repair processes is now becoming evident but the exact relationships between the different complementation groups remains to be precisely determined. Using gene expression analysis we have identified similarities and differences after UV light exposure between the complementation groups XP-A, XP-C, XP-D, XP-E, XP-F, XP-G and an unaffected control. The results reveal that there is a graded change in gene expression patterns between the mildest, most similar to the control response (XP-E and the severest form (XP-A of the disease, with the exception of XP-D. Distinct differences between the complementation groups with neurological symptoms (XP-A, XP-D and XP-G and without (XP-C, XP-E and XP-F were also identified. Therefore, this analysis has revealed distinct gene expression profiles for the XP complementation groups and the first step towards understanding the neurological symptoms of XP.

  12. X chromosome regulation of autosomal gene expression in bovine blastocysts (United States)

    Itoh, Yuichiro; Arnold, Arthur P.


    Although X chromosome inactivation in female mammals evolved to balance the expression of X chromosome and autosomal genes in the two sexes, female embryos pass through developmental stages in which both X chromosomes are active in somatic cells. Bovine blastocysts show higher expression of many X genes in XX than XY embryos, suggesting that X inactivation is not complete. Here we reanalyzed bovine blastocyst microarray expression data from a network perspective with a focus on interactions between X chromosome and autosomal genes. Whereas male to female ratios of expression of autosomal genes were distributed around a mean of 1, X chromosome genes were clearly shifted towards higher expression in females. We generated gene coexpression networks and identified a major module of genes with correlated gene expression that includes female-biased X genes and sexually dimorphic autosomal genes for which the sexual dimorphism is likely driven by the X genes. In this module, expression of X chromosome genes correlates with autosome genes, more than the expression of autosomal genes with each other. Our study identifies correlated patterns of autosomal and X-linked genes that are likely influenced by the sexual imbalance of X gene expression when X inactivation is inefficient. PMID:24817096

  13. Whole Blood Gene Expression Profiling in Preclinical and Clinical Cattle Infected with Atypical Bovine Spongiform Encephalopathy (United States)

    Xerxa, Elena; Barbisin, Maura; Chieppa, Maria Novella; Krmac, Helena; Vallino Costassa, Elena; Vatta, Paolo; Simmons, Marion; Caramelli, Maria; Casalone, Cristina; Corona, Cristiano


    Prion diseases, such as bovine spongiform encephalopathies (BSE), are transmissible neurodegenerative disorders affecting humans and a wide variety of mammals. Variant Creutzfeldt-Jakob disease (vCJD), a prion disease in humans, has been linked to exposure to BSE prions. This classical BSE (cBSE) is now rapidly disappearing as a result of appropriate measures to control animal feeding. Besides cBSE, two atypical forms (named H- and L-type BSE) have recently been described in Europe, Japan, and North America. Here we describe the first wide-spectrum microarray analysis in whole blood of atypical BSE-infected cattle. Transcriptome changes in infected animals were analyzed prior to and after the onset of clinical signs. The microarray analysis revealed gene expression changes in blood prior to the appearance of the clinical signs and during the progression of the disease. A set of 32 differentially expressed genes was found to be in common between clinical and preclinical stages and showed a very similar expression pattern in the two phases. A 22-gene signature showed an oscillating pattern of expression, being differentially expressed in the preclinical stage and then going back to control levels in the symptomatic phase. One gene, SEL1L3, was downregulated during the progression of the disease. Most of the studies performed up to date utilized various tissues, which are not suitable for a rapid analysis of infected animals and patients. Our findings suggest the intriguing possibility to take advantage of whole blood RNA transcriptional profiling for the preclinical identification of prion infection. Further, this study highlighted several pathways, such as immune response and metabolism that may play an important role in peripheral prion pathogenesis. Finally, the gene expression changes identified in the present study may be further investigated as a fingerprint for monitoring the progression of disease and for developing targeted therapeutic interventions. PMID

  14. Whole Blood Gene Expression Profiling in Preclinical and Clinical Cattle Infected with Atypical Bovine Spongiform Encephalopathy. (United States)

    Xerxa, Elena; Barbisin, Maura; Chieppa, Maria Novella; Krmac, Helena; Vallino Costassa, Elena; Vatta, Paolo; Simmons, Marion; Caramelli, Maria; Casalone, Cristina; Corona, Cristiano; Legname, Giuseppe


    Prion diseases, such as bovine spongiform encephalopathies (BSE), are transmissible neurodegenerative disorders affecting humans and a wide variety of mammals. Variant Creutzfeldt-Jakob disease (vCJD), a prion disease in humans, has been linked to exposure to BSE prions. This classical BSE (cBSE) is now rapidly disappearing as a result of appropriate measures to control animal feeding. Besides cBSE, two atypical forms (named H- and L-type BSE) have recently been described in Europe, Japan, and North America. Here we describe the first wide-spectrum microarray analysis in whole blood of atypical BSE-infected cattle. Transcriptome changes in infected animals were analyzed prior to and after the onset of clinical signs. The microarray analysis revealed gene expression changes in blood prior to the appearance of the clinical signs and during the progression of the disease. A set of 32 differentially expressed genes was found to be in common between clinical and preclinical stages and showed a very similar expression pattern in the two phases. A 22-gene signature showed an oscillating pattern of expression, being differentially expressed in the preclinical stage and then going back to control levels in the symptomatic phase. One gene, SEL1L3, was downregulated during the progression of the disease. Most of the studies performed up to date utilized various tissues, which are not suitable for a rapid analysis of infected animals and patients. Our findings suggest the intriguing possibility to take advantage of whole blood RNA transcriptional profiling for the preclinical identification of prion infection. Further, this study highlighted several pathways, such as immune response and metabolism that may play an important role in peripheral prion pathogenesis. Finally, the gene expression changes identified in the present study may be further investigated as a fingerprint for monitoring the progression of disease and for developing targeted therapeutic interventions.

  15. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. (United States)

    Edgar, Ron; Domrachev, Michael; Lash, Alex E


    The Gene Expression Omnibus (GEO) project was initiated in response to the growing demand for a public repository for high-throughput gene expression data. GEO provides a flexible and open design that facilitates submission, storage and retrieval of heterogeneous data sets from high-throughput gene expression and genomic hybridization experiments. GEO is not intended to replace in house gene expression databases that benefit from coherent data sets, and which are constructed to facilitate a particular analytic method, but rather complement these by acting as a tertiary, central data distribution hub. The three central data entities of GEO are platforms, samples and series, and were designed with gene expression and genomic hybridization experiments in mind. A platform is, essentially, a list of probes that define what set of molecules may be detected. A sample describes the set of molecules that are being probed and references a single platform used to generate its molecular abundance data. A series organizes samples into the meaningful data sets which make up an experiment. The GEO repository is publicly accessible through the World Wide Web at

  16. Gene expression in developing watermelon fruit (United States)

    Wechter, W Patrick; Levi, Amnon; Harris, Karen R; Davis, Angela R; Fei, Zhangjun; Katzir, Nurit; Giovannoni, James J; Salman-Minkov, Ayelet; Hernandez, Alvaro; Thimmapuram, Jyothi; Tadmor, Yaakov; Portnoy, Vitaly; Trebitsh, Tova


    Background Cultivated watermelon form large fruits that are highly variable in size, shape, color, and content, yet have extremely narrow genetic diversity. Whereas a plethora of genes involved in cell wall metabolism, ethylene biosynthesis, fruit softening, and secondary metabolism during fruit development and ripening have been identified in other plant species, little is known of the genes involved in these processes in watermelon. A microarray and quantitative Real-Time PCR-based study was conducted in watermelon [Citrullus lanatus (Thunb.) Matsum. & Nakai var. lanatus] in order to elucidate the flow of events associated with fruit development and ripening in this species. RNA from three different maturation stages of watermelon fruits, as well as leaf, were collected from field grown plants during three consecutive years, and analyzed for gene expression using high-density photolithography microarrays and quantitative PCR. Results High-density photolithography arrays, composed of probes of 832 EST-unigenes from a subtracted, fruit development, cDNA library of watermelon were utilized to examine gene expression at three distinct time-points in watermelon fruit development. Analysis was performed with field-grown fruits over three consecutive growing seasons. Microarray analysis identified three hundred and thirty-five unique ESTs that are differentially regulated by at least two-fold in watermelon fruits during the early, ripening, or mature stage when compared to leaf. Of the 335 ESTs identified, 211 share significant homology with known gene products and 96 had no significant matches with any database accession. Of the modulated watermelon ESTs related to annotated genes, a significant number were found to be associated with or involved in the vascular system, carotenoid biosynthesis, transcriptional regulation, pathogen and stress response, and ethylene biosynthesis. Ethylene bioassays, performed with a closely related watermelon genotype with a similar

  17. Gene expression in developing watermelon fruit

    Directory of Open Access Journals (Sweden)

    Hernandez Alvaro


    Full Text Available Abstract Background Cultivated watermelon form large fruits that are highly variable in size, shape, color, and content, yet have extremely narrow genetic diversity. Whereas a plethora of genes involved in cell wall metabolism, ethylene biosynthesis, fruit softening, and secondary metabolism during fruit development and ripening have been identified in other plant species, little is known of the genes involved in these processes in watermelon. A microarray and quantitative Real-Time PCR-based study was conducted in watermelon [Citrullus lanatus (Thunb. Matsum. & Nakai var. lanatus] in order to elucidate the flow of events associated with fruit development and ripening in this species. RNA from three different maturation stages of watermelon fruits, as well as leaf, were collected from field grown plants during three consecutive years, and analyzed for gene expression using high-density photolithography microarrays and quantitative PCR. Results High-density photolithography arrays, composed of probes of 832 EST-unigenes from a subtracted, fruit development, cDNA library of watermelon were utilized to examine gene expression at three distinct time-points in watermelon fruit development. Analysis was performed with field-grown fruits over three consecutive growing seasons. Microarray analysis identified three hundred and thirty-five unique ESTs that are differentially regulated by at least two-fold in watermelon fruits during the early, ripening, or mature stage when compared to leaf. Of the 335 ESTs identified, 211 share significant homology with known gene products and 96 had no significant matches with any database accession. Of the modulated watermelon ESTs related to annotated genes, a significant number were found to be associated with or involved in the vascular system, carotenoid biosynthesis, transcriptional regulation, pathogen and stress response, and ethylene biosynthesis. Ethylene bioassays, performed with a closely related watermelon

  18. Gene Expression Profile Changes in Germinating Rice

    Institute of Scientific and Technical Information of China (English)

    Dongli He; Chao Han; Pingfang Yang


    Water absorption is a prerequisite for seed germination.During imbibition,water influx causes the resumption of many physiological and metabolic processes in growing seed.In order to obtain more complete knowledge about the mechanism of seed germination,two-dimensional gel electrophoresis was applied to investigate the protein profile changes of rice seed during the first 48 h of imbibition.Thirtynine differentially expressed proteins were identified,including 19 down-regulated and 20 up-regulated proteins.Storage proteins and some seed development- and desiccation-associated proteins were down regulated.The changed patterns of these proteins indicated extensive mobilization of seed reserves.By contrast,catabolism-associated proteins were up regulated upon imbibition.Semi-quantitative real time polymerase chain reaction analysis showed that most of the genes encoding the down- or upregulated proteins were also down or up regulated at mRNA level.The expression of these genes was largely consistent at mRNA and protein levels.In providing additional information concerning gene regulation in early plant life,this study will facilitate understanding of the molecular mechanisms of seed germination.

  19. Studying the Complex Expression Dependences between Sets of Coexpressed Genes

    Directory of Open Access Journals (Sweden)

    Mario Huerta


    Full Text Available Organisms simplify the orchestration of gene expression by coregulating genes whose products function together in the cell. The use of clustering methods to obtain sets of coexpressed genes from expression arrays is very common; nevertheless there are no appropriate tools to study the expression networks among these sets of coexpressed genes. The aim of the developed tools is to allow studying the complex expression dependences that exist between sets of coexpressed genes. For this purpose, we start detecting the nonlinear expression relationships between pairs of genes, plus the coexpressed genes. Next, we form networks among sets of coexpressed genes that maintain nonlinear expression dependences between all of them. The expression relationship between the sets of coexpressed genes is defined by the expression relationship between the skeletons of these sets, where this skeleton represents the coexpressed genes with a well-defined nonlinear expression relationship with the skeleton of the other sets. As a result, we can study the nonlinear expression relationships between a target gene and other sets of coexpressed genes, or start the study from the skeleton of the sets, to study the complex relationships of activation and deactivation between the sets of coexpressed genes that carry out the different cellular processes present in the expression experiments.

  20. Nuclear AXIN2 represses MYC gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Rennoll, Sherri A.; Konsavage, Wesley M.; Yochum, Gregory S., E-mail:


    Highlights: •AXIN2 localizes to cytoplasmic and nuclear compartments in colorectal cancer cells. •Nuclear AXIN2 represses the activity of Wnt-responsive luciferase reporters. •β-Catenin bridges AXIN2 to TCF transcription factors. •AXIN2 binds the MYC promoter and represses MYC gene expression. -- Abstract: The β-catenin transcriptional coactivator is the key mediator of the canonical Wnt signaling pathway. In the absence of Wnt, β-catenin associates with a cytosolic and multi-protein destruction complex where it is phosphorylated and targeted for proteasomal degradation. In the presence of Wnt, the destruction complex is inactivated and β-catenin translocates into the nucleus. In the nucleus, β-catenin binds T-cell factor (TCF) transcription factors to activate expression of c-MYC (MYC) and Axis inhibition protein 2 (AXIN2). AXIN2 is a member of the destruction complex and, thus, serves in a negative feedback loop to control Wnt/β-catenin signaling. AXIN2 is also present in the nucleus, but its function within this compartment is unknown. Here, we demonstrate that AXIN2 localizes to the nuclei of epithelial cells within normal and colonic tumor tissues as well as colorectal cancer cell lines. In the nucleus, AXIN2 represses expression of Wnt/β-catenin-responsive luciferase reporters and forms a complex with β-catenin and TCF. We demonstrate that AXIN2 co-occupies β-catenin/TCF complexes at the MYC promoter region. When constitutively localized to the nucleus, AXIN2 alters the chromatin structure at the MYC promoter and directly represses MYC gene expression. These findings suggest that nuclear AXIN2 functions as a rheostat to control MYC expression in response to Wnt/β-catenin signaling.

  1. The relationship among gene expression, the evolution of gene dosage, and the rate of protein evolution.

    Directory of Open Access Journals (Sweden)

    Jean-François Gout


    Full Text Available The understanding of selective constraints affecting genes is a major issue in biology. It is well established that gene expression level is a major determinant of the rate of protein evolution, but the reasons for this relationship remain highly debated. Here we demonstrate that gene expression is also a major determinant of the evolution of gene dosage: the rate of gene losses after whole genome duplications in the Paramecium lineage is negatively correlated to the level of gene expression, and this relationship is not a byproduct of other factors known to affect the fate of gene duplicates. This indicates that changes in gene dosage are generally more deleterious for highly expressed genes. This rule also holds for other taxa: in yeast, we find a clear relationship between gene expression level and the fitness impact of reduction in gene dosage. To explain these observations, we propose a model based on the fact that the optimal expression level of a gene corresponds to a trade-off between the benefit and cost of its expression. This COSTEX model predicts that selective pressure against mutations changing gene expression level or affecting the encoded protein should on average be stronger in highly expressed genes and hence that both the frequency of gene loss and the rate of protein evolution should correlate negatively with gene expression. Thus, the COSTEX model provides a simple and common explanation for the general relationship observed between the level of gene expression and the different facets of gene evolution.

  2. Coamplification of eukaryotic DNA with 16S rRNA gene-based PCR primers: possible consequences for population fingerprinting of complex microbial communities. (United States)

    Huys, Geert; Vanhoutte, Tom; Joossens, Marie; Mahious, Amal S; De Brandt, Evie; Vermeire, Severine; Swings, Jean


    The main aim of this study was to evaluate the specificity of three commonly used 16S rRNA gene-based polymerase chain reaction (PCR) primer sets for bacterial community analysis of samples contaminated with eukaryotic DNA. The specificity of primer sets targeting the V3, V3-V5, and V6-V8 hypervariable regions of the 16S rRNA gene was investigated in silico and by community fingerprinting of human and fish intestinal samples. Both in silico and PCR-based analysis revealed cross-reactivity of the V3 and V3-V5 primers with the 18S rRNA gene of human and sturgeon. The consequences of this primer anomaly were illustrated by denaturing gradient gel electrophoresis (DGGE) profiling of microbial communities in human feces and mixed gut of Siberian sturgeon. DGGE profiling indicated that the cross-reactivity of 16S rRNA gene primers with nontarget eukaryotic DNA might lead to an overestimation of bacterial biodiversity. This study has confirmed previous sporadic indications in literature indicating that several commonly applied 16S rRNA gene primer sets lack specificity toward bacteria in the presence of eukaryotic DNA. The phenomenon of cross-reactivity is a potential source of systematic error in all biodiversity studies where no subsequent analysis of individual community amplicons by cloning and sequencing is performed.

  3. Expressing exogenous genes in newts by transgenesis. (United States)

    Casco-Robles, Martin Miguel; Yamada, Shouta; Miura, Tomoya; Nakamura, Kenta; Haynes, Tracy; Maki, Nobuyasu; Del Rio-Tsonis, Katia; Tsonis, Panagiotis A; Chiba, Chikafumi


    The great regenerative abilities of newts provide the impetus for studies at the molecular level. However, efficient methods for gene regulation have historically been quite limited. Here we describe a protocol for transgenically expressing exogenous genes in the newt Cynops pyrrhogaster. This method is simple: a reaction mixture of I-SceI meganuclease and a plasmid DNA carrying a transgene cassette flanked by the enzyme recognition sites is directly injected into fertilized eggs. The protocol achieves a high efficiency of transgenesis, comparable to protocols used in other animal systems, and it provides a practical number of transgenic newts (∼20% of injected embryos) that survive beyond metamorphosis and that can be applied to regenerative studies. The entire protocol for obtaining transgenic adult newts takes 4-5 months.

  4. Gene expression-targeted isoflavone therapy. (United States)

    Węgrzyn, Alicja


    Lysosomal storage diseases (LSD) form a group of inherited metabolic disorders caused by dysfunction of one of the lysosomal proteins, resulting in the accumulation of certain compounds. Although these disorders are among first genetic diseases for which specific treatments were proposed, there are still serious unsolved problems that require development of novel therapeutic procedures. An example is neuronopathy, which develops in most of LSD and cannot be treated efficiently by currently approved therapies. Recently, a new potential therapy, called gene expression-targeted isoflavone therapy (GET IT), has been proposed for a group of LSD named mucopolysaccharidoses (MPS), in which storage of incompletely degraded glycosaminoglycans (GAGs) results in severe symptoms of virtually all tissues and organs, including central nervous system. The idea of this therapy is to inhibit synthesis of GAGs by modulating expression of genes coding for enzymes involved in synthesis of these compounds. Such a modulation is possible by using isoflavones, particularly genistein, which interfere with a signal transduction process necessary for stimulation of expression of certain genes. Results of in vitro experiments and studies on animal models indicated a high efficiency of GET IT, including correction of behavior of affected mice. However, clinical trials, performed with soy isoflavone extracts, revealed only limited efficacy. This caused a controversy about GET IT as a potential, effective treatment of patients suffering from MPS, especially neuronopathic forms of these diseases. It this critical review, I present possible molecular mechanisms of therapeutic action of isoflavones (particularly genistein) and suggest that efficacy of GET IT might be sufficiently high when using relatively high doses of synthetic genistein (which was employed in experiments on cell cultures and mouse models) rather than low doses of soy isoflavone extracts (which were used in clinical trials). This

  5. On the statistics of the "genetic fingerprint". (United States)

    Ritter, H


    In analogy to the polygene determined morphological features, the DNA-fingerprint is also not suitable for statistical processing. Statements about the individuality are merely speculative. Frequencies of genes cannot be found, since it is impossible to determine which combinations of bands belong to one gene locus. Hence the DNA fingerprint enables the recognition of exclusions from paternity; it does not, however, allow a statistical analysis, no matter which method be employed.

  6. Gene expression profiling of cutaneous wound healing

    Directory of Open Access Journals (Sweden)

    Wang Ena


    Full Text Available Abstract Background Although the sequence of events leading to wound repair has been described at the cellular and, to a limited extent, at the protein level this process has yet to be fully elucidated. Genome wide transcriptional analysis tools promise to further define the global picture of this complex progression of events. Study Design This study was part of a placebo-controlled double-blind clinical trial in which basal cell carcinomas were treated topically with an immunomodifier – toll-like receptor 7 agonist: imiquimod. The fourteen patients with basal cell carcinoma in the placebo arm of the trial received placebo treatment consisting solely of vehicle cream. A skin punch biopsy was obtained immediately before treatment and at the end of the placebo treatment (after 2, 4 or 8 days. 17.5K cDNA microarrays were utilized to profile the biopsy material. Results Four gene signatures whose expression changed relative to baseline (before wound induction by the pre-treatment biopsy were identified. The largest group was comprised predominantly of inflammatory genes whose expression was increased throughout the study. Two additional signatures were observed which included preferentially pro-inflammatory genes in the early post-treatment biopsies (2 days after pre-treatment biopsies and repair and angiogenesis genes in the later (4 to 8 days biopsies. The fourth and smallest set of genes was down-regulated throughout the study. Early in wound healing the expression of markers of both M1 and M2 macrophages were increased, but later M2 markers predominated. Conclusion The initial response to a cutaneous wound induces powerful transcriptional activation of pro-inflammatory stimuli which may alert the host defense. Subsequently and in the absence of infection, inflammation subsides and it is replaced by angiogenesis and remodeling. Understanding this transition which may be driven by a change from a mixed macrophage population to predominately M2

  7. Network Completion for Static Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Natsu Nakajima


    Full Text Available We tackle the problem of completing and inferring genetic networks under stationary conditions from static data, where network completion is to make the minimum amount of modifications to an initial network so that the completed network is most consistent with the expression data in which addition of edges and deletion of edges are basic modification operations. For this problem, we present a new method for network completion using dynamic programming and least-squares fitting. This method can find an optimal solution in polynomial time if the maximum indegree of the network is bounded by a constant. We evaluate the effectiveness of our method through computational experiments using synthetic data. Furthermore, we demonstrate that our proposed method can distinguish the differences between two types of genetic networks under stationary conditions from lung cancer and normal gene expression data.

  8. Advanced Fingerprint Analysis Project Fingerprint Constituents

    Energy Technology Data Exchange (ETDEWEB)

    GM Mong; CE Petersen; TRW Clauss


    The work described in this report was focused on generating fundamental data on fingerprint components which will be used to develop advanced forensic techniques to enhance fluorescent detection, and visualization of latent fingerprints. Chemical components of sweat gland secretions are well documented in the medical literature and many chemical techniques are available to develop latent prints, but there have been no systematic forensic studies of fingerprint sweat components or of the chemical and physical changes these substances undergo over time.

  9. Apopotic gene Bax expression in carotid plaque

    Institute of Scientific and Technical Information of China (English)

    Bao-Zhong MEN; Ding-Biao ZHOU; Huai-Yin SHI; Xiao-Ming ZHANG


    The expression of BAX in carotid atherosclerosis and its regulation is far from defined. Objectives To investigate BAX expression in stable/fibrous and instable/vulnerable carotid plaque and its clinical significance. Methods 25 cases of carotid plaque specimens obtained from endarterectomy were divided into two groups, stable/fibrous 14 cases, vulnerable/instable 11 cases; aortic artery and its branches from hepatic transplantation donors 6 case as control. The expression of proapoptotic BAX was detected by immunohistochemistry(IHC), in situ hybridization(ISH) and in situ TdT dUTP nick end labeling (TUNEL). Results 5 cases of BAX ( + ) were detected by ICH and ISH, 4 case of TUNEL ( + ) were detected by TUNEL in stable/fibrous carotid plaque , while 10 cases were BAX ( + )by IHC(P < 0.05) , 11case by ISH and 9 case by TUNEL were detected in instable/vulnerable carotid plaque ( P < 0.01 ), respectively. The intensity of BAX ( + ) cells by IHC and ISH was 8.63 ± 2.62 and 10.32 ± 3.12 in fibrous plaques, whereas 122 ± 21.64and 152 ± 23.35 in vulnerable plaques, respectively. No expression of BAX was found in controlled group. Conclusion The higher expression of Bax in vulnerable carotid plaque may be one mechanisms in molecular pathogenesis of carotid atherosclerosis which affect plaque stability and be the cause of higher incidence of stroke than fibrous carotid plaques, the regulation of BAX expression in different stage of atherosclerosis may provide targets in gene therapy for carotid atherosclerosis.

  10. Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes

    KAUST Repository

    Horiuchi, Youko


    Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis-eQTLs. Expression

  11. Expression profiles for six zebrafish genes during gonadal sex differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Morthorst, Jane E.; Andersen, Ole;


    the precise timing of expression of six genes previously suggested to be associated with sex differentiation in zebrafish. The current study investigates the expression of all six genes in the same individual fish with extensive sampling dates during sex determination and -differentiation. RESULTS...... the same fish allowing comparison of the high and low expressers of genes that are expected to be highest expressed in either males or females. There were 78% high or low expressers of all three "male" genes (ar, sox9a and dmrt1) in the investigated period and 81% were high or low expressers of both...

  12. Positive selection on gene expression in the human brain

    DEFF Research Database (Denmark)

    Khaitovich, Philipp; Tang, Kun; Franz, Henriette


    Recent work has shown that the expression levels of genes transcribed in the brains of humans and chimpanzees have changed less than those of genes transcribed in other tissues [1] . However, when gene expression changes are mapped onto the evolutionary lineage in which they occurred, the brain...... shows more changes than other tissues in the human lineage compared to the chimpanzee lineage [1] , [2] and [3] . There are two possible explanations for this: either positive selection drove more gene expression changes to fixation in the human brain than in the chimpanzee brain, or genes expressed...... in the brain experienced less purifying selection in humans than in chimpanzees, i.e. gene expression in the human brain is functionally less constrained. The first scenario would be supported if genes that changed their expression in the brain in the human lineage showed more selective sweeps than other genes...

  13. Spatiotemporal patterns of gene expression during fetal monkey brain development. (United States)

    Redmond, D Eugene; Zhao, Ji-Liang; Randall, Jeffry D; Eklund, Aron C; Eusebi, Leonard O V; Roth, Robert H; Gullans, Steven R; Jensen, Roderick V


    Human DNA microarrays are used to study the spatiotemporal patterns of gene expression during the course of fetal monkey brain development. The 444 most dynamically expressed genes in four major brain areas are reported at five different fetal ages. The spatiotemporal profiles of gene expression show both regional specificity as well as waves of gene expression across the developing brain. These patterns of expression are used to identify statistically significant clusters of co-regulated genes. This study demonstrates for the first time in the primate the relevance, timing, and spatial locations of expression for many developmental genes identified in other animals and provides clues to the functions of many unknowns. Two different microarray platforms are used to provide high-throughput cross validation of the most important gene expression changes. These results may lead to new understanding of brain development and new strategies for treating and repairing disorders of brain function.

  14. The Effects of Hallucinogens on Gene Expression. (United States)

    Martin, David A; Nichols, Charles D


    The classic serotonergic hallucinogens, or psychedelics, have the ability to profoundly alter perception and behavior. These can include visual distortions, hallucinations, detachment from reality, and mystical experiences. Some psychedelics, like LSD, are able to produce these effects with remarkably low doses of drug. Others, like psilocybin, have recently been demonstrated to have significant clinical efficacy in the treatment of depression, anxiety, and addiction that persist for at least several months after only a single therapeutic session. How does this occur? Much work has recently been published from imaging studies showing that psychedelics alter brain network connectivity. They facilitate a disintegration of the default mode network, producing a hyperconnectivity between brain regions that allow centers that do not normally communicate with each other to do so. The immediate and acute effects on both behaviors and network connectivity are likely mediated by effector pathways downstream of serotonin 5-HT2A receptor activation. These acute molecular processes also influence gene expression changes, which likely influence synaptic plasticity and facilitate more long-term changes in brain neurochemistry ultimately underlying the therapeutic efficacy of a single administration to achieve long-lasting effects. In this review, we summarize what is currently known about the molecular genetic responses to psychedelics within the brain and discuss how gene expression changes may contribute to altered cellular physiology and behaviors.

  15. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis (United States)

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun


    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  16. Brief isoflurane anaesthesia affects differential gene expression, gene ontology and gene networks in rat brain. (United States)

    Lowes, Damon A; Galley, Helen F; Moura, Alessandro P S; Webster, Nigel R


    Much is still unknown about the mechanisms of effects of even brief anaesthesia on the brain and previous studies have simply compared differential expression profiles with and without anaesthesia. We hypothesised that network analysis, in addition to the traditional differential gene expression and ontology analysis, would enable identification of the effects of anaesthesia on interactions between genes. Rats (n=10 per group) were randomised to anaesthesia with isoflurane in oxygen or oxygen only for 15min, and 6h later brains were removed. Differential gene expression and gene ontology analysis of microarray data was performed. Standard clustering techniques and principal component analysis with Bayesian rules were used along with social network analysis methods, to quantitatively model and describe the gene networks. Anaesthesia had marked effects on genes in the brain with differential regulation of 416 probe sets by at least 2 fold. Gene ontology analysis showed 23 genes were functionally related to the anaesthesia and of these, 12 were involved with neurotransmitter release, transport and secretion. Gene network analysis revealed much greater connectivity in genes from brains from anaesthetised rats compared to controls. Other importance measures were also altered after anaesthesia; median [range] closeness centrality (shortest path) was lower in anaesthetized animals (0.07 [0-0.30]) than controls (0.39 [0.30-0.53], pgenes after anaesthesia and suggests future targets for investigation. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Detection of gene expression pattern in the early stage after spinal cord injury by gene chip

    Institute of Scientific and Technical Information of China (English)

    刘成龙; 靳安民; 童斌辉


    Objective: To study the changes of the gene expression pattern of spinal cord tissues in the early stage after injury by DNA microarray (gene chip). Methods: The contusion model of rat spinal cord was established according to Allen's falling strike method and the gene expression patterns of normal and injured spinal cord tissues were studied by gene chip. Results: The expression of 45 genes was significantly changed in the early stage after spinal cord injury, in which 22 genes up-regulated and 23 genes down-regulated. Conclusions: The expression of some genes changes significantly in the early stage after spinal cord injury, which indicates the complexity of secondary spinal cord injury.

  18. Coactivators in PPAR-Regulated Gene Expression

    Directory of Open Access Journals (Sweden)

    Navin Viswakarma


    Full Text Available Peroxisome proliferator-activated receptor (PPARα, β (also known as δ, and γ function as sensors for fatty acids and fatty acid derivatives and control important metabolic pathways involved in the maintenance of energy balance. PPARs also regulate other diverse biological processes such as development, differentiation, inflammation, and neoplasia. In the nucleus, PPARs exist as heterodimers with retinoid X receptor-α bound to DNA with corepressor molecules. Upon ligand activation, PPARs undergo conformational changes that facilitate the dissociation of corepressor molecules and invoke a spatiotemporally orchestrated recruitment of transcription cofactors including coactivators and coactivator-associated proteins. While a given nuclear receptor regulates the expression of a prescribed set of target genes, coactivators are likely to influence the functioning of many regulators and thus affect the transcription of many genes. Evidence suggests that some of the coactivators such as PPAR-binding protein (PBP/PPARBP/thyroid hormone receptor-associated protein 220 (TRAP220/mediator complex subunit 1 (MED1 may exert a broader influence on the functions of several nuclear receptors and their target genes. Investigations into the role of coactivators in the function of PPARs should strengthen our understanding of the complexities of metabolic diseases associated with energy metabolism.

  19. Gene expression profiling of mouse embryos with microarrays


    Sharov, Alexei A; Piao, Yulan; Minoru S.H. Ko


    Global expression profiling by DNA microarrays provides a snapshot of cell and tissue status and becomes an essential tool in biological and medical sciences. Typical questions that can be addressed by microarray analysis in developmental biology include: (1) to find a set of genes expressed in a specific cell type; (2) to identify genes expressed commonly in multiple cell types; (3) to follow the time-course changes of gene expression patterns; (4) to demonstrate cell’s identity by showing s...

  20. Analysis of multiplex gene expression maps obtained by voxelation

    Directory of Open Access Journals (Sweden)

    Smith Desmond J


    Full Text Available Abstract Background Gene expression signatures in the mammalian brain hold the key to understanding neural development and neurological disease. Researchers have previously used voxelation in combination with microarrays for acquisition of genome-wide atlases of expression patterns in the mouse brain. On the other hand, some work has been performed on studying gene functions, without taking into account the location information of a gene's expression in a mouse brain. In this paper, we present an approach for identifying the relation between gene expression maps obtained by voxelation and gene functions. Results To analyze the dataset, we chose typical genes as queries and aimed at discovering similar gene groups. Gene similarity was determined by using the wavelet features extracted from the left and right hemispheres averaged gene expression maps, and by the Euclidean distance between each pair of feature vectors. We also performed a multiple clustering approach on the gene expression maps, combined with hierarchical clustering. Among each group of similar genes and clusters, the gene function similarity was measured by calculating the average gene function distances in the gene ontology structure. By applying our methodology to find similar genes to certain target genes we were able to improve our understanding of gene expression patterns and gene functions. By applying the clustering analysis method, we obtained significant clusters, which have both very similar gene expression maps and very similar gene functions respectively to their corresponding gene ontologies. The cellular component ontology resulted in prominent clusters expressed in cortex and corpus callosum. The molecular function ontology gave prominent clusters in cortex, corpus callosum and hypothalamus. The biological process ontology resulted in clusters in cortex, hypothalamus and choroid plexus. Clusters from all three ontologies combined were most prominently expressed in

  1. Differentially expressed genes in pancreatic ductal adenocarcinomas identified through serial analysis of gene expression

    DEFF Research Database (Denmark)

    Hustinx, Steven R; Cao, Dengfeng; Maitra, Anirban;


    Serial analysis of gene expression (SAGE) is a powerful tool for the discovery of novel tumor markers. The publicly available online SAGE libraries of normal and neoplastic tissues ( have recently been expanded; in addition, a more complete annotation of the human...

  2. Distorted Fingerprint Verification System

    Directory of Open Access Journals (Sweden)



    Full Text Available Fingerprint verification is one of the most reliable personal identification methods. Fingerprint matching is affected by non-linear distortion introduced in fingerprint impression during the image acquisition process. This non-linear deformation changes both the position and orientation of minutiae. The proposed system operates in three stages: alignment based fingerprint matching, fuzzy clustering and classifier framework. First, an enhanced input fingerprint image has been aligned with the template fingerprint image and matching score is computed. To improve the performance of the system, a fuzzy clustering based on distance and density has been used to cluster the feature set obtained from the fingerprint matcher. Finally a classifier framework has been developed and found that cost sensitive classifier produces better results. The system has been evaluated on fingerprint database and the experimental result shows that system produces a verification rate of 96%. This system plays an important role in forensic and civilian applications.

  3. Gene expression profiling of loss of TET2 and/or JAK2V617F mutant hematopoietic stem cells from mouse models of myeloproliferative neoplasms. (United States)

    Kameda, Takuro; Shide, Kotaro; Yamaji, Takumi; Kamiunten, Ayako; Sekine, Masaaki; Hidaka, Tomonori; Kubuki, Yoko; Sashida, Goro; Aoyama, Kazumasa; Yoshimitsu, Makoto; Abe, Hiroo; Miike, Tadashi; Iwakiri, Hisayoshi; Tahara, Yoshihiro; Yamamoto, Shojiro; Hasuike, Satoru; Nagata, Kenji; Iwama, Atsushi; Kitanaka, Akira; Shimoda, Kazuya


    Myeloproliferative neoplasms (MPNs) are clinically characterized by the chronic overproduction of differentiated peripheral blood cells and the gradual expansion of malignant intramedullary/extramedullary hematopoiesis. In MPNs mutations in JAK2 MPL or CALR are detected mutually exclusive in more than 90% of cases [1,2]. Mutations in them lead to the abnormal activation of JAK/STAT signaling and the autonomous growth of differentiated cells therefore they are considered as "driver" gene mutations. In addition to the above driver gene mutations mutations in epigenetic regulators such as TET2 DNMT3A ASXL1 EZH2 or IDH1/2 are detected in about 5%-30% of cases respectively [3]. Mutations in TET2 DNMT3A EZH2 or IDH1/2 commonly confer the increased self-renewal capacity on normal hematopoietic stem cells (HSCs) but they do not lead to the autonomous growth of differentiated cells and only exhibit subtle clinical phenotypes [4,6-8,5]. It was unclear how mutations in such epigenetic regulators influenced abnormal HSCs with driver gene mutations how they influenced the disease phenotype or whether a single driver gene mutation was sufficient for the initiation of human MPNs. Therefore we focused on JAK2V617F and loss of TET2-the former as a representative of driver gene mutations and the latter as a representative of mutations in epigenetic regulators-and examined the influence of single or double mutations on HSCs (Lineage(-)Sca-1(+)c-Kit(+) cells (LSKs)) by functional analyses and microarray whole-genome expression analyses [9]. Gene expression profiling showed that the HSC fingerprint genes [10] was statistically equally enriched in TET2-knockdown-LSKs but negatively enriched in JAK2V617F-LSKs compared to that in wild-type-LSKs. Double-mutant-LSKs showed the same tendency as JAK2V617F-LSKs in terms of their HSC fingerprint genes but the expression of individual genes differed between the two groups. Among 245 HSC fingerprint genes 100 were more highly expressed in double

  4. Linguistically informed digital fingerprints for text (United States)

    Uzuner, Özlem


    Digital fingerprinting, watermarking, and tracking technologies have gained importance in the recent years in response to growing problems such as digital copyright infringement. While fingerprints and watermarks can be generated in many different ways, use of natural language processing for these purposes has so far been limited. Measuring similarity of literary works for automatic copyright infringement detection requires identifying and comparing creative expression of content in documents. In this paper, we present a linguistic approach to automatically fingerprinting novels based on their expression of content. We use natural language processing techniques to generate "expression fingerprints". These fingerprints consist of both syntactic and semantic elements of language, i.e., syntactic and semantic elements of expression. Our experiments indicate that syntactic and semantic elements of expression enable accurate identification of novels and their paraphrases, providing a significant improvement over techniques used in text classification literature for automatic copy recognition. We show that these elements of expression can be used to fingerprint, label, or watermark works; they represent features that are essential to the character of works and that remain fairly consistent in the works even when works are paraphrased. These features can be directly extracted from the contents of the works on demand and can be used to recognize works that would not be correctly identified either in the absence of pre-existing labels or by verbatim-copy detectors.

  5. Touchless fingerprint biometrics

    CERN Document Server

    Labati, Ruggero Donida; Scotti, Fabio


    Offering the first comprehensive analysis of touchless fingerprint-recognition technologies, Touchless Fingerprint Biometrics gives an overview of the state of the art and describes relevant industrial applications. It also presents new techniques to efficiently and effectively implement advanced solutions based on touchless fingerprinting.The most accurate current biometric technologies in touch-based fingerprint-recognition systems require a relatively high level of user cooperation to acquire samples of the concerned biometric trait. With the potential for reduced constraints, reduced hardw

  6. Modeling of gap gene expression in Drosophila Kruppel mutants.

    Directory of Open Access Journals (Sweden)

    Konstantin Kozlov

    Full Text Available The segmentation gene network in Drosophila embryo solves the fundamental problem of embryonic patterning: how to establish a periodic pattern of gene expression, which determines both the positions and the identities of body segments. The gap gene network constitutes the first zygotic regulatory tier in this process. Here we have applied the systems-level approach to investigate the regulatory effect of gap gene Kruppel (Kr on segmentation gene expression. We acquired a large dataset on the expression of gap genes in Kr null mutants and demonstrated that the expression levels of these genes are significantly reduced in the second half of cycle 14A. To explain this novel biological result we applied the gene circuit method which extracts regulatory information from spatial gene expression data. Previous attempts to use this formalism to correctly and quantitatively reproduce gap gene expression in mutants for a trunk gap gene failed, therefore here we constructed a revised model and showed that it correctly reproduces the expression patterns of gap genes in Kr null mutants. We found that the remarkable alteration of gap gene expression patterns in Kr mutants can be explained by the dynamic decrease of activating effect of Cad on a target gene and exclusion of Kr gene from the complex network of gap gene interactions, that makes it possible for other interactions, in particular, between hb and gt, to come into effect. The successful modeling of the quantitative aspects of gap gene expression in mutant for the trunk gap gene Kr is a significant achievement of this work. This result also clearly indicates that the oversimplified representation of transcriptional regulation in the previous models is one of the reasons for unsuccessful attempts of mutant simulations.

  7. Bioinformatics analysis of the gene expression profile in Bladder carcinoma

    Directory of Open Access Journals (Sweden)

    Jing Xiao


    Full Text Available Bladder carcinoma, which has the ninth highest incidence among malignant tumors in the world, is a complex, multifactorial disease. The malignant transformation of bladder cells results from DNA mutations and alterations in gene expression levels. In this work, we used a bioinformatics approach to investigate the molecular mechanisms of bladder carcinoma. Biochips downloaded from the Gene Expression Omnibus (GEO were used to analyze the gene expression profile in urinary bladder cells from individuals with carcinoma. The gene expression profile of normal genomes was used as a control. The analysis of gene expression revealed important alterations in genes involved in biological processes and metabolic pathways. We also identified some small molecules capable of reversing the altered gene expression in bladder carcinoma; these molecules could provide a basis for future therapies for the treatment of this disease.

  8. Neural crest and mesoderm lineage-dependent gene expression in orofacial development. (United States)

    Bhattacherjee, Vasker; Mukhopadhyay, Partha; Singh, Saurabh; Johnson, Charles; Philipose, John T; Warner, Courtney P; Greene, Robert M; Pisano, M Michele


    The present study utilizes a combination of genetic labeling/selective isolation of pluripotent embryonic progenitor cells, and oligonucleotide-based microarray technology, to delineate and compare the "molecular fingerprint" of two mesenchymal cell populations from distinct lineages in the developing embryonic orofacial region. The first branchial arches-bi-lateral tissue primordia that flank the primitive oral cavity-are populated by pluripotent mesenchymal cells from two different lineages: neural crest (neuroectoderm)- and mesoderm-derived mesenchymal cells. These cells give rise to all of the connective tissue elements (bone, cartilage, smooth and skeletal muscle, dentin) of the orofacial region (maxillary and mandibular portion), as well as neurons and glia associated with the cranial ganglia, among other tissues. In the present study, neural crest- and mesoderm-derived mesenchymal cells were selectively isolated from the first branchial arch of gestational day 9.5 mouse embryos using laser capture microdissection (LCM). The two different embryonic cell lineages were distinguished through utilization of a novel two component transgenic mouse model (Wnt1Cre/ZEG) in which the neural crest cells and their derivatives are indelibly marked (i.e., expressing enhanced green fluorescent protein, EGFP) throughout the pre- and post-natal lifespan of the organism. EGFP-labeled neural crest-derived, and non-fluorescent mesoderm-derived mesenchymal cells from the first branchial arch were visualized in frozen tissue sections from gestational day 9.5 mouse embryos and independently isolated by LCM under epifluorescence optics. RNA was extracted from the two populations of LCM-procured cells, and amplified by double-stranded cDNA synthesis and in vitro transcription. Gene expression profiles of the two progenitor cell populations were generated via hybridization of the cell-type specific cRNA samples to oligo-based GeneChip microarrays. Comparison of gene expression

  9. Gene expression during fruit ripening in avocado. (United States)

    Christoffersen, R E; Warm, E; Laties, G G


    The poly(A) (+)RNA populations from avocado fruit (Persea americana Mill cv. Hass) at four stages of ripening were isolated by two cycles of oligo-dT-cellulose chromatography and examined by invitro translation, using the rabbit reticulocyte lysate system, followed by two-dimensional gel electrophoresis (isoelectric focusing followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis) of the resulting translation products. Three mRNAs increased dramatically with the climacteric rise in respiration and ethylene production. The molecular weights of the corresponding translation products from the ripening-related mRNAs are 80,000, 36,000, and 16,500. These results indicate that ripening may be linked to the expression of specific genes.

  10. Evolution of Gene Expression Balance Among Homeologs of Natural Polyploids

    Directory of Open Access Journals (Sweden)

    Jasdeep S. Mutti


    Full Text Available Polyploidy is a major evolutionary process in eukaryotes, yet the expression balance of homeologs in natural polyploids is largely unknown. To study this expression balance, the expression patterns of 2180 structurally well-characterized genes of wheat were studied, of which 813 had the expected three copies and 375 had less than three. Copy numbers of the remaining 992 ranged from 4 to 14, including homeologs, orthologs, and paralogs. Of the genes with three structural copies corresponding to homeologs, 55% expressed from all three, 38% from two, and the remaining 7% expressed from only one of the three copies. Homeologs of 76–87% of the genes showed differential expression patterns in different tissues, thus have evolved different gene expression controls, possibly resulting in novel functions. Homeologs of 55% of the genes showed tissue-specific expression, with the largest percentage (14% in the anthers and the smallest (7% in the pistils. The highest number (1.72/3 of homeologs/gene expression was in the roots and the lowest (1.03/3 in the anthers. As the expression of homeologs changed with changes in structural copy number, about 30% of the genes showed dosage dependence. Chromosomal location also impacted expression pattern as a significantly higher proportion of genes in the proximal regions showed expression from all three copies compared to that present in the distal regions.

  11. Evolution of Gene Expression Balance Among Homeologs of Natural Polyploids. (United States)

    Mutti, Jasdeep S; Bhullar, Ramanjot K; Gill, Kulvinder S


    Polyploidy is a major evolutionary process in eukaryotes, yet the expression balance of homeologs in natural polyploids is largely unknown. To study this expression balance, the expression patterns of 2180 structurally well-characterized genes of wheat were studied, of which 813 had the expected three copies and 375 had less than three. Copy numbers of the remaining 992 ranged from 4 to 14, including homeologs, orthologs, and paralogs. Of the genes with three structural copies corresponding to homeologs, 55% expressed from all three, 38% from two, and the remaining 7% expressed from only one of the three copies. Homeologs of 76-87% of the genes showed differential expression patterns in different tissues, thus have evolved different gene expression controls, possibly resulting in novel functions. Homeologs of 55% of the genes showed tissue-specific expression, with the largest percentage (14%) in the anthers and the smallest (7%) in the pistils. The highest number (1.72/3) of homeologs/gene expression was in the roots and the lowest (1.03/3) in the anthers. As the expression of homeologs changed with changes in structural copy number, about 30% of the genes showed dosage dependence. Chromosomal location also impacted expression pattern as a significantly higher proportion of genes in the proximal regions showed expression from all three copies compared to that present in the distal regions.

  12. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe


    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an experiment

  13. Phenotypic plasticity and divergence in gene expression. (United States)

    Healy, Timothy M; Schulte, Patricia M


    The extent to which phenotypic plasticity, or the ability of a single genotype to produce different phenotypes in different environments, impedes or promotes genetic divergence has been a matter of debate within evolutionary biology for many decades (see, for example, Ghalambor et al. ; Pfennig et al. ). Similarly, the role of evolution in shaping phenotypic plasticity remains poorly understood (Pigliucci ). In this issue of Molecular Ecology, Dayan et al. () provide empirical data relevant to these questions by assessing the extent of plasticity and divergence in the expression levels of 2272 genes in muscle tissue from killifish (genus Fundulus) exposed to different temperatures. F. heteroclitus (Fig. A) and F. grandis are minnows that inhabit estuarine marshes (Fig. B) along the coasts of the Atlantic Ocean and Gulf of Mexico in North America. These habitats undergo large variations in temperature both daily and seasonally, and these fish are known to demonstrate substantial phenotypic plasticity in response to temperature change (e.g. Fangue et al. ). Furthermore, the range of F. heteroclitus spans a large latitudinal gradient of temperatures, such that northern populations experience temperatures that are on average ~10°C colder than do southern populations (Schulte ). By comparing gene expression patterns between populations of these fish from different thermal habitats held in the laboratory at three different temperatures, Dayan et al. () address two important questions regarding the interacting effects of plasticity and evolution: (i) How does phenotypic plasticity affect adaptive divergence? and (ii) How does adaptive divergence affect plasticity?

  14. Study of gene function based on spatial co-expression in a high-resolution mouse brain atlas

    Directory of Open Access Journals (Sweden)

    Jiang Tao


    Full Text Available Abstract Background The Allen Brain Atlas (ABA project systematically profiles three-dimensional high-resolution gene expression in postnatal mouse brains for thousands of genes. By unveiling gene behaviors at both the cellular and molecular levels, ABA is becoming a unique and comprehensive neuroscience data source for decoding enigmatic biological processes in the brain. Given the unprecedented volume and complexity of the in situ hybridization image data, data mining in this area is extremely challenging. Currently, the ABA database mainly serves as an online reference for visual inspection of individual genes; the underlying rich information of this large data set is yet to be explored by novel computational tools. In this proof-of-concept study, we studied the hypothesis that genes sharing similar three-dimensional expression profiles in the mouse brain are likely to share similar biological functions. Results In order to address the pattern comparison challenge when analyzing the ABA database, we developed a robust image filtering method, dubbed histogram-row-column (HRC algorithm. We demonstrated how the HRC algorithm offers the sensitivity of identifying a manageable number of gene pairs based on automatic pattern searching from an original large brain image collection. This tool enables us to quickly identify genes of similar in situ hybridization patterns in a semi-automatic fashion and consequently allows us to discover several gene expression patterns with expression neighborhoods containing genes of similar functional categories. Conclusion Given a query brain image, HRC is a fully automated algorithm that is able to quickly mine vast number of brain images and identify a manageable subset of genes that potentially shares similar spatial co-distribution patterns for further visual inspection. A three-dimensional in situ hybridization pattern, if statistically significant, could serve as a fingerprint of certain gene function

  15. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Fang, Lusheng; Li, Bo; Tong, Shurong


    is proposed and analyzed, as well as its three categories i.e., the operator gene, the structural gene and the regulator gene. Second, the trigger mechanism that design objectives and constraints trigger the operator gene is constructed. Third, the expression principle of structural gene is analyzed......To improve the design process efficiency, this paper proposes the principle and methodology that design process gene controls the characteristics of design process under the framework of design process reuse and optimization based on design process gene. First, the concept of design process gene...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

  16. Monoallelic expression of the human FOXP2 speech gene. (United States)

    Adegbola, Abidemi A; Cox, Gerald F; Bradshaw, Elizabeth M; Hafler, David A; Gimelbrant, Alexander; Chess, Andrew


    The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations.

  17. Individual variation of adipose gene expression and identification of covariated genes by cDNA microarrays

    NARCIS (Netherlands)

    Boeuf, S.; Keijer, J.; Franssen-Hal, van N.L.W.; Klaus, S.


    Gene expression profiling through the application of microarrays provides comprehensive assessment of gene expression levels in a given tissue or cell population, as well as information on changes of gene expression in altered physiological or pathological situations. Microarrays are particularly su

  18. Modulation of R-gene expression across environments. (United States)

    MacQueen, Alice; Bergelson, Joy


    Some environments are more conducive to pathogen growth than others, and, as a consequence, plants might be expected to invest more in resistance when pathogen growth is favored. Resistance (R-) genes in Arabidopsis thaliana have unusually extensive variation in basal expression when comparing the same R-gene among accessions collected from different environments. R-gene expression variation was characterized to explore whether R-gene expression is up-regulated in environments favoring pathogen proliferation and down-regulated when risks of infection are low; down-regulation would follow if costs of R-gene expression negatively impact plant fitness in the absence of disease. Quantitative reverse transcription-PCR was used to quantify the expression of 13 R-gene loci in plants grown in eight environmental conditions for each of 12 A. thaliana accessions, and large effects of the environment on R-gene expression were found. Surprisingly, almost every change in the environment--be it a change in biotic or abiotic conditions--led to an increase in R-gene expression, a response that was distinct from the average transcriptome response and from that of other stress response genes. These changes in expression are functional in that environmental change prior to infection affected levels of specific disease resistance to isolates of Pseudomonas syringae. In addition, there are strong latitudinal clines in basal R-gene expression and clines in R-gene expression plasticity correlated with drought and high temperatures. These results suggest that variation in R-gene expression across environments may be shaped by natural selection to reduce fitness costs of R-gene expression in permissive or predictable environments.

  19. Radiolabeled PNAs for imaging gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Wickstrom, Eric; Sauter, Edward; Tian, Xianben; Rao, Sampath; Quin, Weyng; Thakur, Mathew [Thomas Jefferson Univ., PA (United States)


    Scintigraphic imaging of gene expression in vivo by non-invasive means could precisely direct physicians to appropriate intervention at the onset of disease and could contribute extensively to the management of patients. However no method is currently available to image specific over expressed oncogene mRNAs in vivo by scintigraphic imaging. Nevertheless, we have observed that Tc 99 m peptides can delineate tumors, and that PNA-peptides are specific for receptors on malignant cells and are taken up specifically and concentrated in nuclei. We hypothesize that antisense Tc 99 m PNA peptides will be taken up by human breast cancer cells, hybridize to complementary mRNA targets, and permit imaging of oncogene mRNAs in human breast cancer xenografts in a mouse model, providing a proof-of-principle for non-invasive detection of precancerous and invasive breast cancer. Oncogenes cyclin D1, erB-2, c-MYC and tumor suppressor p53 will be probed. If successful, this technique will be useful for diagnostic imaging of other solid tumors as well. (author)

  20. Screening and expression of genes from metagenomes. (United States)

    Leis, Benedikt; Angelov, Angel; Liebl, Wolfgang


    Microorganisms are the most abundant and widely spread organisms on earth. They colonize a huge variety of natural and anthropogenic environments, including very specialized ecological niches and even extreme habitats, which are made possible by the immense metabolic diversity and genetic adaptability of microbes. As most of the organisms from environmental samples defy cultivation, cultivation-independent metagenomics approaches have been applied since more than one decade to access and characterize the phylogenetic diversity in microbial communities as well as their metabolic potential and ecological functions. Thereby, metagenomics has fully emerged as an own scientific field for mining new biocatalysts for many industrially relevant processes in biotechnology and pharmaceutics. This review summarizes common metagenomic approaches ranging from sampling, isolation of nucleic acids, construction of metagenomic libraries and their evaluation. Sequence-based screenings implement next-generation sequencing platforms, microarrays or PCR-based methods, while function-based analysis covers heterologous expression of metagenomic libraries in diverse screening setups. Major constraints and advantages of each strategy are described. The importance of alternative host-vector systems is discussed, and in order to underline the role of phylogenetic and physiological distance from the gene donor and the expression host employed, a case study is presented that describes the screening of a genomic library from an extreme thermophilic bacterium in both Escherichia coli and Thermus thermophilus. Metatranscriptomics, metaproteomics and single-cell-based methods are expected to complement metagenomic screening efforts to identify novel biocatalysts from environmental samples.

  1. Integrated analysis of gene expression by association rules discovery

    Directory of Open Access Journals (Sweden)

    Carazo Jose M


    Full Text Available Abstract Background Microarray technology is generating huge amounts of data about the expression level of thousands of genes, or even whole genomes, across different experimental conditions. To extract biological knowledge, and to fully understand such datasets, it is essential to include external biological information about genes and gene products to the analysis of expression data. However, most of the current approaches to analyze microarray datasets are mainly focused on the analysis of experimental data, and external biological information is incorporated as a posterior process. Results In this study we present a method for the integrative analysis of microarray data based on the Association Rules Discovery data mining technique. The approach integrates gene annotations and expression data to discover intrinsic associations among both data sources based on co-occurrence patterns. We applied the proposed methodology to the analysis of gene expression datasets in which genes were annotated with metabolic pathways, transcriptional regulators and Gene Ontology categories. Automatically extracted associations revealed significant relationships among these gene attributes and expression patterns, where many of them are clearly supported by recently reported work. Conclusion The integration of external biological information and gene expression data can provide insights about the biological processes associated to gene expression programs. In this paper we show that the proposed methodology is able to integrate multiple gene annotations and expression data in the same analytic framework and extract meaningful associations among heterogeneous sources of data. An implementation of the method is included in the Engene software package.

  2. Using RNA-Seq data to select refence genes for normalizing gene expression in apple roots (United States)

    Gene expression in apple roots in response to various stress conditions is a less-explored research subject. Reliable reference genes for normalizing quantitative gene expression data have not been carefully investigated. In this study, the suitability of a set of 15 apple genes were evaluated for t...

  3. CDX2 gene expression in acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Hanaa H. Arnaoaut


    Full Text Available CDX genes are classically known as regulators of axial elongation during early embryogenesis. An unsuspected role for CDX genes has been revealed during hematopoietic development. The CDX gene family member CDX2 belongs to the most frequent aberrantly expressed proto-oncogenes in human acute leukemias and is highly leukemogenic in experimental models. We used reversed transcriptase polymerase chain reaction (RT-PCR to determine the expression level of CDX2 gene in 30 pediatric patients with acute lymphoblastic leukemia (ALL at diagnosis and 30 healthy volunteers. ALL patients were followed up to detect minimal residual disease (MRD on days 15 and 42 of induction. We found that CDX2 gene was expressed in 50% of patients and not expressed in controls. Associations between gene expression and different clinical and laboratory data of patients revealed no impact on different findings. With follow up, we could not confirm that CDX2 expression had a prognostic significance.

  4. Automated discovery of functional generality of human gene expression programs.

    Directory of Open Access Journals (Sweden)

    Georg K Gerber


    Full Text Available An important research problem in computational biology is the identification of expression programs, sets of co-expressed genes orchestrating normal or pathological processes, and the characterization of the functional breadth of these programs. The use of human expression data compendia for discovery of such programs presents several challenges including cellular inhomogeneity within samples, genetic and environmental variation across samples, uncertainty in the numbers of programs and sample populations, and temporal behavior. We developed GeneProgram, a new unsupervised computational framework based on Hierarchical Dirichlet Processes that addresses each of the above challenges. GeneProgram uses expression data to simultaneously organize tissues into groups and genes into overlapping programs with consistent temporal behavior, to produce maps of expression programs, which are sorted by generality scores that exploit the automatically learned groupings. Using synthetic and real gene expression data, we showed that GeneProgram outperformed several popular expression analysis methods. We applied GeneProgram to a compendium of 62 short time-series gene expression datasets exploring the responses of human cells to infectious agents and immune-modulating molecules. GeneProgram produced a map of 104 expression programs, a substantial number of which were significantly enriched for genes involved in key signaling pathways and/or bound by NF-kappaB transcription factors in genome-wide experiments. Further, GeneProgram discovered expression programs that appear to implicate surprising signaling pathways or receptor types in the response to infection, including Wnt signaling and neurotransmitter receptors. We believe the discovered map of expression programs involved in the response to infection will be useful for guiding future biological experiments; genes from programs with low generality scores might serve as new drug targets that exhibit minimal

  5. Serial Analysis of Gene Expression: Applications in Human Studies



    Serial analysis of gene expression (SAGE) is a powerful tool, which provides quantitative and comprehensive expression profile of genes in a given cell population. It works by isolating short fragments of genetic information from the expressed genes that are present in the cell being studied. These short sequences, called SAGE tags, are linked together for efficient sequencing. The frequency of each SAGE tag in the cloned multimers directly reflects the transcript abundance. Therefore, SAGE r...

  6. Differential Expression of Salinity Resistance Gene on Cotton

    Institute of Scientific and Technical Information of China (English)

    YE Wu-wei; YU Shu-xun


    @@ Salinity resistance and differential gene expression associated with salinity in cotton germplasm were studied,because of the large scale area of salinity in China,and its significant negative effects on the cotton production.The salinityresisted genes and their differential expression were studied under the stress of NaCI on cotton.There were found,under the NaCI stress,1644 genes differentially expressed from the salinity-sensitive cotton and only 817 genes differentially expressed from the salinityresisted cotton.

  7. Evidence for mitochondrial genetic control of autosomal gene expression. (United States)

    Kassam, Irfahan; Qi, Tuan; Lloyd-Jones, Luke; Holloway, Alexander; Jan Bonder, Marc; Henders, Anjali K; Martin, Nicholas G; Powell, Joseph E; Franke, Lude; Montgomery, Grant W; Visscher, Peter M; McRae, Allan F


    The mitochondrial and nuclear genomes coordinate and co-evolve in eukaryotes in order to adapt to environmental changes. Variation in the mitochondrial genome is capable of affecting expression of genes on the nuclear genome. Sex-specific mitochondrial genetic control of gene expression has been demonstrated in Drosophila melanogaster, where males were found to drive most of the total variation in gene expression. This has potential implications for male-related health and disease resulting from variation in mtDNA solely inherited from the mother. We used a family-based study comprised of 47,323 gene expression probes and 78 mitochondrial SNPs (mtSNPs) from n = 846 individuals to examine the extent of mitochondrial genetic control of gene expression in humans. This identified 15 significant probe-mtSNP associations (P[Formula: see text]) corresponding to 5 unique genes on the mitochondrial and nuclear genomes, with three of these genes corresponding to mitochondrial genetic control of gene expression in the nuclear genome. The associated mtSNPs for three genes (one cis and two trans associations) were replicated (P expression in any of these five probes. Sex-specific effects were examined by applying our analysis to males and females separately and testing for differences in effect size. The MEST gene was identified as having the most significantly different effect sizes across the sexes (P [Formula: see text]). MEST was similarly expressed in males and females with the G allele; however, males with the C allele are highly expressed for MEST, while females show no expression of the gene. This study provides evidence for the mitochondrial genetic control of expression of several genes in humans, with little evidence found for sex-specific effects.

  8. Quantitative modeling of a gene's expression from its intergenic sequence.

    Directory of Open Access Journals (Sweden)

    Md Abul Hassan Samee


    Full Text Available Modeling a gene's expression from its intergenic locus and trans-regulatory context is a fundamental goal in computational biology. Owing to the distributed nature of cis-regulatory information and the poorly understood mechanisms that integrate such information, gene locus modeling is a more challenging task than modeling individual enhancers. Here we report the first quantitative model of a gene's expression pattern as a function of its locus. We model the expression readout of a locus in two tiers: 1 combinatorial regulation by transcription factors bound to each enhancer is predicted by a thermodynamics-based model and 2 independent contributions from multiple enhancers are linearly combined to fit the gene expression pattern. The model does not require any prior knowledge about enhancers contributing toward a gene's expression. We demonstrate that the model captures the complex multi-domain expression patterns of anterior-posterior patterning genes in the early Drosophila embryo. Altogether, we model the expression patterns of 27 genes; these include several gap genes, pair-rule genes, and anterior, posterior, trunk, and terminal genes. We find that the model-selected enhancers for each gene overlap strongly with its experimentally characterized enhancers. Our findings also suggest the presence of sequence-segments in the locus that would contribute ectopic expression patterns and hence were "shut down" by the model. We applied our model to identify the transcription factors responsible for forming the stripe boundaries of the studied genes. The resulting network of regulatory interactions exhibits a high level of agreement with known regulatory influences on the target genes. Finally, we analyzed whether and why our assumption of enhancer independence was necessary for the genes we studied. We found a deterioration of expression when binding sites in one enhancer were allowed to influence the readout of another enhancer. Thus, interference

  9. Using Ontology Fingerprints to Evaluate Genome-wide Association Results


    Lam Tsoi; Michael Boehnke; Richard Klein; Jim Zheng


    We describe an approach to characterize genes or phenotypes via ontology fingerprints which are composed of Gene Ontology (GO) terms overrepresented among those PubMed abstracts linked to the genes or phenotypes. We then quantify the biological relevance between genes and phenotypes by comparing their ontology fingerprints to calculate a similarity score. We validated this approach by correctly identifying genes belong to their biological pathways with high accuracy, and applied this approach...

  10. Heterologous gene expression in filamentous fungi. (United States)

    Su, Xiaoyun; Schmitz, George; Zhang, Meiling; Mackie, Roderick I; Cann, Isaac K O


    Filamentous fungi are critical to production of many commercial enzymes and organic compounds. Fungal-based systems have several advantages over bacterial-based systems for protein production because high-level secretion of enzymes is a common trait of their decomposer lifestyle. Furthermore, in the large-scale production of recombinant proteins of eukaryotic origin, the filamentous fungi become the vehicle of choice due to critical processes shared in gene expression with other eukaryotic organisms. The complexity and relative dearth of understanding of the physiology of filamentous fungi, compared to bacteria, have hindered rapid development of these organisms as highly efficient factories for the production of heterologous proteins. In this review, we highlight several of the known benefits and challenges in using filamentous fungi (particularly Aspergillus spp., Trichoderma reesei, and Neurospora crassa) for the production of proteins, especially heterologous, nonfungal enzymes. We review various techniques commonly employed in recombinant protein production in the filamentous fungi, including transformation methods, selection of gene regulatory elements such as promoters, protein secretion factors such as the signal peptide, and optimization of coding sequence. We provide insights into current models of host genomic defenses such as repeat-induced point mutation and quelling. Furthermore, we examine the regulatory effects of transcript sequences, including introns and untranslated regions, pre-mRNA (messenger RNA) processing, transcript transport, and mRNA stability. We anticipate that this review will become a resource for researchers who aim at advancing the use of these fascinating organisms as protein production factories, for both academic and industrial purposes, and also for scientists with general interest in the biology of the filamentous fungi. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Expressed genes in regenerating rat liver after partial hepatectomy

    Institute of Scientific and Technical Information of China (English)

    Cun-Shuan Xu; Salman Rahrnan; Jing-Bo Zhang; Cui-Fang Chang; Jin-Yun Yuan; Wen-Qiang Li; Hong-Peng Han; Ke-Jin Yang; Li-Feng Zhao; Yu-Chang Li; Hui-Yong Zhang


    AIM: To reveal the liver regeneration (LR) and its controlas well as the occurrence of liver disease and to study the gene expression profiles of 551 genes after partial hepatectomy (PH) in regenerating rat livers.METHODS: Five hundred and fifty-one expressed sequence tags screened by suppression subtractive hybridization were made into an in-house cDNA microarray, and the expressive genes and their expressive profiles in regenerating rat livers were analyzed by microarray and bioinformatics. RESULTS: Three hundred of the analyzed 551 genes were up- or downregulated more than twofolds at one or more time points during LR. Most of the genes were up- or downregulated 2-5 folds, but the highest reached 90 folds of the control. One hundred and thirty-nine of themshowed upregulation, 135 displayed downregulation, and up or down expression of 26 genes revealed a dependence on regenerating livers. The genes expressedin 24-h regenerating livers were much more than those in the others. Cluster analysis and generalization analysis showed that there were at least six distinct temporal patterns of gene expression in the regenerating livers, that is, genes were expressed in the immediate early phase, early phase, intermediate phase, early-late phase, late phase, terminal phase. CONCLUSION: In LR, the number of down-regulated genes was almost similar to that of the upregulated genes; the successively altered genes were more than the rapidly transient genes. The temporal patterns of gene expression were similar 2 and 4 h, 12 and 16 h, 48 and 96 h, 72 and 144 h after PH. Microarray combined with suppressive subtractive hybridization can effectively identify the genes related to LR.

  12. Faster-X Evolution of Gene Expression in Drosophila (United States)

    Meisel, Richard P.; Malone, John H.; Clark, Andrew G.


    DNA sequences on X chromosomes often have a faster rate of evolution when compared to similar loci on the autosomes, and well articulated models provide reasons why the X-linked mode of inheritance may be responsible for the faster evolution of X-linked genes. We analyzed microarray and RNA–seq data collected from females and males of six Drosophila species and found that the expression levels of X-linked genes also diverge faster than autosomal gene expression, similar to the “faster-X” effect often observed in DNA sequence evolution. Faster-X evolution of gene expression was recently described in mammals, but it was limited to the evolutionary lineages shortly following the creation of the therian X chromosome. In contrast, we detect a faster-X effect along both deep lineages and those on the tips of the Drosophila phylogeny. In Drosophila males, the dosage compensation complex (DCC) binds the X chromosome, creating a unique chromatin environment that promotes the hyper-expression of X-linked genes. We find that DCC binding, chromatin environment, and breadth of expression are all predictive of the rate of gene expression evolution. In addition, estimates of the intraspecific genetic polymorphism underlying gene expression variation suggest that X-linked expression levels are not under relaxed selective constraints. We therefore hypothesize that the faster-X evolution of gene expression is the result of the adaptive fixation of beneficial mutations at X-linked loci that change expression level in cis. This adaptive faster-X evolution of gene expression is limited to genes that are narrowly expressed in a single tissue, suggesting that relaxed pleiotropic constraints permit a faster response to selection. Finally, we present a conceptional framework to explain faster-X expression evolution, and we use this framework to examine differences in the faster-X effect between Drosophila and mammals. PMID:23071459

  13. Global gene expression analysis for evaluation and design of biomaterials

    Directory of Open Access Journals (Sweden)

    Nobutaka Hanagata, Taro Takemura and Takashi Minowa


    Full Text Available Comprehensive gene expression analysis using DNA microarrays has become a widespread technique in molecular biological research. In the biomaterials field, it is used to evaluate the biocompatibility or cellular toxicity of metals, polymers and ceramics. Studies in this field have extracted differentially expressed genes in the context of differences in cellular responses among multiple materials. Based on these genes, the effects of materials on cells at the molecular level have been examined. Expression data ranging from several to tens of thousands of genes can be obtained from DNA microarrays. For this reason, several tens or hundreds of differentially expressed genes are often present in different materials. In this review, we outline the principles of DNA microarrays, and provide an introduction to methods of extracting information which is useful for evaluating and designing biomaterials from comprehensive gene expression data.

  14. Gene Expression Pattern of Signal Transduction in Chronic Myeloid Leukemia

    Institute of Scientific and Technical Information of China (English)

    LI Huiyu; JIE Shenghua; GUO Tiannan; HUANG Shi'ang


    To explore the transcriptional gene expression profiles of signaling pathway in Chronic myeloid leukemia (CML), a series of cDNA microarray chips were tested. The results showed that differentially expressed genes related to singal transduction in CML were screened out and the genes involved in Phosphoinositide 3-kinases (PI3K), Ras-MAPK (mitogen-activated protein kinase) and other signaling pathway genes simultaneously. The results also showed that most of these genes were up-expression genes , which suggested that signal transduction be overactivated in CML. Further analysis of these differentially expressed signal transduction genes will be helpful to understand the molecular mechanism of CML and find new targets of treatment.

  15. Social Regulation of Gene Expression in Threespine Sticklebacks.

    Directory of Open Access Journals (Sweden)

    Anna K Greenwood

    Full Text Available Identifying genes that are differentially expressed in response to social interactions is informative for understanding the molecular basis of social behavior. To address this question, we described changes in gene expression as a result of differences in the extent of social interactions. We housed threespine stickleback (Gasterosteus aculeatus females in either group conditions or individually for one week, then measured levels of gene expression in three brain regions using RNA-sequencing. We found that numerous genes in the hindbrain/cerebellum had altered expression in response to group or individual housing. However, relatively few genes were differentially expressed in either the diencephalon or telencephalon. The list of genes upregulated in fish from social groups included many genes related to neural development and cell adhesion as well as genes with functions in sensory signaling, stress, and social and reproductive behavior. The list of genes expressed at higher levels in individually-housed fish included several genes previously identified as regulated by social interactions in other animals. The identified genes are interesting targets for future research on the molecular mechanisms of normal social interactions.

  16. Large Scale Gene Expression Meta-Analysis Reveals Tissue-Specific, Sex-Biased Gene Expression in Humans (United States)

    Mayne, Benjamin T.; Bianco-Miotto, Tina; Buckberry, Sam; Breen, James; Clifton, Vicki; Shoubridge, Cheryl; Roberts, Claire T.


    The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analyzed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes), followed by the heart (375 genes), kidney (224 genes), colon (218 genes), and thyroid (163 genes). More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs, and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.

  17. Large scale gene expression meta-analysis reveals tissue-specific, sex-biased gene expression in humans

    Directory of Open Access Journals (Sweden)

    Benjamin Mayne


    Full Text Available The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analysed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes, followed by the heart (375 genes, kidney (224 genes, colon (218 genes and thyroid (163 genes. More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.

  18. Microarray gene expression profiling and analysis in renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Sadhukhan Provash


    Full Text Available Abstract Background Renal cell carcinoma (RCC is the most common cancer in adult kidney. The accuracy of current diagnosis and prognosis of the disease and the effectiveness of the treatment for the disease are limited by the poor understanding of the disease at the molecular level. To better understand the genetics and biology of RCC, we profiled the expression of 7,129 genes in both clear cell RCC tissue and cell lines using oligonucleotide arrays. Methods Total RNAs isolated from renal cell tumors, adjacent normal tissue and metastatic RCC cell lines were hybridized to affymatrix HuFL oligonucleotide arrays. Genes were categorized into different functional groups based on the description of the Gene Ontology Consortium and analyzed based on the gene expression levels. Gene expression profiles of the tissue and cell line samples were visualized and classified by singular value decomposition. Reverse transcription polymerase chain reaction was performed to confirm the expression alterations of selected genes in RCC. Results Selected genes were annotated based on biological processes and clustered into functional groups. The expression levels of genes in each group were also analyzed. Seventy-four commonly differentially expressed genes with more than five-fold changes in RCC tissues were identified. The expression alterations of selected genes from these seventy-four genes were further verified using reverse transcription polymerase chain reaction (RT-PCR. Detailed comparison of gene expression patterns in RCC tissue and RCC cell lines shows significant differences between the two types of samples, but many important expression patterns were preserved. Conclusions This is one of the initial studies that examine the functional ontology of a large number of genes in RCC. Extensive annotation, clustering and analysis of a large number of genes based on the gene functional ontology revealed many interesting gene expression patterns in RCC. Most

  19. Regulating gene-expression by mechanical force (United States)

    Visscher, Koen


    Initiation of transcription is an attractive target for controlling gene expression. Initiation typically involves binding of RNA polymerase to the DNA, followed by a rapid transition into a ``closed'' complex, and a subsequent transition into the ``open'' complex in which the DNA is locally melted. Nature makes good use of this target, for example in the form of repressor proteins that bind DNA and inhibit transcription. Here we will show that initiation of transcription is also dependent upon DNA tension and thus may be controlled by force alone, without the need for any accessory proteins. Using a three-bead assay in conjunction with optical tweezers we have shown that transient interactions of T7 RNA polymerase with the DNA promoter site shorten significantly, by up to a factor of ˜20, when DNA tension is increased. Experiments in the presence and absence of nucleotides have allowed us to conclude that force is likely to affect the rate constants into and/or out of the open complex, rather than the off-rate from the closed complex.

  20. Cell cycle gene expression under clinorotation (United States)

    Artemenko, Olga


    Cyclins and cyclin-dependent kinase (CDK) are main regulators of the cell cycle of eukaryotes. It's assumes a significant change of their level in cells under microgravity conditions and by other physical factors actions. The clinorotation use enables to determine the influence of gravity on simulated events in the cell during the cell cycle - exit from the state of quiet stage and promotion presynthetic phase (G1) and DNA synthesis phase (S) of the cell cycle. For the clinorotation effect study on cell proliferation activity is the necessary studies of molecular mechanisms of cell cycle regulation and development of plants under altered gravity condition. The activity of cyclin D, which is responsible for the events of the cell cycle in presynthetic phase can be controlled by the action of endogenous as well as exogenous factors, but clinorotation is one of the factors that influence on genes expression that regulate the cell cycle.These data can be used as a model for further research of cyclin - CDK complex for study of molecular mechanisms regulation of growth and proliferation. In this investigation we tried to summarize and analyze known literature and own data we obtained relatively the main regulators of the cell cycle in altered gravity condition.

  1. Gene Expression Profiling in an in Vitro Model of Angiogenesis


    Kahn, Jeanne; Mehraban, Fuad; Ingle, Gladys; Xin, Xiaohua; Bryant, Juliet E.; Vehar, Gordon; Schoenfeld, Jill; Grimaldi, Chrisopher J.; Peale, Franklin; Draksharapu, Aparna; Lewin, David A.; Gerritsen, Mary E.


    In the present study we have used a novel, comprehensive mRNA profiling technique (GeneCalling) for determining differential gene expression profiles of human endothelial cells undergoing differentiation into tubelike structures. One hundred fifteen cDNA fragments were identified and shown to represent 90 distinct genes. Although some of the genes identified have previously been implicated in angiogenesis, potential roles for many new genes, including OX-40, white protein homolog, KIAA0188, a...

  2. Expression Divergence of Tandemly Arrayed Genes in Human and Mouse

    Directory of Open Access Journals (Sweden)

    Valia Shoja


    Full Text Available Tandemly arrayed genes (TAGs account for about one third of the duplicated genes in eukaryotic genomes, yet there has not been any systematic study of their gene expression patterns. Taking advantage of recently published large-scale microarray data sets, we studied the expression divergence of 361 two-member TAGs in human and 212 two-member TAGs in mouse and examined the effect of sequence divergence, gene orientation, and chromosomal proximity on the divergence of TAG expression patterns. Our results show that there is a weak negative correlation between sequence divergence of TAG members and their expression similarity. There is also a weak negative correlation between chromosomal proximity of TAG members and their expression similarity. We did not detect any significant relationship between gene orientation and expression similarity. We also found that downstream TAG members do not show significantly narrower expression breadth than upstream members, contrary to what we predict based on TAG expression divergence hypothesis that we propose. Finally, we show that both chromosomal proximity and expression correlation in TAGs do not differ significantly from their neighboring non-TAG gene pairs, suggesting that tandem duplication is unlikely to be the cause for the higher-than-random expression association between neighboring genes on a chromosome in human and mouse.

  3. Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies.

    Directory of Open Access Journals (Sweden)

    Lucie Kosinová

    Full Text Available The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3 in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0-120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48-120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information

  4. Gene ordering in partitive clustering using microarray expressions. (United States)

    Ray, Shubhra Sankar; Bandyopadhyay, Sanghamitra; Pal, Sankar K


    A central step in the analysis of gene expression data is the identification of groups of genes that exhibit similar expression patterns. Clustering and ordering the genes using gene expression data into homogeneous groups was shown to be useful in functional annotation, tissue classification, regulatory motif identification, and other applications. Although there is a rich literature on gene ordering in hierarchical clustering framework for gene expression analysis, there is no work addressing and evaluating the importance of gene ordering in partitive clustering framework, to the best knowledge of the authors. Outside the framework of hierarchical clustering, different gene ordering algorithms are applied on the whole data set, and the domain of partitive clustering is still unexplored with gene ordering approaches. A new hybrid method is proposed for ordering genes in each of the clusters obtained from partitive clustering solution, using microarray gene expressions.Two existing algorithms for optimally ordering cities in travelling salesman problem (TSP), namely, FRAG_GALK and Concorde, are hybridized individually with self organizing MAP to show the importance of gene ordering in partitive clustering framework. We validated our hybrid approach using yeast and fibroblast data and showed that our approach improves the result quality of partitive clustering solution, by identifying subclusters within big clusters, grouping functionally correlated genes within clusters, minimization of summation of gene expression distances, and the maximization of biological gene ordering using MIPS categorization. Moreover, the new hybrid approach, finds comparable or sometimes superior biological gene order in less computation time than those obtained by optimal leaf ordering in hierarchical clustering solution.

  5. Gene ordering in partitive clustering using microarray expressions

    Indian Academy of Sciences (India)

    Shubhra Sankar Ray; Sanghamitra Bandyopadhyay; Sankar K Pal


    A central step in the analysis of gene expression data is the identification of groups of genes that exhibit similar expression patterns. Clustering and ordering the genes using gene expression data into homogeneous groups was shown to be useful in functional annotation, tissue classification, regulatory motif identification, and other applications. Although there is a rich literature on gene ordering in hierarchical clustering framework for gene expression analysis, there is no work addressing and evaluating the importance of gene ordering in partitive clustering framework, to the best knowledge of the authors. Outside the framework of hierarchical clustering, different gene ordering algorithms are applied on the whole data set, and the domain of partitive clustering is still unexplored with gene ordering approaches. A new hybrid method is proposed for ordering genes in each of the clusters obtained from partitive clustering solution, using microarray gene expressions. Two existing algorithms for optimally ordering cities in travelling salesman problem (TSP), namely, FRAG_GALK and Concorde, are hybridized individually with self organizing MAP to show the importance of gene ordering in partitive clustering framework. We validated our hybrid approach using yeast and fibroblast data and showed that our approach improves the result quality of partitive clustering solution, by identifying subclusters within big clusters, grouping functionally correlated genes within clusters, minimization of summation of gene expression distances, and the maximization of biological gene ordering using MIPS categorization. Moreover, the new hybrid approach, finds comparable or sometimes superior biological gene order in less computation time than those obtained by optimal leaf ordering in hierarchical clustering solution.

  6. Identification and validation of suitable endogenous reference genes for gene expression studies in human peripheral blood

    Directory of Open Access Journals (Sweden)

    Turner Renee J


    Full Text Available Abstract Background Gene expression studies require appropriate normalization methods. One such method uses stably expressed reference genes. Since suitable reference genes appear to be unique for each tissue, we have identified an optimal set of the most stably expressed genes in human blood that can be used for normalization. Methods Whole-genome Affymetrix Human 2.0 Plus arrays were examined from 526 samples of males and females ages 2 to 78, including control subjects and patients with Tourette syndrome, stroke, migraine, muscular dystrophy, and autism. The top 100 most stably expressed genes with a broad range of expression levels were identified. To validate the best candidate genes, we performed quantitative RT-PCR on a subset of 10 genes (TRAP1, DECR1, FPGS, FARP1, MAPRE2, PEX16, GINS2, CRY2, CSNK1G2 and A4GALT, 4 commonly employed reference genes (GAPDH, ACTB, B2M and HMBS and PPIB, previously reported to be stably expressed in blood. Expression stability and ranking analysis were performed using GeNorm and NormFinder algorithms. Results Reference genes were ranked based on their expression stability and the minimum number of genes needed for nomalization as calculated using GeNorm showed that the fewest, most stably expressed genes needed for acurate normalization in RNA expression studies of human whole blood is a combination of TRAP1, FPGS, DECR1 and PPIB. We confirmed the ranking of the best candidate control genes by using an alternative algorithm (NormFinder. Conclusion The reference genes identified in this study are stably expressed in whole blood of humans of both genders with multiple disease conditions and ages 2 to 78. Importantly, they also have different functions within cells and thus should be expressed independently of each other. These genes should be useful as normalization genes for microarray and RT-PCR whole blood studies of human physiology, metabolism and disease.

  7. Transgenic zebrafish recapitulating tbx16 gene early developmental expression.

    Directory of Open Access Journals (Sweden)

    Simon Wells

    Full Text Available We describe the creation of a transgenic zebrafish expressing GFP driven by a 7.5 kb promoter region of the tbx16 gene. This promoter segment is sufficient to recapitulate early embryonic expression of endogenous tbx16 in the presomitic mesoderm, the polster and, subsequently, in the hatching gland. Expression of GFP in the transgenic lines later in development diverges to some extent from endogenous tbx16 expression with the serendipitous result that one line expresses GFP specifically in commissural primary ascending (CoPA interneurons of the developing spinal cord. Using this line we demonstrate that the gene mafba (valentino is expressed in CoPA interneurons.

  8. Gene expression profiles of the developing human retina

    Institute of Scientific and Technical Information of China (English)

    WANG Feng; LI Huiming; LIU Wenwen; XU Ping; HU Gengxi; CHENG Yidong; JIA Libin; HUANG Qian


    Retina is a multilayer and highly specialized tissue important in converting light into neural signals. In humans, the critical period for the formation of complex multiplayer structure takes place during embryogenesis between 12 and 28 weeks. The morphologic changes during retinal development in humans have been studied but little is known about the molecular events essential for the formation of the retina. To gain further insights into this process, cDNA microarrays containing 16361 human gene probes were used to measure the gene expression levels in retinas. Of the 16361 genes, 68.7%, 71.4% and 69.7% showed positive hybridization with cDNAs made from 12-16 week fetal, 22-26 week fetal and adult retinas. A total of 814 genes showed a minimum of 3-fold changes between the lowest and highest expression levels among three time points and among them, 106 genes had expression levels with the hybridization intensity above 100 at one or more time points. The clustering analysis suggested that the majority of differentially expressed genes were down-regulated during the retinal development. The differentially expressed genes were further classified according to functions of known genes, and were ranked in decreasing order according to frequency: development, differentiation, signal transduction, protein synthesis and translation, metabolism, DNA binding and transcription, DNA synthesis-repair-recombination, immuno-response, ion channel- transport, cell receptor, cytoskeleton, cell cycle, pro-oncogene, stress and apoptosis related genes. Among these 106 differentially expressed genes, 60 are already present in NEI retina cDNA or EST Databank but the remaining 46 genes are absent and thus identified as "function unknown". To validate gene expression data from the microarray, real-time RT-PCR was performed for 46 "function unknown" genes and 6 known retina specific expression genes, and β-actin was used as internal control. Twenty-seven of these genes showed very similar

  9. Expression profiles for six zebrafish genes during gonadal sex differentiation

    Directory of Open Access Journals (Sweden)

    Rasmussen Lene J


    Full Text Available Abstract Background The mechanism of sex determination in zebrafish is largely unknown and neither sex chromosomes nor a sex-determining gene have been identified. This indicates that sex determination in zebrafish is mediated by genetic signals from autosomal genes. The aim of this study was to determine the precise timing of expression of six genes previously suggested to be associated with sex differentiation in zebrafish. The current study investigates the expression of all six genes in the same individual fish with extensive sampling dates during sex determination and -differentiation. Results In the present study, we have used quantitative real-time PCR to investigate the expression of ar, sox9a, dmrt1, fig alpha, cyp19a1a and cyp19a1b during the expected sex determination and gonadal sex differentiation period. The expression of the genes expected to be high in males (ar, sox9a and dmrt1a and high in females (fig alpha and cyp19a1a was segregated in two groups with more than 10 times difference in expression levels. All of the investigated genes showed peaks in expression levels during the time of sex determination and gonadal sex differentiation. Expression of all genes was investigated on cDNA from the same fish allowing comparison of the high and low expressers of genes that are expected to be highest expressed in either males or females. There were 78% high or low expressers of all three "male" genes (ar, sox9a and dmrt1 in the investigated period and 81% were high or low expressers of both "female" genes (fig alpha and cyp19a1a. When comparing all five genes with expected sex related expression 56% show expression expected for either male or female. Furthermore, the expression of all genes was investigated in different tissue of adult male and female zebrafish. Conclusion In zebrafish, the first significant peak in gene expression during the investigated period (2–40 dph was dmrt1 at 10 dph which indicates involvement of this gene

  10. Gene Expression Measurement Module (GEMM) - a fully automated, miniaturized instrument for measuring gene expression in space (United States)

    Karouia, Fathi; Ricco, Antonio; Pohorille, Andrew; Peyvan, Kianoosh


    The capability to measure gene expression on board spacecrafts opens the doors to a large number of experiments on the influence of space environment on biological systems that will profoundly impact our ability to conduct safe and effective space travel, and might also shed light on terrestrial physiology or biological function and human disease and aging processes. Measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, determine metabolic basis of microbial pathogenicity and drug resistance, test our ability to sustain and grow in space organisms that can be used for life support and in situ resource utilization during long-duration space exploration, and monitor both the spacecraft environment and crew health. These and other applications hold significant potential for discoveries in space biology, biotechnology and medicine. Accordingly, supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measuring microbial expression of thousands of genes from multiple samples. The instrument will be capable of (1) lysing bacterial cell walls, (2) extracting and purifying RNA released from cells, (3) hybridizing it on a microarray and (4) providing electrochemical readout, all in a microfluidics cartridge. The prototype under development is suitable for deployment on nanosatellite platforms developed by the NASA Small Spacecraft Office. The first target application is to cultivate and measure gene expression of the photosynthetic bacterium Synechococcus elongatus, i.e. a cyanobacterium known to exhibit remarkable metabolic diversity and resilience to adverse conditions

  11. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Charles J. Daniels


    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of

  12. Arabidopsis gene expression patterns are altered during spaceflight (United States)

    Paul, Anna-Lisa; Popp, Michael P.; Gurley, William B.; Guy, Charles; Norwood, Kelly L.; Ferl, Robert J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments results in differential gene expression. A 5-day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β-Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on gene expression patterns initially by using the Adh/GUS transgene to address specifically the possibility that spaceflight induces a hypoxic stress response (Paul, A.L., Daugherty, C.J., Bihn, E.A., Chapman, D.K., Norwood, K.L., Ferl, R.J., 2001. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis, Plant Physiol. 126, 613-621). As a follow-on to the reporter gene analysis, we report here the evaluation of genome-wide patterns of native gene expression within Arabidopsis shoots utilizing the Agilent DNA array of 21,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes was further characterized with quantitative Real-Time RT PCR (ABI - Taqman®). Comparison of the patterns of expression for arrays probed with RNA isolated from plants exposed to spaceflight compared to RNA isolated from ground control plants revealed 182 genes that were differentially expressed in response to the spaceflight mission by more than 4-fold, and of those only 50 genes were expressed at levels chosen to support a conservative change call. None of the genes that are hallmarks of hypoxic stress were induced to this level. However, genes related to heat shock were dramatically induced - but in a pattern and under growth conditions that are not easily explained by elevated temperatures. These gene expression data are discussed in light of current models for plant responses to the spaceflight environment and with regard to potential future spaceflight experiment

  13. Gene expression profiling of mouse embryos with microarrays (United States)

    Sharov, Alexei A.; Piao, Yulan; Ko, Minoru S. H.


    Global expression profiling by DNA microarrays provides a snapshot of cell and tissue status and becomes an essential tool in biological and medical sciences. Typical questions that can be addressed by microarray analysis in developmental biology include: (1) to find a set of genes expressed in a specific cell type; (2) to identify genes expressed commonly in multiple cell types; (3) to follow the time-course changes of gene expression patterns; (4) to demonstrate cell’s identity by showing similarities or differences among two or multiple cell types; (5) to find regulatory pathways and/or networks affected by gene manipulations, such as overexpression or repression of gene expression; (6) to find downstream target genes of transcription factors; (7) to find downstream target genes of cell signaling; (8) to examine the effects of environmental manipulation of cells on gene expression patterns; and (9) to find the effects of genetic manipulation in embryos and adults. Here we describe strategies for executing these experiments and monitoring changes of cell state with gene expression microarrays in application to mouse embryology. Both statistical assessment and interpretation of data are discussed. We also present a protocol for performing microarray analysis on a small amount of embryonic materials. PMID:20699157

  14. Genome-wide gene expression analysis of anguillid herpesvirus 1

    NARCIS (Netherlands)

    Beurden, van S.J.; Peeters, B.P.H.; Rottier, P.J.M.; Davison, A.A.; Engelsma, M.Y.


    Background Whereas temporal gene expression in mammalian herpesviruses has been studied extensively, little is known about gene expression in fish herpesviruses. Here we report a genome-wide transcription analysis of a fish herpesvirus, anguillid herpesvirus 1, in cell culture, studied during the

  15. Genetic architecture of gene expression in ovine skeletal muscle

    DEFF Research Database (Denmark)

    Kogelman, Lisette Johanna Antonia; Byrne, Keren; Vuocolo, Tony


    -based gene expression data we directly tested the hypothesis that there is genetic structure in the gene expression program in ovine skeletal muscle.Results: The genetic performance of six sires for a well defined muscling trait, longissimus lumborum muscle depth, was measured using extensive progeny testing...

  16. Application of four dyes in gene expression analyses by microarrays

    NARCIS (Netherlands)

    Staal, Y.; van Herwijnen, M.H.M.; van Schooten, F.J.; van Delft, J.H.M.


    BACKGROUND: DNA microarrays are widely used in gene expression analyses. To increase throughput and minimize costs without reducing gene expression data obtained, we investigated whether four mRNA samples can be analyzed simultaneously by applying four different fluorescent dyes. RESULTS: Following

  17. FGX : a frequentist gene expression index for Affymetrix arrays

    NARCIS (Netherlands)

    Purutçuoğlu, Vilda; Wit, Ernst


    We consider a new frequentist gene expression index for Affymetrix oligonucleotide DNA arrays, using a similar probe intensity model as suggested previously, called the Bayesian gene expression index (BGX). According to this model, the perfect match and mismatch values are assumed to be correlated a

  18. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J


    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  19. RNA preparation and characterization for gene expression studies

    DEFF Research Database (Denmark)

    Stangegaard, Michael


    Much information can be obtained from knowledge of the relative expression level of each gene in the transcriptome. With the current advances in technology as little as a single cell is required as starting material for gene expression experiments. The mRNA from a single cell may be linearly ampl...

  20. Gene expression during anthesis and senescence in Iris flowers

    NARCIS (Netherlands)

    Doorn, van W.G.; Balk, P.A.; Houwelingen, van A.M.; Hoebrechts, F.A.; Hall, R.D.; Vorst, O.; Schoot, van der C.; Wordragen, van M.F.


    We investigated changes in gene expression in Iris hollandicaflowers by microarray technology. Flag tepals were sampled daily, from three days prior to flower opening to the onset of visible senescence symptoms. Gene expression profiles were compared with biochemical data including lipid and protein

  1. Comparative genomics of the relationship between gene structure and expression

    NARCIS (Netherlands)

    Ren, X.


    The relationship between the structure of genes and their expression is a relatively new aspect of genome organization and regulation. With more genome sequences and expression data becoming available, bioinformatics approaches can help the further elucidation of the relationships between gene struc


    Institute of Scientific and Technical Information of China (English)

    MENG Xu-li; DING Xiao-wen; XU Xiao-hong


    Objective: To investigate the molecular etiology of breast cancer by way of studying the differential expression and initial function of the related genes in the occurrence and development of breast cancer. Methods: Two hundred and eighty-eight human tumor related genes were chosen for preparation of the oligochips probe. mRNA was extracted from 16 breast cancer tissues and the corresponding normal breast tissues, and cDNA probe was prepared through reverse-transcription and hybridized with the gene chip. A laser focused fluorescent scanner was used to scan the chip. The different gene expressions were thereafter automatically compared and analyzed between the two sample groups. Cy3/Cy5>3.5 meant significant up-regulation. Cy3/Cy5<0.25 meant significant down-regulation. Results: The comparison between the breast cancer tissues and their corresponding normal tissues showed that 84 genes had differential expression in the Chip. Among the differently expressed genes, there were 4 genes with significant down-regulation and 6 with significant up-regulation. Compared with normal breast tissues, differentially expressed genes did partially exist in the breast cancer tissues. Conclusion: Changes in multi-gene expression regulations take place during the occurrence and development of breast cancer; and the research on related genes can help understanding the mechanism of tumor occurrence.

  3. Features of Gene Expression of Bacillus pumilus Metalloendopeptidase. (United States)

    Rudakova, N L; Sabirova, A R; Balaban, N P; Tikhonova, A O; Sharipova, M R


    Features of gene expression of the secreted Bacillus pumilus metalloendopeptidase belonging to the adamalysin/reprolysin family were investigated. In the regulatory region of the gene, we identified hypothetical binding sites for transcription factors CcpA and TnrA. We found that the expression of the metalloendopeptidase gene is controlled by mechanisms of carbon and nitrogen catabolite repression. In experiments involving nitrogen metabolism regulatory protein mutant strains, we found that the control of the metalloendopeptidase gene expression involves proteins of ammonium transport GlnK and AmtB interacting with the TnrA-regulator.

  4. The effect of negative autoregulation on eukaryotic gene expression (United States)

    Nevozhay, Dmitry; Adams, Rhys; Murphy, Kevin; Josic, Kresimir; Balázsi, G. Ábor


    Negative autoregulation is a frequent motif in gene regulatory networks, which has been studied extensively in prokaryotes. Nevertheless, some effects of negative feedback on gene expression in eukaryotic transcriptional networks remain unknown. We studied how the strength of negative feedback regulation affects the characteristics of gene expression in yeast cells carrying synthetic transcriptional cascades. We observed a drastic reduction of gene expression noise and a change in the shape of the dose-response curve. We explained these experimentally observed effects by stochastic simulations and a simple set of algebraic equations.

  5. Genetic architecture of gene expression in the chicken

    Directory of Open Access Journals (Sweden)

    Stanley Dragana


    Full Text Available Abstract Background The annotation of many genomes is limited, with a large proportion of identified genes lacking functional assignments. The construction of gene co-expression networks is a powerful approach that presents a way of integrating information from diverse gene expression datasets into a unified analysis which allows inferences to be drawn about the role of previously uncharacterised genes. Using this approach, we generated a condition-free gene co-expression network for the chicken using data from 1,043 publically available Affymetrix GeneChip Chicken Genome Arrays. This data was generated from a diverse range of experiments, including different tissues and experimental conditions. Our aim was to identify gene co-expression modules and generate a tool to facilitate exploration of the functional chicken genome. Results Fifteen modules, containing between 24 and 473 genes, were identified in the condition-free network. Most of the modules showed strong functional enrichment for particular Gene Ontology categories. However, a few showed no enrichment. Transcription factor binding site enrichment was also noted. Conclusions We have demonstrated that this chicken gene co-expression network is a useful tool in gene function prediction and the identification of putative novel transcription factors and binding sites. This work highlights the relevance of this methodology for functional prediction in poorly annotated genomes such as the chicken.

  6. Decreasing the stochasticity of mammalian gene expression by a synthetic gene circuit (United States)

    Nevozhay, Dmitry; Zal, Tomasz; Balazsi, Gabor


    Gene therapy and functional genetic studies usually require precisely controlled and uniform gene expression in a population of cells for reliable level of protein production. Due to this requirement, stochastic gene expression is perceived as undesirable in these fields and ideally has to be minimized. The number of approaches for decreasing gene expression stochasticity in mammalian cells is limited. This creates an unmet need to develop new gene expression systems for this purpose. Based on earlier synthetic constructs in yeast, we developed and assessed a negative feedback-based mammalian gene circuit, with uniform and low level of stochasticity in gene expression at different levels of induction. In addition, this new synthetic construct enables highly precise gene expression control in mammalian cells, due to the linear dependence of gene expression on the inducer concentration applied to the system. This mammalian gene expression circuit has potential applicability for the development of new treatment modalities in gene therapy and research tools in functional genetics. In addition, this work creates a roadmap for moving synthetic gene circuits from microbes into mammalian cells.

  7. Transcriptomic analysis of gene expression profiles of stomach carcinoma reveal abnormal expression of mitotic components. (United States)

    Tong, Hongfei; Wang, Jisheng; Chen, Hui; Wang, Zhaohong; Fan, Henwei; Ni, Zhonglin


    In order to explore the etiology of gastric cancer on global gene expression level, we developed advanced bioinformatic analysis to investigate the variations of global gene expression and the interactions among them. We downloaded the dataset GSE63288 from Gene Expression Omnibus (GEO) database which included 22 human gastric cancer and 22 healthy control samples. We identified the differential expression genes, and explored the Gene ontology (GO) and pathways of the differentially expressed genes. Furthermore, integrative interaction network and co-expression network were employed to identify the key genes which may contribute to gastric cancer progression. The results indicated that 5 kinases including BUB1, TTK protein kinase, Citron Rho-interacting kinase (CIT), ZAK and NEK2 were upregulated in gastric cancer. Interestingly, BUB1, TTK, CIT and NEK2 have shown high expression similarities and bound with each other, and participated in multiple phases of mitosis. Moreover, a subnet of co-expression genes e.g. KIF14, PRC1, CENPF and CENPI was also involved in mitosis which was functionally coupled with the kinases above. By validation assays, the results indicated that CIT, PRC1, TTK and KIF14 were significantly upregulated in gastric cancer. These evidences have suggested that aberrant expression of these genes may drive gastric cancer including progression, invasion and metastasis. Although the causal relationships between gastric cancer and the genes are still lacking, it was reasonable to take them as biomarkers for diagnosis of gastric cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Key aspects of analyzing microarray gene-expression data. (United States)

    Chen, James J


    One major challenge with the use of microarray technology is the analysis of massive amounts of gene-expression data for various applications. This review addresses the key aspects of the microarray gene-expression data analysis for the two most common objectives: class comparison and class prediction. Class comparison mainly aims to select which genes are differentially expressed across experimental conditions. Gene selection is separated into two steps: gene ranking and assigning a significance level. Class prediction uses expression profiling analysis to develop a prediction model for patient selection, diagnostic prediction or prognostic classification. Development of a prediction model involves two components: model building and performance assessment. It also describes two additional data analysis methods: gene-class testing and multiple ordering criteria.

  9. Distribution of population-averaged observables in stochastic gene expression (United States)

    Bhattacharyya, Bhaswati; Kalay, Ziya


    Observation of phenotypic diversity in a population of genetically identical cells is often linked to the stochastic nature of chemical reactions involved in gene regulatory networks. We investigate the distribution of population-averaged gene expression levels as a function of population, or sample, size for several stochastic gene expression models to find out to what extent population-averaged quantities reflect the underlying mechanism of gene expression. We consider three basic gene regulation networks corresponding to transcription with and without gene state switching and translation. Using analytical expressions for the probability generating function of observables and large deviation theory, we calculate the distribution and first two moments of the population-averaged mRNA and protein levels as a function of model parameters, population size, and number of measurements contained in a data set. We validate our results using stochastic simulations also report exact results on the asymptotic properties of population averages which show qualitative differences among different models.

  10. Gene expression profiling of placentas affected by pre-eclampsia

    DEFF Research Database (Denmark)

    Hoegh, Anne Mette; Borup, Rehannah; Nielsen, Finn Cilius;


    Several studies point to the placenta as the primary cause of pre-eclampsia. Our objective was to identify placental genes that may contribute to the development of pre-eclampsia. RNA was purified from tissue biopsies from eleven pre-eclamptic placentas and eighteen normal controls. Messenger RNA...... expression from pooled samples was analysed by microarrays. Verification of the expression of selected genes was performed using real-time PCR. A surprisingly low number of genes (21 out of 15,000) were identified as differentially expressed. Among these were genes not previously associated with pre-eclampsia...... as bradykinin B1 receptor and a 14-3-3 protein, but also genes that have already been connected with pre-eclampsia, for example, inhibin beta A subunit and leptin. A low number of genes were repeatedly identified as differentially expressed, because they may represent the endpoint of a cascade of events...

  11. Gene expression profiling of placentas affected by pre-eclampsia

    DEFF Research Database (Denmark)

    Hoegh, Anne Mette; Borup, Rehannah; Nielsen, Finn Cilius


    Several studies point to the placenta as the primary cause of pre-eclampsia. Our objective was to identify placental genes that may contribute to the development of pre-eclampsia. RNA was purified from tissue biopsies from eleven pre-eclamptic placentas and eighteen normal controls. Messenger RNA...... expression from pooled samples was analysed by microarrays. Verification of the expression of selected genes was performed using real-time PCR. A surprisingly low number of genes (21 out of 15,000) were identified as differentially expressed. Among these were genes not previously associated with pre-eclampsia...... as bradykinin B1 receptor and a 14-3-3 protein, but also genes that have already been connected with pre-eclampsia, for example, inhibin beta A subunit and leptin. A low number of genes were repeatedly identified as differentially expressed, because they may represent the endpoint of a cascade of events...

  12. A predictive approach to identify genes differentially expressed (United States)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana


    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  13. Decoupling Linear and Nonlinear Associations of Gene Expression

    KAUST Repository

    Itakura, Alan


    The FANTOM consortium has generated a large gene expression dataset of different cell lines and tissue cultures using the single-molecule sequencing technology of HeliscopeCAGE. This provides a unique opportunity to investigate novel associations between gene expression over time and different cell types. Here, we create a MatLab wrapper for a powerful and computationally intensive set of statistics known as Maximal Information Coefficient, and then calculate this statistic for a large, comprehensive dataset containing gene expression of a variety of differentiating tissues. We then distinguish between linear and nonlinear associations, and then create gene association networks. Following this analysis, we are then able to identify clusters of linear gene associations that then associate nonlinearly with other clusters of linearity, providing insight to much more complex connections between gene expression patterns than previously anticipated.

  14. A riboswitch-based inducible gene expression system for mycobacteria.

    Directory of Open Access Journals (Sweden)

    Jessica C Seeliger

    Full Text Available Research on the human pathogen Mycobacterium tuberculosis (Mtb would benefit from novel tools for regulated gene expression. Here we describe the characterization and application of a synthetic riboswitch-based system, which comprises a mycobacterial promoter for transcriptional control and a riboswitch for translational control. The system was used to induce and repress heterologous protein overexpression reversibly, to create a conditional gene knockdown, and to control gene expression in a macrophage infection model. Unlike existing systems for controlling gene expression in Mtb, the riboswitch does not require the co-expression of any accessory proteins: all of the regulatory machinery is encoded by a short DNA segment directly upstream of the target gene. The inducible riboswitch platform has the potential to be a powerful general strategy for creating customized gene regulation systems in Mtb.

  15. Fundamental principles of energy consumption for gene expression (United States)

    Huang, Lifang; Yuan, Zhanjiang; Yu, Jianshe; Zhou, Tianshou


    How energy is consumed in gene expression is largely unknown mainly due to complexity of non-equilibrium mechanisms affecting expression levels. Here, by analyzing a representative gene model that considers complexity of gene expression, we show that negative feedback increases energy consumption but positive feedback has an opposite effect; promoter leakage always reduces energy consumption; generating more bursts needs to consume more energy; and the speed of promoter switching is at the cost of energy consumption. We also find that the relationship between energy consumption and expression noise is multi-mode, depending on both the type of feedback and the speed of promoter switching. Altogether, these results constitute fundamental principles of energy consumption for gene expression, which lay a foundation for designing biologically reasonable gene modules. In addition, we discuss possible biological implications of these principles by combining experimental facts.

  16. Method of Fingerprint Identification


    Surachai Panich


    Problem statement: The main task of this study was finding out an effective algorithm in order to match two fingerprints taken from database. The fingerprint identification techniques used in a small database in order to find out an effective algorithm to develop the accuracy in matching process. Higher-level application of this proposed algorithm was determined. Approach: The main objectives in this study were the construction of fingerprint database and matching algorithm for comparison of ...

  17. Mucin gene expression in human middle ear epithelium. (United States)

    Kerschner, Joseph Edward


    To investigate the expression of recently identified human mucin genes in human middle ear epithelial (MEE) specimens from in vivo middle ear (ME) tissue and to compare this mucin gene expression with mucin gene expression in an immortalized cell culture in vitro source of human MEE. Human MEE was harvested as in vivo specimens, and human MEE cell cultures were established for in vitro experimentation. RNA was extracted from MEE and primers designed for reverse-transcription polymerase chain reaction to assess for mucin gene MUC1, MUC2, MUC3, MUC4, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC9, MUC11, MUC12, MUC13, MUC15, MUC16, MUC18, MUC19, and MUC20 expression. Mucin gene expression in the in vivo and in vitro ME tissue was compared against tissues with known expression of the mucin genes in question. Mucin genes MUC1, MUC2, MUC3, MUC4, MUC5AC, MUC5B, MUC7, MUC8, MUC9, MUC11, MUC13, MUC15, MUC16, MUC18, MUC19, and MUC20 were identified and expressed in both the in vivo and in vitro samples of MEE. Mucin genes MUC6, MUC12, and MUC17 were not identified in either tissue samples. Many of the mucin genes that have been recently identified are expressed in human MEE. These genes are expressed in a similar manner in both in vivo and in vitro models. Understanding the mechanisms in which these genes regulate the physiology and pathophysiology of MEE will provide a more thorough understanding of the molecular mechanics of the MEE and disease conditions such as otitis media.

  18. Evaluating the consistency of gene sets used in the analysis of bacterial gene expression data

    Directory of Open Access Journals (Sweden)

    Tintle Nathan L


    Full Text Available Abstract Background Statistical analyses of whole genome expression data require functional information about genes in order to yield meaningful biological conclusions. The Gene Ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG are common sources of functionally grouped gene sets. For bacteria, the SEED and MicrobesOnline provide alternative, complementary sources of gene sets. To date, no comprehensive evaluation of the data obtained from these resources has been performed. Results We define a series of gene set consistency metrics directly related to the most common classes of statistical analyses for gene expression data, and then perform a comprehensive analysis of 3581 Affymetrix® gene expression arrays across 17 diverse bacteria. We find that gene sets obtained from GO and KEGG demonstrate lower consistency than those obtained from the SEED and MicrobesOnline, regardless of gene set size. Conclusions Despite the widespread use of GO and KEGG gene sets in bacterial gene expression data analysis, the SEED and MicrobesOnline provide more consistent sets for a wide variety of statistical analyses. Increased use of the SEED and MicrobesOnline gene sets in the analysis of bacterial gene expression data may improve statistical power and utility of expression data.

  19. Gene expression profile analysis of human intervertebral disc degeneration


    Kai Chen; Dajiang Wu; Xiaodong Zhu; Haijian Ni; Xianzhao Wei; Ningfang Mao; Yang Xie; Yunfei Niu; Ming Li


    In this study, we used microarray analysis to investigate the biogenesis and progression of intervertebral disc degeneration. The gene expression profiles of 37 disc tissue samples obtained from patients with herniated discs and degenerative disc disease collected by the National Cancer Institute Cooperative Tissue Network were analyzed. Differentially expressed genes between more and less degenerated discs were identified by significant analysis of microarray. A total of 555 genes were signi...

  20. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik


    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns...... that encode reverse transcriptase-like genes, and group I introns and archaeal introns that encode homing endonuclease genes (HEGs). Although rDNA-embedded protein genes are widespread in nuclei, organelles and bacteria, there is surprisingly little information available on how these genes are expressed....... Exceptions include a handful of HEGs from group I introns. Recent studies have revealed unusual and essential roles of group I and group I-like ribozymes in the endogenous expression of HEGs. Here we discuss general aspects of rDNA-embedded protein genes and focus on HEG expression from group I introns...

  1. Protamine stimulates bone sialoprotein gene expression. (United States)

    Zhou, Liming; Matsumura, Hiroyoshi; Mezawa, Masaru; Takai, Hideki; Nakayama, Yohei; Mitarai, Makoto; Ogata, Yorimasa


    Protamine is a small, arginine-rich, nuclear protein that replaces histone late in the haploid phase of spermatogenesis and is believed to be essential for sperm head condensation and DNA stabilization. Protamine has many biological activities and has roles in hematopoiesis, immune responses, the nervous system and bone metabolism. Bone sialoprotein (BSP) is a mineralized connective tissue-specific protein expressed in differentiated osteoblasts that appears to function in the initial mineralization of bone. Protamine (71.35 ng/ml) increased BSP mRNA levels by 6h in osteoblast-like ROS 17/2.8 cells. In a transient transfection assay, protamine (71.35 ng/ml) increased luciferase activity of the construct (-116 to +60) in ROS 17/2.8 cells and rat bone marrow stromal cells. Luciferase activities induced by protamine were blocked by protein kinase A, tyrosine kinase and ERK1/2 inhibitors. Introduction of 2 bp mutations to the luciferase constructs showed that the effects of protamine were mediated by a cAMP response element (CRE), a fibroblast growth factor 2 response element (FRE) and a homeodomain protein-binding site (HOX). Gel shift analyses showed that protamine (71.35 ng/ml) increased the nuclear protein binding to CRE, FRE and HOX. CREB, phospho-CREB, c-Fos, c-Jun, JunD and Fra2 antibodies disrupted the formation of CRE-protein complexes. Dlx5, Msx2, Runx2 and Smad1 antibodies disrupted FRE- and HOX-protein complex formations. These studies demonstrate that protamine induces BSP transcription by targeting CRE, FRE and HOX sites in the proximal promoter of the rat BSP gene. Moreover, phospho-CREB, c-Fos, c-Jun, JunD, Fra2, Dlx5, Msx2, Runx2 and Smadl transcription factors appear to be key regulators of protamine effects on BSP transcription.

  2. Latent fingerprint matching. (United States)

    Jain, Anil K; Feng, Jianjiang


    Latent fingerprint identification is of critical importance to law enforcement agencies in identifying suspects: Latent fingerprints are inadvertent impressions left by fingers on surfaces of objects. While tremendous progress has been made in plain and rolled fingerprint matching, latent fingerprint matching continues to be a difficult problem. Poor quality of ridge impressions, small finger area, and large nonlinear distortion are the main difficulties in latent fingerprint matching compared to plain or rolled fingerprint matching. We propose a system for matching latent fingerprints found at crime scenes to rolled fingerprints enrolled in law enforcement databases. In addition to minutiae, we also use extended features, including singularity, ridge quality map, ridge flow map, ridge wavelength map, and skeleton. We tested our system by matching 258 latents in the NIST SD27 database against a background database of 29,257 rolled fingerprints obtained by combining the NIST SD4, SD14, and SD27 databases. The minutiae-based baseline rank-1 identification rate of 34.9 percent was improved to 74 percent when extended features were used. In order to evaluate the relative importance of each extended feature, these features were incrementally used in the order of their cost in marking by latent experts. The experimental results indicate that singularity, ridge quality map, and ridge flow map are the most effective features in improving the matching accuracy.

  3. Binary gene induction and protein expression in individual cells

    Directory of Open Access Journals (Sweden)

    Conolly Rory B


    Full Text Available Abstract Background Eukaryotic gene transcription is believed to occur in either a binary or a graded fashion. With binary induction, a transcription activator (TA regulates the probability with which a gene template is switched from the inactive to the active state without affecting the rate at which RNA molecules are produced from the template. With graded, also called rheostat-like, induction the gene template has continuously varying levels of transcriptional activity, and the TA regulates the rate of RNA production. Support for each of these two mechanisms arises primarily from experimental studies measuring reporter proteins in individual cells, rather than from direct measurement of induction events at the gene template. Methods and results In this paper, using a computational model of stochastic gene expression, we have studied the biological and experimental conditions under which a binary induction mode operating at the gene template can give rise to differentially expressed "phenotypes" (i.e., binary, hybrid or graded at the protein level. We have also investigated whether the choice of reporter genes plays a significant role in determining the observed protein expression patterns in individual cells, given the diverse properties of commonly-used reporter genes. Our simulation confirmed early findings that the lifetimes of active/inactive promoters and half-lives of downstream mRNA/protein products are important determinants of various protein expression patterns, but showed that the induction time and the sensitivity with which the expressed genes are detected are also important experimental variables. Using parameter conditions representative of reporter genes including green fluorescence protein (GFP and β-galactosidase, we also demonstrated that graded gene expression is more likely to be observed with GFP, a longer-lived protein with low detection sensitivity. Conclusion The choice of reporter genes may determine whether protein

  4. A functional profile of gene expression in ARPE-19 cells

    Directory of Open Access Journals (Sweden)

    Johnson Dianna A


    Full Text Available Abstract Background Retinal pigment epithelium cells play an important role in the pathogenesis of age related macular degeneration. Their morphological, molecular and functional phenotype changes in response to various stresses. Functional profiling of genes can provide useful information about the physiological state of cells and how this state changes in response to disease or treatment. In this study, we have constructed a functional profile of the genes expressed by the ARPE-19 cell line of retinal pigment epithelium. Methods Using Affymetrix MAS 5.0 microarray analysis, genes expressed by ARPE-19 cells were identified. Using GeneChip® annotations, these genes were classified according to their known functions to generate a functional gene expression profile. Results We have determined that of approximately 19,044 unique gene sequences represented on the HG-U133A GeneChip® , 6,438 were expressed in ARPE-19 cells irrespective of the substrate on which they were grown (plastic, fibronectin, collagen, or Matrigel. Rather than focus our subsequent analysis on the identity or level of expression of each individual gene in this large data set, we examined the number of genes expressed within 130 functional categories. These categories were selected from a library of HG-U133A GeneChip® annotations linked to the Affymetrix MAS 5.0 data sets. Using this functional classification scheme, we were able to categorize about 70% of the expressed genes and condense the original data set of over 6,000 data points into a format with 130 data points. The resulting ARPE-19 Functional Gene Expression Profile is displayed as a percentage of ARPE-19-expressed genes. Conclusion The Profile can readily be compared with equivalent microarray data from other appropriate samples in order to highlight cell-specific attributes or treatment-induced changes in gene expression. The usefulness of these analyses is based on the assumption that the numbers of genes

  5. Validation of reference genes for quantifying changes in gene expression in virus-infected tobacco. (United States)

    Baek, Eseul; Yoon, Ju-Yeon; Palukaitis, Peter


    To facilitate quantification of gene expression changes in virus-infected tobacco plants, eight housekeeping genes were evaluated for their stability of expression during infection by one of three systemically-infecting viruses (cucumber mosaic virus, potato virus X, potato virus Y) or a hypersensitive-response-inducing virus (tobacco mosaic virus; TMV) limited to the inoculated leaf. Five reference-gene validation programs were used to establish the order of the most stable genes for the systemically-infecting viruses as ribosomal protein L25 > β-Tubulin > Actin, and the least stable genes Ubiquitin-conjugating enzyme (UCE) genes were EF1α > Cysteine protease > Actin, and the least stable genes were GAPDH genes, three defense responsive genes were examined to compare their relative changes in gene expression caused by each virus. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Recent progress in fingerprint recognition

    Institute of Scientific and Technical Information of China (English)


    Fingerprint recognition has been increasingly used to realize personal identification in civilian's daily life, such as ID card, fingerprints hard disk and so on. Great improvement has been achieved in the on-line fingerprint sensing technology and automatic fingerprint recognition algorithms. Various fingerprint recognition techniques, including fingerprint acquisition, classification, enhancement and matching, are highly improved. This paper overviews recent advances in fingerprint recognition and summarizes the algorithm proposed for every step with special focuses on the enhancement of low-quality fingerprints and the matching of the distorted fingerprint images. Both issues are believed to be significant and challenging tasks. In addition, we also discuss the common evaluation for the fingerprint recognition algorithm of the Fingerprint Verification Competition 2004 (FVC2004) and the Fingerprint Vendor Technology Evaluation 2003 (FpVTE2003), based on which we could measure the performance of the recognition algorithm objectively and uniformly.

  7. Relating perturbation magnitude to temporal gene expression in biological systems

    Directory of Open Access Journals (Sweden)

    Pfrender Michael E


    Full Text Available Abstract Background Most transcriptional activity is a result of environmental variability. This cause (environment and effect (gene expression relationship is essential to survival in any changing environment. The specific relationship between environmental perturbation and gene expression – and stability of the response – has yet to be measured in detail. We describe a method to quantitatively relate perturbation magnitude to response at the level of gene expression. We test our method using Saccharomyces cerevisiae as a model organism and osmotic stress as an environmental stress. Results Patterns of gene expression were measured in response to increasing sodium chloride concentrations (0, 0.5, 0.7, 1.0, and 1.2 M for sixty genes impacted by osmotic shock. Expression of these genes was quantified over five time points using reverse transcriptase real-time polymerase chain reaction. Magnitudes of cumulative response for specific pathways, and the set of all genes, were obtained by combining the temporal response envelopes for genes exhibiting significant changes in expression with time. A linear relationship between perturbation magnitude and response was observed for the range of concentrations studied. Conclusion This study develops a quantitative approach to describe the stability of gene response and pathways to environmental perturbation and illustrates the utility of this approach. The approach should be applicable to quantitatively evaluate the response of organisms via the magnitude of response and stability of the transcriptome to environmental change.

  8. Clustering Algorithms: Their Application to Gene Expression Data (United States)

    Oyelade, Jelili; Isewon, Itunuoluwa; Oladipupo, Funke; Aromolaran, Olufemi; Uwoghiren, Efosa; Ameh, Faridah; Achas, Moses; Adebiyi, Ezekiel


    Gene expression data hide vital information required to understand the biological process that takes place in a particular organism in relation to its environment. Deciphering the hidden patterns in gene expression data proffers a prodigious preference to strengthen the understanding of functional genomics. The complexity of biological networks and the volume of genes present increase the challenges of comprehending and interpretation of the resulting mass of data, which consists of millions of measurements; these data also inhibit vagueness, imprecision, and noise. Therefore, the use of clustering techniques is a first step toward addressing these challenges, which is essential in the data mining process to reveal natural structures and identify interesting patterns in the underlying data. The clustering of gene expression data has been proven to be useful in making known the natural structure inherent in gene expression data, understanding gene functions, cellular processes, and subtypes of cells, mining useful information from noisy data, and understanding gene regulation. The other benefit of clustering gene expression data is the identification of homology, which is very important in vaccine design. This review examines the various clustering algorithms applicable to the gene expression data in order to discover and provide useful knowledge of the appropriate clustering technique that will guarantee stability and high degree of accuracy in its analysis procedure. PMID:27932867

  9. Genome-wide patterns of Arabidopsis gene expression in nature.

    Directory of Open Access Journals (Sweden)

    Christina L Richards

    Full Text Available Organisms in the wild are subject to multiple, fluctuating environmental factors, and it is in complex natural environments that genetic regulatory networks actually function and evolve. We assessed genome-wide gene expression patterns in the wild in two natural accessions of the model plant Arabidopsis thaliana and examined the nature of transcriptional variation throughout its life cycle and gene expression correlations with natural environmental fluctuations. We grew plants in a natural field environment and measured genome-wide time-series gene expression from the plant shoot every three days, spanning the seedling to reproductive stages. We find that 15,352 genes were expressed in the A. thaliana shoot in the field, and accession and flowering status (vegetative versus flowering were strong components of transcriptional variation in this plant. We identified between ∼110 and 190 time-varying gene expression clusters in the field, many of which were significantly overrepresented by genes regulated by abiotic and biotic environmental stresses. The two main principal components of vegetative shoot gene expression (PC(veg correlate to temperature and precipitation occurrence in the field. The largest PC(veg axes included thermoregulatory genes while the second major PC(veg was associated with precipitation and contained drought-responsive genes. By exposing A. thaliana to natural environments in an open field, we provide a framework for further understanding the genetic networks that are deployed in natural environments, and we connect plant molecular genetics in the laboratory to plant organismal ecology in the wild.

  10. X chromosome regulation of autosomal gene expression in bovine blastocysts


    Itoh, Yuichiro; Arnold, Arthur P.


    Although X chromosome inactivation in female mammals evolved to balance the expression of X chromosome and autosomal genes in the two sexes, female embryos pass through developmental stages in which both X chromosomes are active in somatic cells. Bovine blastocysts show higher expression of many X genes in XX than XY embryos, suggesting that X inactivation is not complete. Here we reanalyzed bovine blastocyst microarray expression data from a network perspective with a focus on interactions b...

  11. X chromosome regulation of autosomal gene expression in bovine blastocysts


    Itoh, Yuichiro; Arnold, Arthur P.


    Although X chromosome inactivation in female mammals evolved to balance the expression of X chromosome and autosomal genes in the two sexes, female embryos pass through developmental stages in which both X chromosomes are active in somatic cells. Bovine blastocysts show higher expression of many X genes in XX than XY embryos, suggesting that X inactivation is not complete. Here we reanalyzed bovine blastocyst microarray expression data from a network perspective with a focus on interactions b...

  12. With Reference to Reference Genes: A Systematic Review of Endogenous Controls in Gene Expression Studies. (United States)

    Chapman, Joanne R; Waldenström, Jonas


    The choice of reference genes that are stably expressed amongst treatment groups is a crucial step in real-time quantitative PCR gene expression studies. Recent guidelines have specified that a minimum of two validated reference genes should be used for normalisation. However, a quantitative review of the literature showed that the average number of reference genes used across all studies was 1.2. Thus, the vast majority of studies continue to use a single gene, with β-actin (ACTB) and/or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) being commonly selected in studies of vertebrate gene expression. Few studies (15%) tested a panel of potential reference genes for stability of expression before using them to normalise data. Amongst studies specifically testing reference gene stability, few found ACTB or GAPDH to be optimal, whereby these genes were significantly less likely to be chosen when larger panels of potential reference genes were screened. Fewer reference genes were tested for stability in non-model organisms, presumably owing to a dearth of available primers in less well characterised species. Furthermore, the experimental conditions under which real-time quantitative PCR analyses were conducted had a large influence on the choice of reference genes, whereby different studies of rat brain tissue showed different reference genes to be the most stable. These results highlight the importance of validating the choice of normalising reference genes before conducting gene expression studies.

  13. Using PCR to Target Misconceptions about Gene Expression

    Directory of Open Access Journals (Sweden)

    Leslie K. Wright


    Full Text Available We present a PCR-based laboratory exercise that can be used with first- or second-year biology students to help overcome common misconceptions about gene expression. Biology students typically do not have a clear understanding of the difference between genes (DNA and gene expression (mRNA/protein and often believe that genes exist in an organism or cell only when they are expressed. This laboratory exercise allows students to carry out a PCR-based experiment designed to challenge their misunderstanding of the difference between genes and gene expression. Students first transform E. coli with an inducible GFP gene containing plasmid and observe induced and un-induced colonies. The following exercise creates cognitive dissonance when actual PCR results contradict their initial (incorrect predictions of the presence of the GFP gene in transformed cells. Field testing of this laboratory exercise resulted in learning gains on both knowledge and application questions on concepts related to genes and gene expression.

  14. DNA microarray analysis of genes differentially expressed in adipocyte differentiation

    Indian Academy of Sciences (India)

    Chunyan Yin; Yanfeng Xiao; Wei Zhang; Erdi Xu; Weihua Liu; Xiaoqing Yi; Ming Chang


    In the present study, the human liposarcoma cell line SW872 was used to identify global changes in gene expression profiles occurring during adipogenesis. We further explored some of the genes expressed during the late phase of adipocyte differentiation. These genes may play a major role in promoting excessive proliferation and accumulation of lipid droplets, which contribute to the development of obesity. By using microarray-based technology, we examined differential gene expression in early differentiated adipocytes and late differentiated adipocytes. Validated genes exhibited a ≥ 10-fold increase in the late phase of adipocyte differentiation by polymerase chain reaction (RT-PCR). Compared with undifferentiated preadipocytes, we found that 763 genes were increased in early differentiated adipocytes, and 667 genes were increased in later differentiated adipocytes. Furthermore, 21 genes were found being expressed 10-fold higher in the late phase of adipocyte differentiation. The results were in accordance with the RT-PCR test, which validated 11 genes, namely, CIDEC, PID1, LYRM1, ADD1, PPAR2, ANGPTL4, ADIPOQ, ACOX1, FIP1L1, MAP3K2 and PEX14. Most of these genes were found being expressed in the later phase of adipocyte differentiation involved in obesity-related diseases. The findings may help to better understand the mechanism of obesity and related diseases.

  15. DNA microarray analysis of genes differentially expressed in adipocyte differentiation. (United States)

    Yin, Chunyan; Xiao, Yanfeng; Zhang, Wei; Xu, Erdi; Liu, Weihua; Yi, Xiaoqing; Chang, Ming


    In the present study, the human liposarcoma cell line SW872 was used to identify global changes in gene expression profiles occurring during adipogenesis. We further explored some of the genes expressed during the late phase of adipocyte differentiation. These genes may play a major role in promoting excessive proliferation and accumulation of lipid droplets, which contribute to the development of obesity. By using microarray-based technology, we examined differential gene expression in early differentiated adipocytes and late differentiated adipocytes. Validated genes exhibited a greater than or equal to 10-fold increase in the late phase of adipocyte differentiation by polymerase chain reaction (RT-PCR). Compared with undifferentiated preadipocytes, we found that 763 genes were increased in early differentiated adipocytes, and 667 genes were increased in later differentiated adipocytes. Furthermore, 21 genes were found being expressed 10-fold higher in the late phase of adipocyte differentiation. The results were in accordance with the RTPCR test, which validated 11 genes, namely, CIDEC, PID1, LYRM1, ADD1, PPAR?2, ANGPTL4, ADIPOQ, ACOX1, FIP1L1, MAP3K2 and PEX14. Most of these genes were found being expressed in the later phase of adipocyte differentiation involved in obesity-related diseases. The findings may help to better understand the mechanism of obesity and related diseases.

  16. BPH gene expression profile associated to prostate gland volume. (United States)

    Descazeaud, Aurelien; Rubin, Mark A; Hofer, Matthias; Setlur, Sunita; Nikolaief, Nathalie; Vacherot, Francis; Soyeux, Pascale; Kheuang, Laurence; Abbou, Claude C; Allory, Yves; de la Taille, Alexandre


    The aim of the current study was to analyze gene expression profiles in benign prostatic hyperplasia and to compare them with phenotypic properties. Thirty-seven specimens of benign prostatic hyperplasia were obtained from symptomatic patients undergoing surgery. RNA was extracted and hybridized to Affymetrix Chips containing 54,000 gene expression probes. Gene expression profiles were analyzed using cluster, TreeView, and significance analysis of microarrays softwares. In an initial unsupervised analysis, our 37 samples clustered hierarchically in 2 groups of 18 and 19 samples, respectively. Five clinical parameters were statistically different between the 2 groups: in group 1 compared with group 2, patients had larger prostate glands, had higher prostate specific antigen levels, were more likely to be treated by alpha blockers, to be operated by prostatectomy, and to have major irritative symptoms. The sole independent parameter associated with this dichotome clustering, however, was the prostate gland volume. Therefore, the role of prostate volume was explored in a supervised analysis. Gene expression of prostate glands 60 mL were compared using significance analysis of microarrays and 227 genes were found differentially expressed between the 2 groups (>2 change and false discovery rate of <5%). Several specific pathways including growth factors genes, cell cycle genes, apoptose genes, inflammation genes, and androgen regulated genes, displayed major differences between small and large prostate glands.

  17. Validation of housekeeping genes for studying differential gene expression in the bovine myometrium. (United States)

    Rekawiecki, Robert; Kowalik, Magdalena K; Kotwica, Jan


    The aim of this study was to determine the steady-state expression of 13 selected housekeeping genes in the myometrium of cyclic and pregnant cows. Cells taken from bovine myometrium on days 1-5, 6-10, 11-16 and 17-20 of the oestrous cycle and in weeks 3-5, 6-8 and 9-12 of pregnancy were used. Reverse transcribed RNA was amplified in real-time PCR using designed primers. Reaction efficiency was determined with the Linreg programme. The geNorm and NormFinder programmes were used to select the best housekeeping genes. They calculate the expression stability factor for each used housekeeping gene with the smallest value for most stably expressed genes. According to geNorm, the most stable housekeeping genes in the myometrium were C2orf29, TPB and TUBB2B, while the least stably expressed genes were 18S RNA, HPRT1 and GAPDH. NormFinder identified the best genes in the myometrium as C2orf29, MRPL12 and TBP, while the worst genes were 18S RNA, B2M and SF3A1. Differences in stability factors between the two programmes may also indicate that the physiological status of the female, e.g. pregnancy, affects the stability of expression of housekeeping genes. The different expression stability of housekeeping genes did not affect progesterone receptor expression but it could be important if small differences in gene expression were measured between studies.

  18. Gene expression profile analysis of type 2 diabetic mouse liver.

    Directory of Open Access Journals (Sweden)

    Fang Zhang

    Full Text Available Liver plays a key role in glucose metabolism and homeostasis, and impaired hepatic glucose metabolism contributes to the development of type 2 diabetes. However, the precise gene expression profile of diabetic liver and its association with diabetes and related diseases are yet to be further elucidated. In this study, we detected the gene expression profile by high-throughput sequencing in 9-week-old normal and type 2 diabetic db/db mouse liver. Totally 12132 genes were detected, and 2627 genes were significantly changed in diabetic mouse liver. Biological process analysis showed that the upregulated genes in diabetic mouse liver were mainly enriched in metabolic processes. Surprisingly, the downregulated genes in diabetic mouse liver were mainly enriched in immune-related processes, although all the altered genes were still mainly enriched in metabolic processes. Similarly, KEGG pathway analysis showed that metabolic pathways were the major pathways altered in diabetic mouse liver, and downregulated genes were enriched in immune and cancer pathways. Analysis of the key enzyme genes in fatty acid and glucose metabolism showed that some key enzyme genes were significantly increased and none of the detected key enzyme genes were decreased. In addition, FunDo analysis showed that liver cancer and hepatitis were most likely to be associated with diabetes. Taken together, this study provides the digital gene expression profile of diabetic mouse liver, and demonstrates the main diabetes-associated hepatic biological processes, pathways, key enzyme genes in fatty acid and glucose metabolism and potential hepatic diseases.

  19. Expression of HOX C homeobox genes in lymphoid cells. (United States)

    Lawrence, H J; Stage, K M; Mathews, C H; Detmer, K; Scibienski, R; MacKenzie, M; Migliaccio, E; Boncinelli, E; Largman, C


    The class I homeobox genes located in four clusters in mammalian genomes (HOX A, HOX B, HOX C, and HOX D) appear to play a major role in fetal development. Previous surveys of homeobox gene expression in human leukemic cell lines have shown that certain HOX A genes are expressed only in myeloid cell lines, whereas HOX B gene expression is largely restricted to cells with erythroid potential. We now report a survey of the expression patterns of 9 homeobox genes from the HOX C locus in a panel of 24 human and 7 murine leukemic cell lines. The most striking observation is the lymphoid-specific pattern of expression of HOX C4, located at the 3' end of the locus. A major transcript of 1.9 kilobases is observed in both T-cell and B-cell lines. HOX C4 expression is also detected in normal human marrow and peripheral blood lymphocytes, but not in mature granulocytes or monocytes. HOX C8 is also expressed in human lymphoid cells but is expressed in other blood cell types as well. However, the HOX C8 transcript pattern is lineage specific. These data, in conjunction with earlier findings, suggest that homeobox gene expression influences lineage determination during hematopoiesis.

  20. A gene expression signature that defines breast cancer metastases. (United States)

    Ellsworth, Rachel E; Seebach, Jeff; Field, Lori A; Heckman, Caroline; Kane, Jennifer; Hooke, Jeffrey A; Love, Brad; Shriver, Craig D


    The most important predictor of prognosis in breast cancer is lymph node status, yet little is known about molecular changes associated with lymph node metastasis. Here, gene expression analysis was performed on primary breast (PBT) and corresponding metastatic lymph node (MLN) tumors to identify molecular signatures associated with nodal metastasis. RNA was isolated after laser microdissection from frozen PBT and MLN from 20 patients with positive lymph nodes and hybridized to the microarray chips. Differential expression was determined using Mann-Whitney testing; Bonferroni corrected P values of 0.05 and 0.001 were calculated. Results were validated using TaqMan assays. Fifty-one genes were differentially expressed (P 100-fold higher expression in MLT while COL11A1, KRT14, MMP13, TAC1 and WNT2 had >100-fold higher expression in PBT. Gene expression differences between PBT and MLN suggests that expression of a unique set of genes is required for successful lymph node colonization. Genes expressed at higher levels in PBT are involved in degradation of the extracellular matrix, enabling cells with metastatic potential to disseminate, while genes expressed at higher levels in metastases are involved in transcription, signal transduction and immune response, providing cells with proliferation and survival advantages. These data improve our understanding of the biological processes involved in successful metastatis and provide new targets to arrest tumor cell dissemination and metastatic colonization.

  1. Combining metabolomic analysis and microarray gene expression analysis in the characterization of the medicinal plant Chelidonium majus L. (United States)

    Orland, A; Knapp, K; König, G M; Ulrich-Merzenich, G; Knöß, W


    Even though herbal medicines have played an important role in disease management and health for many centuries, their present frequent use is challenged by the necessity to determine their complex composition and their multitarget mode of action. In the present study, modern methods were investigated towards their potential in the characterization of herbal substances. As a model the herbal substance Chelidonii herba was used, for which several reports on liver toxicities exist. Extracts of Chelidonii herba with different solvents were characterized phytochemically and functionally by experiments with HepG2 liver cells. Chelidonii herba was extracted with four solvents of different polarity (dichloromethane, water, ethanol, and ethanol 50% (V/V); four replicates each). The different extracts were characterized metabolomically by (1)H-NMR fingerprinting analysis and principal component analysis (PCA). The content of alkaloids was additionally determined by RP-HPLC. Functional characterization was achieved by the determination of cell proliferation and by transcriptomics techniques (Whole Genome Gene Expression Microarrays v2, Agilent Technologies) in HepG2 cells after exposure to the different extracts (four experimental replicates each). Based on data from (1)H-NMR fingerprints and RP-HPLC analyses the different extracts showed a divergent composition of constituents depending on the solvent used. HepG2 liver cells responded differentially to the four extracts. Microarray analysis revealed a significant regulation of genes and signal cascades related to biotransformation. Also liver-toxic signal cascades were activated. Neither the activated genes nor the proliferation response could be clearly related to the differing alkaloid content of the extracts. Different manufacturing processes lead to different herbal preparations. A systems biology approach combining a metabolomic plant analysis with a functional characterization by gene expression profiling in HepG2

  2. Dynamic association rules for gene expression data analysis. (United States)

    Chen, Shu-Chuan; Tsai, Tsung-Hsien; Chung, Cheng-Han; Li, Wen-Hsiung


    The purpose of gene expression analysis is to look for the association between regulation of gene expression levels and phenotypic variations. This association based on gene expression profile has been used to determine whether the induction/repression of genes correspond to phenotypic variations including cell regulations, clinical diagnoses and drug development. Statistical analyses on microarray data have been developed to resolve gene selection issue. However, these methods do not inform us of causality between genes and phenotypes. In this paper, we propose the dynamic association rule algorithm (DAR algorithm) which helps ones to efficiently select a subset of significant genes for subsequent analysis. The DAR algorithm is based on association rules from market basket analysis in marketing. We first propose a statistical way, based on constructing a one-sided confidence interval and hypothesis testing, to determine if an association rule is meaningful. Based on the proposed statistical method, we then developed the DAR algorithm for gene expression data analysis. The method was applied to analyze four microarray datasets and one Next Generation Sequencing (NGS) dataset: the Mice Apo A1 dataset, the whole genome expression dataset of mouse embryonic stem cells, expression profiling of the bone marrow of Leukemia patients, Microarray Quality Control (MAQC) data set and the RNA-seq dataset of a mouse genomic imprinting study. A comparison of the proposed method with the t-test on the expression profiling of the bone marrow of Leukemia patients was conducted. We developed a statistical way, based on the concept of confidence interval, to determine the minimum support and minimum confidence for mining association relationships among items. With the minimum support and minimum confidence, one can find significant rules in one single step. The DAR algorithm was then developed for gene expression data analysis. Four gene expression datasets showed that the proposed

  3. Regulation of gene expression by Goodwin's loop with many genes (United States)

    Sielewiesiuk, Jan; Łopaciuk, Agata


    The paper presents a simple analysis of a long Goodwin's loop containing many genes. The genes form a closed series. The rate of transcription of any gene is up or down regulated by theprotein product of the preceding gene. We describe the loop with a system of ordinary differential equations of order s. Oscillatory solutions of the system are possible at the odd number of repressions and any number of inductions if the product of all Hill's coefficients, related to both repressions and inductions, is larger than:

  4. Mating alters gene expression patterns in Drosophila melanogaster male heads

    Directory of Open Access Journals (Sweden)

    Ellis Lisa L


    Full Text Available Abstract Background Behavior is a complex process resulting from the integration of genetic and environmental information. Drosophila melanogaster rely on multiple sensory modalities for reproductive success, and mating causes physiological changes in both sexes that affect reproductive output or behavior. Some of these effects are likely mediated by changes in gene expression. Courtship and mating alter female transcript profiles, but it is not known how mating affects male gene expression. Results We used Drosophila genome arrays to identify changes in gene expression profiles that occur in mated male heads. Forty-seven genes differed between mated and control heads 2 hrs post mating. Many mating-responsive genes are highly expressed in non-neural head tissues, including an adipose tissue called the fat body. One fat body-enriched gene, female-specific independent of transformer (fit, is a downstream target of the somatic sex-determination hierarchy, a genetic pathway that regulates Drosophila reproductive behaviors as well as expression of some fat-expressed genes; three other mating-responsive loci are also downstream components of this pathway. Another mating-responsive gene expressed in fat, Juvenile hormone esterase (Jhe, is necessary for robust male courtship behavior and mating success. Conclusions Our study demonstrates that mating causes changes in male head gene expression profiles and supports an increasing body of work implicating adipose signaling in behavior modulation. Since several mating-induced genes are sex-determination hierarchy target genes, additional mating-responsive loci may be downstream components of this pathway as well.

  5. The structure and expression of the human neuroligin-3 gene. (United States)

    Philibert, R A; Winfield, S L; Sandhu, H K; Martin, B M; Ginns, E I


    The neuroligins are a family of proteins that are thought to mediate cell to cell interactions between neurons. During the sequencing at an Xq13 locus associated with a mental retardation syndrome in some studies, we discovered a portion of the human orthologue of the rat neuroligin-3 gene. We now report the structure and the expression of that gene. The gene spans approximately 30kb and contains eight exons. Unlike the rat gene, it codes for at least two mRNAs and at least one of which is expressed outside the CNS. Interestingly, the putative promoter for the gene overlaps the last exon of the neighboring HOPA gene and is located less than 1kb from an OPA element in which a polymorphism associated with mental retardation is found. These findings suggest a possible role for the neuroligin gene in mental retardation and that the role of the gene in humans may differ from its role in rats.

  6. Regulatory systems for hypoxia-inducible gene expression in ischemic heart disease gene therapy. (United States)

    Kim, Hyun Ah; Rhim, Taiyoun; Lee, Minhyung


    Ischemic heart diseases are caused by narrowed coronary arteries that decrease the blood supply to the myocardium. In the ischemic myocardium, hypoxia-responsive genes are up-regulated by hypoxia-inducible factor-1 (HIF-1). Gene therapy for ischemic heart diseases uses genes encoding angiogenic growth factors and anti-apoptotic proteins as therapeutic genes. These genes increase blood supply into the myocardium by angiogenesis and protect cardiomyocytes from cell death. However, non-specific expression of these genes in normal tissues may be harmful, since growth factors and anti-apoptotic proteins may induce tumor growth. Therefore, tight gene regulation is required to limit gene expression to ischemic tissues, to avoid unwanted side effects. For this purpose, various gene expression strategies have been developed for ischemic-specific gene expression. Transcriptional, post-transcriptional, and post-translational regulatory strategies have been developed and evaluated in ischemic heart disease animal models. The regulatory systems can limit therapeutic gene expression to ischemic tissues and increase the efficiency of gene therapy. In this review, recent progresses in ischemic-specific gene expression systems are presented, and their applications to ischemic heart diseases are discussed.

  7. Gene expression in the urinary bladder: a common carcinoma in situ gene expression signature exists disregarding histopathological classification

    DEFF Research Database (Denmark)

    Andersen, Lars Dyrskjøt; Kruhøffer, Mogens; Andersen, Thomas Thykjær


    The presence of carcinoma in situ (CIS) lesions in the urinary bladder is associated with a high risk of disease progression to a muscle invasive stage. In this study, we used microarray expression profiling to examine the gene expression patterns in superficial transitional cell carcinoma (s...... urothelium and urothelium with CIS lesions from the same urinary bladder revealed that the gene expression found in sTCC with surrounding CIS is found also in CIS biopsies as well as in histologically normal samples adjacent to the CIS lesions. Furthermore, we also identified similar gene expression changes...

  8. Efficient expression of the yeast metallothionein gene in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Berka, T.; Shatzman, A.; Zimmerman, J.; Strickler, J.; Rosenberg, M.


    The yeast metallothionein gene CUP1 was cloned into a bacterial expression system to achieve efficient, controlled expression of the stable, unprocessed protein product. The Escherichia coli-synthesized yeast metallothionein bound copper, cadmium, zinc, indicating that the protein was functional. Furthermore, E. coli cells expressing CUP1 acquired a new, inducible ability to selectively sequester heavy metal ions from the growth medium.

  9. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm. (United States)

    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan


    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  10. Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression. (United States)

    Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression Exposure to many drugs and environmentally-relevant chemicals can cause adverse outcomes. These adverse outcomes, such as cancer, have been linked to mol...

  11. A hammerhead ribozyme inhibits ADE1 gene expression in yeast. (United States)

    Ferbeyre, G; Bratty, J; Chen, H; Cedergren, R


    To study factors that affect in vivo ribozyme (Rz) activity, a model system has been devised in Saccharomyces cerevisiae based on the inhibition of ADE1 gene expression. This gene was chosen because Rz action can be evaluated visually by the Red phenotype produced when the activity of the gene product is inhibited. Different plasmid constructs allowed the expression of the Rz either in cis or in trans with respect to ADE1. Rz-related inhibition of ADE1 expression was correlated with a Red phenotype and a diminution of ADE1 mRNA levels only when the Rz gene was linked 5' to ADE1. The presence of the expected 3' cleavage fragment was demonstrated using a technique combining RNA ligation and PCR. This yeast system and detection technique are suited to the investigation of general factors affecting Rz-catalyzed inhibition of gene expression under in vivo conditions.

  12. Gene expression and behaviour in mouse models of HD. (United States)

    Bowles, K R; Brooks, S P; Dunnett, S B; Jones, L


    Huntington's disease (HD) is an autosomal dominant neurodegenerative disease, resulting in expansion of the CAG repeat in exon 1 of the HTT gene. The resulting mutant huntingtin protein has been implicated in the disruption of a variety of cellular functions, including transcription. Mouse models of HD have been central to the development of our understanding of gene expression changes in this disease, and are now beginning to elucidate the relationship between gene expression and behaviour. Here, we review current mouse models of HD and their characterisation in terms of gene expression. In addition, we look at how this can inform behaviours observed in mouse models of disease. The relationship between gene expression and behaviour in mouse models of HD is important, as this will further our knowledge of disease progression and its underlying molecular events, highlight new treatment targets, and potentially provide new biomarkers for therapeutic trials. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Selection and validation of reference genes for quantitative gene expression studies in Erythroxylum coca



    Real-time quantitative PCR is a powerful technique for the investigation of comparative gene expression, but its accuracy and reliability depend on the reference genes used as internal standards. Only genes that show a high level of expression stability are suitable for use as reference genes, and these must be identified on a case-by-case basis. Erythroxylum coca produces and accumulates high amounts of the pharmacologically active tropane alkaloid cocaine (especially in the leaves), and is ...

  14. Gene expression profiles of Nitrosomonas europaea, an obligate chemolitotroph

    Energy Technology Data Exchange (ETDEWEB)

    Daniel J. Arp


    Nitrosomonas europaea is an aerobic lithoautotrophic bacterium that uses ammonia (NH3) as its energy source. As a nitrifier, it is an important participant in the nitrogen cycle, which can also influence the carbon cycle. The focus of this work was to explore the genetic structure and mechanisms underlying the lithoautotrophic growth style of N. europaea. Whole genome gene expression: The gene expression profile of cells in exponential growth and during starvation was analyzed using microarrays. During growth, 98% of the genes increased in expression at least two fold compared to starvation conditions. In growing cells, approximately 30% of the genes were expressed eight fold higher, Approximately 10% were expressed more than 15 fold higher. Approximately 3% (91 genes) were expressed to more than 20 fold of their levels in starved cells. Carbon fixation gene expression: N. europaea fixes carbon via the Calvin-Benson-Bassham (CBB) cycle via a type I ribulose bisphosphate carboxylase/oxygenase (RubisCO). This study showed that transcription of cbb genes was up-regulated when the carbon source was limited, while amo, hao and other energy harvesting related genes were down-regulated. Iron related gene expression: Because N. europaea has a relatively high content of hemes, sufficient Fe must be available in the medium for it to grow. The genome revealed that approximately 5% of the coding genes in N. europaea are dedicated to Fe transport and assimilation. Nonetheless, with the exception of citrate biosynthesis genes, N. europaea lacks genes for siderophore production. The Fe requirements for growth and the expression of the putative membrane siderophore receptors were determined. The N. europaea genome has over 100 putative genes ({approx}5% of the coding genes) related to Fe uptake and its siderophore receptors could be grouped phylogenetically in four clusters. Fe related genes, such as a number of TonB-dependent Fe-siderophore receptors for ferrichrome and

  15. Gene expression profiles of Nitrosomonas europaea, an obligate chemolitotroph

    Energy Technology Data Exchange (ETDEWEB)

    Daniel J Arp


    Nitrosomonas europaea is an aerobic lithoautotrophic bacterium that uses ammonia (NH3) as its energy source. As a nitrifier, it is an important participant in the nitrogen cycle, which can also influence the carbon cycle. The focus of this work was to explore the genetic structure and mechanisms underlying the lithoautotrophic growth style of N. europaea. Whole genome gene expression. The gene expression profile of cells in exponential growth and during starvation was analyzed using microarrays. During growth, 98% of the genes increased in expression at least two fold compared to starvation conditions. In growing cells, approximately 30% of the genes were expressed eight fold higher, Approximately 10% were expressed more than 15 fold higher. Approximately 3% (91 genes) were expressed to more than 20 fold of their levels in starved cells. Carbon fixation gene expression. N. europaea fixes carbon via the Calvin-Benson-Bassham (CBB) cycle via a type I ribulose bisphosphate carboxylase/oxygenase (RubisCO). This study showed that transcription of cbb genes was up-regulated when the carbon source was limited, while amo, hao and other energy harvesting related genes were down-regulated. Iron related gene expression. Because N. europaea has a relatively high content of hemes, sufficient Fe must be available in the medium for it to grow. The genome revealed that approximately 5% of the coding genes in N. europaea are dedicated to Fe transport and assimilation. Nonetheless, with the exception of citrate biosynthesis genes, N. europaea lacks genes for siderophore production. The Fe requirements for growth and the expression of the putative membrane siderophore receptors were determined. The N. europaea genome has over 100 putative genes ({approx}5% of the coding genes) related to Fe uptake and its siderophore receptors could be grouped phylogenetically in four clusters. Fe related genes, such as a number of TonB-dependent Fe-siderophore receptors for ferrichrome and

  16. Detecting microRNA activity from gene expression data.

    LENUS (Irish Health Repository)

    Madden, Stephen F


    BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  17. Detecting microRNA activity from gene expression data

    LENUS (Irish Health Repository)

    Madden, Stephen F


    Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  18. Gene expression profiling predicts the development of oral cancer. (United States)

    Saintigny, Pierre; Zhang, Li; Fan, You-Hong; El-Naggar, Adel K; Papadimitrakopoulou, Vassiliki A; Feng, Lei; Lee, J Jack; Kim, Edward S; Ki Hong, Waun; Mao, Li


    Patients with oral premalignant lesion (OPL) have a high risk of developing oral cancer. Although certain risk factors, such as smoking status and histology, are known, our ability to predict oral cancer risk remains poor. The study objective was to determine the value of gene expression profiling in predicting oral cancer development. Gene expression profile was measured in 86 of 162 OPL patients who were enrolled in a clinical chemoprevention trial that used the incidence of oral cancer development as a prespecified endpoint. The median follow-up time was 6.08 years and 35 of the 86 patients developed oral cancer over the course. Gene expression profiles were associated with oral cancer-free survival and used to develop multivariate predictive models for oral cancer prediction. We developed a 29-transcript predictive model which showed marked improvement in terms of prediction accuracy (with 8% predicting error rate) over the models using previously known clinicopathologic risk factors. On the basis of the gene expression profile data, we also identified 2,182 transcripts significantly associated with oral cancer risk-associated genes (P value oral cancer risk. In multiple independent data sets, the expression profiles of the genes can differentiate head and neck cancer from normal mucosa. Our results show that gene expression profiles may improve the prediction of oral cancer risk in OPL patients and the significant genes identified may serve as potential targets for oral cancer chemoprevention. ©2011 AACR.

  19. On-Chip Integration of Cell-Free Gene Expression (United States)

    Buxboim, Amnon; Morpurgo, Margherita; Bar-Dagan, Maya; Frydman, Veronica; Zbaida, David; Bar-Ziv, Roy


    We present a synthetic approach for the study of gene networks in vitro which is complementary to traditional in vivo methodologies. We have developed a technology for submicron integration of functional genes and on-chip protein synthesis using a cell-free transcription/translation system. The interaction between genes is facilitated by diffusion of on-chip gene expression products from `source' genes towards `acceptor' genes. Our technology is simple and inexpensive and can serve as an improved platform for a wide variety of protein and DNA biochip applications.

  20. A Marfan syndrome gene expression phenotype in cultured skin fibroblasts

    Directory of Open Access Journals (Sweden)

    Emond Mary


    Full Text Available Abstract Background Marfan syndrome (MFS is a heritable connective tissue disorder caused by mutations in the fibrillin-1 gene. This syndrome constitutes a significant identifiable subtype of aortic aneurysmal disease, accounting for over 5% of ascending and thoracic aortic aneurysms. Results We used spotted membrane DNA macroarrays to identify genes whose altered expression levels may contribute to the phenotype of the disease. Our analysis of 4132 genes identified a subset with significant expression differences between skin fibroblast cultures from unaffected controls versus cultures from affected individuals with known fibrillin-1 mutations. Subsequently, 10 genes were chosen for validation by quantitative RT-PCR. Conclusion Differential expression of many of the validated genes was associated with MFS samples when an additional group of unaffected and MFS affected subjects were analyzed (p-value -6 under the null hypothesis that expression levels in cultured fibroblasts are unaffected by MFS status. An unexpected observation was the range of individual gene expression. In unaffected control subjects, expression ranges exceeding 10 fold were seen in many of the genes selected for qRT-PCR validation. The variation in expression in the MFS affected subjects was even greater.

  1. A Marfan syndrome gene expression phenotype in cultured skin fibroblasts (United States)

    Yao, Zizhen; Jaeger, Jochen C; Ruzzo, Walter L; Morale, Cecile Z; Emond, Mary; Francke, Uta; Milewicz, Dianna M; Schwartz, Stephen M; Mulvihill, Eileen R


    Background Marfan syndrome (MFS) is a heritable connective tissue disorder caused by mutations in the fibrillin-1 gene. This syndrome constitutes a significant identifiable subtype of aortic aneurysmal disease, accounting for over 5% of ascending and thoracic aortic aneurysms. Results We used spotted membrane DNA macroarrays to identify genes whose altered expression levels may contribute to the phenotype of the disease. Our analysis of 4132 genes identified a subset with significant expression differences between skin fibroblast cultures from unaffected controls versus cultures from affected individuals with known fibrillin-1 mutations. Subsequently, 10 genes were chosen for validation by quantitative RT-PCR. Conclusion Differential expression of many of the validated genes was associated with MFS samples when an additional group of unaffected and MFS affected subjects were analyzed (p-value < 3 × 10-6 under the null hypothesis that expression levels in cultured fibroblasts are unaffected by MFS status). An unexpected observation was the range of individual gene expression. In unaffected control subjects, expression ranges exceeding 10 fold were seen in many of the genes selected for qRT-PCR validation. The variation in expression in the MFS affected subjects was even greater. PMID:17850668

  2. Immune response gene expression increases in the aging murine hippocampus. (United States)

    Terao, Akira; Apte-Deshpande, Anjali; Dousman, Linda; Morairty, Stephen; Eynon, Barrett P; Kilduff, Thomas S; Freund, Yvonne R


    Using GeneChips, basal and lipopolysaccharide (LPS)-induced gene expression was examined in the hippocampus of 3-, 12-, 18- and 24-month-old male C57BL/6 mice to identify genes whose altered expression could influence hippocampal function in advanced age. Gene elements that changed with age were selected with a t-statistic and specific expression patterns were confirmed with real-time quantitative PCR. Basal expression of 128 gene elements clearly changed with age in the hippocampus. Fourteen gene elements showed increased expression with age and these increases were validated after LPS stimulation. Major histocompatibility complex (MHC) TL region and thymic shared antigen (TSA-1) gene expression increased, suggesting T cell activation in the hippocampus with age. Cytokine (interleukin (IL)-1beta, tumor necrosis factor (TNF)-alpha) and chemokine (macrophage chemotactic protein-1) expression increased sharply in 24-month-old mice. These findings are in contrast to a decrease in the peripheral immune response, documented by decreased T cell proliferation and decreased ratios of naive to memory T cells. Age-related increases in inflammatory potential in the brain may contribute to neurodegenerative diseases of the aged.

  3. Adipose Gene Expression Profile Changes With Lung Allograft Reperfusion. (United States)

    Diamond, Joshua M; Arcasoy, Selim; McDonnough, Jamiela A; Sonett, Joshua R; Bacchetta, Matthew; D'Ovidio, Frank; Cantu, Edward; Bermudez, Christian A; McBurnie, Amika; Rushefski, Melanie; Kalman, Laurel H; Oyster, Michelle; D'Errico, Carly; Suzuki, Yoshikazu; Giles, Jon T; Ferrante, Anthony; Lippel, Matthew; Singh, Gopal; Lederer, David J; Christie, Jason D


    Obesity is a risk factor for primary graft dysfunction (PGD), a form of lung injury resulting from ischemia-reperfusion after lung transplantation, but the impact of ischemia-reperfusion on adipose tissue is unknown. We evaluated differential gene expression in thoracic visceral adipose tissue (VAT) before and after lung reperfusion. Total RNA was isolated from thoracic VAT sampled from six subjects enrolled in the Lung Transplant Body Composition study before and after allograft reperfusion and quantified using the Human Gene 2.0 ST array. Kyoto Encyclopedia of Genes and Genomes pathway analysis revealed enrichment for genes involved in complement and coagulation cascades and Jak-STAT signaling pathways. Overall, 72 genes were upregulated and 56 genes were downregulated in the postreperfusion time compared with baseline. Long pentraxin-3, a gene and plasma protein previously associated with PGD, was the most upregulated gene (19.5-fold increase, p = 0.04). Fibronectin leucine-rich transmembrane protein-3, a gene associated with cell adhesion and receptor signaling, was the most downregulated gene (4.3-fold decrease, p = 0.04). Ischemia-reperfusion has a demonstrable impact on gene expression in visceral adipose tissue in our pilot study of nonobese, non-PGD lung transplant recipients. Future evaluation will focus on differential adipose tissue gene expression and the development of PGD after transplant. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.

  4. Identification of reference genes in human myelomonocytic cells for gene expression studies in altered gravity. (United States)

    Thiel, Cora S; Hauschild, Swantje; Tauber, Svantje; Paulsen, Katrin; Raig, Christiane; Raem, Arnold; Biskup, Josefine; Gutewort, Annett; Hürlimann, Eva; Unverdorben, Felix; Buttron, Isabell; Lauber, Beatrice; Philpot, Claudia; Lier, Hartwin; Engelmann, Frank; Layer, Liliana E; Ullrich, Oliver


    Gene expression studies are indispensable for investigation and elucidation of molecular mechanisms. For the process of normalization, reference genes ("housekeeping genes") are essential to verify gene expression analysis. Thus, it is assumed that these reference genes demonstrate similar expression levels over all experimental conditions. However, common recommendations about reference genes were established during 1 g conditions and therefore their applicability in studies with altered gravity has not been demonstrated yet. The microarray technology is frequently used to generate expression profiles under defined conditions and to determine the relative difference in expression levels between two or more different states. In our study, we searched for potential reference genes with stable expression during different gravitational conditions (microgravity, normogravity, and hypergravity) which are additionally not altered in different hardware systems. We were able to identify eight genes (ALB, B4GALT6, GAPDH, HMBS, YWHAZ, ABCA5, ABCA9, and ABCC1) which demonstrated no altered gene expression levels in all tested conditions and therefore represent good candidates for the standardization of gene expression studies in altered gravity.

  5. Identifying promoters for gene expression in Clostridium thermocellum

    Directory of Open Access Journals (Sweden)

    Daniel G. Olson


    Full Text Available A key tool for metabolic engineering is the ability to express heterologous genes. One obstacle to gene expression in non-model organisms, and especially in relatively uncharacterized bacteria, is the lack of well-characterized promoters. Here we test 17 promoter regions for their ability to drive expression of the reporter genes β-galactosidase (lacZ and NADPH-alcohol dehydrogenase (adhB in Clostridium thermocellum, an important bacterium for the production of cellulosic biofuels. Only three promoters have been commonly used for gene expression in C. thermocellum, gapDH, cbp and eno. Of the new promoters tested, 2638, 2926, 966 and 815 showed reliable expression. The 2638 promoter showed relatively higher activity when driving adhB (compared to lacZ, and the 815 promoter showed relatively higher activity when driving lacZ (compared to adhB.

  6. Applications of Little's Law to stochastic models of gene expression

    CERN Document Server

    Elgart, Vlad; Kulkarni, Rahul V


    The intrinsic stochasticity of gene expression can lead to large variations in protein levels across a population of cells. To explain this variability, different sources of mRNA fluctuations ('Poisson' and 'Telegraph' processes) have been proposed in stochastic models of gene expression. Both Poisson and Telegraph scenario models explain experimental observations of noise in protein levels in terms of 'bursts' of protein expression. Correspondingly, there is considerable interest in establishing relations between burst and steady-state protein distributions for general stochastic models of gene expression. In this work, we address this issue by considering a mapping between stochastic models of gene expression and problems of interest in queueing theory. By applying a general theorem from queueing theory, Little's Law, we derive exact relations which connect burst and steady-state distribution means for models with arbitrary waiting-time distributions for arrival and degradation of mRNAs and proteins. The de...

  7. Lab-specific gene expression signatures in pluripotent stem cells. (United States)

    Newman, Aaron M; Cooper, James B


    Pluripotent stem cells derived from both embryonic and reprogrammed somatic cells have significant potential for human regenerative medicine. Despite similarities in developmental potential, however, several groups have found fundamental differences between embryonic stem cell (ESC) and induced-pluripotent stem cell (iPSC) lines that may have important implications for iPSC-based medical therapies. Using an unsupervised clustering algorithm, we further studied the genetic homogeneity of iPSC and ESC lines by reanalyzing microarray gene expression data from seven different laboratories. Unexpectedly, this analysis revealed a strong correlation between gene expression signatures and specific laboratories in both ESC and iPSC lines. Nearly one-third of the genes with lab-specific expression signatures are also differentially expressed between ESCs and iPSCs. These data are consistent with the hypothesis that in vitro microenvironmental context differentially impacts the gene expression signatures of both iPSCs and ESCs.

  8. Novel redox nanomedicine improves gene expression of polyion complex vector (United States)

    Toh, Kazuko; Yoshitomi, Toru; Ikeda, Yutaka; Nagasaki, Yukio


    Gene therapy has generated worldwide attention as a new medical technology. While non-viral gene vectors are promising candidates as gene carriers, they have several issues such as toxicity and low transfection efficiency. We have hypothesized that the generation of reactive oxygen species (ROS) affects gene expression in polyplex supported gene delivery systems. The effect of ROS on the gene expression of polyplex was evaluated using a nitroxide radical-containing nanoparticle (RNP) as an ROS scavenger. When polyethyleneimine (PEI)/pGL3 or PEI alone was added to the HeLa cells, ROS levels increased significantly. In contrast, when (PEI)/pGL3 or PEI was added with RNP, the ROS levels were suppressed. The luciferase expression was increased by the treatment with RNP in a dose-dependent manner and the cellular uptake of pDNA was also increased. Inflammatory cytokines play an important role in ROS generation in vivo. In particular, tumor necrosis factor (TNF)-α caused intracellular ROS generation in HeLa cells and decreased gene expression. RNP treatment suppressed ROS production even in the presence of TNF-α and increased gene expression. This anti-inflammatory property of RNP suggests that it may be used as an effective adjuvant for non-viral gene delivery systems.

  9. Developmental expression of homeobox genes in the ctenophore Mnemiopsis leidyi. (United States)

    Pang, Kevin; Martindale, Mark Q


    Homeobox genes are a large family of genes that encode helix-turn-helix transcription factors that play fundamental roles in such developmental processes including body axis formation and cell specification. They have been found in a wide variety of organisms, from fungi to plants and animals, with some classes being specific to the Metazoa. While it was once thought that organismal complexity was tied to gene complexity, sequencing of genomes from a cnidarian, poriferan, and placozoan have shown no clear correlation. However, little attention has been paid to ctenophores, another early branching taxon. Ctenophores are mostly pelagic marine animals, with complex morphological features, so understanding the gene content and expression of this nonbilaterian phylum is of key interest to evolutionary biology. Expression information from developmental genes in ctenophores is sparse. In this study, we isolated seven homeobox genes from the ctenophore Mnemiopsis leidyi and examined their expression through development. Phylogenetic analyses of these genes placed four in the ANTP class and three in the PRD class. These are the first reported full-length PRD class genes, although our analyses could not place them into specific families. We have found that most of these homeobox genes begin expression at gastrulation, and their expression patterns suggest a possible role in patterning of the tentacle apparati and pharynx.

  10. Novel redox nanomedicine improves gene expression of polyion complex vector

    Directory of Open Access Journals (Sweden)

    Kazuko Toh, Toru Yoshitomi, Yutaka Ikeda and Yukio Nagasaki


    Full Text Available Gene therapy has generated worldwide attention as a new medical technology. While non-viral gene vectors are promising candidates as gene carriers, they have several issues such as toxicity and low transfection efficiency. We have hypothesized that the generation of reactive oxygen species (ROS affects gene expression in polyplex supported gene delivery systems. The effect of ROS on the gene expression of polyplex was evaluated using a nitroxide radical-containing nanoparticle (RNP as an ROS scavenger. When polyethyleneimine (PEI/pGL3 or PEI alone was added to the HeLa cells, ROS levels increased significantly. In contrast, when (PEI/pGL3 or PEI was added with RNP, the ROS levels were suppressed. The luciferase expression was increased by the treatment with RNP in a dose-dependent manner and the cellular uptake of pDNA was also increased. Inflammatory cytokines play an important role in ROS generation in vivo. In particular, tumor necrosis factor (TNF-α caused intracellular ROS generation in HeLa cells and decreased gene expression. RNP treatment suppressed ROS production even in the presence of TNF-α and increased gene expression. This anti-inflammatory property of RNP suggests that it may be used as an effective adjuvant for non-viral gene delivery systems.

  11. Biasogram: visualization of confounding technical bias in gene expression data

    DEFF Research Database (Denmark)

    Krzystanek, Marcin; Szallasi, Zoltan Imre; Eklund, Aron Charles


    Gene expression profiles of clinical cohorts can be used to identify genes that are correlated with a clinical variable of interest such as patient outcome or response to a particular drug. However, expression measurements are susceptible to technical bias caused by variation in extraneous factors...... such as RNA quality and array hybridization conditions. If such technical bias is correlated with the clinical variable of interest, the likelihood of identifying false positive genes is increased. Here we describe a method to visualize an expression matrix as a projection of all genes onto a plane defined...... by a clinical variable and a technical nuisance variable. The resulting plot indicates the extent to which each gene is correlated with the clinical variable or the technical variable. We demonstrate this method by applying it to three clinical trial microarray data sets, one of which identified genes that may...

  12. Flies selected for longevity retain a young gene expression profile

    DEFF Research Database (Denmark)

    Sarup, Pernille Merete; Sørensen, Peter; Loeschcke, Volker


    differentially expressed between selected and control flies when measured at the same chronological age. The longevity-selected flies consistently showed expression profiles more similar to control flies one age class younger than control flies of the same age. This finding is in accordance with a younger gene...... the physiological age as the level of cumulative mortality. Eighty-four genes were differentially expressed between the control and longevity-selected lines at the same physiological age, and the overlap between the same chronological and physiological age gene lists included 40 candidate genes for increased...... longevity. Among these candidates were genes with roles in starvation resistance, immune response regulation, and several that have not yet been linked to longevity. Investigating these genes would provide new knowledge of the pathways that affect life span in invertebrates and, potentially, mammals....

  13. Spatial gene expression quantification in changing morphologies

    NARCIS (Netherlands)

    Botman, D.


    In systems biology, an organisms’ behavior is explained from the interactions among individual components such as genes and proteins. With few exceptions, interactions among genes and proteins are not measured directly and are therefore inferred from the observed output of a biological system. A net

  14. The gsdf gene locus harbors evolutionary conserved and clustered genes preferentially expressed in fish previtellogenic oocytes. (United States)

    Gautier, Aude; Le Gac, Florence; Lareyre, Jean-Jacques


    The gonadal soma-derived factor (GSDF) belongs to the transforming growth factor-β superfamily and is conserved in teleostean fish species. Gsdf is specifically expressed in the gonads, and gene expression is restricted to the granulosa and Sertoli cells in trout and medaka. The gsdf gene expression is correlated to early testis differentiation in medaka and was shown to stimulate primordial germ cell and spermatogonia proliferation in trout. In the present study, we show that the gsdf gene localizes to a syntenic chromosomal fragment conserved among vertebrates although no gsdf-related gene is detected on the corresponding genomic region in tetrapods. We demonstrate using quantitative RT-PCR that most of the genes localized in the synteny are specifically expressed in medaka gonads. Gsdf is the only gene of the synteny with a much higher expression in the testis compared to the ovary. In contrast, gene expression pattern analysis of the gsdf surrounding genes (nup54, aff1, klhl8, sdad1, and ptpn13) indicates that these genes are preferentially expressed in the female gonads. The tissue distribution of these genes is highly similar in medaka and zebrafish, two teleostean species that have diverged more than 110 million years ago. The cellular localization of these genes was determined in medaka gonads using the whole-mount in situ hybridization technique. We confirm that gsdf gene expression is restricted to Sertoli and granulosa cells in contact with the premeiotic and meiotic cells. The nup54 gene is expressed in spermatocytes and previtellogenic oocytes. Transcripts corresponding to the ovary-specific genes (aff1, klhl8, and sdad1) are detected only in previtellogenic oocytes. No expression was detected in the gonocytes in 10 dpf embryos. In conclusion, we show that the gsdf gene localizes to a syntenic chromosomal fragment harboring evolutionary conserved genes in vertebrates. These genes are preferentially expressed in previtelloogenic oocytes, and thus, they

  15. Gene expression profiling reveals multiple toxicity endpoints induced by hepatotoxicants

    Energy Technology Data Exchange (ETDEWEB)

    Huang Qihong; Jin Xidong; Gaillard, Elias T.; Knight, Brian L.; Pack, Franklin D.; Stoltz, James H.; Jayadev, Supriya; Blanchard, Kerry T


    Microarray technology continues to gain increased acceptance in the drug development process, particularly at the stage of toxicology and safety assessment. In the current study, microarrays were used to investigate gene expression changes associated with hepatotoxicity, the most commonly reported clinical liability with pharmaceutical agents. Acetaminophen, methotrexate, methapyrilene, furan and phenytoin were used as benchmark compounds capable of inducing specific but different types of hepatotoxicity. The goal of the work was to define gene expression profiles capable of distinguishing the different subtypes of hepatotoxicity. Sprague-Dawley rats were orally dosed with acetaminophen (single dose, 4500 mg/kg for 6, 24 and 72 h), methotrexate (1 mg/kg per day for 1, 7 and 14 days), methapyrilene (100 mg/kg per day for 3 and 7 days), furan (40 mg/kg per day for 1, 3, 7 and 14 days) or phenytoin (300 mg/kg per day for 14 days). Hepatic gene expression was assessed using toxicology-specific gene arrays containing 684 target genes or expressed sequence tags (ESTs). Principal component analysis (PCA) of gene expression data was able to provide a clear distinction of each compound, suggesting that gene expression data can be used to discern different hepatotoxic agents and toxicity endpoints. Gene expression data were applied to the multiplicity-adjusted permutation test and significantly changed genes were categorized and correlated to hepatotoxic endpoints. Repression of enzymes involved in lipid oxidation (acyl-CoA dehydrogenase, medium chain, enoyl CoA hydratase, very long-chain acyl-CoA synthetase) were associated with microvesicular lipidosis. Likewise, subsets of genes associated with hepatotocellular necrosis, inflammation, hepatitis, bile duct hyperplasia and fibrosis have been identified. The current study illustrates that expression profiling can be used to: (1) distinguish different hepatotoxic endpoints; (2) predict the development of toxic endpoints; and

  16. Molecular subsets in the gene expression signatures of scleroderma skin.

    Directory of Open Access Journals (Sweden)

    Ausra Milano

    Full Text Available BACKGROUND: Scleroderma is a clinically heterogeneous disease with a complex phenotype. The disease is characterized by vascular dysfunction, tissue fibrosis, internal organ dysfunction, and immune dysfunction resulting in autoantibody production. METHODOLOGY AND FINDINGS: We analyzed the genome-wide patterns of gene expression with DNA microarrays in skin biopsies from distinct scleroderma subsets including 17 patients with systemic sclerosis (SSc with diffuse scleroderma (dSSc, 7 patients with SSc with limited scleroderma (lSSc, 3 patients with morphea, and 6 healthy controls. 61 skin biopsies were analyzed in a total of 75 microarray hybridizations. Analysis by hierarchical clustering demonstrates nearly identical patterns of gene expression in 17 out of 22 of the forearm and back skin pairs of SSc patients. Using this property of the gene expression, we selected a set of 'intrinsic' genes and analyzed the inherent data-driven groupings. Distinct patterns of gene expression separate patients with dSSc from those with lSSc and both are easily distinguished from normal controls. Our data show three distinct patient groups among the patients with dSSc and two groups among patients with lSSc. Each group can be distinguished by unique gene expression signatures indicative of proliferating cells, immune infiltrates and a fibrotic program. The intrinsic groups are statistically significant (p<0.001 and each has been mapped to clinical covariates of modified Rodnan skin score, interstitial lung disease, gastrointestinal involvement, digital ulcers, Raynaud's phenomenon and disease duration. We report a 177-gene signature that is associated with severity of skin disease in dSSc. CONCLUSIONS AND SIGNIFICANCE: Genome-wide gene expression profiling of skin biopsies demonstrates that the heterogeneity in scleroderma can be measured quantitatively with DNA microarrays. The diversity in gene expression demonstrates multiple distinct gene expression programs

  17. Gastrin gene expression and regulation in rat islet cell lines. (United States)

    Brand, S J; Wang, T C


    Gastrin gene expression was observed in two permanent rat insulinoma (RIN) cell lines derived from a rat insulinoma. Gastrin expression was selective; highest expression was seen in a cell line which did not express other islet cell hormones. Gastrin mRNA transcription initiated from the same promoter as antral gastrin mRNA. DNA transfection studies with a gastrin chloramphenicol acetyltransferase chimeric gene showed higher expression in gastrin-expressing RIN cells than non-gastrin-expressing islet cells. This implies that gastrin-expressing RIN cells selectively express a trans-acting transcriptional activator which binds to cis-acting regulatory sequences within the 5'-flanking DNA sequence and first exon of the gastrin gene. The gastrin peptide precursor synthesized in these RIN cell lines is subject to the same repertoire of posttranslational modifications within the cell's secretory apparatus (endoproteolytic cleavage, tyrosine sulfation, and C-terminal amidation) as seen in antral G cells. Gastrin mRNA levels in these RIN cells were selectively increased by increasing the extracellular calcium concentration. Membrane depolarization also stimulated gastrin mRNA levels, probably through activation of voltage-sensitive calcium channels. Thus, these gastrin-expressing RIN cell lines provide permanent cell lines useful in analyzing the cellular regulation of gastrin gene expression.

  18. Gene Expression Profiling of Clostridium botulinum under Heat Shock Stress

    Directory of Open Access Journals (Sweden)

    Wan-dong Liang


    Full Text Available During growth, C. botulinum is always exposed to different environmental changes, such as temperature increase, nutrient deprivation, and pH change; however, its corresponding global transcriptional profile is uncharacterized. This study is the first description of the genome-wide gene expression profile of C. botulinum in response to heat shock stress. Under heat stress (temperature shift from 37°C to 45°C over a period of 15 min, 176 C. botulinum ATCC 3502 genes were differentially expressed. The response included overexpression of heat shock protein genes (dnaK operon, groESL, hsp20, and htpG and downregulation of aminoacyl-tRNA synthetase genes (valS, queA, tyrR, and gatAB and ribosomal and cell division protein genes (ftsZ and ftsH. In parallel, several transcriptional regulators (marR, merR, and ompR families were induced, suggesting their involvement in reshuffling of the gene expression profile. In addition, many ABC transporters (oligopeptide transport system, energy production and conversion related genes (glpA and hupL, cell wall and membrane biogenesis related genes (fabZ, fabF, and fabG, flagella-associated genes (flhA, flhM, flhJ, flhS, and motAB, and hypothetical genes also showed changed expression patterns, indicating that they may play important roles in survival under high temperatures.

  19. Complexity of Gene Expression Evolution after Duplication: Protein Dosage Rebalancing

    Directory of Open Access Journals (Sweden)

    Igor B. Rogozin


    Full Text Available Ongoing debates about functional importance of gene duplications have been recently intensified by a heated discussion of the “ortholog conjecture” (OC. Under the OC, which is central to functional annotation of genomes, orthologous genes are functionally more similar than paralogous genes at the same level of sequence divergence. However, a recent study challenged the OC by reporting a greater functional similarity, in terms of gene ontology (GO annotations and expression profiles, among within-species paralogs compared to orthologs. These findings were taken to indicate that functional similarity of homologous genes is primarily determined by the cellular context of the genes, rather than evolutionary history. Subsequent studies suggested that the OC appears to be generally valid when applied to mammalian evolution but the complete picture of evolution of gene expression also has to incorporate lineage-specific aspects of paralogy. The observed complexity of gene expression evolution after duplication can be explained through selection for gene dosage effect combined with the duplication-degeneration-complementation model. This paper discusses expression divergence of recent duplications occurring before functional divergence of proteins encoded by duplicate genes.

  20. Transposable element influences on gene expression in plants. (United States)

    Hirsch, Cory D; Springer, Nathan M


    Transposable elements (TEs) comprise a major portion of many plant genomes and bursts of TE movements cause novel genomic variation within species. In order to maintain proper gene function, plant genomes have evolved a variety of mechanisms to tolerate the presence of TEs within or near genes. Here, we review our understanding of the interactions between TEs and gene expression in plants by assessing three ways that transposons can influence gene expression. First, there is growing evidence that TE insertions within introns or untranslated regions of genes are often tolerated and have minimal impact on expression level or splicing. However, there are examples in which TE insertions within genes can result in aberrant or novel transcripts. Second, TEs can provide novel alternative promoters, which can lead to new expression patterns or original coding potential of an alternate transcript. Third, TE insertions near genes can influence regulation of gene expression through a variety of mechanisms. For example, TEs may provide novel cis-acting regulatory sites behaving as enhancers or insert within existing enhancers to influence transcript production. Alternatively, TEs may change chromatin modifications in regions near genes, which in turn can influence gene expression levels. Together, the interactions of genes and TEs provide abundant evidence for the role of TEs in changing basic functions within plant genomes beyond acting as latent genomic elements or as simple insertional mutagens. This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Design and Implementation of Visual Dynamic Display Software of Gene Expression Based on GTK

    Institute of Scientific and Technical Information of China (English)

    JIANG Wei; MENG Fanjiang; LI Yong; YU Xiao


    The paper presented an implement method for a dynamic gene expression display software based on the GTK. This method established the dynamic presentation system of gene expression which according to gene expression data from gene chip hybridize at different time, adopted a linearity combination model and Pearson correlation coefficient algorithm. The system described the gene expression changes in graphic form, the gene expression changes with time and the changes in characteristics of the gene expression, also the changes in relations of the gene expression and regulation relationships among genes. The system also provided an integrated platform for analysis on gene chips data, especially for the research on the network of gene regulation.

  2. Fingerprints in Compressed Strings

    DEFF Research Database (Denmark)

    Bille, Philip; Cording, Patrick Hagge; Gørtz, Inge Li


    The Karp-Rabin fingerprint of a string is a type of hash value that due to its strong properties has been used in many string algorithms. In this paper we show how to construct a data structure for a string S of size N compressed by a context-free grammar of size n that answers fingerprint queries...

  3. Photogrammetric fingerprint unwrapping (United States)

    Paar, Gerhard; del Pilar Caballo Perucha, Maria; Bauer, Arnold; Nauschnegg, Bernhard


    Fingerprints are important biometric cues. Compared to conventional fingerprint sensors the use of contact-free stereoscopic image acquisition of the front-most finger segment has a set of advantages: Finger deformation is avoided, the entire relevant area for biometric use is covered, some technical aspects like sensor maintenance and cleaning are facilitated, and access to a three-dimensional reconstruction of the covered area is possible. We describe a photogrammetric workflow for nail-to-nail fingerprint reconstruction: A calibrated sensor setup with typically 5 cameras and dedicated illumination acquires adjacent stereo pairs. Using the silhouettes of the segmented finger a raw cylindrical model is generated. After preprocessing (shading correction, dust removal, lens distortion correction), each individual camera texture is projected onto the model. Image-to-image matching on these pseudo ortho images and dense 3D reconstruction obtains a textured cylindrical digital surface model with radial distances around the major axis and a grid size in the range of 25-50 µm. The model allows for objective fingerprint unwrapping and novel fingerprint matching algorithms since 3D relations between fingerprint features are available as additional cues. Moreover, covering the entire region with relevant fingerprint texture is particularly important for establishing a comprehensive forensic database. The workflow has been implemented in portable C and is ready for industrial exploitation. Further improvement issues are code optimization, unwrapping method, illumination strategy to avoid highlights and to improve the initial segmentation, and the comparison of the unwrapping result to conventional fingerprint acquisition technology.

  4. In plants, expression breadth and expression level distinctly and non-linearly correlate with gene structure

    Directory of Open Access Journals (Sweden)

    Yang Hangxing


    Full Text Available Abstract Background Compactness of highly/broadly expressed genes in human has been explained as selection for efficiency, regional mutation biases or genomic design. However, highly expressed genes in flowering plants were shown to be less compact than lowly expressed ones. On the other hand, opposite facts have also been documented that pollen-expressed Arabidopsis genes tend to contain shorter introns and highly expressed moss genes are compact. This issue is important because it provides a chance to compare the selectionism and the neutralism views about genome evolution. Furthermore, this issue also helps to understand the fates of introns, from the angle of gene expression. Results In this study, I used expression data covering more tissues and employ new analytical methods to reexamine the correlations between gene expression and gene structure for two flowering plants, Arabidopsis thaliana and Oryza sativa. It is shown that, different aspects of expression pattern correlate with different parts of gene sequences in distinct ways. In detail, expression level is significantly negatively correlated with gene size, especially the size of non-coding regions, whereas expression breadth correlates with non-coding structural parameters positively and with coding region parameters negatively. Furthermore, the relationships between expression level and structural parameters seem to be non-linear, with the extremes of structural parameters possibly scale as power-laws or logrithmic functions of expression levels. Conclusion In plants, highly expressed genes are compact, especially in the non-coding regions. Broadly expressed genes tend to contain longer non-coding sequences, which may be necessary for complex regulations. In combination with previous studies about other plants and about animals, some common scenarios about the correlation between gene expression and gene structure begin to emerge. Based on the functional relationships between

  5. State-related alterations of gene expression in bipolar disorder

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Vinberg, Maj; Berk, Michael


    Munkholm K, Vinberg M, Berk M, Kessing LV. State-related alterations of gene expression in bipolar disorder: a systematic review. Bipolar Disord 2012: 14: 684-696. © 2012 The Authors. Journal compilation © 2012 John Wiley & Sons A/S. Objective:  Alterations in gene expression in bipolar disorder...... on comprehensive database searches for studies on gene expression in patients with bipolar disorder in specific mood states, was conducted. We searched Medline, Embase, PsycINFO, and The Cochrane Library, supplemented by manually searching reference lists from retrieved publications. Results:  A total of 17...

  6. Frequencies of virulence genes and pulse field gel electrophoresis fingerprints in Escherichia coli isolates from canine pyometra. (United States)

    Maluta, Renato P; Borges, Clarissa A; Beraldo, Lívia G; Cardozo, Marita V; Voorwald, Fabiana A; Santana, André M; Rigobelo, Everlon C; Toniollo, Gilson H; Avila, Fernando A


    Escherichia coli is the most common bacterial agent isolated from canine pyometra. The frequencies of 24 virulence genes and pulsed field gel electrophoresis (PFGE) profiles were determined for 23 E. coli isolates from cases of canine pyometra in Brazil. The frequencies of virulence genes were 91.3% fimH, 91.3% irp-2, 82.6% fyuA, 56.5% iroN, 47.8% traT, 39.1% usp, 34.8% sfaD/E, 34.8% tsh, 30.4% papC, 30.4% hlyA, 26.1% papGIII, 26.1% cnf-1, 21.7% papE/F, 21.7% iss, 17.4% iutA, 17.4% ompT, 17.4% cvaC, 17.4% hlyF, 17.4% iucD, 13.0% iucC, 13.0% astA, 4.3% papGII, 0% afaB/C and 0% papGI. The high frequency of yersiniabactin (fyuA and irp2) and salmochelin (iroN) genes suggests that iron uptake systems might be important in the pathogenesis of canine pyometra. PFGE profiles of 19 isolates were heterogeneous, confirming that E. coli isolates from canine pyometra are unlikely to be epidemic clones.

  7. A longitudinal study of gene expression in healthy individuals

    Directory of Open Access Journals (Sweden)

    Tessier Michel


    Full Text Available Abstract Background The use of gene expression in venous blood either as a pharmacodynamic marker in clinical trials of drugs or as a diagnostic test requires knowledge of the variability in expression over time in healthy volunteers. Here we defined a normal range of gene expression over 6 months in the blood of four cohorts of healthy men and women who were stratified by age (22–55 years and > 55 years and gender. Methods Eleven immunomodulatory genes likely to play important roles in inflammatory conditions such as rheumatoid arthritis and infection in addition to four genes typically used as reference genes were examined by quantitative reverse transcription-polymerase chain reaction (qRT-PCR, as well as the full genome as represented by Affymetrix HG U133 Plus 2.0 microarrays. Results Gene expression levels as assessed by qRT-PCR and microarray were relatively stable over time with ~2% of genes as measured by microarray showing intra-subject differences over time periods longer than one month. Fifteen genes varied by gender. The eleven genes examined by qRT-PCR remained within a limited dynamic range for all individuals. Specifically, for the seven most stably expressed genes (CXCL1, HMOX1, IL1RN, IL1B, IL6R, PTGS2, and TNF, 95% of all samples profiled fell within 1.5–2.5 Ct, the equivalent of a 4- to 6-fold dynamic range. Two subjects who experienced severe adverse events of cancer and anemia, had microarray gene expression profiles that were distinct from normal while subjects who experienced an infection had only slightly elevated levels of inflammatory markers. Conclusion This study defines the range and variability of gene expression in healthy men and women over a six-month period. These parameters can be used to estimate the number of subjects needed to observe significant differences from normal gene expression in clinical studies. A set of genes that varied by gender was also identified as were a set of genes with elevated

  8. A longitudinal study of gene expression in healthy individuals. (United States)

    Karlovich, Chris; Duchateau-Nguyen, Guillemette; Johnson, Andrea; McLoughlin, Patricia; Navarro, Mercidita; Fleurbaey, Carole; Steiner, Lori; Tessier, Michel; Nguyen, Tracy; Wilhelm-Seiler, Monika; Caulfield, John P


    The use of gene expression in venous blood either as a pharmacodynamic marker in clinical trials of drugs or as a diagnostic test requires knowledge of the variability in expression over time in healthy volunteers. Here we defined a normal range of gene expression over 6 months in the blood of four cohorts of healthy men and women who were stratified by age (22-55 years and > 55 years) and gender. Eleven immunomodulatory genes likely to play important roles in inflammatory conditions such as rheumatoid arthritis and infection in addition to four genes typically used as reference genes were examined by quantitative reverse transcription-polymerase chain reaction (qRT-PCR), as well as the full genome as represented by Affymetrix HG U133 Plus 2.0 microarrays. Gene expression levels as assessed by qRT-PCR and microarray were relatively stable over time with approximately 2% of genes as measured by microarray showing intra-subject differences over time periods longer than one month. Fifteen genes varied by gender. The eleven genes examined by qRT-PCR remained within a limited dynamic range for all individuals. Specifically, for the seven most stably expressed genes (CXCL1, HMOX1, IL1RN, IL1B, IL6R, PTGS2, and TNF), 95% of all samples profiled fell within 1.5-2.5 Ct, the equivalent of a 4- to 6-fold dynamic range. Two subjects who experienced severe adverse events of cancer and anemia, had microarray gene expression profiles that were distinct from normal while subjects who experienced an infection had only slightly elevated levels of inflammatory markers. This study defines the range and variability of gene expression in healthy men and women over a six-month period. These parameters can be used to estimate the number of subjects needed to observe significant differences from normal gene expression in clinical studies. A set of genes that varied by gender was also identified as were a set of genes with elevated expression in a subject with iron deficiency anemia and

  9. Exploring valid reference genes for gene expression studies in Brachypodium distachyon by real-time PCR

    Directory of Open Access Journals (Sweden)

    Xiang Fengning


    Full Text Available Abstract Background The wild grass species Brachypodium distachyon (Brachypodium hereafter is emerging as a new model system for grass crop genomics research and biofuel grass biology. A draft nuclear genome sequence is expected to be publicly available in the near future; an explosion of gene expression studies will undoubtedly follow. Therefore, stable reference genes are necessary to normalize the gene expression data. Results A systematic exploration of suitable reference genes in Brachypodium is presented here. Nine reference gene candidates were chosen, and their gene sequences were obtained from the Brachypodium expressed sequence tag (EST databases. Their expression levels were examined by quantitative real-time PCR (qRT-PCR using 21 different Brachypodium plant samples, including those from different plant tissues and grown under various growth conditions. Effects of plant growth hormones were also visualized in the assays. The expression stability of the candidate genes was evaluated using two analysis software packages, geNorm and NormFinder. In conclusion, the ubiquitin-conjugating enzyme 18 gene (UBC18 was validated as a suitable reference gene across all the plant samples examined. While the expression of the polyubiquitin genes (Ubi4 and Ubi10 was most stable in different plant tissues and growth hormone-treated plant samples, the expression of the S-adenosylmethionine decarboxylase gene (SamDC ranked was most stable in plants grown under various environmental stresses. Conclusion This study identified the reference genes that are most suitable for normalizing the gene expression data in Brachypodium. These reference genes will be particularly useful when stress-responsive genes are analyzed in order to produce transgenic plants that exhibit enhanced stress resistance.

  10. Control of alphavirus-based gene expression using engineered riboswitches. (United States)

    Bell, Christie L; Yu, Dong; Smolke, Christina D; Geall, Andrew J; Beard, Clayton W; Mason, Peter W


    Alphavirus-based replicons are a promising nucleic acid vaccine platform characterized by robust gene expression and immune responses. To further explore their use in vaccination, replicons were engineered to allow conditional control over their gene expression. Riboswitches, comprising a ribozyme actuator and RNA aptamer sensor, were engineered into the replicon 3' UTR. Binding of ligand to aptamer modulates ribozyme activity and, therefore, gene expression. Expression from DNA-launched and VRP-packaged replicons containing riboswitches was successfully regulated, achieving a 47-fold change in expression and modulation of the resulting type I interferon response. Moreover, we developed a novel control architecture where riboswitches were integrated into the 3' and 5' UTR of the subgenomic RNA region of the TC-83 virus, leading to an 1160-fold regulation of viral replication. Our studies demonstrate that the use of riboswitches for control of RNA replicon expression and viral replication holds promise for development of novel and safer vaccination strategies.

  11. The Role of Nuclear Bodies in Gene Expression and Disease (United States)

    Morimoto, Marie; Boerkoel, Cornelius F.


    This review summarizes the current understanding of the role of nuclear bodies in regulating gene expression. The compartmentalization of cellular processes, such as ribosome biogenesis, RNA processing, cellular response to stress, transcription, modification and assembly of spliceosomal snRNPs, histone gene synthesis and nuclear RNA retention, has significant implications for gene regulation. These functional nuclear domains include the nucleolus, nuclear speckle, nuclear stress body, transcription factory, Cajal body, Gemini of Cajal body, histone locus body and paraspeckle. We herein review the roles of nuclear bodies in regulating gene expression and their relation to human health and disease. PMID:24040563

  12. Scaling of Gene Expression with Transcription-Factor Fugacity (United States)

    Weinert, Franz M.; Brewster, Robert C.; Rydenfelt, Mattias; Phillips, Rob; Kegel, Willem K.


    The proteins associated with gene regulation are often shared between multiple pathways simultaneously. By way of contrast, models in regulatory biology often assume these pathways act independently. We demonstrate a framework for calculating the change in gene expression for the interacting case by decoupling repressor occupancy across the cell from the gene of interest by way of a chemical potential. The details of the interacting regulatory architecture are encompassed in an effective concentration, and thus, a single scaling function describes a collection of gene expression data from diverse regulatory situations and collapses it onto a single master curve. PMID:25554908

  13. Integration of biological networks and gene expression data using Cytoscape

    DEFF Research Database (Denmark)

    Cline, M.S.; Smoot, M.; Cerami, E.


    Cytoscape is a free software package for visualizing, modeling and analyzing molecular and genetic interaction networks. This protocol explains how to use Cytoscape to analyze the results of mRNA expression profiling, and other functional genomics and proteomics experiments, in the context of an ...... and (v) identifying enriched Gene Ontology annotations in the network. These steps provide a broad sample of the types of analyses performed by Cytoscape....... of an interaction network obtained for genes of interest. Five major steps are described: (i) obtaining a gene or protein network, (ii) displaying the network using layout algorithms, (iii) integrating with gene expression and other functional attributes, (iv) identifying putative complexes and functional modules...

  14. Prediction of Tumor Outcome Based on Gene Expression Data

    Institute of Scientific and Technical Information of China (English)

    Liu Juan; Hitoshi Iba


    Gene expression microarray data can be used to classify tumor types. We proposed a new procedure to classify human tumor samples based on microarray gene expressions by using a hybrid supervised learning method called MOEA+WV (Multi-Objective Evolutionary Algorithm+Weighted Voting). MOEA is used to search for a relatively few subsets of informative genes from the high-dimensional gene space, and WV is used as a classification tool. This new method has been applied to predicate the subtypes of lymphoma and outcomes of medulloblastoma. The results are relatively accurate and meaningful compared to those from other methods.

  15. The Role of Nuclear Bodies in Gene Expression and Disease

    Directory of Open Access Journals (Sweden)

    Marie Morimoto


    Full Text Available This review summarizes the current understanding of the role of nuclear bodies in regulating gene expression. The compartmentalization of cellular processes, such as ribosome biogenesis, RNA processing, cellular response to stress, transcription, modification and assembly of spliceosomal snRNPs, histone gene synthesis and nuclear RNA retention, has significant implications for gene regulation. These functional nuclear domains include the nucleolus, nuclear speckle, nuclear stress body, transcription factory, Cajal body, Gemini of Cajal body, histone locus body and paraspeckle. We herein review the roles of nuclear bodies in regulating gene expression and their relation to human health and disease.

  16. Scaling of gene expression with transcription-factor fugacity. (United States)

    Weinert, Franz M; Brewster, Robert C; Rydenfelt, Mattias; Phillips, Rob; Kegel, Willem K


    The proteins associated with gene regulation are often shared between multiple pathways simultaneously. By way of contrast, models in regulatory biology often assume these pathways act independently. We demonstrate a framework for calculating the change in gene expression for the interacting case by decoupling repressor occupancy across the cell from the gene of interest by way of a chemical potential. The details of the interacting regulatory architecture are encompassed in an effective concentration, and thus, a single scaling function describes a collection of gene expression data from diverse regulatory situations and collapses it onto a single master curve.

  17. Gene Expression Network Reconstruction by LEP Method Using Microarray Data

    Directory of Open Access Journals (Sweden)

    Na You


    Full Text Available Gene expression network reconstruction using microarray data is widely studied aiming to investigate the behavior of a gene cluster simultaneously. Under the Gaussian assumption, the conditional dependence between genes in the network is fully described by the partial correlation coefficient matrix. Due to the high dimensionality and sparsity, we utilize the LEP method to estimate it in this paper. Compared to the existing methods, the LEP reaches the highest PPV with the sensitivity controlled at the satisfactory level. A set of gene expression data from the HapMap project is analyzed for illustration.

  18. Reference genes for gene expression studies in wheat flag leaves grown under different farming conditions

    Directory of Open Access Journals (Sweden)

    Cordeiro Raposo Fernando


    Full Text Available Abstract Background Internal control genes with highly uniform expression throughout the experimental conditions are required for accurate gene expression analysis as no universal reference genes exists. In this study, the expression stability of 24 candidate genes from Triticum aestivum cv. Cubus flag leaves grown under organic and conventional farming systems was evaluated in two locations in order to select suitable genes that can be used for normalization of real-time quantitative reverse-transcription PCR (RT-qPCR reactions. The genes were selected among the most common used reference genes as well as genes encoding proteins involved in several metabolic pathways. Findings Individual genes displayed different expression rates across all samples assayed. Applying geNorm, a set of three potential reference genes were suitable for normalization of RT-qPCR reactions in winter wheat flag leaves cv. Cubus: TaFNRII (ferredoxin-NADP(H oxidoreductase; AJ457980.1, ACT2 (actin 2; TC234027, and rrn26 (a putative homologue to RNA 26S gene; AL827977.1. In addition of these three genes that were also top-ranked by NormFinder, two extra genes: CYP18-2 (Cyclophilin A, AY456122.1 and TaWIN1 (14-3-3 like protein, AB042193 were most consistently stably expressed. Furthermore, we showed that TaFNRII, ACT2, and CYP18-2 are suitable for gene expression normalization in other two winter wheat varieties (Tommi and Centenaire grown under three treatments (organic, conventional and no nitrogen and a different environment than the one tested with cv. Cubus. Conclusions This study provides a new set of reference genes which should improve the accuracy of gene expression analyses when using wheat flag leaves as those related to the improvement of nitrogen use efficiency for cereal production.

  19. Simultaneous tracking of fly movement and gene expression using GFP

    Directory of Open Access Journals (Sweden)

    Tavaré Simon


    Full Text Available Abstract Background Green Fluorescent Protein (GFP is used extensively as a reporter for transgene expression in Drosophila and other organisms. However, GFP has not generally been used as a reporter for circadian patterns of gene expression, and it has not previously been possible to correlate patterns of reporter expression with 3D movement and behavior of transgenic animals. Results We present a video tracking system that allows tissue-specific GFP expression to be quantified and correlated with 3D animal movement in real time. eyeless/Pax6 reporter expression had a 12 hr period that correlated with fly activity levels. hsp70 and hsp22 gene reporters were induced during fly aging in circadian patterns (24 hr and 18 hr periods, respectively, and spiked in the hours preceding and overlapping the death of the animal. The phase of hsp gene reporter expression relative to fly activity levels was different for each fly, and remained the same throughout the life span. Conclusion These experiments demonstrate that GFP can readily be used to assay longitudinally fly movement and tissue-specific patterns of gene expression. The hsp22-GFP and hsp70-GFP expression patterns were found to reflect accurately the endogenous gene expression patterns, including induction during aging and circadian periodicity. The combination of these new tracking methods with the hsp-GFP reporters revealed additional information, including a spike in hsp22 and hsp70 reporter expression preceding death, and an intriguing fly-to-fly variability in the phase of hsp70 and hsp22 reporter expression patterns. These methods allow specific temporal patterns of gene expression to be correlated with temporal patterns of animal activity, behavior and mortality.

  20. Identification of Reference Genes in Human Myelomonocytic Cells for Gene Expression Studies in Altered Gravity

    Directory of Open Access Journals (Sweden)

    Cora S. Thiel


    Full Text Available Gene expression studies are indispensable for investigation and elucidation of molecular mechanisms. For the process of normalization, reference genes (“housekeeping genes” are essential to verify gene expression analysis. Thus, it is assumed that these reference genes demonstrate similar expression levels over all experimental conditions. However, common recommendations about reference genes were established during 1 g conditions and therefore their applicability in studies with altered gravity has not been demonstrated yet. The microarray technology is frequently used to generate expression profiles under defined conditions and to determine the relative difference in expression levels between two or more different states. In our study, we searched for potential reference genes with stable expression during different gravitational conditions (microgravity, normogravity, and hypergravity which are additionally not altered in different hardware systems. We were able to identify eight genes (ALB, B4GALT6, GAPDH, HMBS, YWHAZ, ABCA5, ABCA9, and ABCC1 which demonstrated no altered gene expression levels in all tested conditions and therefore represent good candidates for the standardization of gene expression studies in altered gravity.

  1. Interpolation based consensus clustering for gene expression time series. (United States)

    Chiu, Tai-Yu; Hsu, Ting-Chieh; Yen, Chia-Cheng; Wang, Jia-Shung


    Unsupervised analyses such as clustering are the essential tools required to interpret time-series expression data from microarrays. Several clustering algorithms have been developed to analyze gene expression data. Early methods such as k-means, hierarchical clustering, and self-organizing maps are popular for their simplicity. However, because of noise and uncertainty of measurement, these common algorithms have low accuracy. Moreover, because gene expression is a temporal process, the relationship between successive time points should be considered in the analyses. In addition, biological processes are generally continuous; therefore, the datasets collected from time series experiments are often found to have an insufficient number of data points and, as a result, compensation for missing data can also be an issue. An affinity propagation-based clustering algorithm for time-series gene expression data is proposed. The algorithm explores the relationship between genes using a sliding-window mechanism to extract a large number of features. In addition, the time-course datasets are resampled with spline interpolation to predict the unobserved values. Finally, a consensus process is applied to enhance the robustness of the method. Some real gene expression datasets were analyzed to demonstrate the accuracy and efficiency of the algorithm. The proposed algorithm has benefitted from the use of cubic B-splines interpolation, sliding-window, affinity propagation, gene relativity graph, and a consensus process, and, as a result, provides both appropriate and effective clustering of time-series gene expression data. The proposed method was tested with gene expression data from the Yeast galactose dataset, the Yeast cell-cycle dataset (Y5), and the Yeast sporulation dataset, and the results illustrated the relationships between the expressed genes, which may give some insights into the biological processes involved.

  2. SIGNATURE: A workbench for gene expression signature analysis

    Directory of Open Access Journals (Sweden)

    Chang Jeffrey T


    Full Text Available Abstract Background The biological phenotype of a cell, such as a characteristic visual image or behavior, reflects activities derived from the expression of collections of genes. As such, an ability to measure the expression of these genes provides an opportunity to develop more precise and varied sets of phenotypes. However, to use this approach requires computational methods that are difficult to implement and apply, and thus there is a critical need for intelligent software tools that can reduce the technical burden of the analysis. Tools for gene expression analyses are unusually difficult to implement in a user-friendly way because their application requires a combination of biological data curation, statistical computational methods, and database expertise. Results We have developed SIGNATURE, a web-based resource that simplifies gene expression signature analysis by providing software, data, and protocols to perform the analysis successfully. This resource uses Bayesian methods for processing gene expression data coupled with a curated database of gene expression signatures, all carried out within a GenePattern web interface for easy use and access. Conclusions SIGNATURE is available for public use at

  3. Imputing Gene Expression in Uncollected Tissues Within and Beyond GTEx (United States)

    Wang, Jiebiao; Gamazon, Eric R.; Pierce, Brandon L.; Stranger, Barbara E.; Im, Hae Kyung; Gibbons, Robert D.; Cox, Nancy J.; Nicolae, Dan L.; Chen, Lin S.


    Gene expression and its regulation can vary substantially across tissue types. In order to generate knowledge about gene expression in human tissues, the Genotype-Tissue Expression (GTEx) program has collected transcriptome data in a wide variety of tissue types from post-mortem donors. However, many tissue types are difficult to access and are not collected in every GTEx individual. Furthermore, in non-GTEx studies, the accessibility of certain tissue types greatly limits the feasibility and scale of studies of multi-tissue expression. In this work, we developed multi-tissue imputation methods to impute gene expression in uncollected or inaccessible tissues. Via simulation studies, we showed that the proposed methods outperform existing imputation methods in multi-tissue expression imputation and that incorporating imputed expression data can improve power to detect phenotype-expression correlations. By analyzing data from nine selected tissue types in the GTEx pilot project, we demonstrated that harnessing expression quantitative trait loci (eQTLs) and tissue-tissue expression-level correlations can aid imputation of transcriptome data from uncollected GTEx tissues. More importantly, we showed that by using GTEx data as a reference, one can impute expression levels in inaccessible tissues in non-GTEx expression studies. PMID:27040689

  4. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer.

    Directory of Open Access Journals (Sweden)

    Jennifer S Myers

    Full Text Available Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The "transforming growth factor-beta signaling" and "Ran regulation of mitotic spindle formation" pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran for investigation in prostate cancer pathogenesis.

  5. Ion channel gene expression predicts survival in glioma patients. (United States)

    Wang, Rong; Gurguis, Christopher I; Gu, Wanjun; Ko, Eun A; Lim, Inja; Bang, Hyoweon; Zhou, Tong; Ko, Jae-Hong


    Ion channels are important regulators in cell proliferation, migration, and apoptosis. The malfunction and/or aberrant expression of ion channels may disrupt these important biological processes and influence cancer progression. In this study, we investigate the expression pattern of ion channel genes in glioma. We designate 18 ion channel genes that are differentially expressed in high-grade glioma as a prognostic molecular signature. This ion channel gene expression based signature predicts glioma outcome in three independent validation cohorts. Interestingly, 16 of these 18 genes were down-regulated in high-grade glioma. This signature is independent of traditional clinical, molecular, and histological factors. Resampling tests indicate that the prognostic power of the signature outperforms random gene sets selected from human genome in all the validation cohorts. More importantly, this signature performs better than the random gene signatures selected from glioma-associated genes in two out of three validation datasets. This study implicates ion channels in brain cancer, thus expanding on knowledge of their roles in other cancers. Individualized profiling of ion channel gene expression serves as a superior and independent prognostic tool for glioma patients.

  6. Estradiol-induced gene expression in largemouth bass (Micropterus salmoides) (United States)

    Bowman, C.J.; Kroll, K.J.; Gross, T.G.; Denslow, N.D.


    Vitellogenin (Vtg) and estrogen receptor (ER) gene expression levels were measured in largemouth bass to evaluate the activation of the ER-mediated pathway by estradiol (E2). Single injections of E2 ranging from 0.0005 to 5 mg/kg up-regulated plasma Vtg in a dose-dependent manner. Vtg and ER mRNAs were measured using partial cDNA sequences corresponding to the C-terminal domain for Vtg and the ligand-binding domain of ER?? sequences. After acute E2-exposures (2 mg/kg), Vtg and ER mRNAs and plasma Vtg levels peaked after 2 days. The rate of ER mRNA accumulation peaked 36-42 h earlier than Vtg mRNA. The expression window for ER defines the primary response to E2 in largemouth bass and that for Vtg a delayed primary response. The specific effect of E2 on other estrogen-regulated genes was tested during these same time windows using differential display RT-PCR. Specific up-regulated genes that are expressed in the same time window as Vtg were ERp72 (a membrane-bound disulfide isomerase) and a gene with homology to an expressed gene identified in zebrafish. Genes that were expressed in a pattern that mimics the ER include the gene for zona radiata protein ZP2, and a gene with homology to an expressed gene found in winter flounder. One gene for fibrinogen ?? was down-regulated and an unidentified gene was transiently up-regulated after 12 h of exposure and returned to basal levels by 48 h. Taken together these studies indicate that the acute molecular response to E2 involves a complex network of responses over time. ?? 2002 Elsevier Science Ireland Ltd. All rights reserved.

  7. Gene Expression Measurement Module (GEMM) - A Fully Automated, Miniaturized Instrument for Measuring Gene Expression in Space (United States)

    Pohorille, Andrew; Peyvan, Kia; Karouia, Fathi; Ricco, Antonio


    The capability to measure gene expression on board spacecraft opens the door to a large number of high-value experiments on the influence of the space environment on biological systems. For example, measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, and determine the metabolic bases of microbial pathogenicity and drug resistance. These and other applications hold significant potential for discoveries in space biology, biotechnology, and medicine. Supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measurement of expression of several hundreds of microbial genes from multiple samples. The instrument will be capable of (1) lysing cell walls of bacteria sampled from cultures grown in space, (2) extracting and purifying RNA released from cells, (3) hybridizing the RNA on a microarray and (4) providing readout of the microarray signal, all in a single microfluidics cartridge. The device is suitable for deployment on nanosatellite platforms developed by NASA Ames' Small Spacecraft Division. To meet space and other technical constraints imposed by these platforms, a number of technical innovations are being implemented. The integration and end-to-end technological and biological validation of the instrument are carried out using as a model the photosynthetic bacterium Synechococcus elongatus, known for its remarkable metabolic diversity and resilience to adverse conditions. Each step in the measurement process-lysis, nucleic acid extraction, purification, and hybridization to an array-is assessed through comparison of the results obtained using the instrument with

  8. A sequence-based approach to identify reference genes for gene expression analysis

    Directory of Open Access Journals (Sweden)

    Chari Raj


    Full Text Available Abstract Background An important consideration when analyzing both microarray and quantitative PCR expression data is the selection of appropriate genes as endogenous controls or reference genes. This step is especially critical when identifying genes differentially expressed between datasets. Moreover, reference genes suitable in one context (e.g. lung cancer may not be suitable in another (e.g. breast cancer. Currently, the main approach to identify reference genes involves the mining of expression microarray data for highly expressed and relatively constant transcripts across a sample set. A caveat here is the requirement for transcript normalization prior to analysis, and measurements obtained are relative, not absolute. Alternatively, as sequencing-based technologies provide digital quantitative output, absolute quantification ensues, and reference gene identification becomes more accurate. Methods Serial analysis of gene expression (SAGE profiles of non-malignant and malignant lung samples were compared using a permutation test to identify the most stably expressed genes across all samples. Subsequently, the specificity of the reference genes was evaluated across multiple tissue types, their constancy of expression was assessed using quantitative RT-PCR (qPCR, and their impact on differential expression analysis of microarray data was evaluated. Results We show that (i conventional references genes such as ACTB and GAPDH are highly variable between cancerous and non-cancerous samples, (ii reference genes identified for lung cancer do not perform well for other cancer types (breast and brain, (iii reference genes identified through SAGE show low variability using qPCR in a different cohort of samples, and (iv normalization of a lung cancer gene expression microarray dataset with or without our reference genes, yields different results for differential gene expression and subsequent analyses. Specifically, key established pathways in lung

  9. Expression of a Carrot Antifreeze Protein Gene in Escherichia coli

    Institute of Scientific and Technical Information of China (English)

    Ma Xinyu; Shen Xin; Lu Cunfu


    The recombinant expression vectorpET43. lb-AFP, which contains full encoding region of a carrot 36 kD antifreeze protein (AFP) gene was constructed. The recombinant was transformed into expression host carrying T7 RNA polymerase gene (DE3 lysogen) and induced by 1 mmol. L-1 IPTG (isopropyl-β-D-thiogalactoside) to express 110 kD polypeptide of AFP fusion protein.The analysis of product solubility revealed that pET43. 1b-AFP was predominately soluble, and the expressed amount reached the maximum after the IPTG treatment for 3 h.

  10. Identification of Porphyra lines using computerized DNA fingerprinting

    Institute of Scientific and Technical Information of China (English)


    RAPD (Randomly Amplified Polymorphic DNA) analysis was performed with filaments of 15 Porphyra lines representing four important groups (P. yezoensis, P. haitanensis, P.katadai var. Hemiphylla and P. oligospermatangia ). Eight stable and repeatable RAPD bands am plified with two primers, OPN-02 and OPJ-18, were selected for the construction of DNA fingerprint ing. The RAPD results were scored based on the presence or absence of each of the 8 bands and then converted to computer language expressed with two digitals, 1 and 0, which represented the presence (numbered as 1) or absence (numbered as 0) of each band, respectively. Based on these results, a model DNA fingerprint and a computerized DNA fingerprint were constructed. In the constructed DNA fingerprint, each Porphyra line has its unique fingerprinting pattern and can be easily distinguished from each other. Later, a software, named as PhGI, was designed based on this DNA fingerprinting.It can be used in practical Porphyra line identification.

  11. Identification of Haemophilus ducreyi genes expressed during human infection. (United States)

    Bauer, Margaret E; Fortney, Kate R; Harrison, Alistair; Janowicz, Diane M; Munson, Robert S; Spinola, Stanley M


    To identify Haemophilus ducreyi transcripts that are expressed during human infection, we used selective capture of transcribed sequences (SCOTS) with RNA isolated from pustules obtained from three volunteers infected with H. ducreyi, and with RNA isolated from broth-grown bacteria used to infect volunteers. With SCOTS, competitive hybridization of tissue-derived and broth-derived sequences identifies genes that may be preferentially expressed in vivo. Among the three tissue specimens, we identified 531 genes expressed in vivo. Southern blot analysis of 60 genes from each tissue showed that 87 % of the identified genes hybridized better with cDNA derived from tissue specimens than with cDNA derived from broth-grown bacteria. RT-PCR on nine additional pustules confirmed in vivo expression of 10 of 11 selected genes in other volunteers. Of the 531 genes, 139 were identified in at least two volunteers. These 139 genes fell into several functional categories, including biosynthesis and metabolism, regulation, and cellular processes, such as transcription, translation, cell division, DNA replication and repair, and transport. Detection of genes involved in anaerobic and aerobic respiration indicated that H. ducreyi likely encounters both microenvironments within the pustule. Other genes detected suggest an increase in DNA damage and stress in vivo. Genes involved in virulence in other bacterial pathogens and 32 genes encoding hypothetical proteins were identified, and may represent novel virulence factors. We identified three genes, lspA1, lspA2 and tadA, known to be required for virulence in humans. This is the first study to broadly define transcripts expressed by H. ducreyi in humans.

  12. Clinicopathologic and gene expression parameters predict liver cancer prognosis

    Directory of Open Access Journals (Sweden)

    Hao Ke


    Full Text Available Abstract Background The prognosis of hepatocellular carcinoma (HCC varies following surgical resection and the large variation remains largely unexplained. Studies have revealed the ability of clinicopathologic parameters and gene expression to predict HCC prognosis. However, there has been little systematic effort to compare the performance of these two types of predictors or combine them in a comprehensive model. Methods Tumor and adjacent non-tumor liver tissues were collected from 272 ethnic Chinese HCC patients who received curative surgery. We combined clinicopathologic parameters and gene expression data (from both tissue types in predicting HCC prognosis. Cross-validation and independent studies were employed to assess prediction. Results HCC prognosis was significantly associated with six clinicopathologic parameters, which can partition the patients into good- and poor-prognosis groups. Within each group, gene expression data further divide patients into distinct prognostic subgroups. Our predictive genes significantly overlap with previously published gene sets predictive of prognosis. Moreover, the predictive genes were enriched for genes that underwent normal-to-tumor gene network transformation. Previously documented liver eSNPs underlying the HCC predictive gene signatures were enriched for SNPs that associated with HCC prognosis, providing support that these genes are involved in key processes of tumorigenesis. Conclusion When applied individually, clinicopathologic parameters and gene expression offered similar predictive power for HCC prognosis. In contrast, a combination of the two types of data dramatically improved the power to predict HCC prognosis. Our results also provided a framework for understanding the impact of gene expression on the processes of tumorigenesis and clinical outcome.

  13. Risk analysis of colorectal cancer incidence by gene expression analysis (United States)

    Shangkuan, Wei-Chuan; Lin, Hung-Che; Chang, Yu-Tien; Jian, Chen-En; Fan, Hueng-Chuen; Chen, Kang-Hua; Liu, Ya-Fang; Hsu, Huan-Ming; Chou, Hsiu-Ling; Yao, Chung-Tay


    Background Colorectal cancer (CRC) is one of the leading cancers worldwide. Several studies have performed microarray data analyses for cancer classification and prognostic analyses. Microarray assays also enable the identification of gene signatures for molecular characterization and treatment prediction. Objective Microarray gene expression data from the online Gene Expression Omnibus (GEO) database were used to to distinguish colorectal cancer from normal colon tissue samples. Methods We collected microarray data from the GEO database to establish colorectal cancer microarray gene expression datasets for a combined analysis. Using the Prediction Analysis for Microarrays (PAM) method and the GSEA MSigDB resource, we analyzed the 14,698 genes that were identified through an examination of their expression values between normal and tumor tissues. Results Ten genes (ABCG2, AQP8, SPIB, CA7, CLDN8, SCNN1B, SLC30A10, CD177, PADI2, and TGFBI) were found to be good indicators of the candidate genes that correlate with CRC. From these selected genes, an average of six significant genes were obtained using the PAM method, with an accuracy rate of 95%. The results demonstrate the potential of utilizing a model with the PAM method for data mining. After a detailed review of the published reports, the results confirmed that the screened candidate genes are good indicators for cancer risk analysis using the PAM method. Conclusions Six genes were selected with 95% accuracy to effectively classify normal and colorectal cancer tissues. We hope that these results will provide the basis for new research projects in clinical practice that aim to rapidly assess colorectal cancer risk using microarray gene expression analysis. PMID:28229027

  14. Identification of optimal housekeeping genes for examination of gene expression in bovine corpus luteum. (United States)

    Rekawiecki, Robert; Rutkowska, Joanna; Kotwica, Jan


    The selection of proper housekeeping genes for studies requiring genes expression normalization is an important step in the appropriate interpretation of results. The expression of housekeeping genes is regulated by many factors including age, gender, type of tissue or disease. The aim of the study was to identify optimal housekeeping genes in the corpus luteum obtained from cyclic or pregnant cows. The mRNA expression of thirteen housekeeping genes: C2orf29, SUZ12, TBP, TUBB2B, ZNF131, HPRT1, 18s RNA, GAPDH, SF3A1, SDHA, MRPL12, B2M and ACTB was measured by Real-time PCR. Range of cycle threshold (C(t)) values of the tested genes varied between 12 and 30 cycles, and 18s RNA had the highest coefficient of variation, whereas C2orf29 had the smallest coefficient. GeNorm software demonstrated C2orf29 and TBP as the most stable and 18s RNA and B2M as the most unstable housekeeping genes. Using the proposed cut-off value (0.15), no more than two of the best GeNorm housekeeping genes are proposed to be used in studies requiring gene expression normalization. NormFinder software demonstrated C2orf29 and SUZ12 as the best and 18s RNA and B2M as the worst housekeeping genes. The study indicates that selection of housekeeping genes may essentially affect the quality of the gene expression results.


    Institute of Scientific and Technical Information of China (English)

    吕桂泉; 许沈华; 牟瀚舟; 朱赤红; 羊正炎; 高永良; 楼洪坤; 刘祥麟; 杨文; 程勇


    To study the gene expression of high metastatic human ovarian carcinoma cell line (HO-8910PM) and to screen for novel metastasis- associated genes by cDNA microarray. Methods: The cDNA was retro-transcribed from equal quantity mRNA derived from tissues of highly metastatic ovarian carcinoma cell line and normal ovarian, and was labeled with Cy5 and Cy3 fluorescence as probes. The mixed probes were hybridized with BioDoor 4096 double dot human whole gene chip. The chip was scanned by scanArray 3000 laser scanner. The acquired image was analyzed by ImaGene 3.0 software. Results: By applying the cDNA microarray we found: A total of 323 genes whose expression level were 3 times higher or lower in HO-8910PM cell than normal ovarian epithelium cell were screened out, with 71 higher and 252 lower respectively. Among these 10 were new genes. 67 genes showed expression difference bigger than 6 times between HO-8910PM cell and normal ovarian epithelium cell, among these genes 12 were higher, 55 lower, and two new genes were found. Conclusion: cDNA microarray technique is effective in screening the differentially expressed genes between human ovarian cancer cell line (HO-8910PM) and normal ovarian epithelium cell. Using the cDNA microarray to analyze of human ovarian cancer cell line gene expression profile difference will help the gene diagnosis, treatment and protection.

  16. Gene expression profile differences in gastric cancer, pericancerous epithelium and normal gastric mucosa by gene chip

    Institute of Scientific and Technical Information of China (English)

    Chuan-Ding Yu; Shen-Hua Xu; Hang-Zhou Mou; Zhi-Ming Jiang; Chi-Hong Zhu; Xiang-Lin Liu


    AIM: To study the difference of gene expression in gastric cancer (T), pericancerous epithelium (P) and normal tissue of gastric mucosa (C), and to screen an associated novel gene in early gastric carcinogenesis by oligonudeotide microarray.METHODS: U133A (Affymetrix, Santa Clara, CA) gene chip was used to detect the gene expression profile difference in T, P and C, respectively. Bioinformatics was used to analyze the detected results.RESULTS: When gastric cancer was compared with normal gastric mucosa, 766 genes were found, with a difference of more than four times in expression levels. Of the 766 genes,530 were up-regulated (Signal Log Ratio [SLR]>2), and 236 were down-regulated (SLR<-2). When pericancerous epithelium was compared with normal gastric mucosa, 64genes were found, with a difference of more than four times in expression levels. Of the 64 genes, 50 were up-regulated (SLR>2), and 14 were down-regulated (SLR<-2). Compared with normal gastric mucosa, a total of 143 genes with a difference in expression levels (more than four times, either in cancer or in pericancerous epithelium) were found in gastric cancer (T) and pericancerous epithelium (P). Of the 143 genes, 108 were up-regulated (SLR>2), and 35were down-regulated (SLR<-2).CONCLUSION: To apply a gene chip could find 143 genes associated with the genes of gastric cancer in pericancerous epithelium, although there were no pathological changes in the tissue slices. More interesting, six genes of pericancerous epithelium were up-regulated in comparison with genes of gastric cancer and three genes were down-regulated in comparison with genes of gastric cancer. It is suggested that these genes may be related to the carcinogenesis and development of early gastric cancer.


    Directory of Open Access Journals (Sweden)



    Full Text Available Microarray technology has now made it possible to simultaneously monitor the expression levels of thousands of genes during important biological processes and across collections of related samples. But the high dimensionality property of gene expression data makes it difficult to be analyzed. Lot of clustering algorithms are available for clustering. In this paper we first briefly introduce the concepts of microarray technology and discuss the basic elements of clustering on gene expression data. Then we introduce rough clustering and itsadvantage over strict and fuzzy clustering is explored. We also explain why rough clustering is preferred over other conventional methods by presenting a survey on few clustering algorithms based on rough set theory for gene expression data. We conclude by stating that this area proves to be potential research field for the researchcommunity.

  18. Gene expression in three stages of ripening tomato fruit

    NARCIS (Netherlands)

    Maagd, de R.A.; Bovy, A.G.


    Gene expression in three stages of ripening tomato fruit (variety Ailsa Craig) was determined with the EUTOM3 Affymetrix array in order to compare with degradrome sequencing data from study GSE42661, treated as RNAseq.

  19. Differential Expression of Salinity Resistance Gene on Cotton

    Institute of Scientific and Technical Information of China (English)


    Salinity resistance and differential gene expression associated with salinity in cotton germplasm were studied,because of the large scale area of salinity in China,and its significant negative effects on

  20. Long SAGE analysis of genes differentially expressed in the midgut ...

    African Journals Online (AJOL)


    Both the technology of female egg balanced-lethal system for male ... RNA isolation. All ribonucleic acid (RNAs) were prepared from two males and two females .... There were also some genes with very high expression ..... Nucleic Acids Res.,.

  1. Visually Relating Gene Expression and in vivo DNA Binding Data

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd


    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  2. Gene expression profiling of benign and malignant pheochromocytoma.

    NARCIS (Netherlands)

    Brouwers, F.M.; Elkahloun, A.G.; Munson, P.J.; Eisenhofer, G.; Barb, J.; Linehan, W.M.; Lenders, J.W.M.; Krijger, R.R. de; Mannelli, M.; Udelsman, R.; Ocal, I.T.; Shulkin, B.L.; Bornstein, S.R.; Breza, J.; Ksinantova, L.; Pacak, K.


    There are currently no reliable diagnostic and prognostic markers or effective treatments for malignant pheochromocytoma. This study used oligonucleotide microarrays to examine gene expression profiles in pheochromocytomas from 90 patients, including 20 with malignant tumors, the latter including

  3. The evolution of gene expression levels in mammalian organs

    DEFF Research Database (Denmark)

    Brawand, David; Soumillon, Magali; Necsulea, Anamaria


    and chromosomes, owing to differences in selective pressures: transcriptome change was slow in nervous tissues and rapid in testes, slower in rodents than in apes and monotremes, and rapid for the X chromosome right after its formation. Although gene expression evolution in mammals was strongly shaped......Changes in gene expression are thought to underlie many of the phenotypic differences between species. However, large-scale analyses of gene expression evolution were until recently prevented by technological limitations. Here we report the sequencing of polyadenylated RNA from six organs across...... ten species that represent all major mammalian lineages (placentals, marsupials and monotremes) and birds (the evolutionary outgroup), with the goal of understanding the dynamics of mammalian transcriptome evolution. We show that the rate of gene expression evolution varies among organs, lineages...

  4. Altered gene expression profiles in mouse tetraploid blastocysts. (United States)

    Park, Mi-Ryung; Hwang, Kyu-Chan; Bui, Hong-Thuy; Cho, Ssang-Goo; Park, Chankyu; Song, Hyuk; Oh, Jae-Wook; Kim, Jin-Hoi


    In this study, it was demonstrated that tetraploid-derived blastocyst embryos had very few Oct4-positive cells at the mid-blastocyst stage and that the inner cell mass at biomarkers Oct4, Sox2 and Klf4 was expressed at less than 10% of the level observed in diploid blastocysts. In contrast, trophectoderm-related gene transcripts showed an approximately 10 to 40% increase. Of 32,996 individual mouse genes evaluated by microarray, 50 genes were differentially expressed between tetraploid or diploid and parthenote embryos at the blastocyst stage (Ptetraploid-derived blastocysts, whereas 22 were more highly downregulated. However, some genes involved in receptor activity, cell adhesion molecule, calcium ion binding, protein biosynthesis, redox processes, transport, and transcription showed a significant decrease or increase in gene expression in the tetraploid-derived blastocyst embryos. Thus, microarray analysis can be used as a tool to screen for underlying defects responsible for the development of tetraploid-derived embryos.

  5. Super-paramagnetic clustering of yeast gene expression profiles

    CERN Document Server

    Getz, G; Domany, E; Zhang, M Q


    High-density DNA arrays, used to monitor gene expression at a genomic scale, have produced vast amounts of information which require the development of efficient computational methods to analyze them. The important first step is to extract the fundamental patterns of gene expression inherent in the data. This paper describes the application of a novel clustering algorithm, Super-Paramagnetic Clustering (SPC) to analysis of gene expression profiles that were generated recently during a study of the yeast cell cycle. SPC was used to organize genes into biologically relevant clusters that are suggestive for their co-regulation. Some of the advantages of SPC are its robustness against noise and initialization, a clear signature of cluster formation and splitting, and an unsupervised self-organized determination of the number of clusters at each resolution. Our analysis revealed interesting correlated behavior of several groups of genes which has not been previously identified.

  6. Super-paramagnetic clustering of yeast gene expression profiles (United States)

    Getz, G.; Levine, E.; Domany, E.; Zhang, M. Q.


    High-density DNA arrays, used to monitor gene expression at a genomic scale, have produced vast amounts of information which require the development of efficient computational methods to analyze them. The important first step is to extract the fundamental patterns of gene expression inherent in the data. This paper describes the application of a novel clustering algorithm, super-paramagnetic clustering (SPC) to analysis of gene expression profiles that were generated recently during a study of the yeast cell cycle. SPC was used to organize genes into biologically relevant clusters that are suggestive for their co-regulation. Some of the advantages of SPC are its robustness against noise and initialization, a clear signature of cluster formation and splitting, and an unsupervised self-organized determination of the number of clusters at each resolution. Our analysis revealed interesting correlated behavior of several groups of genes which has not been previously identified.

  7. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  8. Gene expression profiling of soft and firm Atlantic salmon fillet.

    Directory of Open Access Journals (Sweden)

    Thomas Larsson

    Full Text Available Texture of salmon fillets is an important quality trait for consumer acceptance as well as for the suitability for processing. In the present work we measured fillet firmness in a population of farmed Atlantic salmon with known pedigree and investigated the relationship between this trait and gene expression. Transcriptomic analyses performed with a 21 K oligonucleotide microarray revealed strong correlations between firmness and a large number of genes. Highly similar expression profiles were observed in several functional groups. Positive regression was found between firmness and genes encoding proteasome components (41 genes and mitochondrial proteins (129 genes, proteins involved in stress responses (12 genes, and lipid metabolism (30 genes. Coefficients of determination (R(2 were in the range of 0.64-0.74. A weaker though highly significant negative regression was seen in sugar metabolism (26 genes, R(2 = 0.66 and myofiber proteins (42 genes, R(2 = 0.54. Among individual genes that showed a strong association with firmness, there were extracellular matrix proteins (negative correlation, immune genes, and intracellular proteases (positive correlation. Several genes can be regarded as candidate markers of flesh quality (coiled-coil transcriptional coactivator b, AMP deaminase 3, and oligopeptide transporter 15 though their functional roles are unclear. To conclude, fillet firmness of Atlantic salmon depends largely on metabolic properties of the skeletal muscle; where aerobic metabolism using lipids as fuel, and the rapid removal of damaged proteins, appear to play a major role.

  9. Identification of therapeutic targets for Alzheimer's disease via differentially expressed gene and weighted gene co-expression network analyses. (United States)

    Jia, Yujie; Nie, Kun; Li, Jing; Liang, Xinyue; Zhang, Xuezhu


    In order to investigate the pathogenic targets and associated biological process of Alzheimer's disease in the present study, mRNA expression profiles (GSE28146) and microRNA (miRNA) expression profiles (GSE16759) were downloaded from the Gene Expression Omnibus database. In GSE28146, eight control samples, and Alzheimer's disease samples comprising seven incipient, eight moderate, seven severe Alzheimer's disease samples, were included. The Affy package in R was used for background correction and normalization of the raw microarray data. The differentially expressed genes (DEGs) and differentially expressed miRNAs were identified using the Limma package. In addition, mRNAs were clustered using weighted gene correlation network analysis, and modules found to be significantly associated with the stages of Alzheimer's disease were screened out. The Database for Annotation, Visualization, and Integrated Discovery was used to perform Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses. The target genes of the differentially expressed miRNAs were identified using the miRWalk database. Compared with the control samples, 175,59 genes and 90 DEGs were identified in the incipient, moderate and severe Alzheimer's disease samples, respectively. A module, which contained 1,592 genes was found to be closely associated with the stage of Alzheimer's disease and biological processes. In addition, pathways associated with Alzheimer's disease and other neurological diseases were found to be enriched in those genes. A total of 139 overlapped genes were identified between those genes and the DEGs in the three groups. From the miRNA expression profiles, 189 miRNAs were found differentially expressed in the samples from patients with Alzheimer's disease and 1,647 target genes were obtained. In addition, five overlapped genes were identified between those 1,647 target genes and the 139 genes, and these genes may be important pathogenic targets for Alzheimer

  10. Visual sensitivities tuned by heterochronic shifts in opsin gene expression

    Directory of Open Access Journals (Sweden)

    McFarland William N


    Full Text Available Abstract Background Cichlid fishes have radiated into hundreds of species in the Great Lakes of Africa. Brightly colored males display on leks and vie to be chosen by females as mates. Strong discrimination by females causes differential male mating success, rapid evolution of male color patterns and, possibly, speciation. In addition to differences in color pattern, Lake Malawi cichlids also show some of the largest known shifts in visual sensitivity among closely related species. These shifts result from modulated expression of seven cone opsin genes. However, the mechanisms for this modulated expression are unknown. Results In this work, we ask whether these differences might result from changes in developmental patterning of cone opsin genes. To test this, we compared the developmental pattern of cone opsin gene expression of the Nile tilapia, Oreochromis niloticus, with that of several cichlid species from Lake Malawi. In tilapia, quantitative polymerase chain reaction showed that opsin gene expression changes dynamically from a larval gene set through a juvenile set to a final adult set. In contrast, Lake Malawi species showed one of two developmental patterns. In some species, the expressed gene set changes slowly, either retaining the larval pattern or progressing only from larval to juvenile gene sets (neoteny. In the other species, the same genes are expressed in both larvae and adults but correspond to the tilapia adult genes (direct development. Conclusion Differences in visual sensitivities among species of Lake Malawi cichlids arise through heterochronic shifts relative to the ontogenetic pattern of the tilapia outgroup. Heterochrony has previously been shown to be a powerful mechanism for change in morphological evolution. We found that altering developmental expression patterns is also an important mechanism for altering sensory systems. These resulting sensory shifts will have major impacts on visual communication and could help

  11. Visual sensitivities tuned by heterochronic shifts in opsin gene expression (United States)

    Carleton, Karen L; Spady, Tyrone C; Streelman, J Todd; Kidd, Michael R; McFarland, William N; Loew, Ellis R


    Background Cichlid fishes have radiated into hundreds of species in the Great Lakes of Africa. Brightly colored males display on leks and vie to be chosen by females as mates. Strong discrimination by females causes differential male mating success, rapid evolution of male color patterns and, possibly, speciation. In addition to differences in color pattern, Lake Malawi cichlids also show some of the largest known shifts in visual sensitivity among closely related species. These shifts result from modulated expression of seven cone opsin genes. However, the mechanisms for this modulated expression are unknown. Results In this work, we ask whether these differences might result from changes in developmental patterning of cone opsin genes. To test this, we compared the developmental pattern of cone opsin gene expression of the Nile tilapia, Oreochromis niloticus, with that of several cichlid species from Lake Malawi. In tilapia, quantitative polymerase chain reaction showed that opsin gene expression changes dynamically from a larval gene set through a juvenile set to a final adult set. In contrast, Lake Malawi species showed one of two developmental patterns. In some species, the expressed gene set changes slowly, either retaining the larval pattern or progressing only from larval to juvenile gene sets (neoteny). In the other species, the same genes are expressed in both larvae and adults but correspond to the tilapia adult genes (direct development). Conclusion Differences in visual sensitivities among species of Lake Malawi cichlids arise through heterochronic shifts relative to the ontogenetic pattern of the tilapia outgroup. Heterochrony has previously been shown to be a powerful mechanism for change in morphological evolution. We found that altering developmental expression patterns is also an important mechanism for altering sensory systems. These resulting sensory shifts will have major impacts on visual communication and could help drive cichlid speciation

  12. Identifying suitable reference genes for gene expression analysis in developing skeletal muscle in pigs

    Directory of Open Access Journals (Sweden)

    Guanglin Niu


    Full Text Available The selection of suitable reference genes is crucial to accurately evaluate and normalize the relative expression level of target genes for gene function analysis. However, commonly used reference genes have variable expression levels in developing skeletal muscle. There are few reports that systematically evaluate the expression stability of reference genes across prenatal and postnatal developing skeletal muscle in mammals. Here, we used quantitative PCR to examine the expression levels of 15 candidate reference genes (ACTB, GAPDH, RNF7, RHOA, RPS18, RPL32, PPIA, H3F3, API5, B2M, AP1S1, DRAP1, TBP, WSB, and VAPB in porcine skeletal muscle at 26 different developmental stages (15 prenatal and 11 postnatal periods. We evaluated gene expression stability using the computer algorithms geNorm, NormFinder, and BestKeeper. Our results indicated that GAPDH and ACTB had the greatest variability among the candidate genes across prenatal and postnatal stages of skeletal muscle development. RPS18, API5, and VAPB had stable expression levels in prenatal stages, whereas API5, RPS18, RPL32, and H3F3 had stable expression levels in postnatal stages. API5 and H3F3 expression levels had the greatest stability in all tested prenatal and postnatal stages, and were the most appropriate reference genes for gene expression normalization in developing skeletal muscle. Our data provide valuable information for gene expression analysis during different stages of skeletal muscle development in mammals. This information can provide a valuable guide for the analysis of human diseases.

  13. Identifying suitable reference genes for gene expression analysis in developing skeletal muscle in pigs. (United States)

    Niu, Guanglin; Yang, Yalan; Zhang, YuanYuan; Hua, Chaoju; Wang, Zishuai; Tang, Zhonglin; Li, Kui


    The selection of suitable reference genes is crucial to accurately evaluate and normalize the relative expression level of target genes for gene function analysis. However, commonly used reference genes have variable expression levels in developing skeletal muscle. There are few reports that systematically evaluate the expression stability of reference genes across prenatal and postnatal developing skeletal muscle in mammals. Here, we used quantitative PCR to examine the expression levels of 15 candidate reference genes (ACTB, GAPDH, RNF7, RHOA, RPS18, RPL32, PPIA, H3F3, API5, B2M, AP1S1, DRAP1, TBP, WSB, and VAPB) in porcine skeletal muscle at 26 different developmental stages (15 prenatal and 11 postnatal periods). We evaluated gene expression stability using the computer algorithms geNorm, NormFinder, and BestKeeper. Our results indicated that GAPDH and ACTB had the greatest variability among the candidate genes across prenatal and postnatal stages of skeletal muscle development. RPS18, API5, and VAPB had stable expression levels in prenatal stages, whereas API5, RPS18, RPL32, and H3F3 had stable expression levels in postnatal stages. API5 and H3F3 expression levels had the greatest stability in all tested prenatal and postnatal stages, and were the most appropriate reference genes for gene expression normalization in developing skeletal muscle. Our data provide valuable information for gene expression analysis during different stages of skeletal muscle development in mammals. This information can provide a valuable guide for the analysis of human diseases.

  14. Freedom of expression: cell-type-specific gene profiling. (United States)

    Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H


    Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling.

  15. Semi-supervised consensus clustering for gene expression data analysis


    Wang, Yunli; Pan, Youlian


    Background Simple clustering methods such as hierarchical clustering and k-means are widely used for gene expression data analysis; but they are unable to deal with noise and high dimensionality associated with the microarray gene expression data. Consensus clustering appears to improve the robustness and quality of clustering results. Incorporating prior knowledge in clustering process (semi-supervised clustering) has been shown to improve the consistency between the data partitioning and do...

  16. Effects of environmental enrichment on gene expression in the brain


    Rampon, Claire; Jiang, Cecilia H.; Dong, Helin; Tang, Ya-Ping; Lockhart, David J; Schultz, Peter G.; Joe Z Tsien; Hu, Yinghe


    An enriched environment is known to promote structural changes in the brain and to enhance learning and memory performance in rodents [Hebb, D. O. (1947) Am. Psychol. 2, 306–307]. To better understand the molecular mechanisms underlying these experience-dependent cognitive changes, we have used high-density oligonucleotide microarrays to analyze gene expression in the brain. Expression of a large number of genes changes in response to enrichment training, many of w...

  17. A Compendium of Canine Normal Tissue Gene Expression


    Joseph Briggs; Melissa Paoloni; Qing-Rong Chen; Xinyu Wen; Javed Khan; Chand Khanna


    BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platf...

  18. Global Effects of Catecholamines on Actinobacillus pleuropneumoniae Gene Expression (United States)

    Li, Lu; Xu, Zhuofei; Zhou, Yang; Sun, Lili; Liu, Ziduo; Chen, Huanchun; Zhou, Rui


    Bacteria can use mammalian hormones to modulate pathogenic processes that play essential roles in disease development. Actinobacillus pleuropneumoniae is an important porcine respiratory pathogen causing great economic losses in the pig industry globally. Stress is known to contribute to the outcome of A. pleuropneumoniae infection. To test whether A. pleuropneumoniae could respond to stress hormone catecholamines, gene expression profiles after epinephrine (Epi) and norepinephrine (NE) treatment were compared with those from untreated bacteria. The microarray results showed that 158 and 105 genes were differentially expressed in the presence of Epi and NE, respectively. These genes were assigned to various functional categories including many virulence factors. Only 18 genes were regulated by both hormones. These genes included apxIA (the ApxI toxin structural gene), pgaB (involved in biofilm formation), APL_0443 (an autotransporter adhesin) and genes encoding potential hormone receptors such as tyrP2, the ygiY-ygiX (qseC-qseB) operon and narQ-narP (involved in nitrate metabolism). Further investigations demonstrated that cytotoxic activity was enhanced by Epi but repressed by NE in accordance with apxIA gene expression changes. Biofilm formation was not affected by either of the two hormones despite pgaB expression being affected. Adhesion to host cells was induced by NE but not by Epi, suggesting that the hormones affect other putative adhesins in addition to APL_0443. This study revealed that A. pleuropneumoniae gene expression, including those encoding virulence factors, was altered in response to both catecholamines. The differential regulation of A. pleuropneumoniae gene expression by the two hormones suggests that this pathogen may have multiple responsive systems for the two catecholamines. PMID:22347439

  19. Global effects of catecholamines on Actinobacillus pleuropneumoniae gene expression.

    Directory of Open Access Journals (Sweden)

    Lu Li

    Full Text Available Bacteria can use mammalian hormones to modulate pathogenic processes that play essential roles in disease development. Actinobacillus pleuropneumoniae is an important porcine respiratory pathogen causing great economic losses in the pig industry globally. Stress is known to contribute to the outcome of A. pleuropneumoniae infection. To test whether A. pleuropneumoniae could respond to stress hormone catecholamines, gene expression profiles after epinephrine (Epi and norepinephrine (NE treatment were compared with those from untreated bacteria. The microarray results showed that 158 and 105 genes were differentially expressed in the presence of Epi and NE, respectively. These genes were assigned to various functional categories including many virulence factors. Only 18 genes were regulated by both hormones. These genes included apxIA (the ApxI toxin structural gene, pgaB (involved in biofilm formation, APL_0443 (an autotransporter adhesin and genes encoding potential hormone receptors such as tyrP2, the ygiY-ygiX (qseC-qseB operon and narQ-narP (involved in nitrate metabolism. Further investigations demonstrated that cytotoxic activity was enhanced by Epi but repressed by NE in accordance with apxIA gene expression changes. Biofilm formation was not affected by either of the two hormones despite pgaB expression being affected. Adhesion to host cells was induced by NE but not by Epi, suggesting that the hormones affect other putative adhesins in addition to APL_0443. This study revealed that A. pleuropneumoniae gene expression, including those encoding virulence factors, was altered in response to both catecholamines. The differential regulation of A. pleuropneumoniae gene expression by the two hormones suggests that this pathogen may have multiple responsive systems for the two catecholamines.

  20. Gene Expression Profiling during Pregnancy in Rat Brain Tissue. (United States)

    Mann, Phyllis E


    The neurophysiological changes that occur during pregnancy in the female mammal have led to the coining of the phrases "expectant brain" and "maternal brain". Although much is known of the hormonal changes during pregnancy, alterations in neurotransmitter gene expression have not been well-studied. We examined gene expression in the ventromedial nucleus of the hypothalamus (VMH) during pregnancy based on the fact that this nucleus not only modulates the physiological changes that occur during pregnancy but is also involved in the development of maternal behavior. This study was designed to identify genes that are differentially expressed between mid- and late-pregnancy in order to determine which genes may be associated with the onset and display of maternal behavior and the development of the maternal brain. A commercially available PCR array containing 84 neurotransmitter receptor and regulator genes (RT2 Profiler PCR array) was used. Brains were harvested from rats on days 12 and 21 of gestation, frozen, and micropunched to obtain the VMH. Total RNA was extracted, cDNA prepared, and SYBR Green qPCR was performed. In the VMH, expression of five genes were reduced on day 21 of gestation compared to day 12 (Chrna6, Drd5, Gabrr2, Prokr2, and Ppyr1) whereas Chat, Chrm5, Drd4, Gabra5, Gabrg2, LOC289606, Nmu5r2, and Npy5r expression was elevated. Five genes were chosen to be validated in an additional experiment based on their known involvement in maternal behavior onset. This experiment confirmed that gene expression for both the CCK-A receptor and the GABAAR γ2 receptor increases at the end of pregnancy. In general, these results identify genes possibly involved in the establishment of the maternal brain in rats and indicate possible new genes to be investigated.

  1. Gene Expression Profiling during Pregnancy in Rat Brain Tissue

    Directory of Open Access Journals (Sweden)

    Phyllis E. Mann


    Full Text Available The neurophysiological changes that occur during pregnancy in the female mammal have led to the coining of the phrases “expectant brain” and “maternal brain”. Although much is known of the hormonal changes during pregnancy, alterations in neurotransmitter gene expression have not been well-studied. We examined gene expression in the ventromedial nucleus of the hypothalamus (VMH during pregnancy based on the fact that this nucleus not only modulates the physiological changes that occur during pregnancy but is also involved in the development of maternal behavior. This study was designed to identify genes that are differentially expressed between mid- and late-pregnancy in order to determine which genes may be associated with the onset and display of maternal behavior and the development of the maternal brain. A commercially available PCR array containing 84 neurotransmitter receptor and regulator genes (RT2 Profiler PCR array was used. Brains were harvested from rats on days 12 and 21 of gestation, frozen, and micropunched to obtain the VMH. Total RNA was extracted, cDNA prepared, and SYBR Green qPCR was performed. In the VMH, expression of five genes were reduced on day 21 of gestation compared to day 12 (Chrna6, Drd5, Gabrr2, Prokr2, and Ppyr1 whereas Chat, Chrm5, Drd4, Gabra5, Gabrg2, LOC289606, Nmu5r2, and Npy5r expression was elevated. Five genes were chosen to be validated in an additional experiment based on their known involvement in maternal behavior onset. This experiment confirmed that gene expression for both the CCK-A receptor and the GABAAR γ2 receptor increases at the end of pregnancy. In general, these results identify genes possibly involved in the establishment of the maternal brain in rats and indicate possible new genes to be investigated.

  2. Gene expression signature in peripheral blood detects thoracic aortic aneurysm.

    Directory of Open Access Journals (Sweden)

    Yulei Wang

    Full Text Available BACKGROUND: Thoracic aortic aneurysm (TAA is usually asymptomatic and associated with high mortality. Adverse clinical outcome of TAA is preventable by elective surgical repair; however, identifying at-risk individuals is difficult. We hypothesized that gene expression patterns in peripheral blood cells may correlate with TAA disease status. Our goal was to identify a distinct gene expression signature in peripheral blood that may identify individuals at risk for TAA. METHODS AND FINDINGS: Whole genome gene expression profiles from 94 peripheral blood samples (collected from 58 individuals with TAA and 36 controls were analyzed. Significance Analysis of Microarray (SAM identified potential signature genes characterizing TAA vs. normal, ascending vs. descending TAA, and sporadic vs. familial TAA. Using a training set containing 36 TAA patients and 25 controls, a 41-gene classification model was constructed for detecting TAA status and an overall accuracy of 78+/-6% was achieved. Testing this classifier on an independent validation set containing 22 TAA samples and 11 controls yielded an overall classification accuracy of 78%. These 41 classifier genes were further validated by TaqMan real-time PCR assays. Classification based on the TaqMan data replicated the microarray results and achieved 80% classification accuracy on the testing set. CONCLUSIONS: This study identified informative gene expression signatures in peripheral blood cells that can characterize TAA status and subtypes of TAA. Moreover, a 41-gene classifier based on expression signature can identify TAA patients with high accuracy. The transcriptional programs in peripheral blood leading to the identification of these markers also provide insights into the mechanism of development of aortic aneurysms and highlight potential targets for therapeutic intervention. The classifier genes identified in this study, and validated by TaqMan real-time PCR, define a set of promising potential

  3. Caffeine exposure alters cardiac gene expression in embryonic cardiomyocytes (United States)

    Fang, Xiefan; Mei, Wenbin; Barbazuk, William B.; Rivkees, Scott A.


    Previous studies demonstrated that in utero caffeine treatment at embryonic day (E) 8.5 alters DNA methylation patterns, gene expression, and cardiac function in adult mice. To provide insight into the mechanisms, we examined cardiac gene and microRNA (miRNA) expression in cardiomyocytes shortly after exposure to physiologically relevant doses of caffeine. In HL-1 and primary embryonic cardiomyocytes, caffeine treatment for 48 h significantly altered the expression of cardiac structural genes (Myh6, Myh7, Myh7b, Tnni3), hormonal genes (Anp and BnP), cardiac transcription factors (Gata4, Mef2c, Mef2d, Nfatc1), and microRNAs (miRNAs; miR208a, miR208b, miR499). In addition, expressions of these genes were significantly altered in embryonic hearts exposed to in utero caffeine. For in utero experiments, pregnant CD-1 dams were treated with 20–60 mg/kg of caffeine, which resulted in maternal circulation levels of 37.3–65.3 μM 2 h after treatment. RNA sequencing was performed on embryonic ventricles treated with vehicle or 20 mg/kg of caffeine daily from E6.5-9.5. Differential expression (DE) analysis revealed that 124 genes and 849 transcripts were significantly altered, and differential exon usage (DEU) analysis identified 597 exons that were changed in response to prenatal caffeine exposure. Among the DE genes identified by RNA sequencing were several cardiac structural genes and genes that control DNA methylation and histone modification. Pathway analysis revealed that pathways related to cardiovascular development and diseases were significantly affected by caffeine. In addition, global cardiac DNA methylation was reduced in caffeine-treated cardiomyocytes. Collectively, these data demonstrate that caffeine exposure alters gene expression and DNA methylation in embryonic cardiomyocytes. PMID:25354728

  4. [Gene expression profile of spinal ventral horn in ALS]. (United States)

    Yamamoto, Masahiko; Tanaka, Fumiaki; Sobue, Gen


    The causative pathomechanism of sporadic amyotrophic lateral sclerosis (ALS) is not clearly understood. Using microarray technology combined with laser-captured microdissection, gene expression profiles of degenerating spinal motor neurons as well as spinal ventral horn from autopsied patients with sporadic ALS were examined. Spinal motor neurons showed a distinct gene expression profile from the whole spinal ventral horn. Three percent of genes examined were significantly downregulated, and 1% were upregulated in motor neurons. In contrast with motor neurons, the total spinal ventral horn homogenates demonstrated 0.7% and 0.2% significant upregulation and downregulation of gene expression, respectively. Downregulated genes in motor neurons included those associated with cytoskeleton/axonal transport, transcription and cell surface antigens/receptors, such as dynactin 1 (DCTN1) and early growth response 3 (EGR3). In particular, DCTN1 was markedly downregulated in most residual motor neurons prior to the accumulation of pNF-H and ubiquitylated protein. Promoters for cell death pathway, death receptor 5 (DR5), cyclins C (CCNC) and A1 (CCNA), and caspases were upregulated, whereas cell death inhibitors, acetyl-CoA transporter (ACATN) and NF-kappaB (NFKB) were also upregulated. In terms of spinal ventral horn, the expression of genes related to cell surface antigens/receptors, transcription and cell adhesion/ECM were increased. The gene expression resulting in neurodegenerative and neuroprotective changes were both present in spinal motor neurons and ventral horn. Moreover, Inflammation-related genes, such as belonging to the cytokine family were not, however, significantly upregulated in either motor neurons or ventral horn. The sequence of motor neuron-specific gene expression changes from early DCTN1 downregulation to late CCNC upregulation in sporadic ALS can provide direct information on the genes leading to neurodegeneration and neuronal death, and are helpful

  5. Using GenePattern for Gene Expression Analysis (United States)

    Kuehn, Heidi; Liberzon, Arthur; Reich, Michael; Mesirov, Jill P.


    The abundance of genomic data now available in biomedical research has stimulated the development of sophisticated statistical methods for interpreting the data, and of special visualization tools for displaying the results in a concise and meaningful manner. However, biologists often find these methods and tools difficult to understand and use correctly. GenePattern is a freely available software package that addresses this issue by providing more than 100 analysis and visualization tools for genomic research in a comprehensive user-friendly environment for users at all levels of computational experience and sophistication. This unit demonstrates how to prepare and analyze microarray data in GenePattern. PMID:18551415

  6. Integrated analysis of DNA copy number and gene expression microarray data using gene sets

    NARCIS (Netherlands)

    R.X. de Menezes (Renee); M. Boetzer (Marten); M. Sieswerda (Melle); G.J.B. van Ommen; J.M. Boer (Judith)


    textabstractBackground: Genes that play an important role in tumorigenesis are expected to show association between DNA copy number and RNA expression. Optimal power to find such associations can only be achieved if analysing copy number and gene expression jointly. Furthermore, some copy number

  7. Oncopression: gene expression compendium for cancer with matched normal tissues. (United States)

    Lee, Jungsul; Choi, Chulhee


    Expression profile of normal tissue is primary source to find genes showing aberrant expression pattern specific in matched cancer tissue, but sample number of normal control in public gene expression repositories is disproportionally small compared to cancer and scattered in several datasets. We built oncopression by integrating several datasets into one large dataset for comprehensive analysis about 25 types of human cancers including 20 640 cancer samples and 6801 normal control profiles. Expression profiles in cancers can be directly compared to normal tissue counterparts. Validity of the integration was tested using immunohistochemical staining results and principal component analysis. We have utilized the pre-release version of oncopression to identify cancer-specific genes in several studies. Free access at and all expression data are available for download at the site. or Supplementary data are available at Bioinformatics online.

  8. Digital Gene Expression Profiling to Explore Differentially Expressed Genes Associated with Terpenoid Biosynthesis during Fruit Development in Litsea cubeba. (United States)

    Gao, Ming; Lin, Liyuan; Chen, Yicun; Wang, Yangdong


    Mountain pepper (Litseacubeba (Lour.) Pers.) (Lauraceae) is an important industrial crop as an ingredient in cosmetics, pesticides, food additives and potential biofuels. These properties are attributed to monoterpenes and sesquiterpenes. However, there is still no integrated model describing differentially expressed genes (DEGs) involved in terpenoid biosynthesis during the fruit development of L. cubeba. Here, we performed digital gene expression (DGE) using the Illumina NGS platform to evaluated changes in gene expression during fruit development in L. cubeba. DGE generated expression data for approximately 19354 genes. Fruit at 60 days after flowering (DAF) served as the control, and a total of 415, 1255, 449 and 811 up-regulated genes and 505, 1351, 1823 and 1850 down-regulated genes were identified at 75, 90, 105 and 135 DAF, respectively. Pathway analysis revealed 26 genes involved in terpenoid biosynthesis pathways. Three DEGs had continued increasing or declining trends during the fruit development. The quantitative real-time PCR (qRT-PCR) results of five differentially expressed genes were consistent with those obtained from Illumina sequencing. These results provide a comprehensive molecular biology background for research on fruit development, and information that should aid in metabolic engineering to increase the yields of L. cubeba essential oil.

  9. Relating Perturbation Magnitude to Temporal Gene Expression in Biological Systems

    Energy Technology Data Exchange (ETDEWEB)

    Callister, Stephen J.; Parnell, John J.; Pfrender, Michael E.; Hashsham, Syed


    A method to quantitatively relate stress to response at the level of gene expression is described using Saccharomyces cerevisiae as a model organism. Stress was defined as the magnitude of perturbation and strain was defined as the magnitude of cumulative response in terms of gene expression. Expression patterns of sixty genes previously reported to be significantly impacted by osmotic shock or belonging to the high-osmotic glycerol, glycerolipid metabolism, and glycolysis pathways were determined following perturbations of increasing sodium chloride concentrations (0, 0.5, 0.7, 1.0, 1.5, and 1.4 M). Expression of these genes was quantified temporally using reverse transcriptase real time polymerase chain reaction. The magnitude of cumulative response was obtained by calculating the total moment of area of the temporal response envelope for all the 60 genes, either together or for the set of genes related to each pathway. A non-linear relationship between stress and response was observed for the range of stress studied. This study examines a quantitative approach to quantify the strain at the level of gene expression to relate stress to strain in biological systems. The approach should be generally applicable to quantitatively evaluate the response of organisms to environmental change.

  10. Distribution of population averaged observables in stochastic gene expression (United States)

    Bhattacharyya, Bhaswati; Kalay, Ziya


    Observation of phenotypic diversity in a population of genetically identical cells is often linked to the stochastic nature of chemical reactions involved in gene regulatory networks. We investigate the distribution of population averaged gene expression levels as a function of population, or sample size for several stochastic gene expression models to find out to what extent population averaged quantities reflect the underlying mechanism of gene expression. We consider three basic gene regulation networks corresponding to transcription with and without gene state switching and translation. Using analytical expressions for the probability generating function (pgf) of observables and Large Deviation Theory, we calculate the distribution of population averaged mRNA and protein levels as a function of model parameters and population size. We validate our results using stochastic simulations also report exact results on the asymptotic properties of population averages which show qualitative differences for different models. We calculate the skewness and coefficient of variance for pgfs to estimate the sample size required for population average that contains information about gene expression models. This is relevant to experiments where a large number of data points are unavailable.

  11. A Rough Set based Gene Expression Clustering Algorithm

    Directory of Open Access Journals (Sweden)

    J. J. Emilyn


    Full Text Available Problem statement: Microarray technology helps in monitoring the expression levels of thousands of genes across collections of related samples. Approach: The main goal in the analysis of large and heterogeneous gene expression datasets was to identify groups of genes that get expressed in a set of experimental conditions. Results: Several clustering techniques have been proposed for identifying gene signatures and to understand their role and many of them have been applied to gene expression data, but with partial success. The main aim of this work was to develop a clustering algorithm that would successfully indentify gene patterns. The proposed novel clustering technique (RCGED provides an efficient way of finding the hidden and unique gene expression patterns. It overcomes the restriction of one object being placed in only one cluster. Conclusion/Recommendations: The proposed algorithm is termed intelligent because it automatically determines the optimum number of clusters. The proposed algorithm was experimented with colon cancer dataset and the results were compared with Rough Fuzzy K Means algorithm.

  12. Ebola virus infection induces irregular dendritic cell gene expression. (United States)

    Melanson, Vanessa R; Kalina, Warren V; Williams, Priscilla


    Filoviruses subvert the human immune system in part by infecting and replicating in dendritic cells (DCs). Using gene arrays, a phenotypic profile of filovirus infection in human monocyte-derived DCs was assessed. Monocytes from human donors were cultured in GM-CSF and IL-4 and were infected with Ebola virus Kikwit variant for up to 48 h. Extracted DC RNA was analyzed on SuperArray's Dendritic and Antigen Presenting Cell Oligo GEArray and compared to uninfected controls. Infected DCs exhibited increased expression of cytokine, chemokine, antiviral, and anti-apoptotic genes not seen in uninfected controls. Significant increases of intracellular antiviral and MHC I and II genes were also noted in EBOV-infected DCs. However, infected DCs failed to show any significant difference in co-stimulatory T-cell gene expression from uninfected DCs. Moreover, several chemokine genes were activated, but there was sparse expression of chemokine receptors that enabled activated DCs to home to lymph nodes. Overall, statistically significant expression of several intracellular antiviral genes was noted, which may limit viral load but fails to stop replication. EBOV gene expression profiling is of vital importance in understanding pathogenesis and devising novel therapeutic treatments such as small-molecule inhibitors.

  13. Relationships between PROMPT and gene expression

    DEFF Research Database (Denmark)

    Llinares, Marta Lloret; Mapendano, Christophe K; Martlev, Lasse H;


    Most mammalian protein-coding gene promoters are divergent, yielding promoter upstream transcripts (PROMPTs) in the reverse direction from their conventionally produced mRNAs. PROMPTs are rapidly degraded by the RNA exosome rendering a general function of these molecules elusive. Yet, levels...... of certain PROMPTs are altered in stress conditions, like the DNA damage response (DDR), suggesting a possible regulatory role for at least a subset of these molecules. Here we manipulate PROMPT levels by either exosome depletion or UV treatment and analyze possible effects on their neighboring genes...

  14. Paternal irradiation perturbs the expression of circadian genes in offspring

    Energy Technology Data Exchange (ETDEWEB)

    Gomes, Andre M.G.F.; Barber, Ruth C.; Dubrova, Yuri E., E-mail:


    Highlights: • We have analysed gene expression in the offspring of irradiated male mice. • CBA/Ca and BALB/c male mice were used in our study. • The pattern of gene expression was established in four tissues. • Expression of genes in involved in rhythmic process/circadian rhythm is compromised. • Our data may explain the phenomenon of transgenerational genomic instability. - Abstract: The circadian system represents a complex network which influences the timing of many biological processes. Recent studies have established that circadian alterations play an important role in the susceptibility to many human diseases, including cancer. Here we report that paternal irradiation in mice significantly affects the expression of genes involved in rhythmic processes in their first-generation offspring. Using microarrays, the patterns of gene expression were established for brain, kidney, liver and spleen samples from the non-exposed offspring of irradiated CBA/Ca and BALB/c male mice. The most over-represented categories among the genes differentially expressed in the offspring of control and irradiated males were those involved in rhythmic process, circadian rhythm and DNA-dependent regulation of transcription. The results of our study therefore provide a plausible explanation for the transgenerational effects of paternal irradiation, including increased transgenerational carcinogenesis described in other studies.

  15. Detecting Periodic Genes from Irregularly Sampled Gene Expressions: A Comparison Study

    Directory of Open Access Journals (Sweden)

    Edward R. Dougherty


    Full Text Available Time series microarray measurements of gene expressions have been exploited to discover genes involved in cell cycles. Due to experimental constraints, most microarray observations are obtained through irregular sampling. In this paper three popular spectral analysis schemes, namely, Lomb-Scargle, Capon and missing-data amplitude and phase estimation (MAPES, are compared in terms of their ability and efficiency to recover periodically expressed genes. Based on in silico experiments for microarray measurements of Saccharomyces cerevisiae, Lomb-Scargle is found to be the most efficacious scheme. 149 genes are then identified to be periodically expressed in the Drosophila melanogaster data set.

  16. Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development. (United States)

    Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Zhao, Liqiang; Cheng, Fei; Huang, Yuan; Bie, Zhilong


    Gene expression analysis in watermelon (Citrullus lanatus) fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR) is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC), β-actin (ClACT), and alpha tubulin 5 (ClTUA5) as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND) was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1), a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

  17. Importance of globin gene order for correct developmental expression.

    NARCIS (Netherlands)

    O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)


    textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the

  18. Gene expression profiling of chicken intestinal host responses

    NARCIS (Netherlands)

    Hemert, van S.


    Chicken lines differ in genetic disease susceptibility. The scope of the research described in this thesis was to identify genes involved in genetic disease resistance in the chicken intestine. Therefore gene expression in the jejunum was investigated using a microarray approach. An intestine specif

  19. Gene Expression Signature in Endemic Osteoarthritis by Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Xi Wang


    Full Text Available Kashin-Beck Disease (KBD is an endemic osteochondropathy with an unknown pathogenesis. Diagnosis of KBD is effective only in advanced cases, which eliminates the possibility of early treatment and leads to an inevitable exacerbation of symptoms. Therefore, we aim to identify an accurate blood-based gene signature for the detection of KBD. Previously published gene expression profile data on cartilage and peripheral blood mononuclear cells (PBMCs from adults with KBD were compared to select potential target genes. Microarray analysis was conducted to evaluate the expression of the target genes in a cohort of 100 KBD patients and 100 healthy controls. A gene expression signature was identified using a training set, which was subsequently validated using an independent test set with a minimum redundancy maximum relevance (mRMR algorithm and support vector machine (SVM algorithm. Fifty unique genes were differentially expressed between KBD patients and healthy controls. A 20-gene signature was identified that distinguished between KBD patients and controls with 90% accuracy, 85% sensitivity, and 95% specificity. This study identified a 20-gene signature that accurately distinguishes between patients with KBD and controls using peripheral blood samples. These results promote the further development of blood-based genetic biomarkers for detection of KBD.


    Normal Nasal Gene Expression Levels Using cDNA Array Technology. The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...

  1. Genome polymorphism markers and stress genes expression for ...

    African Journals Online (AJOL)



    Jun 11, 2014 ... environmental stress through investigating SOD and PAL gene expression and also the genetic relationship .... obtained from the gene bank ( under accession number ... stored at -20°C for further work. Primers ...

  2. Paralogous Genes as a Tool to Study the Regulation of Gene Expression

    DEFF Research Database (Denmark)

    Hoffmann, Robert D

    The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... new functions, or their gene products are in a dosage balance. Regulatory DNA elements - some of which are conserved across species and hence called conserved non-coding sequences (CNSs) - that control expression of duplicated genes are thus under similar purifying selection. In the present study, I...... have performed in-depth analyses of paralogous genes in Arabidopsis thaliana, their expression profile, their sequence conservation, and their functions, in order to investigate the relationship between gene expression and retention of paralogous genes. Paralogs with lower expression than...

  3. Gene expression of the mismatch repair gene MSH2 in primary colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Lars Henrik; Kuramochi, Hidekazu; Crüger, Dorthe Gylling


    Microsatellite instability (MSI) is caused by defective mismatch repair (MMR) and is one of the very few molecular markers with proven clinical importance in colorectal cancer with respect to heredity, prognosis, and treatment effect. The gene expression of the MMR gene MSH2 may be a quantitative...... marker for the level of MMR and a potential molecular marker with clinical relevance. The aim was to investigate the gene expression of MSH2 in primary operable colorectal cancer in correlation with MSI, protein expression, and promoter hypermethylation. In a cohort of 210 patients, the primary tumor...... and lymphnode metastases were analyzed with immunohistochemistry, methylation and MSI analyses, and quantitative polymerase chain reaction (PCR). The median gene expression of MSH2 was 1.00 (range 0.16-11.2, quartiles 0.70-1.51) and there was good agreement between the gene expression in primary tumor and lymph...

  4. Cellular phenotype-dependent and -independent effects of vitamin C on the renewal and gene expression of mouse embryonic fibroblasts.

    Directory of Open Access Journals (Sweden)

    Shiu-Ming Kuo

    Full Text Available Vitamin C has been shown to delay the cellular senescence and was considered a candidate for chemoprevention and cancer therapy. To understand the reported contrasting roles of vitamin C: growth-promoting in the primary cells and growth-inhibiting in cancer cells, primary mouse embryonic fibroblasts (MEF and their isogenic spontaneously immortalized fibroblasts with unlimited cell division potential were used as the model pair. We used microarray gene expression profiling to show that the immortalized MEF possess human cancer gene expression fingerprints including a pattern of up-regulation of inflammatory response-related genes. Using the MEF model, we found that a physiological treatment level of vitamin C (10(-5 M, but not other unrelated antioxidants, enhanced cell growth. The growth-promoting effect was associated with a pattern of enhanced expression of cell cycle- and cell division-related genes in both primary and immortalized cells. In the immortalized MEF, physiological treatment levels of vitamin C also enhanced the expression of immortalization-associated genes including a down-regulation of genes in the extracellular matrix functional category. In contrast, confocal immunofluorescence imaging of the primary MEF suggested an increase in collagen IV protein upon vitamin C treatment. Similar to the cancer cells, the growth-inhibitory effect of the redox-active form of vitamin C was preferentially observed in immortalized MEF. All effects of vitamin C required its intracellular presence since the transporter-deficient SVCT2-/- MEF did not respond to vitamin C. SVCT2-/- MEF divided and became immortalized readily indicating little dependence on vitamin C for the cell division. Immortalized SVCT2-/- MEF required higher concentration of vitamin C for the growth inhibition compared to the immortalized wildtype MEF suggesting an intracellular vitamin C toxicity. The relevance of our observation in aging and human cancer prevention was

  5. The Medicago truncatula gene expression atlas web server

    Directory of Open Access Journals (Sweden)

    Tang Yuhong


    Full Text Available Abstract Background Legumes (Leguminosae or Fabaceae play a major role in agriculture. Transcriptomics studies in the model legume species, Medicago truncatula, are instrumental in helping to formulate hypotheses about the role of legume genes. With the rapid growth of publically available Affymetrix GeneChip Medicago Genome Array GeneChip data from a great range of tissues, cell types, growth conditions, and stress treatments, the legume research community desires an effective bioinformatics system to aid efforts to interpret the Medicago genome through functional genomics. We developed the Medicago truncatula Gene Expression Atlas (MtGEA web server for this purpose. Description The Medicago truncatula Gene Expression Atlas (MtGEA web server is a centralized platform for analyzing the Medicago transcriptome. Currently, the web server hosts gene expression data from 156 Affymetrix GeneChip® Medicago genome arrays in 64 different experiments, covering a broad range of developmental and environmental conditions. The server enables flexible, multifaceted analyses of transcript data and provides a range of additional information about genes, including different types of annotation and links to the genome sequence, which help users formulate hypotheses about gene function. Transcript data can be accessed using Affymetrix probe identification number, DNA sequence, gene name, functional description in natural language, GO and KEGG annotation terms, and InterPro domain number. Transcripts can also be discovered through co-expression or differential expression analysis. Flexible tools to select a subset of experiments and to visualize and compare expression profiles of multiple genes have been implemented. Data can be downloaded, in part or full, in a tabular form compatible with common analytical and visualization software. The web server will be updated on a regular basis to incorporate new gene expression data and genome annotation, and is accessible

  6. Gene expression of beta carotene genes in transgenic biofortified cassava


    Telengech, P. K.; Maling’a, J. N.; Nyende, A. B.; Gichuki, S. T.; Wanjala, B. W.


    Cassava is an important food for millions of people around the world. However, cassava is deficient in protein, iron, zinc, pro-vitamin A and vitamin E. Cassava biofortified with pro-vitamin A can help reduce Vitamin A Deficiency among the undernourished communities that rely upon it for sustenance. BioCassava Plus project has developed transgenic cassava that expresses beta carotene in roots using root specific patatin promoter. This study aimed at confirming expression of nptII, crtB and DX...

  7. Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter (United States)

    Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...

  8. The mouse Gene Expression Database (GXD): 2017 update (United States)

    Finger, Jacqueline H.; Smith, Constance M.; Hayamizu, Terry F.; McCright, Ingeborg J.; Xu, Jingxia; Law, Meiyee; Shaw, David R.; Baldarelli, Richard M.; Beal, Jon S.; Blodgett, Olin; Campbell, Jeff W.; Corbani, Lori E.; Lewis, Jill R.; Forthofer, Kim L.; Frost, Pete J.; Giannatto, Sharon C.; Hutchins, Lucie N.; Miers, Dave B.; Motenko, Howie; Stone, Kevin R.; Eppig, Janan T.; Kadin, James A.; Richardson, Joel E.; Ringwald, Martin


    The Gene Expression Database (GXD; is an extensive and well-curated community resource of mouse developmental expression information. Through curation of the scientific literature and by collaborations with large-scale expression projects, GXD collects and integrates data from RNA in situ hybridization, immunohistochemistry, RT-PCR, northern blot and western blot experiments. Expression data from both wild-type and mutant mice are included. The expression data are combined with genetic and phenotypic data in Mouse Genome Informatics (MGI) and made readily accessible to many types of database searches. At present, GXD includes over 1.5 million expression results and more than 300 000 images, all annotated with detailed and standardized metadata. Since our last report in 2014, we have added a large amount of data, we have enhanced data and database infrastructure, and we have implemented many new search and display features. Interface enhancements include: a new Mouse Developmental Anatomy Browser; interactive tissue-by-developmental stage and tissue-by-gene matrix views; capabilities to filter and sort expression data summaries; a batch search utility; gene-based expression overviews; and links to expression data from other species. PMID:27899677

  9. Advanced fingerprint verification software (United States)

    Baradarani, A.; Taylor, J. R. B.; Severin, F.; Maev, R. Gr.


    We have developed a fingerprint software package that can be used in a wide range of applications from law enforcement to public and private security systems, and to personal devices such as laptops, vehicles, and door- locks. The software and processing units are a unique implementation of new and sophisticated algorithms that compete with the current best systems in the world. Development of the software package has been in line with the third generation of our ultrasonic fingerprinting machine1. Solid and robust performance is achieved in the presence of misplaced and low quality fingerprints.

  10. Analysis of gene expression during neurite outgrowth and regeneration

    Directory of Open Access Journals (Sweden)

    Tai Yu


    Full Text Available Abstract Background The ability of a neuron to regenerate functional connections after injury is influenced by both its intrinsic state and also by extrinsic cues in its surroundings. Investigations of the transcriptional changes undergone by neurons during in vivo models of injury and regeneration have revealed many transcripts associated with these processes. Because of the complex milieu of interactions in vivo, these results include not only expression changes directly related to regenerative outgrowth and but also unrelated responses to surrounding cells and signals. In vitro models of neurite outgrowth provide a means to study the intrinsic transcriptional patterns of neurite outgrowth in the absence of extensive extrinsic cues from nearby cells and tissues. Results We have undertaken a genome-wide study of transcriptional activity in embryonic superior cervical ganglia (SCG and dorsal root ganglia (DRG during a time course of neurite outgrowth in vitro. Gene expression observed in these models likely includes both developmental gene expression patterns and regenerative responses to axotomy, which occurs as the result of tissue dissection. Comparison across both models revealed many genes with similar gene expression patterns during neurite outgrowth. These patterns were minimally affected by exposure to the potent inhibitory cue Semaphorin3A, indicating that this extrinsic cue does not exert major effects at the level of nuclear transcription. We also compared our data to several published studies of DRG and SCG gene expression in animal models of regeneration, and found the expression of a large number of genes in common between neurite outgrowth in vitro and regeneration in vivo. Conclusion Many gene expression changes undergone by SCG and DRG during in vitro outgrowth are shared between these two tissue types and in common with in vivo regeneration models. This suggests that the genes identified in this in vitro study may represent new

  11. Differential Gene Expression in Chemically Induced Mouse Lung Adenomas

    Directory of Open Access Journals (Sweden)

    Ruisheng Yao


    Full Text Available Because of similarities in histopathology and tumor progression stages between mouse and human lung adenocarcinomas, the mouse lung tumor model with lung adenomas as the endpoint has been used extensively to evaluate the efficacy of putative lung cancer chemopreventive agents. In this study, a competitive cDNA library screening (CCLS was employed to determine changes in the expression of mRNA in chemically induced lung adenomas compared with paired normal lung tissues. A total of 2555 clones having altered expression in tumors were observed following competitive hybridization between normal lung and lung adenomas after primary screening of over 160,000 clones from a mouse lung cDNA library. Among the 755 clones confirmed by dot blot hybridization, 240 clones were underexpressed, whereas 515 clones were overexpressed in tumors. Sixty-five clones with the most frequently altered expression in six individual tumors were confirmed by semiquantitative RT-PCR. When examining the 58 known genes, 39 clones had increased expression and 19 had decreased expression, whereas the 7 novel genes showed overexpression. A high percentage (>60% of overexpressed or underexpressed genes was observed in at least two or three of the lesions. Reproducibly overexpressed genes included ERK-1, JAK-1, surfactant proteins A, B, and C, NFAT1, α-1 protease inhibitor, helix-loop-helix ubiquitous kinase (CHUK, α-adaptin, α-1 PI2, thioether S-methyltransferase, and CYP2C40. Reproducibly underexpressed genes included paroxanase, ALDH II, CC10, von Ebner salivary gland protein, and α- and β-globin. In addition, CCLS identified several novel genes or genes not previously associated with lung carcinogenesis, including a hypothetical protein (FLJ11240 and a guanine nucleotide exchange factor homologue. This study shows the efficacy of this methodology for identifying genes with altered expression. These genes may prove to be helpful in our understanding of the genetic basis of

  12. Hypergravity-induced changes in gene expression in Arabidopsis hypocotyls. (United States)

    Yoshioka, R; Soga, K; Wakabayashi, K; Takeba, G; Hoson, T


    Under hypergravity conditions, the cell wall of stem organs becomes mechanically rigid and elongation growth is suppressed, which can be recognized as the mechanism for plants to resist gravitational force. The changes in gene expression by hypergravity treatment were analyzed in Arabidopsis hypocotyls by the differential display method, for identifying genes involved in hypergravity-induced growth suppression. Sixty-two cDNA clones were expressed differentially between the control and 300 g conditions: the expression levels of 39 clones increased, whereas those of 23 clones decreased under hypergravity conditions. Sequence analysis and database searching revealed that 12 clones, 9 up-regulated and 3 down-regulated, have homology to known proteins. The expression of these genes was further analyzed using RT-PCR. Finally, six genes were confirmed to be up-regulated by hypergravity. One of such genes encoded 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGR), which catalyzes a reaction producing mevalonic acid, a key precursor of terpenoids such as membrane sterols and several types of hormones. The expression of HMGR gene increased within several hours after hypergravity treatment. Also, compactin, an inhibitor of HMGR, prevented hypergravity-induced growth suppression, suggesting that HMGR is involved in suppression of Arabidopsis hypocotyl growth by hypergravity. In addition, hypergravity increased the expression levels of genes encoding CCR1 and ERD15, which were shown to take part in the signaling pathway of environmental stimuli such as temperature and water, and those of the alpha-tubulin gene. These genes may be involved in a series of cellular events leading to growth suppression of stem organs under hypergravity conditions.

  13. Salmonella induces prominent gene expression in the rat colon

    Directory of Open Access Journals (Sweden)

    Roosing Susanne


    Full Text Available Abstract Background Salmonella enteritidis is suggested to translocate in the small intestine. In vivo it induces gene expression changes in the ileal mucosa and Peyer's patches. Stimulation of Salmonella translocation by dietary prebiotics fermented in colon suggests involvement of the colon as well. However, effects of Salmonella on colonic gene expression in vivo are largely unknown. We aimed to characterize time dependent Salmonella-induced changes of colonic mucosal gene expression in rats using whole genome microarrays. For this, rats were orally infected with Salmonella enteritidis to mimic a foodborne infection and colonic gene expression was determined at days 1, 3 and 6 post-infection (n = 8 rats per time-point. As fructo-oligosaccharides (FOS affect colonic physiology, we analyzed colonic mucosal gene expression of FOS-fed versus cellulose-fed rats infected with Salmonella in a separate experiment. Colonic mucosal samples were isolated at day 2 post-infection. Results Salmonella affected transport (e.g. Chloride channel calcium activated 6, H+/K+ transporting Atp-ase, antimicrobial defense (e.g. Lipopolysaccharide binding protein, Defensin 5 and phospholipase A2, inflammation (e.g. calprotectin, oxidative stress related genes (e.g. Dual oxidase 2 and Glutathione peroxidase 2 and Proteolysis (e.g. Ubiquitin D and Proteosome subunit beta type 9. Furthermore, Salmonella translocation increased serum IFNγ and many interferon-related genes in colonic mucosa. The gene most strongly induced by Salmonella infection was Pancreatitis Associated Protein (Pap, showing >100-fold induction at day 6 after oral infection. Results were confirmed by Q-PCR in individual rats. Stimulation of Salmonella translocation by dietary FOS was accompanied by enhancement of the Salmonella-induced mucosal processes, not by induction of other processes. Conclusion We conclude that the colon is a target tissue for Salmonella, considering the abundant changes in

  14. VESPUCCI: exploring patterns of gene expression in grapevine

    Directory of Open Access Journals (Sweden)

    Marco eMoretto


    Full Text Available Large-scale transcriptional studies aim to decipher the dynamic cellular responses to a stimulus, like different environmental conditions. In the era of high-throughput omics biology, the most used technologies for these purposes are microarray and RNA-Seq, whose data are usually required to be deposited in public repositories upon publication. Such repositories have the enormous potential to provide a comprehensive view of how different experimental conditions lead to expression changes, by comparing gene expression across all possible measured conditions. Unfortunately, this task is greatly impaired by differences among experimental platforms that make direct comparisons difficult.In this paper we present the Vitis Expression Studies Platform Using COLOMBOS Compendia Instances (VESPUCCI, a gene expression compendium for grapevine which was built by adapting an approach originally developed for bacteria, and show how it can be used to investigate complex gene expression patterns. We integrated nearly all publicly available microarray and RNA-Seq expression data: 1608 gene expression samples from 10 different technological platforms. Each sample has been manually annotated using a controlled vocabulary developed ad hoc to ensure both human readability and computational tractability. Expression data in the compendium can be visually explored using several tools provided by the web interface or can be programmatically accessed using the REST interface. VESPUCCI is freely accessible at

  15. Gene-expression Classifier in Papillary Thyroid Carcinoma

    DEFF Research Database (Denmark)

    Londero, Stefano Christian; Jespersen, Marie Louise; Krogdahl, Annelise;


    BACKGROUND: No reliable biomarker for metastatic potential in the risk stratification of papillary thyroid carcinoma exists. We aimed to develop a gene-expression classifier for metastatic potential. MATERIALS AND METHODS: Genome-wide expression analyses were used. Development cohort: freshly...

  16. Gene expression in primate liver during viral hemorrhagic fever

    Directory of Open Access Journals (Sweden)

    Bryant Joseph


    Full Text Available Abstract Background Rhesus macaques infected with lymphocytic choriomeningitis virus (LCMV provide a model for human Lassa fever. Disease begins with flu-like symptoms and progresses rapidly with fatal consequences. Previously, we profiled the blood transcriptome of LCMV-infected monkeys (M. Djavani et al J. Virol. 2007 showing distinct pre-viremic and viremic stages that discriminated virulent from benign infections. In the present study, changes in liver gene expression from macaques infected with virulent LCMV-WE were compared to gene expression in uninfected monkeys as well as to monkeys that were infected but not diseased. Results Based on a functional pathway analysis of differentially expressed genes, virulent LCMV-WE had a broader effect on liver cell function than did infection with non-virulent LCMV-Armstrong. During the first few days after infection, LCMV altered expression of genes associated with energy production, including fatty acid and glucose metabolism. The transcriptome profile resembled that of an organism in starvation: mRNA for acetyl-CoA carboxylase, a key enzyme of fatty acid synthesis was reduced while genes for enzymes in gluconeogenesis were up-regulated. Expression was also altered for genes associated with complement and coagulation cascades, and with signaling pathways involving STAT1 and TGF-β. Conclusion Most of the 4500 differentially expressed transcripts represented a general response to both virulent and mild infections. However, approximately 250 of these transcripts had significantly different expression in virulent infections as compared to mild infections, with approximately 30 of these being differentially regulated during the pre-viremic stage of infection. The genes that are expressed early and differently in mild and virulent disease are potential biomarkers for prognosis and triage of acute viral disease.

  17. Conditional gene expression in the mouse using a Sleeping Beauty gene-trap transposon

    Directory of Open Access Journals (Sweden)

    Hackett Perry B


    Full Text Available Abstract Background Insertional mutagenesis techniques with transposable elements have been popular among geneticists studying model organisms from E. coli to Drosophila and, more recently, the mouse. One such element is the Sleeping Beauty (SB transposon that has been shown in several studies to be an effective insertional mutagen in the mouse germline. SB transposon vector studies have employed different functional elements and reporter molecules to disrupt and report the expression of endogenous mouse genes. We sought to generate a transposon system that would be capable of reporting the expression pattern of a mouse gene while allowing for conditional expression of a gene of interest in a tissue- or temporal-specific pattern. Results Here we report the systematic development and testing of a transposon-based gene-trap system incorporating the doxycycline-repressible Tet-Off (tTA system that is capable of activating the expression of genes under control of a Tet response element (TRE promoter. We demonstrate that the gene trap system is fully functional in vitro by introducing the "gene-trap tTA" vector into human cells by transposition and identifying clones that activate expression of a TRE-luciferase transgene in a doxycycline-dependent manner. In transgenic mice, we mobilize gene-trap tTA vectors, discover parameters that can affect germline mobilization rates, and identify candidate gene insertions to demonstrate the in vivo functionality of the vector system. We further demonstrate that the gene-trap can act as a reporter of endogenous gene expression and it can be coupled with bioluminescent imaging to identify genes with tissue-specific expression patterns. Conclusion Akin to the GAL4/UAS system used in the fly, we have made progress developing a tool for mutating and revealing the expression of mouse genes by generating the tTA transactivator in the presence of a secondary TRE-regulated reporter molecule. A vector like the gene

  18. The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gutiérrez Rodrigo A


    Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

  19. Patterns of expression of cell wall related genes in sugarcane

    Directory of Open Access Journals (Sweden)

    Lima D.U.


    Full Text Available Our search for genes related to cell wall metabolism in the sugarcane expressed sequence tag (SUCEST database ( resulted in 3,283 reads (1% of the total reads which were grouped into 459 clusters (potential genes with an average of 7.1 reads per cluster. To more clearly display our correlation coefficients, we constructed surface maps which we used to investigate the relationship between cell wall genes and the sugarcane tissues libraries from which they came. The only significant correlations that we found between cell wall genes and/or their expression within particular libraries were neutral or synergetic. Genes related to cellulose biosynthesis were from the CesA family, and were found to be the most abundant cell wall related genes in the SUCEST database. We found that the highest number of CesA reads came from the root and stem libraries. The genes with the greatest number of reads were those involved in cell wall hydrolases (e.g. beta-1,3-glucanases, xyloglucan endo-beta-transglycosylase, beta-glucosidase and endo-beta-mannanase. Correlation analyses by surface mapping revealed that the expression of genes related to biosynthesis seems to be associated with the hydrolysis of hemicelluloses, pectin hydrolases being mainly associated with xyloglucan hydrolases. The patterns of cell wall related gene expression in sugarcane based on the number of reads per cluster reflected quite well the expected physiological characteristics of the tissues. This is the first work to provide a general view on plant cell wall metabolism through the expression of related genes in almost all the tissues of a plant at the same time. For example, developing flowers behaved similarly to both meristematic tissues and leaf-root transition zone tissues. Besides providing a basis for future research on the mechanisms of plant development which involve the cell wall, our findings will provide valuable tools for plant engineering in the

  20. Repressor-mediated tissue-specific gene expression in plants (United States)

    Meagher, Richard B.; Balish, Rebecca S.; Tehryung, Kim; McKinney, Elizabeth C.


    Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

  1. Analysis of Gene Expression Responses to a Infection in Rugao Chicken Intestine Using GeneChips

    Directory of Open Access Journals (Sweden)

    D. Q. Luan


    Full Text Available Poultry products are an important source of Salmonella enterica. An effective way to reduce food poisoning due to Salmonella would be to breed chickens more resistant to infection. Unfortunately host responses to Salmonella are complex with many factors involved. To learn more about responses to Salmonella in young chickens of 2 wk old, a cDNA Microarray containing 13,319 probes was performed to compare gene expression profiles between two chicken groups under control and Salmonella infected conditions. Newly hatched chickens were orally infected with S. enterica serovar Enteritidis. Since the intestine is one of the important barriers the bacteria encounter after oral inoculation, intestine gene expression was investigated at 2 wk old. There were 588 differentially expressed genes detected, of which 276 were known genes, and of the total number 266 were up-regulated and 322 were down-regulated. Differences in gene expression between the two chicken groups were found in control as well as Salmonella infected conditions indicating a difference in the intestine development between the two chicken groups which might be linked to the difference in Salmonella susceptibility. The differential expressions of 4 genes were confirmed by quantitative real-time PCR and the results indicated that the expression changes of these genes were generally consistent with the results of GeneChips. The findings in this study have lead to the identification of novel genes and possible cellular pathways, which are host dependent.

  2. Identification of housekeeping genes suitable for gene expression analysis in Jian carp (Cyprinus carpio var. jian). (United States)

    Tang, Yong-kai; Yu, Ju-hua; Xu, Pao; Li, Jian-lin; Li, Hong-xia; Ren, Hong-tao


    Jian carp (Cyprinus carpio var. jian) is an important economic fish species cultured in China. In this report, we performed a systematic analysis to identify an appropriate housekeeping (HK) gene for the study of gene expression in Jian carp. For this purpose, partial DNA sequences of four potential candidate genes (elongation factor 1 alpha (EF-1α), glyceraldehyde-3-phosphate (GAPDH), beta-actin (ACTB), and 18S ribosomal RNA (18S rRNA) were isolated, and their expression levels were studied using RNA extracted from nine tissues (forebrain, hypothalamus, liver, fore-intestine, hind-intestine, ovary, muscle, heart, kidney) in juvenile and adult Jian carp. Gene expression levels were quantified by quantitative real time RT-PCR (qRT-PCR), and expression stability was evaluated by comparing the coefficients of variation (CV) of the Ct values. The results showed that EF-1α was the most suitable HK gene in all tissues of juvenile and adult Jian carp. However, at distinct juvenile and adult developmental stages, there was not a single optimal gene for normalization of expression levels in all tissues. EF-1α was the most stable gene only in forebrain, hypothalamus, liver, heart, and kidney. These results provide data that can be expected to aid gene expression analysis in Jian carp research, but underline the importance of identifying the optimal HK gene for each new experimental paradigm.

  3. In situ gene expression and ecophysiology of thermophilic Cyanobacteria

    DEFF Research Database (Denmark)

    Jensen, Sheila Ingemann

    -378), the expression patterns of various functional genes (with an emphasis on nif genes involved in N2-fixation), the protein levels of nitrogenase (NifH), the N2-fixation activity, as well as microsensor based measurements on O2 availability, production and consumption were investigated in situ over the entire diel...... cycle. Interestingly, it was found that while the nif genes are expressed, and nitrogenase is synthesized once the mat gets anoxic in the early evening, the largest N2-fixation activity occurs as a burst during dim light in the early morning, albeit protein levels remained high over the entire course...

  4. Gene expression changes in chronic inflammatory demyelinating polyneuropathy skin biopsies. (United States)

    Puttini, Stefania; Panaite, Petrica-Adrian; Mermod, Nicolas; Renaud, Susanne; Steck, Andreas J; Kuntzer, Thierry


    Chronic-inflammatory demyelinating polyneuropathy (CIDP) is an immune-mediated disease with no known biomarkers for diagnosing the disease or assessing its prognosis. We performed transcriptional profiling microarray analysis on skin punch biopsies from 20 CIDP patients and 17 healthy controls to identify disease-associated gene expression changes. We demonstrate changes in expression of genes involved in immune and chemokine regulation, growth and repair. We also found a combination of two upregulated genes that can be proposed as a novel biomarker of the disorder.

  5. Differential neutrophil gene expression in early bovine pregnancy

    Directory of Open Access Journals (Sweden)

    Kizaki Keiichiro


    Full Text Available Abstract Background In food production animals, especially cattle, the diagnosis of gestation is important because the timing of gestation directly affects the running of farms. Various methods have been used to detect gestation, but none of them are ideal because of problems with the timing of detection or the accuracy, simplicity, or cost of the method. A new method for detecting gestation, which involves assessing interferon-tau (IFNT-stimulated gene expression in peripheral blood leukocytes (PBL, was recently proposed. PBL fractionation methods were used to examine whether the expression profiles of various PBL populations could be used as reliable diagnostic markers of bovine gestation. Methods PBL were collected on days 0 (just before artificial insemination, 7, 14, 17, 21, and 28 of gestation. The gene expression levels of the PBL were assessed with microarray analysis and/or quantitative real-time reverse transcription (q PCR. PBL fractions were collected by flow cytometry or density gradient cell separation using Histopaque 1083 or Ficoll-Conray solutions. The expression levels of four IFNT-stimulated genes, interferon-stimulated protein 15 kDa (ISG15, myxovirus-resistance (MX 1 and 2, and 2′-5′-oligoadenylate synthetase (OAS1, were then analyzed in each fraction through day 28 of gestation using qPCR. Results Microarray analysis detected 72 and 28 genes in whole PBL that were significantly higher on days 14 and 21 of gestation, respectively, than on day 0. The upregulated genes included IFNT-stimulated genes. The expression levels of these genes increased with the progression of gestation until day 21. In flow cytometry experiments, on day 14 the expression levels of all of the genes were significantly higher in the granulocyte fraction than in the other fractions. Their expression gradually decreased through day 28 of gestation. Strong correlations were observed between the expression levels of the four genes in the granulocyte

  6. Gene expression in the urinary bladder: a common carcinoma in situ gene expression signature exists disregarding histopathological classification

    DEFF Research Database (Denmark)

    Andersen, Lars Dyrskjøt; Kruhøffer, Mogens; Andersen, Thomas Thykjær


    that contained genes with similar expression levels in transitional cell carcinoma (TCC) with surrounding CIS and invasive TCC. However, no close relationship between TCC with adjacent CIS and invasive TCC was observed using hierarchical cluster analysis. Expression profiling of a series of biopsies from normal...... urothelium and urothelium with CIS lesions from the same urinary bladder revealed that the gene expression found in sTCC with surrounding CIS is found also in CIS biopsies as well as in histologically normal samples adjacent to the CIS lesions. Furthermore, we also identified similar gene expression changes...... not only in CIS biopsies but also in sTCC, mTCC, and, remarkably, in histologically normal urothelium from bladders with CIS. Identification of this expression signature could provide guidance for the selection of therapy and follow-up regimen in patients with early stage bladder cancer....

  7. Gene Cloning of Murine α-Fetoprotein Gene and Construction of Its Eukaryotic Expression Vector and Expression in CHO Cells

    Institute of Scientific and Technical Information of China (English)

    易继林; 田耕


    To clone the murine α-fetoprotein (AFP) gene, construct the eukaryotic expression vector of AFP and express in CHO cells, total RNA were extracted from Hepa 1-6 cells, and then the murine α-fetoprotein gene was amplified by RT-PCR and cloned into the eukaryotic expression vector pcDNA3.1. The recombinant of vector was identified by restriction enzyme analysis and sequencing. A fter transient transfection of CHO cells with the vector, Western blotting was used to detect the expression of AFP. It is concluded that the 1.8kb murine α-fetoprotein gene was successfully cloned and its eukaryotic expression vector was successfully constructed.

  8. Novel gene expression tools for rice biotechnology (United States)

    Biotechnology is an effective and important method of improving both quality and agronomic traits in rice. We are developing novel molecular tools for genetic engineering, with a focus on developing novel transgene expression control elements (i.e. promoters) for rice. A suite of monocot grass promo...

  9. Selection and validation of reference genes for quantitative gene expression studies in Erythroxylum coca. (United States)

    Docimo, Teresa; Schmidt, Gregor W; Luck, Katrin; Delaney, Sven K; D'Auria, John C


    Real-time quantitative PCR is a powerful technique for the investigation of comparative gene expression, but its accuracy and reliability depend on the reference genes used as internal standards. Only genes that show a high level of expression stability are suitable for use as reference genes, and these must be identified on a case-by-case basis. Erythroxylum coca produces and accumulates high amounts of the pharmacologically active tropane alkaloid cocaine (especially in the leaves), and is an emerging model for the investigation of tropane alkaloid biosynthesis. The identification of stable internal reference genes for this species is important for its development as a model species, and would enable comparative analysis of candidate biosynthetic genes in the different tissues of the coca plant. In this study, we evaluated the expression stability of nine candidate reference genes in E. coca ( Ec6409, Ec10131, Ec11142, Actin, APT2, EF1α, TPB1, Pex4, Pp2aa3). The expression of these genes was measured in seven tissues (flowers, stems, roots and four developmental leaf stages) and the stability of expression was assessed using three algorithms (geNorm, NormFinder and BestKeeper). From our results we conclude that Ec10131 and TPB1 are the most appropriate internal reference genes in leaves (where the majority of cocaine is produced), while Ec10131 and Ec6409 are the most suitable internal reference genes across all of the tissues tested.

  10. Difference of Gene Expression Profiles between Barrett's Esophagus and Cardia Intestinal Metaplasia by Gene Chip

    Institute of Scientific and Technical Information of China (English)

    CHANG Ying; LIU Bin


    The difference of gene expression profile changes in Barrettes esophagus (BE) and cardia intestinal metaplasia (CIM) epithelium was studied and the novel associated genes were screened in the early stage by cDNA microarray. The cDNA retro-transcribed from equal quantity mRNA from BE and CIM epithelial tissues were labeled with Cy3 and Cy5 fluorescence as probes. The mixed probe was hybridized with three pieces BiostarH-40s double dot human whole gene chip. The chips were scanned with a ScanArray 4000. The acquired images were analyzed using GenePix Pro 3.0 software. It was found a total of 141 genes were screened out that exhibited differentially expression more than 2 times in all three chips. It was identified that in gene expression profiles of BE, 74 genes were up-regulated and 67 down-regulated as compared with CIM. The comparison between the difference of gene expression profile changes in BE and CIM epithelia revealed that there existed the difference between BE and CIM at gene level. 141 genes with the expression more than two time were probably related to the occurrence and development of BE and the promotion or progress in adenocarcinoma.

  11. Genome-wide analysis of homeobox gene family in legumes: identification, gene duplication and expression profiling. (United States)

    Bhattacharjee, Annapurna; Ghangal, Rajesh; Garg, Rohini; Jain, Mukesh


    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development.

  12. Normalization strategy of microarray gene expression data

    Institute of Scientific and Technical Information of China (English)


    Objective: To discuss strategies and methods of normalization on how to deal with and analyze data for different chips with the combination of statistics, mathematics and bioinformatics in order to find significant difference genes. Methods: With Excel and SPSS software, high or low density chips were analyzed through total intensity normalization (TIN) and locally weighted linear regression normalization (LWLRN). Results: These methods effectively reduced systemic errors and made data more comparable and reliable. Conclusion: These methods can search the genes of significant difference, although normalization methods are being developed and need to be improved further. Great breakthrough will be obtained in microarray data normalization analysis and transformation with the development of non-linear technology, software and hardware of computer.

  13. Expressing PHB synthetic genes through chloroplast genetic engineering

    Institute of Scientific and Technical Information of China (English)


    Chloroplast integration and expression vector containing expression cassettes for phbB, phbA, phbC and aadA genes was constructed and bombarded into the tobacco chloroplast genome. Transplastomic plants were analyzed with PCR and Southern blot. Their homoplastomy was also judged. Northern dot and RT-PCR analysis were employed to investigate transgene expression at transcriptional level. The results indicate that the chloroplast transformation system is compatible for poly-3-hydroxybutyrate (PHB) production.

  14. Transgenic banana plants expressing Xanthomonas wilt resistance genes revealed a stable non-target bacterial colonization structure. (United States)

    Nimusiima, Jean; Köberl, Martina; Tumuhairwe, John Baptist; Kubiriba, Jerome; Staver, Charles; Berg, Gabriele


    Africa is among the continents where the battle over genetically modified crops is currently being played out. The impact of GM in Africa could potentially be very positive. In Uganda, researchers have developed transgenic banana lines resistant to banana Xanthomonas wilt. The transgenic lines expressing hrap and pflp can provide a timely solution to the pandemic. However, the impact of the transgenes expression on non-target microorganisms has not yet been investigated. To study this effect, transgenic and control lines were grown under field conditions and their associated microbiome was investigated by 16S rRNA gene profiling combining amplicon sequencing and molecular fingerprinting. Three years after sucker planting, no statistically significant differences between transgenic lines and their non-modified predecessors were detected for their associated bacterial communities. The overall gammaproteobacterial rhizosphere microbiome was highly dominated by Xanthomonadales, while Pseudomonadales and Enterobacteriales were accumulated in the pseudostem. Shannon indices revealed much higher diversity in the rhizosphere than in the pseudostem endosphere. However, the expression of the transgenes did not result in changes in the diversity of Gammaproteobacteria, the closest relatives of the target pathogen. In this field experiment, the expression of the resistance genes appears to have no consequences for non-target rhizobacteria and endophytes.

  15. Modular Analysis of Peripheral Blood Gene Expression in Rheumatoid Arthritis Captures Reproducible Gene Expression Changes in TNF Responders (United States)

    Oswald, Michaela; Curran, Mark; Lamberth, Sarah; Townsend, Robert; Hamilton, Jennifer D.; Chernoff, David N.; Carulli, John; Townsend, Michael; Weinblatt, Michael; Kern, Marlena; Pond, Cassandra; Lee, Annette; Gregersen, Peter K.


    Objective To establish whether the analysis of whole blood gene expression can be useful in predicting or monitoring response to anti-TNF therapy in RA. Methods Whole blood RNA (PAXgene) was obtained at baseline and 14 weeks on three independent cohorts with a combined total of 250 patients with rheumatoid arthritis beginning anti-TNF therapy. We employed an approach to gene expression analysis that is based on gene expression “modules”. Results Good and Moderate Responders by EULAR criteria exhibited highly significant and consistent changes in multiple gene expression modules using a hyper geometric analysis after 14 weeks of therapy. Strikingly, non responders exhibited very little change in any modules, despite exposure to TNF blockade. These patterns of change were highly consistent across all three cohorts, indicating that immunological changes after TNF treatment are specific to the combination of both drug exposure and responder status. In contrast, modular patterns of gene expression did not exhibit consistent differences between responders and non-responders at baseline in the three cohorts. Conclusions These data provide evidence that using gene expression modules related to inflammatory disease may provide a valuable method for objective monitoring of the response of RA patients who are treated with TNF inhibitors. PMID:25371395

  16. Redox regulation, gene expression and longevity. (United States)

    Honda, Yoko; Tanaka, Masashi; Honda, Shuji


    Lifespan can be lengthened by genetic and environmental modifications. Study of these might provide valuable insights into the mechanism of aging. Low doses of radiation and short-term exposure to heat and high concentrations of oxygen prolong the lifespan of the nematode Caenorhabditis elegans. These might be caused by adaptive responses to harmful environmental conditions. Single-gene mutations have been found to extend lifespan in C. elegans, Drosophila and mice. So far, the best-characterized system is the C. elegans mutant in the daf-2, insulin/IGF-I receptor gene that is the component of the insulin/IGF-I signaling pathway. The mutant animals live twice as long as the wild type. The insulin/IGF-I signaling pathway regulates the activity of DAF-16, a FOXO transcription factor. However, the unified explanation for the function of DAF-16 transcription targets in the lifespan extension is not yet fully established. As both of the Mn superoxide dismutase (MnSOD) isoforms (sod-2 and sod-3) are found to be targets of DAF-16, we attempted to assess their functions in regulating lifespan and oxidative stress responsivity. We show that the double deletions of sod-2 and sod-3 genes induced oxidative-stress sensitivity but do not shorten lifespan in the daf-2 mutant background, indicating that oxidative stress is not necessarily a limiting factor for longevity. Furthermore, the deletion in the sod-3 gene lengthens lifespan in the daf-2 mutant. We conclude that the MnSOD systems in C. elegans fine-tune the insulin/IGF-I-signaling based regulation of longevity by acting not as anti-oxidants but as physiological-redox-signaling modulators.

  17. Assessment of Suitable Reference Genes for Quantitative Gene Expression Studies in Melon Fruits. (United States)

    Kong, Qiusheng; Gao, Lingyun; Cao, Lei; Liu, Yue; Saba, Hameed; Huang, Yuan; Bie, Zhilong


    Melon (Cucumis melo L.) is an attractive model plant for investigating fruit development because of its morphological, physiological, and biochemical diversity. Quantification of gene expression by quantitative reverse transcription polymerase chain reaction (qRT-PCR) with stably expressed reference genes for normalization can effectively elucidate the biological functions of genes that regulate fruit development. However, the reference genes for data normalization in melon fruits have not yet been systematically validated. This study aims to assess the suitability of 20 genes for their potential use as reference genes in melon fruits. Expression variations of these genes were measured in 24 samples that represented different developmental stages of fertilized and parthenocarpic melon fruits by qRT-PCR analysis. GeNorm identified ribosomal protein L (CmRPL) and cytosolic ribosomal protein S15 (CmRPS15) as the best pair of reference genes, and as many as five genes including CmRPL, CmRPS15, TIP41-like family protein (CmTIP41), cyclophilin ROC7 (CmCYP7), and ADP ribosylation factor 1 (CmADP) were required for more reliable normalization. NormFinder ranked CmRPS15 as the best single reference gene, and RAN GTPase gene family (CmRAN) and TATA-box binding protein (CmTBP2) as the best combination of reference genes in melon fruits. Their effectiveness was further validated by parallel analyses on the activities of soluble acid invertase and sucrose phosphate synthase, and expression profiles of their respective encoding genes CmAIN2 and CmSPS1, as well as sucrose contents during melon fruit ripening. The validated reference genes will help to improve the accuracy of gene expression studies in melon fruits.

  18. Assessment of Suitable Reference Genes for Quantitative Gene Expression Studies in Melon Fruits (United States)

    Kong, Qiusheng; Gao, Lingyun; Cao, Lei; Liu, Yue; Saba, Hameed; Huang, Yuan; Bie, Zhilong


    Melon (Cucumis melo L.) is an attractive model plant for investigating fruit development because of its morphological, physiological, and biochemical diversity. Quantification of gene expression by quantitative reverse transcription polymerase chain reaction (qRT-PCR) with stably expressed reference genes for normalization can effectively elucidate the biological functions of genes that regulate fruit development. However, the reference genes for data normalization in melon fruits have not yet been systematically validated. This study aims to assess the suitability of 20 genes for their potential use as reference genes in melon fruits. Expression variations of these genes were measured in 24 samples that represented different developmental stages of fertilized and parthenocarpic melon fruits by qRT-PCR analysis. GeNorm identified ribosomal protein L (CmRPL) and cytosolic ribosomal protein S15 (CmRPS15) as the best pair of reference genes, and as many as five genes including CmRPL, CmRPS15, TIP41-like family protein (CmTIP41), cyclophilin ROC7 (CmCYP7), and ADP ribosylation factor 1 (CmADP) were required for more reliable normalization. NormFinder ranked CmRPS15 as the best single reference gene, and RAN GTPase gene family (CmRAN) and TATA-box binding protein (CmTBP2) as the best combination of reference genes in melon fruits. Their effectiveness was further validated by parallel analyses on the activities of soluble acid invertase and sucrose phosphate synthase, and expression profiles of their respective encoding genes CmAIN2 and CmSPS1, as well as sucrose contents during melon fruit ripening. The validated reference genes will help to improve the accuracy of gene expression studies in melon fruits. PMID:27536316

  19. Intrinsic and extrinsic contributions to stochasticity in gene expression (United States)

    Swain, Peter S.; Elowitz, Michael B.; Siggia, Eric D.


    Gene expression is a stochastic, or "noisy," process. This noise comes about in two ways. The inherent stochasticity of biochemical processes such as transcription and translation generates "intrinsic" noise. In addition, fluctuations in the amounts or states of other cellular components lead indirectly to variation in the expression of a particular gene and thus represent "extrinsic" noise. Here, we show how the total variation in the level of expression of a given gene can be decomposed into its intrinsic and extrinsic components. We demonstrate theoretically that simultaneous measurement of two identical genes per cell enables discrimination of these two types of noise. Analytic expressions for intrinsic noise are given for a model that involves all the major steps in transcription and translation. These expressions give the sensitivity to various parameters, quantify the deviation from Poisson statistics, and provide a way of fitting experiment. Transcription dominates the intrinsic noise when the average number of proteins made per mRNA transcript is greater than 2. Below this number, translational effects also become important. Gene replication and cell division, included in the model, cause protein numbers to tend to a limit cycle. We calculate a general form for the extrinsic noise and illustrate it with the particular case of a single fluctuating extrinsic variablea repressor protein, which acts on the gene of interest. All results are confirmed by stochastic simulation u